Experimental Models of Parkinson’s Disease (Methods in Molecular Biology, 2322) [1st ed. 2021] 1071614940, 9781071614945

Table of contents :
Preface
Contents
Contributors
Part I: Biochemical Experiments and Cellular Models of Parkinson´s Disease
Chapter 1: α-Synuclein Seeding Assay Using RT-QuIC
1 Introduction
2 Materials (See Note 1)
3 Methods
3.1 α-Synuclein Purification from Bacteria
3.2 Measurement of the Aggregation Using αSyn RT-QuIC Assay
3.3 Preparation of αSyn Substrate for RT-QuIC
3.4 Preparation of αSyn Reactions
3.5 RT-QuIC Data Analysis: Parameters of Kinetic Change (Fig. 1, See Note 9)
3.6 RT-QuIC Data Analysis for Sensitivity and Specificity (See Note 11)
4 Notes
References
Chapter 2: Electron Microscopic Analysis of α-Synuclein Fibrils
1 Introduction
2 Materials
2.1 Negative Staining
2.2 Immunolabeling
3 Methods
3.1 Negative Staining of α-Syn Fibrils
3.2 Immuno-EM of α-Syn Fibrils
4 Notes
References
Chapter 3: α-Synuclein Seeding Assay Using Cultured Cells
1 Introduction
2 Materials
2.1 α-Synuclein Purification from Bacteria
2.2 α-Synuclein Seed Preparation
2.3 Cell Culture and Transfection
2.4 Biochemical Fractionation of α-Synuclein
2.5 Western Blot Analysis
3 Methods
3.1 α-Synuclein Purification from Bacteria
3.2 α-Synuclein Seed Preparation
3.3 Introduction of α-Synuclein Seeds into Cultured Cells
3.4 Sequential Extraction of α-Synuclein from Cultured Cells
3.5 Western Blot to Monitor α-Synuclein Inclusion Formation
4 Notes
References
Chapter 4: Analysis of α-Synuclein in Exosomes
1 Introduction
2 Materials
2.1 Cell Culture
2.2 Serum Preparation
2.3 Exosome Isolation
2.4 α-Synuclein ELISA
3 Methods
3.1 Preparation of Cell Culture Media
3.2 Preparation of Serum
3.3 Exosome Isolation
3.4 α-Synuclein ELISA
4 Notes
References
Chapter 5: Measurement of GCase Activity in Cultured Cells
1 Introduction
2 Materials
2.1 Cell Culture
2.2 Sample Preparation and GCase Assay
3 Methods
3.1 Cell Culture
3.2 Sample Preparation and GCase Assay
4 Notes
References
Chapter 6: Detection of Substrate Phosphorylation of LRRK2 in Tissues and Cultured Cells
1 Introduction
2 Materials
2.1 Tissue Preparation and Cell Lysis
2.2 SDS-PAGE Electrophoresis
2.3 Immunoblotting
3 Methods
3.1 Sample Preparation: Cultured Cells
3.2 Sample Preparation: Rodent Tissues
3.3 Sample Preparation for SDS-PAGE
3.4 Casting Gels
3.5 Running Gels and Electrotransfer to Membranes
3.6 Immunoblotting
4 Notes
References
Chapter 7: Two Methods to Analyze LRRK2 Functions Under Lysosomal Stress: The Measurements of Cathepsin Release and Lysosomal ...
1 Introduction
2 Materials
2.1 Cell Culture and Drug Treatment
2.2 SDS-PAGE and Immunoblotting
2.3 Immunocytochemistry
2.4 Antibodies
3 Methods
3.1 Cell Culture and CQ Treatment
3.2 SDS-PAGE and Immunoblot Analysis of Cathepsin Secretion
3.3 Immunocytochemical Analysis of Lysosomal Enlargement and LRRK2 Recruitment
4 Notes
References
Chapter 8: Differentiation of Midbrain Dopaminergic Neurons from Human iPS Cells
1 Introduction
2 Materials
2.1 Induction of Midbrain Dopaminergic Precursors
2.2 Induction of Midbrain Dopaminergic Neurons
3 Methods
3.1 Differentiation of Ventral Midbrain-Specific Neurospheres from Human iPS Cells
3.2 Differentiation into Midbrain Dopaminergic Neurons from Neurospheres
4 Notes
References
Chapter 9: Monitoring PINK1-Parkin Signaling Using Dopaminergic Neurons from iPS Cells
1 Introduction
2 Materials
2.1 Preparation of GFP-Parkin Lentivirus
2.2 Lentiviral Infection of GFP-Parkin in Dopaminergic Neuron Culture
2.3 PINK1-Parkin Activation by Mitochondrial Uncouplers
2.4 Immunostaining and Imaging of Dopaminergic Neuron Culture
2.5 Detection of PINK1, Parkin, and Phosphorylated Ubiquitin by Western Blot
3 Methods
3.1 Preparation of GFP-Parkin Lentivirus
3.2 Lentiviral Infection of GFP-Parkin in Dopaminergic Neuron Culture
3.3 PINK1-Parkin Activation by Mitochondrial Uncouplers
3.4 Immunostaining and Imaging of Dopaminergic Neuron Culture
3.5 Detection of PINK1, Parkin, and Phosphorylated Ubiquitin by Western Blot
4 Notes
References
Part II: Mammalian Models of Parkinson´s Disease
Chapter 10: Generation of Mitochondrial Toxin Rodent Models of Parkinson´s Disease Using 6-OHDA, MPTP, and Rotenone
1 Introduction
2 Materials
2.1 6-OHDA Injection
2.2 Immunohistochemistry for Tyrosine Hydroxylase (TH)
2.3 MPTP Administration
2.4 Rotenone
3 Methods
3.1 6-OHDA Injection
3.2 Immunohistochemistry for TH
3.3 MPTP Administration
3.4 Monitoring of Mice After MPTP Administration
3.5 Histochemical Evaluation of Degenerated Dopaminergic Neurons by MPTP
3.6 Rotenone
3.7 Histochemical Evaluation of Degenerated Dopaminergic Neurons by Rotenone
4 Notes
References
Chapter 11: Midbrain Slice Culture as an Ex Vivo Analysis Platform for Parkinson´s Disease
1 Introduction
2 Materials
2.1 Apparatus for Slice Culture
2.2 Reagents for Slice Culture
2.3 Reagents for Immunostaining
3 Methods
3.1 Midbrain Slice Culture
3.2 Immunohistochemical Staining
4 Notes
References
Chapter 12: α-Synuclein Propagation Mouse Models of Parkinson´s Disease
1 Introduction
2 Materials
2.1 Generation and Purification of Recombinant α-Syn Monomer
2.2 Generation and Preparation of α-Syn Preformed Fibrils
2.3 Stereotaxic Injections
2.4 Inoculation of α-Syn PFFs into the Mouse Gastric Wall
3 Methods
3.1 Generation and Purification of Recombinant α-Syn Monomer
3.2 Generation and Preparation of α-Syn Preformed Fibrils
3.3 Stereotaxic Injections of α-Syn PFFs into the Mouse Striatum and Olfactory Bulb
3.4 Injections of α-Syn PFFs into the Mouse Gastric Wall
4 Notes
References
Chapter 13: Common Marmoset Model of α-Synuclein Propagation
1 Introduction
2 Materials
2.1 Equipment and Surgical Instruments
2.2 Drugs
2.3 Intracerebral Injection
2.4 Tissue Collection
3 Methods
3.1 Animal Husbandry
3.2 Preparation of the Injection
3.3 Surgical Procedures
3.4 Tissue Collection and Immunohistochemistry
4 Notes
References
Chapter 14: Application of a Tissue Clearing Method for the Analysis of Dopaminergic Axonal Projections
1 Introduction
2 Materials
2.1 Fixation
2.2 Brain Slice Preparation
2.3 ChemScale
2.4 AbScale
2.5 Brain Slice Mounting and CLSM Imaging
3 Methods
3.1 Fixation
3.2 Brain Slice Preparation
3.3 ChemScale Labeling
3.4 AbScale Labeling
3.5 Brain Slice Mounting and CLSM Imaging
4 Notes
References
Chapter 15: Deep Brain Stimulation Using Animal Models of Parkinson´s Disease
1 Introduction
2 Materials
2.1 Experimental Animal
2.2 Surgery
2.3 Mapping the Striatum, STN, and Globus Pallidus Interna (GPi)
2.4 Preparation of Quadripolar Stimulation Electrodes
2.5 Recording Experiment
2.6 Preparation of Recording-Injection System
2.7 High-Frequency Stimulation (HFS) of the STN or GPi
2.8 Recording-Injection Experiments
3 Methods
3.1 Experimental Animals
3.2 Surgery
3.3 Mapping the Striatum, STN, and GPi
3.4 Recording Preparation
3.5 HFS of the STN or GPi
3.6 Extracellular Neuronal Recording of the Striatum
3.7 Recording-Injection Experiments
3.8 Data Analysis
4 Notes
References
Part III: Invertebrate Models of Parkinson´s Disease
Chapter 16: Assessment of Cytotoxicity of α-Synuclein in Budding Yeast Using a Spot Growth Assay and Fluorescent Microscopy
1 Introduction
2 Materials
2.1 Budding Yeast Strains and Plasmids
2.2 Cell Culture and Yeast Growth Media (Table 1, See Note 3)
2.3 Transformation
2.4 Spot Growth Assay
2.5 Microscopy
2.6 Digital Image Analysis
3 Methods
3.1 Transformation of Yeast with Plasmids for the Expression of α-Synuclein
3.2 Spot Growth Assay to Assess the Toxicity of α-Synuclein
3.3 Imaging of α-Synuclein-GFP in Yeast Cells
4 Notes
References
Chapter 17: The Functional Assessment of LRRK2 in Caenorhabditis elegans Mechanosensory Neurons
1 Introduction
2 Materials
2.1 C. elegans Strains
2.2 Worm Culturing
2.3 Equipment
2.4 Reagents and Other Materials
3 Methods
3.1 Generation of C. elegans Strains Carrying both lrk-1 Gene Mutation and Pmec-7::gfp Transgene
3.2 Assessment of Axon Overextension of ALM Mechanosensory Neurons
4 Notes
References
Chapter 18: Analysis of Dopaminergic Functions in Drosophila
1 Introduction
2 Materials
2.1 Visualization of Mitochondria in DA Neurons
2.2 Imaging of Synaptic Release of DA Neurons
3 Methods
3.1 Visualization of Mitochondria in DA Neurons
3.2 Imaging of Synaptic Release of DA Neurons
4 Notes
References
Chapter 19: Evaluation of Mitochondrial Function and Morphology in Drosophila
1 Introduction
2 Materials
2.1 Fly Wing Posture and Activity Assays
2.2 ATP Level Measurement of Fly Thoracic Muscle Tissue
2.3 Fly Mitochondria Purification
2.4 ROS Assay for Purified Mitochondrial Sample
2.5 MitoSox, TMRM, Rhod2, JC-1, and MitoPOP Staining in Fly Muscle
2.6 Blue Native Gel (BNG) Analysis of Respiratory Complex Assembly
2.7 Immunostaining of Mitochondria in Fly Neuromuscular Tissues
3 Methods
3.1 Wing Posture Analysis
3.2 Jump/Flight Activity Analyses
3.3 ATP Level Measurement of Fly Thoracic Muscle Tissue
3.4 Fly Mitochondria Purification
3.5 ROS Assay for Purified Mitochondrial Sample
3.6 MitoSox, TMRM, Rhod2, JC-1, and MitoPOP Staining in Fly Muscle
3.7 Blue Native Gel (BNG) Analysis of Respiratory Complex Assembly
3.8 Immunostaining of Mitochondria in Fly Muscular Tissues (Fig. 1)
3.9 Immunostaining of Mitochondria in Dopaminergic Neurons (Fig. 2)
4 Notes
References
Chapter 20: Cytosolic and Mitochondrial Ca2+ Imaging in Drosophila Dopaminergic Neurons
1 Introduction
2 Materials
2.1 Setting Up Imaging Tools
3 Methods
3.1 Ca2+ Imaging
4 Notes
References
Index

Citation preview

Methods in Molecular Biology 2322

Yuzuru Imai Editor

Experimental Models of Parkinson’s Disease

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Experimental Models of Parkinson’s Disease Edited by

Yuzuru Imai Department of Research for Parkinson’s Disease, Juntendo University Graduate School of Medicine, Tokyo, Japan

Editor Yuzuru Imai Department of Research for Parkinson’s Disease Juntendo University Graduate School of Medicine Tokyo, Japan

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-1494-5 ISBN 978-1-0716-1495-2 (eBook) https://doi.org/10.1007/978-1-0716-1495-2 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021 This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Cover Illustration Caption: Dopaminergic neuron culture differentiated from iPS cells using the Chapter 8 protocol. Image was taken by Dr. Risa Nonaka. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface Parkinson’s disease (PD) is the second most common neurodegenerative disorder, characterized by age-dependent motor dysfunction and degeneration of midbrain dopaminergic neurons. Deposition of neuronal inclusions called Lewy bodies (LBs) in the affected regions is a pathological feature of PD and related disorders, such as dementia with LB. LB formation is thought to begin with α-synuclein aggregation and fibrillation. Experimental studies based on the knowledge obtained from epidemiological and genetic studies continue in the hopes of making PD risk predictable and surmountable. Discovery of the mitochondrial toxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) contributed to the development of experimental models of PD in the early stage of studies and focused the spotlight on the roles of mitochondria in dopaminergic neurons. MPTP is converted to 1-methyl-4-phenylpyridinium (MPP+) by glial monoamine oxidase B and is transported to dopaminergic neurons, likely through the dopamine transporter, and inhibits mitochondrial respiratory complex I subunits. Another neurotoxin, 6-hydroxydopamine, is a dopamine analog that produces selective damage to dopaminergic neurons by generating reactive oxygen species. MPTP and 6-hydroxydopamine have been widely used to create animal and cellular models of PD. Advances in human genetics and genome-wide association studies have revealed some of the genes involved in the etiology of PD, including α-synuclein, LRRK2, VPS35, ATP13A2, PINK1, Parkin, and CHCHD2. The prion-like propagation of α-synuclein in neural circuits is a very hot topic in this research field, while the dysregulation of mitochondrial function is another important risk factor for PD development, which is characterized by studies on PINK1, Parkin, and CHCHD2. Identification of several PD genes, including LRRK2, VPS35, and ATP13A2, suggests dysregulation of the endolysosome pathway and exosomes is an emerging topic. As invertebrate models, Drosophila, C. elegans, and budding yeast Saccharomyces cerevisiae provide sophisticated genetics and have yielded a great deal of information on protective and risk genes and factors, including lipids and chemicals. This volume of Methods in Molecular Biology focuses on cutting-edge methods to analyze the prion-like properties of α-synuclein, mitochondrial functions related to the PINK1-Parkin pathway/CHCHD2, the endolysosome pathway related to LRRK2, VPS35, and ATP13A2 using cultured cells (including patient iPS cells), deep brain stimulation therapy, classic mitochondrial toxins related to PD, and genetic associations and screenings using mammalian and invertebrate genetic models of PD. This volume intends to be an introductory protocol book for basic research on PD pathogenesis. Tokyo, Japan

Yuzuru Imai

v

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

PART I

BIOCHEMICAL EXPERIMENTS AND CELLULAR MODELS OF PARKINSON’S DISEASE

1 α-Synuclein Seeding Assay Using RT-QuIC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ayami Okuzumi, Taku Hatano, Takeshi Fukuhara, Shinichi Ueno, Nobuyuki Nukina, Yuzuru Imai, and Nobutaka Hattori 2 Electron Microscopic Analysis of α-Synuclein Fibrils. . . . . . . . . . . . . . . . . . . . . . . . . Airi Tarutani and Masato Hasegawa 3 α-Synuclein Seeding Assay Using Cultured Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . Jun Ogata, Daisaku Takemoto, Shotaro Shimonaka, Yuzuru Imai, and Nobutaka Hattori 4 Analysis of α-Synuclein in Exosomes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Taiji Tsunemi, Yuta Ishiguro, Asako Yoroisaka, and Nobutaka Hattori 5 Measurement of GCase Activity in Cultured Cells. . . . . . . . . . . . . . . . . . . . . . . . . . . Yuri Shojima, Jun Ogata, Taiji Tsunemi, Yuzuru Imai, and Nobutaka Hattori 6 Detection of Substrate Phosphorylation of LRRK2 in Tissues and Cultured Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kyohei Ito, Lejia Xu, Genta Ito, and Taisuke Tomita 7 Two Methods to Analyze LRRK2 Functions Under Lysosomal Stress: The Measurements of Cathepsin Release and Lysosomal Enlargement. . . . . . . . . Maria Sakurai and Tomoki Kuwahara 8 Differentiation of Midbrain Dopaminergic Neurons from Human iPS Cells. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kei-Ichi Ishikawa, Risa Nonaka, and Wado Akamatsu 9 Monitoring PINK1-Parkin Signaling Using Dopaminergic Neurons from iPS Cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kahori Shiba-Fukushima and Yuzuru Imai

PART II 10

11

v ix

3

17 27

41

47

53

63

73

81

MAMMALIAN MODELS OF PARKINSON’S DISEASE

Generation of Mitochondrial Toxin Rodent Models of Parkinson’s Disease Using 6-OHDA, MPTP, and Rotenone . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 95 Hiroharu Maegawa and Hitoshi Niwa Midbrain Slice Culture as an Ex Vivo Analysis Platform for Parkinson’s Disease . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 111 Yuji Kamikubo, Keiko Wakisaka, Yuzuru Imai, and Takashi Sakurai

vii

viii

12

13

14

15

Contents

α-Synuclein Propagation Mouse Models of Parkinson’s Disease . . . . . . . . . . . . . . Norihito Uemura, Jun Ueda, Shinya Okuda, Masanori Sawamura, and Ryosuke Takahashi Common Marmoset Model of α-Synuclein Propagation . . . . . . . . . . . . . . . . . . . . . Masami Masuda-Suzukake, Aki Shimozawa, Masashi Hashimoto, and Masato Hasegawa Application of a Tissue Clearing Method for the Analysis of Dopaminergic Axonal Projections . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Kenta Yamauchi, Megumu Takahashi, and Hiroyuki Hioki Deep Brain Stimulation Using Animal Models of Parkinson’s Disease . . . . . . . . . Asuka Nakajima and Yasushi Shimo

PART III 16

17

18 19 20

119

131

141 151

INVERTEBRATE MODELS OF PARKINSON’S DISEASE

Assessment of Cytotoxicity of α-Synuclein in Budding Yeast Using a Spot Growth Assay and Fluorescent Microscopy . . . . . . . . . . . . . . . . . . . . Masak Takaine The Functional Assessment of LRRK2 in Caenorhabditis elegans Mechanosensory Neurons . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tomoki Kuwahara Analysis of Dopaminergic Functions in Drosophila. . . . . . . . . . . . . . . . . . . . . . . . . . Tsuyoshi Inoshita, Daisaku Takemoto, and Yuzuru Imai Evaluation of Mitochondrial Function and Morphology in Drosophila . . . . . . . . Yinglu Tang, Foozhan Tahmasebinia, and Zhihao Wu Cytosolic and Mitochondrial Ca2+ Imaging in Drosophila Dopaminergic Neurons. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Tsuyoshi Inoshita and Yuzuru Imai

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

163

175 185 195

207 215

Contributors WADO AKAMATSU • Center for Genomic and Regenerative Medicine, Juntendo University School of Medicine, Tokyo, Japan TAKESHI FUKUHARA • Department of Neurology, Juntendo University School of Medicine, Tokyo, Japan; Department of Research for Parkinson’s Disease, Juntendo University Graduate School of Medicine, Tokyo, Japan MASATO HASEGAWA • Department of Brain and Neurosciences, Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan; Dementia Research Project, Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan MASASHI HASHIMOTO • Dementia Research Project, Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan TAKU HATANO • Department of Neurology, Juntendo University School of Medicine, Tokyo, Japan NOBUTAKA HATTORI • Department of Neurology, Juntendo University School of Medicine, Tokyo, Japan; Department of Research for Parkinson’s Disease, Juntendo University Graduate School of Medicine, Tokyo, Japan; Department of Diagnosis, Prevention and Treatment of Dementia, Juntendo University Graduate of Medicine, Tokyo, Japan HIROYUKI HIOKI • Department of Cell Biology and Neuroscience, Juntendo University Graduate School of Medicine, Tokyo, Japan YUZURU IMAI • Department of Neurology, Juntendo University School of Medicine, Tokyo, Japan; Department of Research for Parkinson’s Disease, Juntendo University Graduate School of Medicine, Tokyo, Japan TSUYOSHI INOSHITA • Department of Neurodegenerative and Demented Disorders, Juntendo University Graduate School of Medicine, Tokyo, Japan YUTA ISHIGURO • Department of Neurology, Juntendo University School of Medicine, Tokyo, Japan KEI-ICHI ISHIKAWA • Department of Neurology, Juntendo University School of Medicine, Tokyo, Japan; Center for Genomic and Regenerative Medicine, Juntendo University School of Medicine, Tokyo, Japan GENTA ITO • Social Cooperation Program of Brain and Neurological Disorders, Graduate School of Pharmaceutical Sciences, The University of Tokyo, Tokyo, Japan KYOHEI ITO • Laboratory of Neuropathology and Neuroscience, Graduate School of Pharmaceutical Sciences, The University of Tokyo, Tokyo, Japan YUJI KAMIKUBO • Department of Pharmacology, Juntendo University School of Medicine, Tokyo, Japan TOMOKI KUWAHARA • Department of Neuropathology, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan HIROHARU MAEGAWA • Department of Dental Anesthesia, Osaka University Graduate School of Dentistry, Osaka, Japan MASAMI MASUDA-SUZUKAKE • Dementia Research Project, Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan ASUKA NAKAJIMA • Department of Neurology, Juntendo University Nerima Hospital, Tokyo, Japan

ix

x

Contributors

HITOSHI NIWA • Department of Dental Anesthesia, Osaka University Graduate School of Dentistry, Osaka, Japan RISA NONAKA • Department of Neurology, Juntendo University School of Medicine, Tokyo, Japan; Center for Genomic and Regenerative Medicine, Juntendo University School of Medicine, Tokyo, Japan NOBUYUKI NUKINA • Laboratory of Structural Neuropathology, Graduate School of Brain Science, Doshisha University, Kyoto, Japan JUN OGATA • Department of Research for Parkinson’s Disease, Juntendo University Graduate School of Medicine, Tokyo, Japan; Juntendo Advanced Research Institute for Health Science, Juntendo University Graduate School of Medicine, Tokyo, Japan SHINYA OKUDA • Department of Neurology, Kyoto University Graduate School of Medicine, Kyoto, Japan AYAMI OKUZUMI • Department of Neurology, Juntendo University School of Medicine, Tokyo, Japan; Laboratory of Structural Neuropathology, Graduate School of Brain Science, Doshisha University, Kyoto, Japan MARIA SAKURAI • Department of Neuropathology, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan TAKASHI SAKURAI • Department of Pharmacology, Juntendo University School of Medicine, Tokyo, Japan MASANORI SAWAMURA • Department of Neurology, Kyoto University Graduate School of Medicine, Kyoto, Japan KAHORI SHIBA-FUKUSHIMA • Department of Neurodegenerative and Demented Disorders, Juntendo University Graduate School of Medicine, Tokyo, Japan YASUSHI SHIMO • Department of Neurology, Juntendo University Nerima Hospital, Tokyo, Japan; Department of Research and Therapeutics for Movement Disorders, School of Medicine, Juntendo University, Tokyo, Japan SHOTARO SHIMONAKA • Department of Diagnosis, Prevention and Treatment of Dementia, Juntendo University Graduate of Medicine, Tokyo, Japan AKI SHIMOZAWA • Dementia Research Project, Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan YURI SHOJIMA • Department of Neurology, Juntendo University School of Medicine, Tokyo, Japan FOOZHAN TAHMASEBINIA • Department of Biological Sciences, Dedman College of Humanities and Sciences, Southern Methodist University, Dallas, TX, USA MEGUMU TAKAHASHI • Department of Cell Biology and Neuroscience, Juntendo University Graduate School of Medicine, Tokyo, Japan; Department of Neuroscience, Graduate School of Medicine, Kyoto University, Kyoto, Japan RYOSUKE TAKAHASHI • Department of Neurology, Kyoto University Graduate School of Medicine, Kyoto, Japan MASAK TAKAINE • Gunma University Initiative for Advanced Research (GIAR), Gunma University, Maebashi, Gunma, Japan; Institute for Molecular and Cellular Regulation (IMCR), Gunma University, Maebashi, Gunma, Japan DAISAKU TAKEMOTO • Department of Research for Parkinson’s Disease, Juntendo University Graduate School of Medicine, Tokyo, Japan YINGLU TANG • Department of Biological Sciences, Dedman College of Humanities and Sciences, Southern Methodist University, Dallas, TX, USA

Contributors

xi

AIRI TARUTANI • Department of Brain and Neurosciences, Tokyo Metropolitan Institute of Medical Science, Tokyo, Japan; Laboratory of Neuropathology and Neuroscience, Graduate School of Pharmaceutical Sciences, The University of Tokyo, Tokyo, Japan TAISUKE TOMITA • Laboratory of Neuropathology and Neuroscience, Graduate School of Pharmaceutical Sciences, The University of Tokyo, Tokyo, Japan; Social Cooperation Program of Brain and Neurological Disorders, Graduate School of Pharmaceutical Sciences, The University of Tokyo, Tokyo, Japan TAIJI TSUNEMI • Department of Neurology, Juntendo University School of Medicine, Tokyo, Japan JUN UEDA • Department of Neurology, Kyoto University Graduate School of Medicine, Kyoto, Japan NORIHITO UEMURA • Department of Neurology, Kyoto University Graduate School of Medicine, Kyoto, Japan SHINICHI UENO • Department of Neurology, Juntendo University School of Medicine, Tokyo, Japan; Department of Neurology, Fukushima Medical University, Fukushima, Japan KEIKO WAKISAKA • Department of Research for Parkinson’s Disease, Juntendo University Graduate School of Medicine, Tokyo, Japan; Department of Neurology, Juntendo University School of Medicine, Tokyo, Japan ZHIHAO WU • Department of Biological Sciences, Dedman College of Humanities and Sciences, Southern Methodist University, Dallas, TX, USA LEJIA XU • Laboratory of Neuropathology and Neuroscience, Graduate School of Pharmaceutical Sciences, The University of Tokyo, Tokyo, Japan KENTA YAMAUCHI • Department of Cell Biology and Neuroscience, Juntendo University Graduate School of Medicine, Tokyo, Japan; Advanced Research Institute for Health Sciences, Juntendo University, Tokyo, Japan ASAKO YOROISAKA • Department of Neurology, Juntendo University School of Medicine, Tokyo, Japan

Part I Biochemical Experiments and Cellular Models of Parkinson’s Disease

Chapter 1 α-Synuclein Seeding Assay Using RT-QuIC Ayami Okuzumi, Taku Hatano, Takeshi Fukuhara, Shinichi Ueno, Nobuyuki Nukina, Yuzuru Imai, and Nobutaka Hattori Abstract Synucleinopathies are neurodegenerative diseases that are associated with the misfolding and aggregation of α-synuclein (αSyn). They include Parkinson’s disease, dementia with Lewy bodies, and multiple system atrophy. In each disease, it has been proposed that aggregates of αSyn represent different conformational strains of αSyn, leading to self-propagation and spreading from cell to cell. It has been considered that αSyn aggregates grow by seeded polymerization mechanisms. Previously, the mechanism of seed conversion in prion protein aggregation has been exploited by real-time quaking-induced conversion (RT-QuIC) assay. It was further refined by incorporating the fluorescent dye thioflavin-T, which enabled the real-time monitoring of kinetic changes with a highly sensitive detection of seed aggregates present at an extremely low level. In an application for diagnostics, it has been reported that αSyn RT-QuIC exhibits specificity between 82% and 100%, while its sensitivity varies between 70% and 100%, on the basis of a study in which this assay was performed at multiple different laboratories. Furthermore, it has been suggested that the αSyn RT-QuIC method can be applied to study the biochemical characteristics of different αSyn strains among synucleinopathies. In this article, we describe the detailed protocols for αSyn RT-QuIC assays. Key words α-Synuclein, Synucleinopathy, Biomarker, Cerebrospinal fluid, Brain, Seed, Diagnosis, Strain, β-Sheet, RT-QuIC

1

Introduction α-Synucleinopathies, such as Parkinson’s disease (PD), dementia with Lewy bodies (DLB), and multiple system atrophy (MSA), are a class of neurodegenerative diseases characterized by the presence of misfolded, fibrillary α-synuclein (αSyn). In patients with PD or DLB, αSyn is misfolded and accumulates in neurons, while MSA patients show a different pattern of oligodendroglial cytoplasmic inclusions (GCI). Recent studies have suggested that the aggregation and propagation of misfolded αSyn play key roles in disease initiation and progression [1–5]. One of the most effective strategies to develop disease-modifying therapies is to prevent the

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_1, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

3

4

Ayami Okuzumi et al.

accumulation of misfolded αSyn aggregates. Toward the development of such therapies, it is important to first establish an accurate diagnostic method at the earliest stage of the disease. However, accurate diagnosis remains difficult, especially for patients at a stage prior to the prodromal phase of synucleinopathies. There is thus an urgent need to develop a detection system sensitive enough to discriminate the protein aggregates that circulate in peripheral blood, resulting in accumulation in the brain to cause neurological dysfunction. In fact, several investigations of pathological biomarkers in accessible specimens such as cerebrospinal fluid (CSF) suggested arranging an appropriate cohort for clinical trials and the value of serially monitoring the therapeutic efficacy in patients. As for the biophysical mechanism of αSyn aggregation, the propagation of misfolded proteins requires the initial formation of a homotypic complex between the two conformers of a protein [6, 7], which leads to the conversion of the native form into the pathogenic form. The de novo β-sheet-enriched molecule may act as a seed, resulting in contact with other native molecules (typically referred to as substrates) and inducing their conversion into β-sheets [7]. Currently, the most practical and widely implemented method to detect prion seeds is real-time quaking-induced conversion (RT-QuIC) assay. RT-QuIC is an in vitro cell-free assay that amplifies small numbers of pathogenic seeds and enables the detection of aggregates from the fluorescent intensity mediated by thioflavin-T (ThT) binding to cross-β structures typically found in amyloid deposits [8–10]. Thus, RT-QuIC technology has been modified to apply it to the detection of αSyn seeds that are derived from CSF, brain homogenate samples [7, 8, 11–17], submandibular glands [18], and olfactory mucosa [19] of patients with synucleinopathies. The results showed that RT-QuIC could detect extremely low levels of αSyn seeds in a highly sensitive manner. The term “strain” was initially introduced in the field of prions to discriminate the pathological phenotypes associated with the intracerebral inoculation of prion proteins in goats [20, 21]. Strains hence refer to different conformations of the same protein. In some cases of prion RT-QuIC assays, characteristic distinctions among seed strains were confirmed by results based on either SDS-PAGE analyses of protease-mediated cleavage sensitivity of RT-QuIC amplicons or morphological analysis of the ultrastructure of these aggregates using electron microscopy [8, 19]. Taking these findings together, RT-QuIC is a powerful tool to determine the specific characteristics of protein seed strains as well as the susceptibility to diseases in diagnostics. In this chapter, we introduce the detailed method of performing αSyn RT-QuIC.

RT-QuIC for α-Synuclein

2

5

Materials (See Note 1) 1. αSyn expression vectors: Wild-type full-length human αSyn cDNA in bacterial expression plasmid pRK172 was used [22]. Codon 136 was changed from TAC to TAT by sitedirected mutagenesis [23] (see Note 2). The plasmids were transformed into Escherichia coli BL21(DE3) (EMD Biosciences). 2. LB-M broth medium (sterilized by autoclaving). 3. Ampicillin (Sigma): 100 mg/mL in stock solution, stored at 20  C. 4. 1 M DTT, stored at

20  C.

5. Purification buffer: 50 mM Tris–HCl (pH 7.4), 1 mM EGTA, and 1 mM DTT. Add DTT stock solution to the buffer immediately before use. Make up the volume to 1 L and prepare and sterilize by filtration. 6. Wash buffer: 50 mM Tris–HCl (pH 7.4), 1 mM EGTA, 1 mM DTT, and 0.1 M NaCl. Add DTT stock solution to the buffer immediately before use. 7. Elution buffer: 50 mM Tris–HCl (pH 7.4), 1 mM EGTA, 1 mM DTT, and 0.35 M NaCl. Add DTT stock solution to the buffer immediately before use. 8. 30 mM Tris–HCl (pH 7.5). Prepare 2 L. 9. Ammonium sulfate. 10. 1 M isopropyl β-D-thiogalactoside (e.g., Sigma). 11. BioSpectrometer (Eppendorf). 12. 50-mL high-g-force-resistant polypropylene tubes (e.g., Himac, Item#: 328353A). 13. 500-mL high-g-force-resistant polypropylene tubes (e.g., Himac, Item#: 330437A). 14. Sonicator (e.g., MISONIX). 15. 2-Mercaptoethanol. 16. 0.22-μm filter (Millex). 17. Q-Sepharose ion exchange chromatograph (GE). 18. Dialysis membrane: 10 kDa MWCO (e.g., Pierce Thermo Scientific). 19. 100-kDa cut-off filter (Millipore, Amicon Ultra). 20. Seed spoon (Biomedical Science Inc., Item#: SS200).

6

Ayami Okuzumi et al.

21. 96-Well optical black-bottom plate (Nunc Item#: 265301). 22. Plate sealer EASYseal (Greiner Item#: 6760x1). 23. Zirconium/silica beads, 0.5 mm in diameter (BIOSPEC Item#: 11079105Z). 24. Fluorescence OPTIMA).

plate

reader

(BMG

Labtech,

FLUOstar

25. RT-QuIC Reaction Buffer: 100 mM phosphate buffer (pH 8.2), 10μM ThT. 26. Spectrophotometer (ThermoFisher Scientific, NanoDrop). 27. Brain homogenate buffer: 1 PBS containing 1 mM EDTA, 0.5% Triton X-100, and 1 protease inhibitors (Roche, cOmplete protease inhibitor cocktail).

3

Methods

3.1 α-Synuclein Purification from Bacteria

1. Purify recombinant human αSyn protein from Escherichia coli BL21(DE3) harboring pRK172-αSyn (Y136-TAT). If the transformed bacterial cells express the target gene with a good yield of the recombinant protein, the cells can be stored in glycerol stock at 80  C until use. 2. Prepare 50 mL LB-M broth culture containing 50μg/mL ampicillin in a 200 mL breathable culture tube as a starter culture. 3. Inoculate BL21 harboring αSyn expression vector into 50 mL LB-M broth starter culture from a frozen bacterial glycerol stock previously transformed with pRK172-αSyn (Y136-TAT) (see Subheading 2, item 1). Alternatively, this starter culture may be inoculated with colonies grown on an agarose plate for bacterial culture. 4. Grow the starter culture in a shaking incubator at 37  C with vigorous shaking overnight. 5. Prepare and warm 250 mL autoinduction medium (LB-M broth medium with 50μg/mL ampicillin) at 37  C in a 500-mL culture flask. 6. Inoculate the prepared 250 mL autoinduction medium with the entire 50 mL starter culture. 7. Culture at 37  C for several hours with vigorous shaking until the optical density (OD600) measured by the BioSpectrometer reaches 0.6. 8. Add isopropyl 1-thio-β-D-galactopyranoside at a final concentration of 0.5 mM into 250 mL autoinduction medium and incubate for 6 h with vigorous shaking.

RT-QuIC for α-Synuclein

7

9. Collect the cultured medium in 500-mL high-g-force-resistant polypropylene tubes. 10. Centrifuge for 30 min at 3000  g and 4  C. 11. Decant and discard the supernatant. 12. Lyse the cell pellet by adding 10 mL αSyn buffer with gentle resuspension using a 10-mL serological pipette. 13. Sonicate the resuspended bacterial cells on ice under the optimized conditions. 14. Centrifuge the sonicated cell suspension at 20,000  g and 4  C for 10 min. 15. Transfer the clear supernatant to a 50-mL high-g-force-resistant polypropylene tube and add 2-mercaptoethanol at a final concentration of 1%. 16. Incubate in boiling water for 5 min. 17. Centrifuge the solution at 20,000  g and 4  C for 15 min and transfer the supernatant to a new tube. 18. Prepare 5 mL Q-Sepharose ion exchange beads (50% slurry in 20% EtOH) in a 15-mL tube. 19. Wash and equilibrize the beads three times using 10 mL αSyn purification buffer. 20. Load the clear supernatant carefully onto the beads in the column and rotate for 1 h at 4  C. 21. Wash the column with 10 mL αSyn purification buffer at 4  C three times. Then, wash the column with 4.5 mL αSyn wash buffer two times. 22. Collect the eluate by loading 9 mL αSyn elution buffer to elute αSyn. 23. Precipitate by adding solid ammonium sulfate powder at the level of 50% saturation. 24. Centrifuge at 20,000  g for 15 min at 4  C and discard the supernatant. 25. Resuspend the pellet with 1 mL of 30 mM Tris–HCl (pH 7.5) buffer prior to filtrating with a 0.22-μm filter (Millex). 26. Dialyze pooled fractions using a 10-kDa MWCO dialysis membrane against 2 L of 30 mM Tris–HCl, pH 7.5, at 4  C for 1 h twice and then overnight. 27. Determine the concentration of dialyzed protein using a BCA assay. 28. Snap-freeze the protein solution in aliquots appropriate for single experiments. Store the aliquots at 80  C.

8

Ayami Okuzumi et al.

3.2 Measurement of the Aggregation Using αSyn RT-QuIC Assay

1. Open the “Omega” software of the fluorescent plate reader (FLUOstar OPTIMA microplate reader). 2. Enter the following settings into your script: target temperature, 30  C; shaking speed, 200 rpm; gain, 30%; cycle time, 900 min; read every 15 min; total measurement time as required, typically for a week. 3. Set the temperature to 30  C and warm up the machine prior to starting measurement. 4. Thaw frozen test samples (including brain homogenate and CSF) on ice.

3.3 Preparation of αSyn Substrate for RT-QuIC

1. Thaw αSyn substrate on ice. 2. Centrifuge the substrate at 100,000  g and 4  C for 20 min and transfer it to a new tube (see Note 3). 3. Filter the supernatant through a 100-kDa MWCO filter immediately prior to use (see Note 4). 4. Measure the absorbance at 280 nm (A280) with a NanoDrop spectrophotometer and calculate the concentration of the substrate.

3.4 Preparation of αSyn Reactions

1. RT-QuIC reactions are performed in black 96-well plates (see Subheading 2, item 21) (see Note 5). Preload plates with 37  3 mg of 0.5 mm zirconium/silica beads per well (see Note 6). 2. The RT-QuIC reaction buffer is composed of 100 mM phosphate buffer (pH 8.2) and 10μM thioflavin T (ThT). Add 0.1 mg/mL filtered αSyn substrates (final concentration) (see Note 7). 3. For brain homogenate samples: Prepare initial 10% (w/v) brain homogenates using phosphate-buffered saline (PBS) containing 1 mM EDTA, 150 mM NaCl, 0.5% Triton X-100, and cOmplete protease inhibitor cocktail. Each well should contain 95μL reaction buffer. For reactions, seed 5μL brain homogenate diluted with PBS appropriately to a final volume of 100μL. 4. For CSF samples: Place 90μL reaction buffer in each well. Seed reactions with 10μL undiluted CSF to a final reaction volume of 100μL (see Note 8). 5. For pluripotent stem cell (iPSC)-derived dopaminergic neuron samples: Place 95μL reaction buffer in each well. Seed reactions with 5μL iPSC-derived dopaminergic neuron samples to a final reaction volume of 100μL. 6. Centrifuge the plate at 300 rpm for 5 min at 4  C. 7. Seal the plate with EASYseal.

RT-QuIC for α-Synuclein

9

8. Place the prepared plate in the fluorescence plate reader and incubate it at 30  C for 120 h with intermittent shaking cycles: double-orbital mode with 1 min of shaking at 200 rpm followed by 14 min of resting. 9. Monitor the kinetics of fibril formation by the bottom reading method for the fluorescence intensity every 15 min using excitation light at 450 nm and emission fluorescence at 480 nm. Set instrument gains to 30% of the detection limit of the instrument (260,000). 10. Data analysis: For the general strategy, see below. 3.5 RT-QuIC Data Analysis: Parameters of Kinetic Change (Fig. 1, See Note 9)

1. Analyze the relative fluorescent intensity measured by RT-QuIC and plot it using the built-in program Omega Mars. Calculate the area under the curve (AUC), the time to reach half maximum fluorescence, and the speed of aggregation (Figs. 1 and 2, see Note 10).

3.6 RT-QuIC Data Analysis for Sensitivity and Specificity (See Note 11)

1. Using a FLUOstar OPTIMA microplate reader (BMG Labtech), a positive response is defined when ThT fluorescence reaches 260,000 RFU (maximum fluorescence) at 120 h.

Fig. 1 Diagram of the potential seeding conversion mechanism of αSyn in RT-QuIC assay. The seeds trigger the aggregation of monomeric αSyn. This conversion causes conformational modification into misfolded oligomers that elongate into fibrils. After the detection of fibrils, a quaking event breaks the longer fibrils into shorter, reactive oligomers, which further act as seeds for the conversion of monomeric αSyn. The typical shape of the kinetic curve is shown during the aggregation process

10

Ayami Okuzumi et al.

Fig. 2 Amyloid formation is accelerated in a seed dose-dependent manner

2. Each sample is typically set in duplicate. If only one of two samples is positive, the analysis should be repeated in quadruplicate. A positive response in at least two of the replicates is considered as a positive response overall [17]. 3. Positive or negative response data sets (see Subheading 3.6, step 2) are subjected to multiple logistic regression analyses to describe the appropriate receiver operating characteristic (ROC) curves with area under the curve (AUC) by using GraphPad Prism 6 or other graphing software for calculating sensitivity and specificity.

4

Notes 1. Buffers and reagents are filtered through a pre-rinsed 0.22-μm filter into pre-rinsed vessels that are sterilized and subjected to minimization of lint contamination. Filters, syringes, and tubes also need to be pre-rinsed [24]. 2. To avoid cysteine misincorporation at codon 136 in bacterially expressed αSyn protein, the expression constructs with sitedirected mutagenesis at codon 136 (Y136-TAC to Y136TAT) can be generated and used as αSyn constructs [23]. 3. It is common to store recombinant αSyn monomer at 80  C until use. However, a freezing and thawing cycle might promote αSyn aggregation or seed formation. Therefore, we always centrifuge αSyn monomer at 100,000  g and 4  C for 20 min and collect the supernatant for use. 4. A small portion of the substrate might be eliminated during the filtration step.

RT-QuIC for α-Synuclein

11

5. Do not use the outermost wells of a 96-well plate due to the risk of uneven heating. The temperature on a plate reader is unstable, especially in these parts. Apply 100μL water to the outermost wells. 6. Add two seed spoons full of zirconium/silica beads to wells to fill approximately 37 mg beads per well. 7. Never vortex after the substrate has been added to the plate. Vortexing or vigorous mixing might promote aggregate (artificial seed) formation [24]. 8. The applied protocols differ widely in terms of the physical and chemical conditions of the reaction and the starting seed and substrate used for the reaction. As previous reports have described, multiple approaches may be used to detect αSyn seeding activity. For example, a different microenvironment of the reaction, different physical settings for the aggregation, a different source of the seed, a different method of preparing substrate, or any combination of these factors may yield different results [8]. The addition of further compounds such as SDS detergent can change the seeding kinetics and the sensitivity of αSyn RT-QuIC of CSF [7] (see Table 1). 9. RT-QuIC assay is a relatively qualitative method. The seeding activity might differ slightly in each assay due to the differences in substrate lot or reaction environment. This variation should be especially noted when you compare the results among experiments by using quantitative parameters (e.g., lag time or half-maximum fluorescence). 10. RT-QuIC assay takes advantage of the seeding conversion mechanism that underlies prion aggregation. In this assay, small amounts of misfolded αSyn seeds recruit single recombinant αSyn substrate molecules and induce their conversion by integrating them into a growing amyloid aggregate concomitant with a conformational change of the substrate into a seeding-competent state (Fig. 1) [7, 26, 27]. RT-QuIC consists of cycles of (a) incubation steps to control the size of the amyloid product because αSyn fibrils increase exponentially, and (b) vigorous shaking steps, which make fragments of αSyn aggregates into smaller seeds to promote the conversion (Fig. 1). The growth of the αSyn fibrils follows a sigmoidal curve (Fig. 1). It displays a lag phase, during which the nucleation process occurs, followed by the exponential phase representing elongation of the fibrils, and then a plateau phase once the monomers have been converted into β-sheet-enriched species, which saturates the signal (Fig. 1) [7]. The lag phase or time to threshold depends on the initial concentration of seeds (Fig. 2). Over a long period, αSyn substrates will eventually form fibrils spontaneously under various RT-QuIC conditions

2μL 10 % w/V BH 93% in PBS; 15μL CSF

[13] 17 DLB, 12PD, 16 neurol controls, 15 controls

15μL CSF; 2μL BH 1:104

CSF of uncertain 75% synucleinopathy patients

96% 15μL CSF; 2μL BH 1:20,000 in PBS

[14] 15 PD, 11 controls

[17] 118 synucleinopathies, 52 controls

[15] 105 PD, 79 controls

100%

5μL 10% w/V BH ND in PBS

Sn (%)

[12] 7 DLB, 6 neurol controls

Seed 5–15μL CSF; 2μL 95% BH 1:20,000 in PBS

Sample

[11] 42 DLB, 22PD, 35 neurol controls, 35 controls

Ref

Table 1 Comparison of different αSyn RT-QuIC protocols Shaking/ incubation T

pH SDS

37  3 mg of 0.5 mm zirconium/ silica beads 82%

30  C 8.2 No 0.1 g/L human 1 min αSyn double orbital, 200 rpm/ 15 min

0.0015% 6 silica of for 0.8 mm CSF

0.0015% 6 silica of for 0.8 mm CSF

No

37  3 mg of 0.5 mm zirconium/ silica beads

Beads

37  3 mg of 0.5 mm zirconium/ silica beads

42  C 8 0.1 g/L human 1 min αSyn double orbital, 400 rpm/ 1 min

42  C 8 0.1 g/L filtered 1 min double human αSyn; orbital, 0.1 g/L 400 rpm/ K23Q aSyn 1 min

0.1–0.15 g/L 40 s circular, 40  C 7.5 No S129Ah αSyn 432 rpm/ 140 s

30  C 8.2 No 0.1 g/L human 1 min αSyn double orbital, 200 rpm/ 15 min

Substrates

30  C 8.2 No 85–98% 0.1 g/L human 1 min αSyn double orbital, 200 rpm/ 15 min

100%

100%

100%

100%

Sp (%)

12 Ayami Okuzumi et al.

15μL CSF

95.30%

65.50%

98%

84.30%

80% 90% for PD; 40% for LRRK2 PD

95% for 70% for FCx, FCx; 100% 75% for for SNc SNc

37  C 8.4 2% 1 min double orbital, 600 rpm/ 29 min

1 min single 42  C 8 orbital, 200 rpm/ 29 min

42  C 8 0.1 g/L filtered 1 min human αSyn double orbital, 400 rpm/ 1 min

70μM human αSyn

1 glass bead of 3 mm beads

37  3 mg of 0.5 mm zirconium/ silica beads

No

0.0015% 6 silica of for 0.8 mm CSF

No

30  C 8.2 No 0.1 g/L human 1 min αSyn double orbital, 200 rpm/ 15 min

0.14 g/L human αSyn

BH brain homogenate, CBD corticobasal degeneration, DLB dementia with Lewy bodies, FCx frontal cortex, FTDP frontotemporal dementia and parkinsonism, MSA multiple system atrophy, ND not determined, OM olfactory mucosa, PD Parkinson’s disease, PSP progressive supranuclear palsy, Ref reference, Sn sensitivity, Sp specificity, SNc substantia nigra pars compacta, T temperature

[25] Definite NP; 21 DLB, 101 neurol controls. Clinical cohort; 34 DLB, 31 MSA, 71 PD, 119 neurol controls, 62 controls

[19] BH from 1 FTDP, 1 PSP, 1 CBD, 2μL diluted 10 3 1 PD, 1 MSA, and 1 control from 10% BH

15μL CSF

10 DLB, 10PD, 10 controls from 3 μL BH FCx; 8 DLB, 6 PD, 5 controls from SNc

[16] 51 LRRK2 PD, 10 idiopathic PD, 10 controls

[8]

RT-QuIC for α-Synuclein 13

14

Ayami Okuzumi et al.

in the absence of preformed seeds. Thus, we usually distinguish between appropriately matched samples with differing seed concentrations and characteristics by comparing kinetic curves or times to reach the threshold [9, 10, 24]. The slope obtained by differential processing of plotted curves indicates the speed of aggregation. To distinguish different types of αSyn seed strain, the end-products of RT-QuIC were indicated to be resistant to proteinase K (PK) by western blotting [8, 19]. 11. Sensitivity and specificity: To obtain accuracy in terms of specificity and sensitivity, we make positive/negative decisions using samples from synucleinopathy patients and healthy controls, respectively. The relative level of seeding activity can be assessed using end-point dilution [13] or kinetic analyses, as has been described elsewhere for αSyn RT-QuIC reactions.

Acknowledgments We thank Edanz (https://en-author-services.edanzgroup.com/ac) for editing the English text of the draft of this manuscript. This work was supported by Japan Agency for Medical Research and Development (AMED), Strategic Research Program for Brain Sciences (20dm107156 to T.H.), and Grants-in-Aid for Scientific Research (19K16928 to A.O., 19K07831 to T.F.) from the Japan Society for the Promotion of Science (JSPS). References 1. Spillantini MG, Schmidt ML, Lee VM, Trojanowski JQ, Jakes R, Goedert M (1997) Alphasynuclein in Lewy bodies. Nature 388:839–840. https://doi.org/10.1038/ 42166 2. Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A, Pike B, Root H, Rubenstein J, Boyer R, Stenroos ES, Chandrasekharappa S, Athanassiadou A, Papapetropoulos T, Johnson WG, Lazzarini AM, Duvoisin RC, Di Iorio G, Golbe LI, Nussbaum RL (1997) Mutation in the alphasynuclein gene identified in families with Parkinson’s disease. Science 276:2045–2047. https://doi.org/10.1126/science.276.5321. 2045 3. Braak H, Del Tredici K, Ru¨b U, de Vos RA, Jansen Steur EN, Braak E (2003) Staging of brain pathology related to sporadic Parkinson’s disease. Neurobiol Aging 24:197–211. https://doi.org/10.1016/s0197-4580(02) 00065-9

4. Kordower JH, Chu Y, Hauser RA, Freeman TB, Olanow CW (2008) Lewy body-like pathology in long-term embryonic nigral transplants in Parkinson’s disease. Nat Med 14:504–506. https://doi.org/10.1038/ nm1747 5. Li JY, Englund E, Holton JL, Soulet D, Hagell P, Lees AJ, Lashley T, Quinn NP, Rehncrona S, Bjo¨rklund A, Widner H, Revesz T, Lindvall O, Brundin P (2008) Lewy bodies in grafted neurons in subjects with Parkinson’s disease suggest host-to-graft disease propagation. Nat Med 14:501–503. https:// doi.org/10.1038/nm1746 6. Prusiner SB (1994) Biology and genetics of prion diseases. Annu Rev Microbiol 48:655–686. https://doi.org/10.1146/ annurev.mi.48.100194.003255 7. Candelise N, Schmitz M, Thu¨ne K, Cramm M, Rabano A, Zafar S, Stoops E, Vanderstichele H, Villar-Pique A, Llorens F,

RT-QuIC for α-Synuclein Zerr I (2020) Effect of the micro-environment on α-synuclein conversion and implication in seeded conversion assays. Transl Neurodegener 9:5. https://doi.org/10.1186/s40035-0190181-9 8. Candelise N, Schmitz M, Llorens F, VillarPique´ A, Cramm M, Thom T, da Silva Correia SM, da Cunha JEG, Mo¨bius W, Outeiro TF, ´ lvarez VG, Banchelli M, D’Andrea C, de A Angelis M, Zafar S, Rabano A, Matteini P, Zerr I (2019) Seeding variability of different alpha synuclein strains in synucleinopathies. Ann Neurol 85:691–703. https://doi.org/ 10.1002/ana.25446 9. Wilham JM, Orru´ CD, Bessen RA, Atarashi R, Sano K, Race B, Meade-White KD, Taubner LM, Timmes A, Caughey B (2010) Rapid end-point quantitation of prion seeding activity with sensitivity comparable to bioassays. PLoS Pathog 6:e1001217. https://doi.org/ 10.1371/journal.ppat.1001217 10. Colby DW, Zhang Q, Wang S, Groth D, Legname G, Riesner D, Prusiner SB (2007) Prion detection by an amyloid seeding assay. Proc Natl Acad Sci U S A 104:20914–20919. https://doi.org/10.1073/pnas.0710152105 11. Fairfoul G, McGuire LI, Pal S, Ironside JW, Neumann J, Christie S, Joachim C, Esiri M, Evetts SG, Rolinski M, Baig F, Ruffmann C, Wade-Martins R, Hu MT, Parkkinen L, Green AJ (2016) Alpha-synuclein RT-QuIC in the CSF of patients with alpha-synucleinopathies. Ann Clin Transl Neurol 3:812–818. https:// doi.org/10.1002/acn3.338 12. Sano K, Atarashi R, Satoh K, Ishibashi D, Nakagaki T, Iwasaki Y, Yoshida M, Murayama S, Mishima K, Nishida N (2018) Prion-like seeding of misfolded α-Synuclein in the brains of dementia with Lewy body patients in RT-QUIC. Mol Neurobiol 55:3916–3930. https://doi.org/10.1007/s12035-017-06241 13. Groveman BR, Orru` CD, Hughson AG, Raymond LD, Zanusso G, Ghetti B, Campbell KJ, Safar J, Galasko D, Caughey B (2018) Rapid and ultra-sensitive quantitation of diseaseassociated α-synuclein seeds in brain and cerebrospinal fluid by αSyn RT-QuIC. Acta Neuropathol Commun 6:7. https://doi.org/10. 1186/s40478-018-0508-2 14. Manne S, Kondru N, Hepker M, Jin H, Anantharam V, Lewis M, Huang X, Kanthasamy A, Kanthasamy AG (2019) Ultrasensitive detection of aggregated α-Synuclein in glial cells, human cerebrospinal fluid, and brain tissue using the RT-QuIC assay: new high-throughput neuroimmune biomarker assay for Parkinsonian disorders. J

15

Neuroimmune Pharmacol 14:423–435. https://doi.org/10.1007/s11481-01909835-4 15. Kang UJ, Boehme AK, Fairfoul G, Shahnawaz M, Ma TC, Hutten SJ, Green A, Soto C (2019) Comparative study of cerebrospinal fluid α-synuclein seeding aggregation assays for diagnosis of Parkinson’s disease. Mov Disord 34:536–544. https://doi.org/ 10.1002/mds.27646 16. Garrido A, Fairfoul G, Tolosa ES, Martı´ MJ, Green A (2019) α-Synuclein RT-QuIC in cerebrospinal fluid of LRRK2-linked Parkinson’s disease. Ann Clin Transl Neurol 6:1024–1032. https://doi.org/10.1002/ acn3.772 17. van Rumund A, Green AJE, Fairfoul G, Esselink RAJ, Bloem BR, Verbeek MM (2019) α-Synuclein real-time quaking-induced conversion in the cerebrospinal fluid of uncertain cases of parkinsonism. Ann Neurol 85:777–781. https://doi.org/10.1002/ana. 25447 18. Manne S, Kondru N, Jin H, Anantharam V, Huang X, Kanthasamy A, Kanthasamy AG (2020) α-Synuclein real-time quaking-induced conversion in the submandibular glands of Parkinson’s disease patients. Mov Disord 35:268–278. https://doi.org/10.1002/mds. 27907 19. De Luca CMG, Elia AE, Portaleone SM, Cazzaniga FA, Rossi M, Bistaffa E, De Cecco E, Narkiewicz J, Salzano G, Carletta O, Romito L, Devigili G, Soliveri P, Tiraboschi P, Legname G, Tagliavini F, Eleopra R, Giaccone G, Moda F (2019) Efficient RT-QuIC seeding activity for α-synuclein in olfactory mucosa samples of patients with Parkinson’s disease and multiple system atrophy. Transl Neurodegener 8:24. https://doi.org/ 10.1186/s40035-019-0164-x 20. Wemheuer WM, Wrede A, Schulz-Schaeffer WJ (2017) Types and strains: their essential role in understanding protein aggregation in neurodegenerative diseases. Front Aging Neurosci 9:187. https://doi.org/10.3389/fnagi. 2017.00187 21. Pattison IH, Millson GC (1961) Scrapie produced experimentally in goats with special reference to the clinical syndrome. J Comp Pathol 71:101–109. https://doi.org/10.1016/ s0368-1742(61)80013-1 22. Jakes R, Spillantini MG, Goedert M (1994) Identification of two distinct synucleins from human brain. FEBS Lett 345:27–32. https:// doi.org/10.1016/0014-5793(94)00395-5 23. Masuda M, Dohmae N, Nonaka T, Oikawa T, Hisanaga S, Goedert M, Hasegawa M (2006)

16

Ayami Okuzumi et al.

Cysteine misincorporation in bacterially expressed human alpha-synuclein. FEBS Lett 580:1775–1779. https://doi.org/10.1016/j. febslet.2006.02.032 24. Saijo E, Groveman BR, Kraus A, Metrick M, Orru` CD, Hughson AG, Caughey B (2019) Ultrasensitive RT-QuIC seed amplification assays for disease-associated tau, α-Synuclein, and prion aggregates. Methods Mol Biol 1873:19–37. https://doi.org/10.1007/9781-4939-8820-4_2 25. Rossi M, Candelise N, Baiardi S, Capellari S, Giannini G, Orru` CD, Antelmi E, Mammana A, Hughson AG, CalandraBuonaura G, Ladogana A, Plazzi G, Cortelli P, Caughey B, Parchi P (2020) Ultrasensitive RT-QuIC assay with high sensitivity and specificity for Lewy body-associated synucleinopathies. Acta Neuropathol 140

(1):49–62. https://doi.org/10.1007/ s00401-020-02160-8 26. Schmitz M, Cramm M, Llorens F, Mu¨llerCramm D, Collins S, Atarashi R, Satoh K, Orru` CD, Groveman BR, Zafar S, SchulzSchaeffer WJ, Caughey B, Zerr I (2016) The real-time quaking-induced conversion assay for detection of human prion disease and study of other protein misfolding diseases. Nat Protoc 11:2233–2242. https://doi.org/10.1038/ nprot.2016.120 27. Atarashi R, Wilham JM, Christensen L, Hughson AG, Moore RA, Johnson LM, Onwubiko HA, Priola SA, Caughey B (2008) Simplified ultrasensitive prion detection by recombinant PrP conversion with shaking. Nat Methods 5:211–212. https://doi.org/10.1038/ nmeth0308-211

Chapter 2 Electron Microscopic Analysis of α-Synuclein Fibrils Airi Tarutani and Masato Hasegawa Abstract α-Synuclein (α-syn) is a major component of abnormal protein deposits observed in the brains of patients with synucleinopathies, including Parkinson’s disease, dementia with Lewy bodies, and multiple system atrophy (MSA). The synaptic protein α-syn is water-soluble under normal physiological conditions, but in these patients’ brains, we see accumulation of insoluble amyloid-like α-syn fibrils with prion-like properties. Intracerebral accumulation of these fibrils is correlated with disease onset and progression. Recombinant α-syn protein also forms amyloid-like fibrils that are structurally akin to those extracted from patients’ brains. Recent cryo-electron microscopic studies have identified the core structures of synthetic α-syn fibrils and α-syn fibrils extracted from the brains of patients with MSA at the atomic level. In this chapter, we describe negative staining and immunoelectron microscopy protocols for ultrastructural characterization of synthetic α-syn fibrils and pathological α-syn fibrils. Key words α-Synuclein, Amyloid-like fibrils, Negative staining, Immunoelectron microscopy, Parkinson’s disease, Dementia with Lewy bodies, Multiple system atrophy

1

Introduction Accumulation of filamentous α-synuclein (α-syn) in neurons and/or glial cells is the neuropathological hallmark of synucleinopathy [1]. α-Syn accumulates in neurons as Lewy bodies and Lewy neurites in Parkinson’s disease (PD) and dementia with Lewy bodies (DLB) and is observed in oligodendrocytes as glial cytoplasmic inclusions in multiple system atrophy (MSA). Electron microscopic studies of detergent-insoluble fractions extracted from brains of synucleinopathy patients show that α-syn forms amyloid-like structures with a width of 5–10 nm (Figs. 1f and 3c–e) [2–4]. In addition, more than 90% of this accumulated α-syn is phosphorylated at serine 129 and partially ubiquitinated [5, 6]. Missense mutations and multiplications of the SNCA gene encoding α-syn have been reported to cause familial synucleinopathy [7]. α-Syn is a water-soluble, natively unfolded protein composed of 140 amino residues and is localized in synaptic terminals at

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_2, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

17

18

Airi Tarutani and Masato Hasegawa

Fig. 1 Electron microscopic analysis of negatively stained α-syn fibrils. (a) Carbon-coated 300-mesh copper grid. (b) Holding the grid with the cross-lock tweezers. (c) Dropping the sample and staining solutions on the grid. (d) Blotting the sample and staining solutions with filter paper. (e) Negatively stained synthetic α-syn fibrils. Scale bar, 100 nm. (f) Negatively stained α-syn fibrils extracted from the brain of a patient with MSA. Scale bar, 100 nm

Ultrastructural Observation of α-syn Fibrils

19

relatively high concentration [8]. In patients, α-syn in the brain structurally changes from the normal form rich in α-helix to an abnormal form with β-sheet structure. Recombinant α-syn protein purified from bacterial cells also forms amyloid-like fibrils closely resembling those observed in patients upon shaking at 37  C for several days (Figs. 1e and 3a, b) [9, 10]. Furthermore, different misfoldings of α-syn caused by mutations and various cellular conditions lead to the formation of α-syn strains with distinct conformations [11]. Synthetic α-syn fibrils containing familial mutations and synthetic α-syn fibrils formed under various conditions have been reported to exhibit distinct ultrastructural properties and cytotoxicities [12–14]. Cryo-electron microscopy (EM) of α-syn fibrils extracted from MSA patients has revealed that MSA-derived α-syn fibrils are conformationally distinct from synthetic α-syn fibrils and DLB-derived α-syn fibrils [15]. These distinct α-syn strains exhibit heterogeneity of prion-like properties in vitro and in vivo [4, 16–18]. Transmission electron microscopy can visualize samples at nanoscale by irradiating them with electron beams and obtaining an interference image from the transmitted electrons. EM analysis makes it possible to observe filamentous α-syn structures and quantitatively evaluate structural differences using the fibril width and the periodicity as indicators. In this chapter, we describe how to prepare a grid bearing α-syn fibrils for EM analysis. Negative staining is a method to examine easily and quickly all structures contained in the sample solution. Heavy metals in the staining solution occupy the gaps and surrounding parts of the structure and reveal the morphology of the structure. On the other hand, immuno-EM can specifically observe the ultrastructural features of the target protein even in the presence of contaminants.

2

Materials

2.1 Negative Staining

1. Carbon-coated 300-mesh copper grid (see Note 1). 2. Cross-lock stainless steel tweezers. 3. Filter paper. 4. Sample solution: synthetic α-syn fibrils (see Note 2), sarkosylinsoluble fractions extracted from brains of patients with synucleinopathy (see Note 3). 5. Staining solution: 2% phosphotungstic acid, pH 7.5 (see Note 4). 6. Transmission electron microscope.

20

2.2

Airi Tarutani and Masato Hasegawa

Immunolabeling

1. Carbon-coated 300-mesh copper or nickel grid (see Note 5). 2. Cross-lock stainless steel tweezers. 3. Parafilm. 4. Humidified chamber. 5. Filter paper. 6. Sample solution. 7. Blocking and diluent solution: 0.1% gelatin in sterile phosphate-buffered saline (PBS), 0.1% sodium azide. 8. Primary antibody recognizing α-syn (see Note 6). 9. Wash buffer: sterile PBS. 10. Secondary antibody conjugated to gold particles (see Note 7). 11. Staining solution: 2% phosphotungstic acid, pH 7.5. 12. Transmission electron microscope.

3

Methods

3.1 Negative Staining of α-Syn Fibrils

1. Hold the carbon-coated 300-mesh copper grid with cross-lock stainless steel tweezers (Fig. 1a, b). 2. Place 2–4μL of the sample solution on the grid mesh (Fig. 1c). Wait for 1 min. 3. Blot the sample solution with filter paper or a Pipetman (Fig. 1d, see Note 8). 4. Place a few drops of 2% phosphotungstic acid on the grid mesh before the grid dries. Blot the staining solution on the grid with filter paper (Fig. 1c, d). 5. Repeat step 4 twice. 6. Dry completely. 7. Set the prepared grid in the holder of the transmission electron microscope.

3.2 Immuno-EM of α-Syn Fibrils

1. Hold the carbon-coated 300-mesh copper or nickel grid with cross-lock stainless steel tweezers (Fig. 1a, b). 2. Place 2–4μL of the sample solution on the grid mesh (Fig. 1c). Wait for 1 min. 3. Blot the sample solution with filter paper or a Pipetman (Fig. 1d). 4. Dry completely. 5. Put 50μL of the blocking solution onto the parafilm in the humidified chamber and place the grid on top of the drop with the side to which the sample solution is fixed facing down (Fig. 2a–e). Incubate for 10 min at room temperature.

Ultrastructural Observation of α-syn Fibrils

21

Fig. 2 Immunoelectron microscopy of α-syn fibrils. (a) The parafilm in the humidified chamber. (b) Solutions on the parafilm. (c) Placing the grid face-down on the drop. (d, e) Image of the grid during incubation. (f) Blotting surplus solutions on the grid with filter paper

6. Blot the blocking solution remaining on the grid surface with filter paper (Fig. 2f, see Note 9). 7. Put 50μL of the primary antibody (1:50–1:100 dilution, diluted in the diluent solution) onto the parafilm and place the grid on top of the drop (Fig. 2b–e). Incubate for 1 h at room temperature or 37  C. 8. Drop 50μL of wash buffer onto the parafilm and wash the grid surface in it (Fig. 2b, c). 9. Wash twice as in step 8.

22

Airi Tarutani and Masato Hasegawa

10. Blot the wash buffer remaining in the grid surface with filter paper (Fig. 2f). 11. Put 50μL of the second antibody conjugated to gold particles (1:50–1:100 dilution, diluted in the diluent solution) onto the parafilm and place the grid on top of the drop (Fig. 2b–e). Incubate for 1 h at room temperature. 12. Wash three times as in step 8. 13. Blot the wash buffer remaining in the grid surface with filter paper (Fig. 2f). 14. Negative stain the grid as in Subheading 3.1.

4

Notes 1. Hydrophilization treatment of the grid is effective for dispersion of fibrils. The hydrophilized grid prepared with an ion-sputtering device is used within a few hours. 2. Purification of recombinant α-syn protein from Escherichia coli is performed as previously reported [19]. For fibrillization, 2–10 mg/mL recombinant α-syn protein is incubated under shaking (200 rpm) at 37  C for 3–5 days. The degree of fibrillization is evaluated by means of fluorescence assay with thioflavin, which specifically binds to ß-sheet structure. Dilute the formed α-syn fibrils to 1/10 with 30 mM Tris–HCl (pH 7.5) and apply the diluted α-syn fibrils to the grid. If the sample solution contains only a small number of fibrils, the sample solution is ultracentrifuged at 113,000  g for 20 min at 25  C, and the resulting pellet is suspended in a small amount of 30 mM Tris–HCl (pH 7.5). 3. Preparation of the sarkosyl-insoluble fraction from the brain of a patient with synucleinopathy is performed as previously reported [20]. Add an appropriate amount of 30 mM Tris– HCl (pH 7.5) to the sarkosyl-insoluble fraction and suspend by pipetting. If large amounts of contaminants are contained in the sarkosyl-insoluble fraction, centrifuge at 5000  g for 10 min at 25  C and use the supernatant as a sample solution. The morphology of α-syn fibrils accumulated in cultured cells or mouse brain can also be observed by electron microscopic analysis of the sarkosyl-insoluble fraction prepared in the same way as described for patients’ brains. 4. Store in the dark at room temperature. Gently centrifuge to remove debris before use, and then use the supernatant. Uranyl acetate (2%) can also be used as a staining solution. 5. If the incubation time with the primary antibody is prolonged, a nickel grid can be used to prevent rusting.

Ultrastructural Observation of α-syn Fibrils

23

Fig. 3 Immunolabeled synthetic α-syn fibrils and patient-derived α-syn fibrils. (a, b) Synthetic α-syn fibrils positive for α-syn 131–140 antibody, immunolabeled with secondary antibody conjugated to 5 nm (a) and 10 nm (b) gold particles. Scale bar, 200 nm (a), 50 nm (b). (c, d) PS129-positive α-syn fibrils extracted from the brain of a patient with DLB, immunolabeled with secondary antibody conjugated to 5 nm gold particles. Arrowheads indicate ferritins. Scale bar, 200 nm (c), 50 nm (d). (e) PS129-positive α-syn fibril extracted from the brain of a patient with MSA, immunolabeled with secondary antibody conjugated to 5 nm gold particles. Scale bar, 50 nm

6. Antibodies directed against α-syn phosphorylated at serine 129 can differentiate normal and abnormal α-syn and are useful for immuno-EM of patient-derived α-syn fibrils. Antibodies that recognize the C-terminal of α-syn are used for immuno-

24

Airi Tarutani and Masato Hasegawa

EM of synthetic α-syn fibrils. The C-terminal of α-syn is located outside the filamentous α-syn structure and is easily recognized by immuno-EM. 7. The fibril width of α-syn fibrils is 5–10 nm. Gold particles with a diameter of 5–20 nm are suitable to label α-syn fibrils. In general, ferritin, approximately 10 nm in diameter, is one of the major contaminants in the sarkosyl-insoluble fraction extracted from the patient’s brain (Fig. 3d) [21]. Care is needed to distinguish ferritins from gold particles. 8. Place the filter paper on the edge of the grid and take care not to let the filter paper touch the grid mesh. 9. Stand the grid perpendicular to the filter paper. References 1. Goedert M (2001) Alpha-synuclein and neurodegenerative diseases. Nat Rev Neurosci 2 (7):492–501. https://doi.org/10.1038/ 35081564 2. Spillantini MG, Crowther RA, Jakes R, Hasegawa M, Goedert M (1998) AlphaSynuclein in filamentous inclusions of Lewy bodies from Parkinson’s disease and dementia with lewy bodies. Proc Natl Acad Sci U S A 95 (11):6469–6473. https://doi.org/10.1073/ pnas.95.11.6469 3. Spillantini MG, Crowther RA, Jakes R, Cairns NJ, Lantos PL, Goedert M (1998) Filamentous alpha-synuclein inclusions link multiple system atrophy with Parkinson’s disease and dementia with Lewy bodies. Neurosci Lett 251(3):205–208 4. Tarutani A, Arai T, Murayama S, Hisanaga SI, Hasegawa M (2018) Potent prion-like behaviors of pathogenic alpha-synuclein and evaluation of inactivation methods. Acta Neuropathol Commun 6(1):29. https://doi. org/10.1186/s40478-018-0532-2 5. Fujiwara H, Hasegawa M, Dohmae N, Kawashima A, Masliah E, Goldberg MS, Shen J, Takio K, Iwatsubo T (2002) AlphaSynuclein is phosphorylated in synucleinopathy lesions. Nat Cell Biol 4(2):160–164. https:// doi.org/10.1038/ncb748 6. Hasegawa M, Fujiwara H, Nonaka T, Wakabayashi K, Takahashi H, Lee VM, Trojanowski JQ, Mann D, Iwatsubo T (2002) Phosphorylated alpha-synuclein is ubiquitinated in alpha-synucleinopathy lesions. J Biol Chem 277(50):49071–49076. https://doi.org/10. 1074/jbc.M208046200 7. Nussbaum RL (2018) Genetics of Synucleinopathies. Cold Spring Harb Perspect Med 8(6):

a024109. https://doi.org/10.1101/ cshperspect.a024109 8. Maroteaux L, Campanelli JT, Scheller RH (1988) Synuclein: a neuron-specific protein localized to the nucleus and presynaptic nerve terminal. J Neurosci 8(8):2804–2815 9. Crowther RA, Jakes R, Spillantini MG, Goedert M (1998) Synthetic filaments assembled from C-terminally truncated alpha-synuclein. FEBS Lett 436(3):309–312 10. Serpell LC, Berriman J, Jakes R, Goedert M, Crowther RA (2000) Fiber diffraction of synthetic alpha-synuclein filaments shows amyloid-like cross-beta conformation. Proc Natl Acad Sci U S A 97(9):4897–4902. https://doi.org/10.1073/pnas.97.9.4897 11. Tarutani A, Hasegawa M (2019) Prion-like propagation of alpha-synuclein in neurodegenerative diseases. Prog Mol Biol Transl Sci 168:323–348. https://doi.org/10.1016/bs. pmbts.2019.07.005 12. El-Agnaf OM, Jakes R, Curran MD, Wallace A (1998) Effects of the mutations Ala30 to Pro and Ala53 to Thr on the physical and morphological properties of alpha-synuclein protein implicated in Parkinson’s disease. FEBS Lett 440(1–2):67–70 13. Bousset L, Pieri L, Ruiz-Arlandis G, Gath J, Jensen PH, Habenstein B, Madiona K, Olieric V, Bockmann A, Meier BH, Melki R (2013) Structural and functional characterization of two alpha-synuclein strains. Nat Commun 4:2575. https://doi.org/10.1038/ ncomms3575 14. Suzuki G, Imura S, Hosokawa M, Katsumata R, Nonaka T, Hisanaga SI, Saeki Y, Hasegawa M (2020) Alpha-synuclein strains that cause distinct pathologies differentially

Ultrastructural Observation of α-syn Fibrils inhibit proteasome. Elife 9:e56825. https:// doi.org/10.7554/eLife.56825 15. Schweighauser M, Shi Y, Tarutani A, Kametani F, Murzin AG, Ghetti B, Matsubara T, Tomita T, Ando T, Hasegawa K, Murayama S, Yoshida M, Hasegawa M, Scheres SHW, Goedert M (2020) Structures of alpha-synuclein filaments from multiple system atrophy. Nature 585 (7825):464–469. https://doi.org/10.1038/ s41586-020-2317-6 16. Peelaerts W, Bousset L, Van der Perren A, Moskalyuk A, Pulizzi R, Giugliano M, Van den Haute C, Melki R, Baekelandt V (2015) Alpha-Synuclein strains cause distinct synucleinopathies after local and systemic administration. Nature 522(7556):340–344. https:// doi.org/10.1038/nature14547 17. Peng C, Gathagan RJ, Covell DJ, Medellin C, Stieber A, Robinson JL, Zhang B, Pitkin RM, Olufemi MF, Luk KC, Trojanowski JQ, Lee VM (2018) Cellular milieu imparts distinct pathological alpha-synuclein strains in alphasynucleinopathies. Nature 557 (7706):558–563. https://doi.org/10.1038/ s41586-018-0104-4 18. Shahnawaz M, Mukherjee A, Pritzkow S, Mendez N, Rabadia P, Liu XG, Hu B, Schmeichel A, Singer W, Wu G, Tsai AL, Shirani H, Nilsson KPR, Low PA, Soto C

25

(2020) Discriminating alpha-synuclein strains in Parkinson’s disease and multiple system atrophy. Nature 578(7794):273–277. https://doi. org/10.1038/s41586-020-1984-7 19. Tarutani A, Suzuki G, Shimozawa A, Nonaka T, Akiyama H, Hisanaga S, Hasegawa M (2016) The effect of fragmented pathogenic alpha-Synuclein seeds on prion-like propagation. J Biol Chem 291(36):18675–18688. https://doi.org/10.1074/jbc.M116.734707 20. Taniguchi-Watanabe S, Arai T, Kametani F, Nonaka T, Masuda-Suzukake M, Tarutani A, Murayama S, Saito Y, Arima K, Yoshida M, Akiyama H, Robinson A, Mann DMA, Iwatsubo T, Hasegawa M (2016) Biochemical classification of tauopathies by immunoblot, protein sequence and mass spectrometric analyses of sarkosyl-insoluble and trypsin-resistant tau. Acta Neuropathol 131(2):267–280. https://doi.org/10.1007/s00401-015-15033 21. Wenborn A, Terry C, Gros N, Joiner S, D’Castro L, Panico S, Sells J, Cronier S, Linehan JM, Brandner S, Saibil HR, Collinge J, Wadsworth JD (2015) A novel and rapid method for obtaining high titre intact prion strains from mammalian brain. Sci Rep 5:10062. https://doi.org/10.1038/ srep10062

Chapter 3 α-Synuclein Seeding Assay Using Cultured Cells Jun Ogata, Daisaku Takemoto, Shotaro Shimonaka, Yuzuru Imai, and Nobutaka Hattori Abstract α-Synuclein, a presynaptic protein, is involved in synaptic vesicle dynamics in response to neuronal activity. Mutations of the α-synuclein gene and the neuronal deposition of α-synuclein, called Lewy bodies, are linked to the development of Parkinson’s disease. α-Synuclein has a prion-like property that converts its physiological protein conformation to a pathogenic one, forming disease-causing fibrils. Aggregation of these fibrils and subsequent inclusion formation are suggested to interfere with vesicular trafficking and organelle function in neurons. Thus, detection of a prion-like property of α-synuclein and the evaluation of its modifying factors are required to understand the pathogenesis of Parkinson’s disease and to develop new therapies. In this chapter, we describe a cell-based assay for detecting α-synuclein propagation. Key words α-Synuclein, Recombinant protein, Protein purification, Transfection, Cultured cells

1

Introduction Several neurodegenerative diseases, including Parkinson’s disease, Parkinson’s disease dementia, dementia with Lewy bodies, and multiple system atrophy, are classified as synucleinopathies, which are characterized by the progressive accumulation of fibrillized α-synuclein in the affected regions [1, 2]. The deposition of Lewy bodies is a pathological feature of synucleinopathies [1, 2]. The Lewy body consists of fibrillized α-synuclein, which is often phosphorylated at Ser219 [3], organelles such as mitochondria and lysosomes, and lipid membranes [4]. The formation of α-synuclein inclusions interferes with intercellular trafficking and organelle functions, leading to neuronal death [5]. Pathological analyses have shown that Lewy body deposition extends from the dorsal motor nucleus of the vagus to the upper brain stem and from

Jun Ogata and Daisaku Takemoto contributed equally to this work. Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_3, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

27

28

Jun Ogata et al.

the olfactory bulb to the limbic system [6, 7], suggesting that pathogenic α-synuclein exhibits prion-like seeding activity to convert the physiological form of α-synuclein to pathogenic fibrils. The formation of α-synuclein cellular inclusions by α-synuclein fibrils as ‘seeds’ has been experimentally demonstrated using α-synuclein inclusions extracted from brain autopsies with synucleinopathies, including Parkinson’s disease, as well as fibrils prepared from recombinant α-synuclein [8, 9]. Depending on diseasecausing mutations, the brain environment, and conditions for the preparation of recombinant α-synuclein fibrils, α-synuclein fibrils form distinct structures, which could affect their propagation efficiency and pathological effects [10–13]. To analyze the mechanism of α-synuclein aggregation and cell– cell propagation using cultured cells, we describe a modified assay protocol based on a method established by Hasegawa et al. [9, 14]. The preparation of ‘competent seeds’ is a critical step in this protocol. This assay can evaluate the efficiency of α-synuclein aggregation and the effect of modifiers in the intracellular environment in a short time without protein transfection reagents. We hope this protocol contributes to elucidating the pathogenesis of synucleinopathies, modifier genes, and chemicals [15].

2

Materials

2.1 α-Synuclein Purification from Bacteria

1. BL21 (DE3) competent cells: 20 μl aliquot with competency >5
107 cfu/μg with pUC19. 2. LB medium: autoclaved. 3. 50 mg/ml ampicillin stock in 70% ethanol. 4. 2 l shake flask with 3 baffles. 5. LB agar plates: standard LB agar plates (100 mm in diameter) with 50 μg/ml ampicillin. 6. Isopropyl ß-D-1-thiogalactopyranoside (IPTG): 0.1 M stock in distilled water. Store at 20  C. 7. Bacterial expression vector: pRK172-human α-synuclein (see Note 1). 8. Large-capacity refrigerated centrifuge (Himac, CR21N). 9. α-Synuclein purification buffer: 50 mM Tris–HCl, pH 7.4, 1 mM EGTA, 1 mM DTT. Prepare 500 ml and store at 4  C. Add 1 M DTT stock just before use. 10. α-Synuclein wash buffer: α-synuclein buffer containing 0.1 M NaCl. Add 0.29 g NaCl to 50 ml α-synuclein buffer. 11. α-Synuclein elution buffer: α-synuclein buffer containing 0.35 M NaCl. Add 1.0 g NaCl to 50 ml α-synuclein buffer.

α-Synuclein Seeding Assay Using Cultured Cells

29

12. High powered sonicator (Taitec, VP-050 N, see Note 2). 13. 50 ml polypropylene centrifuge tubes. 14. 2-Mercaptoethanol. 15. Dialysate: 30 mM Tris–HCl, pH 7.5. Prepare 2000 ml and store at 4  C. 16. Ammonium sulfate (biochemical grade). 17. Q Sepharose Fast Flow (GE Healthcare, 17051010). 18. Empty chromatography column #7321010, 20 ml bed volume).

(Bio-Rad,

Econo-Pac

19. Vortex mixer. 20. Stirrer. 21. Cellulose dialysis tubing (MWCO 14,000). 22. Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) system: a 12.5% gel is appropriate to separate α-synuclein. 23. Coomassie Brilliant Blue (CBB) staining solution. 24. Bicinchoninic acid (BCA) assay kit. 2.2 α-Synuclein Seed Preparation

1. Purified recombinant α-synuclein in dialysate from Subheading 3.1. 2. 1.5 ml safe-lock microcentrifuge tube (Eppendorf, see Note 3). 3. NaN3 solution: 1% in distilled water. 4. Dialysate: 30 mM Tris–HCl, pH 7.5. Filter it through a 0.22 μm filter. 5. 0.01% NaN3/PBS: Phosphate-buffered saline (PBS) containing 0.01% NaN3. Filter it through a 0.22 μm filter. 6. 1.5 ml tube incubator shaker with a lid (Eppendorf ThermoMixer) or bacteria shaker. 7. High-powered sonicator (Taitec, VP-050 N, see Note 4). 8. Microultracentrifuge (Himac, CS150GXL). 9. BCA assay kit.

2.3 Cell Culture and Transfection

1. Cultured human cells (see Note 5). 2. Cell culture medium: DMEM (Sigma-Aldrich) containing 10% fetal bovine serum (Gibco) and 1
penicillin-streptomycin solution (Gibco). 3. X-tremeGENE 9 (Roche). 4. Opti-MEM (Gibco).

30

Jun Ogata et al.

5. pcDNA3-human α-synuclein: 1 mg/ml in Tris–EDTA buffer, pH 8.0 (see Note 6). 6. α-Synuclein fibrils (see Note 7). 2.4 Biochemical Fractionation of α-Synuclein

1. PBS. 2. A68 buffer: 10 mM Tris–HCl, pH 7.4, 0.8 M NaCl, 1 mM EGTA, 5 mM EDTA, 10% sucrose. 3. Triton-X100/A68 buffer: A68 buffer containing 1% TritonX100. 4. Sarkosyl/A68 buffer: A68 buffer containing 1% sarkosyl. 5. 3
Sodium dodecyl sulfate (SDS) sample buffer: 188 mM TrisCl, pH 6.8, 6% (w/v) SDS, 30% glycerol, 0.03% bromophenol blue, 150 mM DTT. Add 1 M DTT stock just before use. 6. High-powered sonicator (Taitec, VP-050 N, see Note 2). 7. Microultracentrifuge (Himac, CS150GXL).

2.5 Western Blot Analysis

1. SDS-PAGE system: A 12.5% gel is appropriate to separate α-synuclein. 2. Polyvinylidene difluoride (PVDF) membranes were used for western blots (Millipore). 3. Methanol. 4. Transfer buffer: 48 mM Tris, 39 mM glycine, 20% methanol, 1.3 mM (0.0375%) SDS. 5. Paraformaldehyde/PBS: 4% paraformaldehyde in PBS. Prepare just before use. 6. TBS-T: 50 mM Tris–HCl, pH 7.6, 150 mM NaCl, 0.05% Tween 20. 7. Blocking solution: TBS-T containing 5% bovine serum albumin (BSA). 8. Anti-phospho-Ser129 α-synuclein (Abcam, EP1536Y). 9. Anti-α-synuclein (BD Biosciences, 42/α-Synuclein). 10. Secondary antibody and detection solution (see Note 8).

3

Methods

3.1 α-Synuclein Purification from Bacteria

1. Transform a 20 μl aliquot of BL21(DE3) with 80 ng pRK172human α-synuclein following standard procedures. 2. Streak bacteria on LB agar plates (see Note 9). 3. Collect all colonies of BL21 harboring α-synuclein from the LB plate by pipetting with 5 ml of LB medium containing 50 μg/ ml ampicillin.

α-Synuclein Seeding Assay Using Cultured Cells

31

4. Add the bacterial suspension from step 3 to a 2 l shake flask with baffles containing 500 ml LB medium and 50 μg/ml ampicillin. The OD600 of the resultant culture will be approximately 0.2 (see Note 10). 5. Shake the LB culture at 200 rpm at 37  C for 3.5 h. 6. Add 1 ml of 0.1 M IPTG stock. 7. Shake the LB culture for 4 h more. 8. Harvest bacteria at 6000
g for 10 min at 4  C in a largecapacity refrigerated centrifuge. 9. Completely remove the supernatant. 10. Store the centrifuge tube containing bacterial pellet at 80  C (see Note 11). 11. Add 10 ml ice-cold α-synuclein purification buffer to the bacterial pellet and completely resuspend the pellet on ice. 12. Transfer the bacterial suspension to a 50-ml centrifuge tube. 13. Sonicate the suspension on ice until the solution is clear (see Note 2). 14. Centrifuge the sonicated suspension at 20,000
g for 10 min at 4  C in a refrigerated centrifuge. 15. Transfer the supernatant after centrifugation in step 14 to a new 50-ml centrifuge tube, and add 2-mercaptoethanol to a final concentration of 1%. 16. Incubate the tube in boiling water for 5 min (see Note 12). 17. Centrifuge the boiled tube at 20,000
g for 15 min at 4  C, and transfer the supernatant to a new 50-ml centrifuge tube. 18. During centrifugation in step 17, step up the Q Sepharose column (see Note 13). 19. Pour the supernatant into the Q Sepharose column. 20. Wash the Q Sepharose with 30 ml (>10 bead volume of beads) of α-synuclein purification buffer. 21. Wash the Q Sepharose with 9 ml (3 bead volume of beads) of α-synuclein wash buffer. 22. Elute α-synuclein bound to the Q Sepharose with 9 ml (3 bead volume of beads) of α-synuclein elution buffer. 23. Add 2.82 g ammonium sulfate to the elution fraction on ice to precipitate α-synuclein (see Note 14). 24. Centrifuge the elution fraction from step 23 at 20,000
g for 15 min at 4  C. 25. Aspirate the supernatant.

32

Jun Ogata et al.

Fig. 1 Recombinant α-synuclein purified from bacteria. Dialyzed α-synuclein (16.4 mg/ml) was serially diluted at 1–16 dilutions and analyzed by SDS-PAGE/ CBB. An arrowhead indicates α-synuclein

26. Resuspend the α-synuclein pellet in 1–2 ml dialysate, and transfer the suspension to dialysis tubing prehydrated in distilled water. 27. Dialyze the α-synuclein suspension against 1000 ml dialysate at 4  C for 1–2 h. Stir the dialysate gently with a stirrer. 28. Exchange the dialysate for another 1000 ml dialysate and dialyze the α-synuclein solution at 4  C overnight. 29. Centrifuge the α-synuclein solution at 100,000
g for 20 min at 4  C to remove the precipitate. 30. Collect the supernatant as purified α-synuclein (see Note 15). 31. Check the purity and concentration of α-synuclein by SDS-PAGE/CBB staining and the BCA assay kit, respectively (Fig. 1). 3.2 α-Synuclein Seed Preparation

1. Add the NaN3 solution to 300 μl purified recombinant α-synuclein protein (4–10 mg/ml in dialysate) in a 1.5-ml safe-lock microcentrifuge tube to a final concentration of 0.01%. 2. Shake the α-synuclein solution for 1–7 days at 37  C in a 1.5 ml incubator shaker at 200 rpm (Fig. 2a, see Note 16). 3. Ultracentrifuge the α-synuclein solution at 100,000
g for 20 min at 4  C. 4. Remove the supernatant, and collect the α-synuclein fibrils (Fig. 2b, c). 5. Resuspend the fibrils in 200–300 μl of 0.01% NaN3/PBS.

α-Synuclein Seeding Assay Using Cultured Cells

33

Fig. 2 α-Synuclein fibrils. (a) The appearance of homogenous gelled liquid (white arrowhead) and cloudy white materials (orange arrowhead) after 7 days of incubation at 37  C. The latter contains poorly formed fibrils (see e). (b) The appearance of fibrils formed (a, white arrowhead) just after ultracentrifugation. (c) Precipitates of gelled fibrils (white arrowhead) and supernatant (orange arrowhead) after ultracentrifugation. (d) The morphology of fibrils from highly viscous clear solution (a, white arrowhead) observed by electron microscopy. (e) The morphology of fibrils from solution with white amorphous insoluble matter (a, orange arrowhead). (f) Fragmented fibrils after sonication. The fibril length is approximately 50 nm, which is appropriate for the propagation assay. Scale bars ¼ 100 nm

6. Sonicate the fibrils on ice using a Taitec high-powered sonicator at a setting of pulse width modulation (PWM) 15–20% for 5 min to obtain α-synuclein fibrils approximately 50 nm in length (Fig. 2d–f, see Note 4). 7. Ultracentrifuge the sonicated solution at 100,000
g for 20 min at 4 C. 8. Resuspend the sonicated fibrils in an optimal buffer (e.g. PBS). 9. Determine the protein concentration using the BCA assay kit. 10. Save the α-synuclein fibrils as seeds at room temperature (see Note 17). 3.3 Introduction of α-Synuclein Seeds into Cultured Cells

1. Plate SH-SY5Y cells (or other cell lines) suspended in the cell culture medium at 60–70% confluence in a six-well plate and culture at 37  C in a humidified atmosphere containing 5% CO2 for 12–16 h to reach 80–90% confluence. 2. Dilute 1 μg plasmid DNA (pcDNA3-α-synuclein) in 100 μl Opti-MEM in a 1.5-ml tube, and add 3 μl X-tremeGENE 9. Mix the solution well, and incubate for 15 min at room

34

Jun Ogata et al.

temperature to allow DNA-X-tremeGENE 9 complex formation. 3. Add the solution containing the DNA-X-tremeGENE 9 complex dropwise to the cells. 4. Add 2.5 μg α-synuclein seeds from Subheading 3.2 diluted in 100 μl Opti-MEM to SH-SY5Y cells. 5. Incubate the cells for 1 day. 6. Replace the cell culture medium with fresh medium, and incubate the cells for an additional 2 days. 3.4 Sequential Extraction of α-Synuclein from Cultured Cells

1. Remove the cell culture medium from the α-synuclein seedinfected cells from Subheading 3.3. 2. Wash cells with 2 ml PBS. 3. Add 1 ml PBS and harvest cells with gentle pipetting. 4. Centrifuge the cell suspension at 16,900
g for 10 min at 4  C, and remove the supernatant. 5. Resuspend the cell pellet in 150 μl A68 buffer. Sonicate the cell suspension on ice at PWM 25% for 1 min (see Note 18). 6. Ultracentrifuge the suspension at 100,000
g for 20 min. 7. Transfer the supernatant to a new 1.5-ml microcentrifuge tube. 8. Add 40 μl supernatant to a new 1.5-ml microcentrifuge tube containing 20 μl 3
SDS sample buffer (this sample is the A68 buffer-soluble fraction). Estimate the protein concentration of the A68 buffer-soluble fraction using the remaining supernatant from step 7. 9. Wash the pellets from step 7 with 500 μl A68 buffer and subsequently ultracentrifuge at 100,000
g for 10 min. 10. Resuspend the A68 buffer-insoluble pellets in 100 μl TritonX100/A68 buffer. 11. Sonicate the suspension at PWM 25% for 40 s at room temperature (see Note 18). 12. Ultracentrifuge the suspension at 100,000
g for 20 min. 13. Collect the supernatant as the Triton X-100-soluble fraction (see Note 19). 14. Wash the pellets in 500 μl Triton X-100/A68 buffer and subsequently ultracentrifuge at 100,000
g for 10 min. 15. Resuspend the pellets in 100 μl Sarkosyl/A68 buffer. 16. Sonicate the suspension at PWM 25% for 40 s at room temperature (see Note 18). 17. Ultracentrifuge the suspension at 100,000
g for 20 min. 18. Collect the supernatant as the sarkosyl-soluble fraction (see Note 19).

α-Synuclein Seeding Assay Using Cultured Cells

35

19. Wash the pellets with 500 μl Sarkosyl/A68 buffer and subsequently ultracentrifuge at 100,000
g for 10 min. 20. Dissolve the pellets in 50 μl of 3
SDS sample buffer. 21. Sonicate the suspension at PWM 25% for 10 s three times at room temperature (this sample is the sarkosyl-insoluble fraction). 22. Boil each sample at 100  C for 5 min. 3.5 Western Blot to Monitor α-Synuclein Inclusion Formation

1. Apply each fraction prepared from Subheading 3.4 on a 12.5% SDS-PAGE gel. Two micrograms of protein per lane is appropriate for a standard 12-well gel. 2. After SDS-PAGE, transfer the separated proteins from the SDS-PAGE gel onto a PVDF membrane prehydrated with 100% methanol and subsequent transfer buffer. 3. Incubate the PVDF membrane in 25 ml paraformaldehyde/ PBS at room temperature for 30 min (see Note 20). 4. Incubate the membrane in 25 ml blocking solution for 1 h at room temperature. 5. Dilute anti-phospho-Ser129 α-synuclein (at 1:2000 dilution) and/or anti-α-synuclein (at 1:3000 dilution) as primary antibodies with 5 ml blocking solution. 6. Incubate the membrane with 5 ml primary antibody solution overnight at 4  C. 7. Wash the membrane three times for 10 min each with 25 ml of TBS-T. 8. Incubate the membrane with horseradish peroxidase (HRP)conjugated secondary antibody at RT for 1 h. 9. Wash the membrane three times for 10 min each with 25 ml of TBS-T. 10. Incubate the membrane with a chemiluminescence reagent to detect bands for α-synuclein (Fig. 3).

4

Notes 1. We used a modified α-synuclein gene (α-synuclein Y136-TAT), in which the codon for Tyr136 is modified from TAC to TAT to avoid mistranslation to a Cys residue instead of a Tyr in bacteria [16]. 2. We used a probe-type sonicator (Taitec, VP-050N) under an operating condition of 1 min at PWM 50% on ice. The sonication conditions on different equipment should be determined by the experimenters. 3. This tube should be ultracentrifuge-resistant.

36

Jun Ogata et al.

Fig. 3 Formation of sarkosyl-insoluble α-synuclein in cultured cells. (a) SH-SY5Y cells were transfected with α-synuclein plasmid or pcDNA3 as a mock plasmid and infected with 2.5 μg α-synuclein fibrils in Opti-MEM (+) or Opti-MEM alone (). Phospho-Ser219 α-synuclein and total α-synuclein were detected by western blot. (b) A549 cells were transfected as in (a) and infected with 2.5 μg α-synuclein fibrils or 2.5 μg α-synuclein monomer. A68, A68-soluble fraction; TX, Triton X-100-soluble fraction; Sar, sarkosyl-soluble fraction; Ppt, sarkosyl-insoluble fraction

4. The sonication processes can be performed using a probe-type ultrasonic homogenizer or an ultrasonic bath. The optimized setting of the sonicator to obtain ~50 nm α-synuclein fibrils should be determined by the experimenters. 5. We successfully performed this protocol using SH-SY5Y cells, A549 cells, and HeLa cells. 6. Unmodified α-synuclein gene. 7. Fibrils as seeds prepared in Subheadings 2.2 and 3.2. 8. Any detection protocols for western blot can be used. We routinely used horseradish peroxidase-conjugated secondary antibodies and ECL solution (GE Healthcare). 9. Preparation of bacterial glycerol stocks can omit the transformation step. 10. Alternatively, you can prepare 500 ml bacterial suspension with OD600 0.2 by dilution of an overnight bacterial preculture. We do not recommend adopting this protocol for high-yield protein production conditions (e.g. changing culture medium or culture flasks). Under such conditions, α-Synuclein could form insoluble aggregates in bacterial cells.

α-Synuclein Seeding Assay Using Cultured Cells

37

11. You can stop the procedure in this step. 12. The solution will become cloudy because most of the proteins precipitate. α-Synuclein is heat-stable and still soluble under boiling conditions. 13. For Q Sepharose column setting, pour 6 ml Q Sepharose (50% slurry in 20% EtOH) into Econo-Pac Columns. Wash the Q Sepharose with 30 ml (>10 bead volume of beads) of α-synuclein purification buffer. Check whether the water droplet flow is approximately 2 drops/s. Now the column (approximately 3 ml bed volume) is ready. 14. Add ammonium sulfate bit by bit and immediately mix by a vortex mixer to avoid unwanted precipitation. 15. Aliquot the dialyzed α-synuclein as monomer at 80  C. Do not repeat freeze-thaw cycles, which cause fibril formation. 16. Before ultracentrifugation, check the viscosity and transparency of fibrils. Well-developed fibrils appear in highly viscous clear solution, whereas poorly developed fibrils appear in viscous liquid with white amorphous insoluble matter (Fig. 2a). Because these two kinds of solutions appear using the same batch of recombinant α-synuclein, we recommend setting up multiple test tubes for fibril production. The viscosity increases by 4 days when fibrils develop successfully. 17. For long-term storage, aliquots of the fibrils were stored at 80  C until use. Seeding ability may be lost during the freezethaw process. Do not store at 4  C. 18. We used a probe-type sonicator (Taitec, VP-050N). The sonication conditions of different equipment should be determined by the experimenters. 19. Place 40 μl Triton X-100-soluble and sarkosyl-soluble fractions into new 1.5-ml microcentrifuge tubes containing 20 μl 3
SDS sample buffer for western blot samples, and estimate the protein concentration of these fractions using the remaining supernatants in the same way as the A68 buffer-soluble fraction. 20. α-Synuclein monomers tend to detach from blotted membranes. Fixation of blotted membranes with paraformaldehyde/PBS improves α-synuclein signals [17].

Acknowledgments We thank Drs. Masato Hasegawa and Takashi Nonaka (Tokyo Metropolitan Institute of Medical Science) for providing materials and advice for this protocol. This work was supported by Grants-in-

38

Jun Ogata et al.

Aid for Scientific Research (20H03453 and 20K21531 to Y.I.) from the Japan Society for the Promotion of Science (JSPS). Jun Ogata and Daisaku Takemoto contributed equally to this chapter. References 1. Kalia LV, Lang AE (2015) Parkinson’s disease. Lancet 386(9996):896–912. https://doi.org/ 10.1016/s0140-6736(14)61393-3 2. Galvin JE, Lee VM, Trojanowski JQ (2001) Synucleinopathies: clinical and pathological implications. Arch Neurol 58(2):186–190. https://doi.org/10.1001/archneur.58.2.186 3. Fujiwara H, Hasegawa M, Dohmae N, Kawashima A, Masliah E, Goldberg MS, Shen J, Takio K, Iwatsubo T (2002) AlphaSynuclein is phosphorylated in synucleinopathy lesions. Nat Cell Biol 4(2):160–164. https:// doi.org/10.1038/ncb748 4. Shahmoradian SH, Lewis AJ, Genoud C, Hench J, Moors TE, Navarro PP, CastanoDiez D, Schweighauser G, Graff-Meyer A, Goldie KN, Sutterlin R, Huisman E, Ingrassia A, Gier Y, Rozemuller AJM, Wang J, Paepe A, Erny J, Staempfli A, Hoernschemeyer J, Grosseruschkamp F, Niedieker D, El-Mashtoly SF, Quadri M, Van IWFJ, Bonifati V, Gerwert K, Bohrmann B, Frank S, Britschgi M, Stahlberg H, Van de Berg WDJ, Lauer ME (2019) Lewy pathology in Parkinson’s disease consists of crowded organelles and lipid membranes. Nat Neurosci 22(7):1099–1109. https://doi.org/10.1038/ s41593-019-0423-2 5. Mahul-Mellier AL, Burtscher J, Maharjan N, Weerens L, Croisier M, Kuttler F, Leleu M, Knott GW, Lashuel HA (2020) The process of Lewy body formation, rather than simply alpha-synuclein fibrillization, is one of the major drivers of neurodegeneration. Proc Natl Acad Sci U S A 117(9):4971–4982. https:// doi.org/10.1073/pnas.1913904117 6. Braak H, Ghebremedhin E, Rub U, Bratzke H, Del Tredici K (2004) Stages in the development of Parkinson’s disease-related pathology. Cell Tissue Res 318(1):121–134. https://doi. org/10.1007/s00441-004-0956-9 7. Sengoku R, Saito Y, Ikemura M, Hatsuta H, Sakiyama Y, Kanemaru K, Arai T, Sawabe M, Tanaka N, Mochizuki H, Inoue K, Murayama S (2008) Incidence and extent of Lewy bodyrelated alpha-synucleinopathy in aging human olfactory bulb. J Neuropathol Exp Neurol 67 (11):1072–1083. https://doi.org/10.1097/ NEN.0b013e31818b4126

8. Luk KC, Song C, O’Brien P, Stieber A, Branch JR, Brunden KR, Trojanowski JQ, Lee VM (2009) Exogenous alpha-synuclein fibrils seed the formation of Lewy body-like intracellular inclusions in cultured cells. Proc Natl Acad Sci U S A 106(47):20051–20056. https://doi. org/10.1073/pnas.0908005106 9. Nonaka T, Watanabe ST, Iwatsubo T, Hasegawa M (2010) Seeded aggregation and toxicity of α-synuclein and tau: cellular models of neurodegenerative diseases. J Biol Chem 285 (45):34885–34898. https://doi.org/10. 1074/jbc.M110.148460 10. Bousset L, Pieri L, Ruiz-Arlandis G, Gath J, Jensen PH, Habenstein B, Madiona K, Olieric V, Bockmann A, Meier BH, Melki R (2013) Structural and functional characterization of two alpha-synuclein strains. Nat Commun 4:2575. https://doi.org/10.1038/ ncomms3575 11. Peng C, Gathagan RJ, Covell DJ, Medellin C, Stieber A, Robinson JL, Zhang B, Pitkin RM, Olufemi MF, Luk KC, Trojanowski JQ, Lee VM (2018) Cellular milieu imparts distinct pathological alpha-synuclein strains in alphasynucleinopathies. Nature 557 (7706):558–563. https://doi.org/10.1038/ s41586-018-0104-4 12. Li B, Ge P, Murray KA, Sheth P, Zhang M, Nair G, Sawaya MR, Shin WS, Boyer DR, Ye S, Eisenberg DS, Zhou ZH, Jiang L (2018) Cryo-EM of full-length alpha-synuclein reveals fibril polymorphs with a common structural kernel. Nat Commun 9(1):3609. https://doi. org/10.1038/s41467-018-05971-2 13. Schweighauser M, Shi Y, Tarutani A, Kametani F, Murzin AG, Ghetti B, Matsubara T, Tomita T, Ando T, Hasegawa K, Murayama S, Yoshida M, Hasegawa M, Scheres SHW, Goedert M (2020) Structures of alpha-synuclein filaments from multiple system atrophy. Nature 585 (7825):464–469. https://doi.org/10.1038/ s41586-020-2317-6 14. Tarutani A, Arai T, Murayama S, Hisanaga SI, Hasegawa M (2018) Potent prion-like behaviors of pathogenic alpha-synuclein and evaluation of inactivation methods. Acta Neuropathol Commun 6(1):29. https://doi. org/10.1186/s40478-018-0532-2

α-Synuclein Seeding Assay Using Cultured Cells 15. Gao J, Perera G, Bhadbhade M, Halliday GM, Dzamko N (2019) Autophagy activation promotes clearance of alpha-synuclein inclusions in fibril-seeded human neural cells. J Biol Chem 294(39):14241–14256. https://doi. org/10.1074/jbc.RA119.008733 16. Masuda M, Dohmae N, Nonaka T, Oikawa T, Hisanaga S, Goedert M, Hasegawa M (2006)

39

Cysteine misincorporation in bacterially expressed human alpha-synuclein. FEBS Lett 580(7):1775–1779. https://doi.org/10. 1016/j.febslet.2006.02.032 17. Lee BR, Kamitani T (2011) Improved immunodetection of endogenous alpha-synuclein. PLoS One 6(8):e23939. https://doi.org/10. 1371/journal.pone.0023939

Chapter 4 Analysis of α-Synuclein in Exosomes Taiji Tsunemi, Yuta Ishiguro, Asako Yoroisaka, and Nobutaka Hattori Abstract Alpha synuclein (α-Syn), a presynaptic protein with unknown function, is accumulated in Lewy bodies/ neurites that are one of the hallmark pathologies of Parkinson’s disease (PD). Missense or multiplication mutations in SNCA, which codes α-Syn, result in a genetic form of PD, further indicating the involvement of α-Syn in PD pathogenesis. Recent pathological and experimental studies suggest that α-Syn possesses a secretory feature, as it is detected in the culture media, in the cerebrospinal fluid, and even in the blood. Secreted α-Syn can spread throughout the body and invade the CNS, disseminating the α-Syn associated pathology. Exosomes are small extracellular vesicles that carry many proteins, lipids, or miRNA. We and others have discovered α-Syn in exosomes and revealed that exosomes may regulate intracellular α-Syn levels by transporting outside the cells. In this chapter, we describe a protocol to measure α-Syn levels in exosomes. Key words α-Synuclein, Exosome, ELISA

1

Introduction Parkinson’s disease (PD) and related synucleinopathies that include dementia with Lewy bodies (DLB) and multiple system atrophy (MSA) are characterized by the accumulation of misfolded insoluble proteins mainly compose of alpha synuclein (α-Syn), Lewy bodies/neurites in PD and DLB, and glial cytoplasmic inclusions in MSA [1]. Both missense mutations and multiplication in the SNCA gene encoding α-Syn [2] and loss of function mutations in several genes encoding proteins in lysosomes where α-Syn is largely degraded [3], all result in Lewy body-associated PD, suggesting the deep involvement of α-Syn, especially in terms of its neuronal expression levels, in the development of PD. As Braak hypothesized, Lewy pathology propagates from peripheral tissues to the central nervous system (CNS) and then spreads within the CNS, which were supported by not all, but many pathological and experimental results, though the precise route for this spreading remains to be determined [4]. Initial studies

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_4, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

41

42

Taiji Tsunemi et al.

suggested that the transneuronal transfer is the main pathway from the pathological observations of α-Syn spreading to anatomically connected regions [5]. It was experimentally corroborated that the inoculated α-Syn preformed fibrils (PFFs) into the mouse striatum also primarily transferred to the anatomically connected areas [6]. However, though, about a half of PD cases do not follow the transneuronal connections and inoculated PFFs eventually spread a whole brain regardless of anatomical connections [4]. Furthermore, inoculated PFFs in guts or small intestines spread till nuclei of the vagus nerves in the medulla oblongata, but no further from it. These results indicate that the other, non-neuronal transfer, may exist, which is even necessary for the full development of PD pathology. One of the candidates for the indirect pathways include exosomes, small extracellular vesicles with a diameter of 50–100 nm, which are generated and released from the many types of cells [7]. Exosomes predictively function as a physiological communication tool between cells and organs by carrying multiple proteins, lipids, and micro-RNAs, while they also contribute to the progression of different sorts of disorders by spreading toxic materials, such as insoluble proteins that are found in neurons affected by many neurodegenerative disorders [7]. We [8] and others have discovered that exosomes contain α-Syn, and exosomal α-Syn secretion, at least partially, regulates intracellular α-Syn levels in the cells. Recent studies revealed that serum or central spinal fluid exosomal α-Syn in PD patients is different from normal individuals, indicating a potential diagnostic biomarker. In this chapter, we describe how to isolate exosomes from serum or cell culture media and then how to quantify α-Syn by using a highly sensitive ELISA.

2 2.1

Materials Cell Culture

1. Any type of cells, including primary cultures, cell lines, or iPS-derived cells. 2. Six-well cell culture plate or 10 cm cell culture dish. 3. Cell culture medium used for cells. 4. Exosome-free media: Centrifuge the culture media at 100,000
g for 16 h. Collect the supernatant.

2.2 Serum Preparation

1. Serum separator tubes.

2.3 Exosome Isolation

1. Tubes. 2. Tabletop centrifuge. 3. Ultracentrifuge.

Analysis of α-Synuclein in Exosomes

2.4 α-Synuclein ELISA

43

1. 96-well half-area high-binding ELISA plate (Corning). 2. Dulbecco’s phosphate-buffered saline (PBS). 3. Sodium dodecyl sulfate (SDS). 4. Capture antibody: syn42 mouse monoclonal antibody (BD Biosciences). 5. Recombinant human alpha synuclein (140 amino acids) (rPeptide). 6. Blocking buffer: 2% bovine serum albumin (BSA) in PBS. 7. PBS-T: 0.05% Tween-20 in PBS. 8. Detection antibody: primary anti-α-Syn rabbit polyclonal antibody (USBiological). 9. Anti-rabbit IgG, HRP-linked antibody. 10. TMB One (SurModics).

Component

HRP

Microwell

Substrate

11. Liquid Stop Solution for TMB Microwell Substrates (SurModics). 12. Plate mixer with temperature control. 13. Plate reader (Molecular Devices, SpectraMax iD5).

3

Methods

3.1 Preparation of Cell Culture Media

1. Change the media to the exosome-free media. 2. After 24 h, collect the culture media. Centrifuge the media at 300
g for 10 min. Collect the supernatant, and centrifuge it at 2000
g for 10 min. Collect the supernatant, and centrifuge it at 10,000
g for 30 min. Collect the supernatant.

3.2 Preparation of Serum

Collect 16 mL blood in serum separator tubes. Allow the blood to clot for at least 60 min. Separate serum by centrifuging at 1000
g for 5 min. Collect 4 mL serum above the clot and store at 80  C.

3.3 Exosome Isolation

Centrifuge the prepared media/serum at 100,000
g for 1 h. Aspirate the supernatant and wash the sediments with PBS of a quarter of original culture media/serum. Centrifuge the PBS at 100,000
g for 1 h. Aspirate the supernatant, resuspend the exosome pellets with PBS, and store at 80  C. From either 1 mL serum or 10 mL cell culture media, 100μL PBS is used for resuspension (see Note 1).

44

Taiji Tsunemi et al.

3.4 α-Synuclein ELISA

1. Prepare coating solution by diluting the capture antibody in PBS at the concentration of 5μg/mL (1:50). 2. A 96-well half-area high-binding ELISA plate is coated with 50μl coating solution per well overnight at 4  C. 3. Aspirate and wash with >100μL PBS three times per well. Following wash, invert and tap on absorbent paper to remove excess liquid. 4. The plate is blocked by adding 100μL blocking buffer per well for 1.0 h at room temperature. 5. For preparing standards, recombinant human alpha synuclein at 3 ng/mL is serially diluted threefold in blocking buffer, providing a standard curve ranging from 3000 pg/mL to 1.37 pg/mL (3000, 1000, 333, 111, 37, 12.3, 4.1, 1.4). 6. Prepare sample solution by diluting isolated exosomes in blocking buffer at the dilution of 1:50 (1:10–1:100). Add SDS to the final concentration of 0.02% (see Note 2). 7. The ELISA plate with 50μL standards and 50μL sample solution per well is incubated at 4  C overnight with shaking at 400 rpm. 8. Aspirate and wash with >100μL PBS-T three times per well. Following wash, invert and tap on absorbent paper to remove excess liquid. 9. Prepare detection antibody solution by diluting the detection antibody in 1% BSA/PBS-T at the concentration of 1:500. 10. Add 50μL detection antibody solution per well. Incubate at 4  C overnight with shaking at 400 rpm. 11. Aspirate and wash with >100μL PBS-T three times per well. Following wash, invert and tap on absorbent paper to remove excess liquid. 12. Prepare secondary antibody solution by diluting secondary anti-rabbit antibody in 1% BSA/PBS-T at the concentration of 1:1.000. 13. Add 50μl secondary antibody solution per well. Incubate at 4  C for 1 h with shaking at 400 rpm. 14. Aspirate and wash with >100μL PBS-T three times per well. Following wash, invert and tap on absorbent paper to remove excess liquid. 15. Add 50μL TMB One Component HRP Microwell Substrate to each well. 16. Add 50μL Liquid Stop Solution to each well. 17. Measure absorbance at 450 nm within 3 h after adding Liquid Stop Solution (Fig. 1).

Analysis of α-Synuclein in Exosomes

45

Fig. 1 Measurement of α-Synuclein concentration in exosomes. The values of the absorbance measured at 450 nm were plotted against the corresponding concentrations of α-Synuclein (n ¼ 3)

4

Notes 1. The amount of PBS for resuspension can be changed from 200 to 50μL, depending on the size of exosomal pellets. 2. The amount of SDS for exosomal permeabilization can be changed from 0.01% to 0.05%.

Acknowledgments This work was supported by Grants-in-Aid for Scientific Research (18K07510) to T.T. References 1. Spillantini MG, Goedert M (2000) The alphasynucleinopathies: Parkinson’s disease, dementia with Lewy bodies, and multiple system atrophy. Ann N Y Acad Sci 920:16–27 2. Nussbaum RL (2018) Genetics of synucleinopathies. Cold Spring Harb Perspect Med 8(6): a024109 3. Moors T et al (2016) Lysosomal dysfunction and alpha-synuclein aggregation in Parkinson’s disease: diagnostic links. Mov Disord 31 (6):791–801 4. Uchihara T, Giasson BI (2016) Propagation of alpha-synuclein pathology: hypotheses, discoveries, and yet unresolved questions from experimental and human brain studies. Acta Neuropathol 131(1):49–73

5. Hawkes CH, Del Tredici K, Braak H (2007) Parkinson’s disease: a dual-hit hypothesis. Neuropathol Appl Neurobiol 33(6):599–614 6. Luk KC et al (2012) Pathological alphasynuclein transmission initiates Parkinson-like neurodegeneration in nontransgenic mice. Science 338(6109):949–953 7. Janas AM et al (2016) Exosomes and other extracellular vesicles in neural cells and neurodegenerative diseases. Biochim Biophys Acta 1858 (6):1139–1151 8. Tsunemi T, Hamada K, Krainc D (2014) ATP13A2/PARK9 regulates secretion of exosomes and alpha-synuclein. J Neurosci 34 (46):15281–15287

Chapter 5 Measurement of GCase Activity in Cultured Cells Yuri Shojima, Jun Ogata, Taiji Tsunemi, Yuzuru Imai, and Nobutaka Hattori Abstract Glucocerebrosidase (GCase), which is encoded by the GBA1 gene, has lysosomal glycoside hydrolase activity that hydrolyzes glucosylceramide. Defects in GCase lead to the accumulation of glucosylceramide, which causes the development of the lysosomal storage disease known as Gaucher’s disease. Loss-offunction mutations in the GBA1 gene are the most important genetic risk factor for synucleinopathies, such as Parkinson’s disease and dementia with Lewy bodies. Recent studies on PD genes associated with lysosomal function suggest that GCase activity is decreased in cell models of PD and in neurons derived from PD patients. In this chapter, we describe a protocol to measure GCase activity in cultured cells. Key words Glucocerebrosidase, GBA1, Glucosylceramide, Lysosome, Synucleinopathies, Lysosomal storage disorder, Gaucher’s disease

1

Introduction The age-related neurodegenerative disorders, Parkinson’s disease (PD), and dementia with Lewy bodies are characterized by the accumulation of misfolded α-synuclein inclusions called Lewy bodies in the affected neurons. Mutations in [1, 2] and multiplication of [3–5] the SNCA gene encoding α-synuclein cause PD, suggesting that α-synuclein is a key risk factor in the etiology of PD. Studies using genes associated with PD and Lewy body pathology have revealed that some PD-associated genes are involved in vesicular transport and membrane dynamics, including Golgiendosomal trafficking and the autophagy-lysosomal pathway [6– 11]. These studies suggest that disturbances in lysosomal hydrolase and lipid trafficking affect α-synuclein turnover. Glucocerebrosidase (GCase) hydrolyzes glucosylceramide to produce ceramide. There are two known genes that encode

Yuri Shojima and Jun Ogata are contributed equally to this work. Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_5, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

47

48

Yuri Shojima et al.

GCase, lysosomal GBA1 and nonlysosomal GBA2 [12]. Clinical and genetic evidence has shown that GBA1 mutations are a risk factor for the development of PD [13–16]. Mutations in GBA1 are believed to cause loss of function of lysosomal GCase and accumulation of lipid substrate glucosylceramide. Cell culture studies suggest that α-synuclein aggregation reciprocally inhibits lysosomal GCase activity and trafficking, amplifying the pathogenic process [6, 17, 18]. However, how GBA1 mutations confer an elevated risk of α-synuclein aggregation is still under debate [19]. In this chapter, we describe a 96-well plate-based method to measure cellular GCase activity, which is based on the methods reported by Mazzulli et al. [6, 11, 17]. This protocol measures the kinetics of GCase activity for 90 min after starting the enzymatic reaction, with or without the selective GCase inhibitor, conduritol B epoxide [20]. Activation of the lysosomal TRP channel TRPML1 stimulates lysosomal exocytosis, leading to the release of lysosomal GCase [11]. Treatment of cells with the TRPML1 agonist MK6-83 reduces GCase activity in cells, which is described in this protocol.

2 2.1

Materials Cell Culture

1. SH-SY5Y cells or other cell lines. 2. 96-well cell culture plate. 3. Cell culture medium: DMEM containing 10% fetal bovine serum and 1
penicillin-streptomycin solution. 4. Dimethyl sulfoxide (DMSO). 5. 5-Methyl-N-[2-(1-piperidinyl)phenyl]-2-thiophenesulfonamide (MK6-83; Cayman chemical): Prepare 1 mM stock in DMSO. Store at 20  C.

2.2 Sample Preparation and GCase Assay

1. Dulbecco’s phosphate-buffered saline (PBS). 2. RIPA buffer: 50 mM Tris–HCl pH 8.0, 150 mM sodium chloride, 0.5% (w/v) sodium deoxycholate, 0.1% (w/v) sodium dodecyl sulfate, and 1% (w/v) NP-40 substitute. 3. GCase Assay buffer: 150 mM citrate-phosphate buffer pH 5.4, 0.25% taurocholic acid sodium salt hydrate, and 0.25% Triton X-100. Store at room temperature. 4. 4-Methylumbelliferyl β-D-glucopyranoside β-glucosidase substrate (4MUD; Sigma-Aldrich). Prepare 100 mM stock in DMSO. Store at 20  C. 5. Bovine serum albumin (BSA): 10% (w/v) in GCase Assay buffer. Store at 20  C. 6. Conduritol B epoxide (CBE): Prepare 25 mM stock by dissolving CBE at a concentration of 4.05 mg/mL in distilled water. Store at 20  C.

GCase Assay Using Cultured Cells

49

7. 96-well black plate. 8. Plate mixer. 9. Plate centrifuge. 10. Plate reader (Molecular Devices, SpectraMax iD5).

3 3.1

Methods Cell Culture

1. Trypsinize SH-SY5Y cells and dispense 80μL cell suspension per well at a cell density of 5
104 cells/well in a 96-well cell culture plate. 2. Incubate cells for 12 h. 3. Add MK6-83 (at a final concentration of 1μM, see Note 1) or DMSO to the wells, and incubate at 37  C for 1 h.

3.2 Sample Preparation and GCase Assay

1. Discard the cell culture medium from the 96-well culture plate, and wash the cells with 200μL PBS (see Note 2). 2. Add 50μL RIPA buffer per well on ice for 30 min, and shake the 96-well cell culture plate on a plate mixer for 1 min to completely extract cells. 3. Dilute 100 mM 4MUD stock to 2.5 mM in GCase assay buffer. 4. Prepare the requisite amount of reaction master mix with the following composition. Reaction master mix with CBE: GCase assay buffer

7.6μL

10% BSA

6μL

Final 1%

2.5 mM 4MUD

24μL

Final 1 mM

25 mM CBE

2.4μL

Final 1 mM

Total

40μL

Reaction master mix without CBE: GCase assay buffer

7.6μL

10% BSA

6μL

Final 1%

2.5 mM 4MUD

24μL

Final 1 mM

Distilled water

2.4μL

Total

40μL

5. Dispense 40μL reaction master mix per well to the 96-well black plate on ice. 6. Apply 20μL lysate per well to the 96-well black plate on ice.

50

Yuri Shojima et al.

Fig. 1 Measurement of GCase activities. (a) Fluorescence intensities (means  SEM) measured every 2 min for 100 min are plotted (n ¼ 3). (b) GCase activities (means  SEM) were calculated as differences between samples with and without CBE. (c) GCase activities at 90 min (means  SEM) are plotted as a bar graph

7. Centrifuge the 96-well black plate at 800
g for 1 min at room temperature using a plate centrifuge, and incubate the plate at 37  C for 1 min (see Note 3). 8. Measure fluorescence intensity every 2 min with 30 s shaking between the measurements using SpectraMax iD5 (wavelength: 355/460 nm, measurement mode: FL [fluorescence], type: kinetic, detection integration: 1000 ms, PMT [photomultiplier tube]: high, read height: 1 mm). 9. Normalize each value to the value at 0 s (Fig. 1a). 10. Subtract values without CBE from values of the same samples with CBE. The resultant value is GCase activity (Fig. 1b). 11. Alternatively, graph the values at 90 min (Fig. 1c).

4

Notes 1. Dilute MK6-83 to 2μM (2
stock) in cell culture medium, and dispense 80μL 2
stock per well for MK6-83-treated samples. 2. Remove PBS completely, being careful not to aspirate the cells. 3. Keep in mind that the temperature of the whole plate should be uniform when starting the fluorescence measurement.

GCase Assay Using Cultured Cells

51

Acknowledgments This work was supported by Grants-in-Aid for Scientific Research (19K16929 to J.O.; 20H03453 and 20K21531 to Y.I.) from the Japan Society for the Promotion of Science (JSPS). Yuri Shojima and Jun Ogata contributed equally to this work. References 1. Kruger R, Kuhn W, Muller T, Woitalla D, Graeber M, Kosel S, Przuntek H, Epplen JT, Schols L, Riess O (1998) Ala30Pro mutation in the gene encoding alpha-synuclein in Parkinson’s disease. Nat Genet 18(2):106–108. https://doi.org/10.1038/ng0298-106 2. Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A, Pike B, Root H, Rubenstein J, Boyer R, Stenroos ES, Chandrasekharappa S, Athanassiadou A, Papapetropoulos T, Johnson WG, Lazzarini AM, Duvoisin RC, Di Iorio G, Golbe LI, Nussbaum RL (1997) Mutation in the alphasynuclein gene identified in families with Parkinson’s disease. Science 276 (5321):2045–2047. https://doi.org/10. 1126/science.276.5321.2045 3. Chartier-Harlin MC, Kachergus J, Roumier C, Mouroux V, Douay X, Lincoln S, Levecque C, Larvor L, Andrieux J, Hulihan M, Waucquier N, Defebvre L, Amouyel P, Farrer M, Destee A (2004) Alpha-synuclein locus duplication as a cause of familial Parkinson’s disease. Lancet 364(9440):1167–1169. https://doi.org/10.1016/S0140-6736(04) 17103-1 4. Ibanez P, Bonnet AM, Debarges B, Lohmann E, Tison F, Pollak P, Agid Y, Durr A, Brice A, Genetic FPsD (2004) Causal relation between alpha-synuclein gene duplication and familial Parkinson’s disease. Lancet 364(9440):1169–1171. https://doi.org/10. 1016/S0140-6736(04)17104-3 5. Singleton AB, Farrer M, Johnson J, Singleton A, Hague S, Kachergus J, Hulihan M, Peuralinna T, Dutra A, Nussbaum R, Lincoln S, Crawley A, Hanson M, Maraganore D, Adler C, Cookson MR, Muenter M, Baptista M, Miller D, Blancato J, Hardy J, Gwinn-Hardy K (2003) Alpha-synuclein locus triplication causes Parkinson’s disease. Science 302(5646):841–841. https://doi.org/10.1126/science.1090278 6. Mazzulli JR, Xu YH, Sun Y, Knight AL, McLean PJ, Caldwell GA, Sidransky E, Grabowski GA, Krainc D (2011) Gaucher disease glucocerebrosidase and alpha-synuclein form a

bidirectional pathogenic loop in synucleinopathies. Cell 146(1):37–52. https://doi.org/10. 1016/j.cell.2011.06.001 7. MacLeod DA, Rhinn H, Kuwahara T, Zolin A, Di Paolo G, McCabe BD, Marder KS, Honig LS, Clark LN, Small SA, Abeliovich A (2013) RAB7L1 interacts with LRRK2 to modify intraneuronal protein sorting and Parkinson’s disease risk. Neuron 77(3):425–439. https:// doi.org/10.1016/j.neuron.2012.11.033 8. Inoshita T, Cui C, Hattori N, Imai Y (2018) Regulation of membrane dynamics by Parkinson’s disease-associated genes. J Genet 97 (3):715–725 9. Ramirez A, Heimbach A, Grundemann J, Stiller B, Hampshire D, Cid LP, Goebel I, Mubaidin AF, Wriekat AL, Roeper J, Al-Din A, Hillmer AM, Karsak M, Liss B, Woods CG, Behrens MI, Kubisch C (2006) Hereditary parkinsonism with dementia is caused by mutations in ATP13A2, encoding a lysosomal type 5 P-type ATPase. Nat Genet 38 (10):1184–1191. https://doi.org/10.1038/ ng1884 10. Oji Y, Hatano T, Ueno SI, Funayama M, Ishikawa KI, Okuzumi A, Noda S, Sato S, Satake W, Toda T, Li Y, Hino-Takai T, Kakuta S, Tsunemi T, Yoshino H, Nishioka K, Hattori T, Mizutani Y, Mutoh T, Yokochi F, Ichinose Y, Koh K, Shindo K, Takiyama Y, Hamaguchi T, Yamada M, Farrer MJ, Uchiyama Y, Akamatsu W, Wu YR, Matsuda J, Hattori N (2020) Variants in saposin D domain of prosaposin gene linked to Parkinson’s disease. Brain 143(4):1190–1205. https://doi. org/10.1093/brain/awaa064 11. Tsunemi T, Perez-Rosello T, Ishiguro Y, Yoroisaka A, Jeon S, Hamada K, Rammonhan M, Wong YC, Xie Z, Akamatsu W, Mazzulli JR, Surmeier DJ, Hattori N, Krainc D (2019) Increased lysosomal exocytosis induced by lysosomal ca(2+) channel agonists protects human dopaminergic neurons from alpha-Synuclein toxicity. J Neurosci 39(29):5760–5772. https://doi.org/10. 1523/JNEUROSCI.3085-18.2019

52

Yuri Shojima et al.

12. Boot RG, Verhoek M, Donker-Koopman W, Strijland A, van Marle J, Overkleeft HS, Wennekes T, Aerts JMFG (2007) Identification of the non-lysosomal glucosylceramidase as beta-glucosidase 2. J Biol Chem 282 (2):1305–1312. https://doi.org/10.1074/ jbc.M610544200 13. Neudorfer O, Giladi N, Elstein D, Abrahamov A, Turezkite T, Aghai E, Reches A, Bembi B, Zimran A (1996) Occurrence of Parkinson’s syndrome in type I Gaucher disease. QJM 89(9):691–694. https://doi.org/10.1093/qjmed/89.9.691 14. Sidransky E, Nalls MA, Aasly JO, AharonPeretz J, Annesi G, Barbosa ER, Bar-Shira A, Berg D, Bras J, Brice A, Chen CM, Clark LN, Condroyer C, De Marco EV, Durr A, Eblan MJ, Fahn S, Farrer MJ, Fung HC, Gan-Or Z, Gasser T, Gershoni-Baruch R, Giladi N, Griffith A, Gurevich T, Januario C, Kropp P, Lang AE, Lee-Chen GJ, Lesage S, Marder K, Mata IF, Mirelman A, Mitsui J, Mizuta I, Nicoletti G, Oliveira C, Ottman R, Orr-Urtreger A, Pereira LV, Quattrone A, Rogaeva E, Rolfs A, Rosenbaum H, Rozenberg R, Samii A, Samaddar T, Schulte C, Sharma M, Singleton A, Spitz M, Tan EK, Tayebi N, Toda T, Troiano AR, Tsuji S, Wittstock M, Wolfsberg TG, Wu YR, Zabetian CP, Zhao Y, Ziegler SG (2009) Multicenter analysis of glucocerebrosidase mutations in Parkinson’s disease. N Engl J Med 361(17):1651–1661. https://doi.org/10. 1056/NEJMoa0901281 15. Nalls MA, Duran R, Lopez G, KurzawaAkanbi M, McKeith IG, Chinnery PF, Morris CM, Theuns J, Crosiers D, Cras P, Engelborghs S, De Deyn PP, Van Broeckhoven C, Mann DM, Snowden J, Pickering-Brown S, Halliwell N, Davidson Y, Gibbons L, Harris J, Sheerin UM, Bras J, Hardy J, Clark L, Marder K, Honig LS, Berg D, Maetzler W, Brockmann K, Gasser T, Novellino F, Quattrone A, Annesi G, De Marco EV, Rogaeva E, Masellis M, Black SE, Bilbao JM, Foroud T, Ghetti B, Nichols WC,

Pankratz N, Halliday G, Lesage S, Klebe S, Durr A, Duyckaerts C, Brice A, Giasson BI, Trojanowski JQ, Hurtig HI, Tayebi N, Landazabal C, Knight MA, Keller M, Singleton AB, Wolfsberg TG, Sidransky E (2013) A multicenter study of glucocerebrosidase mutations in dementia with Lewy bodies. JAMA Neurol 70(6):727–735. https://doi.org/10.1001/ jamaneurol.2013.1925 16. Aflaki E, Westbroek W, Sidransky E (2017) The complicated relationship between Gaucher disease and Parkinsonism: insights from a rare disease. Neuron 93(4):737–746. https://doi. org/10.1016/j.neuron.2017.01.018 17. Mazzulli JR, Zunke F, Isacson O, Studer L, Krainc D (2016) Alpha-Synuclein-induced lysosomal dysfunction occurs through disruptions in protein trafficking in human midbrain synucleinopathy models. Proc Natl Acad Sci U S A 113(7):1931–1936. https://doi.org/10. 1073/pnas.1520335113 18. Ysselstein D, Nguyen M, Young TJ, Severino A, Schwake M, Merchant K, Krainc D (2019) LRRK2 kinase activity regulates lysosomal glucocerebrosidase in neurons derived from Parkinson’s disease patients. Nat Commun 10(1):5570. https://doi.org/10.1038/ s41467-019-13413-w 19. Henderson MX, Sedor S, McGeary I, Cornblath EJ, Peng C, Riddle DM, Li HL, Zhang B, Brown HJ, Olufemi MF, Bassett DS, Trojanowski JQ, Lee VMY (2020) Glucocerebrosidase activity modulates neuronal susceptibility to pathological alpha-Synuclein insult. Neuron 105(5):822–836. e827. https://doi.org/10.1016/j.neuron.2019.12. 004 20. Farfel-Becker T, Roney JC, Cheng XT, Li S, Cuddy SR, Sheng ZH (2019) Neuronal Somaderived degradative lysosomes are continuously delivered to distal axons to maintain local degradation capacity. Cell Rep 28(1):51–64. e54. https://doi.org/10.1016/j.celrep.2019.06. 013

Chapter 6 Detection of Substrate Phosphorylation of LRRK2 in Tissues and Cultured Cells Kyohei Ito, Lejia Xu, Genta Ito, and Taisuke Tomita Abstract Recent studies revealed that leucine-rich repeat kinase 2 (LRRK2) phosphorylates several Rab proteins under physiological conditions. Mutations linked with familial Parkinson’s disease cause an abnormal increase in the Rab phosphorylation, which has not been elucidated in an in vitro kinase assays where artificial peptide substrates are often used. Here, we provide protocols for detecting the LRRK2 activity in tissues and cultured cells using Rab phosphorylation as a readout. Key words Leucine-rich repeat kinase 2, Rab, Phosphorylation, Parkinson disease, Phos-tag

1

Introduction Parkinson disease (PD) is the second most common neurodegenerative disorder, pathologically characterized by selective degeneration of dopaminergic neurons in the substantia nigra [1]. Major clinical manifestations include motor symptoms such as tremor, bradykinesia, rigidity, and postural instability. Approximately 10% of PD consists of familial cases (familial PD; FPD), while most cases are sporadic. Leucine-rich repeat kinase 2 (LRRK2) was identified as a causative gene for FPD as well as a locus associated with an increased risk of developing sporadic PD [2–5]. Based on these genetic findings, it has been hypothesized that LRRK2 plays a critical role in the pathogenesis of PD. LRRK2 has a protein kinase activity physiologically phosphorylating several Rab proteins involved in the intracellular vesicle trafficking. Previous studies have suggested that eight pathogenic mutations linked to FPD (i.e., N1437H, R1441C/G/H/S, Y1699C, G2019S, and I2020T) abnormally enhance the kinase

Kyohei Ito, Lejia Xu, and Genta Ito contributed equally to this work. Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_6, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

53

54

Kyohei Ito et al.

activity of LRRK2, thereby increasing the levels of Rab phosphorylation in cells [6, 7]. Based on these results, it has been hypothesized that the overactivation of LRRK2 might underlie the PD pathology. Thus, biochemical assays that can semi-quantitatively detect the LRRK2 kinase activity in cultured cells or tissues become essential for the development of LRRK2-related PD therapies. Here we describe two methods that can be used for the detection of the cellular activity of LRRK2 where we use Rab10 phosphorylation as a readout. It has been shown that LRRK2 phosphorylates Rab10 at Thr73 under physiological conditions. Furthermore, treatment with LRRK2-specific inhibitors completely diminishes the Rab10 phosphorylation in vivo as well as in cultured cells. Thus, the phosphorylation level of Rab10 at Thr73 is an optimum indicator of the cellular LRRK2 kinase activity. In the present protocol, we describe a simple immunoblotting protocol using a phospho-Rab10 Thr73-specific antibody. We also employ the Phos-tag assay to detect the phosphorylation of LRRK2 substrates. The Phos-tag assay utilizes Phos-tag SDS–PAGE, a modified version of SDS–PAGE, where phosphorylated proteins can be distinguished from non-phosphorylated ones based on the mobility shift. When Phos-tag acrylamide is co-polymerized in SDS–PAGE gels together with divalent metal ions (e.g., Mn2+), Phos-tag-metal ion complexes strongly interacts with phosphate groups in phosphorylated proteins during electrophoresis, thereby selectively retarding the apparent mobility of the phosphorylated proteins. The Phos-tag assay has some advantages over the simple immunoblotting: (1) the Phos-tag assay can be employed without having phospho-specific antibodies, and (2) the ratio of a phosphorylated protein to its non-phosphorylated version can be examined.

2

Materials All solutions should be prepared using double-deionized water. Store all reagents at room temperature unless indicated otherwise. Reagents with asterisks are only for running Phos-tag gels.

2.1 Tissue Preparation and Cell Lysis

1. Dulbecco’s phosphate-buffered saline (DPBS): 137 mM NaCl, 2.7 mM KCl, 8.04 mM Na2HPO4, 1.47 mM KH2PO4 (pH 7.4). Sterilize by autoclave or filtration through 0.22μm filter. 2. Cell scrapers. 3. Cell lysis buffer: 50 mM Tris–HCl pH 7.5, 1 mM EGTA, 50 mM NaF, 10 mM β-glycerophosphate, 5 mM sodium pyrophosphate, 270 mM sucrose, 1%(v/v) Triton X-100, 1 mM

Detection of Cellular Substrate Phosphorylation by LRRK2

55

sodium orthovanadate, 0.1μg/mL microcystin-LR, cOmplete™ protease inhibitor cocktail EDTA-free. The prepared solution can be aliquoted and stored at
80  C for a short period of time. 4. Bradford assay reagent. 5. 2 mg/mL bovine serum albumin. 6. (*) 1 M MnCl2 solution: 1 M manganese chloride in water. 7. SDS–PAGE sample buffer (4): 250 mM Tris–HCl pH 6.8, 8%(w/v) SDS, 40%(v/v) glycerol, 0.02%(w/v) bromophenol Blue, 4%(v/v) β-mercaptoethanol. β-Mercaptoethanol should be added just before use. 2.2 SDS–PAGE Electrophoresis

1. SDS–PAGE tanks. 2. Gel plates and 1-mm silicon spacers. 3. Stacking gel buffer: 0.5 M Tris–HCl pH 6.8. 4. Separation gel buffer: 1.5 M Tris–HCl pH 8.8. 5. 40%(w/v) acrylamide solution: 40%(w/v) acrylamide/bis mixed solution (mono:bis ¼ 29:1): Store at 4  C. Protect from light. 6. 10%(w/v) SDS solution: 10%(w/v) sodium dodecyl sulfate (SDS) dissolved in water. 7. N,N,N,N0 -Tetramethyl-ethylenediamine (TEMED): Store at 4  C. 8. 10%(w/v) APS solution: 10%(w/v) ammonium persulfate (APS) dissolved in water. Store desiccated at room temperature. 9. 100% isopropanol. 10. Running buffer: 25 mM Tris, 192 mM glycine, 0.1% (w/v) SDS. 11. Molecular weight markers. 12. (*) 100 mM MnCl2 solution: 100 mM manganese chloride in water. 13. (*) 5 mM Phos-tag® acrylamide (WAKO): dissolve 10 mg of solid Phos-tag acrylamide completely with 100μL methanol and bring to 3.3 mL by adding water. Store at 4  C. Protect from light.

2.3

Immunoblotting

1. Transfer tanks, cassettes, sponges. 2. Transfer buffer: 48 mM Tris, 39 mM glycine, 20%(v/v) methanol. 3. Gel wash buffer 1: Transfer buffer containing 10 mM EDTA and 0.05%(w/v) SDS.

56

Kyohei Ito et al.

4. Gel wash buffer 2: Transfer buffer containing 0.05% (w/v) SDS. 5. Filter paper. 6. 0.45μm nitrocellulose membrane. 7. Ponceau S solution: dissolve final 0.1%(w/v) Ponceau S powder in 5%(v/v) acetic acid. Protect from light. 8. Tris-buffered saline (TBS): 50 mM Tris, 150 mM sodium chloride. Adjust pH to 7.5 with HCl. 9. TBS-Tween (TBST): 0.1%(v/v) Tween-20 in TBS. 10. Blocking buffer: 5%(v/v) skim milk in TBST. Store at 4  C. 11. Anti-phospho-Rab10 antibody (Abcam, ab230261). 12. Anti-Rab10 antibody (Cell Signaling Technology, #8127). 13. Secondary antibodies conjugated with horseradish peroxidase. 14. Enhanced chemiluminescence (ECL) reagents and an imaging equipment for detecting ECL.

3

Methods All buffers used in this section should be kept at 4  C or on ice unless specified otherwise, and all procedures in this section should be carried out at 4  C or on ice unless specified otherwise.

3.1 Sample Preparation: Cultured Cells

1. Place the culture plates/dishes on ice at 80% confluence and aspirate and discard the culture media (see Notes 1 and 2). 2. Wash the cells once with DPBS. Add an ice-cold cell lysis buffer to the cells. Use 100–200μL for a well of six-well plates and 500–1000μL for a 10 cm dish. 3. Scrape and collect the lysates into 1.5-mL tubes placed on ice.

3.2 Sample Preparation: Rodent Tissues

1. For preparing lysates of rodent tissues, euthanize animals and dissect tissues in accordance with animal welfare legislation, and snap freeze the tissues in liquid nitrogen (see Note 3). Store the tissues at
80  C until use. Alternatively, the frozen tissues can be powdered and stored in several aliquots at
80  C. 2. Put the frozen tissue in a 15-mL conical tube placed on ice and add 2–4 mL of cell lysis buffer. 3. Homogenize the tissue using a mechanical homogenizer while holding the tube in iced water to avoid overheating of the homogenate. Two 10 s homogenization with a 30 s interval should be sufficient.

Detection of Cellular Substrate Phosphorylation by LRRK2

57

4. Aliquot the homogenates into 1.5 mL tubes placed on ice for centrifugation. 3.3 Sample Preparation for SDS– PAGE

1. Centrifugate the tubes at 20,000  g for 10 min for cell lysates and 30 min for tissue homogenates to remove insoluble materials. 2. Transfer the cleared lysates to new 1.5 mL tubes placed on ice, which can be snap-frozen in liquid nitrogen and stored at
80  C. 3. Determine the protein concentration of the cleared lysates by conventional methods (e.g., Bradford assay) using serially diluted BSA as standards. 4. Adjust the protein concentration using the SDS–PAGE sample buffer (4) and cell lysis buffer to prepare SDS–PAGE samples containing 2 mg/mL protein (see Note 4). Heat the samples to 95–100  C for 5 min. 5. For Phos-tag assays, add 1/100 vol of 1 M MnCl2 solution (final concentration: 10 mM) to the samples. The samples can be stored at
20  C until use (see Note 5). 6. Defrost samples before running gels at room temperature, and vortex and centrifuge them at maximum speed for 1 min at room temperature.

3.4

Casting Gels

To detect the phosphorylation of Rab10 using a phospho-Rab10 Thr73-specific antibody, use a 12.5% acrylamide gel. In the case of Phos-tag SDS–PAGE, use a 10% acrylamide gel containing Phostag acrylamide and MnCl2. 1. Assemble glass plates for SDS–PAGE with a 1-mm silicon spacer. 2. For normal SDS–PAGE, prepare a 12.5% separation gel solution by mixing 2.11 mL of water, 1.56 mL of 40%(w/v) acrylamide solution, 1.25 mL of separation gel buffer, and 50μL of 10%(w/v) SDS solution. 3. In the case of Phos-tag SDS–PAGE, prepare a Phos-tag separation gel solution by mixing 2.42 mL of water, 1.25 mL of 40% (w/v) acrylamide solution, 1.25 mL of separation gel buffer, 50μL of 10%(w/v) SDS solution, 5μL of 100 mM MnCl2 solution, and 50μL of 5 mM Phos-tag acrylamide (see Note 6). 4. Mix 7.5μL of TEMED and 25μL of 10%(w/v) APS solution in the separation gel solution to start polymerization. Pour the mixture to the assembled plates and overlay with 100% isopropanol to flatten the gel-top. 5. Prepare a stacking gel solution by mixing 1.89 mL of water, 0.3 mL of 40%(w/v) acrylamide solution, 0.75 mL of stacking gel buffer and 30μL of 10%(w/v) SDS solution.

58

Kyohei Ito et al.

6. Remove the isopropanol and rinse the gel-top with water three times. Mix 7.5μL of TEMED and 25μL of 10%(w/v) APS solution in the stacking gel solution to start polymerization. Pour the mixture to the top of the separation gel and insert a comb. Polymerization will take about 15 min. 3.5 Running Gels and Electrotransfer to Membranes

1. Place the casted gel in an SDS–PAGE tank and pour the running buffer to the top and bottom chambers. 2. Wash all wells and the underneath of the gel with the running buffer using a needle attached to a syringe to remove gel debris and air bubbles. 3. In the case of Phos-tag SDS–PAGE, centrifuge the samples in 20,000  g for 1 min at room temperature to remove manganese precipitates. 4. Load 30μg protein (i.e., 15μL of 2 mg/mL samples) of each sample side-by-side with an appropriate amount of molecular weight markers (MWM) (see Note 7). 5. Run gels at 50–70 V (constant voltage) for 30 min for stacking the samples. 6. Change the voltage to 120–150 V (constant voltage) and run until the dye front reaches the bottom of gels (i.e., 45–60 min for normal gels; 60–90 min for Phos-tag gels). 7. In the case of Phos-tag SDS–PAGE, to inactivate Phos-tagMn2+ complexes, thereby allowing phosphorylated proteins to dissociate from gels, wash gels in gel wash buffer 1 for 10 min 3 times at room temperature. Then, wash one more time with gel wash buffer 2 for another 10 min. 8. Place a gel on a piece of filter paper, then cover the gel with a piece of nitrocellulose membrane. Place another piece of filter paper on top of the membrane. 9. Remove air bubbles existing between the gel and membrane. 10. Put the filter paper-gel-membrane-filter paper sandwich into a transfer cassette with sponges on both sides, and put them into a transfer tank filled with the transfer buffer. 11. Transfer at 90 V (constant voltage) for 90 min at 4  C. For transferring from Phos-tag gels, soak the transfer tank in iced water for more efficient cooling, and transfer at 100 V for 180 min.

3.6

Immunoblotting

1. Take the membrane off the gel with great care in order not to leave any gel pieces on the membrane. 2. Put the membrane in the Ponceau S solution and incubate at room temperature for a few seconds.

Detection of Cellular Substrate Phosphorylation by LRRK2

59

3. Briefly wash the membrane with water and check if there is no obvious variation in staining among the lanes and no air bubbles. 4. Wash the membrane at room temperature in TBST until the membrane becomes completely colorless. 5. Put the membrane into the blocking buffer and incubate at room temperature for 30 min. 6. During the incubation, dilute the primary antibodies (antiphospho-Rab10 for normal immunoblotting and anti-Rab10 for the Phos-tag assay) in the blocking buffer at 1μg/mL and 1:1000, respectively. 7. After blocking the membrane, incubate the blocked membrane with the diluted primary antibodies at 4  C overnight. 8. Wash the membrane with TBST at room temperature three times (every wash should be for 5 min). The used primary antibody solution can be stored at below
20  C and re-used several times. 9. While washing the membrane, dilute the secondary antibody (anti-rabbit IgG) in the blocking buffer. 10. Incubate the membrane in the diluted secondary antibody solution at room temperature for 1 h. 11. Wash the membrane with TBST at room temperature six times (every wash should be for 5 min). 12. Use ECL reagents to develop the membrane and detect the ECL in an imaging equipment (Figs. 1 and 2) (see Note 8).

Fig. 1 Cell lysates of A549 cells treated with either DMSO or 10 nM MLi-2 for 1 h, as well as lung homogenates of WT and Lrrk2 knockout mice were prepared as described in the protocol. Rab10 phosphorylation was analyzed by immunoblotting using an anti-phospho-Rab10 antibody (top panel). Control immunoblots were performed with the indicated antibodies

60

Kyohei Ito et al.

Fig. 2 Wild-type (WT) mouse embryonic fibroblasts (MEFs) were treated with 0.1%(v/v) DMSO (
), 1μM GSK2578215A (GSK), 3μM HG-10-102-01 (HG), or 10 nM MLi-2 for 1 h in duplicate. Cell lysates were prepared as described in the protocol, and Rab10 phosphorylation was analyzed by a Phos-tag assay (top panel). Control immunoblots were done on normal gels with the indicated antibodies. Bands corresponding to phosphorylated and non-phosphorylated Rab10 were marked with open (○) and closed (●) circles, respectively. (This figure was originally published in Ito G et al., Biochemical Journal, 2016 [7] (https://portlandpress.com/biochemj/article/473/17/2671/49266/Phos-taganalysis-of-Rab10-phosphorylation-by))

4

Notes 1. Cells expressing relatively high levels of endogenous LRRK2 suitable for detecting endogenous Rab10 phosphorylation include human lung carcinoma A549, mouse embryonic fibroblast 3T3-Swiss albino, as well as mouse primary embryonic fibroblasts and rodent primary astrocytes. 2. Cells treated with LRRK2 inhibitors such as GSK2578215A, HG-10-102-01, and MLi-2 should be prepared in parallel to serve as a negative control. 3. Lrrk2 knockout mice or rodents administered with LRRK2 inhibitors should be prepared in parallel to serve as a negative control. 4. It is not recommended to use commercial SDS–PAGE sample buffers as they sometimes contain EDTA which prevents Phostag from functioning by chelating manganese ions. 5. SDS–PAGE samples added with MnCl2 should not be used for normal SDS–PAGE. 6. Degas for 10 min if gels containing Phos-tag acrylamide do not polymerize so efficiently.

Detection of Cellular Substrate Phosphorylation by LRRK2

61

7. For Phos-tag SDS–PAGE, the sample volume loaded in EVERY well should be the same: if 15μL of samples and 2μL of MWM are loaded, add 13μL of 1 SDS–PAGE sample buffer containing 10 mM MnCl2 to the MWM. Empty lanes should also be loaded with 15μL of 1 SDS–PAGE sample buffer containing 10 mM MnCl2. 8. For Phos-tag assay, use highly sensitive or long-lasting ECL reagents (e.g., SuperSignal West Dura Extended Duration from Thermo Fisher Scientific) to detect faint bands corresponding to phosphorylated Rab10. If X-ray films are used for detecting chemiluminescence, use highly sensitive films (e.g., Amersham Hyperfilm ECL from Cytiva) and expose films for a long period of time (up to several hours).

Acknowledgments Kyohei Ito, Lejia Xu, and Genta Ito contributed equally to this work. References 1. Fahn S (2003) Description of Parkinson’s disease as a clinical syndrome. Ann N Y Acad Sci 991:1–14 2. Paisa´n-Ruı´z C, Jain S, Evans EW et al (2004) Cloning of the gene containing mutations that cause PARK8-linked Parkinson’s disease. Neuron 44:595–600. https://doi.org/10.1016/j. neuron.2004.10.023 3. Zimprich A, Biskup S, Leitner P et al (2004) Mutations in LRRK2 cause autosomaldominant parkinsonism with pleomorphic pathology. Neuron 44:601–607. https://doi. org/10.1016/j.neuron.2004.11.005 4. Satake W, Nakabayashi Y, Mizuta I et al (2009) Genome-wide association study identifies common variants at four loci as genetic risk factors for Parkinson’s disease. Nat Genet

41:1303–1307. https://doi.org/10.1038/ng. 485 5. Simo´n-Sa´nchez J, Schulte C, Bras JM et al (2009) Genome-wide association study reveals genetic risk underlying Parkinson’s disease. Nat Genet 41:1308–1312. https://doi.org/10. 1038/ng.487 6. Steger M, Tonelli F, Ito G et al (2016) Phosphoproteomics reveals that Parkinson’s disease kinase LRRK2 regulates a subset of Rab GTPases. elife 5:e12813. https://doi.org/10. 7554/eLife.12813 7. Ito G, Katsemonova K, Tonelli F et al (2016) Phos-tag analysis of Rab10 phosphorylation by LRRK2: a powerful assay for assessing kinase function and inhibitors. Biochem J 473:2671–2685. https://doi.org/10.1042/ BCJ20160557

Chapter 7 Two Methods to Analyze LRRK2 Functions Under Lysosomal Stress: The Measurements of Cathepsin Release and Lysosomal Enlargement Maria Sakurai and Tomoki Kuwahara Abstract Leucine-rich repeat kinase 2 (LRRK2) is a causative gene product of autosomal-dominant Parkinson’s disease and has been shown to play a role in lysosomal regulation. We have previously shown that endogenous LRRK2 recruited its substrates Rab8a and Rab10 onto overloaded lysosomes depending on their phosphorylation, which functioned in the suppression of lysosomal enlargement as well as the promotion of the exocytic release of lysosomal cathepsins. In this chapter, we introduce two methods to analyze cellular functions of LRRK2 upon exposure to lysosomal overload stress in RAW264.7 cells. Key words LRRK2, Rab, Lysosomes, Lysosomotropic agent, Cathepsin

1

Introduction Missense mutations in the leucine-rich repeat kinase 2 (LRRK2) gene are a major cause of autosomal-dominant Parkinson’s disease (PD) [1, 2]. A subset of Rab small GTPases, such as Rab8, Rab10, Rab29, and Rab35, have been identified as bona fide cellular substrates of LRRK2 [3–6]. In previous studies, LRRK2 has been implicated in vesicular trafficking, cytoskeletal functions, and the regulation of the endolysosomal system including autophagy [7– 9]. Lrrk2 knockout mice showed the accumulation of enlarged lysosomes in renal proximal tubules and lamellar bodies in lung type II pneumocytes [10–13], suggesting that LRRK2 may particularly function in maintaining lysosomal homeostasis. We have previously demonstrated that the treatment of cells with lysosomotropic agents such as chloroquine (CQ) caused (a) the recruitment of endogenous LRRK2 and its substrates Rab8/Rab10 onto overloaded lysosomes, (b) the enlargement of lysosomes that were further enhanced by LRRK2/Rab8 knockdown, and (c) LRRK2/

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_7, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

63

64

Maria Sakurai and Tomoki Kuwahara

Fig. 1 An overview of the analyses. The exocytic release of lysosomal cathepsins and the enlargement of lysosomes upon CQ treatment are evaluated by immunoblotting and immunocytochemical analysis, respectively

Rab10-mediated release of lysosomal cathepsins into media [14, 15]. Importantly, both lysosomal recruitment of Rab8/ Rab10 and cathepsin release were dependent on LRRK2 kinase activity, and these responses were particularly evident in cells of the monocyte/macrophage lineage, such as murine RAW264.7 cells. Understanding two lysosomal responses regulated by LRRK2—the suppression of lysosomal enlargement and the promotion of lysosomal release—are of particular importance, as excess lysosomal enlargement causes lysosomal membrane permeabilization that leads to cell death [16], and the impaired lysosomal release is implicated in lysosomal storage disorders [17, 18]. In this chapter, we introduce two methods to evaluate cellular functions of LRRK2 in response to lysosomal stress using RAW264.7 cells: the immunoblot detection of exocytic release of cathepsin B/D and the immunocytochemical assessment of lysosomal enlargement (Fig. 1).

2

Materials

2.1 Cell Culture and Drug Treatment

We use murine macrophage-like RAW264.7 cells purchased from ATCC (American Type Culture Collection) for the following analyses. We usually analyze freshly thawed cells and avoid using those that are serially passaged for more than 20 times.

Analysis of LRRK2 Under Lysosomal Stress

65

1. Dulbecco’s Modified Eagle’s Medium (DMEM)—high glucose (Sigma-Aldrich). 2. Fetal bovine serum (BioWest). 3. Penicillin-streptomycin. 4. Mouse interferon-γ (Cell Signaling Technology): Reconstitute with distilled water (DW) at a concentration of 0.1 mg/mL. 5. siRNA (siGENOME SMARTpool siRNA, Dharmacon): Reconstitute with siRNA buffer to 20 μM before use according to the manufacturer’s protocol. 6. Lipofectamine RNAiMAX (Thermo Fisher Scientific). 7. Chloroquine (CQ): Dilute with DW at a concentration of 50 mM. 8. LRRK2 inhibitors: GSK2578251A (Sigma-Aldrich), PF-06447475 (MedChemExpress). Dilute them with dimethyl sulfoxide (DMSO) at a concentration of 1 mM. 9. Six-well plates. 2.2 SDS-PAGE and Immunoblotting

1. Lysis buffer: Tris-buffered saline (TBS) containing PhosSTOP (Sigma-Aldrich), cOmplete EDTA-free Protease Inhibitor Cocktail Tablets (Roche), and 0.5% Triton X-100. 2. Phosphate-buffered saline (PBS). 3. 4
sample buffer: NuPAGE LDS Sample Buffer (4
) (Invitrogen) containing 4% 2-mercaptoethanol. 4. Running gel: Add 1.25 mL 40% acrylamide/bis (30:0.8), 1.25 mL 1.5 M Tris–HCl, pH 8.8, 50 μL 10% sodium dodecyl sulfate (SDS), 25 μL ammonium peroxodisulfate (APS, 1 g in 4 mL DW) and 7.5 μL N,N,N0 ,N0 -tetramethyl-ethylenediamine (TEMED) into DW to a volume of 5 mL. 5. Stacking gel: Add 150 μL 40% acrylamide/bis (30:1.5), 375 μL 0.5 M Tris–HCl, pH 6.6, 15 μL 10% SDS, 12.5 μL APS, and 3.75 μL TEMED into DW to a volume of 1.5 mL. 6. Running buffer (10
): Add 90 g Tris, 432 g glycine, and 30 g SDS into DW to make up to 3 L. Store at 4  C. 7. Blotting buffer: Add 9 g Tris, 43.2 g glycine, and 600 mL methanol into DW to make up to 3 L. Chill the buffer at 4  C before use. 8. TS-Tween: 0.1% Tween 20 in TBS. 9. Blocking buffer: 5% skim milk in TS-Tween. 10. Immuno-enhancer (Wako). 11. ImmunoStar reagents (Wako). 12. Electrophoresis chamber.

66

Maria Sakurai and Tomoki Kuwahara

13. Transfer blotting apparatus. 14. Filter paper. 15. PVDF membrane (Merck). 2.3 Immunocytochemistry

1. Dulbecco’s phosphate-buffered saline (DPBS). 2. 4% paraformaldehyde (PFA) in PBS: Add 8.0 g PFA into 192 mL DW and mix the solution using a magnetic stirrer on a hot plate set at 50–60  C. Add a drop (15–20 μL) of 10 M NaOH to promote dissolution. After the solution is clear, cool it on ice and add 8 mL of 25
PBS for the buffering of the solution. After filtration, aliquot and store at 20  C. 3. Blocking/permeabilization buffer: 3% bovine serum albumin and 0.1% Triton X-100 in PBS. 4. DRAQ5 (Biostatus). 5. 12-well plates. 6. Slide glasses and coverslips. 7. Fine point forceps. 8. Parafilm. 9. 150-mm dish. 10. PermaFluor aqueous mountant (Thermo Fisher Scientific).

2.4

Antibodies

1. Anti-LRRK2 [MJFF2 (C41-2)] (Abcam). 2. Anti-cathepsin D [EPR3957Y] (Abcam). 3. Anti-cathepsin B [D1C7Y] (Cell Signaling Technology). 4. Anti-CD107a (LAMP1), clone 1D4B (Bio-Rad). 5. Anti-α-tubulin [T6199] (Sigma-Aldrich). 6. Anti-rabbit IgG (H + L), horseradish peroxidase (HRP) conjugate. 7. Anti-mouse IgG (H + L), horseradish peroxidase (HRP) conjugate. 8. Goat anti-rabbit IgG (H + L) highly cross-adsorbed, Alexa Fluor 488 conjugate (Life Technologies). 9. Goat anti-rat IgG (H + L) highly cross-adsorbed, Alexa Fluor 546 conjugate (Life Technologies).

3

Methods

3.1 Cell Culture and CQ Treatment

1. Culture RAW264.7cells in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (PS) at 37  C under a humidified 5% CO2 atmosphere (see Note 1).

Analysis of LRRK2 Under Lysosomal Stress

67

2. If necessary, transfect cells with each siRNA mixture using Lipofectamine RNAiMAX 72 h before each assay, according to the manufacturer’s protocol. 3. For immunoblotting, seed 0.8
106 cells per well in six-well plates. For immunocytochemistry, seed 0.8
106 cells per well on 12–15 mm coverslips that are placed on the bottom of six-well plates (see Note 2). Pretreat cells with IFN-γ 48 h before each assay to activate RAW264.7 cells (see Note 3). 4. Replace cell culture medium with 500 μL of DMEM containing 1% FBS in the presence or absence of CQ (100 μM) and LRRK2 inhibitors (1 μM) (see Note 4). Incubate cells for 3 h at 37  C. 5. If necessary, perform lactate dehydrogenase (LDH) release assay to evaluate cell death (optional). 3.2 SDS-PAGE and Immunoblot Analysis of Cathepsin Secretion

1. Collect media into 1.5 mL Eppendorf-type tubes and centrifuge them at 200
g for 5 min. Transfer the supernatants into new tubes, add NuPAGE LDS Sample Buffer (4
), mix well and heat them for 5 min at 95  C. Keep the samples as medium fraction. 2. For the preparation of cell lysates, wash cells once with PBS and add 500 μL of lysis buffer. After shaking the plates for 30 min at 4  C, harvest cell lysates into new tubes and centrifuge them at 15,300
g for 5 min at 4  C. Mix the supernatants with NuPAGE LDS Sample Buffer (4
) and heat them for 5 min at 95  C. Keep the samples as lysate fraction. 3. Run the medium and lysate samples on SDS-PAGE gels. 4. Transfer the proteins from SDS-PAGE gels onto PVDF membranes using wet transfer (226 mA, 2 h at 4  C). 5. Incubate the membranes in blocking buffer for >30 min. 6. Incubate the membranes with primary antibodies in Immunoenhancer Reagent A at 4  C overnight and with the secondary antibodies in Immuno-enhancer Reagent B for >45 min at room temperature. 7. Detect proteins on the membranes using ImmunoStar reagents and acquire digital images on a LAS4000 image analyzer. The secretion of cathepsin D and cathepsin B will be detected upon CQ treatment, which is expected to be inhibited either by LRRK2/Rab10 knockdown (Fig. 2a, b) or LRRK2 inhibitor treatment (Fig. 2c–e).

68

Maria Sakurai and Tomoki Kuwahara

Fig. 2 Inhibition of LRRK2 suppresses CQ-induced exocytic release of cathepsin B and cathepsin D. (a) Immunoblot analysis of the levels of cathepsin D in media from RAW264.7 cells treated with the indicated siRNA. (b) Densitometric analysis of the intermediate cathepsin D in media, as shown in (a). (c) Immunoblot analysis of the levels of cathepsin B and cathepsin D in media in the presence of LRRK2 inhibitors, GSK2578251A (GSK) (Sigma-Aldrich) and PF-06447475 (PF) (MedChemExpress). (d, e) Densitometric analysis of the intermediate cathepsin D (d) and mature cathepsin B (e) in media, as shown in (c). Mean  SD (n ¼ 3), ** p < 0.01, *** p < 0.001, **** p < 0.0001; one-way ANOVA with Tukey’s test. (Reproduced from ref. 14 with permission from the authors) 3.3 Immunocytochemical Analysis of Lysosomal Enlargement and LRRK2 Recruitment

1. Take out cell-attached coverslips from the bottom of the culture dish using fine point forceps, and transfer them into new 12-well plates (see Note 4). 2. Wash cells once with DPBS. 3. Add 700 μL of 4% PFA in PBS onto cells, place lids on plates and gently shake them for 20–30 min at room temperature. 4. Wash cells three times with DPBS and add 20  C ethanol. Keep them at 20  C overnight for the purpose of antigen retrieval and post-fixation (see Note 5). 5. Wash cells three times with DPBS, and incubate them in Blocking/permeabilization buffer for 30 min at room temperature. 6. Gently place cell-attached coverslips onto 40 μL of primary antibody solution (anti-LAMP1 and anti-LRRK2 antibodies diluted in blocking buffer) that are spotted on a sheet of parafilm spread in a 150 mm dish (see Note 6). Be sure to place coverslips face down on the spot of antibody solution, so that cells react with antibodies. Put a foil-wrapped lid on a dish and incubate them for 2 h at room temperature.

Analysis of LRRK2 Under Lysosomal Stress

69

7. Wash cells three times with DPBS, and place coverslips face down on the spot of 40 μL of secondary antibody solution (Alexa Fluor-conjugated anti-IgG antibodies and DRAQ5 in blocking buffer) that are spotted on a sheet of parafilm. Incubate for 1 h at room temperature preventing from light. 8. Wash cells three times with DPBS, and mount coverslips on glass slides using an aqueous mountant. 9. Acquire fluorescence images using a confocal microscopy. Take pictures containing >50 cells in each field of view. 10. Measure the area of the largest lysosomes (i.e., LAMP1positive vacuoles) in each cell using the ImageJ software (see Note 7). If necessary, adjust brightness and contrast (see Note 8). Evaluate the colocalization of LAMP1 with LRRK2 on confocal images. Lysosomal enlargement as well as the lysosomal recruitment of endogenous LRRK2 will be detected upon CQ treatment (Fig. 3a). Lysosomal enlargement is expected to be promoted either by LRRK2 inhibitor treatment (Fig. 3b) or LRRK2 knockdown (Fig. 3c, d).

Fig. 3 Immunocytochemical analysis of lysosomal enlargement regulated by LRRK2. (a) Lysosomal enlargement and lysosomal recruitment of LRRK2 upon CQ treatment. RAW264.7 cells were stained with anti-LRRK2 (green) and anti-LAMP1 (red) antibodies. Nuclei were stained with DRAQ5 (blue). (b, c) Inhibition of LRRK2 enhances CQ-induced lysosomal enlargement. CQ-treated cells were additionally treated with LRRK2 inhibitors (b) or LRRK2 siRNA (c). Red: LAMP1, Blue: nuclei. A broken line indicates the largest lysosome in each cell. Scale bars: 10 μm. (d) Measurement of the size of the largest lysosome in each cell, as examined in (c). Mean  SD (n ¼ 68 and n ¼ 69, respectively), *** p < 0.001; one-way ANOVA with Tukey’s test. (Reproduced from ref. 14 with permission from the authors)

70

4

Maria Sakurai and Tomoki Kuwahara

Notes 1. We routinely use the culture dish for suspension cells to maintain RAW264.7 cells, as these cells tend to stick to the bottom of the dish firmly, which makes it difficult to detach cells upon passaging. 2. We sometimes immerse fresh coverslips with 1 M NaOH for a couple of hours before use to degrease them, which facilitates the attachment of cells to coverslips. After rinsing with DW, keep them in 70% ethanol until use. Perform flame sterilization immediately before placing them on the bottom of dishes. 3. It is necessary to activate RAW264.7 cells by IFN-γ treatment for ~48 h before assay. This process causes the upregulation of the expression level of endogenous LRRK2. 4. We use DMEM containing 1% FBS as a medium when performing LDH release assay because FBS contains various proteins and enzymes that may interfere with LDH activity. 5. Incubation of PFA-fixed cells with chilled ethanol is essential for the immunostaining of endogenous LRRK2 with antiLRRK2 MJFF2 antibody. Samples can be stored in ethanol at 20  C for a couple of months keeping from drying out. 6. We adopt this incubation method to save the amount of antibodies used. Spread a sheet of Parafilm in an empty 150 mm dish and drop an antibody solution onto it. Parafilm repels water and makes droplets with height. When spotting multiple droplets, give them some distance (Fig. 4, left). Place a cellattached coverslip on a droplet of antibody solution using forceps for the cells to face the solution (Fig. 4, right). Put a foil-wrapped lid on a dish to prevent samples from drying and block out light, and incubate them for the indicated periods. After incubation, pick up coverslips using forceps and place them in new 12-well plates to wash them with DPBS.

Fig. 4 An illustration of the method to incubate cell-attached coverslips with the antibody solution for immunocytochemical analyses

Analysis of LRRK2 Under Lysosomal Stress

71

7. For the measurement of lysosomal area, we use ImageJ: select “Polygon selections” tool to surround the most enlarged lysosomes and pull down the Analyze menu to choose “Measure.” The measured area is shown in “Area” column. 8. We routinely use photo retouching software Photoshop or GIMP2 (https://www.gimp.org/downloads/) to adjust brightness and contrast of images.

Acknowledgments We thank Drs. Takeshi Iwatsubo and Tomoya Eguchi for their support during the establishment of the described methods. This work was supported by JSPS KAKENHI Grant number 19K07816. References 1. Paisan-Ruiz C, Jain S, Evans EW, Gilks WP, Simon J, van der Brug M, Lopez de Munain A, Aparicio S, Gil AM, Khan N, Johnson J, Martinez JR, Nicholl D, Marti Carrera I, Pena AS, de Silva R, Lees A, MartiMasso JF, Perez-Tur J, Wood NW, Singleton AB (2004) Cloning of the gene containing mutations that cause PARK8-linked Parkinson’s disease. Neuron 44(4):595–600 2. Zimprich A, Biskup S, Leitner P, Lichtner P, Farrer M, Lincoln S, Kachergus J, Hulihan M, Uitti RJ, Calne DB, Stoessl AJ, Pfeiffer RF, Patenge N, Carbajal IC, Vieregge P, Asmus F, Muller-Myhsok B, Dickson DW, Meitinger T, Strom TM, Wszolek ZK, Gasser T (2004) Mutations in LRRK2 cause autosomaldominant parkinsonism with pleomorphic pathology. Neuron 44(4):601–607 3. Liu Z, Bryant N, Kumaran R, Beilina A, Abeliovich A, Cookson MR, West AB (2018) LRRK2 phosphorylates membrane-bound Rabs and is activated by GTP-bound Rab7L1 to promote recruitment to the trans-Golgi network. Hum Mol Genet 27(2):385–395 4. Steger M, Tonelli F, Ito G, Davies P, Trost M, Vetter M, Wachter S, Lorentzen E, Duddy G, Wilson S, Baptista MA, Fiske BK, Fell MJ, Morrow JA, Reith AD, Alessi DR, Mann M (2016) Phosphoproteomics reveals that Parkinson’s disease kinase LRRK2 regulates a subset of Rab GTPases. Elife 5:e12813 5. Steger M, Diez F, Dhekne HS, Lis P, Nirujogi RS, Karayel O, Tonelli F, Martinez TN, Lorentzen E, Pfeffer SR, Alessi DR, Mann M (2017) Systematic proteomic analysis of LRRK2-mediated Rab GTPase

phosphorylation establishes a connection to ciliogenesis. Elife 6:e31012 6. Fujimoto T, Kuwahara T, Eguchi T, Sakurai M, Komori T, Iwatsubo T (2018) Parkinson’s disease-associated mutant LRRK2 phosphorylates Rab7L1 and modifies trans-Golgi morphology. Biochem Biophys Res Commun 495 (2):1708–1715 7. Martin I, Kim JW, Dawson VL, Dawson TM (2014) LRRK2 pathobiology in Parkinson’s disease. J Neurochem 131(5):554–565 8. Roosen DA, Cookson MR (2016) LRRK2 at the interface of autophagosomes, endosomes and lysosomes. Mol Neurodegener 11(1):73 9. Kuwahara T, Iwatsubo T (2020) The emerging functions of LRRK2 and Rab GTPases in the endolysosomal system. Front Neurosci 14:227 10. Tong Y, Yamaguchi H, Giaime E, Boyle S, Kopan R, Kelleher RJ 3rd, Shen J (2010) Loss of leucine-rich repeat kinase 2 causes impairment of protein degradation pathways, accumulation of alpha-synuclein, and apoptotic cell death in aged mice. Proc Natl Acad Sci U S A 107(21):9879–9884 11. Herzig MC, Kolly C, Persohn E, Theil D, Schweizer T, Hafner T, Stemmelen C, Troxler TJ, Schmid P, Danner S, Schnell CR, Mueller M, Kinzel B, Grevot A, Bolognani F, Stirn M, Kuhn RR, Kaupmann K, van der Putten PH, Rovelli G, Shimshek DR (2011) LRRK2 protein levels are determined by kinase function and are crucial for kidney and lung homeostasis in mice. Hum Mol Genet 20 (21):4209–4223

72

Maria Sakurai and Tomoki Kuwahara

12. Hinkle KM, Yue M, Behrouz B, D€achsel JC, Lincoln SJ, Bowles EE, Beevers JE, Dugger B, Winner B, Prots I, Kent CB, Nishioka K, Lin WL, Dickson DW, Janus CJ, Farrer MJ, Melrose HL (2012) LRRK2 knockout mice have an intact dopaminergic system but display alterations in exploratory and motor co-ordination behaviors. Mol Neurodegener 7 (25):17 13. Kuwahara T, Inoue K, D’Agati VD, Fujimoto T, Eguchi T, Saha S, Wolozin B, Iwatsubo T, Abeliovich A (2016) LRRK2 and RAB7L1 coordinately regulate axonal morphology and lysosome integrity in diverse cellular contexts. Sci Rep 6:29945 14. Eguchi T, Kuwahara T, Sakurai M, Komori T, Fujimoto T, Ito G, Yoshimura SI, Harada A, Fukuda M, Koike M, Iwatsubo T (2018) LRRK2 and its substrate Rab GTPases are sequentially targeted onto stressed lysosomes and maintain their homeostasis. Proc Natl Acad Sci U S A 115(39):E9115–E9124

15. Kuwahara T, Funakawa K, Komori T, Sakurai M, Yoshii G, Eguchi T, Fukuda M, Iwatsubo T (2020) Roles of lysosomotropic agents on LRRK2 activation and Rab10 phosphorylation. Neurobiol Dis 145:105081 16. Ono K, Kim SO, Han J (2003) Susceptibility of lysosomes to rupture is a determinant for plasma membrane disruption in tumor necrosis factor alpha-induced cell death. Mol Cell Biol 23(2):665–676 17. Medina DL, Fraldi A, Bouche V, Annunziata F, Mansueto G, Spampanato C, Puri C, Pignata A, Martina JA, Sardiello M, Palmieri M, Polishchuk R, Puertollano R, Ballabio A (2011) Transcriptional activation of lysosomal exocytosis promotes cellular clearance. Dev Cell 21(3):421–430 18. Cao Q, Zhong XZ, Zou Y, Zhang Z, Toro L, Dong XP (2015) BK channels alleviate Lysosomal storage diseases by providing positive feedback regulation of Lysosomal Ca2+ release. Dev Cell 33(4):427–441

Chapter 8 Differentiation of Midbrain Dopaminergic Neurons from Human iPS Cells Kei-Ichi Ishikawa, Risa Nonaka, and Wado Akamatsu Abstract Human-induced pluripotent stem (iPS) cells provide a powerful means for analyzing disease mechanisms and drug screening, especially for neurological diseases, considering the difficulty to obtain live pathological tissue. The midbrain dopaminergic neurons of the substantia nigra are mainly affected in Parkinson’s disease, but it is impossible to obtain and analyze viable dopaminergic neurons from live patients. This problem can be overcome by the induction of dopaminergic neurons from human iPS cells. Here, we describe an efficient method for differentiating human iPS cells into midbrain dopaminergic neurons. This protocol holds merit for obtaining a deeper understanding of the disease and for developing novel treatments. Key words Induced pluripotent stem cells, Dopaminergic neurons, Parkinson’s disease

1

Introduction In 2006, Yamanaka and colleagues reported a scientific breakthrough in stem cell research by indicating that only four transcriptional factors, OCT4, SOX2, KLF4, and MYC, can reprogram terminally differentiated murine somatic cells into the pluripotent state [1]. These pluripotent cells were named induced pluripotent stem (iPS) cells and were found to be similar to embryonic stem (ES) cells in gene expression and differentiation potential. The following year, Yamanaka’s and Thomson’s groups independently reported that iPS cells could be generated from human fibroblasts [2, 3]. Following these reports, many studies have shown that iPS cells can be stably established from sources other than fibroblasts, such as blood cells [4–6]. The technology for the differentiation of pluripotent stem cells into major cell types has already been established using human ES cells, and it has become possible to easily obtain target cells from patient cells in vitro without ethical issues. This technology is called disease-specific iPS cell technology.

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_8, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

73

74

Kei-Ichi Ishikawa et al.

The major hindrance in Parkinson’s disease research has been the collection and analysis of live dopamine neurons from patients, making it difficult to accurately discern the pathological changes occurring in patients’ neurons. However, this problem might be solved by differentiating iPS cells from patients with Parkinson’s disease into dopaminergic neurons. iPS cells generated from Parkinson’s disease patients were first reported in 2008 [7]. In 2011, familial Parkinson’s diseases with mutations in LRRK2 (PARK8), PINK1 (PARK6), and SNCA triplication (PARK4) were used to successfully reproduce the disease phenotype [8–10]. In 2012, we succeeded in recapitulating abnormalities in mitochondrial clearance using familial Parkinson’s disease PARK2 [11, 12]. In that study, however, the induction rate of dopaminergic neurons was low, and several months were required to induce tyrosine hydroxylase (TH)-positive dopaminergic neurons. Since then, a number of groups, including ours, have reported techniques to improve the method of inducing neuronal differentiation from iPS cells. Methods for inducing neural differentiation, including the dual-SMAD inhibition method, have been developed [6, 13, 14], and regionspecific neuron induction methods were established by Wnt, retinoic acid (RA), and sonic hedgehog (Shh), providing resources to study the mechanisms of lesion-specific neurodegenerative disease [15–18]. Midbrain dopaminergic neurons, which are mainly affected in patients with Parkinson’s disease, can be obtained from iPSC-derived neural stem cells specific to the ventral midbrain. This chapter provides a protocol for highly efficient dopaminergic neuronal induction from on-feeder iPS cells to understand the disease mechanisms and assess drug efficacy and toxicity predictions. In previous studies, we have successfully revealed the mechanisms of Parkinson’s disease in patients’ dopaminergic neurons [19–23] and assessed the therapeutic effects of candidate compounds [24–27]. This protocol could be applicable in drug screening for hereditary and sporadic Parkinson’s disease [28]. We hope that this approach will further advance Parkinson’s disease research and yield results that will benefit patients.

2

Materials

2.1 Induction of Midbrain Dopaminergic Precursors

1. iPSC culture medium: Dulbecco’s modified Eagle medium/ nutrient mixture F-12 (DMEM/F12) supplemented with 1% non-essential amino acid solution, 2 mM L-glutamine, 0.1 M 2-mercaptoethanol, 125 mL KnockOut Serum Replacement (KSR), 4 ng/mL basic fibroblast growth factor (bFGF), and 0.5% penicillin/streptomycin. 2. 10 mM SB431542.

Differentiation of Dopaminergic Neurons from iPS Cells

75

3. 5 mM Dorsomorphin. 4. 30 mM CHIR99021. 5. Phosphate-buffered saline (PBS). 6. Dissociation solution for human ES/iPS cells (ReproCELL). 7. TrypLE Select (Life Technologies). 8. Trypsin inhibitor. 9. 40 μm cell strainers. 10. 10 mM Y-27632. 11. Neurosphere culture medium: KBM neural stem cell medium (Kohjin Bio) supplemented with B27 and 0.5% penicillin/ streptomycin. 12. T75 and/or T25 flasks. 13. 50 μg/mL bFGF 14. 10 mM Purmorphamine. 2.2 Induction of Midbrain Dopaminergic Neurons

1. 48-well plates. 2. Round cover glasses (10 mm). 3. 150 μg/mL Poly-L-ornithine. 4. 0.5 mg/mL Fibronectin. 5. Neuron culture medium: Neurosphere culture medium supplemented with 10 ng/mL brain-derived neurotrophic factor (BDNF), 10 ng/mL glial cell-derived neurotrophic factor (GDNF), 1 mM dibutyryl-cAMP, 200 μM ascorbic acid, 1 ng/mL transforming growth factor β3 (TGF-β3), and 10 μM DAPT. 6. 30 mM CHIR99021.

3

Methods

3.1 Differentiation of Ventral MidbrainSpecific Neurospheres from Human iPS Cells

An overview of this protocol is shown in Fig. 1. 1. Culture human iPS cells on feeder cells in a six-well plates (see Note 1). 2. Culture iPS cells for 5 days with iPSC culture medium supplemented with 3 μM SB431542, 3 μM dorsomorphin, and 3 μM CHIR99021 by adding stock solutions, which should be replaced daily. 3. Aspirate the medium and wash the cells twice with 2 mL PBS. 4. Treat the cells with 500 μL of dissociation solution and aspirate. Incubate the plate at 37
C for 3 min.

76

Kei-Ichi Ishikawa et al.

Fig. 1 Overview of midbrain dopaminergic neural induction from on-feeder induced pluripotent cells

5. Add 2 mL PBS and aspirate floating feeder cells with PBS (see Note 2). 6. Add 2 mL iPSC culture medium and detach the iPS colonies with a cell scraper. Collect the colonies in 15-mL tubes. 7. Centrifuge for 5 min at 200  g and aspirate the supernatant. 8. Add 1 mL TrypLE Select and incubate in a 37
C water bath for 5 min. 9. Triturate colonies using a P1000 pipette about 10–20 times to dissociate the cells into single cells (see Note 3). 10. Add 1 mL trypsin inhibitor and filter through a 40-μm cell strainer. 11. Wash the cell strainer with 7 mL Neurosphere culture medium. 12. Centrifuge for 5 min at 200  g and aspirate the supernatant. 13. Resuspend cells in 1 mL Neurosphere culture medium supplemented with 10 μM Y-27632 and count the viable cells. 14. Culture the cells at a density of 1  104 cells/mL in Neurosphere culture medium supplemented with 20 ng/mL bFGF, 2 μM SB431542, and 10 μM Y-27632 in a T75 flask (40 mL) or T25 flask (15 mL) at 37
C, 5% CO2, and 4% O2. 15. After 3 days, add 3 μM CHIR99021 and 2 μM purmorphamine to the Neurosphere culture medium and incubate cells for another 10 days (see Note 4). The cells form spheres of colonies, named primary neurospheres (see Note 5). 16. Collect the neurospheres in a 50-mL tube. 17. Centrifuge for 5 min at 200  g and aspirate the supernatant. 18. To establish secondary neurospheres, follow the same procedure as steps #8–13. 19. Culture the cells at a density of 5  104 cells/mL in Neurosphere culture medium supplemented with 20 ng/mL bFGF,

Differentiation of Dopaminergic Neurons from iPS Cells

77

2 μM SB431542, 10 μM Y-27632, 3 μM CHIR99021, and 2 μM purmorphamine in a culture flask for 7 days at 37
C, 5% CO2, and 4% O2. 20. To establish third or higher passage neurospheres, follow the same procedure as steps #16–19 (see Note 6). 3.2 Differentiation into Midbrain Dopaminergic Neurons from Neurospheres

1. Place cover glasses in 48-well plates and coat the dishes with 15 μg/mL poly-L-ornithine overnight. Aspirate the poly-Lornithine and coat with 10 μg/mL fibronectin overnight (see Note 7). 2. For the final induction of dopaminergic neurons, follow steps #16–18. 3. Discard the coating solution in the 48-well plates. Add 500 μL neuron culture medium supplemented with 3 μM CHIR99021, and plate the cells at a density of 9  104 cells/ well (see Note 8). 4. Change half of the neuron culture medium every 3 days for 14 days (see Note 9).

4

Notes 1. The protocols for the maintenance of human iPS cells are as described by Ohnuki et al. [29]. 2. The feeder cells detach from the dish, but iPS cell colonies remain attached to the dish. 3. Pipette carefully but quickly until the colonies are dissociated into single cells. This step is important to obtain a sufficient number of cells. 4. These chemicals provide regional specificity for the ventral midbrain to neural precursors (Fig. 2b). 5. The culture period should be extended from 10 to 20 days, depending on the colony growth (Fig. 2a). 6. Colony formation of secondary and more passaged neurospheres is faster than that of primary neurospheres. Adjust the incubation period from 5 to 10 days, depending on the colony growth. We mainly use third to fifth passaged neurospheres. 7. This protocol is for immunostaining assays. Depending on the purpose of the experiment, slide chambers and other plastic/ glass-bottomed dishes can be used as well. 8. CHIR99021 is added only at this time to promote efficient differentiation of neurons. 9. We usually use dopaminergic neurons around day 14, when there is sufficient neuronal growth for our experiments, such as

78

Kei-Ichi Ishikawa et al.

Fig. 2 Neurospheres and dopaminergic neurons differentiated by this protocol. (a) Neurospheres formed after 14-day incubation. Scale bar ¼ 100 μm. (b) The neurospheres are positive for the midbrain dopaminergic neuron progenitor markers FOXA2 and LMX1A. Scale bars ¼ 50 μm. (c) Differentiated dopaminergic neurons 14 days after plating on a dish. Scale bar ¼ 100 μm. (d) The neurons are positive for the neuron marker β3tubulin, and 40–60% of them are positive for the dopaminergic neuron marker tyrosine hydroxylase (TH). Scale bars ¼ 50 μm

mitochondrial abnormalities and cell fragility of patientsderived neurons. Depending on the purpose of the experiment, the incubation period can be extended to perform assays with more mature neurons. Around 30–60% of neurons are positive for TH, a dopaminergic neuron marker (Fig. 2c, d) [19, 28].

Acknowledgments This work was supported by Grants-in-Aid for Scientific Research (20K07873 to K.I., 20K07741 to R.N.) from the Japan Society for the Promotion of Science (JSPS), MEXT-Supported Programs for the Strategic Research Foundation at Private Universities (S1411007), Fostering Physicians in Basic Research for Coping with Advancing Sophistication of Medicine and Medical Care, and the Rare/Intractable Disease Project of Japan (JP17ek0109244 to K.I. and W.A). References 1. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663–676. https://doi.org/10.1016/ j.cell.2006.07.024

2. Takahashi K, Tanabe K, Ohnuki M et al (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131:861–872. https://doi.org/10.1016/J. CELL.2007.11.019

Differentiation of Dopaminergic Neurons from iPS Cells 3. Yu J, Vodyanik MA, Smuga-Otto K et al (2007) Induced pluripotent stem cell lines derived from human somatic cells. Science 318:1917–1920. https://doi.org/10.1126/ science.1151526 4. Shi Y, Inoue H, Wu JC, Yamanaka S (2017) Induced pluripotent stem cell technology: a decade of progress. Nat Rev Drug Discov 16:115–130 5. Okita K, Yamakawa T, Matsumura Y et al (2013) An efficient nonviral method to generate integration-free human-induced pluripotent stem cells from cord blood and peripheral blood cells. Stem Cells 31:458–466. https:// doi.org/10.1002/stem.1293 6. Matsumoto T, Fujimori K, Andoh-Noda T et al (2016) Functional neurons generated from T cell-derived induced pluripotent stem cells for neurological disease modeling. Stem Cell Reports 6:422–435. https://doi.org/10. 1016/j.stemcr.2016.01.010 7. Park IH, Arora N, Huo H et al (2008) Diseasespecific induced pluripotent stem cells. Cell 134:877–886. https://doi.org/10.1016/j. cell.2008.07.041 8. Nguyen HN, Byers B, Cord B et al (2011) LRRK2 mutant iPSC-derived DA neurons demonstrate increased susceptibility to oxidative stress. Cell Stem Cell 8:267–280. https:// doi.org/10.1016/j.stem.2011.01.013 9. Seibler P, Graziotto J, Jeong H et al (2011) Mitochondrial Parkin recruitment is impaired in neurons derived from mutant PINK1 iPS cells. J Neurosci 31:5970–5976. https://doi. org/10.1523/JNEUROSCI.4441-10.2011 10. Byers B, Cord B, Nguyen HN et al (2011) SNCA triplication Parkinson’s patient’s iPSCderived DA neurons accumulate α-Synuclein and are susceptible to oxidative stress. PLoS One 6(11):e26159. https://doi.org/10. 1371/journal.pone.0026159 11. Imaizumi Y, Okada Y, Akamatsu W et al (2012) Mitochondrial dysfunction associated with increased oxidative stress and α-synuclein accumulation in PARK2 iPSC-derived neurons and postmortem brain tissue. Mol Brain 5:35. https://doi.org/10.1186/1756-6606-5-35 12. Ishikawa K-I, Yamaguchi A, Okano H, Akamatsu W (2018) Assessment of mitophagy in iPS cell-derived neurons. Methods Mol Biol 1759:59–67. https://doi.org/10.1007/ 7651_2017_10 13. Chambers SM, Fasano CA, Papapetrou EP et al (2009) Highly efficient neural conversion of human ES and iPS cells by dual inhibition of SMAD signaling. Nat Biotechnol 27:275–280. https://doi.org/10.1038/nbt.1529

79

14. Fujimori K, Matsumoto T, Kisa F et al (2017) Escape from pluripotency via inhibition of TGF-β/BMP and activation of Wnt signaling accelerates differentiation and aging in hPSC progeny cells. Stem Cell Reports 9:1675–1691. https://doi.org/10.1016/j. stemcr.2017.09.024 15. Fasano CA, Chambers SM, Lee G et al (2010) Efficient derivation of functional floor plate tissue from human embryonic stem cells. Cell Stem Cell 6:336–347. https://doi.org/10. 1016/j.stem.2010.03.001 16. Kriks S, Shim J-W, Piao J et al (2011) Dopamine neurons derived from human ES cells efficiently engraft in animal models of Parkinson’s disease. Nature 480:547–551. https:// doi.org/10.1038/nature10648 17. Doi D, Samata B, Katsukawa M et al (2014) Isolation of human induced pluripotent stem cell-derived dopaminergic progenitors by cell sorting for successful transplantation. Stem Cell Reports 2:337–350. https://doi.org/10. 1016/J.STEMCR.2014.01.013 18. Imaizumi K, Sone T, Ibata K et al (2015) Controlling the regional identity of hPSCderived neurons to uncover neuronal subtype specificity of neurological disease phenotypes. Stem Cell Reports 5:1010–1022. https://doi. org/10.1016/j.stemcr.2015.10.005 19. Suzuki S, Akamatsu W, Kisa F et al (2017) Efficient induction of dopaminergic neuron differentiation from induced pluripotent stem cells reveals impaired mitophagy in PARK2 neurons. Biochem Biophys Res Commun 483:88–93. https://doi.org/10.1016/j.bbrc. 2016.12.188 20. Valentine MNZ, Hashimoto K, Fukuhara T et al (2019) Multi-year whole-blood transcriptome data for the study of onset and progression of Parkinson’s disease. Sci Data 6:20. https://doi.org/10.1038/s41597-019-00229 21. Ikeda A, Nishioka K, Meng H et al (2019) Mutations in CHCHD2 cause α-synuclein aggregation. Hum Mol Genet 28:3895–3911. https://doi.org/10.1093/hmg/ddz241 22. Oji Y, Hatano T, Ueno S-I et al (2020) Variants in saposin D domain of prosaposin gene linked to Parkinson’s disease. Brain 143:1190–1205. https://doi.org/10.1093/brain/awaa064 23. Shiba-Fukushima K, Ishikawa K-I, Inoshita T et al (2017) Evidence that phosphorylated ubiquitin signaling is involved in the etiology of Parkinson’s disease. Hum Mol Genet 26:3172–3185. https://doi.org/10.1093/ hmg/ddx201

80

Kei-Ichi Ishikawa et al.

24. Ren Q, Ma M, Yang J et al (2018) Soluble epoxide hydrolase plays a key role in the pathogenesis of Parkinson’s disease. Proc Natl Acad Sci U S A 115:E5815–E5823. https://doi. org/10.1073/pnas.1802179115 25. Hirano K, Fujimaki M, Sasazawa Y et al (2019) Neuroprotective effects of memantine via enhancement of autophagy. Biochem Biophys Res Commun 518:161–170. https://doi.org/ 10.1016/j.bbrc.2019.08.025 26. Kataura T, Saiki S, Ishikawa K-I et al (2020) BRUP-1, an intracellular bilirubin modulator, exerts neuroprotective activity in a cellular Parkinson’s disease model. J Neurochem 155 (1):81–97. https://doi.org/10.1111/jnc. 14997

27. Shiba-Fukushima K, Inoshita T, Sano O et al (2020) A cell-based high-throughput screening identified two compounds that enhance PINK1-Parkin signaling. iScience 23:101048. https://doi.org/10.1016/j.isci.2020.101048 28. Yamaguchi A, Ishikawa K-I, Inoshita T et al (2020) Identifying therapeutic agents for amelioration of mitochondrial clearance disorder in neurons of familial Parkinson disease. Stem Cell Reports 14:1060–1075. https://doi. org/10.1016/j.stemcr.2020.04.011 29. Ohnuki M, Takahashi K, Yamanaka S (2009) Generation and characterization of human induced pluripotent stem cells. Curr Protoc Stem Cell Biol 9:4A.2.1–4A.2.25. https:// doi.org/10.1002/9780470151808. sc04a02s9

Chapter 9 Monitoring PINK1-Parkin Signaling Using Dopaminergic Neurons from iPS Cells Kahori Shiba-Fukushima and Yuzuru Imai Abstract The physiological importance of mitochondrial quality control has been uncovered by the finding that genes for early onset Parkinson’s disease (PD), PINK1 and Parkin, regulate mitochondrial autophagy, called mitophagy, and motility. Dopaminergic neurons derived from human-induced pluripotent stem (iPS) cells are a useful tool for analyzing the pathogenesis caused by defects in mitochondrial quality control and for screening candidate drugs for PD. Moreover, dopaminergic neurons could provide new findings not obtained in other cells. In this chapter, we will describe our method for monitoring PINK1-Parkin signaling using iPS cell-derived dopaminergic neurons. Key words Dopaminergic neuron, Immunocytochemistry, Western blot, Mitochondria, Parkin, PINK1, iPS cells, Autophagy, Ubiquitin

1

Introduction Mutations of genes encoding PINK1 and Parkin cause autosomal recessive early onset Parkinson’s disease (PD), in which selective loss of midbrain dopaminergic neurons occurs [1, 2]. The ubiquitin-ligase Parkin has a role in mitochondrial quality control in collaboration with the mitochondrial serine/threonine protein kinase PINK1 [3–7]. Studies using animal models for accelerated accumulation of mitochondrial genomic errors [8] and for mitochondrial unfolded protein stress [9] suggest that PINK1 and Parkin maintain the survival of dopaminergic neurons through correction of the dysfunctional mitochondrial pool. Studies using Drosophila and mammalian cultured neurons revealed that PINK1 and Parkin suppress axonal transport of damaged mitochondria through the degradation of the motor-adaptor protein Miro [10, 11].

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_9, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

81

82

Kahori Shiba-Fukushima and Yuzuru Imai

PINK1 is constitutively degraded by a combination of mitochondrial proteases and the ubiquitin–proteasome pathway in a mitochondrial membrane potential (ΔΨm)-dependent manner [12]. The reduction of ΔΨm due to mitochondrial damage leads to PINK1 accumulation and activation on the mitochondrial outer membrane, preventing the ΔΨm-dependent import of PINK1 to the internal compartment of the mitochondria [12, 13]. Activated PINK1 phosphorylates Parkin and ubiquitin [14–19], whereby a latent form of Parkin in the cytosol is activated and translocated to the mitochondrial outer membrane, ubiquitinating mitochondrial proteins, such as Mitofusin and Miro [10, 11, 20]. Ubiquitination of mitochondrial proteins is believed to induce autophagy through recruitment of autophagy adaptors, such as NDP52 and optineurin [21]. Condensed dopaminergic neuron cultures from iPS cells are an important tool to validate the pathogenesis caused by PD gene mutations and the effect and toxicity of candidate drugs for PD [22–25]. Mitochondrial translocation of Parkin and phosphorylation of ubiquitin were compromised in iPS cell-derived dopaminergic neurons from patients carrying PINK1 or Parkin mutations [23]. Moreover, the phosphorylation of ubiquitin is more prominent in dopaminergic neurons than in other cells, suggesting that PINK1-Parkin signaling is indispensable to the survival of dopaminergic neurons [23]. In this chapter, we will introduce our method for detecting PINK1-Parkin signaling in dopaminergic neurons.

2

Materials

2.1 Preparation of GFP-Parkin Lentivirus

1. HEK293FT cells (Thermo Fisher Scientific). 2. Cell culture medium: DMEM (Sigma-Aldrich) containing 10% fetal bovine serum (Gibco) and 1
penicillin–streptomycin solution (Gibco). 3. Lipofectamine 2000 (Thermo Fisher Scientific). 4. pLV-SIN Puro-GFP-Parkin (see Note 1). 5. Lentiviral High Titer Packaging Mix (Takara). 6. Syringe filter (0.45 μm pore size, polyethersulfone) (see Note 2). 7. Lenti-X Concentrator (Takara). 8. Phosphate-buffered saline (PBS). 9. Styrofoam box.

Detection of PINK1-Parkin Signaling in iPS Cells

2.2 Lentiviral Infection of GFP-Parkin in Dopaminergic Neuron Culture

83

1. Round glass coverslips (Fig. 1a, 10 mm in diameter, 0.13–0.17 mm in thickness). 2. Glass petri dish. 3. Shaker. 4. Aluminum foil. 5. Dry Oven. 6. 3
poly-L-ornithine solution: Dissolve 50 mg poly-L-ornithine (Sigma-Aldrich) in 333 ml sterile water and filtrate with a 500 ml Vacuum Filter/Storage Bottle System (Corning). Aliquot 15 ml in 50-ml tubes and store at 20  C. 7. 50
fibronectin solution: 0.5 mg/ml fibronectin (Corning) in sterile water. Store at 20  C in 500 μl aliquots. 8. 48-well cell culture plates. 9. Tweezers (for coverslips). 10. TrypLE Select (Thermo Fisher Scientific). 11. Polybrene stock solution: Prepare 8 mg/ml hexadimethrin bromide (Sigma-Aldrich) stock in PBS. Filter sterilize and aliquot into small tubes. Store at 20  C.

2.3 PINK1-Parkin Activation by Mitochondrial Uncouplers 2.4 Immunostaining and Imaging of Dopaminergic Neuron Culture

1. Antimycin A and oligomycin A (A/O) stock solution: Dissolve 2 mM in each in DMSO. Store at 20  C. 2. 4
fixative solution: 16% paraformaldehyde dissolved in PBS. Prepare before use. 1. Digitonin stock: Dissolve 10 mg/ml in DMSO. Store at RT. 2. Permeabilization solution: Add digitonin stock to a final concentration of 50 μg/ml in PBS. 3. Blocking solution: Add 0.1% (w/v) gelatin (Sigma-Aldrich) to PBS and dissolve at 60  C. Prepare before use and bring back to RT. 4. Primary antibody solution: Rabbit anti-Tom20 (Santa Cruz Biotechnology, 1:1000 dilution) and mouse anti-tyrosine hydroxylase (Millipore, 1:500 dilution) diluted in blocking solution. 5. Parafilm coverslip: Cut parafilm to fit the well size (Fig. 1b; see Note 3). 6. PBS-T: PBS containing 0.05% Tween 20. 7. Aluminum foil. 8. DAPI (40 ,6-diamidino-2-phenylindole dihydrochloride) stock solution: Dissolve at 1 mg/ml in distilled water. Protect from light and store at 20  C.

84

Kahori Shiba-Fukushima and Yuzuru Imai

Fig. 1 Overview of the glass coverslip and preparation for imaging. (a) Round glass coverslip treated with the coating solution for dopaminergic neuron culture. (b) Parafilm coverslip for immunostaining in 48-well cell culture plates. (c) Bent needle. (d) Lift up the glass coverslip using a bent needle to avoid damaging the dopaminergic neuron culture. (e) Dopaminergic neurons cultured on a glass coverslip were placed on a slide glass and sealed with mounting medium, cover glass and nail polish

9. The secondary antibody solution: Alexa Fluor 568-conjugated goat anti-rabbit IgG (Thermo Fisher Scientific, 1:1000 dilution), Alexa Fluor 647-conjugated goat anti-mouse IgG (Thermo Fisher Scientific, 1:1000 dilution), FITC-conjugated goat anti-GFP antibody (Abcam, 1:1000 dilution), and 1 μg/ ml DAPI diluted in blocking solution. 10. 27-Gauge needle: Bend needle as shown in Fig. 1c. 11. Mounting medium. 12. Cover glass (18
18 mm, 0.13–0.17 mm in thickness). 13. Clear nail polish. 14. Confocal laser scanning microscope.

Detection of PINK1-Parkin Signaling in iPS Cells

2.5 Detection of PINK1, Parkin, and Phosphorylated Ubiquitin by Western Blot

85

1. 3
poly-L-ornithine solution: see Subheading 2.2. 2. 50
fibronectin solution: see Subheading 2.2. 3. Six-well cell culture plates. 4. TrypLE Select (Thermo Fisher Scientific). 5. 1.5-ml tube. 6. RIPA buffer: 50 mM Tris–HCl (pH 7.6), 150 mM NaCl, 1% Nonidet P40, 0.5% Sodium deoxycholate, 0.1% SDS. 7. Protease inhibitor cocktail (100
). 8. Phosphatase inhibitor cocktail (100
). 9. Bicinchoninic acid (BCA) assay kit (Thermo Fisher Scientific). 10. SDS-PAGE/western blot system. 11. TBS-T: TBS containing 0.05% Tween 20. 12. Blocking solution: TBS-T containing 5% bovine serum albumin (BSA). 13. Primary antibodies: anti-PINK1 (Cell Signaling Technology, 1:1000 dilution), anti-Parkin (Cell Signaling Technology, 1:1000 dilution), anti-phospho (Ser65)-ubiquitin (Cell Signaling Technology, 1:1000 dilution), and anti-ubiquitin (Santa Cruz Biotechnology, 1:1000 dilution). Dilute antibodies in the blocking solution. 14. Secondary antibody and detection solution (see Note 4).

3

Methods

3.1 Preparation of GFP-Parkin Lentivirus

1. Seed 5.0
106 HEK293FT cells/10 ml cell culture medium into a 10-cm dish. Incubate cells at 37  C in a 5% CO2 atmosphere in an incubator overnight. 2. Cotransfect HEK293FT cells with pLVSIN-CMV Pur-GFPParkin and Lentiviral High Titer Packaging Mix using Lipofectamine 2000 according to the manufacturer’s protocol (see Note 5). 3. Replace with 10 ml fresh cell culture medium. 4. Approximately 48 h post transfection, the cell culture medium, which contains lentivirus particles, should be harvested (see Note 6). 5. Filter the cell culture medium (viral supernatant) using a syringe filter at a rate of 1 drop/s in a 15-ml tube (see Note 7). 6. Add 1 volume of ice-cold Lenti-X Concentrator to three volumes of the filtered viral supernatant. 7. Gently mix the viral supernatant. 8. Incubate the viral supernatant at 4  C overnight (see Note 8).

86

Kahori Shiba-Fukushima and Yuzuru Imai

9. Centrifuge the tube containing the viral supernatant at 1500
g for 45 min at 4  C. 10. Discard the supernatant. 11. Centrifuge the tube at 1500
g for 1 min at 4  C. 12. Discard the entire supernatant (see Note 9). 13. Add 100 μl (1/100 of the original volume) PBS and gently resuspend the pellet. 14. Samples are immediately titrated using a titration kit (e.g., Lenti-X qRT-PCR Titration Kit or Lenti-X p24 Rapid Titer Kit) or stored at 80  C in single-use aliquots. 3.2 Lentiviral Infection of GFP-Parkin in Dopaminergic Neuron Culture

1. Place the round glass coverslips in a glass petri dish containing absolute ethanol. Shake the petri dish gently overnight at RT. 2. Discard absolute ethanol and warp the petri dish containing the round glass coverslips with aluminum foil. 3. Bake the round glass coverslips in the petri dish at 180  C for 2 h. 4. Add 30 ml PBS to a 50-ml tube containing 15 ml 3
poly-Lornithine solution. 5. Place the round glass coverslips in a 48-well plate (Fig. 1a) and incubate the round glass coverslips with 500 μl 1
poly-Lornithine solution overnight. 6. Aspirate the poly-L-ornithine solution and wash twice with 1 ml PBS. 7. Dilute 500 μl 50
fibronectin solution into 25 ml PBS. 8. Coat with 500 μl fibronectin solution overnight. 9. Aspirate the fibronectin solution from the 48-well plate. 10. Dissociate neurospheres prepared from iPS cells using TrypLE Select (see Note 10). Seed a 500 μl cell suspension with 8.9
104 cells/well into a 48-well cell culture plate to allow cells to differentiate into dopaminergic neurons (see Note 10). 11. Add 1/100 (5 μl) lentivirus solution and 1/1000 (0.5 μl) polybrene stock solution to the cell culture medium volume in the dopaminergic neuron culture from Subheading 3.1 step 14 (see Note 11). 12. Incubate the dopaminergic neuron culture for 48 h.

3.3 PINK1-Parkin Activation by Mitochondrial Uncouplers

1. Add 1/1000 A/O stock solution (working concentration is 2 μM each) to the dopaminergic neuron culture and incubate for 6–24 h. 2. Fix the dopaminergic neuron culture in 170 μl 4
fixative solution for 15 min at RT (see Note 12).

Detection of PINK1-Parkin Signaling in iPS Cells

3.4 Immunostaining and Imaging of Dopaminergic Neuron Culture

87

1. Remove the medium containing fixative solution. 2. Wash the culture twice with 1 ml PBS (see Note 13). 3. Incubate the culture with 300 μl permeabilization solution at RT for 15 min. 4. Remove the permeabilization solution and wash with 1 ml PBS. 5. Incubate the culture with blocking solution at RT for 30 min. 6. Add 100 μl primary antibody solution to the culture. Place parafilm coverslips on the culture and incubate at 4  C overnight (see Note 3). 7. Add 500 μl PBS-T and remove parafilm coverslips on PBS-T using tweezers. 8. Wash the culture with PBS-T three times for 10 min each (see Note 14). 9. Add 300 μl secondary antibody solution to the culture. Protect it from light with aluminum foil and incubate at RT for 1 h. 10. Wash the culture twice with 500 μl PBS-T for 10 min each. 11. Add 500 μl PBS to the culture. 12. Lift up the round glass coverslip with a bent needle (Fig. 1c, d) and pick up the glass coverslip with tweezers. 13. Turn up the culture side of the round glass coverslip and put it on a slide glass (Fig. 1e). 14. Drop the mounting medium, and place the coverslip (Fig. 1e). 15. Seal the coverslip with clear nail polish and a cover glass (Fig. 1e). 16. Analyze the stained culture by confocal laser scanning microscope. Typical images are shown in Fig. 2.

Fig. 2 Dopaminergic neurons, where GFP-Parkin (green) was virally introduced, were treated with (right) or without (left) antimycin A and oligomycin A (2 μM each) for 8 h. GFP-Parkin colocalization with the TOM20 signal (red), indicating that Parkin was translocated to the mitochondria. Scale bar ¼ 25 μm

88

Kahori Shiba-Fukushima and Yuzuru Imai

3.5 Detection of PINK1, Parkin, and Phosphorylated Ubiquitin by Western Blot

1. Coat a six-well plate with 1 ml of 1
poly-L-ornithine solution overnight, as shown in Subheading 3.2. 2. Aspirate the poly-L-ornithine solution and wash twice with 4 ml PBS. 3. Coat with 1 ml fibronectin solution overnight as shown in Subheading 3.2. 4. Aspirate the fibronectin solution. 5. Dissociate neurospheres prepared from iPS cells using TrypLE Select (see Note 10). Seed a 2 ml cell suspension with 8.8
105 cells/well into a 48-well cell culture plate for differentiation into dopaminergic neurons. 6. Treat dopaminergic neuron culture with 1/1000 A/O stock solution (working concentration is 2 μM each) or DMSO as a mock treatment and incubate for 6–24 h. 7. Wash cells twice with 2 ml PBS. 8. Harvest cells in a 1.5-ml tube by gentle pipetting and centrifuge at 200
g for 5 min. 9. Discard the supernatant. 10. Add five volumes (approximately 100 μl) of RIPA buffer containing 1
protease inhibitor cocktail and 1
phosphatase inhibitor cocktail to the cell pellet. 11. Suspend cells by gentle pipetting and incubate on ice for 15 min. 12. Centrifuge at 12,000
g for 10 min and transfer the supernatant to a new 1.5-ml tube. 13. Determine the protein concentration of the supernatant (cell lysate) using a BCA assay kit. 14. Apply 20 μg/lane of protein in SDS-sample buffer in a mini acrylamide gel (12 lanes, 80 mm (W)
70 mm (H), thickness: 1 mm). 15. Resolve proteins using a standard SDS-PAGE/western blot method. 16. Incubate the transferred PVDF membrane in 25 ml blocking solution at RT for 30 min (see Note 15). 17. Dilute primary antibodies in 5 ml blocking solution. 18. Incubate membranes with 5 ml primary antibody solution at 4  C overnight. 19. Wash membranes three times with 25 ml TBS-T for 15 min each. 20. Incubate membranes with horseradish peroxidase (HRP)conjugated secondary antibody at RT for 1 h.

Detection of PINK1-Parkin Signaling in iPS Cells

89

Fig. 3 Condensed dopaminergic neuron cultures were treated with compound 1 (cpd 1), cpd 2 or antimycin A and oligomycin A (AO, 2 μM each) for 8 or 20 h. The indicated proteins were analyzed by western blot. Treatment with AO or cpd 2 led to accumulation of PINK1 and phosphorylation of Parkin and ubiquitin, indicating that PINK1 and Parkin were activated

21. Wash membranes three times with 25 ml TBS-T for 15 min each. 22. Incubate membrane with a chemiluminescence reagent to detect bands (Fig. 3).

4

Notes 1. GFP-Parkin was cloned into the pLV-SIN Puro vector (Takara). There are currently no commercially available anti-Parkin antibodies to detect endogenous Parkin by immunocytochemistry. GFP-Parkin was used to monitor Parkin dynamics.

90

Kahori Shiba-Fukushima and Yuzuru Imai

2. Do not use nitrocellulose filters. Nitrocellulose binds surface proteins on the lentiviral envelope and destroys the virus. 3. The parafilm coverslip suppresses the surface tension of the antibody solution in the wells of the cell culture plates. Do not trap air bubbles between the coverslip and the culture. 4. Any detection protocols for western blot can be used. We routinely use HRP-conjugated secondary antibodies and ECL solution (GE Healthcare). 5. Lentivirus particles are produced by this transfection. You should check the biosafety level and regulation of your institute in terms of the lentivirus production and infection. 6. Handle the medium in a biological safety cabinet. 7. Filter the medium slowly to avoid damaging lentivirus particles. 8. Seal the tube cap with parafilm to avoid leaks in the lentivirus solution, and place the tube horizontally on a Styrofoam box containing ice. Shake the Styrofoam box gently in a cold room overnight. 9. The resultant white pellet contains lentivirus particles. 10. Refer to chapter ‘Differentiation of midbrain dopaminergic neurons from human iPS cells’ for neurosphere preparation from iPS cells and differentiation into dopaminergic neurons. 11. Polybrene is a cationic agent that is thought to shield the negative surface charges of viruses and cells, thus increasing transduction efficiency by decreasing repulsion. 12. Before fixation, the 4
fixative solution was returned to RT. 13. PBS is slowly added to the wall of the well to avoid detaching the culture from the surface. 14. PBS-T treatment tends to weaken the attachment of neuron cultures on the round glass coverslip. Handle the cultures very carefully. 15. For blocking solution, PBS-T containing 5% skim milk can be used for nonphosphoprotein detection. Skim milk is stronger than BSA in terms of blocking ability.

Acknowledgments This work was supported by Grants-in-Aid for Scientific Research (20K07910 to K.S-F. and 20H03453 and 20K21531 to Y.I.) from the Japan Society for the Promotion of Science (JSPS).

Detection of PINK1-Parkin Signaling in iPS Cells

91

References 1. Kitada T, Asakawa S, Hattori N, Matsumine H, Yamamura Y, Minoshima S, Yokochi M, Mizuno Y, Shimizu N (1998) Mutations in the parkin gene cause autosomal recessive juvenile parkinsonism. Nature 392 (6676):605–608. https://doi.org/10.1038/ 33416 2. Valente EM, Abou-Sleiman PM, Caputo V, Muqit MM, Harvey K, Gispert S, Ali Z, Del Turco D, Bentivoglio AR, Healy DG, Albanese A, Nussbaum R, GonzalezMaldonado R, Deller T, Salvi S, Cortelli P, Gilks WP, Latchman DS, Harvey RJ, Dallapiccola B, Auburger G, Wood NW (2004) Hereditary early-onset Parkinson’s disease caused by mutations in PINK1. Science 304(5674):1158–1160. https://doi.org/10. 1126/science.1096284 3. Clark IE, Dodson MW, Jiang C, Cao JH, Huh JR, Seol JH, Yoo SJ, Hay BA, Guo M (2006) Drosophila pink1 is required for mitochondrial function and interacts genetically with parkin. Nature 441(7097):1162–1166. https://doi. org/10.1038/nature04779 4. Park J, Lee SB, Lee S, Kim Y, Song S, Kim S, Bae E, Kim J, Shong M, Kim JM, Chung J (2006) Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature 441(7097):1157–1161. https://doi.org/10.1038/nature04788 5. Yang Y, Gehrke S, Imai Y, Huang Z, Ouyang Y, Wang JW, Yang L, Beal MF, Vogel H, Lu B (2006) Mitochondrial pathology and muscle and dopaminergic neuron degeneration caused by inactivation of Drosophila Pink1 is rescued by Parkin. Proc Natl Acad Sci U S A 103 (28):10793–10798. https://doi.org/10. 1073/pnas.0602493103 6. Narendra DP, Jin SM, Tanaka A, Suen DF, Gautier CA, Shen J, Cookson MR, Youle RJ (2010) PINK1 is selectively stabilized on impaired mitochondria to activate Parkin. PLoS Biol 8(1):e1000298. https://doi.org/ 10.1371/journal.pbio.1000298 7. Matsuda N, Sato S, Shiba K, Okatsu K, Saisho K, Gautier CA, Sou YS, Saiki S, Kawajiri S, Sato F, Kimura M, Komatsu M, Hattori N, Tanaka K (2010) PINK1 stabilized by mitochondrial depolarization recruits Parkin to damaged mitochondria and activates latent Parkin for mitophagy. J Cell Biol 189 (2):211–221. https://doi.org/10.1083/jcb. 200910140 8. Pickrell AM, Huang CH, Kennedy SR, Ordureau A, Sideris DP, Hoekstra JG, Harper JW, Youle RJ (2015) Endogenous Parkin

preserves dopaminergic substantia nigral neurons following mitochondrial DNA mutagenic stress. Neuron 87(2):371–381. https://doi. org/10.1016/j.neuron.2015.06.034 9. Pimenta de Castro I, Costa AC, Lam D, Tufi R, Fedele V, Moisoi N, Dinsdale D, Deas E, Loh SH, Martins LM (2012) Genetic analysis of mitochondrial protein misfolding in Drosophila melanogaster. Cell Death Differ 19 (8):1308–1316. https://doi.org/10.1038/ cdd.2012.5 10. Liu S, Sawada T, Lee S, Yu W, Silverio G, Alapatt P, Millan I, Shen A, Saxton W, Kanao T, Takahashi R, Hattori N, Imai Y, Lu B (2012) Parkinson’s disease-associated kinase PINK1 regulates Miro protein level and axonal transport of mitochondria. PLoS Genet 8(3): e1002537. https://doi.org/10.1371/journal. pgen.1002537 11. Wang X, Winter D, Ashrafi G, Schlehe J, Wong YL, Selkoe D, Rice S, Steen J, LaVoie MJ, Schwarz TL (2011) PINK1 and Parkin target Miro for phosphorylation and degradation to arrest mitochondrial motility. Cell 147 (4):893–906. https://doi.org/10.1016/j.cell. 2011.10.018 12. Jin SM, Lazarou M, Wang C, Kane LA, Narendra DP, Youle RJ (2010) Mitochondrial membrane potential regulates PINK1 import and proteolytic destabilization by PARL. J Cell Biol 191(5):933–942. https://doi.org/10. 1083/jcb.201008084 13. Okatsu K, Kimura M, Oka T, Tanaka K, Matsuda N (2015) Unconventional PINK1 localization to the outer membrane of depolarized mitochondria drives Parkin recruitment. J Cell Sci 128(5):964–978. https://doi.org/10. 1242/jcs.161000 14. Kondapalli C, Kazlauskaite A, Zhang N, Woodroof HI, Campbell DG, Gourlay R, Burchell L, Walden H, Macartney TJ, Deak M, Knebel A, Alessi DR, Muqit MM (2012) PINK1 is activated by mitochondrial membrane potential depolarization and stimulates Parkin E3 ligase activity by phosphorylating serine 65. Open Biol 2(5):120080. https://doi.org/10.1098/rsob.120080 15. Shiba-Fukushima K, Imai Y, Yoshida S, Ishihama Y, Kanao T, Sato S, Hattori N (2012) PINK1-mediated phosphorylation of the Parkin ubiquitin-like domain primes mitochondrial translocation of Parkin and regulates mitophagy. Sci Rep 2:1002. https://doi.org/ 10.1038/srep01002 16. Koyano K, Okatsu K, Kosako H, Tamura Y, Go E, Kimura M, Kimura Y, Tsuchiya H,

92

Kahori Shiba-Fukushima and Yuzuru Imai

Yoshihara H, Hirokawa T, Endo T, Fon E, Trempe J-F, Saeki Y, Tanaka K, Matsuda N (2014) Ubiquitin is phosphorylated by PINK1 to activate parkin. Nature 510 (7503):162–166. https://doi.org/10.1038/ nature13392 17. Kane LA, Lazarou M, Fogel AI, Li Y, Yamano K, Sarraf SA, Banerjee S, Youle RJ (2014) PINK1 phosphorylates ubiquitin to activate Parkin E3 ubiquitin ligase activity. J Cell Biol 205(2):143–153. https://doi.org/ 10.1083/jcb.201402104 18. Ordureau A, Sarraf SA, Duda DM, Heo JM, Jedrychowski MP, Sviderskiy VO, Olszewski JL, Koerber JT, Xie T, Beausoleil SA, Wells JA, Gygi SP, Schulman BA, Harper JW (2014) Quantitative proteomics reveal a feedforward mechanism for mitochondrial PARKIN translocation and ubiquitin chain synthesis. Mol Cell 56(3):360–375. https:// doi.org/10.1016/j.molcel.2014.09.007 19. Shiba-Fukushima K, Arano T, Matsumoto G, Inoshita T, Yoshida S, Ishihama Y, Ryu KY, Nukina N, Hattori N, Imai Y (2014) Phosphorylation of mitochondrial polyubiquitin by PINK1 promotes Parkin mitochondrial tethering. PLoS Genet 10(12):e1004861. https:// doi.org/10.1371/journal.pgen.1004861 20. Tanaka A, Cleland MM, Xu S, Narendra DP, Suen DF, Karbowski M, Youle RJ (2010) Proteasome and p97 mediate mitophagy and degradation of mitofusins induced by Parkin. J Cell Biol 191(7):1367–1380. https://doi.org/10. 1083/jcb.201007013 21. Lazarou M, Sliter DA, Kane LA, Sarraf SA, Wang C, Burman JL, Sideris DP, Fogel AI, Youle RJ (2015) The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature 524(7565):309–314. https:// doi.org/10.1038/nature14893

22. Imaizumi Y, Okada Y, Akamatsu W, Koike M, Kuzumaki N, Hayakawa H, Nihira T, Kobayashi T, Ohyama M, Sato S, Takanashi M, Funayama M, Hirayama A, Soga T, Hishiki T, Suematsu M, Yagi T, Ito D, Kosakai A, Hayashi K, Shouji M, Nakanishi A, Suzuki N, Mizuno Y, Mizushima N, Amagai M, Uchiyama Y, Mochizuki H, Hattori N, Okano H (2012) Mitochondrial dysfunction associated with increased oxidative stress and alpha-synuclein accumulation in PARK2 iPSC-derived neurons and postmortem brain tissue. Mol Brain 5:35. https://doi.org/10.1186/1756-6606-5-35 23. Shiba-Fukushima K, Ishikawa KI, Inoshita T, Izawa N, Takanashi M, Sato S, Onodera O, Akamatsu W, Okano H, Imai Y, Hattori N (2017) Evidence that phosphorylated ubiquitin signaling is involved in the etiology of Parkinson’s disease. Hum Mol Genet 26 (16):3172–3185. https://doi.org/10.1093/ hmg/ddx201 24. Yamaguchi A, Ishikawa KI, Inoshita T, ShibaFukushima K, Saiki S, Hatano T, Mori A, Oji Y, Okuzumi A, Li Y, Funayama M, Imai Y, Hattori N, Akamatsu W (2020) Identifying therapeutic agents for amelioration of mitochondrial clearance disorder in neurons of familial Parkinson disease. Stem Cell Reports 14(6):1060–1075. https://doi.org/10.1016/ j.stemcr.2020.04.011 25. Shiba-Fukushima K, Inoshita T, Sano O, Iwata H, Ishikawa KI, Okano H, Akamatsu W, Imai Y, Hattori N (2020) A cell-based high-throughput screening identified two compounds that enhance PINK1Parkin signaling. iScience 23(5):101048. https://doi.org/10.1016/j.isci.2020.101048

Part II Mammalian Models of Parkinson’s Disease

Chapter 10 Generation of Mitochondrial Toxin Rodent Models of Parkinson’s Disease Using 6-OHDA, MPTP, and Rotenone Hiroharu Maegawa and Hitoshi Niwa Abstract Several animal models are employed to discover novel treatments for the symptoms of Parkinson’s disease (PD). PD models can be divided into two models: neurotoxin models and genetic models. Among neurotoxins to produce PD models, 6-hydroxydopamine (6-OHDA), 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), and rotenone, which inhibit the mitochondrial complex I, are widely used. Animal models of PD using these neurotoxins are also known as mitochondrial toxin models. Here this chapter describes the preparation of these mitochondrial toxin models. Key words 6-Hydroxydoopamine (6-OHDA), 1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), Rotenone, Mitochondrial complex I, Rat, Mouse

1

Introduction For the past several decades, animal models of Parkinson’s disease (PD) have generated in a variety of forms [1]. Animal models of PD produced by neurotoxins, such as 6-hydroxydopamine (6-OHDA), 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), and rotenone, are called mitochondrial toxin models. These PD models are widely used to reproduce the typical motor symptoms of idiopathic PD [2, 3]. Literature indicates 6-OHDA and MPTP, which specifically target catecholaminergic neurons such as the midbrain dopaminergic neurons, are the most widely used to generate mitochondrial toxin rodent models of PD [4]. Rotenone, which causes the chronic production of reactive oxygen species (ROS) from the mitochondria, is also widely used to generate another rodent model [5]. A highly oxidizable dopamine analog 6-OHDA, which was first isolated in the 1950s [6], has been used to produce the lesion of nigro-striatal pathway in rats since that time [7]. Because 6-OHDA does not cross the blood–brain

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_10, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

95

96

Hiroharu Maegawa and Hitoshi Niwa

barrier (BBB), its unilateral stereotaxic injection is an essential step [8]. Delivered 6-OHDA is incorporated via the monoamine transporters and induces neuronal death through oxidative stress caused by the inhibition of mitochondrial complex I and H2O2 generation by its autoxidation [9]. MPTP was discovered as a by-product in the synthesis of narcotics [10]. MPTP is highly lipophilic and crosses the BBB [1]. After systemic administration, MPTP is converted to 1-methyl-4-phenyl-2,3-dihydropyridinium (MPDP+) by monoamine oxidase B in astrocytes. MPDP+ is oxidized to a toxic metabolite 1-methyl-4-phenylpyridinium (MPP+) and taken into dopaminergic neurons via the dopamine transporters. MPP+ inhibits the mitochondrial complex I of dopaminergic neurons, selectively eliminating these neurons [11–14]. Rotenone, which is a pesticide from roots of the family Leguminosae [15], is lipophilic and crosses the BBB [1]. Rotenone inhibits the mitochondrial complex I of most cells [16]. This chapter describes the generation of rodent PD models by using 6-OHDA, MPTP and rotenone.

2 2.1

Materials 6-OHDA Injection

1. Rats: (see Note 1). 2. 0.01% sodium ascorbate solution: Dissolve sodium ascorbate in sterile saline. Store at 4
C. 3. Sterile saline: 154 mM NaCl in distilled water, autoclaved. Store at room temperature. 4. 6-OHDA hydrobromide: Store at 20
C. 5. Desipramine hydrochloride: Store at room temperature. 6. Methamphetamine: 3 mg/mL. Store at a fixed safe-box according to regulation of the institution. Store at room temperature. 7. Disposable plastic tuberculin syringe with 27-gauge needles. 8. Microinjection pump. 9. Polyethylene tube: Inner diameter, 0.28 mm. 10. 30-Gauge needle (for a cannula of 6-OHDA injection). 11. Stereotaxic apparatus. 12. Tweezers. 13. Scalpel. 14. Suture needle. 15. Needle holder. 16. Dental drill.

Protocol for the Mitochondrial Toxin Models of Parkinson’s Disease

97

17. Bone wax. 18. Sutures. 19. Scale for weighing rats. 20. Microbalance for weighing 6-OHDA. 21. Warming pad. 2.2 Immunohistochemistry for Tyrosine Hydroxylase (TH)

1. Phosphate-buffered saline (PBS): 1.47 mM KH2PO4, 2.68 mM KCl, 7.75 mM Na2KPO4, 0.137 M NaCl, pH 7.4. Store at room temperature. 2. Paraformaldehyde solution: 4% solution in PBS (see Note 2). Store at 4
C. 3. Sucrose solution: 30% solution in Milli-Q water. 4. Peristatic pump. 5. Freezing microtome. 6. 12-Well cell culture plates. 7. Shaker for incubation of tissue sections. 8. Methanol: Store at room temperature. 9. Blocking solution: 10% normal horse serum and 1% TritonX100 in PBS: Store at 4
C. 10. Anti-TH antibody: Store at 20
C. 11. Biotinylated secondary antibody: Store at 4
C. 12. VECTASTAIN® ABC kit (Vector): Store at 4
C (see Note 3). 13. DAB substrate kit (Vector): Store at 4
C (see Note 4). 14. Hydrogen peroxide: 30%. Store at 4
C. 15. Gelatin-coated glass slides. 16. Mounting medium. 17. Cover glasses. 18. Light microscope.

2.3 MPTP Administration

1. Mice (see Note 5). 2. Sterile saline: 154 mM NaCl in distilled water, autoclaved. Store at room temperature. 3. MPTP powder: Store at room temperature (see Note 6). 4. Sodium hypochlorite: 1% solution in water. 5. A negative-pressure procedure room (temperature 22–27
C) with a sink and a fume hood approved by the institution’s animal care and use committee. 6. A fixed safe-box to store the stock of MPTP powder. 7. Protective gear [17] (see Note 7). 8. Scale for weighing mice.

98

Hiroharu Maegawa and Hitoshi Niwa

9. Microbalance for weighing MPTP. 10. Disposable plastic tuberculin syringes with 27-gauge needles for the injections. 11. Osmotic minipumps (Alzet 2004, DURECT Corporation, Cupertino, CA): required for MPTP infusion [18]. 12. Flow moderators (Alzet 0002486): required for MPTP infusion [18]. 13. Filling tubes infusion [18].

(Alzet

0007987):

required

for

MPTP

14. Tweezers. 15. Scalpel. 16. Suture needle. 17. Needle holder. 18. Dissolvable sutures: required for MPTP infusion. 19. Warming pad: required for MPTP infusion. 20. Clean mouse cages. 2.4

Rotenone

1. Rats (see Note 8). 2. Rotenone: store at room temperature (see Note 9). 3. Solvent to dissolve rotenone (see Note 10). 4. Sodium hypochlorite: 1% solution in water. 5. A negative-pressure procedure room (temperature at 22–27
C) with a sink and a fume hood approved by the institution’s animal care and use committee. 6. A fixed safe-box to store rotenone. 7. Protective gear: [17] (see Note 7). 8. Scale for weighing rats. 9. Microbalance for weighing rotenone. 10. Stereotaxic apparatus. 11. Dental drill. 12. Bone wax. 13. Scalpel. 14. Tweezers. 15. Suture needle. 16. Needle holder. 17. Disposable plastic tuberculin syringes with 27-gauge needles for the injections. 18. Microinjection pump: required for rotenone injection. 19. Polyethylene tube: inner diameter, 0.28 mm, required for rotenone injection.

Protocol for the Mitochondrial Toxin Models of Parkinson’s Disease

99

20. 30-Gauge needle (used as a cannula for rotenone injection). 21. Osmotic minipumps and its flow moderator (Alzet 2ML4 or 2ML1, DURECT Corporation, Cupertino, CA): required for rotenone infusion [19]. 22. Dissolvable sutures: required for rotenone infusion. 23. Warming pad: required for rotenone infusion.

3

Methods Carry out all procedures at room temperature unless otherwise specified.

3.1

6-OHDA Injection

1. Weigh rats with a scale. 2. Calculate the required amount of desipramine hydrobromide, and dissolve it in sterile saline (e.g. 20 mg in 2.5 mL). Thirty minutes prior to 6-OHDA injection, administrate this solution (20 mg/kg) intraperitoneally to rats (see Note 11). 3. Dissolve 2–3 mg of 6-OHDA hydrobromide (weighed with microbalance) in 1 mL of 0.01% sodium ascorbate solution (see Note 12). 4. Set an anesthetized rat in stereotaxic apparatus with the incisor bar set 2.4 mm below the level of the ear bars. Place a warming pad under the body of rat. Cut the head skin with a scalpel and drill a hole to the skull just above the injection site of 6-OHDA hydrobromide by a dental drill. For example, when 6-OHDA is injected into the medial forebrain bundle, stereotaxic coordinates are 3.3 mm rostral to the interaural line, 1.4 mm left or right of the midline, and 6.8 and 6.5 mm (two injections, 2 μL each) ventral to the dural surface [20] (Fig. 1) (see Note 13). Connect a 30-gauge needle (cannula) to polyethylene tube, and connect the tube to tuberculin syringe with a 27-gauge needle. Inject 6-OHDA hydrobromide solution through a cannula with a microinjection pump at 1 μL/min. Leave the cannula in place for 5 min after the completion of injection (see Note 14). 5. After the removal of a cannula, fill the hole with bone wax and suture the wound with tweezers, sutures, a suture needle, and needle holder. 6. Two weeks after the injection of 6-OHDA hydrobromide, administrate methamphetamine (3 mg/kg) intraperitoneally. When dopaminergic axonal degeneration occurs, rats show rotational behavior toward the ipsilateral side of the 6-OHDA injection following methamphetamine administration (see Note 15). Rats that show rotational behavior are considered as PD model rats.

100

Hiroharu Maegawa and Hitoshi Niwa

Fig. 1 Surgery for the injection of 6-OHDA solution into the medial forebrain bundle. The center of the hole is 3.3 mm rostral to the interaural line and 1.4 mm left to the midline 3.2 Immunohistochemistry for TH

1. Anesthetize rats deeply. 2. Perfuse rats transcardially with PBS (e.g., 100 mL for a 300 g rat) followed by the paraformaldehyde solution (e.g., 300 mL for a 300 g rat) using a peristatic pump. 3. Remove brain tissues and immerse them in the paraformaldehyde solution overnight. Transfer them to the sucrose solution. 4. Freeze the brain tissues in sucrose solution by using dry ice. 5. Slice serial coronal sections using a freezing microtome (e.g., at 50 μm thickness). Collect the sections containing the striatum and substantia nigra in a 12-well cell culture plate filled with PBS (Fig. 2). 6. Incubate sections in 0.3% hydrogen peroxide in methanol for 20 min using a shaker. 7. Remove the above solution, and rinse sections with PBS three times for 5 min each using a shaker. 8. Immerse sections in the blocking solution for 30 min using a shaker. 9. Remove the blocking solution, and rinse sections with PBS three times for 5 min each using a shaker. 10. Incubate sections with anti-TH antibody diluted with the blocking solution for 12 h using a shaker. 11. Remove the first antibody solution, and rinse sections with PBS three times for 5 min each using a shaker. 12. Incubate sections in biotinylated secondary antibody diluted (e.g., at 1:200) with 1.5% normal horse serum in PBS for 1 h using a shaker.

Protocol for the Mitochondrial Toxin Models of Parkinson’s Disease

101

Fig. 2 Collected sections containing the striatum and substantia nigra in a 12-well cell culture plate filled with PBS

13. Remove the second antibody solution, and wash sections with PBS three times for 5 min each using a shaker. 14. Incubate sections using VECTASTAIN ® ABC kit (1% avidin and 1% biotinylated horseradish peroxidase [HRP] in PBS) for 1 h using a shaker. 15. Remove the above solution, and wash sections with PBS three times for 5 min each using a shaker. 16. React sections with DAB substrate kit (0.05% diaminobenzidine tetrahydrochloride, 0.1% ammonium nickel sulfate, and 0.01% hydrogen peroxide in Tris–HCl buffer provided in the kit). 17. To stop the reaction, remove the above solution and rinse sections with PBS three times for 5 min each using a shaker. 18. Mount sections on gelatin-coated glass slides. Air-dry the sections and mount cover glasses using mounting medium. 19. Examine prepared specimens under light microscopy. Reduced TH-immunoreactivity in the striatum and substantia nigra is observed in the 6-OHDA injection side (Fig. 3). 3.3 MPTP Administration

1. Weigh mice with a scale. 2. MPTP can be injected by several methods [A: subcutaneous (s.c.) or intraperitoneal (i.p.)] or infusion (B) (see Note 16). Handle MPTP in a negative-pressured room. 3. (A) Determine the total volume of MPTP solution needed for the administration. MPTP is administrated at a dose of 20 mg/ kg [18] (see Note 17). Inject approximately 10 μL solution per 1 g body weight. When five mice (25 g each) receive four injections, the total amount of MPTP is 0.025 kg  20 mg/ kg  5  4 ¼ 10 mg. The total volume of sterile saline is 10 μL/g  25  5  4 ¼ 5 mL.

102

Hiroharu Maegawa and Hitoshi Niwa

Fig. 3 Photomicrographs of the striatum and substantia nigra in rats with saline or 6-OHDA injection into the medial forebrain bundle following immunohistochemical staining for tyrosine hydroxylase (TH). Reduction of TH immunoreactivity is observed in the striatum and substantia nigra on the 6-OHDA-injectioned side. Scale bar ¼ 1 mm

4. Weigh the required amount of MPTP with a microbalance in a fume hood. 5. Dissolve MPTP in sterile saline in a protective gear (see Note 18). 6. Administrate the MPTP solution to mice according to the schedule (see Note 19). 7. (B) Determine the amount of MPTP (see Note 20). When MPTP is administrated at a dose of 50 mg/kg/day [21] for 4 weeks to a mouse (25 g), the total amount of MPTP is 50 mg/kg/day  0.025 kg  28 day ¼ 35 mg. The characteristics of Alzet osmotic minipumps is as follows: reservoir volume ¼ 200 μL, releasing rate ¼ 0.25 μL/h (¼ 6 μL/day). The minipump releases 168 μL solution containing 35 mg of MPTP for 28 days. When the volume of MPTP solution is 200 μL, the required amount of MPTP is 41.7 mg. 8. Weigh the necessary amount of MPTP with a microbalance in a fume hood. 9. Dissolve MPTP in sterile saline in the protective gear. 10. Weigh the empty osmotic pump and its flow moderator. Fill the osmotic pump with MPTP solution in a fume hood. Weigh the filled osmotic pump with flow moderator.

Protocol for the Mitochondrial Toxin Models of Parkinson’s Disease

103

11. Anesthetize mice. Shave the abdominal area. Place a warming pad under the body of mouse. Make a 1- to 1.5-cm-long incision in the mid abdomen with a scalpel. 12. Incise the peritoneal wall with a scalpel. 13. Insert a minipump into the peritoneal cavity. 14. Suture the musculoperitoneal layer with tweezers, dissolvable sutures, a suture needle and a needle holder. 15. Suture the skin incision with tweezers, dissolvable sutures, a suture needle, and a needle holder. 16. Decontaminate work area with 1% sodium hypochlorite solution [18]. Detoxicate the residual MPTP solution with 1% sodium hypochlorite solution, which can be discarded as liquid hazardous waste [18]. Discard all disposables in a biohazard bag [18]. Non-disposable tools must be decontaminated with 1% sodium hypochlorite solution and rinsed thoroughly with water [18]. 3.4 Monitoring of Mice After MPTP Administration

1. Put mice in clean cages, and isolate mice in a negative-pressured room until excretions do not contain MPTP and its metabolites [18] (see Note 21). 2. After the excretion of MPTP and its metabolites, mice for further investigation are housed in a regular animal room [18].

3.5 Histochemical Evaluation of Degenerated Dopaminergic Neurons by MPTP

3.6

Rotenone

1. Perfuse mice as described in Subheading 3.2 (e.g., 15 mL of PBS and 50 mL of paraformaldehyde solution for a 30 g mouse) (see Note 22). 2. Make sections with a freezing microtome and perform immunohistochemical staining for TH as described in Subheading 3.2. 1. Weigh rats with a scale. 2. Rotenone can be injected by several methods [A: intraperitoneal (i.p.) or B: intranigral] or infusion (C) (see Note 23). Handle rotenone in a negative-pressured room. 3. (A) Determine the total volume of rotenone solution needed for administration. For example, rotenone is administered at a dose of 2.5 mg/kg [22] (see Note 24). 4. Weigh the necessary amount of rotenone with a microbalance in a fume hood. 5. Dissolve rotenone in a solvent in a protective gear. For example, rotenone is dissolved in sunflower oil [22] (see Note 25). 6. Administrate the rotenone solution to rats according to an experimental schedule. For example, rotenone is administered once a day for 10 consecutive days [22] (see Note 26).

104

Hiroharu Maegawa and Hitoshi Niwa

7. (B) Determine the total volume of rotenone solution needed for administration. 8. Weigh the necessary amount of rotenone with a microbalance in a fume hood. 9. Dissolve rotenone in a solvent in a protective gear. For example, rotenone is dissolved in polyethylene glycol (12 μg/μL) [23, 24] (see Note 27). 10. Set an anesthetized rat in stereotaxic apparatus. Cut the head skin with a scalpel and drill a hole to the skull just above the injection site by a dental drill. Stereotaxic coordinates are 5.0 mm caudal to the bregma, 2.1 mm left and right of the midline, and 8.0 mm ventral to the skull [24] (see Note 28). Connect a 30-gauge needle (cannula) to polyethylene tube, and connect the tube to tuberculin syringe with a 27-gauge needle. Inject rotenone solution through a cannula with a microinjection pump at a rate of 0.33 μL/min for 3 min. Leave the cannula in place for 2 min after the completion of injection (see Note 14). 11. After the removal of a cannula, fill the hole with bone wax and suture the wound with tweezers, dissolvable sutures, a suture needle and a needle holder. 12. (C) Determine the amount of rotenone. Rotenone was administrated at a dose of 2–3 mg/kg per day [19, 25]. 13. Weigh the necessary amount of rotenone with a microbalance in a fume hood. 14. Dissolve rotenone in a solvent in a protective gear (see Note 29). 15. Weigh the empty Alzet osmotic pump and its flow moderator. Fill the osmotic pump with rotenone solution in a fume hood. Weigh the filled osmotic pump and its flow moderator. 16. Anesthetize rats. Place warming pad under the body of rat. Put the osmotic pump under the skin of rat back, and cannulate the right jugular vein with a scalpel, tweezers, and dissolvable sutures [19]. 17. Suture the skin incision with tweezers, dissolvable sutures, a suture needle, and a needle holder. 18. Decontaminate work area with 1% sodium hypochlorite solution [26]. Detoxicate the residual rotenone solution with 1% sodium hypochlorite solution, which can be discarded as liquid hazardous waste. Discard all disposables in a biohazard bag. Non-disposable tools must be decontaminated with 1% sodium hypochlorite solution and rinsed thoroughly with water.

Protocol for the Mitochondrial Toxin Models of Parkinson’s Disease

3.7 Histochemical Evaluation of Degenerated Dopaminergic Neurons by Rotenone

4

105

1. Perfuse rats as described in Subheading 3.2 (e.g., 15 mL of PBS and 50 mL of paraformaldehyde solution for a 30 g mouse) (see Note 30). 2. Make sections with a freezing microtome and perform immunohistochemical staining for TH as described in Subheading 3.2.

Notes 1. Although rats are frequently used for PD models, mice, cats, dogs, and monkeys are all sensitive to 6-OHDA [27–30]. Sprague-Dawley rats and Wistar rats are commonly used (e.g., [31, 32]). 2. Put on a dust mask because paraformaldehyde powder causes respiratory tract irritation. 3. This kit consists of avidin and biotinylated HRP. 4. This kit consists of Tris–HCl buffer, diaminobenzidine, hydrogen peroxide, and ammonium nickel sulphate. However, details are not described. 5. Adult male C57bl/6 mice weighing 25–30 g are commonly used [18]. MPTP used mainly in nonhuman primates and mice [33]. Rats are resistant to MPTP [34]. 6. Because MPTP causes parkinsonism in human, safety handling is important. The three most important requirements for the safe use of MPTP are personal protective gear, a negativepressured procedure room, and the proper handling and detoxification of all contaminated samples and materials [18]. 7. A one-piece garment with an attached hood, elasticized wrists, and attached boots is preferred. A full-face respirator with removable HEPA filter cartridges that is fit-tested to the individual is preferred [17]. 8. Rotenone has been administrated to a few strains of rats. For example, male Sprague-Dawley rats [19, 35], male Wistar rats [22–24], and male Lewis rats [19, 36] have been used. Lewis rats were reported to be more sensitive to rotenone then other rat strains [19]. Rotenone-induced mouse model of PD was recently reported [37], while many attempts to make lesions in mice and monkeys have not succeeded [1]. 9. Although rotenone is widely used as herbicide in private gardens, proper handling is required like MPTP [38]. 10. Several solvents can be used such as sunflower oil [22], dimethyl sulfoxide (DMSO) and medium-chain triglyceride [36], polyethylene glycol (PEG) [23, 24], PEG and DMSO [19, 25], and DMSO alone [35].

106

Hiroharu Maegawa and Hitoshi Niwa

11. Desipramine hydrochloride is administrated to protect noradrenergic neurons and fibers [20, 39]. 12. Prepare the 6-OHDA hydrobromide solution just before use. Once 6-OHDA hydrobromide is dissolved in an aqueous solution, the oxidization to diminish the activity starts. 6-OHDA is light sensitive and protect it from light [40]. Do not keep stock solutions. 13. Because 6-OHDA does not cross the BBB, direct injection of 6-OHDA into a specific brain region such as the striatum, the substantia nigra, and the medial forebrain bundle is required [41, 42]. This protocol describes the unilateral injection of 6-OHDA hydrobromide solution into the medial forebrain bundle. For the injection into the substantia nigra, stereotaxic coordinates are 3.5 mm rostral to lambda, 1.9 mm lateral of the midline, and 7.1 mm ventral from the dura. For the injection into the striatum, 9.2 mm rostral to the interaural line, lateral of the midline, and 4.5 mm ventral to from the dura. 14. This step allows for backflow prevention of the solution. 15. Rotational behavior toward the contralateral side of 6-OHDA injection is observed when apomorphine is administrated. 16. There are several different MPTP dosing regimens. One common regimen is one injection of MPTP (14 mg/kg) every 2 h for a total of four doses over an 8 h period in 1 day, which is called an acute intoxication [43]. Another popular regimen is one injection of 30 mg/kg free base MPTP daily for five consecutive days, which is called sub-acute intoxication [44]. Infusion of MPTP with an osmotic pump is called a chronic regimen [45]. 17. The molecular weight of MPTP-HCl (209.71) corresponds to 1.21-fold free base MPTP. The dose of free base MPTP (20 mg/kg) corresponds to that of MPTP-HCl (20 mg/ kg  1.21 ¼ 24.2 mg/kg). 18. MPTP solution should be kept on ice for several injections. 19. The back between scapulae of mice is an appropriate place for subcutaneous injection [18]. 20. Other dosing regimens (100 mg/kg/day [21] and 30 mg/ kg/day [45]) are also reported. 21. The interior of cage, the bodies of mice, and their excreta should be considered as contaminated materials with MPTP and its metabolite [46]. Most of unmetabolized MPTP are excreted during the first day of the injection, and MPTP metabolites are excreted up to 3 days post injection [46]. When a different regimen is used, the duration of MPTP excretion must be determined by collecting urine and extracting MPTP/MPP+ from the interior of the cages as described in a previous research [46].

Protocol for the Mitochondrial Toxin Models of Parkinson’s Disease

107

22. For acute intoxication, mice are perfused 7 days after MPTP injection [47]. For sub-acute intoxication, mice are perfused 21 days after the last MPTP injection [48]. For chronic regimen, mice are perfused 28 days after the implantation of osmotic minipumps [45]. 23. Literature reports that oral administration of rotenone does not induce neurotoxicity [1, 49, 50]. 24. Rotenone was also administered at a dose of 2.75 or 3 mg/ kg [36]. 25. Rotenone dissolved in DMSO is alternatively diluted with medium-chain triglyceride at the point of use [36]. 26. Rotenone are alternatively administered once a day for 6–10 days until rats show a PD-like motor symptom [36]. 27. Rotenone is alternatively dissolved in DMSO at different concentrations (3 μg/μL, 6 μg/μL, or 12 μg/μL) [35]. 28. Stereotaxic coordinates used in another study are 5.0 mm caudal to the bregma, 2.0 mm left and right of the midline, and 8.0 mm ventral to the skull, and the rotenone solution was injected at a rate of 0.2 μL/min for 5 min [35]. 29. Rotenone is dissolved in PEG or DMSO [19, 25]. 30. For intraperitoneal injection, rats with a PD-like motor symptom are perfused [36]. Rats treated with an intranigral injection of rotenone were perfused 30 days after rotenone injection [24]. Chronic rat models are perfused 7–35 days after the start of administration [19]. References 1. Blesa J, Phani S, Jackson-Lewis V, Przedborski S (2012) Classic and new animal models of Parkinson’s disease. J Biomed Biotechnol 2012:845618. https://doi.org/10.1155/ 2012.845618 2. Blesa J, Przedborski S (2014) Parkinson’s disease: animal models and dopaminergic cell vulnerability. Front Neuroanat 8:155. https:// doi.org/10.3389/fnana.2014.00155 3. More SV, Kumar H, Cho DY, Yun YS, Choi DK (2016) Toxin-induced experimental models of learning and memory impairment. Int J Mol Sci 17:1447. https://doi.org/10.3390/ ijms17091447 4. Kin K, Yasuhara T, Kameda M, Date I (2019) Animal models for Parkinson’s disease research: trends in the 2000s. Int J Mol Sci 20:5402. https://doi.org/10.3390/ ijms20215402 5. Johnson ME, Bobrovskaya L (2015) An update on the rotenone models of Parkinson’s

disease: their ability to reproduce the features of clinical disease and model gene-environment interactions. Neurotoxicol 46:101–116. https://doi.org/10.1016/j.neuro.2014.12. 002 6. Senoh S, Witkop B (1959) Non-enzymic conversions of dopamine to norepinephrine and trihydroxyphenethylamines. J Am Chem Soc 81:6222–6231 7. Ungerstedt U (1968) 6-hydroxy-dopamine induced degeneration of central monoamine neurons. Eur J Pharmacol 5:107–110. https://doi.org/10.1016/0014-2999(68) 90164-7 8. Konnova EA, Swanberg M (2018) Animal models of Parkinson’s disease. In: Stoker TB, Greenland JC (eds) Parkinson’s disease: pathogenesis and clinical aspects [Internet]. Codon Publications, Brisbane 9. Schober A (2004) Classic toxin-induced animal models of Parkinson’s disease: 6-OHDA and

108

Hiroharu Maegawa and Hitoshi Niwa

MPTP. Cell Tissue Res 318:215–224. https:// doi.org/10.1007/s00441-004-0938-y 10. Langston JW, Ballard P, Tetrud JW, Irwin I (1983) Chronic parkinsonism in humans due to a product of meperidine-analog synthesis. Science 219:979–980. https://doi.org/10. 1126/science.6823561 11. Javitch JA, D’Amato RJ, Strittmatter SM, Snyder SH (1985) Parkinsonism-inducing neurotoxin, N-methyl-4-phenyl-1,2,3,6tetrahydropyridine: uptake of the metabolite N-methyl-4-phenylpyridine by dopamine neurons explains selective toxicity. Proc Natl Acad Sci U S A 82:2173–2177. https://doi.org/10. 1073/pnas.82.7.2173 12. Bezard E, Gross CE, Fournier MC, Dovero S, Bloch B, Jaber M (1999) Absence of MPTPinduced neuronal death in mice lacking the dopamine transporter. Exp Neurol 155:268–273. https://doi.org/10.1006/ exnr.1998.6995 13. Cui M, Aras R, Christian WV, Rappold PM, Hatwar M, Panza J et al (2009) The organic cation transporter-3 is a pivotal modulator of neurodegeneration in the nigrostriatal dopaminergic pathway. Proc Natl Acad Sci U S A 106:8043–8048. https://doi.org/10.1073/ pnas.0900358106 14. Guillot TS, Miller GW (2009) Protective actions of the vesicular monoamine transporter 2 (VMAT 2) in monoaminergic neurons. Mol Neurobiol 39:149–170. https://doi.org/10. 1007/s12035-009-8059-y 15. Xiong N, Long X, Xiong J, Jia M, Chen C, Huang J et al (2012) Mitochondrial complex I inhibitor rotenone-induced toxicity and its potential mechanisms in Parkinson’s disease models. Crit Rev Toxicol 42:613–632. https://doi.org/10.3109/10408444.2012. 680431 16. Heikkalia RE, Nicklas WJ, Vyas I, Duvoisin RC (1985) Dopaminergic toxicity of rotenone and the 1-methyl-4-phenylpyridinium ion after their stereotaxic administration to rats: implication for the mechanism of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine toxicity. Neurosci Lett 62:389–394. https://doi.org/ 10.1016/0304-3940(85)90580-4 17. Przedborski S, Jackson-Lewis V, Naini AB, Jakowec M, Petzinger G, Miller R et al (2001) The parkinsonian toxin 1-methyl-4phenyl-1,2,3,6-tetrahydropyridine (MPTP): a technical review of its utility and safety. J Neurochem 76:1265–1274. https://doi.org/10. 1046/j.1471-4159.2001.00183.x 18. Jackson-Lewis V, Przedborski S (2007) Protocol of the MPTP mouse model of Parkinson’s

disease. Nat Protoc 2:141–151. https://doi. org/10.1038/nprot.2006.342 19. Betarbet R, Sherer TB, MacKinzie G, GraciaOsuna M, Panov AV, Greenamyre JT (2000) Chronic systemic pesticide exposure reproduces features of Parkinson’s disease. Nat Neurosci 3:1301–1306. https://doi.org/10. 1038/81834 20. Maegawa H, Morimoto Y, Kudo C, Hanamoto H, Boku A, Sugimira M et al (2015) Neural mechanism underlying hyperalgesic response to orofacial pain in Parkinson’s disease model rats. Neurosci Res 96:59–68. https://doi.org/10.1016/j.neures.2015.01. 006 21. Yasuda T, Hayakawa H, Nihira T, Ren YR, Nakata Y, Nagai M et al (2011) Parkinmediated protection of dopaminergic neurons in a chronic MPTP-minipump mouse model of Parkinson disease. J Neuropathol Exp Neurol 70:686–697. https://doi.org/10.1097/ NEN.0b013e3182269ecd 22. Morais LH, Lima MMS, Martynhak BJ, Santiago R, Takahashi TT, Ariza D et al (2012) Characterization of motor, depressivelike and neurochemical alterations induced by a short-term rotenone administration. Pharmacol Rep 64:1081–1090. https://doi.org/10. 1016/s1734-1140(12)70905-2 23. Santiago RM, Barbieiro J, Lima MM, Dombrowski PA, Andreatini R, Vital MA et al (2010) Depressive-like behaviors alterations induced by intranigral MPTP, 6-OHDA, LPS and rotenone models of Parkinson’s disease are predominantly associated with serotonin and dopamine. Prog Neuropsycopharmacol Biol Psychiarty 34:1104–1114. https://doi.org/ 10.1016/j.pnpbp.2010.06.004 24. Moreira CG, Barbiero JK, Ariza D, Dombrowski PA, Sabioni P, Bortotanza M et al (2012) Behavioral, neurochemical and histological alterations promoted by bilateral intranigral rotenone administration: a new approach for an old neurotoxin. Neurotox Res 21:291–301. https://doi.org/10.1007/ s12640-011-9278-3 25. Sherer TB, Kim JH, Betarbet R, Greenamyre JT (2003) Subcutaneous rotenone exposure causes highly selective dopaminergic degeneration and alpha-synuclein aggregation. Exp Neurol 179:9–16. https://doi.org/10.1006/ exnr.2002.8072 26. Chemical Book (2006) Chemicalbook Inc. https://www.chemicalbook.com/ ChemicalProductProperty_JP_CB6397762. htm. Accessed 16 Mar 2020

Protocol for the Mitochondrial Toxin Models of Parkinson’s Disease 27. Roeling TAP, Docter GJ, Voorn P, Melchers BPC, Wolters EC, Groenwegen HJ (1995) Effects of unilateral 6-hydroxydopamine lesions on neuropeptide immunoreactivity in the basal ganglia of the common marmoset, Callithrix jacchus, a quantitative immunohistochemical analysis. J Chem Neuroanat 9:155–164. https://doi.org/10.1016/08910618(95)00072-0 28. Valette H, Deleuze P, Syrota A, Delforqe J, Crouzel C, Fuseau C et al (1997) Canine myocardial beta-adrenergic, muscarinic receptor densities after denervation: a PET study. J Nucl Med 36:140–146 29. Annett LE, Torres EM, Clarke DJ, Ishida Y, Barker RA, Ridley RM et al (1997) Survival of nigral grafts within the striatum of marmosets with 6-OHDA lesions depends critically in donor embryo age. Cell Transplant 6:557–569. https://doi.org/10.1016/s09636897(97)00079-1 30. Ruffy R, Leonard M (1997) Chemical cardiac sympathetic denervation hampers defibrillation in the dog. J Cardiovasc Electrophysiol 8:62–67. https://doi.org/10.1111/j.15408167.1997.tb00609.x 31. Ho YH, Nam MH, Choi I, Min J, Jeon SR (2020) Optogenetic inactivation of the entopeduncular nucleus improves forelimb akinesia in a Parkinson’s disease model. Behav Brain Res 386:11251. https://doi.org/10.1016/j.bbr. 2020.112551 32. Yang SQ, Tian Q, Li D, He SQ, Hu M, Liu SY et al (2020) Leptin mediates protection of hydrogen sulfide against 6-hydroxydopamineinduced Parkinson’s disease: involving enhancement in Warburg effect. Neurochem Int 135:104692. https://doi.org/10.1016/j. neuint.2020.104692 33. Zigmond MJ, Berger TW, Grace AA, Stricker EM (1989) Compensatory responses to nigrostriatal bundle injury. Studies with 6-hydroxydopamine in an animal model of parkinsonism. Mol Chem Neuropathol 10:185–200. https://doi.org/10.1007/ bf03159728 34. Chiueh CC, Markey SP, Burns RS (1984) Neurochemical and behavioral effects of systemic and intranigral administration of N-methyl-4phenyl-1,2,3,6-tetrahydropyridine in the rat. Eur J Pharmcol 100:189–194. https://doi. org/10.1016/0014-2999(84)90221-8 35. Xiong N, Huang J, Zhang Z, Zhang Z, Xiong J, Liu X et al (2009) Stereotaxical infusion of rotenone: a reliable rodent model for Parkinson’s disease. PLoS One 4:e7878. https://doi.org/10.1371/journal.pone. 0007878

109

36. Cannon JR, Tapias VM, Na HM, Honick AS, Drolet RE, Greennamyre JT (2009) A highly reproducible rotenone model of Parkinson’s disease. Neurobiol Dis 34:279–290. https:// doi.org/10.1016/j.nbd.2009.01.016 37. Dodiya HB, Forsyth CB, Voigt RM, Engen PA, Patel J, Shaikh M et al (2020) Chronic stressinduced gut dysfunction exacerbates Parkinson’s disease phenotype and pathology in a rotenone-induced mouse model of Parkinson’s disease. Neurobol Dis 135:104352. https:// doi.org/10.1016/j.nbd.2018.12.012 38. Nehru B, Verma R, Khanna P, Sharma SK (2008) Behavioral alternations in rotenone model of Parkinson’s disease: attenuation by co-treatment of centrophenoxine. Brain Res 1201:122–127. https://doi.org/10.1016/j. brainres.2008.01.074 39. Maegawa H, Adachi N, Hanamoto H, Kudo C, Niwa H (2019) Bilateral Parkinson’s disease model rats exhibit hyperalgesia to subcutaneous formalin administration into the vibrissa pad. PLoS One 14:e0225928. https://doi. org/10.1371/journal.pone.0225928 40. Mercanti G, Bazzu G, Giusti P (2012) A 6-hydroxydopamine in vivo model of Parkinson’s disease. Methods Mol Biol 846:355–364. https://doi.org/10.1007/978-1-61779-5367_30 41. Perese DA, Ulman J, Viola J, Ewing SE, Bankiewicz KS (1989) A 6-hydroxydopamineinduced selective parkinsonian rat model. Brain Res 494:285–293. https://doi.org/10. 1016/0006-8993(89)90597-0 42. Przedborski S, Levivier M, Jiang H et al (1995) Dose-dependent lesions of the dopaminergic nigrostriatal pathway induced by intrastriatal injection of 6-hydroxydopamine. Neuroscience 67:631–647. https://doi.org/10.1016/ 0306-4522(95)00066-r 43. Jackson-Lewis V, Jakowec M, Burke RE, Przedborski S (1995) Time course and morphology of dopaminergic neuronal death caused by the neurotoxin 1-methyl-4-phenyl1,2,3,6-tetrahydropyridine. Neurodegeneration 4:257–269. https://doi.org/10.1016/ 1055-8330(95)90015-2 44. Tatton NA, Kish SJ (1997) In situ detection of apoptotic nuclei in the substantia nigra compacta of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-treated mice using terminal deoxynucleotidyl transferase labelling and acridine orange staining. Neuroscience 77:1037–1048. https://doi.org/10.1016/ s0306-4522(96)00545-3 45. Fornai F, Schlu¨ter OM, Lenzi P, Gesi M, Ruffoli R, Ferrucci M et al (2005) Parkinsonlike syndrome induced by continuous MPTP

110

Hiroharu Maegawa and Hitoshi Niwa

infusion: convergent roles of the ubiquitinproteasome system and α-synuclein. Proc Natl Acad Sci U S A 102:3413–3418. https://doi. org/10.1073/pnas.0409713102 46. Yang SC, Markey SP, Bankiewicz KS, London WT, Lunn G (1988) Recommended safe practices for using the neurotoxin MPTP in animal experiments. Lab Anim Sci 38:563–567 47. Furuya T, Hayakawa H, Yamada M, Yoshimi K, Hisahara S, Miura M et al (2004) Caspase-11 mediates inflammatory dopaminergic cell death in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mouse model of Parkinson’s disease. J Neurosci 24:1865–1872. https://doi. org/10.1523/JNEUROSCI.3309-03.2004 48. Turmel H, Hartmann A, Parain K, Douhou A, Srinivasan A, Agid Y et al (2001) Caspase-3 activation in 1-methyl-4-phenyl-1,2,3,6-

tetrahydropyridine (MPTP) -treated mice. Mov Disord 16:185–189. https://doi.org/ 10.1002/mds.1037 49. Inden M, Kitamura Y, Takeuti H, Yanagida T, Takata K, Kobayashi Y et al (2007) Neurodegeneration of mouse nigrostriatal dopaminergic system induced by repeated oral administration of rotenone is prevented by 4-phenylbutyrate, a chemical chaperone. J Neurochem 101:1491–1504. https://doi. org/10.1111/j.1471-4159.2006.04440.x 50. Inden M, Kitamura Y, Abe M, Tamaki A, Takata K, Taniguchi T (2011) Parkinsonian rotenone mouse model: reevaluation of longterm administration of rotenone in C57BL/6 mice. Biol Pharm Bull 34:92–96. https://doi. org/10.1248/bpb.34.92

Chapter 11 Midbrain Slice Culture as an Ex Vivo Analysis Platform for Parkinson’s Disease Yuji Kamikubo, Keiko Wakisaka, Yuzuru Imai, and Takashi Sakurai Abstract Parkinson’s disease (PD) is a neurodegenerative disorder that affects the motor system. PD is characterized by the accumulation of intracellular protein aggregates, Lewy bodies, and Lewy neurites, composed primarily of the protein α-synuclein. Thus, PD is classified as the most common synucleinopathy. The motor symptoms of the disease result from the death of cells in the region of the midbrain, leading to a dopamine deficit. While the cause of PD is unknown, it is believed to involve both inherited and environmental factors. PD has been extensively studied using in vitro and in vivo models; however, some discrepancy is observed in these results. In order to analyze progressive neurodegenerative disease, experimental platform amenable to continuous observation and experimental manipulation is required. In this chapter, we provide a practical method to slice and cultivate the midbrain tissue as an ex vivo experimental model. Key words Organotypic culture, Midbrain, Ex vivo model, Membrane interface, Immunofluorescent staining

1

Introduction Organotypic brain cultures, including slice culture, are used in central nervous system research because they have advantages over both in vivo and in vitro platforms [1]. Cultured brain slices preserve tissue structure, neural circuit, and extracellular environment and replicate the native status of the in vivo context. Filter membrane-interface neural tissue culture was improved for practical use by Stoppini et al. [2]. Since filter membrane cup is designed to easily change the medium, this apparatus as an interface is convenient for long-term maintenance of the explant tissue. The cultured brain slices on the membrane cup are amenable for completely replacing culture medium. Previously, we reported about neural circuit, synaptic plasticity, development, and Alzheimer’s disease (AD) using cultured hippocampal slices [3–5].

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_11, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

111

112

Yuji Kamikubo et al.

Large amount of data from cell and animal model-based assay revealed the molecular mechanism of neurodegeneration to understand PD [6]. The cell line models are powerful tools for molecular biology studies, but there are discrepancies between cell and animal models. Although experiments using cultured neuron provide important observation, they have lost the tissue structures of the brain. Neural circuits, glial network, and the extracellular environment are important for neurodegenerative disorders [7, 8]. The animal models provide suggestive evidence of disease pathology and physiology of related molecules. These studies, however, have disadvantages; they need lengthy experiments and substantial cost, and laborious monitoring of multiple parameters following manipulations [9]. Because the organotypic culture of the brain retains some of their architecture and is easy to perform experimental manipulation and long-term consecutive analysis, midbrain slice culture may be a potential technique linking between cellular and animal models of PD.

2

Materials

2.1 Apparatus for Slice Culture

1. Tissue chopper (Mcllwain). 2. Stereomicroscope (Olympus, SZX7). 3. Double Edge Stainless Steel Cutting Blades (Feather, FA-10). 4. Disposable scalpel (Feather, No.11, No. 22). 5. Tweezers (Dumont #5). 6. Microscissors. 7. Steel medicine spoons. 8. Sterile 50 mL centrifuge tubes. 9. Sterile 15 mL centrifuge tubes. 10. Medical oxygen cylinder tank and gas regulator. 11. Disposable injection needle (22G  70 mm). 12. Syringe filter (pore size; 0.2μm). 13. Autoclaved glass bottle (100 or 200 mL). 14. Filter membrane cup (Millicell-CM, Millipore, PICM03050 or PICM0RG50). 15. 60-mm and 100-mm plastic dishes. 16. Six-well culture plate. 17. Autoclaved overhead projector (OHP) sheet, cut into 5 cm squares. 18. Autoclaved filter paper (No.1, 70 mm). 19. Autoclaved glass pipette.

Organotypic Cultures of Midbrain Slices

2.2 Reagents for Slice Culture

113

1. Neurobasal-A Medium (Invitrogen). 2. B-27 Plus Supplement (50, Invitrogen). 3. GlutaMAX Supplement (100, Invitrogen). 4. Gentamicin sulfate solution (50 mg/mL). 5. 1 M HEPES stock solution (pH 7.4): Dissolve 11.9 g of HEPES in distilled water for 100 mL stock. Adjust the pH with 10 N NaOH. Sterilize the solution by passing it through a 0.22-μm filter. 6. 20% glucose stock: Dissolve 40 g of glucose in distilled water for 200 mL stock. Sterilize the solution by passing it through a 0.22-μm filter. 7. Hanks’ balanced salt solution (HBSS) for slicing: 1.5 mM CaCl2, 1 mM MgCl2, 0.32 mM MgSO4, 2 mM HEPES (pH 7.4) are added. 8. Minimum Essential Media (MEM). 9. Modified MEM: Add HEPES stock solution and glucose stock solution to MEM to a final concentration of 2 and 72 mM, respectively. 10. Horse serum (HS): Heat-inactivated at 56  C for 30 min. 11. Gey’s balanced salt solution (BSS): 137 mM NaCl, 5 mM KCl, 0.18 mM KH2PO4, 0.84 mM Na2HPO4 12H2O, 36 mM glucose, 1.5 mM CaCl2, 1 mM MgCl2, 0.32 mM MgSO4.

2.3 Reagents for Immunostaining

1. Fixative solution: 4%-paraformaldehyde phosphate buffer solution. 2. Phosphate buffered saline (PBS): 137 mM NaCl, 8.1 mM Na2HPO4, 2.68 mM KCl, 1.47 mM KH2PO4, pH 7.4. 3. Blocking buffer: PBS containing 5% fetal bovine serum and 0.05% Triton X-100. 4. Mounting agent: PermaFluor Aqueous Mounting Medium (Thermo Scientific). 5. Hoechst 33342 trihydrochloride, trihydrate (Invitrogen). 6. Anti-NeuN antibody (Millipore). 7. Anti-MAP 2 antibody (Abcam). 8. Anti-GFAP antibody (Abcam). 9. Fluorescent-labeled secondary antibody against mouse, rabbit, and chicken (Invitrogen).

114

3

Yuji Kamikubo et al.

Methods

3.1 Midbrain Slice Culture

1. Prepare the culture medium; B27/neurobasal medium or HS/HBSS/MEM medium. The B27/neurobasal medium was Neurobasal-A Medium contained B-27 Plus Supplement (1), GlutaMAX Supplement (1), and gentamicin sulfate (50μg/mL). HS/HBSS/MEM medium contained 50% MEM, 25% HBSS, and 25% HS. 2. Prepare six-well plates. Add 1 mL culture medium, per well, and place culture inserts in each well. Make sure the filter membranes are thoroughly wet with no bubble underneath. Place the plates with filter membrane cups maintained at 37  C with 5% CO2-enriched humidified atmosphere until needed. 3. Wipe the tissue chopper, a new blade, stereomicroscope, and dissecting instruments with 70% ethanol solution. Sterilize them for 30 min with UV light in the clean bench. 4. Dispense HBSS into sterilized glass bottle and place it on icebox. Bubble the HBSS with 100% O2 for 20–30 min. 30–40 mL HBSS is required per culture session (1–3 pups) (see Note 1). 5. Prepare the tissue chopper placing on clean bench and mounting a sterilized blade and placing autoclaved OHP sheet on cutting chamber. 6. The late embryonic (after day 16) or early postnatal (before day 8) rats or mice are deeply anesthetized and then killed by decapitation. Cut the scalp and expose the skull. Remove the skull by cutting along the sagittal suture and then from rostral to caudal side. Scoop out the brain quickly with a micro medicine spoon and place it in ice-cold oxygenated HBSS (Fig. 1a) (see Note 2). 7. Transfer the brains to the OHP sheet on the tissue chopper chamber and drain excess of HBSS (Fig. 1b). Coronal midbrain slices were prepared with a tissue chopper. 8. Transfer sliced midbrain from the OHP sheet to 60 -mm dish filled with ice-cold oxygenated HBSS. Since tissue chopper and brains are placed at room temperature, quick operation is required in steps 7–8 (see Note 3). 9. Under the stereomicroscope; separate well defined and undamaged slices from damaged slices, and pinch the area of no interest with precision tweezers and divide the midbrain slices one by one (Fig. 1c). It is important to complete the steps 6–9 within 20 min. 10. Incubate separated midbrains in new ice-cold oxygenated HBSS for 30–60 min.

Organotypic Cultures of Midbrain Slices

115

Fig. 1 Schematic diagrams and photographs of procedure for midbrain slice culture. (a) Shema of midbrain slices culture method. (b) Image of tissue chopper and isolated brains. Two brains were placed on OHP sheet in cutting chamber. (c) Sliced midbrain. (d) Four slices were placed onto the filter membrane cup in the six-well plate with culture medium. Midbrain slices are not located close to the cup walls of the inserts or close to each other. (e) Scheme representing the transverse section of disposition of slice on membrane culture insert and within the culture dish

11. Transfer individual slices on to the filter membrane in the six-well plate with culture medium. Place 1–4 slices per membrane, not to place the slices either close to the insert wall or close to each other (Fig. 1d). 12. Move the dish back to the incubator, and the prepared slices are maintained at 37  C with 5% CO2-enriched humidified atmosphere. 13. The culture medium was replaced twice a week with fresh medium during the entire culture period. Aspirate the medium in dish and add 750μL of fresh pre-warmed medium per well. Approximately 250μL of medium would remain in the culture dish and the filter membrane (see Note 4).

116

Yuji Kamikubo et al.

3.2 Immunohistochemical Staining

1. Rinse the cultured slices on filter membrane cup with PBS, and then fix in fixative solution at 25  C for 30 min. 2. Wash the filter membrane cup three times with PBS. 3. Remove a slice with membrane from cup insert, using scalpel (see Note 5). 4. Permeabilize and block the cultured slices with blocking buffer for 30 min at 25  C. 5. Prepare primary antibody solution. Dilute primary antibody in blocking buffer. 6. Place the cultured slices into the 12- or 24-well plate with the primary antibody solution, using around 500 or 200μL solution per well. 7. Incubate the cultured slices with the primary antibody solution at 4  C for about 48 h with gentle shaking. 8. Wash the cultured slices three times with PBS for 5 min. 9. Wash the culture slices once with blocking buffer for 30 min. 10. Prepare secondary antibody solution. Dilute fluorescentlabeled secondary antibody in blocking buffer. 11. Incubate the cultured slices with the secondary antibody solution at 4  C for about 24 h with gentle shaking. 12. Wash the cultured slices five times with PBS for 5 min. 13. Mount the stained slices with mounting agent for microscopy. Representative results are shown in Fig. 2.

Fig. 2 Immunofluorescent staining of cultured midbrain slices. (a) Immunofluorescence staining of cultured (4 DIV) midbrain slice with anti-NeuN (Red) and MAP 2 (Green) antibody. (b) Immunofluorescence staining of cultured (4 DIV) midbrain slice with anti-GFAP (Red) antibody and Hoechst 33342 (Cyan). Aq; aqueduct of midbrain. Scale bar; 100μm

Organotypic Cultures of Midbrain Slices

4

117

Notes 1. Due to the high oxygen demand of the central nervous system, it is necessary to adequately oxygenate and cool the working solution. 2. To aseptically oxygenate the working solution, blow oxygen through a long needle with a syringe filter. 3. Since tissue chopper and OHP sheet are placed at room temperature, quick operation is required in slicing brain. 4. When brain slices are immersed in medium, oxygen deficiency causes neural cell death. Keep the brain slices in contact with both air and culture medium. 5. The reason for cutting the brain slice with the membrane is that it is easy to pick it up and perform other operations.

Acknowledgments This work was supported by JSPS KAKENHI Grant Number JP20K07765 and JP17K09040 (to Y.K), and grants-in-aid from the TERUMO LIFE SCIENCE FOUNDATION (to Y.K). References 1. Cho S, Wood A, Bowlby M (2007) Brain slices as models for neurodegenerative disease and screening platforms to identify novel therapeutics. Curr Neuropharmacol 5:19–33. https:// doi.org/10.2174/157015907780077105 2. Stoppini L, Buchs PA, Muller D (1991) A simple method for organotypic cultures of nervous tissue. J Neurosci Methods 37:173–182. https:// doi.org/10.1016/0165-0270(91)90128-M 3. Shinoda Y, Kamikubo Y, Egashira Y et al (2005) Repetition of mGluR-dependent LTD causes slowly developing persistent reduction in synaptic strength accompanied by synapse elimination. Brain Res 1042:99–107. https://doi.org/ 10.1016/j.brainres.2005.02.028 4. Tominaga-Yoshino K, Kondo S, Tamotsu S, Ogura A (2002) Repetitive activation of protein kinase a induces slow and persistent potentiation associated with synaptogenesis in cultured hippocampus. Neurosci Res 44:357–367. https:// doi.org/10.1016/S0168-0102(02)00155-4

5. Kamikubo Y, Takasugi N, Niisato K et al (2017) Consecutive analysis of BACE1 function on developing and developed neuronal cells. J Alzheimers Dis 56:641–653. https://doi.org/10. 3233/JAD-160806 6. Kalia LV, Lang AE (2015) Parkinson’s disease. Lancet 386:896–912 7. Irie F, Badie-Mahdavi H, Yamaguchi Y (2012) Autism-like socio-communicative deficits and stereotypies in mice lacking heparan sulfate. Proc Natl Acad Sci U S A 109:5052–5056. https://doi.org/10.1073/pnas.1117881109 8. Sethi MK, Zaia J (2017) Extracellular matrix proteomics in schizophrenia and Alzheimer’s disease. Anal Bioanal Chem 409:379–394 9. Doussau F, Dupont JL, Neel D et al (2017) Organotypic cultures of cerebellar slices as a model to investigate demyelinating disorders. Expert Opin Drug Discov 12:1011–1022

Chapter 12 α-Synuclein Propagation Mouse Models of Parkinson’s Disease Norihito Uemura, Jun Ueda, Shinya Okuda, Masanori Sawamura, and Ryosuke Takahashi Abstract Parkinson’s disease (PD) is pathologically characterized by intraneuronal α-synuclein (α-Syn) inclusions called Lewy bodies (LBs) and the loss of dopaminergic neurons in the substantia nigra pars compacta (SNpc). Autopsy studies have suggested that Lewy pathology initially occurs in the olfactory bulb and enteric nervous system, subsequently spreading in the brain stereotypically. Recent studies have demonstrated that templated fibrillization and intercellular dissemination of misfolded α-Syn underlie this pathological progression. Injection of animals with α-Syn preformed fibrils (PFFs) can recapitulate LB-like inclusions and the subsequent intercellular transmission of α-Syn pathology. Moreover, targeting specific brain regions or body parts enables the generation of unique models depending on the injection sites. These features of α-Syn PFF-injected animal models provide a platform to explore disease mechanisms and to test disease modifying therapies in PD research. Here, we describe a methodology for the generation of α-Syn PFFs and the surgery on mice. Key words Parkinson’s disease, α-synuclein, Preformed fibrils, Propagation, Stereotaxic injection, Dopaminergic neurons, Olfactory bulb, Gastrointestinal tracts

1

Introduction The pathological findings in Parkinson’s disease (PD) include dopaminergic neuron loss in the substantia nigra pars compacta (SNpc) and the presence of α-synuclein (α-Syn) inclusions called Lewy bodies (LBs) and Lewy neurites [1]. Clinically, dopamine depletion in the nigrostriatal system causes motor symptoms in PD, which can be relieved by dopamine replacement therapy [1]. However, Lewy pathology in PD is not limited to the SNpc; rather, it is widely seen in other brain regions. Braak et al. systematically analyzed the pathology in cases with incidental LB pathology and sporadic PD, suggesting that Lewy pathology initially develops in the olfactory bulb and dorsal motor nucleus of the

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_12, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

119

120

Norihito Uemura et al.

vagus nerve (dmX) and then spreads in the brain in a stereotypical manner [2]. Moreover, because Lewy pathology is also found in the enteric nervous system (ENS) in the early stage of PD, those authors hypothesized that Lewy pathology occurs first in the ENS and then spreads to the dmX via the vagus nerve, ascending in the brainstem to the SNpc [3]. While α-Syn normally exists as a natively unfolded protein, it forms misfolded aggregates under disease conditions and is closely associated with neurodegeneration. Accumulating evidence indicates that pathological α-Syn exhibits prion-like behavior, i.e., the ability to self-propagate via templated fibrilization and intercellular dissemination [4]. Injection of α-Syn preformed fibrils (PFFs) into animals can induce this process, the formation of LB-like inclusions and the subsequent intercellular spread of α-Syn pathology [5, 6]. These features of α-Syn PFF-injected animal models have not been documented in other PD animal models such as genetically modified or chemical toxin-treated models, providing unique opportunities to explore the specific aspects of PD pathophysiology. Moreover, the injection methodology can be applied to various brain regions or body parts, enabling the generation of unique models depending on the injection sites. For example, the striatum, SNpc, hippocampus, olfactory bulb, gastrointestinal tract, autonomic ganglia, hind-limb muscle, abdominal cavity, and tail vein have been reported as the injection sites in mice [5–16]. Here, we describe the methodology used for striatal, olfactory bulb, and gastric wall injections of α-Syn PFFs in mice. Striatal injections induce robust LB-like inclusions accompanied by the loss of dopaminergic neurons in the SNpc [5]. Olfactory bulb and gastric wall injections induce spread of α-Syn pathology from the initial lesions of Lewy pathology in PD [8–13]. These models are useful for exploring disease mechanisms and testing diseasemodifying therapies in PD research.

2

Materials

2.1 Generation and Purification of Recombinant α-Syn Monomer

1. Escherichia coli BL21 cells (DE). 2. 1.5 ml microcentrifuge tube. 3. pRK172 plasmid encoding the human or mouse α-Syn cDNA sequence. 4. LB agar plate containing 50μg/ml ampicillin. 5. LB medium containing 50μg/ml ampicillin. 6. 12 ml culture tube. 7. 1 l glass flask. 8. Spectrophotometer. 9. 0.1 M isopropyl β-D-1-thiogalactopyranoside (IPTG) solution.

α-Synuclein Propagation Mouse Models

121

10. α-Syn buffer: 50 mM Tris–HCl, I mM ethylenediaminetetraacetic acid (EDTA), and 1 mM dithiothreitol (DTT), pH 7.5. 11. 50 ml tube. 12. 10 ml syringe. 13. Absorbent cotton. 14. Q-Sepharose Fast Flow (GE Healthcare). 15. α-Syn buffer containing 0.1 and 0.5 M sodium chloride. 16. Ammonium sulfate. 17. Cellulose tube (EIDIA). 18. Dialysis buffer: 150 mM KCl and 50 mM Tris–HCl, pH 7.5. 19. 300 ml beaker. 2.2 Generation and Preparation of α-Syn Preformed Fibrils

1. 10% (w/v) sodium azide solution. 2. Sterile 1.5 ml microcentrifuge tube. 3. Shaking incubator. 4. Mask and goggles. 5. 8 M guanidine hydrochloride solution. 6. Pierce BCA Protein Assay kit (Thermo Fisher). 7. Ultrasonic wave disruption system (Diagenode, Bioruptor). 8. Sterile phosphate-buffered saline (PBS). 9. 1% (w/v) fast green solution: Filter the solution using a 0.2μm syringe filter and store at 4  C.

2.3 Stereotaxic Injections

1. Mask and goggles. 2. Stereotaxic instruments (Narishige). 3. Stereotaxic micromanipulator (Narishige). 4. Stereotaxic microinjector (Narishige). 5. Auxiliary ear bar (Narishige). 6. 33 G Neuros syringe (Hamilton). 7. Scale (for body-weight measurements). 8. Avertin: Mix 1.5 g 2, 2, 2-tribromoethanol in 1 ml 3-methyl-1butanol in a dark or foil-covered tube until fully dissolved. Subsequently, add 80 ml water and mix well. Filter the solution through a 0.2μm syringe filter into a dark or foil-covered tube and store at 4  C (see Note 1). 9. Electric shaver. 10. Scalpel. 11. Electric drill (MINITOR, ONE SERIES ver.2). 12. Forceps. 13. Tweezers. 14. 5–0 silk surgical suture with needle.

122

Norihito Uemura et al.

15. Warming lamp. 16. 70% (v/v) ethanol. 17. 1% (w/v) sodium dodecyl sulfate (SDS) solution in a spray bottle. 2.4 Inoculation of α-Syn PFFs into the Mouse Gastric Wall

1. Mask and goggles. 2. Avertin. 3. 35-gauge needle (Saito Medical Instruments). 4. 10μl syringe (Hamilton). 5. Depilatory cream. 6. Scissors. 7. Forceps. 8. Tweezers. 9. 5–0 silk surgical suture with needle. 10. Warming lamp. 11. 70% (v/v) ethanol. 12. 1% (w/v) SDS solution in a spray bottle.

3

Methods

3.1 Generation and Purification of Recombinant α-Syn Monomer

1. Thaw competent cells (Escherichia coli BL21) on ice. 2. Add 10–20 ng pRK172 plasmid encoding the human or mouse α-Syn cDNA sequence to 50μl competent cells in a 1.5 ml microcentrifuge tube and mix gently (see Note 2). Leave the tube on ice for 5 min. 3. Spread 50μl competent cells onto a 37  C pre-warmed LB agar plate containing 50μg/ml ampicillin. Incubate the plate at 37  C overnight. 4. For the starter culture, pick a single colony for inoculation in 3 ml LB medium containing 50μg/ml ampicillin in a 12 ml culture tube. Incubate the bacteria at 200 rpm at 37  C overnight. 5. Inoculate 500 ml LB medium containing 50μg/ml ampicillin with 500μl starter culture. Incubate the bacteria at 200 rpm at 37  C. 6. Regularly check the optical density (OD) of the LB medium at 600 nm using a spectrophotometer. Once the OD reaches 0.3, add 0.1 M IPTG solution at the final concentration of 0.1 mM to induce α-Syn expression. 7. After further incubation for 4 h, apply the medium to 50 ml tubes and harvest the bacteria by centrifuging at 4000  g at 4  C for 5 min. Discard the supernatant. Store the bacterial pellets at 80  C.

α-Synuclein Propagation Mouse Models

123

8. Thaw the bacterial pellets (see Note 3). Add 20 ml α-Syn buffer to the tubes and resuspend the bacterial pellets by vortexing vigorously. 9. Centrifuge the lysate at 20,400  g at 4  C for 5 min. Apply the supernatant to new 50 ml tubes. 10. Immerse the tubes in boiling water for 5 min, to heat the supernatant. Centrifuge the tubes at 20,400  g at 4  C for 15 min (see Note 4). 11. Stand a barrel of 10 ml syringe with the flange up. Place a small amount of absorbent cotton on the bottom of the barrel and then add 3 ml Q-Sepharose® Fast Flow. 12. Add 30 ml α-Syn buffer to equilibrate the Q-Sepharose® Fast Flow. Allow the column to empty by gravity flow and discard the flow-through. 13. Add the supernatant from step 10 into the barrel. Allow the column to empty by gravity flow and discard the flow-through (see Note 5). 14. Add 9 ml α-Syn buffer containing 0.1 M sodium chloride. Allow the column to empty by gravity flow and discard the flow-through. 15. Add 9 ml α-Syn buffer containing 0.5 M sodium chloride. Allow the column to empty by gravity flow and collect the flow-through. 16. Add 50% (% saturation) or 2.8 g ammonium sulfate to the flowthrough, to precipitate α-Syn. 17. Centrifuge at 20,400  g at 4  C for 15 min and discard the supernatant. 18. Add 1 ml α-Syn buffer to dissolve the precipitated α-Syn. 19. Dialyze the α-Syn monomer solution in a cellulose tube against 200 ml dialysis buffer in a 300 ml beaker at 4  C overnight. 20. Ultracentrifuge the dialyzed α-Syn monomer solution at 186,000  g at 4  C for 20 min. Use the supernatant in the following steps. 3.2 Generation and Preparation of α-Syn Preformed Fibrils

1. Determine the concentration of α-Syn monomer by BCA assay and then dilute α-Syn monomer in dialysis buffer containing 0.1% sodium azide to 7μg/μl. 2. Incubate 1 ml α-Syn monomer solution in a sterile 1.5 ml microcentrifuge tube at 37  C with constant agitation at 1000 rpm in the shaker for 10 days (Fig. 1, see Note 6). 3. Wear personal protective equipment (PPE), including gloves, a mask, and goggles, to handle the α-Syn PFF solution.

124

Norihito Uemura et al.

Fig. 1 Generation of α-Syn preformed fibrils. (a) Left: mouse α-Syn monomer solution, Right: mouse α-Syn PFF solution. α-Syn PFF solution appears turbid. (b) Coomassie brilliant blue (CBB) staining and Western blot (WB) analysis of α-Syn. Smear bands are observed in PFFs. Samples containing 10μg protein were loaded in each lane and separated on 12% (w/v) gels for SDS-polyacrylamide gel electrophoresis. An anti-α-Syn primary antibody (BD Transduction, Syn-1, 1:2000) was used for WB. (Reproduced from Uemura et al., 2018 [11])

4. After vortexing the α-Syn PFF solution well, divide it into aliquots (20–50μl) in sterile 1.5 ml microcentrifuge tubes. Ultracentrifuge these aliquots at 186,000  g at 20  C for 20 min and discard the supernatant. Store the pellets at 80  C until use. 5. Dissolve a pellet of α-Syn PFFs with 8 M guanidine hydrochloride solution to determine the amount of α-Syn PFFs. Dilute the resultant solution ten times with water and determine the protein concentration by BCA assay (see Note 7). 6. Add sterile PBS to the α-Syn PFF pellet so that the final concentration is 5μg/μl. 7. Sonicate the α-Syn PFF pellet in PBS for 4 min (4 cycles of 30 s on and 30 s off) with an ultrasonic wave disruption system. 8. For stereotaxic injections, add 1% fast green solution to the sonicated α-Syn PFF solution at the final concentration of 0.02% (see Note 8). For gastric wall injections, dilute the α-Syn PFF solution to 2μg/μl with sterile PBS and add 1% fast green solution at the final concentration of 0.1%. 3.3 Stereotaxic Injections of α-Syn PFFs into the Mouse Striatum and Olfactory Bulb

1. Wear PPE, including gloves, a mask, and goggles. 2. Prepare all equipment, including stereotaxic instruments, drill, and surgical instruments (Fig. 2a). 3. Suck the α-Syn PFF solution with a 33 G Neuros syringe and then equip it with a stereotaxic microinjector.

α-Synuclein Propagation Mouse Models

125

Fig. 2 Stereotaxic injections of α-Syn PFFs into the mouse striatum and olfactory bulb. (a) Preparation of equipment. (b) Incision of the head skin and identification of the bregma, lambda, and inferior cerebral vein. (c) Fixation of a mouse onto the nose and ear fixing clamps of the stereotaxic instruments. (d) Suture of the head skin

4. Weigh a mouse and anesthetize it by intraperitoneal administration of Avertin (0.01–0.02 ml/g of body weight). Wait for ~5 min and make sure that the mouse is nonresponsive to toe pinch. Add a small volume of Avertin as necessary. 5. Remove hair with an electric shaver or by plucking it. Disinfect the head skin with 70% ethanol. 6. Make a midline incision of the head skin with a scalpel and expose the skull. Identify the bregma, lambda, and inferior cerebral vein (Fig. 2b).

126

Norihito Uemura et al.

7. Install an auxiliary ear bar into the external auditory meatus. Make sure that the left and right levels are virtually horizontal. 8. Fix the mouse onto the nose and ear fixing clamps of the stereotaxic instruments (Fig. 2a, c). Make sure that the Bregma is virtually level with the lambda (see Note 9). 9. For striatal injection, the stereotaxic coordinates are +0.2 mm relative to the Bregma, 2.0 mm from the midline, and 2.6 mm beneath the skull surface. For olfactory bulb injection, the stereotaxic coordinates are +1.0 mm relative to the inferior cerebral vein or + 4.5 mm relative to the bregma, 0.9 mm from the midline, and 1.5 mm beneath the skull surface (see Note 10). Move the needle tip to the indicated location on the skull surface. 10. Make a small hole at the indicated location on the skull using an electric drill. Make sure not to damage the brain or olfactory bulb underneath the skull. 11. Insert the needle into the brain or olfactory bulb to the indicated depth from the skull surface. Run the stereotaxic microinjector and inject the desired volume of α-Syn PFF solution at the rate of 0.2μl/min. For the striatal and olfactory bulb injections, we usually inject 2 and 0.5μl, respectively. 12. After injecting all of the α-Syn PFF solution, leave the needle in place for 2 min to minimize the leakage of injected solution. Then gently withdraw the needle from the injection site. 13. Unclamp the mouse and suture the head skin with a silk surgical suture (Fig. 2d). 14. Place the mouse in a clean cage under a warming lamp until it wakes up and walks around on its own. 15. Flush the 33 G Neuros syringe ten times with 70% ethanol and then ten times with sterile PBS. 16. Wipe all the stereotaxic instruments with 1% SDS solution to reduce the potential risk of handling α-Syn PFFs (see Note 11). 17. Sacrifice the mouse at the desired time point. Confirm pathology formation (Fig. 4a, b, see Note 12). 3.4 Injections of α-Syn PFFs into the Mouse Gastric Wall

1. Wear PPE, including gloves, a mask, and goggles. 2. Disinfect the surgical table with 70% ethanol. 3. Prepare all of the surgical instruments. Attach the 35-gauge needle to the 10μl syringe and suck the α-Syn PFF solution. 4. Weigh the mouse and anesthetize it by intraperitoneal administration of Avertin (0.02 ml/g of body weight). Wait for ~5 min and make sure that the mouse is nonresponsive to toe pinch. Add a small volume of Avertin as necessary.

α-Synuclein Propagation Mouse Models

127

Fig. 3 Injections of α-Syn PFFs into the mouse gastric wall. (a) Incision of the abdominal wall. (b) Identification of the liver. (c) Identification and pulling out of the stomach. (d) Injection of the α-Syn PFF solution into the gastric wall. (e) Suture of the muscle layer of the gastric wall. (f) Suture of the skin layer of the abdominal wall

5. Remove the hair on the belly of the animal using depilatory cream. Disinfect the abdominal skin with 70% ethanol. 6. Make a ~2-cm incision in the abdominal midline. The abdominal wall consists of two layers, the skin layer and the muscle layer. Make sure to incise these layers separately (Fig. 3a). 7. Identify and pull out the stomach, which is located behind the left liver lobe, using the tweezers (Fig. 3b, c). 8. Inject the α-Syn PFF solution into the gastric wall of the corpus and pylorus (Fig. 3d, see Notes 13 and 14). We usually inject 3μl α-Syn PFF solution into each of eight sites (four sites on the anterior wall and four sites on the posterior wall). Make sure not to damage blood vessels, to avoid bleeding. 9. Suture the muscle layer and the skin layer of the abdominal wall separately with a silk surgical suture (Fig. 3e, f). 10. Place the mouse in a clean cage under a warming lamp until it wakes up and walks around on its own. 11. Flush the needle and syringe ten times with 70% ethanol and then ten times with sterile PBS.

128

Norihito Uemura et al.

Fig. 4 Confirmation of pathology formation. Mice injected with α-Syn PFFs were sacrificed and analyzed at one-month postinjection. Eight-μm paraffinized sections were prepared for immunohistochemical analyses. An anti-phosphorylated α-Syn (pSyn) (Abcam, EP1536Y, 1:20,000) antibody was used as a primary antibody. (a) SNpc of the mouse which received the striatal injection. (b) Piriform cortex of the mouse which received the olfactory bulb injection. (c) DmX of the mouse which received the gastric wall injection. Arrows indicate LB-like inclusions. Scale bar 50μm

12. Wipe the surgical table with 1% SDS solution to reduce the potential risk of handling α-Syn PFFs. 13. Sacrifice the mouse at the desired time point. Confirm pathology formation (Fig. 4c, see Note 12).

4

Notes 1. 2, 2, 2-Tribromoethanol is degraded in the presence of heat or light, to produce toxic byproducts. 2. We usually use mouse rather than human α-Syn because mouse α-Syn PFFs are more potent for inducing α-Syn pathology in brains of wild-type mice compared with human α-Syn PFFs [6]. 3. This step lyses the bacterial cells. 4. Because α-Syn is a heat-stable protein, a high temperature denatures and precipitates many other protein contaminants [17]. 5. α-Syn is negatively charged. When loaded, α-Syn is captured by the anion exchanger Q-Sepharose Fast Flow, and it is eluted by the 0.5 M sodium chloride solution. 6. Mouse and human α-Syn solutions usually turn turbid within 24 and 72 h, respectively. 7. According to the manufacturer’s protocol, 4 M guanidine does not cause a noticeable interference with the BCA assay. 8. Coloring makes it easy to handle the α-Syn PFF solution during injection.

α-Synuclein Propagation Mouse Models

129

9. To achieve this precisely, measure the heights of bregma and lambda by moving the needle tip of the syringe. Adjust the height of the nose fixing clamp and rotate the mouse’s head as necessary. 10. For olfactory bulb injections, we usually use the coordinates based on the inferior cerebral vein, to minimize errors. 11. SDS can detach α-Syn PFFs from contaminated surfaces and disassemble them [18]. 12. We do not describe the methodology used for pathological analysis. Please refer to our previous articles [9, 11]. 13. The gastric wall is so thin that the needle chip can easily go into the gastric lumen. Make sure that the needle tip is placed in the gastric wall. 14. The vagus nerve innervates the myenteric plexus of the stomach [19], which is located in the outer part of the gastrointestinal wall. Assuming that α-Syn PFFs are taken up by the axon terminal of the vagus nerve, we usually try to place the needle tip in the outer part of the gastric wall, to inject the α-Syn PFF solution there.

Acknowledgments This research is supported by the program for Brain Mapping by Integrated Neurotechnologies for Disease Studies (Brain/ MINDS) from Ministry of Education, Culture, Sports Science, MEXT, and the Japan Agency for Medical Research and Development, AMED under the Grant Number JP17dm0207020h0004 and JP20dm0207070 (RT), JSPS KAKENHI Grant Numbers JP17H05698 (RT), JP17K16119 (NU), the Takeda Science Foundation (NU), and the Kanae Foundation for the Promotion of Medical Science (NU). References 1. Kalia LV, Lang AE (2015) Parkinson’s disease. Lancet 386(9996):896–912. https://doi.org/ 10.1016/s0140-6736(14)61393-3 2. Braak H, Del Tredici K, Rub U, de Vos RA, Jansen Steur EN, Braak E (2003) Staging of brain pathology related to sporadic Parkinson’s disease. Neurobiol Aging 24(2):197–211 3. Braak H, de Vos RA, Bohl J, Del Tredici K (2006) Gastric alpha-synuclein immunoreactive inclusions in Meissner’s and Auerbach’s plexuses in cases staged for Parkinson’s disease-related brain pathology. Neurosci Lett

396(1):67–72. https://doi.org/10.1016/j. neulet.2005.11.012 4. Uemura N, Uemura MT, Luk KC, Lee VM, Trojanowski JQ (2020) Cell-to-cell transmission of tau and α-Synuclein. Trends Mol Med 26(10):936–952. https://doi.org/10.1016/j. molmed.2020.03.012 5. Luk KC, Kehm V, Carroll J, Zhang B, O’Brien P, Trojanowski JQ, Lee VM (2012) Pathological alpha-synuclein transmission initiates Parkinson-like neurodegeneration in

130

Norihito Uemura et al.

nontransgenic mice. Science 338 (6109):949–953. https://doi.org/10.1126/ science.1227157 6. Masuda-Suzukake M, Nonaka T, Hosokawa M, Oikawa T, Arai T, Akiyama H, Mann DM, Hasegawa M (2013) Prion-like spreading of pathological alpha-synuclein in brain. Brain 136(Pt 4):1128–1138. https:// doi.org/10.1093/brain/awt037 7. Luna E, Decker SC, Riddle DM, Caputo A, Zhang B, Cole T, Caswell C, Xie SX, Lee VMY, Luk KC (2018) Differential alphasynuclein expression contributes to selective vulnerability of hippocampal neuron subpopulations to fibril-induced toxicity. Acta Neuropathol 135(6):855–875. https://doi.org/10. 1007/s00401-018-1829-8 8. Rey NL, Steiner JA, Maroof N, Luk KC, Madaj Z, Trojanowski JQ, Lee VM, Brundin P (2016) Widespread transneuronal propagation of alpha-synucleinopathy triggered in olfactory bulb mimics prodromal Parkinson’s disease. J Exp Med 213(9):1759–1778. https://doi.org/10.1084/jem.20160368 9. Uemura N, Uemura MT, Lo A, Bassil F, Zhang B, Luk KC, Lee VM, Takahashi R, Trojanowski JQ (2019) Slow progressive accumulation of oligodendroglial alpha-synuclein (alpha-syn) pathology in synthetic alpha-syn fibril-induced mouse models of synucleinopathy. J Neuropathol Exp Neurol 78 (10):877–890. https://doi.org/10.1093/ jnen/nlz070 10. Uemura N, Ueda J, Yoshihara T, Ikuno M, Uemura MT, Yamakado H, Asano M, Trojanowski JQ, Takahashi R (2021) α-synuclein spread from olfactory bulb causes hyposmia, anxiety, and memory loss in BAC-SNCA mice. Mov Disord. https://doi.org/10. 1002/mds.28512 11. Uemura N, Yagi H, Uemura MT, Hatanaka Y, Yamakado H, Takahashi R (2018) Inoculation of alpha-synuclein preformed fibrils into the mouse gastrointestinal tract induces Lewy body-like aggregates in the brainstem via the vagus nerve. Mol Neurodegener 13 (1):21. https://doi.org/10.1186/s13024018-0257-5 12. Kim S, Kwon SH, Kam TI, Panicker N, Karuppagounder SS, Lee S, Lee JH, Kim WR, Kook M, Foss CA, Shen C, Lee H, Kulkarni S, Pasricha PJ, Lee G, Pomper MG, Dawson VL, Dawson TM, Ko HS (2019)

Transneuronal propagation of pathologic alpha-synuclein from the gut to the brain models Parkinson’s disease. Neuron 103 (4):627–641.e7. https://doi.org/10.1016/j. neuron.2019.05.035 13. Uemura N, Yagi H, Uemura MT, Yamakado H, Takahashi R (2020) Limited spread of pathology within the brainstem of alpha-synuclein BAC transgenic mice inoculated with preformed fibrils into the gastrointestinal tract. Neurosci Lett 716:134651. https://doi.org/10.1016/j. neulet.2019.134651 14. Wang XJ, Ma MM, Zhou LB, Jiang XY, Hao MM, Teng RKF, Wu E, Tang BS, Li JY, Teng JF, Ding XB (2020) Autonomic ganglionic injection of α-synuclein fibrils as a model of pure autonomic failure α-synucleinopathy. Nat Commun 11(1):934. https://doi.org/10. 1038/s41467-019-14189-9 15. Sacino AN, Brooks M, Thomas MA, McKinney AB, Lee S, Regenhardt RW, McGarvey NH, Ayers JI, Notterpek L, Borchelt DR, Golde TE, Giasson BI (2014) Intramuscular injection of α-synuclein induces CNS α-synuclein pathology and a rapid-onset motor phenotype in transgenic mice. Proc Natl Acad Sci U S A 111(29):10732–10737. https://doi.org/10. 1073/pnas.1321785111 16. Ayers JI, Brooks MM, Rutherford NJ, Howard JK, Sorrentino ZA, Riffe CJ, Giasson BI (2017) Robust central nervous system pathology in transgenic mice following peripheral injection of α-synuclein fibrils. J Virol 91 (2). https://doi.org/10.1128/jvi.02095-16 17. Jakes R, Spillantini MG, Goedert M (1994) Identification of two distinct synucleins from human brain. FEBS Lett 345 (1):27–32. https://doi.org/10.1016/00145793(94)00395-5 18. Bousset L, Brundin P, Bo¨ckmann A, Meier B, Melki R (2016) An efficient procedure for removal and inactivation of alpha-synuclein assemblies from laboratory materials. J Parkinsons Dis 6(1):143–151. https://doi.org/10. 3233/jpd-150691 19. Phillips RJ, Walter GC, Wilder SL, Baronowsky EA, Powley TL (2008) Alpha-synuclein-immunopositive myenteric neurons and vagal preganglionic terminals: autonomic pathway implicated in Parkinson’s disease? Neuroscience 153(3):733–750. https://doi.org/10. 1016/j.neuroscience.2008.02.074

Chapter 13 Common Marmoset Model of α-Synuclein Propagation Masami Masuda-Suzukake, Aki Shimozawa, Masashi Hashimoto, and Masato Hasegawa Abstract The propagation of assembled α-synuclein (αS) is key to understanding the pathological mechanisms of synucleinopathies such as Parkinson’s disease, dementia with Lewy bodies, and multiple system atrophy. Here we describe a nonhuman primate model of αS propagation using common marmosets (Callithrix jacchus) with an intracerebral injection of synthetic preformed αS fibrils. This protocol enables observation of the formation of phosphorylated αS pathology and its propagation three months after the injection. Key words α-synuclein, Synucleinopathy, Propagation, Common marmosets, Nonhuman primates, Intracerebral injection

1

Introduction The intracellular accumulation of assembled α-synuclein (αS) is a common pathological feature of synucleinopathies such as Parkinson’s disease (PD), dementia with Lewy bodies (DLB), and multiple system atrophy (MSA) [1]. αS is a soluble protein consisting of 140 amino acids that is encoded by the SNCA gene on chromosome 4. The discovery of missense mutations in SNCA and the multiplication of the region encompassing SNCA in familial forms of PD and DLB [2, 3] revealed that abnormalities in αS protein cause neurodegenerative synucleinopathies. In brains of patients with these diseases, αS is deposited by conversion to insoluble amyloid filaments with a β-sheet structure [4]. Moreover, it is subjected to specific posttranslational modifications, i.e., phosphorylation at serine129 and partial ubiquitination [5, 6]. Progressive distribution of αS pathology correlates to the clinical stages of sporadic PD [7], suggesting that the propagation of αS is closely related to disease progression. The propagation of pathological αS in vivo was confirmed by experimental studies in rodents, which showed that intracerebral

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_13, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

131

132

Masami Masuda-Suzukake et al.

injection of preformed αS fibrils into non-transgenic mice induces conversion of endogenous protein into insoluble aggregates and time-dependent propagation of pathological αS [8–10]. These studies demonstrated that preformed αS fibrils cause prion-like propagation in vivo and that pathological αS spreads from the injection site to anatomically connected regions. However, the rodent brain is neuroanatomically distinct from the human brain, particularly in the basal ganglia including the striatum [11], which is affected in PD. In the human brain, the striatum consists of the putamen and caudate nucleus, which are clearly separated by the internal capsule, whereas in rodents the two structures are combined. Hence, further analysis is required using animal models with brain structures closer to human. Common marmoset (Callithrix jacchus) is a small New World primate (body length: 20–25 cm, weight: 250–500 g). It is easier to handle than larger primates such as macaque monkeys, breed more rapidly, and has a shorter lifespan (~15 years). Compared with rodents, marmosets have a relatively large brain (brain weight: ~8 g; Fig. 1a) and show more complex social behavior.

Fig. 1 Comparison of marmoset and mouse brains. (a) Macroscopic photographs of marmoset and mouse brains. Dorsal (left), ventral (middle), and lateral (right) surface views are shown. (b) Comparison of the amino acid sequences of human, macaque, marmoset, and mouse αS. The underlines indicate the amino acids distinct from the human sequence. The red box indicates an epitope of the LB509 antibody

Common Marmoset Model of α-Synuclein Propagation

133

The marmoset brain shares common anatomical features with the human brain; for example, the striatum is separated into the caudate and putamen (Fig. 2b). Hence, the marmoset is a promising animal model for neuroscience research on neurodegenerative diseases [12, 13]. Furthermore, marmoset αS shares 97% amino acid sequence identity with human αS, which is higher than that when compared with mouse αS (Fig. 1b). Considering these advantages, we believe they are ideal model animal for studying the pathogenic mechanisms of synucleinopathies.

Fig. 2 Stereotactic surgery in common marmosets. (a) Stereotaxic instruments for common marmosets. (b) The injection sites used in our study. The asterisks indicate the injection sites; the caudate nucleus (Cd) and putamen (Pu). ic: internal capsule. Coronal brain section (50μm thick), hematoxylin staining

134

2

Masami Masuda-Suzukake et al.

Materials

2.1 Equipment and Surgical Instruments

Please ensure that all animal procedures are approved by the respective institutional ethics committees and are conducted in accordance with the regulations and ethical guidelines for animal research (see Note 1). 1. Stereotaxic frame, auxiliary ear bar for common marmosets (Narishige, SR-6C-HT), micromanipulator, and microinjector (Fig. 2a). 2. Veterinary vital signs monitor (optional). 3. Surgical instruments (sterilized): Surgical drapes, scalpel, forceps, periosteal elevator, surgical retractor, needle holder, suture needle, and cotton balls. 4. Electric clipper. 5. Electric handy drill. 6. Heating pad. 7. Sterile disposable syringes (1 mL) and needles. 8. 70% ethanol. 9. Povidone-iodine.

2.2

Drugs

1. Ketamine hydrochloride, or thiopental sodium. Isoflurane inhalation can be used instead. If isoflurane is chosen, an isoflurane vaporizer, mask, and induction chamber are required. 2. Xylazine. 3. Atropine. 4. Butorphanol. 5. Piperacillin sodium. 6. Lubricant eye ointment. 7. Sterile saline.

2.3 Intracerebral Injection

1. 50μL Hamilton syringe with a 26-gauge needle. 2. 4 mg/mL preformed αS filaments in saline (store at 80  C; see Note 2). The preparation of preformed fibrils has been described previously [14]. 3. Sonicator.

2.4

Tissue Collection

1. Heparinized phosphate-buffered saline (PBS): 0.5 U/mL heparin sodium and sterile PBS. 2. 10% formalin neutral buffer solution. 3. Surgical instruments: Scalpel, forceps, surgical scissors, and bone rongeur. 4. Peristaltic pump.

Common Marmoset Model of α-Synuclein Propagation

3

135

Methods

3.1 Animal Husbandry

1. Keep adult common marmosets housed at 30  2  C, with 40  10% humidity, and a 12-h light/12-h dark cycle. 2. Provide free access to water and a pelleted commercial diet. 3. Weigh animals before surgery.

3.2 Preparation of the Injection

3.3 Surgical Procedures

1. Thaw the preformed αS filament solution. 2. Sonicate the αS filament solution for fragmentation before use (see Note 3) and keep them at room temperature until use. The intracerebral injection is performed ipsilaterally so that the propagation of αS to the contralateral (non-injected) side of brain can be observed. 1. The animal should be fasted overnight prior to surgery. 2. Fill a Hamilton syringe with 50μL of sonicated αS fibril solution. 3. Set the ear bars symmetrically, with the tips attached at the midline to determine the 0-mm interaural (anterior-posterior: A-P) and 0-mm medial-lateral (M-L) points. Attach the Hamilton syringe to the microinjector and set at the midline. This point is defined as 0-mm interaural and 0-mm M-L. Ensure that the scale is read. 4. Induce anesthesia with an intramuscular injection of ketamine (30 mg/kg), xylazine (1.0 mg/kg), atropine (0.03 mg/kg), and butorphanol (0.03 mg/kg; see Note 4). 5. Remove hair on the head and ears with an electric clipper. 6. Hold the animal head using an auxiliary ear bar with the external acoustic meatus. 7. Place the animal in the stereotaxic frame using ear bars, eye bars, and a mouthpiece. Make sure that the animal is placed horizontally in a symmetrical fashion. Place a heating pad under the animal. 8. Apply lubricant eye ointment to prevent dry eyes. 9. Measure the heart rate (HR) and blood oxygen saturation (SpO2) if a veterinary vital signs monitor is used (see Note 5). 10. Cover the animal’s head with a surgical drape. Then, disinfect the shaved scalp with 70% ethanol and povidone-iodine using sterile cotton balls. 11. Make a midline incision on the skin using a scalpel, and hold the incision using a surgical retractor (see Note 6). 12. Place the needle of the Hamilton syringe at the point set in step 3 (0-mm interaural and 0-mm M-L). Ensure that the sagittal suture is placed at the 0-mm M-L point.

136

Masami Masuda-Suzukake et al.

13. Move along the A-P and M-L axes to the coordinates of the injection site (see Note 7) and mark the point on the skull surface. 14. Drill a hole in the skull at the mark with an electric handy drill. 15. Make a small incision in the dura with a sterile needle. 16. Set the needle tip of the Hamilton syringe at the burr hole on the brain surface. 17. Gently lower the needle tip from the brain surface to the depth of the coordinate (dorsal-ventral axis) and inject 50μL of αS fibrils with a microinjector at 10μL/min. 18. After the injection, wait for 5 min to prevent backflow and then retract the needle slowly. 19. Repeat steps 13–18 for the other injection site. 20. Suture the skin with a surgical suture needle and apply povidone-iodine to the skin. 21. Inject piperacillin sodium (40 mg/kg) intramuscularly. Replace fluids by a subcutaneous injection of warm sterile saline. 22. Warm the animal and then return them to their home cage. Observation should be continued until the animal has fully recovered from the anesthetic (see Note 8). 3.4 Tissue Collection and Immunohistochemistry

The brain tissue can be analyzed three months after the intracerebral injection. 1. Inject the animal with ketamine (10 mg/kg) and xylazine (0.5 mg/kg) intramuscularly, followed by an injection with thiopental sodium (30 mg/kg, intravenous) for deep anesthesia. 2. After confirming the loss of corneal reflex, perfuse the animal transcardially with 200 mL of heparinized PBS at 10 mL/min with a peristaltic pump and the same volume of 10% formalin neutral buffer solution for fixation. 3. After decapitation, remove the skin using scissors and forceps. Carefully open the skull from the site of decapitation with a bone rongeur (see Note 9). 4. Incise the dura over the brain with small scissors and open it carefully using forceps. 5. Turn the head upside down and carefully remove the brain from the skull. 6. Immerse the brain in 10% neutral buffered formalin. 7. After fixation, section the brain in the coronal plane (see Note 10). 8. Stain the brain sections with antibodies against pathological αS or β-sheet ligands (see Note 11 and Fig. 3).

Common Marmoset Model of α-Synuclein Propagation

137

Fig. 3 Propagation of αS pathology in the marmoset brain three months after the injection into the caudate and putamen. αS pathology can be observed in both the ipsilateral (injected) and contralateral hemispheres. The brain sections are stained with an anti-pS129 antibody (Abcam, ab51253). (a) Low-magnification image at the injection site (interaural +9.5 mm). (b) Low-magnification image distant from the injection site (interaural +4.2 mm). High magnification of the boxed area is shown in (c)–(n). (c, g, k) caudate nucleus, (d, h) putamen, (e, i) cingulate cortex, (f) somatosensory cortex, (j, n) substantia nigra, (l) medial temporal cortex, (m) temporal area. Scale bars 50μm

138

4

Masami Masuda-Suzukake et al.

Notes 1. Our experiments were approved by the Animal Care and Use Committee of the Tokyo Metropolitan Institute of Medical Science (No. 16038) and were performed in accordance with the Guidelines for Proper Conduct of Animal Experiments by Science Council of Japan. 2. αS fibrils prepared from recombinant mouse protein were used so that the endogenous marmoset αS could be distinguished from the injected fibrils [14]. LB509 antibody (against 115–122 a.a. of human αS, Fig. 1b) can stain marmoset αS but not mouse protein. 3. We used a BRANSON Sonifier SFX250 cup horn sonicator (output 35%, for 3 min). 4. If the animal still responds to stimuli such as pinching the toes, a half dose of ketamine should be administered. Make sure that the animal is fully anesthetized. 5. Reference value: HR 120–250 beats/min, SpO2 >95%. 6. If the temporal muscle is placed on the area of injection, push it aside to clear the surface of the skull using a periosteal elevator. 7. The caudate and putamen in the ipsilateral hemisphere were chosen as the injection sites so as to target the striatum. The coordinates were determined according to the Marmoset Brain Atlas [15, 16], caudate nucleus and putamen as follows: interaural: +9.5 mm and + 9.5 mm, lateral: 3 mm and 6 mm, and depth: 6 mm and 9 mm, respectively (Fig. 2b). 8. Perches and food should be removed from the home cage to prevent falling and aspiration until the animal has fully recovered from anesthetic. 9. The skull was slowly removed with a rongeur until the brain was fully exposed. An electric handy drill can be used to open the skull. 10. We have experience cutting vibratome, frozen, and paraffinembedded sections. In our previous report, we sectioned 50μm thick free-floating sections using a vibratome [14]. However, it occasionally caused damage when sectioning at the sulcus. To avoid damage, embedding in O.C.T compound (frozen section) or paraffin (paraffin-embedded section) is recommended. 11. To observe αS pathology, antibodies against phosphorylated αS (pS129), ubiquitin, and p62 were used. Staining with β-sheet ligands, thioflavin-S and 1-Fluoro-2,5-bis(3-carboxy4-hydroxystyryl)benzene (FSB) could also be used. The protocol for staining has been described previously [14].

Common Marmoset Model of α-Synuclein Propagation

139

References 1. Goedert M (2001) Alpha-synuclein and neurodegenerative diseases. Nat Rev Neurosci 2 (7):492–501. https://doi.org/10.1038/ 35081564 2. Polymeropoulos MH, Lavedan C, Leroy E, Ide SE, Dehejia A, Dutra A, Pike B, Root H, Rubenstein J, Boyer R, Stenroos ES, Chandrasekharappa S, Athanassiadou A, Papapetropoulos T, Johnson WG, Lazzarini AM, Duvoisin RC, Di Iorio G, Golbe LI, Nussbaum RL (1997) Mutation in the alphasynuclein gene identified in families with Parkinson’s disease. Science 276 (5321):2045–2047 3. Singleton AB, Farrer M, Johnson J, Singleton A, Hague S, Kachergus J, Hulihan M, Peuralinna T, Dutra A, Nussbaum R, Lincoln S, Crawley A, Hanson M, Maraganore D, Adler C, Cookson MR, Muenter M, Baptista M, Miller D, Blancato J, Hardy J, Gwinn-Hardy K (2003) Alpha-Synuclein locus triplication causes Parkinson’s disease. Science 302(5646):841. https://doi.org/10.1126/science.1090278 4. Serpell LC, Berriman J, Jakes R, Goedert M, Crowther RA (2000) Fiber diffraction of synthetic alpha-synuclein filaments shows amyloid-like cross-beta conformation. Proc Natl Acad Sci U S A 97(9):4897–4902 5. Fujiwara H, Hasegawa M, Dohmae N, Kawashima A, Masliah E, Goldberg MS, Shen J, Takio K, Iwatsubo T (2002) AlphaSynuclein is phosphorylated in synucleinopathy lesions. Nat Cell Biol 4(2):160–164. https:// doi.org/10.1038/ncb748 6. Hasegawa M, Fujiwara H, Nonaka T, Wakabayashi K, Takahashi H, Lee VM, Trojanowski JQ, Mann D, Iwatsubo T (2002) Phosphorylated alpha-synuclein is ubiquitinated in alpha-synucleinopathy lesions. J Biol Chem 277(50):49071–49076. https://doi.org/10. 1074/jbc.M208046200 7. Braak H, Del Tredici K, Rub U, de Vos RA, Jansen Steur EN, Braak E (2003) Staging of brain pathology related to sporadic Parkinson’s disease. Neurobiol Aging 24(2):197–211 8. Luk KC, Kehm V, Carroll J, Zhang B, O’Brien P, Trojanowski JQ, Lee VM (2012)

Pathological alpha-synuclein transmission initiates Parkinson-like neurodegeneration in nontransgenic mice. Science 338(6109):949–953. https://doi.org/10.1126/science.1227157 9. Masuda-Suzukake M, Nonaka T, Hosokawa M, Oikawa T, Arai T, Akiyama H, Mann DM, Hasegawa M (2013) Prion-like spreading of pathological alpha-synuclein in brain. Brain 136(Pt 4):1128–1138. https:// doi.org/10.1093/brain/awt037 10. Masuda-Suzukake M, Nonaka T, Hosokawa M, Kubo M, Shimozawa A, Akiyama H, Hasegawa M (2014) Pathological alpha-synuclein propagates through neural networks. Acta Neuropathol Commun 2:88. https://doi.org/10.1186/s40478-014-00888 11. Zeiss CJ (2005) Neuroanatomical phenotyping in the mouse: the dopaminergic system. Vet Pathol 42:753–773 12. Okano H, Sasaki E, Yamamori T, Iriki A, Shimogori T, Yamaguchi Y, Kasai K, Miyawaki A (2016) Brain/MINDS: a Japanese National Brain Project for marmoset neuroscience. Neuron 92(3):582–590. https://doi.org/10. 1016/j.neuron.2016.10.018 13. Marx V (2016) Neurobiology: learning from marmosets. Nat Methods 13(11):911–916. https://doi.org/10.1038/nmeth.4036 14. Shimozawa A, Ono M, Takahara D, Tarutani A, Imura S, Masuda-Suzukake M, Higuchi M, Yanai K, Hisanaga SI, Hasegawa M (2017) Propagation of pathological alphasynuclein in marmoset brain. Acta Neuropathol Commun 5(1):12. https://doi.org/ 10.1186/s40478-017-0413-0 15. Paxinos G, Watson C, Petrides M, Rosa M, Tokuno H (2012) The marmoset brain in stereotaxic coordinates. Academic press, Elsevier, Amsterdam. https://www.researchgate.net/ publication/335871101_PDF_of_The_Mar moset_Brain_in_Stereotaxic_Coordinates 16. Hardman CD, Ashwell KWS (2012) Stereotaxic and chemoarchitectural atlas of the brain of the common marmoset (Callithrix jacchus). CRC Press, New York

Chapter 14 Application of a Tissue Clearing Method for the Analysis of Dopaminergic Axonal Projections Kenta Yamauchi, Megumu Takahashi, and Hiroyuki Hioki Abstract Parkinson’s disease (PD) is a neurodegenerative disorder characterized with the progressive loss of dopaminergic (DA) neurons within the substantia nigra pars compacta (SNc). Quantitative analysis of neuronal loss including neuronal processes, axons and dendrites, would advance the understanding of the pathogenesis of PD. ScaleS, an aqueous tissue clearing method, provides stable tissue preservation while maintaining potent clearing capability, allowing quantitative three-dimensional (3D) imaging of biological tissues. In this chapter, we describe detailed procedures for 3D imaging of brain slice tissues with ScaleS technique. These include brain slice preparation, tissue clarification, chemical and immunohistochemical labeling (ChemScale and AbScale), and observation of labeled tissues using a confocal laser scanning microscope (CLSM). Key words Dopaminergic neurons, Axonal projections, Tissue clearing, Confocal laser scanning microscope, Three-dimensional imaging

1

Introduction PD is a common neurodegenerative disorder that manifests with a broad range of symptoms [1]. The crucial pathological feature of PD is the progressive loss of DA neurons within the SNc. In addition to these DA neurons, neuronal loss in PD involves multiple neuroanatomical area with neurotransmitters other than dopamine [1]. Quantitative analysis of neuronal loss including neuronal processes, axons and dendrites, shows the association of its clinical expression with the pathology of neuronal loss, advancing the understanding of the pathogenesis of PD. Recent advances in tissue clearing methods have drastically improved the depth-independent observation of biological tissues with a fluorescence microscope, facilitating 3D reconstruction of brain-wide connectivity [2–4]. Quantitative 3D imaging requires a tissue clearing method that achieves accurate 3D tissue

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_14, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

141

142

Kenta Yamauchi et al.

reconstructions with potent clearing capability (clearingpreservation spectrum). Of proliferating tissue clearing methods, an aqueous tissue clearing method, ScaleS, holds a distinctive position with its effective clearing-preservation spectrum, allowing quantitative 3D imaging of pathological tissues [5]. In this chapter, we describe detailed protocols of 3D imaging of brain slices using ScaleS technique. These include brain slice preparation, tissue clarification, chemical and immunohistochemical labeling (ChemScale and AbScale), and CLSM imaging of labeled tissues. For a detailed procedure for preparation of Scale solutions, refer to Miyawaki et al., 2016 [6].

2 2.1

Materials Fixation

1. Mouse (C57B6/J). 2. Sodium pentobarbital. 3. Phosphate buffer saline (PBS): filter through filter paper. 4. Fixative solution: 4% (w/v) paraformaldehyde (PFA) in 0.1 M phosphate buffer (PB), pH 7.4 (see Note 1). Prepare before use. Add 4 g PFA in distilled deionized water (DDW) at 60–70
C. Dissolve PFA by adding 1 N NaOH, and allow the solution to cool to room temperature (RT). Add 50 mL 0.2 M PB, and bring 100 mL with DDW. Filter the solution through filter paper. 5. 0.02% NaN3 in PBS (see Note 2). 6. 22-gauge regular bevel needle and 25 mL syringe. 7. Surgical scissors. 8. Tweezers.

2.2 Brain Slice Preparation

1. 4% (w/v) agar in PBS: Add 2 g agar to 50 mL of PBS. Melt the agar by heating the slurry in a microwave oven. Allow the solution to cool at 40–45
C. 2. 0.1 M PB, pH 7.4. 3. PBS. 4. 0.02% NaN3 in PBS. 5. 6-well cell culture plate. 6. Razor blade. 7. Aron alpha A (Daiichi-Sankyo). 8. Vibrating blade tissue slicer (#PRO7N, Dosaka EM).

Dopaminergic Neuron Imaging with Scale Technology

2.3

ChemScale

143

1. ScaleA2 solution: 4 M urea. 0.1% (w/v) Triton X-100 (see Note 3). 10% (w/v) glycerol. Dissolve all solutes in DDW, and stir until well mixed. Leave the solution overnight at RT. Store at 4
C for up to 1 month. 2. ScaleS0 solution (see Note 4): 20% (w/v) D-()-sorbitol. 5% (w/v) glycerol. 1 mM methyl-β-cyclodextrin (#M1356, Tokyo Chemical Industry) (see Note 5). 1 mM γ-cyclodextrin (#037-10643, Wako Pure Chemical Industries) (see Note 6). 3% (w/v) dimethylsulfoxide (DMSO). Dissolve all solutes in PBS(), and stir until well mixed. Leave the solution overnight at RT. Store at 4
C for up to 1 month. 3. ScaleS4(D25T0.2) solution: 40% (w/v) D-()-sorbitol. 10% (w/v) glycerol. 4 M urea. 0.2% (w/v) Triton X-100. 25% (v/v) DMSO. Dissolve all solutes in DDW by stirring on a hot plate, and stir until well mixed. Leave the solution overnight at RT. Store at 4
C for up to 1 month. 4. PBS(). 5. Propidium iodide (PI) (see Note 7). 6. 6-well cell culture plate. 7. 12-well cell culture plate. 8. Spatula. 9. Orbital shaker. 10. Constant temperature incubator shaker.

2.4

AbScale

1. ScaleA2 solution. 2. ScaleS0 solution. 3. ScaleS4(D25T0.2) solution. 4. AbScale solution:

144

Kenta Yamauchi et al.

0.33 M urea. 0.1% (w/v) Triton X-100. Dissolve all solutes in PBS(), and stir until well mixed. Leave the solution overnight at RT. Store at 4
C for up to 1 month. 5. PBS(). 6. Mouse monoclonal anti-tyrosine hydroxylase (TH) antibody (Merck Millipore). 7. Alexa Fluor® 647 conjugated donkey anti-mouse IgG (Thermo Fisher Scientific). 8. 6-well cell culture plate. 9. Safe-Lock tubes, 2.0 mL (Eppendorf). 10. Cardboard freezer box. 11. Kim Wipe (NIPPON PAPER CRECIA). 12. Spatula. 13. Orbital shaker. 14. Constant temperature incubator shaker. 2.5 Brain Slice Mounting and CLSM Imaging

1. ScaleS4(D25T0) solution: 40% (w/v) D-()-sorbitol. 10% (w/v) glycerol. 4 M urea. 25% (v/v) DMSO. Dissolve all solutes in DDW by stirring on a hot plate, and stir until well mixed. Leave the solution overnight at RT. Store at 4
C for up to 1 month. 2. ScaleS4 gel: 1.5–2.5% (w/v) low melting temperature agarose. ScaleS4(D25T0) solution. Add 1.5–2.5 g agarose powder into ScaleS4(D25T0) solution to make 100 mL of a mixture. Stir until well mixed. Melt the agarose powder by heating in a microwave. Allow the solution to cool at 37
C. 3. Aron alpha A. 4. Kim Wipe. 5. Glass petri dish (60 mm). 6. Micro spatula, stainless steel. 7. Orbital shaker. 8. CLSM system (Leica Microsystems).

Dopaminergic Neuron Imaging with Scale Technology

145

9. 16 multi-immersion objective lens (#HC FLUOTAR 16/ 0.60 IMM CORR VISIR, Leica Microsystems) (see Note 8).

3 3.1

Methods Fixation

1. Anesthetize an adult mouse (8–16 weeks old) with an intraperitoneal injection of sodium pentobarbital (200 mg/kg). Follow institutional regulations. 2. Open the thoracic cavity with surgical scissors, cut the right atrial appendage, and immediately insert a 22-gauge needle into the left ventricle of the heart from the apex. 3. Perfuse with 20 mL ice-cold PBS using a syringe over 1–3 min. 4. Perfuse with 20 mL ice-cold fixative with another syringe over 1–3 min. 5. Decapitulate using surgical scissors, and remove the scalp, skull, and dura mater with tweezers. 6. Collect the brain in the same fixative, and gently shake for 8–72 h at 4
C. Brain tissues can be stored in 0.02% NaN3 in PBS at 4
C (see Note 9).

3.2 Brain Slice Preparation

1. Soak a razor blade in ethanol to remove any oils or adhesives. 2. Attach the razor blade to the blade holder. 3. Pour 4% agar in PBS into a 6-well culture plate (see Note 10). 4. Submerge the brain tissue in the 4% agar in PBS, and leave the plate on ice until the agar solidifies. 5. Remove the embedded brain tissue and agar, and trim excess agar away. 6. Glue the agar block to the bottom of a vibratome bath with Aron alpha A, and pour 0.1 M PB into the bath (see Note 11). 7. Cut 1 to 3-mm-thick brain slices, and collect the slices in a 6-well cell culture plate containing PBS. Brain slices can be stored in 0.02% NaN3 in PBS at 4
C.

3.3 ChemScale Labeling

1. Transfer the brain slices with a spatula into pre-warmed ScaleS0 solution in a 6-well cell culture plate, and incubate them for 2 h at 37
C with shaking (90 rpm) on the constant temperature incubator shaker (see Note 12). 2. Incubate the brain slices with ScaleA2 solution in a 6-well cell culture plate for 24 h at 37
C with shaking (90 rpm) on the constant temperature incubator shaker (see Note 13). 3. Incubate the brain slices with 1.0 μg/mL PI in ScaleA2 solution in a 12-well cell culture plate for 2–6 h at 37
C with

146

Kenta Yamauchi et al.

shaking (90 rpm) on the constant temperature incubator shaker. 4. Wash the brain slices with ScaleA2 solution in a 6-well cell culture plate for 1 h twice at RT on the orbital shaker. 5. Wash the brain slices with PBS() in a 6-well cell culture plate for 15 min twice at RT on the orbital shaker. Brain slices can be stored in 0.02% NaN3 in PBS at 4
C. 6. Incubate the brain slices with ScaleS4(D25T0.2) solution in a 6-well cell culture plate for 6–12 h at 37
C (see Note 14). 3.4

AbScale Labeling

1. Transfer the brain slices with a spatula into pre-warmed ScaleS0 solution in a 6-well cell culture plate, and incubate them for 2 h at 37
C with shaking (90 rpm) on the constant temperature incubator shaker. 2. Incubate the brain slices with ScaleA2 solution in a 6-well cell culture plate for 24 h at 37
C with shaking (90 rpm) on the constant temperature incubator shaker (see Note 15). 3. Wash the brain slices with PBS() in a 6-well cell culture plate for 15 min twice at RT on the orbital shaker. 4. Transfer the brain slices with a spatula into a 2 mL Safe-Lock tube containing 1:100 diluted mouse anti-TH antibody in AbScale solution (see Note 16). Place the tubes in a cardboard freezer box (Fig. 1a), and fill the space in the box with Kim Wipes (Fig. 1b). Seal the box with tape (Fig. 1c), and place the box on the constant temperature incubator shaker sideways (Fig. 1d). Incubate the brain slices for 7 days at 37
C with shaking (90 rpm) (see Note 17). 5. Wash the brain slices with AbScale solution in a 6-well cell culture plate for 1 h six times at RT on the orbital shaker. 6. Transfer the brain slices with a spatula into a 2 mL Safe-Lock tube containing 10 μg/mL Alexa Fluor® 647 conjugated donkey anti-mouse IgG in AbScale solution. Place the tubes in a cardboard freezer box (Fig. 1a), and fill the space in the box with Kim Wipes (Fig. 1b). Seal the box with tape (Fig. 1c), and place the box on the constant temperature incubator shaker sideways (Fig. 1d). Incubate the brain slices for 7 days at 37
C with shaking (90 rpm) (see Note 18). 7. Wash the brain slices with AbScale solution in a 6-well cell culture plate for 1 h four times at RT on the orbital shaker. 8. Fix the brain slices with the fixative for 1 h at RT. 9. Wash the brain slices with PBS() in a 6-well cell culture plate for 15 min twice at RT on the orbital shaker. Brain slices can be stored in 0.02% NaN3 in PBS at 4
C. 10. Incubate the brain slices with ScaleS4(D25T0.2) solution in a 6-well cell culture plate for 6–12 h at 37
C.

Dopaminergic Neuron Imaging with Scale Technology

147

Fig. 1 Sample processing procedure for the antibody incubation. (a) 2 mL Safe-Lock tubes in a cardboard freezer box. (b) Filling the space in the box with Kim Wipes. (c) Sealing the box with tape. (d) Placement of the box on the constant temperature incubator shaker 3.5 Brain Slice Mounting and CLSM Imaging

1. Place the cleared brain slice on the bottom of a glass petri dish. 2. Wipe up excessive ScaleS4(D25T0.2) solution around the slice, and leave the slice to lightly dry the surface of brain slice (typically 5–15 min). 3. Drop ScaleS4 gel on the brain slice, and allow the gel to solidify in a refrigerator for 30–60 min (see Note 19). 4. Trim away the edges of the gel with a micro-spatula. Wipe out the surface of the dish with a wet Kim Wipe, and leave it in the air for 5 min. 5. Attach the rim of the gel onto the dish with Alon alpha A. Adhesion at multiple points is required. Leave it in the air for 10 min for complete immobilization of the gel, which can be checked by slanting the dish. 6. Pour ScaleS4(D25T0.2) solution into the dish. 7. Equilibrate the sample to ScaleS4(D25T0.2) by gentle shaking on the orbital shaker for 1 h at RT. 8. Substitute fresh ScaleS4(D25T0.2) solution for observation. Samples can be stored in the ScaleS4(D25T0.2) solution at 4
C for 1 week.

148

Kenta Yamauchi et al.

Fig. 2 ChemScale labeling of a 1-mm-thick mouse brain slice with PI. (a, b) Transmission images of a 1-mm-thick brain slice before (a) and after (b) ChemScale labeling with PI. The grid interval is 1 mm. (c) An xy image of the brain slice at the depths of 800 μm. Ctx cerebral cortex, Hipp hippocampus, PI propidium iodide. Scale bar: 1 mm

Fig. 3 AbScale labeling of DA axonal projections in the mouse striatum. (a) A transmission image of a 1-mm-thick brain slice at the level of the striatum after AbScale labeling for TH. The grid interval is 1 mm. (b) An xy image of the slice at the depths of 400 μm. (c) A high magnification xy image in the caudate-putamen at the depths of 200 μm. CPu caudate-putamen, Ctx cerebral cortex, IC internal capsule, TH tyrosine hydroxylase. Scale bar: 1 mm and 20 μm in (b) and (c)

9. Immerse the 16 multi-immersion objective lens in ScaleS4 (D25T0.2) solution, and make it approach to the sample slowly. 10. Observe the slices under a CLSM (Figs. 2 and 3) (see Note 20).

4

Notes 1. PFA is a toxic chemical and a teratogen. Avoid inhalation or contact with skin. Handle it inside a fume hood with appropriate protective gear. 2. Sodium azide is toxic. Avoid inhalation or contact with skin. Handle it inside a fume hood with appropriate protective gear.

Dopaminergic Neuron Imaging with Scale Technology

149

3. Prepare Triton X-100 stock solution (10% [w/v] Triton X-100) as follows: Dissolve 10 g Triton X-100 in approximately 80 mL DDW by stirring. Bring 100 mL with DDW, and stir until well mixed. Store the solution at 4
C. 4. The original ScaleS0 solution contains: N-acetyl-L-hydroxyproline from Skin Essential Actives (Taiwan) [5]. If this amino acid derivative is difficult to obtain from the manufacture, N-acetyl-L-hydroxyproline must be omitted from the solution. Do not use N-acetyl-L-hydroxyproline provided by other manufactures. These products can affect tissue clarification. 5. 100 mM methyl-β-cyclodextrin can be stored at 20
C for three months as a stock solution. 6. 100 mM γ-cyclodextrin can be stored at 20
C for three months as a stock solution. 7. Other nuclear staining dyes, such as 40 ,6-diamidino-2-phenylindole (DAPI) and Hoechst 33342, can be used for ChemScale. 8. ScaleS4(D25T0.2) solution has refractive index (RI) around 1.47. Objective lenses that support for high RIs should be used for observation. 9. For long-term storage, increase the concentration of sodium azide to 0.2%. 10. Much care should be taken to verify that the agar solution is cooled enough. 11. To prevent the blade holder from getting rust, PB but not PBS should be used. 12. Brain slices show shrinkage during the incubation with ScaleS0 solution. 13. Brain slices expand during the incubation with ScaleA2 solution. 14. Brain slices become transparent after the incubation with ScaleS4(D25T0.2) solution. 15. An optimized incubation time should be determined empirically dependent on antibodies (typically 24–72 h). Longer incubation time enhances antibody penetration. 16. An optimized concentration of the antibody should be determined empirically. 17. An optimized incubation time should be determined empirically dependent on antibodies (typically 1–14 days). Longer incubation time enhances antibody penetration.

150

Kenta Yamauchi et al.

18. Much care should be taken to verify that ScaleS4 gel is cooled enough. 19. CLSM observation for a long time causes water evaporation of ScaleS4(D25T0.2) solution. This can be prevented by covering the surface of the solution with a thin plastic film made of saran.

Acknowledgments This study was supported by Grants-in-Aid from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) and the Japan Society for the Promotion of Science (JSPS) for Scientific Research (JP20K07231 to K.Y; JP16H04663 to H.H.) and Scientific Research on Innovative Area “Resonance Bio” (JP18H04743 to H.H.). This study was also supported by the Japan Agency for Medical Research and Development (AMED) (JP20dm0207064 to H.H.), Grants-in-Aid from the Research Institute for Diseases of Old Age at the Juntendo University School of Medicine (X2016 to K.Y.; X2001 to H.H.), and MEXT Private University Research Branding Project (Juntendo University). References 1. Kalia LV, Lang AE (2015) Parkinson’s disease. Lancet 386(9996):896–912. https://doi.org/ 10.1016/S0140-6736(14)61393-3 2. Richardson DS, Lichtman JW (2015) Clarifying tissue clearing. Cell 162(2):246–257. https:// doi.org/10.1016/j.cell.2015.06.067 3. Ueda HR, Dodt HU, Osten P, Economo MN, Chandrashekar J, Keller PJ (2020) Whole-brain profiling of cells and circuits in mammals by tissue clearing and light-sheet microscopy. Neuron 106(3):369–387. https://doi.org/10. 1016/j.neuron.2020.03.004 4. Ueda HR, Erturk A, Chung K, Gradinaru V, Chedotal A, Tomancak P, Keller PJ (2020)

Tissue clearing and its applications in neuroscience. Nat Rev Neurosci 21(2):61–79. https:// doi.org/10.1038/s41583-019-0250-1 5. Hama H, Hioki H, Namiki K, Hoshida T, Kurokawa H, Ishidate F, Kaneko T, Akagi T, Saito T, Saido T, Miyawaki A (2015) ScaleS: an optical clearing palette for biological imaging. Nat Neurosci 18(10):1518–1529. https://doi. org/10.1038/nn.4107 6. Miyawaki A, Hama H, Hioki H, Namiki K, Hoshida T, Kurokawa H (2016) Deep imaging of cleared brain by confocal laser-scanning microscopy. Protocol Exchange. https://doi. org/10.1038/protex.2016.019

Chapter 15 Deep Brain Stimulation Using Animal Models of Parkinson’s Disease Asuka Nakajima and Yasushi Shimo Abstract The use of deep brain stimulation (DBS) as a therapy for neurological disorders, especially Parkinson’s disease (PD), is widely applied in the field of functional neurosurgery. Both the subthalamic nucleus and the globus pallidus interna are major targets for PD. Experimental DBS is performed using animal models to evaluate new indications and promote advancements in technology. In this chapter, we reviewed our experience with the concept of experimental DBS, including its development and validation. The following work aimed to establish that experimental DBS in animals is an adequate tool for exploring new indications for DBS and to further refine DBS technology. Key words Basal ganglia, Deep brain stimulation, Single-unit recording, Voltammetry

1

Introduction Parkinson’s disease (PD) is one of the most common neurodegenerative disorders characterized by a gradual and progressive degeneration of dopaminergic neurons in the substantia nigra, which leads to the loss of dopaminergic inputs into the striatum. Low dopaminergic tone in the striatum causes abnormal neuronal firing patterns (oscillations) in the cortico-basal ganglia circuit, which leads to PD symptoms such as bradykinesia, rigidity, and tremor [1]. Deep brain stimulation (DBS) is a widely accepted therapy for advanced PD. Applying high-frequency (around 130 Hz) electrical stimulation through an implanted electrode improves the symptoms of PD and reduces the necessity for anti-PD medication, when implanted into the subthalamic nucleus (STN). The exact mechanism(s) of how DBS modulates neuronal activity of neurons within the proximity of the electrode is still unknown. Due to recent therapeutic advancements, DBS is applied not only to movement disorders but also to psychiatric disorders [2]. Given its vastly

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_15, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

151

152

Asuka Nakajima and Yasushi Shimo

growing applications, it is important to elucidate the therapeutic mechanisms of DBS. In 2017, we conducted a series of experiments to help clarify the therapeutic mechanisms of DBS, using nonhuman primates. In this chapter, we provide an overview on how to clarify the therapeutic mechanisms of DBS in nonhuman primates.

2

Materials

2.1 Experimental Animal

1. Female adult Japanese monkeys (Macaca fuscata, weighing between 5 and 7 kg): Confirm that the experimental protocols have been approved by the institution’s Animal Care and Use Committee or appropriate equivalent. Conduct all experiments according to the guidelines set forth by the National Institutes of Health’s Guide for the Care and Use of Laboratory Animals. 2. Primate cages with free access to food and water for each monkey.

2.2

Surgery

1. A commercially available tungsten microelectrode (Resistance, 0.5–1 Mohm). 2. Hamilton microsyringe. 3. Microdrive (Narishige, MO-903A). 4. Ketamine hydrochloride. 5. Medetomidine hydrochloride. 6. 15–20 titanium screws. 7. Dental acrylic resin (REPAIRSIN, GC Corporation). 8. Custom-made rectangular Delrin chamber (length and width: 32
26 mm). 9. A Combined MRI and Histology Atlas of the Rhesus Monkey Brain in Stereotaxic Coordinates 2nd Edition. 10. Custom-made head holder. 11. Cefazolin.

2.3 Mapping the Striatum, STN, and Globus Pallidus Interna (GPi)

1. Magnetic resonance imaging (MRI, 0.3 T; AIRIS2, Hitachi Medical Co.). 2. Tungsten microelectrodes (FHC Inc.) 3. Stainless steel guide tube (30G). 4. Microdrive (Narishige, MO-903A). 5. Artificial cerebral spinal fluid (aCSF): NaCl 14 mM, KCl 2.8 mM, MgCl2 1.2 mM, CaCl2 1.2 mM; and Na2HPO4, 1 mM. hydrochloric acid, pH 7.2–7.4. 6. Muscimol: 1 μg/μL in aCSF. 7. Recording-injection system (see Subheading 2.6).

Deep Brain Stimulation Using Animal Models of Parkinson’s Disease

153

Fig. 1 Design of the stimulating electrode used for monkey brains

Fig. 2 Design of the recording-injection system 2.4 Preparation of Quadripolar Stimulation Electrodes

1. Quadripolar platinum stimulation electrodes: The four polyvinyl chloride-insulated copper wires are threaded into a stainless steel tube. The tip of the wire is attached to the platinum/ iridium. The tip of the electrode consists of four uninsulated contacts. All contacts are 1 mm apart. The overall specifications are shown in Fig. 1.

2.5 Recording Experiment

1. Grid: Made of Delrin. The holes (diameter 0.5 mm) are made to be within a 1.0 mm
1.0 mm space. This grid is helpful to avoid misplacement of the electrode and potentially unstable recordings. 2. Tungsten microelectrodes (FHC Inc.). 3. Ketamine hydrochloride. 4. Medetomidine hydrochloride.

2.6 Preparation of Recording-Injection System

1. Recording-injection system (see Note 1): The system consists of a tungsten microelectrode (FHC Inc.) for unit recordings which is placed within a stainless steel tube (diameter 24G, 85 mm in length) for drug delivery. The tip of the recording electrode 0.25–0.50 mm exposed from the end of the stainless steel tube. Connect the recording-injection assembly to polyethylene tubing (inner diameter 0.5 mm) with epoxy resin, which is attached to Teflon tubing with an inner diameter of 0.1 mm (EICOM), connected to a Hamilton microsyringe. The overall specifications are shown in Fig. 2 (see Note 2).

154

Asuka Nakajima and Yasushi Shimo

2.7 High-Frequency Stimulation (HFS) of the STN or GPi

1. Muscimol: 1 μg/μL in aCSF. 2. Custom-made stimulating electrode prepared in Subheading 2.4. 3. Stimulation isolator (SS-203J, Nihon Kohden). 4. Pulse generator (SEN-7203, Nihon Kohden). 5. Recording drive (Multichannel Acquisition; Plexon). 6. Data sorting (Off-line Sort Program, Plexon).

2.8 RecordingInjection Experiments

1. CGP55845: 0.05–0.1 mmol/mL in aCSF. 2. Sulpiride: 29 mmol/mL diluted in aCSF. 3. Gabazine: 1 or 2 mmol/mL in distilled water. 4. Recording-injection system prepared in Subheading 2.6. 5. Stimulation isolator (SS-203J, Nihon Kohden). 6. Pulse generator (SEN-7203, Nihon Kohden). 7. Recording drive (Multichannel Acquisition; Plexon). 8. Data sorting (Off-line Sort Program, Plexon).

3

Methods

3.1 Experimental Animals

1. Train the monkeys daily to sit quietly on a monkey chair. This training phase takes approximately 2–4 weeks (see Note 3).

3.2

1. Conduct the surgery to place the head holder and chamber on the animal’s head to be used for the stereotactic recordings once the animal has been trained to sit on the chair.

Surgery

2. Anesthetize the monkey with an intramuscular administration of ketamine (4 mg/kg) and medetomidine (1 mg/kg). Work with aseptic operation. 3. Exposes the skull with a vertical incision from the forehead to the back of the skull. Anchor 15–20 titanium screws to the skull and secure them with dental acrylic resin. 4. Place a custom-made rectangular Delrin chamber over the animal’s head for both recording of the neuronal activity within the striatum and stimulation of the STN or GPi, referring to the information of A Combined MRI and Histology Atlas of the Rhesus Monkey Brain in Stereotaxic Coordinates 2nd Edition. Use the following measurements in mm: the anteriorposterior ¼ +9.8 from the center of the ear bar centerline and the lateral-medial ¼ +6.2 from the center of the sagittal line of the skull (Fig. 3). 5. Attach the head holder and Delrin chamber to the skull with dental acrylic resin.

Deep Brain Stimulation Using Animal Models of Parkinson’s Disease

155

Fig. 3 A coronal MRI scan of the monkey brain. White structure is the recording chamber which was filled with glycerin

6. Administer the antibiotic cefazolin (50 mg, i.m.), pre- and post-surgery. 3.3 Mapping the Striatum, STN, and GPi

1. Perform an MRI scan to estimate the location of each region relative to the chamber (Fig. 3) before recording the neuronal activity of the striatum. 2. Fill the chamber with glycerin to facilitate its appearance in the MRI scan. 3. Estimate the location of the target regions relative to the chamber, according to the MRI scans and the stereotactic brain atlas. 4. Insert the tungsten microelectrode into a stainless steel guide tube (30G), which penetrates the dura matter. Mount this onto a microdrive. 5. Lower the microdrive slowly and penetrate the dura matter with the guide tube. Use the microdrive to guide the electrode to its optimal location. 6. Identify the STN and GPi by their characteristic firing patterns and relative location to the striatum [3]. 7. Identify the precise location of the STN. Perform a microinjection of the GABA antagonist muscimol (1 μg/μL) into the STN at a rate of 0.2 μL/30 s for a total of 1 μL using the recording-injection system. 8. Induce abnormal ballistic-contralateral body movements by inhibiting neuronal activity in the STN with muscimol.

156

Asuka Nakajima and Yasushi Shimo

3.4 Recording Preparation

1. Fit a grid to the chamber. 2. Mount the microdrive with tungsten microelectrodes onto the grid. 3. Record single-unit neuronal activity using tungsten microelectrodes (see Note 4). 4. Previous to each recording session, sedate the animal lightly with ketamine hydrochloride (0.5–0.75 mg, i.m.) and medetomidine hydrochloride (0.01–0.015 mg, i.m.) to avoid artifacts caused by the monkey’s body movements in each recording session. 5. Use the booster injections, intermittently to prevent interfering vocalizations.

3.5 HFS of the STN or GPi

1. Determine the stimulation site in the GPi using the same methods as those used for human patients (see Note 5). 2. Implant a custom-made stimulating electrode (Fig. 1) after identifying the location of the STN or GPi (see Note 6). 3. Stimulate the STN and GPi with quadripolar electrodes with four uninsulated tips spread 1 mm apart. Use a stimulation isolator to control pulse width, frequency, and duration of stimulation and a pulse generator. Send the stimulation timestamp to a Plexon’s system. 4. Set contact 1 of quadripolar stimulation electrodes as the anode and contact 2 as the cathode. 5. Set the other stimulus parameters as follows: bipolar stimulation, strength up to 0.4 mA, 130 Hz, 60 μs, delivered for 30 or 10 s. 6. Determine stimulating parameters such as amplitude, frequency, and anode/cathode contacts by observing the LANs response to STN stimulation (see Note 7).

3.6 Extracellular Neuronal Recording of the Striatum

1. Identify the striatum based on its anatomical location, as estimated using MRI scans and position relative to other regions, such as the STN and GPi. 2. Identify LANs based on their characteristic spike waveform (broad and often initial positive) and their regular tonic firing pattern (3–10 Hz), which is dissimilar to the very low resting firing frequency of striatal projection neurons [4, 5]. 3. Amplify the recorded signals 8000 times and filter to 300–5000 Hz. Digitize and store all waveforms in a computer for offline analysis. 4. Distinguish individual spikes from artifacts using principal component analysis and visualization of the selected waveforms.

Deep Brain Stimulation Using Animal Models of Parkinson’s Disease

157

5. Use principal component analysis to display the recorded waveforms in a 2D cluster view. 6. Use manual sorting to separate the waveforms, including artifacts, into individual units. 7. Inspect the resulting clusters and consider the units to be separate only if the cluster borders do not overlap. 8. Inspect the individual waveforms of the clusters visually to ensure that there are no artifacts. 3.7 RecordingInjection Experiments

1. Record the activity of LANs before, during, and after injection of the D2 antagonist sulpiride, gabazine, or CGP55845 during STN and GPi stimulation (see Note 8). 2. Inject the drug solutions through the stainless steel tube via hand pressure, applied to the Hamilton microsyringe (0.2 μL per 30 s for a total of 1.2 μL). 3. Additionally, evaluate the effects of the drugs within 5–10 min after the injection (see Note 9) [6]. 4. Continue recording for at least 10 min after the end of the injection (see Note 10).

3.8

Data Analysis

1. Convert spontaneous single-unit spiking activities to interspike intervals (ISIs) in order to calculate the discharge rates (binned in 500 ms intervals). 2. Compare ISIs during the 30 s period before stimulation to ISIs during stimulation to evaluate the responses of individual LANs to STN- and GPi-HFS. 3. Construct peri-stimulus time histograms (bin width of 0.5 s) for the stimulus trials to evaluate the responses of LANs to drug injection during STN-HFS and GPi-HFS. 4. Analyze changes in neuronal activity in response to drug injection before and during stimulation using the nonparametric Mann–Whitney U-test. 5. Calculate the occurrence of burst discharges to determine the changes in the LANs firing pattern after drug or electrical stimulation using an algorithm based on the Poisson “surprise” method [7]. 6. Apply the algorithm separately to the data that was collected either pre- and postinjection or before and during stimulation. 7. Compare groups of ISIs to the overall distribution of ISIs in the spike train. 8. Check that for the initial classification of a burst, two consecutive ISIs (three spikes) each have to be shorter than half of the mean ISI of the cell.

158

Asuka Nakajima and Yasushi Shimo

9. Check that the Poisson “surprise” value for this “burst” [i.e., the negative logarithm of the probability of the occurrence of the sequence of ISIs, constituting the burst under the assumption of random (Poisson) firing] must be 10. 10. Check that additional ISIs are added to the beginning or the end of the burst until further extension of the burst do not increase the resulting burst’s surprise value. This burst detection method is frequently used in primate and human recording studies and yields conservative estimates for the occurrence of bursts. 11. Compare the pre- and postinjection burst indices of individual cells using the Mann–Whitney U-test. 12. Consider P < 0.05 as statistically significant for all statistical tests. 13. Express the discharge rates as the mean  standard deviation. 14. Reconstruct the recording site for each monkey at the end of the experiment using MRI and the recording results.

4

Notes 1. To clarify the role of specific neurotransmitters in the activity of particular neurons in vivo, it is necessary to use a recordinginjection system that can record extracellular neuronal activity under local injection of drugs to modify receptor function. 2. On the first training day, when monkeys were learning to sit in their chair, they were given sedatives and led to the chair. After the drug effects wore off, the monkeys were given a reward (food, juice, etc.) to train them so that if they sat in the chair, they would be rewarded. 3. During the recording experiments, it is important to avoid contamination of artificial noise, such as radio waves. Therefore, if possible, it is better to perform the experiment in a sealed, soundproof room. 4. Recognize the stimulation location is 0.5 mm above the lower GPi border where it is possible to identify noise from the optic tract by light-induced stimulation of the ipsilateral eye. 5. Locating the area of interest can be challenging, particularly when it is not a superficial structure and readily visible. There are several ways to find the target area, which maximize the time for experimentation and data collection. With the injection-recording system, inject the GABA-A antagonist muscimol into the center of the STN (0.2 every 30 s for a total of 1 μL) to transiently inactivate STN neurons, as in previous studies [8, 9], which leads to hemi-ballistic movement

Deep Brain Stimulation Using Animal Models of Parkinson’s Disease

159

Fig. 4 Effect of local injection of the D2 receptor antagonist sulpiride on STN-HFS–induced suppression of LAN firing (population histograms). (a) Pre-injection, (b) 2 min after injection, and 6 min after injection (c). The STN-HFS–induced suppression of LAN firing was transiently blocked by local injection of sulpiride (a–c). Red bars indicate stimulation period

of the contralateral side of the injection site. This method is useful for verifying the targeting of the STN. 6. In the striatum, approximately 80% of neurons are medium spiny neurons (MSNs), which project to structures outside of the striatum. MSNs rarely fire during resting conditions. Large aspiny neurons (LANs) comprise 10% of striatal neurons and show tonic firing patterns. Because of the unique firing patterns, you can separately identify MSNs or LANs and detect the border of the striatum. 7. Inject receptor antagonists locally and subsequently record the extracellular activity from LANs during HFS of the STN and GPi to examine the neurotransmitter pathways involved in the regulation of LAN activity (Fig. 4). Previous studies using a similar injection method indicated that the drug-affected area could be 0.5–1.0 mm in diameter [9, 10]. 8. Do not inject the drugs until a stable baseline recording is acquired at least for 1 min. 9. Expose the animals to only one injection per day.

160

Asuka Nakajima and Yasushi Shimo

References 1. Hammond C, Bergman H, Brown P (2007) Pathological synchronization in Parkinson’s disease: networks, models and treatments. Trends Neurosci 30(7):357–364 2. Clausen J (2010) Ethical brain stimulation neuroethics of deep brain stimulation in research and clinical practice. Eur J Neurosci 32(7):1152–1162 3. Rodriguez-Oroz MC, Rodriguez M, Guridi J, Mewes K, Chockkman V, Vitek J et al (2001) The subthalamic nucleus in Parkinson’s disease: somatotopic organization and physiological characteristics. Brain 124 (Pt 9):1777–1790 4. Aosaki T, Graybiel AM, Kimura M (1994) Effect of the nigrostriatal dopamine system on acquired neural responses in the striatum of behaving monkeys. Science 265 (5170):412–415 5. Morris G, Arkadir D, Nevet A, Vaadia E, Bergman H (2004) Coincident but distinct messages of midbrain dopamine and striatal tonically active neurons. Neuron 43 (1):133–143

6. Kita H, Nambu A, Kaneda K, Tachibana Y, Takada M (2004) Role of ionotropic glutamatergic and GABAergic inputs on the firing activity of neurons in the external pallidum in awake monkeys. J Neurophysiol 92 (5):3069–3084 7. Legendy CR, Salcman M (1985) Bursts and recurrences of bursts in the spike trains of spontaneously active striate cortex neurons. J Neurophysiol 53(4):926–939 8. Kita H, Chiken S, Tachibana Y, Nambu A (2006) Origins of GABA(A) and GABA (B) receptor-mediated responses of globus pallidus induced after stimulation of the putamen in the monkey. J Neurosci 26(24):6554–6562 9. Shimo Y, Wichmann T (2009) Neuronal activity in the subthalamic nucleus modulates the release of dopamine in the monkey striatum. Eur J Neurosci 29(1):104–113 10. Nakajima A, Shimo Y, Uka T, Hattori N (2017) Subthalamic nucleus and globus pallidus interna influence firing of tonically active neurons in the primate striatum through different mechanisms. Eur J Neurosci 46 (11):2662–2673

Part III Invertebrate Models of Parkinson’s Disease

Chapter 16 Assessment of Cytotoxicity of α-Synuclein in Budding Yeast Using a Spot Growth Assay and Fluorescent Microscopy Masak Takaine Abstract The budding yeast Saccharomyces cerevisiae is a model organism amenable both to genetic analysis and cell biology. Due to these advantages, yeast has provided platforms to examine the properties of pathogenic proteins involved in human diseases. The methods used to examine the cytotoxicity and intracellular localization of α-Synuclein, a human neuronal protein implicated in Parkinson’s disease, using yeast have been described herein. These methods are readily accessible to researchers or graduate students unfamiliar with experiments using yeast and applicable to larger scale analyses, such as high-throughput genetic and chemical screenings. Key words α-synuclein, Toxicity assessment, Budding yeast, Transformation, Spot growth assay, Fluorescent microscopy

1

Introduction Human α-synuclein is a protein that is abundantly expressed in nerve cells in the brain and predominantly localizes to presynaptic terminals [1]. Although the biological functions of α-synuclein currently remain unclear, its aggregation is cytotoxic and may induce neural cell death that results in several neurodegenerative diseases, including Parkinson’s disease [2]. Despite extensive efforts, the mechanisms underlying the aggregation of α-synuclein and the toxicity of its aggregates have not yet been elucidated [3]. Saccharomyces cerevisiae, also known as baker’s yeast, is one of the most powerful model organisms in genetics and cell biology. It has also served as a model system for investigating the toxic aggregation of proteins in neurodegenerative diseases, such as α-synuclein [4, 5], amyloid β (Alzheimer’s disease), huntingtin (Huntington’s disease), and TDP-43 (amyotrophic lateral sclerosis) (reviewed in [6]). Basic methods to express α-synuclein in budding yeast cells have been described herein, and its toxicity was

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_16, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

163

164

Masak Takaine

Fig. 1 Transformation and spot growth assay. (a) Three examples of streaking motion. Orange dots indicate a cell suspension. The first, second, and third streaking motions are shown in black, blue, and red, respectively. (b) A scheme to illustrate spreading of cells using a 1000-μl pipette tip (side view, not to scale). An orange object indicates a cell suspension. (c) Preparation of serial dilutions in a 96-well microplate. (d) An example of a 5
8 grid to spot the cell culture onto a 9-cm plate. Place cell dilutions over “+” marks. (e) Toxicity assessment of α-synuclein expression in yeast cells by a spot growth assay. Serial dilutions of cells bearing the indicated plasmids were spotted onto an SCG-U (left and middle) or SC-U (right) plate. Plates were incubated at 30  C for 2 days and imaged

evaluated by a spot growth assay and fluorescent microscopy. These techniques revealed that some single-gene deletion mutants of interest were more sensitive to the toxicity of α-synuclein than wild-type cells (Fig. 1) and also that cytoplasmic aggregates of α-synuclein are more likely to accumulate in mutant cells (Fig. 2)

Toxicity Assessment of α-Synuclein using Budding Yeast

165

Fig. 2 Observation of α-synuclein-GFP in budding yeast cells. (a) Intracellular localization of α-synuclein-GFP in wild-type and mutant cells. Cells bearing pYES2-α-synuclein-GFP plasmids were grown on SCG-U at 30  C for approximately 40 h and then imaged. Representative green fluorescence (shown as inverted grayscale) and bright-field images are shown. Arrowheads indicate some cytoplasmic foci for clarity. Bar ¼ 5 μm. (b) Localization patterns of α-synuclein-GFP. Cells were classified and scored according to the localization pattern of α-synuclein-GFP. More than 100 cells were scored for each strain. PM, plasma membrane; ER, endoplasmic reticula

[7]. The experiments described herein are for a low-throughput analysis; however, the principal is applicable to a high-throughput format such as genetic screening to identify mutants resistant to the expression of α-synuclein. Chemical screening can also be performed to detect compounds that reduce the toxicity or

166

Masak Takaine

aggregation of α-synuclein. Yeast mutants sensitive to the expression of α-synuclein were previously identified by high-throughput screening using a similar method [5]. Detailed protocols with background information for the expression of a protein of interest in budding yeast and assessments of intracellular localization and cytotoxicity are provided in addition to a basic protocol for the preparation of media, transformation, spot assays, and microscopy. This information will be useful as a beginner’s guide to experiments with yeast.

2

Materials

2.1 Budding Yeast Strains and Plasmids

1. Wild-type strain (haploid): BY4741 (MATa his3Δ1 leu2Δ0 ura3Δ0 met15Δ0) (see Notes 1 and 2). 2. Single-gene deletion strains (haploid): A genome-wide yeast knockout strain collection (GE Healthcare, YSC1053). 3. Plasmids for the expression of human α-synuclein in budding yeast: pYES2-α-synuclein-GFP and pYES2-GFP (negative control).

2.2 Cell Culture and Yeast Growth Media (Table 1, See Note 3)

1. Sterile plastic cell culture dish (diameter of 9 cm) (SANSEI MEDICAL CO., LTD.) 2. Culture rotator (TAITEC, RT-50). 3. Sterile culture tube (16 ml, polypropylene) (EVERGREEN). 4. Sterile toothpicks (6–10 cm) (wooden, any brand) (see Note 4). 5. 100
AA mix: Mix 10 g L-glutamic acid, 12 g L-lysine, 4 g L-methionine, 5 g L-phenylalanine, 38 g L-serine, 20 g L-threonine, and 0.6 g myo-inositol in 1000 ml deionized water and autoclave. 6. 100
Leu stock: Dissolve 11 g L-leucine in 1000 ml deionized water and autoclave. 7. 100
His stock: Dissolve 3.5 g L-histidine in 1000 ml deionized water and autoclave. 8. Media recipes: Table 1 summarizes recipes of the following media. 9. YPD liquid medium: 1% yeast extract, 2% peptone, and 2% glucose. Mix 10 g yeast extract (BD), 20 g bacto-peptone (BD), and 20 g D (+)-glucose (FUJIFILM Wako) in 1000 ml deionized water and autoclave. 10. YPD plate: YPD solidified with 2% (w/v) agar (FUJIFILM Wako) in a plastic cell culture dish. 11. SC-U liquid medium: 0.34% yeast nitrogen base, 2% glucose, 100 μg/ml glutamic acid, 120 μg/ml lysine, 40 μg/ml

Toxicity Assessment of α-Synuclein using Budding Yeast

167

Table 1 Media recipes Component

YPD

SC-U

SCG-U

SCG-UL

Yeast extract

10 g

–

–

–

Peptone

20 g

–

–

–

YNB

–

6.7 g

6.7 g

6.7 g

Glucose

20 g

20 g

–

–

Galactose

–

–

20 g

20 g

100
AA mix

–

10 ml

10 ml

10 ml

100
Leu

–

10 ml

10 ml

–

100
His

–

10 ml

10 ml

10 ml

20 g

20 g

20 g

20 g

a

Agar

Deionized water

Up to 1000 ml

a

Include agar when making plates

methionine, 50 μg/ml phenylalanine, 375 μg/ml serine, 200 μg/ml threonine, 35 μg/ml histidine, 110 μg/ml leucine, and 6 μg/ml myo-inositol. Mix 6.7 g the yeast nitrogen base without amino acids with ammonium sulfate (YNB) (Invitrogen), 20 g glucose, 10 ml 100
AA mix, 10 ml 100
Leu stock, and 10 ml 100
His stock in 1000 ml deionized water and autoclave (see Notes 5 and 6). 12. SC-U plate: SC-U solidified with 2% (w/v) agar in a plastic cell culture dish. 13. SCG-U: SC-U composed of 2% (w/v) of D (+)-galactose (FUJIFILM Wako) instead of glucose. 14. SCG-U plate: SCG-U solidified with 2% (w/v) agar in a plastic cell culture dish. 15. SCG-UL: SCG-U lacking leucine. 2.3

Transformation

1. Sterile 1.6-ml microtubes. 2. Dry block incubator (Labnet). 3. Sterile deionized water (SDW): Sterilize deionized water by autoclaving. 4. Lithium acetate (1 M): Dissolve 66 g lithium acetate (anhydrous) (FUJIFILM Wako) in 1000 ml deionized water and autoclave. 5. Single-stranded carrier DNA (ssDNA) (2 mg/ml): Dissolve 10 mg deoxyribonucleic acid from salmon sperm (500–1000 bp) (FUJIFILM Wako) in 10 ml TE buffer

168

Masak Takaine

(10 mM Tris–HCl and 1 mM EDTA, pH 8.0). Divide into 1-ml aliquots and store at 20  C. Before use, dilute the stock with SDW to 2 mg/ml DNA, incubate at 98  C for 5 min, and quickly cool in ice water for 5 min. Store on ice until used. 6. Polyethylene glycol (PEG) (50%, w/v): Dissolve 15 g PEG (average molecular weight ¼ 3400) (MP Biomedicals) in 10 ml deionized water in a 100-ml bottle, gradually fill to 30 ml, and autoclave (see Note 7). 7. LPD (350 μl/sample): Mix 36 μl lithium acetate, 240 μl PEG, 50 μl ssDNA, and 24 μl SDW. Store on ice until used. 2.4 Spot Growth Assay

1. Sterile 96-well microplates. 2. 8-channel micropipette 3. Automated cell counter (Bio-Rad, TC20). 4. Cell counting slide (dual-chamber) (Bio-Rad). 5. Flat-head image scanner (EPSON, GT-X830). 6. Black velvet cloth (40
60 cm, any brand).

2.5

Microscopy

1. Glass slide (76
26 mm, pre-cleaned). 2. Coverslip (18
18 mm, thickness 0.12–0.17 mm, pre-cleaned). 3. Inverted fluorescence microscope (Nikon, Eclipse Ti-2E) equipped with a 100
objective lens (Nikon, CFI Plan Apoλ 100
Oil DIC/NA1.45), FITC filter set (Nikon), and CMOS image sensor (Nikon, DS-Qi2).

2.6 Digital Image Analysis

3

1. Fiji (ver. 2.0.0-rc-69/1.52n or higher) (http://fiji.sc/#).

Methods

3.1 Transformation of Yeast with Plasmids for the Expression of α-Synuclein

The following transformation methods are based on the methods reported by Gietz and Woods [8] and slightly modified. pYES2 is a high copy vector for expression in S. cerevisiae and contains the URA3 gene of yeast to complement uracil auxotrophy. Protein expression from pYES2 is repressed in glucose medium and induced in galactose medium. Therefore, the galactose-inducible expression vector enables the introduction of expression plasmids for cytotoxic proteins, including α-synuclein, even into mutant strains sensitive to proteotoxic stress (see Note 8). 1. Scoop yeast cells of wild-type and/or mutant strains from a frozen stock using a 1000-μl pipette tip, streak on a YPD plate, and incubate at 30  C for 1–2 days.

Toxicity Assessment of α-Synuclein using Budding Yeast

169

2. Inoculate 2 ml YPD with a loopful of cells into a culture tube using a toothpick and culture overnight (12–16 h) on a culture rotator at no less than 40 rotations/min. 3. The next morning, dilute the overnight culture by 40–50-fold with YPD and continue to culture. 4. Grow yeast cells to the mid-log phase, which takes approximately 3 h for wild-type cells (see Note 9). 5. Harvest cells from 1 ml of the culture by centrifugation at 10,000
g for 1 min in a microtube, and wash with 1 ml SDW twice. 6. Vortex the cell pellet and resuspend in 350 μl LPD (see Note 10). 7. Mix cells with a plasmid of less than 10 μl, vortex for 20 s, and incubate at 42  C for 40 min on a block incubator (see Note 11). 8. Harvest the cells, wash with 1 ml SC-U twice, and resuspend in 200 μl SC-U. 9. Place the cell suspension onto SC-U plates, spread cells by repeated streaking using a 1000-μl pipette tip (Fig. 1a, b, see Notes 12–14), and incubate the plates at 30  C for 2–3 days to visualize transformant colonies. 10. Pick up at least three independent colonies from one plate, and place the isolates on fresh SC-U plates using a toothpick (see Note 15). 3.2 Spot Growth Assay to Assess the Toxicity of α-Synuclein

A spot assay is a widely used method to examine the growth phenotypes of yeast strains. It provides semiquantitative information on the colony-forming unit (viability) of the culture by colony density and the growth rate of the strain by colony size. Since the method is easy to apply and inexpensive, it allows simultaneous comparisons of the growth properties of different strains under different growth conditions. 1. Cell preparation (steps 1–6): Inoculate 2 ml SC-U with a loopful of cells bearing the plasmids using a toothpick, and culture overnight on a culture rotator. 2. Dilute the overnight culture by 20-fold with SC-U in a new culture tube, and culture at 30  C for 3–4 h. 3. Harvest cells from 1 ml of the culture by centrifugation in a microtube, wash with 1 ml SCG-UL twice, and resuspend in 1 ml SCG-UL (see Notes 16 and 17). 4. Dilute 50 μl of the cell culture with 450 μl SCG-UL in a microtube, and apply 10 μl of the dilute into the chamber of a cell counter slide.

170

Masak Takaine

5. Measure cell density using the Bio-Rad TC20 cell counter (see Notes 18 and 19). 6. Calculate the volumes of the cell culture and SCG-UL required to make a 300-μl cell culture with a density of 3.0
106 cells/ml. 7. Cell spotting (steps 7–12): Place 200 μl SCG-UL from the second to fifth columns of the first to eighth (from A to H) rows in a 96-well microplate. Each row corresponds to one strain (Fig. 1c). 8. Dilute the cell culture with SCG-UL to a density of 3.0
106 cells/ml in the first (the leftmost) column, making the final volume to 300 μl (see Note 20). 9. Make fivefold serial dilutions from the first to fifth columns by sequentially transferring 50 μl of the culture from the left to the right column. 10. Place an SCG-U plate over a printed grid (Fig. 1d). 11. Spot 4 μl of the cell culture on the plate using an 8-channel pipette, and leave the plate for 10 min to allow the suspension to soak (see Note 21). 12. Incubate the plates at 30  C for 2–3 days. 13. Imaging of cell colonies on plates (steps 13–16): Wipe fine condensation off the inside of the lids of plates using Kimwipes. 14. Place the plates with the lid up on the glass surface of an image scanner. 15. Cover the plates with a black velvet cloth and close the cover of the scanner. 16. Scan an image of yeast colonies on the agar. High-resolution images (more than 300 dpi) are required for publishable data (Fig. 1e). 3.3 Imaging of α-Synuclein-GFP in Yeast Cells

1. Fluorescence microscopy (steps 1–7): Streak cells bearing plasmids for the expression of α-synuclein-GFP on a fresh SC-U plate using a toothpick, and incubate at 30  C for 2 days. 2. Re-streak the cells on an SCG-U plate by streaking motion (ii) or (iii) (Fig. 1a), and incubate at 30  C for 40–48 h. 3. Place 2 μl SCG-U on a slide glass, and suspend a small amount of cells from the SCG-U plate into a puddle using a 200-μl pipette tip (see Note 22). 4. Place a coverslip slowly over the suspension, and shift the coverslip slightly (within 5 mm) (see Note 23). 5. Observe immobilized cells under a fluorescence microscope by bright-field imaging, and focus the cells.

Toxicity Assessment of α-Synuclein using Budding Yeast

171

6. Acquire a bright-field image and green fluorescence image from a single z-plane. Save the images as an nd2 file (see Note 24). 7. Collect cell images from several independent fields of view (see Note 25). 8. Digital image analysis (steps 8–16): Open the nd2 file using Fiji software as a hyperstack file composed of two channel images (bright-field and green fluorescence). 9. Draw a rectangle region including a cell of interest using a rectangle selection tool, and create a new hyperstack file corresponding to the region: Image ! Duplicate. 10. Separate the two channel images: Image ! Color ! Split Channels. 11. Convert the images to 8-bit images: Image ! Type ! 8-bit. 12. Optional: Convert the green fluorescence image to an inverted grayscale image (Fig. 2a): Image ! Lookup Tables ! Grays and Image ! Lookup Tables ! Invert LUT. 13. Adjust the brightness and contrast of images using a B&C control panel (Image ! Adjust ! Brightness/Contrast). 14. Optional: Quantify and score cells according to the types of localization of α-Synuclein-GFP using a cell counter plugin (Fig. 2b): Plugins ! Analyze ! Cell Counter (see Notes 26 and 27). 15. Insert a scale bar (usually 5 μm) around the lower right corner of the image: Analyze ! Tools ! Scale Bar. 16. Save the images as tiff files: File ! Save as ! Tiff.

4

Notes 1. The BY4741 strain is auxotrophic for histidine (his3Δ1), leucine (leu2Δ0), methionine (met15Δ0), and uracil (ura3Δ0). 2. The wild-type yeast strain and plasmids are all available from the Yeast Genetic Resource Centre Japan (YGRC, http://yeast. nig.ac.jp/yeast/). pYES2-α-synuclein-HA, a plasmid for the expression of α-synuclein-HA, is also available from YGRC. The parent vector pYES2 is commercially available. pYES2-α-synuclein-GFP and pYES2-α-synuclein-HA are both originally derived from Wijayanti et al. [9]. 3. Full and more detailed protocols for the preparation of media and agar plates are described elsewhere [10]. 4. Sterilize by autoclaving. Reusable until they break. 5. “SC” denotes synthetic complete medium containing all amino acids and nucleotide bases (histidine, leucine, methionine,

172

Masak Takaine

lysine, and uracil) required for the growth of BY series strains, and SC-U means SC lacking uracil. The supplementation of SC-U with a final concentration of 40 μg/ml uracil yields SC. 6. Medium was prepared as described previously by Hanscho et al. [11], which was developed to achieve the optimal growth of the BY strain. 7. The PEG solution may be used for at least three months without a significant decrease in transformation efficiency. 8. The galactose-inducible promoter is derived from that of the GAL1 gene (a gene encoding galactokinase of yeast) [12]. 9. The mid-log phase corresponds to 5.0
106–5.0
107 cells/ ml. Empirically, the overnight culture reaches approximately 1.5
108 cells/ml. Regarding the precise counting of cell density, see Subheading 3.2 and Note 19. 10. Since LPD is highly viscous, its direct addition onto the cell pellet without vortexing hardens the pellet, making subsequent suspensions very difficult. 11. Purify plasmid DNA using commercially available plasmid purification kits (any brand). In general, 0.1–0.5 μg plasmid DNA/sample provides sufficient numbers of colonies of the transformant. 12. Streaking motions (i) and (ii) provide a gradient of cell density on the surface of a plate, which is useful, particularly when the colony-forming unit of the plasmid is unknown. Alternatively, streaking multiple cell suspensions with different volumes (e.g., 5, 45, and 150 μl) simply provides zones with various cell densities on a plate. 13. Streaking motion (iii) is most suitable for isolation of small number of single colonies. 14. Be careful not to dig the plate at the edge of the tip. Allow the tip to move up and down freely. 15. Transformants may be stored on SC-U plates at 4  C for up to 2 weeks, and culturing on new plates refreshes old cells. 16. After this step, cells are suspended in SCG-LU to prevent further proliferation during the preparation. 17. It is important to remove as much of the supernatant as possible after the first centrifugation because even low concentrations of residual glucose may inhibit gene expression under the control of the GAL1 promoter. 18. Adjust the cell density of samples to be within the optimal cell concentration range of TC20: 1
105–5
106 cells/ml. 19. Cell counting may be performed by measuring the optical density at 600 nm (OD600) of a cell culture. In this case, pre-calibration between OD600 and actual cell numbers using

Toxicity Assessment of α-Synuclein using Budding Yeast

173

a hematocytometer is required. In the experimental environment used here, 0.5 of OD600 corresponds to 3.0
106 cells/ ml. 20. It is desirable for a countable number of colonies (approximately 10 colonies) to appear in the most dilute spot. To achieve this, the initial density and dilution ratio are adjustable (e.g., the author uses tenfold serial dilutions from 1.0
106 cells/ml in the other assay). 21. Spotting on an additional SC-U (expression of α-synucleinGFP is repressed) plate is useful for confirming that dilutions were made correctly, and almost the same numbers of cells of each strain were plated. 22. Scoop cells from small (growing) colonies. 23. The lateral movement of the coverslip helps sandwiched cells to be in one layer. 24. Wild-type α-synuclein primarily localizes to the plasma membrane of budding yeast cells (Fig. 2a) [13]. 25. Imaging needs to be completed within 10 min after the preparation of the specimen to avoid the evaporation of medium and alterations to the cell physiology. 26. Expression levels of α-synuclein-GFP vary between cells (see Fig. 2a). Cells with very low expression levels of α-synucleinGFP need to be excluded from the analysis. 27. The cell counter plugin (https://imagej.net/Cell_Counter) enables manual cell counting using eight counters. Data may be exported as a csv file.

Acknowledgments The author thanks Nobukazu Nameki, Soichiro Hoshino, and Mitsue Miyazaki for their insightful comments on the manuscript. This work was supported by JSPS grants to the author (19K06654) and a joint research program of the Institute for Molecular and Cellular Regulation, Gunma University, Japan. References 1. Iwai A, Masliah E, Yoshimoto M, Ge N, Flanagan L, de Silva HA, Kittel A, Saitoh T (1995) The precursor protein of non-A beta component of Alzheimer’s disease amyloid is a presynaptic protein of the central nervous system. Neuron 14(2):467–475. https://doi. org/10.1016/0896-6273(95)90302-x 2. Lashuel HA, Overk CR, Oueslati A, Masliah E (2013) The many faces of alpha-synuclein:

from structure and toxicity to therapeutic target. Nat Rev Neurosci 14(1):38–48. https:// doi.org/10.1038/nrn3406 3. Cookson MR (2009) Alpha-Synuclein and neuronal cell death. Mol Neurodegener 4:9. https://doi.org/10.1186/1750-1326-4-9 4. Outeiro TF, Lindquist S (2003) Yeast cells provide insight into alpha-synuclein biology and pathobiology. Science 302

174

Masak Takaine

(5651):1772–1775. https://doi.org/10. 1126/science.1090439 5. Willingham S, Outeiro TF, DeVit MJ, Lindquist SL, Muchowski PJ (2003) Yeast genes that enhance the toxicity of a mutant huntingtin fragment or alpha-synuclein. Science 302 (5651):1769–1772. https://doi.org/10. 1126/science.1090389 6. Khurana V, Lindquist S (2010) Modelling neurodegeneration in Saccharomyces cerevisiae: why cook with baker’s yeast? Nat Rev Neurosci 11(6):436–449. https://doi.org/10.1038/ nrn2809 7. Takaine M, Imamura H, Yoshida S (2021) High and stable ATP levels prevent aberrant intracellular protein aggregation. bioRxiv:801738. https://doi.org/10.1101/ 801738 8. Gietz RD, Woods RA (2002) Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Methods Enzymol 350:87–96. https://doi.org/10. 1016/s0076-6879(02)50957-5 9. Wijayanti I, Watanabe D, Oshiro S, Takagi H (2015) Isolation and functional analysis of yeast ubiquitin ligase Rsp5 variants that

alleviate the toxicity of human α-synuclein. J Biochem 157(4):251–260. https://doi.org/ 10.1093/jb/mvu069 10. Takaine M (2019) QUEEN-based spatiotemporal ATP imaging in budding and fission yeast. Bio-Protocol 9(15):e3320. https://doi. org/10.21769/BioProtoc.3320 11. Hanscho M, Ruckerbauer DE, Chauhan N, Hofbauer HF, Krahulec S, Nidetzky B, Kohlwein SD, Zanghellini J, Natter K (2012) Nutritional requirements of the BY series of Saccharomyces cerevisiae strains for optimum growth. FEMS Yeast Res 12(7):796–808. https://doi.org/10.1111/j.1567-1364.2012. 00830.x 12. West RW Jr, Yocum RR, Ptashne M (1984) Saccharomyces cerevisiae GAL1-GAL10 divergent promoter region: location and function of the upstream activating sequence UASG. Mol Cell Biol 4(11):2467–2478. https://doi.org/ 10.1128/mcb.4.11.2467 13. Sharma N, Brandis KA, Herrera SK, Johnson BE, Vaidya T, Shrestha R, DebBurman SK (2006) α-synuclein budding yeast model. J Mol Neurosci 28(2):161–178. https://doi. org/10.1385/JMN:28:2:161

Chapter 17 The Functional Assessment of LRRK2 in Caenorhabditis elegans Mechanosensory Neurons Tomoki Kuwahara Abstract The nematode Caenorhabditis elegans (C. elegans) is a powerful model organism to systematically analyze the functions of genes of interest in vivo. Especially, C. elegans nervous system is suitable for morphological and functional analyses of neuronal genes due to its optical transparency of the body and the wellestablished anatomy including neural connections. The C. elegans ortholog of Parkinson’s diseaseassociated gene LRRK2, named lrk-1, has been shown to play a role in the regulation of axonal morphology in a subset of neurons. Here I describe the detailed methodologies for the assessment of LRK-1/LRRK2 function as well as the analysis of genetic interaction involving lrk-1/LRRK2 by performing live imaging of C. elegans mechanosenrory neurons. Key words LRRK2, LRK-1, C. elegans, Mechanosensory neuron, Axon overextension

1

Introduction Leucine-rich repeat kinase 2 (LRRK2), the major causative gene for autosomal-dominant Parkinson’s disease (PD), encodes a multi-domain protein kinase that phosphorylates a subset of Rab small GTPases [1]. A number of studies have documented the diverse functions of LRRK2 in neuronal and nonneuronal cells, such as the regulation of neurite morphology [2–5], membrane trafficking [6–8], and the maintenance of stressed lysosomes [9– 11]. In rodents, LRRK2 deficiency results in age-dependent accumulation of enlarged lysosomes in peripheral tissues [12, 13], whereas pathogenic LRRK2 overexpression causes neuronal dysfunctions in some models [14, 15]. Although these experimental settings have contributed to our understanding of the roles of LRRK2 in cells and animals, alternative systems are also useful to further explore genetic pathways involving LRRK2 in vivo.

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_17, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

175

176

Tomoki Kuwahara

The nematode Caenorhabditis elegans (C. elegans) is a unique multicellular organism that has been widely used for nearly 50 years [16], and actually, the use of C. elegans has a couple of advantages for genetic studies because (a) a significant portion of genes are conserved from C. elegans to humans [17], and (b) genetic backgrounds in C. elegans populations are mostly identical due to the self-fertilization system of hermaphrodite worms in the process of reproduction. Moreover, a well-developed nervous system in C. elegans makes it a valuable tool for studying neuronal functions. C. elegans has a sole ortholog of human LRRK2, termed lrk-1. We have previously reported that lrk-1 null mutants exhibited the impaired axon termination in mechanosensory neurons, which could be rescued by overexpression of LRK-1 as well as human LRRK2 [18]. Subsequent genetic analyses revealed that glo-1, an ortholog of human RAB29 (also known as RAB7L1) as well as RAB32 and RAB38, and apb-3, which encodes an AP-3 complex component, function within a common pathway with lrk-1/ LRRK2 in the regulation of axon termination. This experiment requires the use of transgenic worms that express green fluorescent protein (GFP) in a set of mechanosensory neurons to visualize their morphologies in the living state. It should be noted that the percentage of mutant worms exhibiting the axon termination defect was relatively low and that this percentage readily increases as the temperature increases [19]. Therefore, a careful assessment is required to acquire reproducible results. This chapter aims to describe basic and detailed methods for evaluating axon termination phenotype in lrk-1 mutant worms as well as for assessing genetic interaction with lrk-1/LRRK2 in C. elegans neurons.

2

Materials The handling of C. elegans basically follows the standard methods initially described by Sydney Brenner [16]. C. elegans can be cultured in the biosafety level 1 (BSL-1) laboratory, although local restrictions and exceptional cases should also be taken into account.

2.1 C. elegans Strains

1. Wild-type strain: Bristol N2 is the most popular strain and can be obtained from the Caenorhabditis Genetics Center (CGC; https://cgc.umn.edu/). N2 males are usually rare in the population (approx. one out of 1000) and thus are also available in the CGC. Alternatively, the proportions of males can be increased to ~1% following heat shock stress (~6 h at 30
C). 2. Mutant strains: a loss-of-function mutant carrying lrk-1 (tm1898) allele is available from National Bioresource Project (NBRP) in Japan (https://shigen.nig.ac.jp/c.elegans/top. xhtml). Transgenic strain expressing GFP in mechanosensory

LRRK2 Analysis in C. elegans Neurons

177

neurons (CF702, carrying muIs32 (Pmec-7::gfp)) can be obtained from the CGC. Other strains carrying mutations or transgenes of interest are also available mostly in the CGC or NBRP. 2.2

Worm Culturing

1. Nematode Growth Medium (NGM) agar plates: Transfer 6.0 g of sodium chloride, 5.0 g of Bacto-peptone, 30 g of agar, and 2 ml of cholesterol solution (5 mg/ml in ethanol) into the 2 L flask. Add water to a volume of 2 L, put the stirrer in the flask, and sterilize it by autoclaving. After autoclaving, cooldown the flask in a room temperature with constant stirring until the temperature is lowered to 60
C, then add the following reagents on a stirring hot plate set at 60
C: 50 ml of 1 M potassium phosphate buffer (108.3 g of anhydrous KH2PO4 and 35.6 g of anhydrous K2HPO4 in distilled water, pH 6.0, autoclaved and kept at room temperature), 2 ml of 1 M MgSO4, 2 ml of 1 M CaCl2, 2 ml of streptomycin solution (0.2 g/ml in distilled water, filtrated and kept at 20
C), 2 ml of nystatin solution (10 mg/ml in dimethylformamide, kept at 20
C). Dispense NGM agar solution into petri plates (8.5 ml for each 60-mm diameter plate, or 3.0 ml for each 35-mm diameter plate) using a peristaltic pump. Leave them at room temperature overnight to completely solidify the agar. 2. Food source: Grow E. coli strain OP50 (obtained from the GCG) in LB medium at 37
C overnight without shaking, and spread them on NGM agar plates. The plates can be used for worm culturing on the following day.

2.3

Equipment

1. A dissecting stereomicroscope equipped with a transmitted light source for observation and handling of C. elegans. 2. Confocal fluorescence microscope for live imaging of green fluorescent protein (GFP) expressed in C. elegans neurons. 3. An incubator with the temperature settings between 12 and 25
C. CO2 supply is unnecessary. If the incubators specifically for worms are not available, a certain type of wine cellar can be used as an alternative. 4. A worm picker, which can be made by connecting a fine platinum wire to the tip of a Pasture pipet. 5. A thermal cycler for the genotyping of crossed worms.

2.4 Reagents and Other Materials

1. M9 buffer: Add 3 g of KH2PO4, 6 g of Na2HPO4, and 5 g of NaCl into 1 L of water and autoclave. After cooling, add 1 ml of 1 M MgSO4. The final concentration of each component is 22 mM KH2PO4, 22 mM Na2HPO4, 85 mM NaCl, 1 mM MgSO4. Store at room temperature.

178

Tomoki Kuwahara

Fig. 1 A method for the preparation of agarose pads and the observation of anesthetized worms. Agarose pads are laid by placing a drop of liquefied hot agarose solution on a glass slide followed by covering with another slide. After detaching glass slides, place a drop of anesthetizing agent on an agarose pad, transfer 10–15 worms into anesthetizing agent, and gently put a cover glass onto them. The axonal morphology is analyzed by the observation of GFP fluorescence

2. Worm anesthetizing buffer: 50 mM sodium azide in M9 buffer. Store at 4
C. 3. Agarose pads: The preparation of agarose pads must be done just before mounting worms for observation, otherwise agarose will soon dry up and stiff. Add agarose into water to make 3–4% agarose suspension. Heat it in a microwave until it boils, and mix well. Place a drop (~50 μl) of liquefied hot agarose solution on a glass slide using a cutoff P200 tip, wait for a couple of seconds (< 5 s), and immediately place a second glass slide on the drop to make a flattened pad. After a minute or two, detach two glass slides, which results in the attachment of an agarose pad on either one of two slides (Fig. 1). The glass slides without attaching agarose pads can be reused for the next round of preparation of agarose pads. 4. Worm lysis buffer: Mix 2.5 ml of 2 M KCl (final 50 mM), 2.5 ml of 1 M Tris pH 8.5 (final 25 mM), 0.2 ml of 0.5 M EDTA pH 8.0 (final 1 mM), 5 ml of 10% Tween20 (final 0.5%), and distilled water up to 100 ml and autoclave. After cooling, store at 4
C. Before use, add 5 μl of proteinase K solution (50 mg/ml in stock, final 250 μg/ml in lysis buffer) and mix well. 5. PCR primers for genotyping of lrk-1(tm1898) allele: Primer F1, CTCTTTCAACGCTGGACACA; Primer F2, TGGGCA CAGTGAACTTGGTA; Primer R1, GCGTAGAAGAAGGTC GATGC. For more information about basic methods, see WormBook (http://www.wormbook.org/).

LRRK2 Analysis in C. elegans Neurons

3

179

Methods

3.1 Generation of C. elegans Strains Carrying both lrk-1 Gene Mutation and Pmec-7::gfp Transgene

The following protocol describes the method of crossing GFP-expressing worms with lrk-1(tm1898) mutant strain; the similar method is also applicable to the crossing with other mutant strains for the assessment of genetic interaction with lrk-1 or related genes. 1. Transfer hermaphrodite worms carrying the allele muIs32 (Pmec-7::gfp) and wild-type N2 males onto a small spot of bacterial lawn in a 35 mm-diameter agar plate for mating. Typically, five hermaphrodites and ten males are placed in a plate upon mating (see Note 1). 2. Cross lrk-1 mutant hermaphrodites with males expressing GFP encoded by Pmec-7::gfp transgene, and transfer 3–5 individuals of first-generation offspring expressing GFP to a new agar plate (60 mm diameter). For lrk-1 mutant, several alleles are available: tm1898, km17, etc. 3. Transfer second-generation offspring (~20 individuals) that strongly express GFP to a new agar plate singly (35 mm diameter) (see Note 2). Once a sufficient number of third-generation offspring are hatched, select the plates where all thirdgeneration individuals display strong GFP fluorescence. 4. As for the selected plates, transfer a second-generation individual (i.e., the parent) into 20 μl of worm lysis buffer that has been dispensed in strips of eight PCR tubes for genotyping. 5. Lyse worms in lysis buffer by placing strips of eight PCR tubes in the thermal cycler and running the following program: 15 min at 50
C, 10 min at 90
C, then hold at 4
C. 6. Transfer 1 μl of lysed solution into 20 μl of PCR mixture containing DNA polymerase, dNTP mixture, and primers. Use primer set F1-R1 as well as F2-R1 for genotyping of lrk1(tm1898) allele. Run the PCR program that is optimized for the polymerase used. The elongation time in PCR can be set at 40–60 s. 7. Check the amplified bands by performing DNA electrophoresis. PCR using F1-R1 primer set will yield 692 bp band in wildtype allele, 324 bp in lrk-1(tm1898), and both bands in heterozygotes. PCR with F2-R2 primers will yield 275 bp band in both wild-type and heterozygotes, and no bands in lrk-1 (tm1898) homozygotes. 8. Select the plates where a second-generation individual (i.e., the parent) is homozygote for lrk-1(tm1898). This strain is considered as carrying both lrk-1(tm1898) allele and Pmec-7::gfp transgene.

180

Tomoki Kuwahara

3.2 Assessment of Axon Overextension of ALM Mechanosensory Neurons

1. Synchronization of worm populations: place 30–50 individuals of adult worms (3–6-day-old) on a bacterial lawn in a fresh 60-mm diameter plate, leave it for 6 h in the incubator, then remove all the worms by picking up and burning them (see Note 3). Only eggs can be found on bacterial lawns. 2. Culture worms in the incubator set at either 20
C or 25
C, depending on the purpose of the experiment. The temperature settings greatly influence the axon phenotype (see Note 4). Wait until the worms grow up to be young adults (usually it takes 3 days at 20
C and 2 days at 25
C). 3. Prepare agarose pads immediately before assay (see Subheading 2). 4. Place 10 μl of worm anesthetizing buffer on the middle of an agarose pad, and transfer individual worm into anesthetizing buffer using worm picker (see Note 5). 10–15 individuals can be placed in a 10 μl drop of anesthetizing buffer (see Note 6). 5. Wait for about 30 s for worms to be completely anesthetized, and place a cover glass (24 mm  24 mm) on a drop of anesthetizing buffer. Be careful not to incorporate bubbles between an agarose pad and a cover glass. 6. Observe the fluorescence of GFP expressed in the axon of ALM mechanosensory neurons using ordinary fluorescence microscope. ALM neuron in wild-type worms extends their axon toward the nose that usually terminates at a distance from the tip of the nose. In contrast, ALM axon in lrk-1 mutant worms tends to overextend to the tip of the nose and subsequently reverses course, resulting in a hook-like structure (Fig. 2) (see Note 7). ALM axons in worms cultured at 25
C throughout their development show much higher percentage of axon overextension phenotypes (~50% in wild-type worms) as compared to those cultured at 20
C (~5% in wild-type worms) (Fig. 3) (see Note 8). 7. Evaluate the presence of overextension of ALM axon by binary evaluation mode, in which an axon is counted as having an overextension if the end of axon is bent at the tip of nose. Calculate the percentage of worms exhibiting the overextension of ALM axons by observing 200–300 individual worms per strain. It is expected that lrk-1 mutant worms show a higher ratio of axon overextension compared to wild-type worms when cultured at 20
C and that LRK-1/LRRK2-overexpressing worms show a lower ratio of overextension compared to non-transgenic (wild-type) worms when cultured at 25
C (Fig. 3).

LRRK2 Analysis in C. elegans Neurons

181

Fig. 2 Typical extension patterns of an axon of ALM mechanosensory neuron in the head regions of wild-type (WT) and lrk-1 mutant worms. GFP is expressed under the mec-7 promoter (Pmec-7::gfp) and visualized by fluorescence microscopy. ALM axon normally terminates at a distance from the tip of the nose (yellow arrowhead) in WT worms, whereas it sometimes overextends to the tip of the nose and then reverses course (white arrowhead) in lrk-1 mutants. Schematic drawing of the ALM axon structures is shown at the bottom. Anterior is to the right; scale bar ¼ 50 μm. (reproduced from Ref. 18, which is licensed under CC BY 4.0)

4

Notes 1. If the mating is not successful, increase the number of males up to 15–20 individuals. It is also helpful to narrow the area of bacterial lawn, which facilitates the gathering of worms. 2. It is important to select the individual with strong GFP fluorescence, because worms homozygote for Pmec-7::gfp transgene express twice as much GFP as heterozygotes. This difference in the intensity of GFP fluorescence can be detected by the human eye, although not perfect. 3. Synchronization of worm population can alternatively be performed by following a bleaching protocol that uses sodium hydroxide solution and a household bleach. This method is useful when synchronizing a large number of worms. For details, see Wormbook (http://www.wormbook.org/).

182

Tomoki Kuwahara

Fig. 3 Quantitative analysis of axon overextension of ALM neurons. Overextension was evaluated by the percentages of worms harboring overextended ALM axon that are cultured at 20
C (a) or at 25
C (b). The results using two independent lrk-1 mutant strains (km17 and tm1898) as well as transgenic strains overexpressing C. elegans LRK-1 or human LRRK2 are shown. Psnb-1: synaptobrevin promoter. Ex: extrachromosomally overexpressing strain, Is: chromosomally integrated strain. Data represent mean  SEM, *p < 0.05, **p < 0.01; samples numbers n are shown to the right. (reproduced from Ref. 18, which is licensed under CC BY 4.0)

4. It has been shown that the axon overextension phenotype in C. elegans is extremely temperature-sensitive [19], culturing worms at higher temperature (e.g., 25
C) results in higher rates of overextension. 5. If E. coli (food source) clings to worm bodies, immerse the worms in a drop of M9 buffer, let them swim for a while to rinse E. coli off the body, and then transfer them into a drop of anesthetizing buffer. 6. Placing too many worms (>20) in a drop of anesthetizing buffer will make it difficult to recognize the individuals that are analyzed and those not analyzed yet.

LRRK2 Analysis in C. elegans Neurons

183

7. Although lrk-1 mutant worms exhibit higher rate of axon overextension, the percentage showing this phenotype is expected to be below 20% of populations when cultured at 20
C. Therefore, it may be required to increase the number of worms for the assessment (>300 individuals per strain, as described in ref. 18) if the difference between wild-type and mutant worms is small. 8. The assessment at 25
C is useful when assessing the effect of overexpression of C. elegans LRK-1 protein or human LRRK2 in neurons, as transgenic expression of either of the protein results in the significant reduction in the percentage of axon overextension as compared to non-transgenic (wild-type) state.

Acknowledgments I thank Drs. Asa Abeliovich, Takeshi Iwatsubo and their colleagues for their support during the establishment of the described methods. This work was supported by JSPS KAKENHI Grant number 19K07816. References 1. Steger M, Tonelli F, Ito G, Davies P, Trost M, Vetter M, Wachter S, Lorentzen E, Duddy G, Wilson S, Baptista MA, Fiske BK, Fell MJ, Morrow JA, Reith AD, Alessi DR, Mann M (2016) Phosphoproteomics reveals that Parkinson’s disease kinase LRRK2 regulates a subset of Rab GTPases. elife 5:e12813 2. MacLeod D, Dowman J, Hammond R, Leete T, Inoue K, Abeliovich A (2006) The familial parkinsonism gene LRRK2 regulates neurite process morphology. Neuron 52 (4):587–593 3. Plowey ED, Cherra SJ 3rd, Liu YJ, Chu CT (2008) Role of autophagy in G2019S-LRRK2associated neurite shortening in differentiated SH-SY5Y cells. J Neurochem 105 (3):1048–1056 4. Chan D, Citro A, Cordy JM, Shen GC, Wolozin B (2011) Rac1 protein rescues neurite retraction caused by G2019S leucine-rich repeat kinase 2 (LRRK2). J Biol Chem 286 (18):16140–16149 5. Winner B, Melrose HL, Zhao C, Hinkle KM, Yue M, Kent C, Braithwaite AT, Ogholikhan S, Aigner R, Winkler J, Farrer MJ, Gage FH (2011) Adult neurogenesis and neurite outgrowth are impaired in LRRK2 G2019S mice. Neurobiol Dis 41(3):706–716

6. MacLeod DA, Rhinn H, Kuwahara T, Zolin A, Di Paolo G, McCabe BD, Marder KS, Honig LS, Clark LN, Small SA, Abeliovich A (2013) RAB7L1 interacts with LRRK2 to modify intraneuronal protein sorting and Parkinson’s disease risk. Neuron 77(3):425–439 7. Cookson MR (2016) Cellular functions of LRRK2 implicate vesicular trafficking pathways in Parkinson’s disease. Biochem Soc Trans 44 (6):1603–1610 8. Bonet-Ponce L, Cookson MR (2019) The role of Rab GTPases in the pathobiology of Parkinson’ disease. Curr Opin Cell Biol 59:73–80 9. Eguchi T, Kuwahara T, Sakurai M, Komori T, Fujimoto T, Ito G, Yoshimura SI, Harada A, Fukuda M, Koike M, Iwatsubo T (2018) LRRK2 and its substrate Rab GTPases are sequentially targeted onto stressed lysosomes and maintain their homeostasis. Proc Natl Acad Sci U S A 115(39):E9115–E9124 10. Kuwahara T, Funakawa K, Komori T, Sakurai M, Yoshii G, Eguchi T, Fukuda M, Iwatsubo T (2020) Roles of lysosomotropic agents on LRRK2 activation and Rab10 phosphorylation. Neurobiol Dis 145:105081 11. Kuwahara T, Iwatsubo T (2020) The emerging functions of LRRK2 and Rab GTPases in the endolysosomal system. Front Neurosci 14:227

184

Tomoki Kuwahara

12. Tong Y, Yamaguchi H, Giaime E, Boyle S, Kopan R, Kelleher RJ 3rd, Shen J (2010) Loss of leucine-rich repeat kinase 2 causes impairment of protein degradation pathways, accumulation of alpha-synuclein, and apoptotic cell death in aged mice. Proc Natl Acad Sci U S A 107(21):9879–9884 13. Herzig MC, Kolly C, Persohn E, Theil D, Schweizer T, Hafner T, Stemmelen C, Troxler TJ, Schmid P, Danner S, Schnell CR, Mueller M, Kinzel B, Grevot A, Bolognani F, Stirn M, Kuhn RR, Kaupmann K, van der Putten PH, Rovelli G, Shimshek DR (2011) LRRK2 protein levels are determined by kinase function and are crucial for kidney and lung homeostasis in mice. Hum Mol Genet 20 (21):4209–4223 14. Volta M, Melrose H (2017) LRRK2 mouse models: dissecting the behavior, striatal neurochemistry and neurophysiology of PD pathogenesis. Biochem Soc Trans 45(1):113–122

15. Seegobin SP, Heaton GR, Liang D, Choi I, Blanca Ramirez M, Tang B, Yue Z (2020) Progress in LRRK2-associated Parkinson’s disease animal models. Front Neurosci 14:674 16. Brenner S (1974) The genetics of Caenorhabditis elegans. Genetics 77(1):71–94 17. Shaye DD, Greenwald I (2011) OrthoList: a compendium of C. elegans genes with human orthologs. PLoS One 6(5):e20085 18. Kuwahara T, Inoue K, D’Agati VD, Fujimoto T, Eguchi T, Saha S, Wolozin B, Iwatsubo T, Abeliovich A (2016) LRRK2 and RAB7L1 coordinately regulate axonal morphology and lysosome integrity in diverse cellular contexts. Sci Rep 6:29945 19. Grill B, Bienvenut WV, Brown HM, Ackley BD, Quadroni M, Jin Y (2007) C. elegans RPM-1 regulates axon termination and synaptogenesis through the Rab GEF GLO-4 and the Rab GTPase GLO-1. Neuron 55 (4):587–601

Chapter 18 Analysis of Dopaminergic Functions in Drosophila Tsuyoshi Inoshita, Daisaku Takemoto, and Yuzuru Imai Abstract Dopaminergic (DA) neurons regulate various physiological functions, including motor function, emotion, learning, sleep, and arousal. Degeneration of DA neurons in the substantia nigra of the midbrain causes motor disturbance in Parkinson’s disease (PD). Studies on familial PD have revealed that a subset of PD genes encode proteins that regulate mitochondrial function and synaptic dynamics. Drosophila is a powerful model of PD, whereby genetic interactions of PD genes with well-conserved cellular signaling can be evaluated. Morphological changes in mitochondria, along with dysfunction and degeneration of DA neurons, have been reported in many studies using Drosophila PD models. In this chapter, we will describe imaging methods to visualize mitochondria in DA neurons and to evaluate spontaneous neural activity of DA neurons in the Drosophila brain. Key words Dopaminergic neuron, Immunohistochemistry, Mitochondria, Synaptic vesicle release, Live imaging, pHluorin, Drosophila

1

Introduction Drosophila, the genome of which contains over 75% of disease genes conserved in humans, has several clusters of dopaminergic (DA) neurons [1]. These DA clusters have conserved regulatory functions in humans, such as locomotion [2], aggression [3], reward [4], sleep and arousal [5, 6], and memory and learning [7, 8]. Similar to humans, these DA neuron functions decline with age [9]. Moreover, the introduction of gene mutations for Parkinson’s disease (PD) affects the function and survival of DA neurons in Drosophila [10, 11]. Over 20 causative genes for PD have already been identified and are being characterized. These PD-associated genes are broadly classified into two groups: genes involved in mitochondrial function and genes related to membrane dynamics, such as synaptic vesicle regulation [11, 12]. Mutations in Parkin and PINK1 cause a recessive form of early-onset PD. The ubiquitin ligase Parkin and the mitochondrial kinase PINK1 are involved in mitochondrial

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_18, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

185

186

Tsuyoshi Inoshita et al.

quality control, regulating mitochondrial motility and mitophagy [11]. CHCHD2, mutations of which are responsible for a dominant form of PD, regulates mitochondrial respiratory function [13]. Some PD genes, which include α-synuclein, LRRK2, Vps35, Synaptojanin1, and Auxilin, are involved in endo-/exocytosis, intracellular vesicle transport, and synaptic vesicle dynamics [12]. A Drosophila model of PD in which the α-synuclein gene was introduced was first reported in 2000 [14]. Since then, Drosophila has been employed as a genetic PD model because ectopic gene expression can be easily performed in specific tissues and cells using molecular genetic techniques. Because the transparent Drosophila brain is approximately 100 μm in thickness, the neural circuits and synaptic connections can be visualized in whole-mount brains under a fluorescence microscope. Alteration of mitochondrial morphology in DA neurons is successfully visualized by mitochondrialtargeted fluorescent proteins, such as mito-GFP [15]. The synaptic vesicle dynamics of DA neurons can be evaluated by pH-sensitive dyes or pH-sensitive fluorescent proteins. One of the pH-sensitive fluorescent proteins, pHluorin, produces weak fluorescence at lower pH, while its fluorescence intensity increases at neutral pH [16]. DA expression of VMAT-pHluorin, in which pHluorin is fused with the vesicular monoamine transporter (VMAT), allows for monitoring of synaptic vesicle release as an increase in fluorescence intensity in living brains [15, 17]. In this chapter, we will introduce our methods for visualizing DA neurons and evaluating the mitochondrial morphology and synaptic release of DA neurons in Drosophila whole-mount brains.

2

Materials

2.1 Visualization of Mitochondria in DA Neurons

1. Silicone (Shin-Etsu silicone, KE-106 and CAT-RG). 2. 35-mm culture dishes. 3. Dissection dish: Mix 3.6 ml KE-106 and 0.4 ml CAT-RG in a 35-mm culture dish and incubate them at 37
C for 2 days to congeal the silicone (Fig. 1). 4. Tweezers (FST, Dumont #5 forceps Dumoxel standard tip). 5. Microscissors (WPI, SuperFine Vannas scissors, 3 mm straight blades). 6. PCR tubes (200 μl). 7. PBS-T: Phosphate-buffered saline (PBS) containing 0.3% Triton X-100. 8. HL-3 solution: 70 mM NaCl, 5 mM KCl, 20 mM MgCl2, 10 mM NaHCO3, 115 mM sucrose, 5 mM trehalose, 5 mM HEPES (pH 7.2), and 2 mM CaCl2. Filter the solution with a 0.22 μm syringe filter and store at 4
C for 2 weeks.

Analysis of Dopaminergic Functions in Drosophila

187

Fig. 1 Overview of the dissection dish. The culture dish is filled with silicone 2–3 mm in height

9. Fixative solution: 4% paraformaldehyde dissolved in PBS. Store at 4
C. 10. 10% normal goat serum (NGS): Dilute NGS in PBS-T. 11. Primary antibody solution: Anti-tyrosine hydroxylase (mouse anti-tyrosine hydroxylase, clone LNC1, Sigma-Aldrich) diluted 1:500 in 10% NGS. 12. Secondary antibody solution: Alexa Fluor 568-conjugated goat anti-rabbit IgG (Thermo Fisher Scientific, 1:200 dilution) and FITC-conjugated goat anti-GFP antibody (Abcam, 1:500 dilution) diluted in 10% NGS. 13. Mounting reagent: SlowFade Gold Antifade Mountant (Thermo Fisher Scientific) or equivalent. 14. Clear nail polish. 15. Cover glasses (24  40 mm and 18  18 mm, 0.13–0.17 mm in thickness). 16. Drosophila melanogaster harboring gene mutations or transgenes (most strains are available from public stock centers that can be accessed through the following website: http://flybase. org/wiki/FlyBase:Stocks). 17. Transgenic Drosophila lines: w*; P{ple-GAL4. F}3, known as TH-Gal4 (Bloomington Drosophila Stock Center, Stock#: 8848), w1118; P{Ddc-GAL4.L}4.3D (Stock#: 7010) and P {UAS-mito-HA-GFP} (Stock#: 8442 or 8443). 18. Confocal laser scanning microscope. 2.2 Imaging of Synaptic Release of DA Neurons

1. Silicone (Shin-Etsu silicone, KE-106 and CAT-RG). 2. 35-mm culture dishes. 3. Dissection dish: Mix 3.6 ml KE-106 and 0.4 ml CAT-RG in a 35-mm culture dish and incubate them at 37
C for 2 days to congeal the silicone (Fig. 1). 4. Tweezers (FST, Dumont #5 forceps Dumoxel standard tip).

188

Tsuyoshi Inoshita et al.

5. Microscissors (WPI, SuperFine Vannas scissors, 3 mm straight blades). 6. HL-3 solution containing 5 mM Ca2+: 70 mM NaCl, 5 mM KCl, 20 mM MgCl2, 10 mM NaHCO3, 115 mM sucrose, 5 mM trehalose, 5 mM HEPES (pH 7.2), and 5 mM CaCl2. Filter the solution with a 0.22 μm syringe filter unit and store at 4
C for 2 weeks. 7. Cover glasses (24  40 mm and 18  18 mm, 0.13–0.17 mm in thickness). 8. Black or dark plastic tape (200 μm thick). 9. Drosophila melanogaster harboring gene mutations or transgenes (most strains are available from public stock centers that can be accessed through the following website: http:// flybase.org/wiki/FlyBase:Stocks). 10. Transgenic Drosophila lines: w*; P{ple-GAL4.F}3, known as TH-Gal4 (Bloomington Drosophila Stock Center, Stock#: 8848), w1118; P{Ddc-GAL4.L}4.3D (Stock#: 7010) and UAS-VMAT-pHluorin [16]. 11. Confocal laser scanning microscope.

3

Methods

3.1 Visualization of Mitochondria in DA Neurons

1. Anesthetize adult fly crosses expressing mito-GFP in dopaminergic neurons with carbon dioxide. 2. Rinse whole body briefly with PBS-T to remove body wax and soak the body in HL-3 in the dissection dish (see Note 1). 3. Cut off the head with microscissors (Fig. 2a). 4. Dissect the brain using tweezers following these steps: Remove both antennae and mouthpart (Fig. 2b). Incise the head cuticle and pick up the brain. Remove tracheae from the brain as much as possible (Fig. 2c, see Note 2). 5. Soak the dissected brains in the fixative solution for 10 min. 6. Wash the brains in 200 μl PBS-T at 10 min and wash twice in 200 μl PBS in the PCR tube (see Note 3). 7. Incubate brains in 10% NGS at room temperature (RT) for 30 min. 8. Incubate brains in primary antibody solution with gentle rotation at 4
C overnight. 9. Wash brains in 200 μl PBS-T three times at RT for 10 min. 10. Incubate brains in secondary antibody solution with gentle rotation at RT for 2 h. 11. Wash brains in 200 μl PBS-T for 10 min and wash in 200 μl PBS twice.

Analysis of Dopaminergic Functions in Drosophila

189

Fig. 2 Dissection of the fly head. (a) Adult fly head. (b) Head after removal of the antennae and mouthpart. (c) Diagram of the anterior brain (upper) and brain after removal of the cuticle and tracheae around the brain (lower). Scale bar ¼ 100 μm

12. Transfer the brains onto the cover glass (24  40 mm) using a 200 μl pipette tip whose tip has been cut off with scissors (see Note 4). 13. Remove surplus PBS, and add a drop of mounting reagent. Cover the tissues with another cover glass (18  18 mm), and seal the cover glass with clear nail polish. 14. Image specimens using confocal laser scanning microscope (Fig. 3). 3.2 Imaging of Synaptic Release of DA Neurons

1. Anesthetize adult fly crosses expressing VMAT-pHluorin in dopaminergic neurons with carbon dioxide. 2. Briefly rinse the whole body in PBS-T and soak the body in HL-3 containing 5 mM Ca2+ in the dissection dish (see Note 1). 3. Cut off the head with microscissors (Fig. 2a). 4. Dissect the brain using tweezers following these steps: Remove both the antennae and mouthpart (Fig. 2b). Incise the head cuticle and pick up the brain. Remove tracheae from the brain as much as possible (Fig. 2c, see Note 2). 5. Make a window (~5 mm squares) in the center of a piece of plastic tape that is slightly larger than a small cover glass (18  18 mm), and attach the tape to a large cover glass (24  40 mm, Fig. 4).

190

Tsuyoshi Inoshita et al.

Fig. 3 Mitochondria (green) of DA neurons (red) in the whole-mount brain. The protocerebral anterior lateral (PAL) and the protocerebral anterior medial (PAM) clusters in the anterior (left) and the protocerebral posterior lateral 1 (PPL1), the protocerebral posterior medial (PPM)1/2 or the PPM3 clusters in the posterior (right) brain are shown. (b) Higher magnification of mitochondria (green) in the PPL1 cluster DA neurons (red). Mito-GFP is driven by TH-GAL4. Note that TH-GAL4 does not cover all PPL1 neurons [18] and does not drive PAM neurons [2]. Ddc-GAL4 covers PAM and PPM2 neurons, while this driver does not cover PPM3 neurons or most PPL1 neurons [2, 19]. Scale bars ¼ 100 μm (a) or 10 μm (b)

6. Fill the window with HL-3 containing 5 mM Ca2+, and place the brain in the window. 7. Seal the window containing the brain with a small cover glass (18  18 mm). 8. Photobleach the whole brain with a 488 nm argon laser at maximum power output for 2 min, and take z-stack images

Analysis of Dopaminergic Functions in Drosophila

191

Fig. 4 Assembly of an observation stage for VMAT-pHluorin. (a) A piece of plastic tape (approximately 22  22 mm) with a 5-mm square window is placed on a larger cover glass (24  40 mm). (b) A dissected brain is incubated in HL-3 that fills the window of tape. The brain in HL-3 is sealed with a smaller cover glass (18  18 mm)

Fig. 5 VMAT-pHluorin measurement. (a) VMAT-pHluorin signals in DA neurons of a posterior brain. (b) Pseudocolor images of VMAT-pHluorin before and after photobleaching and 3 min post bleaching. A region around the calyx (shown by a red box in a), where the PPL1 cluster DA neurons project [9], is analyzed. (c) Graph indicates relative fluorescence intensity (mean  s.e.m.) before and after photobleaching in (b). Scale bars ¼ 100 μm (a) or 10 μm (b)

every 3 min under the same conditions using confocal laser scanning microscope (Fig. 5). An increase in fluorescence intensity is measured as spontaneous synaptic release using Fiji (ImageJ-2) software [15, 17].

192

4

Tsuyoshi Inoshita et al.

Notes 1. Soak briefly (approximately 1 s) to avoid tissue damage. 2. Remove the trachea to suppress autofluorescence of the trachea as much as possible. 3. Remove the solution under a stereomicroscope. 4. When the brain tissues stick to the pipette tip, repeat pipetting or pick them up with tweezers.

Acknowledgments This work was supported by Grants-in-Aid for Scientific Research (19K07830 to T.I. and 20H03453 and 20K21531 to Y.I.) from the Japan Society for the Promotion of Science (JSPS). References 1. Mao Z, Davis RL (2009) Eight different types of dopaminergic neurons innervate the Drosophila mushroom body neuropil: anatomical and physiological heterogeneity. Front Neural Circuits 3:5. https://doi.org/10.3389/neuro. 04.005.2009 2. Riemensperger T, Issa AR, Pech U, Coulom H, Nguyen MV, Cassar M, Jacquet M, Fiala A, Birman S (2013) A single dopamine pathway underlies progressive locomotor deficits in a Drosophila model of Parkinson disease. Cell Rep 5(4):952–960. https://doi.org/10. 1016/j.celrep.2013.10.032 3. Alekseyenko OV, Chan YB, Li R, Kravitz EA (2013) Single dopaminergic neurons that modulate aggression in Drosophila. Proc Natl Acad Sci U S A 110(15):6151–6156. https:// doi.org/10.1073/pnas.1303446110 4. Liu C, Placais PY, Yamagata N, Pfeiffer BD, Aso Y, Friedrich AB, Siwanowicz I, Rubin GM, Preat T, Tanimoto H (2012) A subset of dopamine neurons signals reward for odour memory in Drosophila. Nature 488 (7412):512–516. https://doi.org/10.1038/ nature11304 5. Van Swinderen B, Andretic R (2011) Dopamine in Drosophila: setting arousal thresholds in a miniature brain. Proc Biol Sci 278 (1707):906–913. https://doi.org/10.1098/ rspb.2010.2564 6. Ueno T, Tomita J, Tanimoto H, Endo K, Ito K, Kume S, Kume K (2012) Identification of a dopamine pathway that regulates sleep and arousal in Drosophila. Nat Neurosci 15

(11):1516–1523. https://doi.org/10.1038/ nn.3238 7. Keleman K, Vrontou E, Kruttner S, Yu JY, Kurtovic-Kozaric A, Dickson BJ (2012) Dopamine neurons modulate pheromone responses in Drosophila courtship learning. Nature 489 (7414):145–149. https://doi.org/10.1038/ nature11345 8. Vogt K, Schnaitmann C, Dylla KV, Knapek S, Aso Y, Rubin GM, Tanimoto H (2014) Shared mushroom body circuits underlie visual and olfactory memories in Drosophila. elife 3: e02395. https://doi.org/10.7554/eLife. 02395 9. White KE, Humphrey DM, Hirth F (2010) The dopaminergic system in the aging brain of Drosophila. Front Neurosci 4:205. https:// doi.org/10.3389/fnins.2010.00205 10. Mizuno H, Fujikake N, Wada K, Nagai Y (2010) Alpha-Synuclein transgenic Drosophila as a model of Parkinson’s disease and related Synucleinopathies. Parkinsons Dis 2011:212706. https://doi.org/10.4061/ 2011/212706 11. Imai Y (2020) PINK1-Parkin signaling in Parkinson’s disease: lessons from Drosophila. Neurosci Res 159:40–46. https://doi.org/ 10.1016/j.neures.2020.01.016 12. Inoshita T, Cui C, Hattori N, Imai Y (2018) Regulation of membrane dynamics by Parkinson’s disease-associated genes. J Genet 97 (3):715–725 13. Meng H, Yamashita C, Shiba-Fukushima K, Inoshita T, Funayama M, Sato S, Hatta T,

Analysis of Dopaminergic Functions in Drosophila Natsume T, Umitsu M, Takagi J, Imai Y, Hattori N (2017) Loss of Parkinson’s diseaseassociated protein CHCHD2 affects mitochondrial crista structure and destabilizes cytochrome c. Nat Commun 8:15500. https://doi. org/10.1038/ncomms15500 14. Feany MB, Bender WW (2000) A Drosophila model of Parkinson’s disease. Nature 404 (6776):394–398. https://doi.org/10.1038/ 35006074 15. Shiba-Fukushima K, Inoshita T, Hattori N, Imai Y (2014) PINK1-mediated phosphorylation of Parkin boosts Parkin activity in Drosophila. PLoS Genet 10(6):e1004391. https://doi.org/10.1371/journal.pgen. 1004391 16. Wu TH, Lu YN, Chuang CL, Wu CL, Chiang AS, Krantz DE, Chang HY (2013) Loss of vesicular dopamine release precedes tauopathy in degenerative dopaminergic neurons in a Drosophila model expressing human tau. Acta Neuropathol 125(5):711–725. https://doi. org/10.1007/s00401-013-1105-x

193

17. Hosaka Y, Inoshita T, Shiba-Fukushima K, Cui C, Arano T, Imai Y, Hattori N (2017) Reduced TDP-43 expression improves neuronal activities in a Drosophila model of Perry syndrome. EBioMedicine 21:218–227. https://doi.org/10.1016/j.ebiom.2017.06. 002 18. Whitworth AJ, Theodore DA, Greene JC, Benes H, Wes PD, Pallanck LJ (2005) Increased glutathione S-transferase activity rescues dopaminergic neuron loss in a Drosophila model of Parkinson’s disease. Proc Natl Acad Sci U S A 102(22):8024–8029. https://doi. org/10.1073/pnas.0501078102 19. Imai Y, Inoshita T, Meng H, ShibaFukushima K, Hara KY, Sawamura N, Hattori N (2019) Light-driven activation of mitochondrial proton-motive force improves motor behaviors in a Drosophila model of Parkinson’s disease. Commun Biol 2:424. https://doi. org/10.1038/s42003-019-0674-1

Chapter 19 Evaluation of Mitochondrial Function and Morphology in Drosophila Yinglu Tang, Foozhan Tahmasebinia, and Zhihao Wu Abstract Drosophila melanogaster (Drosophila, fruit fly, or fly) is an important model organism in the studies of molecular genetic analysis and mechanism of Parkinson’s disease (PD), benefiting from its powerful genetic tools and massive available genetic mutants. People have generated different fly models to mimic the inherited PDs and most of them have obvious mitochondrial abnormalities. Here, we describe some common approaches to analyze mitochondrial functions and morphological changes in Drosophila PD models. Key words Parkinson’s disease (PD), Drosophila, Mitochondrial function, Wing posture, Movement, ATP, Respiration, Reactive oxygen species (ROS), Mitochondrial morphology, Mitochondrial aggregation

1

Introduction Parkinson’s disease (PD) is the second most common progressive neurodegenerative disease in the elderly population, which is characterized by the symptoms of movement disabilities including tremor, bradykinesia, rigid muscles, impaired posture and balance, and loss of automatic movements [1]. PD, as a movement disorder, is clinically recognized by selective degeneration of dopamine (DA) neurons in the substantia nigra pars compacta in the postmortem examinations [1, 2]. About 90% of the PD cases are sporadic and around 10% of the PD patients carry genetic variants [3]. Many candidate genes have been identified from familial PDs and investigated, including SNCA/α-synuclein, LRRK2, DJ-1, VPS35, PINK1, and Parkin [4]. Currently, overwhelming evidence has been accumulated and indicates a central role of mitochondrial dysfunction in both sporadic and familial PD pathophysiology [5]. The supporting evidence includes the continually and consistently identified compromised respiratory complex activity [6],

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_19, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

195

196

Yinglu Tang et al.

ATP production [7], and reactive oxygen species (ROS) induction [8] in both PD animal models [9] and PD patient postmortem studies [10, 11]. Drosophila melanogaster (Drosophila, fruit fly, or fly) is a broadly used model organism in the studies of human diseases, because its genome is 60% homologous to that of humans, and about 75% of the human disease candidate genes have homologs in fly [4, 12]. Using the fly as an experimental platform for PD research provides a great opportunity to mimic the patients’ pathological abnormalities [13, 14], conduct a rapidly genetic screen, and investigate functionally conserved mitochondria-associated genes in order to get a better understanding of molecular pathways underlying mitochondrial dysfunction in PD [15–19]. Mitochondrial dysfunction usually causes an imbalance of mitochondrial dynamics, while on the other hand, mitochondrial fission/fusion strongly regulates the mitochondrial functions [20, 21]. In PD fly models, mitochondrial morphology changes, in many cases—mitochondrial aggregation, are often observed in the indirect flight muscle and dopaminergic neurons and considered as a hallmark of pathogenesis [14, 22]. In the genetic screens, the elimination of mitochondrial aggregation in both tissues is the golden standard of confirming efficient rescues [7, 13, 17, 23, 24]. Here we exhibit multiple robust assays to assess the alteration of mitochondrial functions and describe the protocols of mitochondrial staining in neuromuscular tissues to illuminate mitochondrial aggregation in PD flies. These methods are able to systemically evaluate the mitochondrial damages in disease models.

2

Materials

2.1 Fly Wing Posture and Activity Assays

1. Standard corn meal fly food (Standard food): 35.6 g yeast, 116.8 g corn meal, 17.8 g agar, 2.43 L deionized water (diH2O). Boil mixture for 10 min. After boiling, add 30 ml corn syrup, 0.3 lb. malt, and 2.1 g Tegosept (in 20.3 ml of 100% ethanol). When cooled to around 80
C, add additional 15.2 ml propionic acid and aliquot it into vials. 2. Fly food for cross (cross food): 35.6 g yeast, 106.2 g corn meal, 1.5 g agar, 2.43 L deionized water (diH2O). Boil mixture for 10 min. After boiling, add 60 ml corn syrup, 0.6 lb. malt, and 2.1 g Tegosept (in 20.3 ml of 100% ethanol). When cooled to around 80
C, add additional 15.2 ml propionic acid and aliquot it into vials (see Note 1).

Mitochondrial Assays in Drosophila

2.2 ATP Level Measurement of Fly Thoracic Muscle Tissue 2.3 Fly Mitochondria Purification

197

1. Cell lysis reagent, dilution buffer, ATP standard, and luciferase reagent are from ATP Bioluminescence Assay Kit HS II (Roche) and prepared according to its bulletin.

The recipe is modified from the original protocol of mitochondrial purification via Percoll gradient from adherent cells grown in culture [25]. 1. Homogenization buffer (HB): 5 mM HEPES, 210 mM mannitol, 70 mM sucrose, 1 mM EGTA (1 M stock, pH 7.5), pH 7.12 at 25
C (see Note 2). 2. Homogenization buffer supplemented (HBS): HB with Roche’s Complete Mini EDTA-free protease inhibitor cocktail at a final concentration of 1 (1 mini-tablet in 10 ml buffer) and 0.1 mg/ml cycloheximide. 3. Percoll solutions: 50% Percoll solution, Percoll diluted 1 to 1 with 2 HB plus appropriate concentrations of protease inhibitor cocktail and cycloheximide; 22% and 15% Percoll solutions, the 50% Percoll diluted with HBS to prepare all other Percoll solutions. 4. Tenbroeck tissue grinder (DWK Life Sciences Wheaton™). 5. Ultracentrifuge tube (Open-Top Thinwall Ultra-Clear Tube, 14  89 mm, Beckman Coulter).

2.4 ROS Assay for Purified Mitochondrial Sample

1. Respiratory buffer (RB): 120 mM KCl, 5 mM K2HPO4, 3 mM HEPES, 1 mM EGTA, 1 mM MgCl2, and 0.2% fatty acid-free BSA (see Note 3). 2. DCFH (20 ,70 -Dichlorfluorescein): 10 mM stock solution (dissolved in DMSO). DCFH is sensitive to H2O2 and its derivative, such as·OH (see Note 4). 3. Dihydrorhodamine 123: 10 mM stock solution (dissolved in DMSO). DCFH is sensitive to superoxide, such as O2 (see Note 5).

2.5 MitoSox, TMRM, Rhod2, JC-1, and MitoPOP Staining in Fly Muscle

1. Schneider’s medium (also called S2 medium). 2. 1  PBS, pH 7.0 ~ 7.2 (see Note 6). 3. MitoSOX (Invitrogen): 5 mM stock solution (dissolved in DMSO) (see Note 7). 4. TMRM (Invitrogen): 10 mM stock solution (dissolved in DMSO) (see Note 8). 5. JC-1 (Invitrogen): 5 mM stock solution (dissolved in DMSO) (see Note 9). 6. mitoPOP [26]: 1 mM stock solution (dissolved in DMSO) (see Note 10).

198

Yinglu Tang et al.

2.6 Blue Native Gel (BNG) Analysis of Respiratory Complex Assembly

1. NativePAGE™ 4–16% Bis-Tris protein gels (Invitrogen). 2. NativePAGE™ sample buffer (4) (Invitrogen). 3. NativePAGE™ cathode buffer additive (Invitrogen). 4. NativePAGE™ 5% G-250 sample additive (Invitrogen). 5. NativePAGE™ running buffer (20) (Invitrogen). 6. 5% digitonin (Invitrogen) (see Note 11).

2.7 Immunostaining of Mitochondria in Fly Neuromuscular Tissues

1. 1  PBS: 137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, 1.8 mM KH2PO4. Dissolve 8 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4, 0.24 g KH2PO4 in water, adjust its pH to 7.4, and make up to 1 L with water. 2. PBSTx: 0.25% Triton X-100 in 1 PBS. 3. Fixative solution: 4% formaldehyde in PBSTx. 4. Blocking solution: 5% normal goat serum in PBSTx. 5. Primary antibody dilution: Dilute the primary antibody into 5% normal goat serum in PBSTx. 6. Antibodies: Chicken anti-GFP (Abcam); rabbit anti-Ref2p (Abcam); rabbit anti-fly TH [17]; goat anti-chicken 488 (Invitrogen); goat anti-rabbit 568 (Invitrogen). 7. Antifade mounting reagent: ProLong™ Gold Antifade Mountant (Invitrogen).

3

Methods

3.1 Wing Posture Analysis

1. Set up fly crosses in the bottles with fly cross food and collect male progenies of desired genotypes from the crosses. 2. Male flies are aged at 29
C with 20 flies per vial with standard fly food. Flies are flipped into fresh vials every 2 days (see Note 12). 3. The penetrance of abnormal wing posture is calculated as the percentage of flies with either held-up or dropped wing postures at day 1, day 7, and day 14. 4. For each experiment, at least 60 flies (three repeats) per genotype are analyzed for their wing posture phenotype [17].

3.2 Jump/Flight Activity Analyses

1. 10 five-days-old male flies are put into each vial (see Note 13). 2. Vials are gently rotated to initiate jump/flight events. These events are counted for two consecutive minutes [17]. 3. Each of these analyses are repeated at least three times. Three independent groups of flies are tested for each genotype.

Mitochondrial Assays in Drosophila

3.3 ATP Level Measurement of Fly Thoracic Muscle Tissue

199

1. The thoracic ATP level is measured using a luciferase-based bioluminescence assay (ATP Bioluminescence Assay Kit HS II, Roche). 2. For each measurement, five thoraces are dissected from fivedays-old flies with wings and legs are removed and immediately homogenized in 100 μl cell lysis reagent. 3. The lysate is then boiled (100
C) for 5 min on dry heat block bath and cleared by centrifugation at 20,000  g for 2 min at 4
C (see Note 14). 4. 5 μl of cleared lysate is added to 185 μl dilution buffer and 10 μl luciferase reagent, and the luminescence signal is immediately measured using a Lumat LB 9507 tube luminometer (Berthold Technologies) or microplate reader (BioTek). 5. Each reading is converted to the amount of ATP per thorax based on the standard curve generated with ATP standards and normalized to control sample (as 100%). At least five independent measurements are made for each genotype.

3.4 Fly Mitochondria Purification

This protocol is modified from the original method of mitochondrial purification via Percoll gradient from adherent cells grown in culture [25]. 1. Per purification, collect 50 thoraces from flies with wings and legs removed (see Note 15). 2. Homogenize the samples in the Tenbroeck tissue grinder within 3 ml HBS. Use 25 strokes of the pestle in about 3 min, maintaining the homogenizer tube in ice. Wait for 3 min, then repeat once. 3. Spin the resultant homogenate at 1500  g for 5 min on 4
C centrifuge, then collect the supernatant. 4. Centrifugate the supernatant from step 3 at 13,000  g for 17 min on 4
C. Centrifuge again. 5. Save the resultant supernatant as the sample of the postmitochondria fraction, and the resultant pellet as the mitochondria fraction. 6. When centrifuging, prepare two 13.2 ml ultracentrifuge tubes with a discontinued Percoll gradient: 3 ml of 50% Percoll solution as cushion followed by layering 3 ml of a 22% Percoll solution. 7. Resuspend the pellet in 1.4 ml of HBS, and add 0.6 ml of 50% Percoll solution to make it 15% Percoll solution in final sample. Layer the final sample on top of the 15%–22%–50% discontinued Percoll gradient. Use 15% Percoll solution to help balance the tubes before centrifugation.

200

Yinglu Tang et al.

8. Centrifuge the resultant gradient at 30,700  g for 12 min at 4
C (see Note 16). 9. Recover the mitochondria from the 22–50% Percoll gradient interface (see Note 17). 10. Wash the samples with triple volumes of HBS buffer to minimize the amount of Percoll and centrifuge the samples at 20,000  g for 30 min at 4
C. 11. Repeat the wash step once and resuspend the resultant pellet of mitochondria with HBS or the buffer used in the following experiments (see Note 18). 3.5 ROS Assay for Purified Mitochondrial Sample

This protocol is originally used for detecting the ROS production of Aluminum-treated flies [27]. 1. Resuspend the mitochondria pellet purified from Subheading 3.3 with RB. 2. Mix DCFH or dihydrorhodamine 123 with the mitochondria sample (final sample should contain 1 μM dye, diluted with RB buffer). 3. Signal dynamics is monitored by Fluoroskan Ascent (Thermo Electron Corp.) every 4–5 min in a 20 min period (see Note 19).

3.6 MitoSox, TMRM, Rhod2, JC-1, and MitoPOP Staining in Fly Muscle

All fluorescent dye staining follows a similar protocol and here JC-1 is used as an example. 1. Collect fly thoraces with wings and legs removed, and dissect the indirect flight muscle from thorax sample freshly in Drosophila S2 cell culture medium (Schneider’s medium, S2 medium) supplemented with 10% fetal bovine serum. 2. Incubate the muscle fiber in S2 medium supplemented with 10% fetal bovine serum and with a final JC-1 dye concentration at 5 μM, diluted with S2 medium. Avoid light (see Note 20). 3. After 30 min incubation at 37
C, wash the samples for two times (5 min each) with S2 medium and two times (5 min each) with pre-warmed PBS buffer in the dark chamber. 4. For image acquisition, samples are illuminated under the confocal microscope at 488 nm excitation and emissions between 515/545 nm and 575/625 nm are collected (see Note 21).

3.7 Blue Native Gel (BNG) Analysis of Respiratory Complex Assembly

This protocol is modified from the manual of NativePAGE™ Novex® Bis-Tris. Gel System. 1. Resuspend the mitochondria pellet purified from Subheading 3.3 with HBS, and determine the protein concentration with

Mitochondrial Assays in Drosophila

201

NanoDrop™ One UV-Vis Spectrophotometer. Then dilute the sample with HBS to a final protein concentration of approximately 5 μg/μl. 2. 40 μg of mitochondrial protein (8 μl) is mixed with 5% digitonin (4 μl) and 4X NativePAGE™ sample buffer (5 μl) and an additional 3 μl HBS (see Note 22). 3. Incubate sample on ice for 30 min and spin at 20,000  g for 30 min at 4
C. 4. Cleared supernatant is mixed with 1 μl NativePAGE™ 5% G-250 sample additive (see Note 23). 5. Perform the electrophoresis and Coomassie staining of the gel by following the instruction of the NativePAGE™ Novex® Bis-Tris Gel System manual. 3.8 Immunostaining of Mitochondria in Fly Muscular Tissues (Fig. 1)

1. Prepare fresh fixative solution and chill it on ice. Flies of one genotype can be fixed in one Eppendorf tube with 1 ml fixative solution. 2. Collect the fly thoraces from the right genotype with wings and legs removed and fix it in the fixative solution for 1 h at room temperature on a Nutator (see Fig. 1a). 3. Wash the samples with 1 PBSTx for three times, 10 min each wash. 4. Dissect the indirect flight muscle from fixed thoraces. Then transfer the dissected muscle fibers into a new tube (see Fig. 1b). 5. Carefully remove the remaining PBSTx buffer by pipetting. Then block the samples with the blocking solution at room temperature for 1 h on a Nutator (see Note 24). 6. Carefully dispose of the blocking solution and incubate the samples with the diluted primary antibodies at 4
C overnight (at least 8 h) on the Nutator (see Note 25). 7. Recycle the primary antibody dilution and wash the samples with 1 PBSTx for three times, 15 min each on the Nutator. 8. Remove the remaining PBSTx and incubate the samples in the secondary antibody dilution (in 1 PBSTx) at room temperature for 3 h. Avoid light (see Note 26). 9. Dispose of the secondary antibody dilution and wash the samples with 1X PBSTx for three times, 15 min each on the Nutator. Avoid light.

202

Yinglu Tang et al.

Fig. 1 Samples of Indirect Flight Muscle Dissection. (a) Fly thorax with legs and wings removed. (b) Dissected fly indirect flight muscle fibers in the dissection chamber. (c) Mitochondrial aggregation (GFP) images from muscle samples of MHC-Gal4 > PINK1 RNAi; UAS-mitoGFP fly. Scale bar, 20 μm

10. Use a pipette to transfer the samples onto a glass slide. Remove the extra buffer and mount it with one drop of antifade mounting reagent. Seal the cover glass with the clear nail polisher. The samples can be observed under the microscope (see Note 27 and Fig. 1c). 3.9 Immunostaining of Mitochondria in Dopaminergic Neurons (Fig. 2)

1. Prepare the fresh fixative solution in the same way as muscle staining. 2. Collect the fly heads by cutting the neck with a scalpel. For brain staining, multiple heads can be fixed together in one Eppendorf tube with 1 ml fixative solution (see Fig. 2a). 3. Dissect the brains in the PBSTx buffer and then transfer the brains to a new thin-wall PCR tube (see Note 28 and Fig. 2b). 4. The following staining steps are the same as the protocol of muscle staining, with the exception of different primary and secondary antibody combinations. In the dopaminergic neuron staining, we use the chicken anti-GFP and rabbit anti-fly TH for primary antibodies and the goat anti-chicken 488 and goat anti-rabbit 568 for the secondary (see Fig. 2c).

Mitochondrial Assays in Drosophila

203

Fig. 2 Samples of Fly Brain Dissection. (a) Collected fly brain. (b) Dissected fly brain in the dissection chamber. (c) Mitochondria (GFP) and dopaminergic neurons staining in brain samples of w-/Y; TH-Gal4 > mitoGFP fly. Scale bar, 5 μm

4

Notes 1. Cross food, which is softer than standard food, helps larvae digest and increases the eclosion rate. 2. HB can be stored at 4
C. 3. The existence of fatty acid may disturb mitochondrial respiration and ROS production. 4. DCFH stock solution can be stored at 20
C. Avoid light. 5. Dihydrorhodamine 123 stock solution can be stored at 20
C. Avoid light. 6. Fly tissue maintains better activity in a pH range between 6.75 and 7.35 [28]. PBS pH 7.0 generally works better than pH 7.4. 7. MitoSOX stock solution can be stored at 20
C. Avoid light. 8. TMRM stock solution can be stored at 20
C. Avoid light. 9. JC-1 stock solution can be stored at 20
C. Avoid light. 10. mitoPOP stock solution can be stored at 20
C. Avoid light.

204

Yinglu Tang et al.

11. 5% digitonin solution forms precipitate in room temperature. Prior to use, heat the solution at 95
C for 5 min and vortex slowly to dissolve precipitate. Cool to room temperature. 12. 15 ~ 20 flies per vial are appropriate. Crowded vials with too many flies in it result in a higher juvenile mortality. 13. Ten flies per vial are appropriate for scoring the jumping/flight events. Too many flies in one vial may cause a nonlinear increase of the movements, therefore keeping a consistent number in all the assays is important. 14. The pellets can be collected and dissolved in a 2X SDS Laemmli sample buffer for later immunoblot analysis as the loading controls of ATP assays. 15. Keep the samples on ice during collection to avoid any protein degradation. 16. 30,700  g approximately equals to 15,780 rpm when using an SW-40Ti rotor. 17. The intact mitochondria form a milkiness layer at the interface of 22% and 50% Percoll layers, which is easier to find in a dark background. 18. Resuspend the mitochondria pellet respiratory buffer (RB) in Subheading 3.4. 19. The excitation/emission of DCFH is 495 nm/529 nm; the excitation/emission of dihydrorhodamine 123 is 507 nm/ 529 nm. 20. The final concentration of MitoSOX in the S2 medium is 5 μM, TMRM is 200 nM, and mitoPOP is 5 μM. 21. The excitation/emission of MitoSOX is 510 nm/580 nm, TMRM is 488 nm/570 nm, and mitoPOP is 485 nm/535 nm. 22. In our case, the total final volume is 20 μl, while the final concentration of digitonin in the sample is 1%, and the final concentration of NativePAGE™ sample buffer is 1. 23. The G-250 final concentration is 25% of the digitonin concentration. 24. Use gel-loading tips (Fisher sci) to remove the remaining buffer in the tube. Look through the light when pipetting to avoid losing the samples. 25. We usually use MHC-Gal4 > UAS-mitoGFP to express GFP in mitochondria ectopically. Therefore, our commonly used primary antibody combination is chicken anti-GFP (showing mitochondria structure) and rabbit anti-Ref2p (showing potential mitophagy). 26. Corresponding to primary antibody selection, we commonly use goat anti-chicken 488 and goat anti-rabbit 568 as secondary.

Mitochondrial Assays in Drosophila

205

27. Slides can be safely saved at 4
C for days and 20
C for weeks. 28. A detailed video protocol of fly brain dissection can be found on YouTube Ito Laboratory channel (https://www.youtube. com/watch?v¼Exd6yGuk1Bo).

Acknowledgments This work is supported by the start-up grant of Southern Methodist University to Z.W and the Mustang Fellowship to F.T. We thank Mr. Sree Nallamothu for manuscript proofreading. References 1. Kalia LV, Lang AE (2015) Parkinson’s disease. Lancet 386(9996):896–912. https://doi.org/ 10.1016/S0140-6736(14)61393-3 2. Michell AW, Lewis SJ, Foltynie T, Barker RA (2004) Biomarkers and Parkinson’s disease. Brain 127(Pt 8):1693–1705. https://doi. org/10.1093/brain/awh198 3. Tysnes OB, Storstein A (2017) Epidemiology of Parkinson’s disease. J Neural Transm (Vienna) 124(8):901–905. https://doi.org/ 10.1007/s00702-017-1686-y 4. Kim CY, Alcalay RN (2017) Genetic forms of Parkinson’s disease. Semin Neurol 37 (2):135–146. https://doi.org/10.1055/s0037-1601567 5. Park JS, Davis RL, Sue CM (2018) Mitochondrial dysfunction in Parkinson’s disease: new mechanistic insights and therapeutic perspectives. Curr Neurol Neurosci Rep 18(5):21. https://doi.org/10.1007/s11910-018-0829-3 6. Liu W, Acı´n-Pere´z R, Geghman KD, Manfredi G, Lu B, Li C (2011) Pink1 regulates the oxidative phosphorylation machinery via mitochondrial fission. Proc Natl Acad Sci U S A 108(31):12920–12924. https://doi.org/ 10.1073/pnas.1107332108 7. Gehrke S, Wu Z, Klinkenberg M, Sun Y, Auburger G, Guo S, Lu B (2015) PINK1 and Parkin control localized translation of respiratory chain component mRNAs on mitochondria outer membrane. Cell Metab 21 (1):95–108. https://doi.org/10.1016/j. cmet.2014.12.007 8. Dias V, Junn E, Mouradian MM (2013) The role of oxidative stress in Parkinson’s disease. J Parkinsons Dis 3(4):461–491. https://doi. org/10.3233/JPD-130230

9. Coulom H, Birman S (2004) Chronic exposure to rotenone models sporadic Parkinson’s disease in Drosophila melanogaster. J Neurosci Off J Soc Neurosci 24(48):10993–10998. https://doi.org/10.1523/JNEUROSCI. 2993-04.2004 10. Schapira AH, Cooper JM, Dexter D, Jenner P, Clark JB, Marsden CD (1989) Mitochondrial complex I deficiency in Parkinson’s disease. Lancet 1(8649):1269. https://doi.org/10. 1016/s0140-6736(89)92366-0 11. Bindoff LA, Birch-Machin M, Cartlidge NE, Parker WD, Turnbull DM (1989) Mitochondrial function in Parkinson’s disease. Lancet 2 (8653):49. https://doi.org/10.1016/s01406736(89)90291-2 12. Ugur B, Chen K, Bellen HJ (2016) Drosophila tools and assays for the study of human diseases. Dis Model Mech 9(3):235–244. https:// doi.org/10.1242/dmm.023762 13. Liu S, Lu B (2010) Reduction of protein translation and activation of autophagy protect against PINK1 pathogenesis in Drosophila melanogaster. PLoS Genet 6(12):e1001237. https://doi.org/10.1371/journal.pgen. 1001237 14. Yang Y, Gehrke S, Imai Y, Huang Z, Ouyang Y, Wang JW, Yang L, Beal MF, Vogel H, Lu B (2006) Mitochondrial pathology and muscle and dopaminergic neuron degeneration caused by inactivation of Drosophila Pink1 is rescued by Parkin. Proc Natl Acad Sci U S A 103 (28):10793–10798. https://doi.org/10. 1073/pnas.0602493103 15. Clark IE, Dodson MW, Jiang C, Cao JH, Huh JR, Seol JH, Yoo SJ, Hay BA, Guo M (2006) Drosophila pink1 is required for mitochondrial

206

Yinglu Tang et al.

function and interacts genetically with parkin. Nature 441(7097):1162–1166. https://doi. org/10.1038/nature04779 16. Park J, Lee SB, Lee S, Kim Y, Song S, Kim S, Bae E, Kim J, Shong M, Kim JM, Chung J (2006) Mitochondrial dysfunction in Drosophila PINK1 mutants is complemented by parkin. Nature 441(7097):1157–1161. https://doi.org/10.1038/nature04788 17. Wu Z, Sawada T, Shiba K, Liu S, Kanao T, Takahashi R, Hattori N, Imai Y, Lu B (2013) Tricornered/NDR kinase signaling mediates PINK1-directed mitochondrial quality control and tissue maintenance. Genes Dev 27 (2):157–162. https://doi.org/10.1101/gad. 203406.112 18. Liu Z, Wang X, Yu Y, Li X, Wang T, Jiang H, Ren Q, Jiao Y, Sawa A, Moran T, Ross CA, Montell C, Smith WW (2008) A Drosophila model for LRRK2-linked parkinsonism. Proc Natl Acad Sci U S A 105(7):2693–2698. https://doi.org/10.1073/pnas.0708452105 19. Hao LY, Giasson BI, Bonini NM (2010) DJ-1 is critical for mitochondrial function and rescues PINK1 loss of function. Proc Natl Acad Sci U S A 107(21):9747–9752. https://doi. org/10.1073/pnas.0911175107 20. Dorn GW (2019) Evolving concepts of mitochondrial dynamics. Annu Rev Physiol 81:1–17. https://doi.org/10.1146/annurevphysiol-020518-114358 21. Ferree A, Shirihai O (2012) Mitochondrial dynamics: the intersection of form and function. Adv Exp Med Biol 748:13–40. https:// doi.org/10.1007/978-1-4614-3573-0_2 22. Yang Y, Ouyang Y, Yang L, Beal MF, McQuibban A, Vogel H, Lu B (2008) Pink1 regulates mitochondrial dynamics through interaction with the fission/fusion machinery.

Proc Natl Acad Sci U S A 105(19):7070–7075. https://doi.org/10.1073/pnas.0711845105 23. Wu Z, Wu A, Dong J, Sigears A, Lu B (2018) Grape skin extract improves muscle function and extends lifespan of a Drosophila model of Parkinson’s disease through activation of Mitophagy. Exp Gerontol 113:10–17. https://doi. org/10.1016/j.exger.2018.09.014 24. Wu Z, Wang Y, Lim J, Liu B, Li Y, Vartak R, Stankiewicz T, Montgomery S, Lu B (2018) Ubiquitination of ABCE1 by NOT4 in response to mitochondrial damage links co-translational quality control to PINK1directed Mitophagy. Cell Metab 28 (1):130–144.e7. https://doi.org/10.1016/j. cmet.2018.05.007 25. Kristia´n T, Hopkins IB, McKenna MC, Fiskum G (2006) Isolation of mitochondria with high respiratory control from primary cultures of neurons and astrocytes using nitrogen cavitation. J Neurosci Methods 152(1–2):136–143. https://doi.org/10.1016/j.jneumeth.2005. 08.018 26. Austin S, Tavakoli M, Pfeiffer C, Seifert J, Mattarei A, De Stefani D, Zoratti M, Nowikovsky K (2017) LETM1-mediated K + and Na + homeostasis regulates mitochondrial ca 2 + efflux. Front Physiol 8:839. https://doi.org/ 10.3389/fphys.2017.00839 27. Wu Z, Du Y, Xue H, Wu Y, Zhou B (2012) Aluminum induces neurodegeneration and its toxicity arises from increased Iron accumulation and reactive oxygen species (ROS) production. Neurobiol Aging 33(1):199.e1–199. e12. https://doi.org/10.1016/j. neurobiolaging.2010.06.018 28. Robb JA (1969) Maintenance of imaginal discs of Drosophila melanogaster in chemically defined media. J Cell Biol 41(3):876–885. https://doi.org/10.1083/jcb.41.3.876

Chapter 20 Cytosolic and Mitochondrial Ca2+ Imaging in Drosophila Dopaminergic Neurons Tsuyoshi Inoshita and Yuzuru Imai Abstract The ATP-producing organelle mitochondrion controls cellular or synaptic Ca2+ concentrations through temporal uptake of Ca2+ outside of the mitochondria. Although intracellular Ca2+ influx occurs during neuronal activity, a persistently higher concentration of intracellular Ca2+ is neurotoxic. Healthy mitochondria ensure rapid Ca2+ uptake, which is necessary for proper neuronal activity. Mitochondrial Ca2+ buffering activity decreases in aged or sick neurons. In this chapter, we will introduce our protocol for evaluating Ca2+ buffering activity through the mitochondria during neuronal activity of dopaminergic neurons. Key words Ca2+ buffering, GCaMP, Mitochondria, Synaptic activity, Dopaminergic neuron, Live imaging, Drosophila

1

Introduction As a second messenger, Ca2+ plays an important role in regulating cellular functions, whereas a high concentration of Ca2+ is harmful to cells. Under steady-state conditions, the cytoplasmic Ca2+ concentration is kept low by extracellular release via Ca2+ pumps and Ca2+ storage in the endoplasmic reticulum and mitochondria [1– 3]. In the mitochondria, Ca2+ influx is regulated through the channel called the Ca2+ uniporter existing on the inner membrane [4, 5]. On the other hand, the Na+/Ca2+ exchanger and mitochondrial permeability transition pore (mPTP) contribute to Ca2+ release from the mitochondria to the cytoplasm [6, 7]. Mammalian dopaminergic neurons in the substantia nigra have an autonomous pacemaking property involving L-type Ca2+ channels [8, 9]. Mitochondria regulate cellular Ca2+ concentrations upon Ca2+ influx via the opening of Ca2+ channels during synaptic activity, whereby the continuous firing of dopaminergic neurons is secured. Dysregulation of Ca2+ might render dopaminergic

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2_20, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

207

208

Tsuyoshi Inoshita and Yuzuru Imai

neurons vulnerable to various stresses, especially oxidative stress, because Ca2+ influx to the mitochondria stimulates oxidative phosphorylation, resulting in high ROS generation when antioxidant ability is compromised [8]. Indeed, a reduction in mitochondrial function, especially respiratory complex I activity, in dopaminergic neurons has been reported in both idiopathic and genetic Parkinson’s disease [10, 11]. The Ca2+-binding protein calmodulin (CaM) binds to various proteins through conformational changes in the presence of Ca2+ and regulates various cellular functions. The green fluorescent protein (GFP)-based Ca2+ probe GCaMP was developed for the detection of changes in intracellular Ca2+ concentrations by utilizing Ca2+-dependent binding between CaM and the M13 fragment of the myosin light-chain kinase [12]. When Ca2+ binds to the CaM motif in GCaMP, a structural change in GFP increases the fluorescence intensity. Local changes in Ca2+ concentration can be monitored by cytoplasmic GCaMP or organelle-targeted GCaMP, depending on Ca2+ concentration. Improved versions of cytoplasmic and mitochondrial GCaMP, GCaMP6f, and mito-GCaMP6 successfully detect cytosolic and mitochondrial Ca2+ dynamics in the nerve terminals of dopaminergic neurons [13]. The protocerebral anterior medial (PAM) cluster dopaminergic neurons located in the Drosophila anterior brain regulate locomotion, and their degeneration causes defects in startle-induced negative geotaxis [14]. R58E02-GAL4 [15] and Ddc-GAL4 [14] drive the expression of UAS transgenes in PAM neurons. In this chapter, we will introduce our method for analyzing Ca2+ dynamics in the nerve terminals of Drosophila PAM neurons induced by electrical stimulation [13].

2

Materials

2.1 Setting Up Imaging Tools

1. Tweezers (FST, Dumont #5 forceps Dumoxel standard tip). 2. Ca2+-free HL-3: 70 mM NaCl, 5 mM KCl, 20 mM MgCl2, 10 mM NaHCO3, 115 mM sucrose, 5 mM trehalose, and 5 mM HEPES (pH 7.2). Filter the solution with a 0.22 μm syringe filter unit, and store at 4
C for 2 weeks. 3. Plastic coverslip (Fisher). 4. Round ceramic magnet (20 mm in diameter, 5 mm in thickness). 5. Black or dark nail polish. 6. Wet chamber: Put wet filter papers in a plastic box. 7. Glass electrode (Warner Instruments, Item# W3 64-0792) with a 100-μm tip diameter made by an electrode puller (Sutter Instrument, P-97).

Ca2+ imaging in Drosophila Dopaminergic Neurons

209

8. Reference electrode (Platinum wire). 9. Electrical stimulator (Nihon kohden, SEN-3401). 10. Isolator (Nihon kohden, SS-104J). 11. Fluorescence microscope: Eclipse FN1 microscope equipped with a fluorescence imaging system (Nikon) and NIS-Elements software (Nikon). 12. Excel (Microsoft). 13. Transgenic Drosophila lines: UAS-GCaMP6f [16], UAS-mitoGCaMP6 [13], and R58E02-GAL4 [15] (see Note 1).

3 3.1

Methods Ca2+ Imaging

1. Prepare a fly retainer as below. Drill a hole (1 mm in diameter) in a plastic coverslip. Cement a round ceramic magnet and a plastic coverslip with nail polish, as shown in Fig. 1a. Put another ceramic magnet on the other side of the plastic coverslip (Fig. 1a, see Note 2).

Fig. 1 Setting up the fly imaging stage. (a) Assembly of the fly retainer. (b) Flip the fly retainer and insert the fly head into the hole in the plastic slip. (c) Overview of the fly imaging stage. (d) After surgery of the head, as shown in Fig. 2, the fly retainer and electrodes are set on a microscope stage. (e) Enlarged front view of the fly stage

210

Tsuyoshi Inoshita and Yuzuru Imai

Fig. 2 Surgery of the fly head to make the observation window. (a) Setting up the imaging stage from Fig. 1c. A high-magnification image of a fly head is shown on the right. (b) The gap around the fly head was filled with nail polish. After the nail polish hardened, the cuticle between the compound eyes was removed, as shown in the right image. (c) Cutoff position of the esophagus (dashed red line) and removal of the mouthpart. (d) Remove of tracheae around the anterior part of brain. (e) Observation window after the surgery, which is filled with Ca2+-free HL-3

2. Anesthetize adult fly crosses expressing GCaMP6f or mitoGCaMP6 in dopaminergic neurons with carbon dioxide. 3. Flip the fly retainer. Insert the fly head into the hole of the retainer as shown in Fig. 1b. 4. Turn back the fly retainer. Pull the fly mouthpart and attach the tip of the mouthpart to the fly retainer using nail polish, as shown in Fig. 1c. 5. Fill the gap between the head and the hole so as not to move the fly head (Fig. 2a, b, see Note 3). 6. Incubate the fly retainer in a wet chamber for 15 min (see Note 4). 7. Remove the upside ceramic magnet, and put 200 μl of Ca2+free HL-3 on the fly head. 8. Remove the cuticle between the compound eyes using tweezers, as shown in Fig. 2b. 9. Cut off the esophagus that passes through the center of the brain using tweezers, and remove the mouthpart (Fig. 2c) and trachea (Fig. 2d, e).

Ca2+ imaging in Drosophila Dopaminergic Neurons

211

10. Replace the Ca2+-free HL-3 twice with 200 μl fresh Ca2+-free HL-3. 11. Soak a reference electrode in Ca2+-free HL-3 with which the fly head covers and connect the reference electrode to a ground (Fig. 1d, e). 12. Observe the fly brain under a fluorescence microscope, and insert one side of the antennal nerves from the root into a glass electrode (Fig. 3a, b).

Fig. 3 Diagram of the electrostimulation. (a) Drosophila anterior brain anatomy. AL, antennal lobe; CA, calyx; LH, lateral horn; MB, mushroom body. (b) The antennal nerve projected from the antennal lobe is sucked using a glass electrode. Electrostimulation of the antennal lobe excites the projection region of the PAM neurons. (c) Fluorescence image of a dissected brain. The positions of the PAM cluster dopamine neurons (asterisk) project to the mushroom bodies and the glass electrode. The terminals of the PAM neurons are visualized by GCaMP6f under control of the R58E02-GAL4 driver. (d, e). Fluorescence images before (d) and after (e) electrostimulation in the boxed region in (c). Asterisks indicate the region that includes the cell bodies of the PAM neurons. (f) The fluorescence intensity of poststimulation subtracted from prestimulation is shown by a pseudocolor image. Scale bars ¼ 100 μm (c); 50 μm (d–f)

212

Tsuyoshi Inoshita and Yuzuru Imai

Fig. 4 Typical results showing the cytosolic Ca2+ influx and subsequent mitochondrial Ca2+ uptake in the PAM nerve terminals. Traces (mean  s.e.m.) of relative fluorescence intensity changes from 2 s before stimulation were graphed. The gray bar indicates 40 Hz electrical stimulations (a set of 15 ms intervals at 5 V and 10 ms duration). When mitochondria are damaged, the peak of cytosolic Ca2+ is expected to become higher, while mitochondrial Ca2+ uptake will be impaired [13, 17]

13. Perform 40-Hz electrical stimulation (5 V with 15-ms duration, 10-ms intervals) for 1 s using an electrical stimulator combined with an isolator (Fig. 3c–f, see Note 5). 14. Analyze the fluorescence intensity of the projection region of the PAM cluster dopaminergic neurons using NIS-Elements software (Fig. 3c–e), ImageJ-Fiji (Fig. 3f), and Excel (Fig. 4, Microsoft) as described below. ΔF peak =F base ¼ ðpeak intensity  base intensityÞ=base intensity:

4

Notes 1. UAS-GCaMP6f (stock #42742) is available from Bloomington Drosophila Stock Center (https://bdsc.indiana.edu). 2. The detachable upside magnet is used to ensure a longitudinal space when the fly is inserted into the flipped fly retainer (Fig. 1b). The upside magnet is removed in the image recording (Fig. 1d, e). 3. Fix the eyes with nail polish to avoid movement of the head during dissection. 4. This step prevents drying of the flies until the nail polish become solidified. 5. Imaging should be started within 10 min after dissection.

Ca2+ imaging in Drosophila Dopaminergic Neurons

213

Acknowledgments This work was supported by Grants-in-Aid for Scientific Research (19K07830 to T.I., and 20H03453 and 20K21531 to Y.I.) from the Japan Society for the Promotion of Science (JSPS). References 1. Marchi S, Patergnani S, Missiroli S, Morciano G, Rimessi A, Wieckowski MR, Giorgi C, Pinton P (2018) Mitochondrial and endoplasmic reticulum calcium homeostasis and cell death. Cell Calcium 69:62–72. https://doi.org/10.1016/j.ceca.2017.05.003 2. Giorgi C, De Stefani D, Bononi A, Rizzuto R, Pinton P (2009) Structural and functional link between the mitochondrial network and the endoplasmic reticulum. Int J Biochem Cell Biol 41(10):1817–1827. https://doi.org/10. 1016/j.biocel.2009.04.010 3. Pinton P, Giorgi C, Siviero R, Zecchini E, Rizzuto R (2008) Calcium and apoptosis: ER-mitochondria Ca2+ transfer in the control of apoptosis. Oncogene 27(50):6407–6418. https://doi.org/10.1038/onc.2008.308 4. Gunter TE, Gunter KK, Sheu SS, Gavin CE (1994) Mitochondrial calcium transport: physiological and pathological relevance. Am J Phys 267(2 Pt 1):C313–C339. https://doi.org/10. 1152/ajpcell.1994.267.2.C313 5. Csordas G, Golenar T, Seifert EL, Kamer KJ, Sancak Y, Perocchi F, Moffat C, Weaver D, de la Fuente Perez S, Bogorad R, Koteliansky V, Adijanto J, Mootha VK, Hajnoczky G (2013) MICU1 controls both the threshold and cooperative activation of the mitochondrial Ca(2) (+) uniporter. Cell Metab 17(6):976–987. https://doi.org/10.1016/j.cmet.2013.04. 020 6. Bernardi P, Petronilli V (1996) The permeability transition pore as a mitochondrial calcium release channel: a critical appraisal. J Bioenerg Biomembr 28(2):131–138. https://doi.org/ 10.1007/BF02110643 7. Rizzuto R, Marchi S, Bonora M, Aguiari P, Bononi A, De Stefani D, Giorgi C, Leo S, Rimessi A, Siviero R, Zecchini E, Pinton P (2009) Ca(2+) transfer from the ER to mitochondria: when, how and why. Biochim Biophys Acta 1787(11):1342–1351. https://doi. org/10.1016/j.bbabio.2009.03.015 8. Guzman JN, Sanchez-Padilla J, Wokosin D, Kondapalli J, Ilijic E, Schumacker PT, Surmeier DJ (2010) Oxidant stress evoked by pacemaking in dopaminergic neurons is attenuated by

DJ-1. Nature 468(7324):696–U119. https:// doi.org/10.1038/nature09536 9. Kang S, Cooper G, Dunne SF, Dusel B, Luan CH, Surmeier DJ, Silverman RB (2012) Ca(V) 1.3-selective L-type calcium channel antagonists as potential new therapeutics for Parkinson’s disease. Nat Commun 3:1146. https:// doi.org/10.1038/ncomms2149 10. Hattori N, Tanaka M, Ozawa T, Mizuno Y (1991) Immunohistochemical studies on complexes I, II, III, and IV of mitochondria in Parkinson’s disease. Ann Neurol 30 (4):563–571. https://doi.org/10.1002/ana. 410300409 11. Imai Y (2020) PINK1-Parkin signaling in Parkinson’s disease: lessons from Drosophila. Neurosci Res 159:40–46. https://doi.org/ 10.1016/j.neures.2020.01.016 12. Nakai J, Ohkura M, Imoto K (2001) A high signal-to-noise Ca2+ probe composed of a single green fluorescent protein. Nat Biotechnol 19(2):137–141. https://doi.org/10.1038/ 84397 13. Imai Y, Inoshita T, Meng H, ShibaFukushima K, Hara KY, Sawamura N, Hattori N (2019) Light-driven activation of mitochondrial proton-motive force improves motor behaviors in a Drosophila model of Parkinson’s disease. Commun Biol 2:424. https://doi. org/10.1038/s42003-019-0674-1 14. Riemensperger T, Issa AR, Pech U, Coulom H, Nguyen MV, Cassar M, Jacquet M, Fiala A, Birman S (2013) A single dopamine pathway underlies progressive locomotor deficits in a Drosophila model of Parkinson disease. Cell Rep 5(4):952–960. https://doi.org/10. 1016/j.celrep.2013.10.032 15. Liu C, Placais PY, Yamagata N, Pfeiffer BD, Aso Y, Friedrich AB, Siwanowicz I, Rubin GM, Preat T, Tanimoto H (2012) A subset of dopamine neurons signals reward for odour memory in Drosophila. Nature 488 (7412):512–516. https://doi.org/10.1038/ nature11304 16. Chen TW, Wardill TJ, Sun Y, Pulver SR, Renninger SL, Baohan A, Schreiter ER, Kerr RA, Orger MB, Jayaraman V, Looger LL,

214

Tsuyoshi Inoshita and Yuzuru Imai

Svoboda K, Kim DS (2013) Ultrasensitive fluorescent proteins for imaging neuronal activity. Nature 499(7458):295–300. https://doi.org/ 10.1038/nature12354 17. Xing X, Wu CF (2018) Unraveling synaptic GCaMP signals: differential excitability and

clearance mechanisms underlying distinct Ca (2+) dynamics in tonic and phasic excitatory, and aminergic modulatory motor terminals in Drosophila. eNeuro 5(1). doi:https://doi. org/10.1523/ENEURO.0362-17.2018

INDEX A

E

A549 cells ..................................................................36, 59 AbScale ................................................142–144, 146, 148 α-synuclein (αSyn) ................................. 3–14, 17, 27–37, 42–45, 47, 48, 119–129, 131–138, 163–173, 186, 195 α-synuclein fibrils ........................... 17–24, 28, 31, 33, 36 Amyloid-like fibrils .......................................................... 19 Anesthesia ............................................................. 135, 136 Antimycin A........................................................ 83, 87, 89 Artificial cerebral spinal fluid (aCSF) .................. 152, 154 ATP ......................................................195, 197, 199, 204 Axonal projections ............................................... 141–150 Axon overextension .................................... 180, 182, 183

Electrical stimulation ..........................151, 157, 208, 212 Electron microscopy ............................................ 4, 19, 33 ELISA ........................................................................42–44 Exosomes...................................................................41–45

B Basal ganglia .................................................................. 132 Blue native PAGE ....................................... 198, 200, 201 Budding yeast, see Saccharomyces cerevisiae

F Frozen section ............................................................... 138

G Gastrointestinal tract..................................................... 120 GBA1 ............................................................................... 48 GCaMP.......................................................................... 208 Globus pallidus interna (GPi) ...................................... 152 Glucocerebrosidase (GCase) ....................................47–51 Glucosylceramide ......................................................47, 48

H High-frequency stimulation (HFS) ........... 154, 156, 159 6-hydroxydoopamine (6-OHDA)..........................95–107

C Ca2+ imaging ........................................................ 209–212 Caenorhabditis elegans ......................................... 175–183 Cathepsins .................................................................63–71 Cell culture ...........................................29, 33, 34, 42, 43, 48–50, 67, 82–86, 88, 90, 97, 100, 101, 142–146, 164, 166, 167, 169, 170, 172, 200 Cerebrospinal fluid (CSF) ............................... 4, 8, 11–13 ChemScale ..................................142, 143, 145, 148, 149 Chloroquine ..............................................................63, 65 Common marmoset, see Marmoset Confocal laser scanning microscope (CLSM) .............. 84, 87, 142, 144, 147, 148, 150, 187–189, 191

D Deep brain stimulation (DBS) ............................ 151–160 Differentiation into dopaminergic neurons ..........................................................88, 90 Dopaminergic neurons .................................8, 53, 73–78, 81–90, 95, 96, 119, 120, 151, 188, 189, 196, 202, 203, 207–213 Drosophila melanogaster.............................. 187, 188, 196

I Immunocytochemistry....................................... 66, 67, 89 Immuno-electron microscopy ........................................ 21 Immunohistochemistry ........................97, 100, 101, 136 Induced pluripotent stem cells (iPSCs) .............. 8, 73–76 Infusion administration .................................98, 101, 102 Intracerebral injection..................................131, 134–136 Intramuscular administration ....................................... 154 Intranigral administration.................................... 102, 107 Intraperitoneal administration...................................... 125

J Japanese monkeys ......................................................... 152 Jump/flight activity analyses ........................................ 198

L Large aspiny neurons .................................................... 159 Lentiviral infection ....................................................83, 86 Live imaging .................................................................. 177 LRK-1 ...........................................................176, 178–183

Yuzuru Imai (ed.), Experimental Models of Parkinson’s Disease, Methods in Molecular Biology, vol. 2322, https://doi.org/10.1007/978-1-0716-1495-2, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2021

215

EXPERIMENTAL MODELS

216 Index

OF

PARKINSON’S DISEASE

LRRK2.................................................. 13, 53–61, 63–71, 74, 175–183, 186, 195 LRRK2 inhibitors GSK2578215A.......................................................... 60 HG-10-102-01 ......................................................... 60 MLi-2...................................................................59, 60 PF-06447475 ......................................................65, 68 Lysosomes .................................... 41, 63, 64, 69, 71, 175 Lysosomotropic agents ................................................... 63

M Macaca fuscata .............................................................. 152 Magnetic resonance imaging (MRI)...........................152, 154–156, 158 Marmosets ............................................................ 131–138 Mechanosensory neurons .................................... 175–183 Medium spiny neurons (MSNs)................................... 159 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)...............................................95–107, 207 Mice ............................................................ 21, 42, 43, 59, 60, 63, 65, 83, 97, 98, 101–103, 105–107, 113, 114, 119–129, 132, 133, 138, 142, 144–146, 148, 187 Mitochondria.....................................................27, 81, 82, 87, 95, 186–190, 197–204, 207, 208, 212 Mitochondrial respiratory complex.......................... v, 208 Mitophagy ............................................................ 186, 204 Monkeys ..............................................105, 152–156, 158 Mouse embryonic fibroblasts (MEFs) ........................... 60

N Negative staining............................................................. 19 Neurospheres......................................... 75–78, 86, 88, 90

O Olfactory bulb .............................................. 28, 119, 120, 125, 126, 128, 129 Oligomycin A ..................................................... 83, 87, 89

P Parkin .......................................... 81–83, 88, 89, 185, 195 pHluorin ........................................................................ 186 Phos-tag........................................................54, 55, 57–61 PINK1 ........................................................ 74, 81, 82, 85, 88, 89, 185, 195, 202 Plasmids ............ 5, 33, 36, 120, 122, 164–166, 168–172 Propagation ................... 3, 4, 28, 33, 119–129, 131–139 Protein purification ............................................ 19, 21, 31 Pulse generator..................................................... 154, 156

Q Quadripolar stimulation electrodes..................... 153, 156

R Rab8...........................................................................63, 64 Rab10 ......................................................... 54, 57, 59–61, 63, 64, 67 Rat................................................. 99, 100, 104, 105, 107 RAW264.7 cells.................................................. 64, 67–70 Reactive oxygen species (ROS) ............................ 95, 196, 197, 200, 203 Real-time quaking-induced conversion (RT-QuIC) ...................................................... 3–14 Recombinant protein ........................................................ 6 Recording-injection system .........................152–155, 158 Rodent primary astrocytes.............................................. 60 Rotenone .................................................................95–107

S Saccharomyces cerevisiae........................................ 163, 168 ScaleS .......................................................... 18, 23, 33, 69, 78, 87, 97–99, 101, 102, 142, 148 Seeds ........................................................... 4, 5, 8–12, 14, 28, 29, 31, 33, 34, 36, 67, 85, 86, 88 Sequential extraction of proteins ................................... 33 SH-SY5Y cells........................................33, 34, 36, 48, 49 Slice culture .......................................................... 111–117 SNCA............................................................................... 41 see α-synuclein (αSyn) Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE)....................... 29, 30, 32, 35, 65, 67, 85, 88 Spot growth assay ................................................ 163–173 Stereotaxic injections .....................................96, 124, 125 Stimulation isolator.............................................. 154, 156 Striatum ................................................ 42, 100–102, 106, 120, 125, 132, 133, 138, 148, 151, 152, 154–157, 159 Subcutaneous administration ....................................... 101 Substantia nigra pars compacta.....................13, 119, 195 Subthalamic nucleus (STN)................................ 151, 152, 154–159 Synaptic activity............................................................. 207 Synaptic vesicle release .................................................. 186

T Thoracic muscle ................................................... 197, 199 Three-dimensional imaging................................. 141, 142 3T3-Swiss albino ............................................................. 60 Tissue clearing ...................................................... 141–150 Toxicity assessment ....................................................... 164 Transfection................................................. 28, 29, 85, 90 Transformation in bacteria .................................................................... 6 in budding yeast ...................................................... 166

EXPERIMENTAL MODELS

OF

PARKINSON’S DISEASE Index 217

U

W

Ubiquitin ................................................. 82, 89, 138, 185

Western blots..................................................... 30, 35–37, 85, 88–90, 124 Wing postures ...................................................... 196, 198

V VMAT-pHluorin ......................................... 186, 189, 191