Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols [1st ed.] 9781071609576, 9781071609583

Table of contents :
Front Matter ....Pages i-xi
Ex Vivo Culture for Preimplantation Mouse Embryo to Analyze Pluripotency (Katia Boutourlinsky, Nicolas Allègre, Claire Chazaud)....Pages 1-10
Microfabricated Device for High-Resolution Imaging of Preimplantation Embryos (Sandrine Vandormael-Pournin, Emmanuel Frachon, Samy Gobaa, Michel Cohen-Tannoudji)....Pages 11-30
In Vitro Culture of Mouse Blastocysts to the Egg Cylinder Stage via Mural Trophectoderm Excision (Hatice O. Ozguldez, Ivan Bedzhov)....Pages 31-40
Spatially Organized Differentiation of Mouse Pluripotent Stem Cells on Micropatterned Surfaces (Sophie M. Morgani, Anna-Katerina Hadjantonakis)....Pages 41-58
Mouse Primordial Germ Cells: In Vitro Culture and Conversion to Pluripotent Stem Cell Lines (Malgorzata Borkowska, Harry G. Leitch)....Pages 59-73
Generation of Primordial Germ Cell-like Cells on Small and Large Scales (Wolfram H. Gruhn, Ufuk Günesdogan)....Pages 75-89
Genome-Scale CRISPR Screening for Regulators of Cell Fate Transitions (Valentina Carlini, Kristjan H. Gretarsson, Jamie A. Hackett)....Pages 91-108
Somatic Reprograming by Nuclear Transfer (Vincent Brochard, Nathalie Beaujean)....Pages 109-123
Targeted Transgenic Mice Using CRISPR/Cas9 Technology (Fatima El Marjou, Colin Jouhanneau, Denis Krndija)....Pages 125-141
Whole-Mount Immunofluorescence Staining of Early Mouse Embryos (Frederick C. K. Wong)....Pages 143-155
Investigating the Inner Cell Mass of the Mouse Blastocyst by Combined Immunofluorescence Staining and RNA Fluorescence In Situ Hybridization (Maud Borensztein)....Pages 157-173
Mapping of Chromosome Territories by 3D-Chromosome Painting During Early Mouse Development (Katia Ancelin, Yusuke Miyanari, Olivier Leroy, Maria-Elena Torres-Padilla, Edith Heard)....Pages 175-187
Deciphering the Early Mouse Embryo Transcriptome by Low-Input RNA-Seq (Raquel Pérez-Palacios, Patricia Fauque, Aurélie Teissandier, Déborah Bourc’his)....Pages 189-205
Studying DNA Methylation Genome-Wide by Bisulfite Sequencing from Low Amounts of DNA in Mammals (Ambre Bender, Hala Al Adhami, Thomas Dahlet, Michael Weber)....Pages 207-220
Profiling DNA Methylation Genome-Wide in Single Cells (António Galvão, Gavin Kelsey)....Pages 221-240
Tracking Histone Modifications in Embryos and Low-Input Samples Using Ultrasensitive STAR ChIP-Seq (Bingjie Zhang, Xu Peng, Feng Xu, Wei Xie)....Pages 241-252
Chromatin Profiling in Mouse Embryonic Germ Cells by CUT&RUN (Srinivasa Abishek Prakash, Joan Barau)....Pages 253-264
DamID to Map Genome-Protein Interactions in Preimplantation Mouse Embryos (Mrinmoy Pal, Jop Kind, Maria-Elena Torres-Padilla)....Pages 265-282
Understanding Chromosome Structure During Early Mouse Development by a Single-Cell Hi-C Analysis (Noémie Ranisavljevic, Maud Borensztein, Katia Ancelin)....Pages 283-293
Bioinformatic Analysis of Single-Cell Hi-C Data from Early Mouse Embryo (Samuel Collombet, Yuvia A. Pérez-Rico, Katia Ancelin, Nicolas Servant, Edith Heard)....Pages 295-316
Back Matter ....Pages 317-318

Citation preview

Methods in Molecular Biology 2214

Katia Ancelin Maud Borensztein Editors

Epigenetic Reprogramming During Mouse Embryogenesis Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences, University of Hertfordshire, Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Epigenetic Reprogramming During Mouse Embryogenesis Methods and Protocols

Edited by

Katia Ancelin Institut Curie, CNRS UMR3215/ INSERM U934, Paris Sciences & Lettres Research University (PSL), Paris, France

Maud Borensztein Institut Curie, CNRS UMR3215/ INSERM U934, Paris Sciences & Lettres Research University (PSL), Paris, France; Institut de Génétique Moléculaire de Montpellier, Univ Montpellier, CNRS, Montpellier, France

Editors Katia Ancelin Institut Curie, CNRS UMR3215/ INSERM U934 Paris Sciences & Lettres Research University (PSL) Paris, France

Maud Borensztein Institut Curie, CNRS UMR3215/ INSERM U934 Paris Sciences & Lettres Research University (PSL) Paris, France Institut de Ge´ne´tique Mole´culaire de Montpellier Univ Montpellier, CNRS Montpellier, France

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-0957-6 ISBN 978-1-0716-0958-3 (eBook) https://doi.org/10.1007/978-1-0716-0958-3 © Springer Science+Business Media, LLC, part of Springer Nature 2021 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface Epigenetic reprogramming is crucial for mammalian development and entails unique changes in the spatial and functional organization of the chromatin landscape. Genomewide reprogramming occurs at specific developmental stages, in the germline and early embryo, and is critical for generating a totipotent/pluripotent state. Altogether, chromatin remodeling is essential for the transmission of information from parent to offspring. The scarcity of early embryos and germ cells and limited access to these materials represent considerable challenges for exploring the diversity of genome-wide chromatin reprogramming events. However, constant technological development has made it increasingly possible to overcome this barrier, thereby leading to major progress, in particular using the mouse model. This book provides an overview of the cutting-edge methods available to understand chromatin reprogramming in embryos and germ cells. Various and robust culture systems are presented which constitute invaluable tools to investigate these developmental processes. In parallel, the advent of CRISPR/Cas9-mediated genome modification and cloning has enabled the identification of new factors involved in reprogramming. Historically, microscopy-based approaches have also revealed the extent of chromatin reprogramming, and we review here different methods for direct examination of DNA, RNA, and proteins in embryos. The book also includes a variety of low-input and single-cell assays for exploring these features at the genome-wide scale. Although optimized for mouse embryos, these protocols can be adapted to other mammalian models and organoids in culture. Ultimately, this volume aims to present a comprehensive overview of the methods available to scientists wishing to make new discoveries in the fascinating field of chromatin reprogramming. Paris, France

Katia Ancelin Maud Borensztein

v

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

1 Ex Vivo Culture for Preimplantation Mouse Embryo to Analyze Pluripotency. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Katia Boutourlinsky, Nicolas Alle`gre, and Claire Chazaud 2 Microfabricated Device for High-Resolution Imaging of Preimplantation Embryos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sandrine Vandormael-Pournin, Emmanuel Frachon, Samy Gobaa, and Michel Cohen-Tannoudji 3 In Vitro Culture of Mouse Blastocysts to the Egg Cylinder Stage via Mural Trophectoderm Excision. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Hatice O. Ozguldez and Ivan Bedzhov 4 Spatially Organized Differentiation of Mouse Pluripotent Stem Cells on Micropatterned Surfaces . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Sophie M. Morgani and Anna-Katerina Hadjantonakis 5 Mouse Primordial Germ Cells: In Vitro Culture and Conversion to Pluripotent Stem Cell Lines. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Malgorzata Borkowska and Harry G. Leitch 6 Generation of Primordial Germ Cell-like Cells on Small and Large Scales . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ¨ nesdogan Wolfram H. Gruhn and Ufuk Gu 7 Genome-Scale CRISPR Screening for Regulators of Cell Fate Transitions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Valentina Carlini, Kristjan H. Gretarsson, and Jamie A. Hackett 8 Somatic Reprograming by Nuclear Transfer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Vincent Brochard and Nathalie Beaujean 9 Targeted Transgenic Mice Using CRISPR/Cas9 Technology . . . . . . . . . . . . . . . . Fatima El Marjou, Colin Jouhanneau, and Denis Krndija 10 Whole-Mount Immunofluorescence Staining of Early Mouse Embryos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Frederick C. K. Wong 11 Investigating the Inner Cell Mass of the Mouse Blastocyst by Combined Immunofluorescence Staining and RNA Fluorescence In Situ Hybridization. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Maud Borensztein 12 Mapping of Chromosome Territories by 3D-Chromosome Painting During Early Mouse Development . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Katia Ancelin, Yusuke Miyanari, Olivier Leroy, Maria-Elena Torres-Padilla, and Edith Heard

vii

v ix

1

11

31

41

59

75

91 109 125

143

157

175

viii

13

14

15 16

17 18

19

20

Contents

Deciphering the Early Mouse Embryo Transcriptome by Low-Input RNA-Seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Raquel Pe´rez-Palacios, Patricia Fauque, Aure´lie Teissandier, and De´borah Bourc’his Studying DNA Methylation Genome-Wide by Bisulfite Sequencing from Low Amounts of DNA in Mammals. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ambre Bender, Hala Al Adhami, Thomas Dahlet, and Michael Weber Profiling DNA Methylation Genome-Wide in Single Cells . . . . . . . . . . . . . . . . . . . ˜ o and Gavin Kelsey Ant
o nio Galva Tracking Histone Modifications in Embryos and Low-Input Samples Using Ultrasensitive STAR ChIP-Seq . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Bingjie Zhang, Xu Peng, Feng Xu, and Wei Xie Chromatin Profiling in Mouse Embryonic Germ Cells by CUT&RUN. . . . . . . . Srinivasa Abishek Prakash and Joan Barau DamID to Map Genome-Protein Interactions in Preimplantation Mouse Embryos . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mrinmoy Pal, Jop Kind, and Maria-Elena Torres-Padilla Understanding Chromosome Structure During Early Mouse Development by a Single-Cell Hi-C Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Noe´mie Ranisavljevic, Maud Borensztein, and Katia Ancelin Bioinformatic Analysis of Single-Cell Hi-C Data from Early Mouse Embryo . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Samuel Collombet, Yuvia A. Pe´rez-Rico, Katia Ancelin, Nicolas Servant, and Edith Heard

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

189

207

221

241 253

265

283

295

317

Contributors HALA AL ADHAMI • CNRS UMR7242, Biotechnology and Cell Signaling, University of Strasbourg, Illkirch Cedex, France NICOLAS ALLE`GRE • Institut GReD, Universite´ Clermont Auvergne, CNRS, Inserm, Clermont-Ferrand, France KATIA ANCELIN • Institut Curie, CNRS UMR3215/ INSERM U934, Paris Sciences & Lettres Research University (PSL), Paris, France JOAN BARAU • Institute of Molecular Biology (IMB), Mainz, Germany NATHALIE BEAUJEAN • Universite´ Paris-Saclay, INRAE, ENVA, BREED U1198, Jouy-enJosas, France; Univ Lyon, Universite´ Lyon 1, Inserm, INRAE, Stem Cell and Brain Research Institute U1208, USC 1361, Bron, France IVAN BEDZHOV • Embryonic Self-Organization Research Group, Max Planck Institute for Molecular Biomedicine, Mu¨nster, Germany AMBRE BENDER • CNRS UMR7242, Biotechnology and Cell Signaling, University of Strasbourg, Illkirch Cedex, France MAUD BORENSZTEIN • Institut Curie, CNRS UMR3215/ INSERM U934, Paris Sciences & Lettres Research University (PSL), Paris, France; Institut de Ge´ne´tique Mole´culaire de Montpellier, Univ Montpellier, CNRS, Montpellier, France MALGORZATA BORKOWSKA • MRC London Institute of Medical Sciences (LMS), London, UK; Institute of Clinical Sciences (ICS), Faculty of Medicine, Imperial College London, London, UK ´ DEBORAH BOURC’HIS • Institut Curie, INSERM U934, CNRS UMR3215, Paris Sciences Lettres Research University, Paris, France KATIA BOUTOURLINSKY • Institut GReD, Universite´ Clermont Auvergne, CNRS, Inserm, Clermont-Ferrand, France VINCENT BROCHARD • Universite´ Paris-Saclay, INRAE, ENVA, BREED U1198, Jouy-enJosas, France VALENTINA CARLINI • Epigenetics and Neurobiology Unit, European Molecular Biology Laboratory (EMBL), Rome, Italy; Collaboration for Joint PhD Degree between EMBL and Heidelberg University, Faculty of Biosciences, Heidelberg, Germany CLAIRE CHAZAUD • Institut GReD, Universite´ Clermont Auvergne, CNRS, Inserm, Clermont-Ferrand, France MICHEL COHEN-TANNOUDJI • Early Mammalian Development and Stem Cell Biology, Institut Pasteur, CNRS UMR 3738, Paris, France SAMUEL COLLOMBET • Institut Curie, CNRS UMR3215/ INSERM U934, Paris Sciences & Lettres Research University (PSL), Paris, France; EMBL, Heidelberg, Germany THOMAS DAHLET • CNRS UMR7242, Biotechnology and Cell Signaling, University of Strasbourg, Illkirch Cedex, France FATIMA EL MARJOU • Cell Migration and Invasion Group, Department of Cell Biology, UMR144, Institut Curie, Paris, France

ix

x

Contributors

PATRICIA FAUQUE • Laboratoire de Biologie de la Reproduction, Hoˆpital Franc¸ois Mitterrand, Universite´ de Bourgogne, Dijon, France; INSERM UMR1231, Universite´ de Bourgogne Franche-Comte´, Dijon, France EMMANUEL FRACHON • Group of Biomaterials and Microfluidics Core Facility, Institut Pasteur, Paris, France ANTO´NIO GALVA˜O • Institute of Animal Reproduction and Food Research of PAS, Olsztyn, Poland; Epigenetics Programme, The Babraham Institute, Cambridge, UK; Centre for Trophoblast Research, University of Cambridge, Cambridge, UK SAMY GOBAA • Group of Biomaterials and Microfluidics Core Facility, Institut Pasteur, Paris, France KRISTJAN H. GRETARSSON • Epigenetics and Neurobiology Unit, European Molecular Biology Laboratory (EMBL), Rome, Italy WOLFRAM H. GRUHN • Wellcome Trust/Cancer Research UK Gurdon Institute, University of Cambridge, Cambridge, UK; Department of Physiology, Development and Neuroscience, University of Cambridge, Cambridge, UK UFUK GU¨NESDOGAN • Department of Developmental Biology, Go¨ttingen Center for Molecular Biosciences, University of Go¨ttingen, Go¨ttingen, Germany; Department of Molecular Developmental Biology, Max Planck Institute for Biophysical Chemistry, Go¨ttingen, Germany JAMIE A. HACKETT • Epigenetics and Neurobiology Unit, European Molecular Biology Laboratory (EMBL), Rome, Italy ANNA-KATERINA HADJANTONAKIS • Developmental Biology Program, Sloan Kettering Institute, Memorial Sloan Kettering Cancer Center, New York, NY, USA EDITH HEARD • EMBL, Heidelberg, Germany; Institut Curie, CNRS UMR3215/ INSERM U934, Paris Sciences & Lettres Research University (PSL), Paris, France COLIN JOUHANNEAU • Institut Curie Plateforme d’Expe´rimentation In Vivo, Universite´ Paris-Sud 11, Orsay, France GAVIN KELSEY • Epigenetics Programme, The Babraham Institute, Cambridge, UK; Centre for Trophoblast Research, University of Cambridge, Cambridge, UK JOP KIND • Oncode Institute, Hubrecht Institute–KNAW and University Medical Center Utrecht, Utrecht, The Netherlands DENIS KRNDIJA • Cell Migration and Invasion Group, Department of Cell Biology, UMR144, Institut Curie, Paris, France HARRY G. LEITCH • MRC London Institute of Medical Sciences (LMS), London, UK; Institute of Clinical Sciences (ICS), Faculty of Medicine, Imperial College London, London, UK OLIVIER LEROY • Institut Curie, CNRS UMR3215/ INSERM U934, Paris Sciences & Lettres Research University (PSL), Paris, France YUSUKE MIYANARI • Division of Nuclear Dynamics, Exploratory Research Center on Life and Living Systems: ExCELLS National Institute for Basic Biology, Okazaki, Japan SOPHIE M. MORGANI • Developmental Biology Program, Sloan Kettering Institute, Memorial Sloan Kettering Cancer Center, New York, NY, USA; Wellcome-MRC Cambridge Stem Cell Institute, University of Cambridge, Cambridge, UK HATICE O. OZGULDEZ • Embryonic Self-Organization Research Group, Max Planck Institute for Molecular Biomedicine, Mu¨nster, Germany MRINMOY PAL • Institute of Epigenetics and Stem Cells (IES), Helmholtz Zentrum Mu¨nchen, Munich, Germany

Contributors

xi

XU PENG • Institute of Molecular and Cell Biology, Agency for Science, Technology and Research (A*STAR), Singapore, Singapore RAQUEL PE´REZ-PALACIOS • Institut Curie, INSERM U934, CNRS UMR3215, Paris Sciences Lettres Research University, Paris, France YUVIA A. PE´REZ-RICO • EMBL, Heidelberg, Germany SRINIVASA ABISHEK PRAKASH • Institute of Molecular Biology (IMB), Mainz, Germany NOE´MIE RANISAVLJEVIC • Institut Curie, CNRS UMR3215/ INSERM U934, Paris Sciences & Lettres Research University (PSL), Paris, France; Department of Reproductive Medicine, CHU and University of Montpellier, Montpellier Cedex 5, France NICOLAS SERVANT • Institut Curie, INSERM U900, Mines ParisTech, Paris Sciences & Lettres Research University (PSL), Paris, France AURE´LIE TEISSANDIER • Institut Curie, INSERM U934, CNRS UMR3215, Paris Sciences Lettres Research University, Paris, France MARIA-ELENA TORRES-PADILLA • Institute of Epigenetics and Stem Cells (IES), Helmholtz Zentrum Mu¨nchen, Munich, Germany; Faculty of Biology, Ludwig-Maximilians Universit€ at, Munich, Germany SANDRINE VANDORMAEL-POURNIN • Early Mammalian Development and Stem Cell Biology, Institut Pasteur, CNRS UMR 3738, Paris, France MICHAEL WEBER • CNRS UMR7242, Biotechnology and Cell Signaling, University of Strasbourg, Illkirch Cedex, France FREDERICK C. K. WONG • Wellcome Trust/Cancer Research UK Gurdon Institute, University of Cambridge, Cambridge, UK WEI XIE • Center for Stem Cell Biology and Regenerative Medicine, MOE Key Laboratory of Bioinformatics, THU-PKU Center for Life Sciences, School of Life Sciences, Tsinghua University, Beijing, China FENG XU • Institute of Molecular and Cell Biology, Agency for Science, Technology and Research (A*STAR), Singapore, Singapore BINGJIE ZHANG • Center for Stem Cell Biology and Regenerative Medicine, MOE Key Laboratory of Bioinformatics, THU-PKU Center for Life Sciences, School of Life Sciences, Tsinghua University, Beijing, China

Chapter 1 Ex Vivo Culture for Preimplantation Mouse Embryo to Analyze Pluripotency Katia Boutourlinsky, Nicolas Alle`gre, and Claire Chazaud Abstract A couple of days after fertilization of a mouse oocyte by a sperm, two sequential cell differentiation events segregate pluripotent cells that can be identified by the presence of specific markers. Early mammalian embryos are relatively easy to recover as they are not yet implanted in the uterus matrix. Several decades of experimentation have enabled to find appropriate media to culture them, and therefore provide an excellent way to test different experimental setups such as the use of signaling inhibitors. We provide here a commonly used protocol to culture preimplantation embryos as well as a method to detect pluripotent cells in blastocysts. Key words Blastocyst, Immunofluorescence, Epiblast, Primitive endoderm, Trophectoderm

1

Introduction Mammalian preimplantation development has received a lot of attention in the last decades. As the onset of a new organism, it has been shown to pass through critical and/or unique steps of development such as embryonic genome activation, epigenetic remodeling, and the first cell lineages differentiation. Early mammalian embryos have been the source of technological developments with the production of transgenic mouse lines, the isolation of embryonic stem (ES) cells that enabled the production of hundreds of knockout mice, and are now studied for stem cell therapies. Before their implantation in the uterus, mammalian embryos can be easily collected and cultured. The first embryo cultures were reported in the 1950s [1], and rapidly validated by a successful development after embryo transfer into surrogate females [2]. Since then, several modifications were brought in media composition, taking into account energy source and amino acids requirements as well as pH and osmolarity changes in order to

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021

1

2

Katia Boutourlinsky et al.

improve the quality of cultures [3]. As such, pyruvate is first needed after fertilization, then lactate from the two-cell stage onward, and finally glucose can support embryo development after compaction. Further optimization led to the KSOM medium [4] enabling to overcome the two-cell block observed with several mouse strains, which was improved by adding nonessential and essential amino acids (AA) [3, 5]. The KSOM+AA is widely used for developing mouse preimplantation embryos, and indeed comparing their transcriptome shows that they are close to freshly collected embryos [6]. Other media have been developed, essentially for human ART (assisted reproductive technologies), with various compositions (sometimes not completely disclosed) [7–9]. For practical reasons, mouse embryos are generally cultured with atmospheric oxygen tension that is around 20%. However, it is thought that the female reproductive tract is hypoxic (around 3–5%) [10], and a high oxygen tension can create reactive oxygen species (ROS) that can alter embryo development. When culturing in a 20% oxygen atmosphere, inclusion of the chelator EDTA improves blastocyst development; however, with a lower cell number compared to a 5% atmosphere [11]. Correlated to embryonic growth, there is an impact of oxygen concentration on the transcriptome of cultured embryos [12]. In mice, three cell lineages are segregated before implantation, in two sequential steps: first the inner cell mass (ICM) and the trophectoderm (TE) segregate, followed by differentiation of the ICM into epiblast (Epi) and primitive endoderm (PE) cells during the blastocyst formation [13]. These two cell types originate from common ICM precursors that differentiate asynchronously between embryonic day (E)3.25 and E3.75. Cell specification occurs in an apparent random manner, characterized by a “salt and pepper” pattern [14, 15]. From E3.75–4.0, Epi and PE cells sort to constitute two separated tissues. While TE and PE are essentially extraembryonic tissues, Epi cells are producing all the cells of the future individual and are therefore pluripotent. They are the source of ES cells, with whom they share many characteristics at E4.5 [16]. Variation of the culture medium composition is known to affect the balance in cell lineage distribution. Similarly culture conditions have an impact on ES cell state and differentiation abilities [17] and thus may have an effect on epiblast differentiation. Moreover, culturing Tead4
/
embryos in 5% oxygen tension rescues trophectoderm formation compared to a 20% atmosphere [18], demonstrating that ROS can have an effect on cell lineage differentiation. Thus, in the blastocyst four cell types can be found at the same time: outside TE cells, ICM precursor cells, PE, and Epi cells. As Epi and PE cells are intermingled and the differentiation is asynchronous, it is difficult to distinguish between ICM (precursors), PE, and Epi states before cell sorting. In situ, the most reliable

Preimplantation Embryo Culture

3

method is to examine by immunofluorescence the relative levels of the transcription factors NANOG and GATA6. The NANOG/ GATA6 level ratio is high in Epi cells and low in PE cells, whereas in ICM state cells have relatively equal levels of NANOG and GATA6 [19, 20]. Other markers such as SOX2 (Epi), SOX17, GATA4 or PDGFRα (PE) can be used only after E3.75 as their expression is initiated or is specifically restricted at later time points [15, 21, 22]. Around E4.5, NANOG levels decrease [23], it is thus advised to use another marker such as SOX2 to identify the pluripotent Epi cells. Alternatively, individual cells can be characterized by single-cell RNA analyses [24–26]. During blastocyst formation, the pluripotent Epi cells can be identified by the high Nanog/Gata6 RNA levels ratio, and also by expression of Fgf4 and higher RNA levels of Tdgf1, Klf2, Klf4, Prdm14 compared to PrE cells [27, 28]. We provide here a method to recover and culture preimplantation embryos, as well as a protocol to detect the pluripotent Epi cells by immunofluorescence when they appear during blastocyst formation (E3.25 - E4.0).

2

Materials 1. Stereomicroscope. 2. Incubator: regular cell/tissue culture incubator (37  C, 5% CO2). 3. Three-dimensional rotating, rocking mixer. 4. Fine stainless steel forceps (similar to Adson forceps). 5. Fine stainless steel scissors sharp blunt. 6. Burner. 7. 1 Phosphate buffer saline (PBS). 8. Triton 100. 9. 70% ethanol. 10. M2 culture medium (embryo tested) (94.66 mM NaCl, 4.78 mM KCl, 1.71 mM CaCl2.2H2O, 1.19 mM KH2PO4, 1.19 mM MgSO4.7H2O, 4.15 mM NaHCO3, 20.85 mM HEPES, 23.28 mM Sodium lactate, 0.33 mM Sodium pyruvate, 5.56 mM glucose, 4 g/l BSA) (see Note 1). 11. KSOM+AA culture medium (embryo tested) supplemented with amino acids (95 mM NaCl, 2.5 mM KCl, 0.35 mM KH2PO4, 0.20 mM MgSO4.7H2O, 10.0 mM Sodium Lactate, 0.3 mM Sodium Pyruvate, 2.8 mM Glucose, 25 mM NaHCO3, 1.71 mM CaCl2, 1.0 mM Glutamine, 0.01 mM EDTA, 0.5 mM Non essential amino acids, 0.5 mM Essential amino acids, 100 IU/ml Penicillin G, 0.5 g/ml Streptomycin sulphate, 5.0 mg/ml BSA) (see Note 2).

4

Katia Boutourlinsky et al.

a

b

fat pad oviduct

forceps ovary

1 ml syringe

oviduct

mesometrium infundibulum

forceps

flushing medium uterine horn cervix

bacterial Petri dish

c

Fig. 1 Schematic representation for flushing preimplantation mouse embryos. (a) After opening the abdomen, uncover the uterine horn-oviduct-ovary on one side. Cut (dashed lines) to recover either the oviduct or the uterine horn. Proceed to the other side. (b) To flush the oviduct, locate the infundibulum (naturally lose opening). Use the forceps to introduce the needle. Maintain the needle with the forceps while flushing. (c) Mouth pipette setup. A latex aspirator tube is connected with a mouth piece (or a cut syringe barrel) on one side and a 1 ml micropipette tip on the other side, which is the holder of the pulled Pasteur pipette

12. Aspirator tube assembly (see Fig. 1c) (see Note 3). 13. 30G needles. 14. 26G needles. 15. Bacterial Petri dishes. 16. Foetal bovine serum. 17. Mineral oil, embryo tested. 18. 4-well plates. 19. 35 mm tissue culture dishes. 20. Pasteur pipettes (see Note 4). 21. 32% Paraformaldehyde. 22. 35 mm Petri dishes (nonadherent are preferable). 23. Terasaki microwell plate (60 conical wells of 10 μl each). 24. μ-Slide 18 well—Flat slides (slides with glass or confocalcompatible plastic bottom). 25. Primary antibodies (see Table 1).

Preimplantation Embryo Culture

5

Table 1 Primary antibodies used Epitope

Host

Supplier

Reference

Dilution

CDX2

Mouse

Abcam

Ab86949

1/1

GATA6

Goat

R&D

AF1700

1/300

NANOG

Rabbit

Abcam

Ab80892

1/100

26. Secondary antibodies directed against the different hosts of the primary antibodies, coupled with different fluorophores compatible with the confocal microscope setup. 27. DAPI (40 ,6-diamidino-2-phenylindole) DNA dye. 28. PBT: 0.1% (vol/vol) Triton X-100 in 1 PBS 1. 29. PBT-0.5%: 0.5% (vol/vol) Triton X-100 in 1 PBS (see Note 5). 30. Confocal microscope.

3

Methods From the 2- to the 16-cell stage, embryos are recovered by flushing the oviducts. From the 32-cell to blastocyst stage, embryos are collected from the uterine horns. When embryos are collected for culture, flush with M2 medium. If embryos are directly processed for analysis, they can be flushed with PBS. All manipulations are carried out under a stereomicroscope.

3.1 Dissection and Recovery of Embryos from the Oviduct

1. After euthanasia, soak the abdomen with 70% ethanol. Using forceps and scissors make a large incision through skin, muscles, and peritoneum of the abdomen, enabling to see the whole intestine. Push the gut away to uncover the two uterus horns, oviducts, and ovaries underneath. 2. To collect the oviduct, hold the uterus horn close to the oviduct with forceps. With fine scissors cut the uterus horn and then between the ovary and the oviduct (see Fig. 1a). Collect the oviduct in a bacterial Petri dish. The oviduct can remain without buffer for around 15 min. 3. Place the oviduct in a drop of M2 medium (see Note 1). 4. Fill a 1 ml syringe with M2 and adjust a 30 G needle, making sure there are no air bubbles left. The needle can be blunted with robust scissors to avoid piercing the oviduct, however it is more difficult to introduce into the infundibulum. 5. Locate the infundibulum (opened extremity of the oviduct) within the loops of the oviduct. With the help of forceps, introduce the needle into the infundibulum (see Fig. 1b).

6

Katia Boutourlinsky et al.

Maintain the needle inside with the forceps and flush around 0.1 ml of M2. The oviduct should swell, and the flush should exit from the uterine horn side. 6. Remove the oviduct and collect the embryos using a mouth pipette (see Note3) and a pulled Pasteur pipette (see Note 4) and transfer them into a clean M2 drop (around 50 μl). Embryos are washed twice in drops of clean M2. 3.2 Uterine Horn Flush

1. Using forceps and fine scissors, cut each uterine horn at the cervix and oviduct extremities (see Fig. 1a). It is better to trim away the mesometrium and the fat beforehand with the scissors. Place the horns in a bacterial Petri dish. The horns can remain without buffer for around 15 min. 2. Place individual horns in a drop of M2 medium. 3. Fill a 1 ml syringe with M2 and adjust a 26G needle, making sure there are no air bubbles left. 4. With the help of forceps, insert the needle into one extremity of the horn. Maintain the needle inside with the forceps and flush 0.2–0.3 ml. 5. Remove the horn and collect the embryos using a pulled Pasteur pipette. Transfer them into a clean M2 drop (around 50 μl). Embryos are washed twice in drops of clean M2.

3.3

Embryo Culture

Culturing mouse embryos in groups is beneficial compared to individual cultures probably due to unknown paracrine factors [3, 29]. Embryos can be cultured in drops covered by mineral oil or in open culture systems such as 4-well plates [3]. Murine embryos are susceptible to temperature and pH variations, thus a minimum of time in manipulating embryos is beneficial. Embryos can be cultured in a classic incubator at 37  C, 5% CO2. 1. Rinse rapidly the embryos in two drops of culture medium and place them in 400–500 μl of medium in a 4-well plate. Alternatively, embryos can be cultured in 10 μl medium drops (about 10 embryos per drop) covered by 2 ml of mineral oil in a 35 mm tissue culture dish. 2. Incubate for the desired time. Staging can be appreciated with the morphology (compaction, cavity size, hatching...). In a successful culture there are very small or no delays compared to freshly collected embryos.

3.4 Characterization of Cell Types to Identify Pluripotent Cells In Situ by Immunofluorescence

To identify the pluripotent epiblast cells, we use antibodies directed against NANOG and GATA6, as well as CDX2. Indeed, there can be TE cells that still express NANOG, leading to misinterpretation. Thus, it is strongly advised to examine a TE marker such as CDX2 to clearly identify TE versus ICM cells. A nuclear dye can be used for visualization of all the cells and for fluorescence normalization.

Preimplantation Embryo Culture

7

Unless otherwise indicated, experiments are carried out at room temperature (RT) in 4-well plates with 0.5 ml of solution and under gentle agitation. At each step, embryos are either transferred into the next solution with a pulled Pasteur pipette, or the solution can be replaced in the same well, paying attention to the embryos. 1. After flushing or embryo culture, transfer embryos with pulled Pasteur pipette into a 4-well plate containing the fixation solution (4% PFA, see Note 6). Fix embryos for 10 min at RT to overnight at 4  C (this can depend on your epitope). 2. Wash the embryos in PBT (see Note 5) twice for 5 min. For long-term storage, embryos can be dehydrated (see Note 7). 3. Permeabilize with PBT-0.5% (see Note 5) for 5 min. 4. Block antibody- unspecific sites by incubating with blocking solution (10% FBS in PBT) for 15 min. 5. Incubate with primary antibodies diluted in blocking solution, overnight at 4  C (see Note 8). 6. Wash embryos once for 5 min and twice for 25 min in PBT. 7. Incubate with secondary antibodies and with the DNA dye diluted in blocking solution (Dapi 0.1 μg/ml) for 1 h. From this step on, to avoid fluorescence decay, embryos are protected from the light (in a dark chamber or cover with aluminum foil). 8. Wash twice for 5 min in PBT. 9. Transfer embryos into a confocal-compatible slide and scan embryos at the confocal microscope (see Note 9). 10. Analyze markers labeling. An example of interpretation is given in Fig. 2.

4

Notes 1. M2 is a working medium buffered with HEPES. It can be aliquoted and kept at
20  C for several months. Once thawed, keep at +4  C and use within 3 days. 2. KSOM+AA medium is aliquoted and kept frozen at
20  C for several months. Once thawed keep at +4  C and use within 2 days. The KSOM culture medium needs to be equilibrated to allow temperature and gas equilibration for a minimum of 2 h before starting embryo culture. Make holes in the tube cap for gas exchange and place aliquots directly into the incubator. 3. A mouth pipette (see Fig. 1c) is composed of an aspirator tube in latex (3 mm  5 mm in diameter, ~50 cm long), a mouth piece, a pulled Pasteur pipette and a pipette holder (1000 μl tip). The mouth piece can be home-made by cutting the

8

Katia Boutourlinsky et al.

Fig. 2 Labeling of NANOG, GATA6, and CDX2 by immunofluorescence coupled with nuclear staining by Dapi. The image shows a single Z plane through a E3.75 embryo. The bottom right panel depicts the interpretation of the cell identities: Epi (pluripotent) cells are labeled by NANOG (green), PrE cells are labeled by GATA6 (red), ICM precursor (pluripotent) cells are labeled by both NANOG and GATA6 (yellow), TE cells are labeled by CDX2 (blue). This section displayed cells in mitosis (purple) not attributed to any lineage with these markers. In gray, there is a weak labeling with Dapi, indicating that it will be necessary to change Z plane to correctly identify this cell

extremity of the barrel of a 1 ml syringe. Pieces are assembled as in Fig. 1c. 4. Disposable glass Pasteur pipettes are used to transfer embryos. Their narrow part is pulled on a flame and a blunt tip is broken up by applying a twist on the flexible and tapered end of the Pasteur pipette. The break must be blunt to prevent damaging the embryos. To avoid embryo sticking to the walls of the pipette, we coat the Pasteur pipette with FBS. Pneumatic pressure is adjusted by picking a few air bubbles alternated with the medium used. 5. PBT (0.1% (vol/vol) Triton X-100 in PBS 1) and PBT-0.5% (0.5% (vol/vol) Triton X-100 in PBS 1) can be stored at RT for several months. Washes can also be performed with Tween20 at the same dilution instead of Triton X-100.

Preimplantation Embryo Culture

9

6. 4% PFA in PBS 1. Aliquots are kept at
20  C for several months. Once thawed, 4% PFA can be kept at +4  C for 1 week. When transferring embryos into PFA, they tend to move to the surface, due to the difference in solution composition, where they could be damaged. This can be prevented by making swirls with the pipette to maintain embryos down. 7. For long-term storage, embryos can be dehydrated in increasing concentrations of ethanol in PBT (25%, 50% and 75% ethanol (vol/vol) and twice in ethanol 100%) 5 min each and stored at
20  C in four-well plate with parafilm. Caution to prevent full evaporation when stored for several weeks. When needed, embryos are rehydrated in decreasing concentrations of ethanol in PBT (75%, 50% and 25% ethanol (vol/vol)) and twice in PBT, 5 min each. This freezing step can damage some epitopes. The antibodies we report here are working after a dehydration step. Many epitopes are not perturbed by this treatment; however, this should be tested and validated for each primary antibody. 8. In order to use smaller amounts of antibodies, we carry out incubations in 10 μl in terasaki microwell plates (humidified with a wet pad). 9. We generally scan embryos in PBT in confocal-compatible microwell plates (maximum 100 μm thick bottom). This allows to easily recover embryos for genotyping by PCR after imaging. References 1. Whitten WK (1956) Culture of tubal mouse ova. Nature 177:96. https://doi.org/10. 1038/177096a0 2. McLAREN A, Biggers JD (1958) Successful development and birth of mice cultivated in vitro as early as early embryos. Nature 182:877–878. https://doi.org/10.1038/ 182877a0 3. Nagy A (2003) Manipulating the mouse embryo: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor 4. Lawitts JA, Biggers JD (1993) Culture of preimplantation embryos. Meth Enzymol 225:153–164. https://doi.org/10.1016/ 0076-6879(93)25012-q 5. Ho Y, Wigglesworth K, Eppig JJ, Schultz RM (1995) Preimplantation development of mouse embryos in KSOM: augmentation by amino acids and analysis of gene expression. Mol Reprod Dev 41:232–238. https://doi. org/10.1002/mrd.1080410214

6. Rinaudo P, Schultz RM (2004) Effects of embryo culture on global pattern of gene expression in preimplantation mouse embryos. Reproduction 128:301–311. https://doi.org/ 10.1530/rep.1.00297 7. Morbeck DE, Krisher RL, Herrick JR et al (2014) Composition of commercial media used for human embryo culture. Fertil Steril 102:759–766.e9. https://doi.org/10.1016/j. fertnstert.2014.05.043 8. Morbeck DE, Baumann NA, Oglesbee D (2017) Composition of single-step media used for human embryo culture. Fertil Steril 107:1055–1060.e1. https://doi.org/10. 1016/j.fertnstert.2017.01.007 9. Biggers JD, Summers MC (2008) Choosing a culture medium: making informed choices. Fertil Steril 90:473–483. https://doi.org/10. 1016/j.fertnstert.2008.08.010 10. Fischer B, Bavister BD (1993) Oxygen tension in the oviduct and uterus of rhesus monkeys, hamsters and rabbits. Reproduction

10

Katia Boutourlinsky et al.

99:673–679. https://doi.org/10.1530/jrf.0. 0990673 11. Orsi NM, Leese HJ (2001) Protection against reactive oxygen species during mouse preimplantation embryo development: role of EDTA, oxygen tension, catalase, superoxide dismutase and pyruvate. Mol Reprod Dev 59:44–53. https://doi.org/10.1002/mrd. 1006 12. Feuer S, Liu X, Donjacour A et al (2016) Transcriptional signatures throughout development: the effects of mouse embryo manipulation in vitro. Reproduction 153:107. https://doi.org/10.1530/REP-16-0473 13. Rossant J (2018) Genetic control of early cell lineages in the mammalian embryo. Annu Rev Genet 52:185–201. https://doi.org/10. 1146/annurev-genet-120116-024544 14. Chazaud C, Yamanaka Y, Pawson T, Rossant J (2006) Early lineage segregation between epiblast and primitive endoderm in mouse blastocysts through the Grb2-MAPK pathway. Dev Cell 10:615–624. https://doi.org/10.1016/j. devcel.2006.02.020 15. Plusa B, Piliszek A, Frankenberg S et al (2008) Distinct sequential cell behaviours direct primitive endoderm formation in the mouse blastocyst. Development 135:3081–3091. https:// doi.org/10.1242/dev.021519 16. Boroviak T, Loos R, Bertone P et al (2014) The ability of inner cell mass cells to selfrenew as embryonic stem cells is acquired upon epiblast specification. Nat Cell Biol 16:516–528. https://doi.org/10.1038/ ncb2965 17. Harvey AJ, Rathjen J, Gardner DK (2016) Metaboloepigenetic regulation of pluripotent stem cells. Stem Cells Int 2016:1816525. https://doi.org/10.1155/2016/1816525 18. Kaneko KJ, DePamphilis ML (2013) TEAD4 establishes the energy homeostasis essential for blastocoel formation. Development 140:3680–3690. https://doi.org/10.1242/ dev.093799 19. Saiz N, Williams KM, Seshan VE, Hadjantonakis A-K (2016) Asynchronous fate decisions by single cells collectively ensure consistent lineage composition in the mouse blastocyst. Nat Commun 7:13463. https://doi.org/10. 1038/ncomms13463 20. Bessonnard S, De Mot L, Gonze D et al (2014) Gata6, Nanog and Erk signaling control cell

fate in the inner cell mass through a tristable regulatory network. Development 141:3637–3648. https://doi.org/10.1242/ dev.109678 21. Yamanaka Y, Lanner F, Rossant J (2010) FGF signal-dependent segregation of primitive endoderm and epiblast in the mouse blastocyst. Development 137:715–724. https://doi.org/ 10.1242/dev.043471 22. Artus J, Piliszek A, Hadjantonakis A-K (2011) The primitive endoderm lineage of the mouse blastocyst: sequential transcription factor activation and regulation of differentiation by Sox17. Dev Biol 350:393–404. https://doi. org/10.1016/j.ydbio.2010.12.007 23. Chambers I, Colby D, Robertson M et al (2003) Functional expression cloning of Nanog, a pluripotency sustaining factor in embryonic stem cells. Cell 113:643–655. https://doi.org/10.1016/s0092-8674(03) 00392-1 24. Tang F, Barbacioru C, Wang Y et al (2009) mRNA-Seq whole-transcriptome analysis of a single cell. Nat Methods 6:377–382. https:// doi.org/10.1038/nmeth.1315 25. Deng Q, Ramsko¨ld D, Reinius B, Sandberg R (2014) Single-cell RNA-Seq reveals dynamic, random Monoallelic gene expression in mammalian cells. Science 343:193–196. https:// doi.org/10.1126/science.1245316 26. Posfai E, Petropoulos S, de Barros FRO et al (2017) Position- and hippo signalingdependent plasticity during lineage segregation in the early mouse embryo. eLife 6:e22906. https://doi.org/10.7554/eLife.22906 27. Alle`gre N, Chauveau S, Dennis C et al (2019) A Nanog-dependent gene cluster initiates the specification of the pluripotent epiblast. bioRxiv 707679. https://doi.org/10.1101/ 707679 28. Ohnishi Y, Huber W, Tsumura A et al (2014) Cell-to-cell expression variability followed by signal reinforcement progressively segregates early mouse lineages. Nat Cell Biol 16:27–37. https://doi.org/10.1038/ncb2881 29. Kelley RL, Gardner DK (2019) Individual culture and atmospheric oxygen during culture affect mouse preimplantation embryo metabolism and post-implantation development. Reprod Biomed Online 39:3–18. https://doi. org/10.1016/j.rbmo.2019.03.102

Chapter 2 Microfabricated Device for High-Resolution Imaging of Preimplantation Embryos Sandrine Vandormael-Pournin, Emmanuel Frachon, Samy Gobaa, and Michel Cohen-Tannoudji Abstract The mouse preimplantation embryo is an excellent system for studying how mammalian cells organize dynamically into increasingly complex structures. Accessible to experimental and genetic manipulations, its normal or perturbed development can be scrutinized ex vivo by real-time imaging from fertilization to late blastocyst stage. High-resolution imaging of multiple embryos at the same time can be compromised by embryos displacement during imaging. We have developed an inexpensive and easy-to-produce imaging device that facilitates greatly the imaging of preimplantation embryo. In this chapter, we describe the different steps of production and storage of the imaging device as well as its use for live imaging of mouse preimplantation embryos expressing fluorescent reporters from genetically modified alleles or after in vitro transcribed mRNA transfer by microinjection or electroporation. Key words Mouse embryo, Confocal microscopy, Live imaging, Transgenic, Fluorescent reporter, RNA microinjection, RNA electroporation, Photolithography, Soft-Lithography, Microfabricated cell culture devices

1

Introduction From the very beginning, time-lapse image recording has provided invaluable knowledge on the dynamic nature of embryo development [1–3]. In mammals, unlike many other organisms, embryos develop within the female genital tract. Finding media and culture conditions allowing its continuous observation ex vivo has been very difficult and live imaging of mammalian embryo is limited to the preimplantation period as well as the first few days following implantation [4–6]. In the early days of mammalian embryology studies, rabbit preimplantation embryos turned out to be most suitable for experimental manipulation and tolerant to

Sandrine Vandormael-Pournin and Emmanuel Frachon contributed equally to this work. Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_2, © Springer Science+Business Media, LLC, part of Springer Nature 2021

11

12

Sandrine Vandormael-Pournin et al.

contemporary culture conditions. Accordingly, accurate description of the different stages of preimplantation development [7], embryo transfer to a foster mother [7], or cinemicrography of cleavage embryos cultured for several days [8] were first reported for rabbits. In the second half of the twentieth century, progress in reproductive physiology and controlled culture techniques for preimplantation-stage embryos combined with the power of mouse genetics have changed the game, and today most of our current understanding of mammalian preimplantation development has been generated in mice. Live imaging is an essential technology for studying the complex and dynamic behaviors of cells and biological molecules in living embryos. Development of genetically encoded fluorescent proteins [9, 10] and emergence of sophisticated microscopy techniques [11] have revolutionized the field bringing it to deeper and faster embryo imaging with unprecedented details and spatiotemporal resolution. Live imaging has been decisive for all aspects of preimplantation development including the analysis of cell cycle [12] and cell death [13] dynamics, the study of first embryonic lineages segregation through tracking cell position and polarity [14–18] or using lineage specific fluorescent reporter [19, 20], the determination of transcription factor DNA binding kinetics [21], and the highlighting of the morphogenetic contributions of cellular, mechanical, and molecular cues during compaction [22, 23] and cavitation [24, 25]. Imaging multiple preimplantation embryos at the same time at high resolution for long periods can be challenging. Vibrations and movements in the culture medium generally cause the embryos to drift out from the field of view, making it impossible to analyze the corresponding data. Post-imaging analyses can also be compromised by displacement and mixing of the embryos during recovery of the samples from the imaging station. Researchers have used different strategies to try to limit these movements. Hence, embryo containment during imaging can be achieved through embedding into alginate gels [26] or dense packing into small drops of medium [12, 27]. Embryos can also be immobilized with relatively simple devices such as hand-pulled thin glass filaments [16] or small pieces of a polyester mesh [28] or more sophisticated ones such as manufactured multiwell glass chip [29]. To facilitate preimplantation embryo live-imaging experiments, we developed an imaging device, which we called the mouse eggbox. We used a photolithography-based microfabrication process to generate customized microwell arrays in polydimethylsiloxane (PDMS) that allows imaging of multiple embryos in parallel. PDMS is an inert and optically clear silicon-based organic polymer compatible with embryo culture and imaging (see Figs. 1 and 2). Mounted on a glass bottom dish, the mouse eggbox facilitates live imaging of tens of

Customized Device for Preimplantation Embryos Live Imaging

13

embryos at the same time with an inverted microscope equipped with motorized scanning stage. It also secures the retrieval of all embryos after imaging when further analyses (genotyping, fixation and staining, transfer to a foster mother, omics analysis, . . . .) are to be performed. When imaging fixed embryos, it considerably reduces the time spent in front of the microscope by allowing the use of automatic acquisition at defined positions corresponding to the microwells of the device. The mouse eggbox is inexpensive, easy to produce, and incubation chambers can be prepared in advance and stored for several months. The design of the microwells has been optimized to accommodate mouse oocytes and embryos from zygote to hatching blastocyst stage, but it can be easily modified to fit other small nonadherent samples such as organoids or embryos from other species.

2

Materials

2.1 Customized Chip Microfabrication

1. 2D vector-based drawing software such as Clewin layout editor (e.g. WieWeb software). 2. Photomask on thin sheet of UV-transparent polyester plastic (180
240
0.175 mm). Drawings at 50800 dpi. 3. 5
5-in. glass plate (generic amorphous silica). 4. Any mask Aligner or other controlled insolation device. We used an MJB4 mask aligner from Su¨ss. 5. Spincoater for the photoresist that accepts 4-in. silicon wafers. 6. Hotplate capable of homogenously delivering 65  C and 95  C onto a 4-in. wafer with automatic ramping. 7. Negative photoresist. We used SU8-2100 from Microchem. 8. Siliconizing reagent for glass and other surfaces. We used both Trichlorosilane and Sigmacote. 9. Mirror-polished 5-in. 525-μm thick silicon wafers. 10. Generic balance. 11. Polydimethylsiloxane (PDMS) base elastomer and curing agent. 12. Vacuum pump and bell for degassing PDMS. 13. O2 Plasma treatment oven. We used the Femto cute system from Femto Science. 14. Iso 5 horizontal flow hood. 15. Magic scotch tape (3 M). 16. Any 35 mm glass bottom dishes with a No. 1.5 coverslip insert of 20 mm in diameter.

14

Sandrine Vandormael-Pournin et al.

17. Generic UV/Ozone sterilization device. We used the UVO device from Jelight. 18. Propylene glycol monomethyl ether acetate or PGMEA. 19. Orbital shaker. 20. Standard aluminum sheets. 21. Dumont 55 tweezers. 22. Any generic stereomicroscope for the quality control of the produced devices. 2.2 mRNA Preparation

1. Taq DNA polymerase with high fidelity and good performance for long fragment DNA synthesis. We used LA taq DNA Polymerase from TaKaRa. 2. Ultrafiltration device for purification, concentration, and desalting of macromolecules. We use Amicon Ultra Centifugal Filter Units 50 kDa. 3. Kit for in vitro synthesis of capped RNA. We use mMESSAGE mMACHINE T7 Ultra Kit from Invitrogen. 4. Brinster microinjection buffer: 10 mM Tris-HCl pH 7.5, 0.25 mM EDTA. 5. Thermocycler. 6. PCR tubes. 7. Agarose gel electrophoresis equipment. 8. Nanodrop® and Bioanalyzer® equipment or equivalent for quantitative and qualitative measurement of in vitro transcribed RNAs.

2.3 Embryo Recovery and Culture

1. Stereomicroscope with high magnification (up to 63
or 100
), long working distance and transmitted/reflected illumination and optic fibber illumination. It is recommended to equip the stereomicroscope with a glass heating device to maintain embryos and culture media warn during embryos harvesting and transfer. We used thermoplate from Takai hit. 2. Dumont n 5 forceps and dissecting scissors. 3. Bunsen burner. 4. BDH capillary tubes, hard glass for melting. 5. PVC enteral feeding tube 125 cm. 6. Plastic petri dishes. 7. Pregnant Mare’s Serum Gonadotropin (PMSG) and human chorionic gonadotropin (hCG). Lyophilized powders are resuspended at 25 and 50 UI/ml in 1
PBS respectively and stored at 20  C.

Customized Device for Preimplantation Embryos Live Imaging

15

8. 1 ml syringes with a 30 G 1/2-in. needle. 9. Nontreated 4-well dish. We used 4-well dish validated for in vitro fertilization from NUNC. 10. EmbryoMax M2 Medium with Phenol Red. 11. EmbryoMax KSOM + AA with D-Glucose with Phenol Red. 12. Hyaluronidase 3 mg/ml in M2 medium. 13. Humidified incubator, 5–8% CO2 and 37  C. 2.4 Embryo Microinjection or Electroporation

1. Microinjection setup: high-quality inverted microscope with Differential Interference Contrast optics, micromanipulators, and microinjectors. 2. Thin wall borosilicate glass capillaries (outer/internal diameters: 1/0.78 mm and 1/0.58 mm for microinjection and holding pipettes respectively). We use GC100T-10 and GC100-10 capillaries from Clark electromedical instruments. 3. Microtools production setup. We use a capillary puller Sutter P-97 and a De Fonbrune microforge. 4. Glass depression or cavity slide (L
W 76 mm
26 mm, thickness 1.2–1.5 mm, with 1 concavity). 5. Square waves electroporation apparatus allowing multistep low voltage short and long pulses and reversing polarities and small-volume ex vivo electrodes chamber. We use NEPA21 electroporator and a small-volume electrode chamber (CUY501P1-1.5) from Nepagene. 6. Opti-MEM Reduced Serum Medium. 7. Embryo-tested mineral oil.

2.5 Microscope Setup for Imaging Mouse Embryos

1. Laser scanning confocal equipped with 405, 488, 561 and 640 nm laser lines and high sensibility PMTs (Multi-Alcaline and Gallium Arsenide Phosphide). 2. Long working distance Plan-Apochromat objectives without immersion (20
/0.8 and 40
/0.95). 3. Motorized XY scanning stage 130
85 STEP with stepper motor. 4. Environmental chamber with temperature control and CO2 control. 5. Computer workstation with high speed multicore processor, sufficient RAM and ZEN blue 2.1 acquisition software. 6. Embryo-tested mineral oil.

16

3

Sandrine Vandormael-Pournin et al.

Methods

3.1 Customized Chip Design and Microfabrication

Standard photolithography process [30] allows the transfer, with submicrometer resolution, of any pattern from a 2D photomask to a 3D substrate. This substrate can then serve as a master mold to generate microstructured devices in soft material compatible with embryo or cell culture through a process termed soft lithography [31]. We designed a pattern of 5
5 circular microwells to fit preimplantation mouse embryos. We found that a diameter of 140–160 μm and a depth of 160 μm to be the best dimensions capable of accommodating embryos and constraining their displacement during transport from the stereomicroscope to the microscope stage as well as for their loading and recovery from the wells. 1. Design the micropillar array (160 μm diameter and 500 μm center-to-center pitch) with a 2D vector-based drawing software (see Fig. 1a) and order the corresponding photomask. 2. Transfer the obtained photomask to the photolithography bench under dust-free atmosphere (see Note 1). 3. Scotch tape the plastic photomask on a glass plate. Make sure that the inked side of the photomask is facing downward. The objective is to minimize the distance between the inked side and the surface of the resin. This will minimize diffraction and ensure the production of sharp edges on the microfabricated structure. 4. Turn on the illumination device and start prewarming the UV lamp. 5. Turn on the spin-coater and the hotplate. 6. Dehydrate a blank silicon wafer at 200  C for 15 min on a hotplate. 7. After cooled down, install it on the chuck of the spin-coater. 8. Poor 20 g of SU8-2100 resin on the wafer. Avoid bubble formation. 9. Spin the wafer at 2000 rpm for 30 s in order to obtain a 160 μm thick layer. 10. Soft-bake the wafer on the hotplate (5 min at 65  C and then 30 min at 95  C). During baking time, install the mask on the illumination device (MJB4). 11. After cooling down, install the wafer on the illumination device (MJB4). 12. Set the exposure dose to 280 mJ/cm2 and expose the wafer. 13. Immediately after, perform the post-exposure bake (PEB) on the hotplate (5 min at 65  C and 12 min at 95  C). Avoid delaying PEB after exposure (see Note 2).

Customized Device for Preimplantation Embryos Live Imaging

17

Fig. 1 Production process of the Eggbox imaging device. (a) Cropped picture of the photomask used for the lithography process. The photo mask contains an array of 5
5 disks with a diameter of 160 μm nested in 4
4 blocks. A pitch of 500 μm (center-to-center) between disks was used in order to ease the loading of embryos. (b) The produced photomask is then used to produce the master mold by a standard

18

Sandrine Vandormael-Pournin et al.

14. Place the produced wafer in the dedicated Becher and cover with PGMEA. Perform the development for 15 min on an orbital shaker. 15. Hard-bake at 180  C for 30 min (optional) (see Note 3). 3.2 Eggbox Imaging Chamber Assembly and Storage

Structured PDMS sheets containing microwells are replicated from the microfabricated master mold. For optimization purposes, several variations in the design can be included in a single master (microwell diameters, pitch, array size. . .). Please note that only x and y dimension can vary in the same mold. Adjusting depth (or z) requires the production of different molds. We chose to assemble pads made of 4 blocks, each containing an array of 5
5 microwells, into a single 35 mm glass-bottom dish. Eggbox chambers built this way allow imaging up to 100 embryos at the same time (see Fig. 2a). Fifty or more pads can be recovered from single PDMS mold allowing for the production of a large number of eggbox chambers in one run. 1. Clean the silicon wafer containing the microfabricated structures with water and soap, rinse with milliQ water and dry with an air gun. 2. Cover the silicon wafer microfabricated surface with 1 ml of Sigmacote to make it hydrophobic and allow it to dry under the chemical hood. 3. Bake the treated wafer for 2 h at 80  C. 4. Clean the silicon wafer containing the microfabricated structures with water and soap, rinse with milliQ water and dry with an air gun. 5. Weight 30 g of PDMS base and 3 g of curing agent (10:1 respectively). Mix actively during 3 min. 6. Degas 30 min under vacuum (800 mBar) until eliminating all air bubbles. 7. Place the cleaned wafer in the spin coater and cover with approximatively 15 g of PDMS. Spin at 500 rpm during 30 s. Transfer to a piece of aluminum foil. 8. Let the PDMS polymerize for 4 h at 65  C. 9. Cover the polymerized PDMS with 3 M scotch tape. Cut PDMS pads through the tape with a scalpel. Remove the tape

ä Fig. 1 (continued) photolithography process. Briefly, photosensitive resin is spun on a silicon wafer in order to produce a 160 μm layer. This is then baked and exposed to UV through the mask. The development process reveals the micropillars that can be later salinized to ease demolding. (c) The final step consists in producing the Eggbox device by replicating the master mold with polydimethylsiloxane. The obtained microwell sheet is bonded on the bottom of a 35 mm, glass window dish with oxygen plasma. After UV/Ozone sterilization the Eggbox device can be loaded with embryos

Customized Device for Preimplantation Embryos Live Imaging

19

Fig. 2 The eggbox imaging device is compatible with mouse preimplantation embryo live imaging. (a) Picture of glass bottom dish with a 100 microwells PDMS pad. (b) Higher magnification of 5
5 microwells loaded with blastocysts. (c) Example of time-lapse imaging of a mouse embryo from zygote to expanded blastocyst stage in the eggbox. 48 embryos were imaged for 87 h (starting 30 h post hCG injection) with a time interval of 30 min. Note that at the end of the recording, blastocysts started to hatch and almost completely filled the well (140 μm). 160 μm-wells chip should be preferred when imaging late blastocysts. Bar: 20 μm

and place the recovered PDMS pads on a nonadherent teflon substrate. Microwells should be facing the Teflon support. If needed, this operation can be performed with dedicated tweezers under a stereomicroscope (see Note 4). 10. Place the glass bottom dishes, without lids, and the PDMS pads in the oxygen plasma system. 11. Generate an O2 plasma at 0.5 Torr, 20 SCCM O2 flow and 60 W power for 40 s.

20

Sandrine Vandormael-Pournin et al.

12. Bond the PDMS pads (microwells facing up) onto the glass bottom dishes. Press firmly and incubate 2 h at 80  C. 13. Sterilize the obtained dishes in the UV/ozone System. Further UV treatment under the cell culture hood can be needed. 14. Add 2 ml of sterile water and store until use in a hermetic box at 4  C for up to 3 months. 3.3 mRNA In Vitro Transcription

Capped polyadenylated mRNA are produced by in vitro transcription on a DNA template obtained by PCR amplification with a forward primer containing the minimal T7 promoter sequence. During all steps, it is critical to use RNAse-free reagents, tubes, and filter tips. Preparation of the PCR Template 1. Use a plasmid containing the sequence of interest to be transcribe (see Note 5). 2. Design 21–24 nt long forward and reverse primers with a Tm value >65  C. Include the minimal T7 promoter sequence (50 GTAATACGACTCACTATAGGG 30 ) at the 50 end of the forward primer. 3. Prepare reaction mix for the PCR amplification step as given below: Final concentration

Reaction mixture for PCR (250 μl reaction volume)

10
LA PCR buffer (Mg2+ free)

1


25 μl

MgCl2 (25 mM)

2.5 mM

25 μl

dNTP mixture (2.5 mM each)

0.4 mM each

40 μl

Primer 1 (100 μM)

0.2 μM

0.5 μl

Primer 2 (100 μM)

0.2 μM

0.5 μl

Sterile MilliQ water

–

Up to 250 μl

Reagents

TaKaRa LA Taq (10 UI/μl) 2.5 UI

2.5 μl

Plasmid template

50 ng

200 pg/μl

4. Before adding the plasmid template, mix the general reaction PCR mixture and transfer 25 μl to a PCR tube (negative control). 5. Add plasmid and split the reaction mixture in 9
25 μl in PCR tubes. 6. Incubate in a thermocycler for 1 min at 94  C, followed by 25 PCR cycles (10 s at 98  C, 50 s/kb at 68  C), and a final elongation of 10 min at 72  C (see Note 6).

Customized Device for Preimplantation Embryos Live Imaging

21

7. Pool the nine PCR reactions and check for amplification yield and specificity by running 10 μl on an agarose gel alongside with an appropriate-sized ladder and the negative control. 8. To remove primers, dNTPs and salts, and concentrate the PCR product, fill the reservoir of an Ultra Centifugal Filter Units with 300 μl of milliQ water and the PCR reaction. Spin the device at 14,000
g for 10 min at 4  C. Remove the filter from the tube and place it upside down in a clean microcentrifuge tube and centrifuge for 2 min at 1000
g to recover the concentrated PCR product. 9. Measure the concentration and integrity of the PCR by running 1 μl on an agarose gel together with an appropriate DNA ladder (see Note 7). 10. Verify the sequence the PCR product by sequencing. RNA Transcription, Polyadenylation, and Purification 11. Prepare T7 reaction mix for transcription according to manufacturer instructions. Here is presented the following reaction amounts using mMESSAGE mMACHINE® T7 reaction kit.

Reagents

Final concentration

Reaction mixture for in vitro transcription (20 μl reaction volume)

Nuclease-free water

–

Up to 20 μl

NTPs 2


1


10 μl

T7 reaction buffer 10


1


2 μl

Template PCR matrice

10 ng/μl

200 ng

T7 enzyme mix

0.2 μM

2 μl

12. Incubate for 2 h at 37  C. 13. Add 1 μl of TURBO DNase, mix well, and incubate 15 min at 37  C. 14. Add tailing reagents in the following order: Reagents

Amount

mMessage mMachine T7 Ultra reaction

(20 μl)

Nuclease-free water

36 μl

5
Poly(A) polymerase buffer

20 μl

25 mM MnCl2

10 μl

ATP solution

10 μl

15. Add 4 μl of Poly(A) Polymerase, and mix gently. 16. Incubate at 37  C for 45 min.

22

Sandrine Vandormael-Pournin et al.

17. Add 50 μl of LiCl precipitation solution to stop the reaction and precipitate the RNA. 18. Mix thoroughly. Chill overnight at 20  C. 19. Centrifuge at 4  C for 30 min at 20,800
g to pellet the RNA. 20. Carefully remove the supernatant. Wash the pellet once with 500 μl of 70% ethanol, and re-centrifuge to maximize removal of unincorporated nucleotides. 21. Carefully remove the 70% ethanol and re-centrifuge for 2 min to remove completely the 70% ethanol. 22. Add 40 μl of Brinster microinjection buffer to dissolve the pellet. 23. Determine the RNA concentration. 24. Store aliquots of 1–2 μl in a microfuge tube for up to 6 months at – 80  C. 3.4 Embryos Recovery and Culture

Embryos at the desired developmental stage are collected a few hours before imaging. In case of RNA microinjection or electroporation experiments, we used hormonal stimulation to ensure a sufficient number of embryos for RNA transfer and subsequent imaging. Here, we described the recovery of E0.5 zygotes from superovulated prepubertal females. Details on the recovery of embryos at other developmental stage can be found in [32]. 1. Inject intraperitoneally 22–26 days old (C57BL/6 x DBA/2) F1 females with 2.5 IU of PMSG and 42–48 h later with 5 IU of hCG and place right away with breeder males (see Note 8). 2. The next morning, check for successful mating as evidenced by the presence of a vaginal plug. 3. Before starting the dissection, equilibrate and prewarm a 4-well dish with 400 μl of KSOM per wells in the incubator for at least 1 h. Prewarm at room temperature M2 medium and dilute hyaluronidase solution 1 in 10 in M2 medium (0.3 mg/ml). 4. 22–24 h post hCG injection, kill the females by cervical dislocation and collect the oviducts, leaving a small part of the distal uterus attached, into a drop of M2 medium. 5. Turn on the thermoplate at 37  C. 6. Put each oviduct on a paper tissue to remove residual blood and fat and transfer them in a drop of hyaluronidase. 7. Under a stereomicroscope, grasp the oviduct next to the swollen infundibulum and hold it firmly on the bottom of the dish. Use forceps to tear the oviduct close to where the zygotes are located and push them out by gently squeezing the oviduct. 8. Incubate the zygotes in the hyaluronidase solution at 37  C on the thermoplate until the cumulus cells fall off.

Customized Device for Preimplantation Embryos Live Imaging

23

9. Meanwhile, assemble a mouth pipette composed of an enteral feeding tube connected at one extremity with a filter tip and to a capillary tube pulled over a Bunsen flame and cut between fingers at a diameter of about 100–120 μm at the other extremity. Collect the embryos with the pulled capillary and rinse them though several drops of M2 medium to dilute the hyaluronidase solution and remove all debris and cumulus cells. 10. Transfer the zygotes into the equilibrated KSOM medium (see Notes 9 and 10). 3.5 Embryo Microinjection or Electroporation

Both microinjection and electroporation can be used to transfer RNA into mouse preimplantation embryos. While microinjection requires extensive training and particular skills, electroporation only requires skills for embryo handling. Electroporation takes less time to perform and usually results in better survival rate. Some experimental designs, such as RNA transfer to a single blastomere of a 4-cell or 8-cell embryos, require the use of microinjection. EmbryoMicroinjection 1. Prepare injection pipettes with a micropipette puller. Settings may vary depending on puller model and filament and must be adjusted to obtain the desired shape of pipettes. We use the following program with the Sutter P-97 puller: Heat 555, Pull 75, Velocity 75, Delay 80 to produce a 6 mm elongation. 2. Prepare holding pipette using a microforge to cut straight a pulled capillary at an external diameter of 60 μm and then firepolish its extremity until its opening reaches a diameter of 15 μm. Alternatively, holding and microinjection pipettes can be purchased from various vendors. 3. Thaw an aliquot of concentrated in vitro transcribed and polyadenylated RNA on ice and dilute it with cold Brinster microinjection buffer at 50–200 ng/μl (see Note 11). 4. Make small drops of M2 medium and one tiny (1 μl or less) drop of RNA in the middle of a clean RNAse-free glass depression slide and cover with embryo-tested mineral oil. 5. Using a mouth pipette, collect about 30 zygotes from KSOM medium, rinse them several times in M2 medium, and transfer them into the drop of M2 in the depression slide and put the slide onto the microscope stage. 6. Fill the injection pipette through direct aspiration of the RNA solution in the depression slide. 7. Pick one zygote at a time through suction with the holding pipette and introduce slowly the tip of the injection pipette through the zona pellucida and the membrane before injecting the RNA solution into the pronucleus (see Note 12). 8. When all of the zygotes have been injected, rinse them through several drops of CO2-equilibrated KSOM and place them back in the incubator (see Note 13).

24

Sandrine Vandormael-Pournin et al.

Fig. 3 Example of fluorescence time-lapse imaging. (a) Visualization of membranes, nuclei, and mitotic chromosomes with GFP fluorescent nuclear-localized (H2B-GFP) and Tomato fluorescent membrane-localized (mTomato) reporters. Zygotes were recovered from a cross between a CAG::H2B-EGFP [33] homozygous female and a RosamT/mG [34] homozygous male and imaged every 15 min starting 24–25 h post hCG injection. Fluorescence panels represent z-stacks projection except for the last two where a single z-stack is shown.

Customized Device for Preimplantation Embryos Live Imaging

25

EmbryoElectroporation 1. Thaw an aliquot of concentrated in vitro transcribed and polyadenylated RNA on ice and dilute it with OptiMEM at 50–200 ng/μl (see Note 11). 2. Fill the electrode chamber with 5 μl of RNA solution. 3. Using the mouth pipette, wash up to 30 zygotes in several drops of OptiMEM medium. 4. Transfer the zygotes into the middle of the electrode chamber. 5. Measured sample impedance with the electroporator apparatus and adjust if neccessary to a value between 200–400 Ω by adding or removing RNA solution. 6. Perform zygotes electroporation using the following settings: four poring pulses of 40 V, 3.5 ms length, 50 ms intervals, 10% decay rate, polarity + followed by five transfer pulses of 5 V, 50 ms length, 50 ms intervals, 10% decay rate, polarity +/, “current limit ON” activated (see Note 14). 7. Recover the embryos out from the electrode, rinse them through several drops of CO2-equilibrated KSOM and place them back in the incubator. 8. If more embryos are to be electroporated, remove liquid and add a new 5 μl of RNA solution in the electrode chamber at a distance away from the first 5 μl and repeat steps 2–7 with new zygotes. 9. When the entire length of the electrodes has been used, rinse three times the electrode chamber with RNAse-free water and air dry before starting again zygote electroporation. 3.6 Live Imaging of Preimplantation Mouse Embryos

Live imaging can be performed on mouse preimplantation embryos expressing fluorescent reporters from genetically modified alleles or after in vitro transcribed mRNA transfer by microinjection or electroporation (see Fig. 3). The number of embryos that can be imaged in parallel depends on the imaging parameters used. For example, up to 30 embryos can be imaged on two fluorescence channels, with 25 z-stacks/embryos and with a time interval of 10 min. Increasing the time interval or reducing the number of z-stacks allow to increase the number of imaged embryos.

ä Fig. 3 (continued) Bar: 20 μm. (b) First mitosis visualized with a fluorescent nuclear-localized reporter (H2B-mCherry) following RNA electroporation (100 ng/μl). (c) Transient expression of Esrrb-tdTomato fusion protein [35] following RNA microinjection (40 ng/μl). Embryos were imaged every 10 min starting 27–28 h post hCG injection and 2 and 3 h post electroporation and microinjection respectively. Corresponding proteins are visualized rapidly after the transfer for a duration which depends on RNA concentration and stability of the fusion proteins. Fluorescence panels represent z-stacks projection. Bar: 20 μm

26

Sandrine Vandormael-Pournin et al.

1. Several hours before live imaging, remove the water from an eggbox imaging chamber, add 2 ml of EmbryoMax KSOM medium and place it in the incubator to allow equilibration and elimination of air bubbles (see Note 15). 2. Prewarm the on-stage incubator to 37  C 1 h before live imaging (may be longer depending on the incubator). Under a stereomicroscope, transfer the embryos into the microwells of the equilibrated eggbox imaging chamber. 3. Fix eggbox imaging chamber to the 35 mm petri dish holder of the microscope stage and make sure that the seal between the dish and the holder is tight (see Note 16). 4. Place the holder with the dish on the microscope stage, and immediately provide 8% of CO2. 5. Using the “positions” window of the advanced setup module, save the x y z coordinates of each embryo. Set up z plane on the middle of the embryo before saving the position. 6. Name each position and using the “verify positions” window check that the saved z position indeed corresponds to the midplane of each embryo. 7. Using the “center” tab of the z-stack module, define the range, the number of slices and the interval to cover the thickness of the embryos (see Note 17). 8. Pour gently 2 ml of embryo-tested mineral oil on top of the KSOM medium to prevent evaporation during long time imaging (see Note 18). 9. To minimize embryo exposure to laser light, zoom the scanning area on the microwell, set fast scan mode (directional scan mode, rapid scan speed, no averaging signal), use low laser power intensity range and, if necessary, set the pinhole wider than 1 Airy unit. The number of embryos imaged at the same time will depend on those parameters together with the number of z slices and the time interval (see Note 19). 10. After live imaging, recover the embryos out from the eggbox microwells under a stereomicroscope using the mouth pipette for further analyses (genotyping, immunostaining, omics analysis, . . .).

4

Notes 1. The photolithography and soft-lithography processes should be performed in dedicated facilities or gray rooms. This ensures that the dust particles of the atmosphere are filtered out and cannot interfere with the fabrication. Air quality of the iso5 standard is recommended.

Customized Device for Preimplantation Embryos Live Imaging

27

2. According to the manufacturer, upon exposure SU8 crosslinking proceeds in-two-steps (1) formation of a strong acid during the exposure process, followed by (2) acid-initiated, thermally driven epoxy cross-linking during the PEB step. Delaying the PEB might cause acid to diffuse out of the exposed area and thus result in blurry edges. 3. Hard baking allows to further crosslink the SU8 material. This helps increasing the lifespan of the mold. 4. Remaining can be stored for long time and used whenever needed to produce additional eggbox imaging devices. 5. In vitro transcription can be performed directly from linearized plasmids containing a T7 promoter. Because residual RNase A can be present in plasmid DNA preps, use of a PCR template may be more suitable for RNA synthesis. 6. Amplification elongation time should be adapted to the size of the amplicon (50 s/kb). If the Tm of the primers are under 68  C, add an annealing step at the Tm value for 30 s. 7. RNA concentration can be measured with Nanodrop®, Qubit® or Bioanalyser®. In our experience, Bioanalyser® is the most reliable to estimate the concentration of the PCR product at this step. 8. Mice are kept on a constant 14 h light/10 h dark cycle. The number of females should be adapted to ones’ needs. On average, we recover 24 zygotes per (C57BL6 x DBA2)F1 female. The timing between the two hormones may be adapted depending on the strain and the age of the females. Intraperitoneal injection is an invasive procedure that could request for authorization from local and national authorities. 9. Each batch of KSOM medium should be tested with embryos cultured for several days. More than 80% zygotes should develop into blastocyst after 4 days. 10. Freshly recovered zygotes are usually more resistant and easier to inject. It is therefore preferable to start the microinjection immediately after collecting the embryos. 11. The working RNA concentration should be determined for each preparation by testing the fluorescence intensity, the duration of fluorescence detection and eventual developmental defects due to the transient expression of the fusion protein following microinjection or electroporation with a range of concentration from 50 ng/μl to 1 μg/μl. 12. RNA microinjection can be performed either in the cytoplasm or the pronucleus. We routinely use pronuclear injection as it allows a better visualization and control of RNA delivery and, in our hands, give similar rate (50–80%) of viable embryos following injection.

28

Sandrine Vandormael-Pournin et al.

13. Zygotes should not stay longer than 20–30 min in the microinjection M2 drop. The number of embryos transferred should therefore be adapted according to the experimenter microinjection skills. Change the M2 medium in the microinjection drop before transferring a new batch of zygotes. 14. Embryos’ viability is excellent (>95%) following electroporation with these parameters. 15. It is important to replace water by KSOM several hours before imaging because the hydrophobic nature of the PDMS chip favours the formation of air bubbles in the microwells during this step. Bubbles will usually escape from the microwells after a few hours in the incubator. It is possible to accelerate the elimination of air bubbles by flushing medium in the microwells with a mouth pipette. 16. If necessary, it is possible to seal the remaining spaces between the dish and the holder with electric tape to prevent leakage of the humidified air. 17. Depending on the specificities of each live imaging experiment (brilliance of the signal, duration of acquisition, dynamics of the process under study, . . .), acquisition parameters (scanning mode, number of z slices, time interval, . . .) should be adapted in order to obtain the optimal spatiotemporal resolution without affecting embryo integrity. 18. Once covered with mineral oil, it is difficult to relocate the eggbox without risk of overflows. It is thus preferable to add the mineral oil only after all positions have been verified and parameters for live imaging have been set up. 19. When possible, use outbred or hybrid genetic background strains since preimplantation embryos from these strains are more robust than the ones from inbred strains.

Acknowledgments We thank the Institut Pasteur, the Centre National de la Recherche Scientifique and the Agence Nationale de la Recherche (ANR-10LABX-73-01 REVIVE and ANR-14 CE11-0017 PrEpiSpec) for their support. The activity of the Biomaterials and Microfluidics core facility is partially funded by the Carnot MS program. We are grateful to all lab members for their help and in particular Gwendoline Tallec and Sylvain Bessonnard for their involvement in the design and validation of the initial version of the mouse Eggbox. We thank Je´roˆme Artus for critical reading of the manuscript.

Customized Device for Preimplantation Embryos Live Imaging

29

References 1. Wallingford JB (2019) The 200-year effort to see the embryo. Science 365:758–759. https://doi.org/10.1126/science.aaw7565 2. Ries J (1909) Kinematographie der Befruchtung und Zellteilung. Arch Mikrosk Anat 74:1–31. https://doi.org/10.1007/ BF02979930 3. Landecker H (2009) Seeing things: from microcinematography to live cell imaging. Nat Methods 6:707–709. https://doi.org/10. 1038/nmeth1009-707 4. Hammer RE (1998) Egg culture: the foundation. Int J Dev Biol 42:833–839 5. Bedzhov I, Leung CY, Bialecka M, ZernickaGoetz M (2014) In vitro culture of mouse blastocysts beyond the implantation stages. Nat Protoc 9:2732–2739. https://doi.org/ 10.1038/nprot.2014.186 6. McDole K, Guignard L, Amat F et al (2018) In toto imaging and reconstruction of postimplantation mouse development at the single-cell level. Cell 175:859–876.e33. https://doi.org/10.1016/j.cell.2018.09.031 7. Heape W (1997) Preliminary note on the transplantation and growth of mammalian ova within a uterine foster-mother. Proc R Soc Lond 48:457–458. https://doi.org/10. 1098/rspl.1890.0053 8. Lewis WH, Gregory PW (1929) Cinematographs of living developing rabbit-eggs. Science 69:226–229. https://doi.org/10.1126/ science.69.1782.226-a 9. Nowotschin S, Eakin GS, Hadjantonakis A-KK (2009) Live-imaging fluorescent proteins in mouse embryos: multi-dimensional, multispectral perspectives. Trends Biotechnol 27:266–276. https://doi.org/10.1016/j. tibtech.2009.02.006 10. Lambert TJ (2019) FPbase: a communityeditable fluorescent protein database. Nat Methods 16:277–278. https://doi.org/10. 1038/s41592-019-0352-8 11. Pantazis P, Supatto W (2014) Advances in whole-embryo imaging: a quantitative transition is underway. Nat Rev Mol Cell Biol 15:327–339. https://doi.org/10.1038/ nrm3786 12. Louvet-Valle´e S, Vinot S, Maro B (2005) Mitotic spindles and cleavage planes are oriented randomly in the two-cell mouse embryo. Curr Biol 15:464–469. https://doi.org/10. 1016/j.cub.2004.12.078 13. Artus J, Kang M, Cohen-Tannoudji M, Hadjantonakis A-KK (2013) PDGF signaling is required for primitive endoderm cell survival

in the inner cell mass of the mouse blastocyst. Stem Cells 31:1932–1941. https://doi.org/ 10.1002/stem.1442 14. Meilhac SM, Adams RJ, Morris SA et al (2009) Active cell movements coupled to positional induction are involved in lineage segregation in the mouse blastocyst. Dev Biol 331:210–221. https://doi.org/10.1016/j. ydbio.2009.04.036 15. Morris SA, Teo RTY, Li H et al (2010) Origin and formation of the first two distinct cell types of the inner cell mass in the mouse embryo. Proc Natl Acad Sci U S A 107:6364–6369. https://doi.org/10.1073/ pnas.0915063107 16. Watanabe T, Biggins JS, Tannan NB, Srinivas S (2014) Limited predictive value of blastomere angle of division in trophectoderm and inner cell mass specification. Development 141:2279–2288. https://doi.org/10.1242/ dev.103267 17. Samarage CR, White MD, Alvarez YD et al (2015) Cortical tension allocates the first inner cells of the mammalian embryo. Dev Cell 34:435–447. https://doi.org/10.1016/ j.devcel.2015.07.004 18. Korotkevich E, Niwayama R, Courtois A et al (2017) The apical domain is required and sufficient for the first lineage segregation in the mouse embryo. Dev Cell 40:235–247.e7. https://doi.org/10.1016/j.devcel.2017.01. 006 19. Plusa B, Piliszek A, Frankenberg S et al (2008) Distinct sequential cell behaviours direct primitive endoderm formation in the mouse blastocyst. Development 135:3081–3091. https:// doi.org/10.1242/dev.021519 20. Xenopoulos P, Kang M, Puliafito A et al (2015) Heterogeneities in nanog expression drive stable commitment to pluripotency in the mouse blastocyst. Cell Rep 10:1508–1520. https:// doi.org/10.1016/j.celrep.2015.02.010 21. Plachta N, Bollenbach T, Pease S et al (2011) Oct4 kinetics predict cell lineage patterning in the early mammalian embryo. Nat Cell Biol 13:117–123. https://doi.org/10.1038/ ncb2154 22. Fierro-Gonza´lez JC, White MD, Silva JC, Plachta N (2013) Cadherin-dependent filopodia control preimplantation embryo compaction. Nat Cell Biol 15:1424–1433. https:// doi.org/10.1038/ncb2875 23. Maıˆtre J-L, Niwayama R, Turlier H et al (2015) Pulsatile cell-autonomous contractility drives compaction in the mouse embryo. Nat Cell

30

Sandrine Vandormael-Pournin et al.

Biol 17:849–855. https://doi.org/10.1038/ ncb3185 24. Dumortier JG, Le Verge-Serandour M, Tortorelli A-F et al (2019) Hydraulic fracturing and active coarsening position the lumen of the mouse blastocyst. Science 365:465–468. https://doi.org/10.1126/science.aaw7709 25. Zenker J, White MD, Gasnier M et al (2018) Expanding actin rings zipper the mouse embryo for blastocyst formation. Cell 173:776–791.e17. https://doi.org/10.1016/ j.cell.2018.02.035 26. Gardner RL (2001) Specification of embryonic axes begins before cleavage in normal mouse development. Development 128:839–847 27. Hiiragi T, Solter D (2004) First cleavage plane of the mouse egg is not predetermined but defined by the topology of the two apposing pronuclei. Nature 430:360–364. https://doi. org/10.1038/nature02595 28. Alexandrova S, Kalkan T, Humphreys P et al (2016) Selection and dynamics of embryonic stem cell integration into early mouse embryos. Development 143:24–34. https://doi.org/10. 1242/dev.124602 29. Strauss B, Harrison A, Coelho PA et al (2018) Cyclin B1 is essential for mitosis in mouse embryos, and its nuclear export sets the time for mitosis. J Cell Biol 217:179–193. https:// doi.org/10.1083/jcb.201612147

30. Ramade A, Legant WR, Picart C et al (2014) Microfabrication of a platform to measure and manipulate the mechanics of engineered microtissues. Methods Cell Biol 121:191–211. https://doi.org/10.1016/ B978-0-12-800281-0.00013-0 31. Xia YN, Whitesides GM (1998) Soft Lithography. Angew Chem Int Ed Engl 37:550–575. https://doi.org/10.1002/(SICI)1521-3773( 19980316)37:53.0. CO;2-G 32. Behringer R, Gertsenstein M, Nagy KV, Nagy A (2014) Manipulating the mouse embryo: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor 33. Hadjantonakis A-KK, Papaioannou VE (2004) Dynamic in vivo imaging and cell tracking using a histone fluorescent protein fusion in mice. BMC Biotechnol 4:1–14. https://doi. org/10.1186/1472-6750-4-33 34. Muzumdar MD, Tasic B, Miyamichi K et al (2007) A global double-fluorescent Cre reporter mouse. Genesis 45:593–605. https://doi.org/10.1002/dvg.20335 35. Festuccia N, Dubois A, Vandormael-Pournin S et al (2016) Mitotic binding of Esrrb marks key regulatory regions of the pluripotency network. Nat Cell Biol 18:1139–1148. https:// doi.org/10.1038/ncb3418

Chapter 3 In Vitro Culture of Mouse Blastocysts to the Egg Cylinder Stage via Mural Trophectoderm Excision Hatice O. Ozguldez and Ivan Bedzhov Abstract The developmental transition from the blastocyst to the egg cylinder stage is associated with stark changes in the overall shape of the embryo, as well as with reorganization of the transcriptional network and epigenetic landscape in the pluripotent and the supportive extraembryonic lineages. To directly analyze this pre- to postimplantation switch, culture conditions are needed that can support mouse embryogenesis beyond the blastocyst stage without maternal input. Here we provide a step-by-step protocol describing an experimental pipeline for isolating late blastocysts, excising (manually or via laser assistance) the mural trophectoderm, and, finally, culturing the embryo to the egg cylinder stage. Key words Blastocyst, Egg cylinder, Implantation, In vitro, Culture, Mouse embryo, Mural trophectoderm

1

Introduction In mice, the end of preimplantationembryonic development is marked with the establishment of a mature, hollow-shaped blastocyst at embryonic day four and a half (E4.5) post fertilization. The E4.5 blastocyst consists of three lineages—pluripotent epiblast (EPI) and two supportive extraembryonic tissues—the primitive endoderm (PE), and trophectoderm (TE). The TE is subdivided into polar TE, which is in direct contact with the EPI, and mural TE, which surrounds the blastocoel cavity. The mural TE mediates the first contact with the mother, adhering to the uterine epithelium and initiating the process of implantation. At E4.75 the distal part of the mural TE differentiates into invasive trophoblast giant cells (TGCs) that penetrate into the uterine stroma. In turn, the stromal cells rapidly proliferate, forming a decidua that completely engulfs and conceals the embryo. By E5.5, an early egg cylinder is formed that consists of polar TE–derived extraembryonic ectoderm

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_3, © Springer Science+Business Media, LLC, part of Springer Nature 2021

31

32

Hatice O. Ozguldez and Ivan Bedzhov

(ExE) and cup-shaped EPI, both surrounded by a layer of visceral endoderm (VE) cells [1]. During the blastocyst to egg cylinder transition (E4.5–E5.5), the embryo undergoes extensive morphogenetic, transcriptional, and epigenetic reorganization. The EPI transforms from a ball of cells into a polarized epithelium surrounding a central proaminiotic cavity [2, 3]. At the same time, the transcriptional network associated with the preimplantation (naı¨ve) pluripotent state is dismantled and the formative state of pluripotency is established, which allows the EPI to undergo further differentiation [4]. The global DNA methylation levels in the pluripotent lineage rapidly increase, and in female embryos one of the X-chromosomes is randomly inactivated [5, 6]. Shortly after E5.5, patterning signals from the VE and ExE set up the anterior/posterior body axis and initiate germ and somatic lineage specification. Importantly, directly analyzing the developmental processes that transform the blastocyst into an egg cylinder requires in vitro culture conditions that support peri-implantation embryogenesis without maternal input. Here we provide a step-by-step protocol for isolating E4.75 blastocysts, microdissecting the mural TE, and, finally, culturing the embryo to the egg cylinder stage. At E4.75, all three lineages that build the blastocyst are fully specified, the embryo is hatched from its glycoprotein envelope (Zona pellucida), and the implantation process is activated. Using this advanced stage of blastocyst development increases the efficiency of egg cylinder formation in vitro in comparison with using early (E3.5) blastocysts, where the preimplantation embryogenesis is still ongoing. A characteristic feature of the E4.75 embryos is the TGC differentiation of the distal mural TE that mediates the contact between the blastocyst and the uterine wall. However, in vitro the typical invasion of the TCGs into the uterine stroma during implantation does not take place, since the embryos are cultured on impenetrable plastic. Therefore, embryonic developmentin vitro does not require the mural TE; moreover, we found that removing this tissue further enhances the rate of proper egg cylinder formation. Here we describe two techniques for mural TE excision: laser-assisted dissection, which requires specialized equipment, and manual cutting using a glass needle. After removing the mural TE, the remaining clump of inner cell mass (ICM) and polar TE cells is cultured in IVC1 and IVC2 media [7, 8], which support further embryonic development to the egg cylinder stage in vitro.

2 2.1

Materials Equipment

1. Standard stereomicroscope with transillumination base. 2. Inverted microscope equipped with laser objective for trophectoderm biopsy (see Note 1), left and right micromanipulators

Blastocyst to Egg Cylinder Transition In Vitro

33

with control joysticks, and two injectors with attached holding pipettes (see Subheading 2.3). 3. Micropipette glass puller. 4. Microforge for processing pipette tips. 5. Bunsen burner. 2.2

Dissection Tools

1. Fine scissors. 2. Fine forceps (e.g., Dumont #5). 3. Rubber tubing. 4. Petri dishes, 35  10 mm.

2.3

Glass

1. Glass Pasteur pipettes. 2. Capillary glass for micropipettes and needles. 3. Mouth pipette for collecting and transferring embryos: Pull a glass Pasteur pipette over the flame of the Bunsen burner and break the tip to form an open end (see Fig. 1a and see Note 2). On one side of the rubber tubing place a 1000 μl tip without a filter; on the other side, place a 200 μl filter tip. To finish assembly of the mouth pipette, attach the Pasteur pipette to the large open end of the 1000 μl tip. 4. Holding pipettes for laser dissection of the mural TE. Two pipettes are required for embryo micromanipulations: one for holding the polar TE and another for holding the mural TE (see Note 3). 5. Dissection needle for manual removal of the mural TE (see Fig. 1b). Use the same capillary glass and glass puller program described in Note 3 to generate the needles. No further microforge-assisted processing of the glass is required.

Fig. 1 Glass pipettes and needles. (a) Pipette for collecting embryos and transferring samples between different plates and media. (b) Glass needle for manual dissection of the mural TE

34

2.4

Hatice O. Ozguldez and Ivan Bedzhov

Stock Solutions

1. Mineral oil, embryo tested and filtered by the manufacturer. 2. Advanced DMEM/F-12. 3. Foetal calf serum (FCS), high quality, embryonic stem cell grade (see Note 4). 4. Knockout serum replacement (KSR). 5. 200 mM L-glutamine in ddH2O. 6. Penicillin–streptomycin solution: 5000 units/ml penicillin and 5000 μg/ml streptomycin. 7. 100 ITS-X stock solution: 1 g/l insulin, 0.55 g/l transferrin, 0.00067 g/l sodium selenite, 0.20 g/l ethanolamine. 8. 10 μM β-estradiol solution in DMSO (see Note 5). 9. 1 mg/ml progesterone solution in DMSO (see Note 5). 10. 50 mM N-acetyl-L-cysteine (NAC) solution in ddH2O (see Note 5).

2.5

Media

1. M2 medium (see Note 6). 2. IVC1 medium: Supplement the basal Advanced DMEM/F12 medium with 20% (vol/vol) FCS, 2 mM L-glutamine, 25 units/ml penicillin, 25 μg/ml streptomycin, 1 ITS-X solution (10 mg/l insulin, 5.5 mg/l transferrin, 0.0067 mg/l sodium selenite and 2 mg/l ethanolamine), 8 nM β-estradiol, 200 ng/ml progesterone, and 25 μM NAC final (see Note 7). 3. IVC2 medium: Supplement the basal Advanced DMEM/F12 medium with 30% (vol/vol) KSR, 2 mM L-glutamine, penicillin (25 units/ml), streptomycin (25 μg/ml), 1 ITS-X (10 mg/l insulin, 5.5 mg/l transferrin, 0.0067 mg/l sodium selenite and 2 mg/l ethanolamine), 8 nM β-estradiol, 200 ng/ ml progesterone, and 25 μM N-acetyl-L-cysteine (see Note 7).

3

Methods The embryo micromanipulation procedures, namely isolation of E4.75 embryos and laser or manual dissection of the mural TE, are performed at room temperature in M2 medium. The subsequent embryo culture is carried out in a humidified incubator at 37  C and 5% CO2 in air using IVC1 / IVC2 media.

3.1 Isolation of E4.75 Eembryos

1. Humanely euthanize pregnant female mice and, using scissors, make a cut through the skin and the underlying peritoneum. Move away the overlying abdominal organs to locate the reproductive tract and collect the uterus, oviduct, and the ovary in one piece.

Blastocyst to Egg Cylinder Transition In Vitro

35

Fig. 2 Schematic overview of the embryo isolation procedure

2. Transfer the reproductive tract into an inverted lid of a 35-mm dish filled with warm M2 medium (see Note 8). Under a stereomicroscope, cut off and discard the ovaries, oviducts, and fat pads (see step 1 of Fig. 2). 3. Cut at the connection between the uterine horns to separate them. Locate the mesometrial site of each horn, marked by the uterine artery and vein. Using fine scissors, cut alongside the mesometrial pole to open the uterine tube (see step 2 of Fig. 2). It is safe to cut through the mesometrial pole, as the embryos attach to the opposite, anti-mesometrial side of the uterus. 4. The E4.75 embryos are at an early phase of implantation, and the uterine endometrium responds by initiating decidualization. These areas of the uterus have smooth surface, in contrast to the wavy appearance of the tissues where there are no established embryo-maternal interactions (see step 3 of Fig. 2). Cut through the wavy parts of the uterus to separate the areas containing individual implantation sites. 5. Using fine forceps locate the site of implantation, which appears as a dark spot (see Note 9). This is a tissue fold with triangular shape, usually positioned in the middle of the smooth area, containing a single E4.75 blastocyst. Using only one end of the open forceps, gently scoop the embryo out (see step 4 of Fig. 2). Collect and transfer the embryos in drops of M2 medium under mineral oil using mouth pipetting (see Note 10). Proceed with the removal of the mural TE immediately either by laser-assisted dissection (Subheading 3.2) or manual cutting using a glass needle (Subheading 3.3). 3.2 Laser-Assisted Excision of the Mural TE

The laser-assisted removal of the mural TE requires specialized equipment such as an inverted microscope with attached micromanipulators and a laser objective (see Notes 1 and 11). Here, we use the LYCOS RED-I laser system, which has to be set on “Multipulse” mode to enable continuous emission of the laser beam (see Note 12).

36

Hatice O. Ozguldez and Ivan Bedzhov

Fig. 3 Laser-assisted excision of the mural TE. (a) Schematic representation of the sequential steps of embryo micromanipulations resulting in the separation of the mural TE from the ICM/polar TE compartment. (b) Snapshot images of time-lapse microscopy capturing laser dissection of an E4.75 blastocyst using the LYCOS RED-i system

1. Place a single blastocyst in a 5-μl drop of M2 covered with mineral oil on a glass bottom slide or plate (see Fig. 3a, b). Using two micropipettes, fix the embryo by holding the polar and the mural TE, and turn on the laser beam. 2. Move the embryo over the cutting laser beam following trophectodermal cell-cell junctions and, at the same time, pull apart the separating tissues. 3. Gently release from the holding micropipette the clump containing the ICM and polar TE. 4. Collect this part of the embryo with the mouth pipette for further cultivation.

Blastocyst to Egg Cylinder Transition In Vitro

3.3 Manual Dissection of the Mural TE

37

Manual cutting of the mural TE does not require any specialized equipment, apart from a stereomicroscope and a glass needle. Initially, this technique can take more time to master; nevertheless, we highly recommend performing manual cutting, as one can process more embryos much faster compared to the laser-assisted dissection. 1. Place E4.75 embryos into an inverted lid of a 35-mm dish filled with warm M2 medium (see Fig. 4a, b) (see Note 13). Locate

Fig. 4 Manual removal of the mural TE and subsequent embryo culture to the egg cylinder stage. (a) Schematic overview of mural TE excision using a glass needle. (b) Intact and dissected E4.75 blastocyst with characteristic appearance of the mural TE (darker tissue) and ICM/polar TE compartment (round and shiny). (c) In vitro culture of dissected E4.75 embryo to early egg cylinder stage, subsequently stained by immunofluorescence for Oct4 (EPI marker), Cdx2 (ExE marker), and DAPI (nuclear marker)

38

Hatice O. Ozguldez and Ivan Bedzhov

the ICM and the mural TE and press the tip of the glass needle down between these two compartments. 2. Once properly positioned between the mural TE and the ICM, slide the needle to cut off the mural TE (see Note 14). 3. Collect the clump containing the ICM and polar TE by mouth pipetting for further cultivation. 3.4 In Vitro Culture to Egg Cylinder Stage

The efficiency of egg cylinder formation in vitro greatly depends on the precision of mural TE dissection. If a large part of the mural TE is still remaining, it can close back up and repair the blastocoel cavity. It is critical to preserve the ICM intact, as any mechanical or laser damage to the tissue can result in abnormal or a complete block of further embryonic development. The embryo culture can be performed following a two-step protocol of sequential cultivation in IVC1 and IVC2 media [3, 9]. 1. Using the mouth pipette, transfer individual clump of ICM and polar TE cells into a 15 μl drop of prewarmed IVC1 medium completely covered with mineral oil. 2. After 24 h of culture, carefully transfer the embryo into a new drop of IVC2 medium. Further supply of fresh medium is not required. Because the mural TE of the E4.75 blastocyst is removed, there are very few or no TGCs that emerge during embryo culture to mediate stable attachment to the plate. Therefore, using the two-step protocol in experiments such as live imaging may result in unwanted shifts in the position of the embryo due to media flow. To circumvent this, we routinely perform uninterrupted embryo culture in a 15 μl drop of 1:1 mix of IVC1 and IVC2 media covered with mineral oil, which supports efficient embryo development to the egg cylinder stage (see Fig. 4c).

4

Notes 1. In this protocol we use LYCOS RED-i laser system from Hamilton Thorne. 2. The diameter of the open end should be slightly larger than the embryo to allow free movement of the specimen in and out of the pipette. 3. The pipette for holding the polar TE is a standard holding pipette, which can be fabricated by pulling capillary glass using a micropipette glass puller. We use the following program on our puller (P-1000 from Sutter Instrument)—Heat: 490, Pull: 30, Vel:120, Time: 200, Pressure: 300 with Ramp value of 463. This generates a micropipette with a closed tip

Blastocyst to Egg Cylinder Transition In Vitro

39

that should be processed using a microforge to produce an open, fire-polished end for holding the embryo on the side of the polar TE. Fabricating the mural TE micropipette follows the same steps, but the diameter of the open end should be 2–3 times larger. 4. The quality of the serum is crucial for efficient embryonic development to the egg cylinder stage in vitro, and each batch of sera has to be individually tested. The serum component of the IVC1 medium is required to stimulate the blastocyst for further postimplantation development. Heat-inactivate the serum complement by incubation at 56  C for 30 min before use. 5. Store at

20  C for up to 2 months.

6. Warm the medium to 37  C before use. 7. The medium can be kept at 20  C for 3 months or at 4  C for up to 2 weeks. Warm the medium (37  C) and equilibrate in a humidified air atmosphere of 5% CO2 for at least half an hour before use. 8. Using the lid instead of the plate provides easier access to the sample, as the wall of the lid is lower. 9. For a detailed description and microscopy images of the implantation site, see [9]. 10. Some of the embryos are loosely attached to the uterine wall, whereas implantation is more advanced in others. The loosely attached embryos can be flushed out before the dissection of the uterine horns, using a syringe filled with M2 medium. Carefully examine the medium to locate any detached blastocysts. The E4.75 embryos have no zona pellucida, and they appear flat with a compacted (shiny) ICM and a differentiated (darker) mural TE. 11. The LYCOS RED-i system has a build-in laser guide that appears as a red dot, showing the location of the laser beam. 12. Although the laser is focused on a single point, the tissues and the medium in close proximity are also heated up. This can generate secondary damage of the neighboring cells. To visualize the temperature in the areas around the focal point of laser ablation, turn on the “Isotherms” mode in the LYCOS RED-i software and adjust the laser settings to prevent damage to the ICM. 13. This is a critical step. If the embryos are not processed immediately after isolation, the blastocoel cavity tends to collapse, which decreases the available mural TE area for proper positioning of the needle. 14. During cutting, the tissues may start rolling before being completely separated.

40

Hatice O. Ozguldez and Ivan Bedzhov

Acknowledgements We thank Heike Brinkmann for the excellent technical assistance; all lab members for their constructive discussions and suggestions and Dr. Celeste Brennecka for proofreading the manuscript. This work was supported by the German Research Foundation (DFG) Emmy Noether grant (BE 5800/1-1) and the Collaborative Research Center 1348 “Dynamic Cellular Interfaces” grant (1348/1, B09) to I.B.; H.O.O. is a PhD student funded by the Collaborative Research Center 1348 “Dynamic Cellular Interfaces” grant (1348/1, B09) and is part of the integrated research training group CRC1348 IRTG. References 1. Govindasamy N, Duethorn B, Oezgueldez HO, Kim YS, Bedzhov I (2019) Test-tube embryos— mouse and human development in vitro to blastocyst stage and beyond. Int J Dev Biol 63 (3–5):203–215. https://doi.org/10.1387/ ijdb.180379ib 2. Bedzhov I, Zernicka-Goetz M (2014) Selforganizing properties of mouse pluripotent cells initiate morphogenesis upon implantation. Cell 156(5):1032–1044. https://doi.org/10. 1016/j.cell.2014.01.023 3. Bedzhov I, Zernicka-Goetz M (2015) Cell death and morphogenesis during early mouse development: are they interconnected? BioEssays 37 (4):372–378. https://doi.org/10.1002/bies. 201400147 4. Kinoshita M, Smith A (2018) Pluripotency deconstructed. Develop Growth Differ 60 (1):44–52. https://doi.org/10.1111/dgd. 12419

5. Lee HJ, Hore TA, Reik W (2014) Reprogramming the methylome: erasing memory and creating diversity. Cell Stem Cell 14(6):710–719. https://doi.org/10.1016/j.stem.2014.05.008 6. Lee JT, Bartolomei MS (2013) X-inactivation, imprinting, and long noncoding RNAs in health and disease. Cell 152(6):1308–1323. https:// doi.org/10.1016/j.cell.2013.02.016 7. Bedzhov I, Leung CY, Bialecka M, ZernickaGoetz M (2014) In vitro culture of mouse blastocysts beyond the implantation stages. Nat Protoc 9(12):2732–2739. https://doi.org/10. 1038/nprot.2014.186 8. Zernicka-Goetz M, Bedzhov I (2015) Media and methods for culturing embryos and stem cells. Patent, WO2015022541 9. Govindasamy N, Bedzhov I (2019) Isolation and culture of periimplantation and early postimplantation mouse embryos. Methods Mol Biol 2006:373–382. https://doi.org/10. 1007/978-1-4939-9566-0_25

Chapter 4 Spatially Organized Differentiation of Mouse Pluripotent Stem Cells on Micropatterned Surfaces Sophie M. Morgani and Anna-Katerina Hadjantonakis Abstract Pluripotent stem cells (PSCs) are the in vitro counterpart of the pluripotent epiblast of the mammalian embryo with the capacity to generate all cell types of the adult organism. During development, the three definitive germ layers are specified and simultaneously spatially organized. In contrast, differentiating PSCs tend to generate cell fates in a spatially disorganized manner. This has limited the in vitro study of specific cell–cell interactions and patterning mechanisms that occur in vivo. Here we describe a protocol to differentiate mouse PSCs in a spatially organized manner on micropatterned surfaces. Micropatterned chips comprise many colonies of uniform size and geometry facilitating a robust quantitative analysis of patterned fate specification. Furthermore, multiple factors may be simultaneously manipulated with temporal accuracy to probe the dynamic interactions regulating these processes. The micropattern system is scalable, providing a valuable tool to generate material for large-scale analysis and biochemical experiments that require substantial amounts of starting material, difficult to obtain from early embryos. Key words Pluripotent stem cells, Micropatterns, Differentiation, EpiLCs, ESCs, Patterning, Gastrulation, Epiblast, Ectoderm, Mesoderm, Endoderm, Primitive streak

1

Introduction Gastrulation is the developmental process whereby pluripotent cells within the epiblast (Epi) of the embryo differentiate and spatially organize into three embryonic (or definitive) germ layers. Studying this complex process in vivo in mammalian models presents several challenges. At the onset of gastrulation, embryos get implanted into the uterus of the mother, rendering them somewhat inaccessible. In order to study this process, embryos must be extracted and cultured ex vivo under precisely optimized conditions. At early gastrulation stages, the embryo comprises of only a few thousand cells [1], hence experimental design is constrained by the availability of embryonic material. Throughout gastrulation the embryo is vastly increasing in size while undergoing morphogenetic processes. These rapid changes in size and shape mean that imaging

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_4, © Springer Science+Business Media, LLC, part of Springer Nature 2021

41

42

Sophie M. Morgani and Anna-Katerina Hadjantonakis

gastrulating embryos in their entirety, at a frequency and resolution to allow for single cell tracking, while maintaining viability is difficult and requires substantial computational capacity [2]. Furthermore, it is not possible to easily and accurately manipulate multiple factors simultaneously in vivo with temporal control. As a result of these compounding factors, fundamental questions remain regarding the dynamic regulation of mammalian gastrulation. Pluripotent stem cells (PSCs) are the in vitro counterparts of the pluripotent Epi. PSCs have the potential to give rise to all cell types of the adult organism and are used as a model of in vivo development. The majority of PSC differentiation protocols generate cell fates without obvious spatial organization, but the advent of organoid systems [3] revealed that, under appropriate conditions, PSCs can self-organize in vitro as they would during embryonic development. While most organoid systems mimic (post-gastrulation) organogenesis and comprise derivatives of a single germ layer, pluripotent human embryonic stem cells (ESCs) differentiated on circular micropatterns generate organized multi-germ layer colonies [4–7] reminiscent of gastrulating embryos [8]. However, ethical restrictions [9] prevent comparisons with human embryos. Based on the human ESC micropattern differentiation, we established a mouse PSC micropattern system. Comparisons to gastrulating mouse embryos revealed that micropatterned colonies can spatially organize both posterior and anterior cell fates (Fig. 1) in a manner that temporally recapitulates aspects of in vivo development [10]. First, mouse ESCs are converted to epiblast-like cells (EpiLCs) [11, 12] (Fig. 2), akin to the early post-implantation Epi. EpiLCs are seeded onto Laminin-coated micropatterns generating uniform circular colonies that are then exposed to gastrulation-promoting signals (Fig. 3). Patterning of cell fates is assessed by analysis (for example immunostaining) of appropriate markers (Fig. 4). This system facilitates the quantitative analysis of organized differentiation and may be adapted to screen for factors regulating these processes as well as forming cross species comparisons.

2

Materials Materials are stored at room temperature (RT) unless otherwise specified.

2.1

ESC Culture

1. Tissue culture-grade plates. 2. 5 mL and 10 mL serological pipettes. 3. 15 mL conical tubes. 4. Phosphate-buffered saline without calcium and magnesium (PBS ).

Micropattern Differentiation of Mouse PSCs

43

Fig. 1 Differentiation of mouse EpiLCs to posterior or anterior cell fates and correspondence to cell types present in the mouse embryo. Schematic diagram of cell fate domains after 72 h differentiation in anterior (left) or posterior (right) medium. Mouse EpiLCs may be differentiated under two distinct conditions on micropatterned surfaces. In anterior differentiation medium, mouse EpiLCs give rise to a central domain resembling the anterior epiblast and an outer domain that is a mix of definitive endoderm cells and cells that express markers common to both the anterior primitive streak and axial mesoderm, and therefore may represent one or both of these populations. In posterior differentiation medium, mouse EpiLCs give rise to a central domain of cells resembling the vicinity of the posterior epiblast, a mid domain corresponding to primitive streak (PS) and an outer domain that comprises a mix of cells corresponding to embryonic and extraembryonic mesoderm. The diagram highlights the location of the corresponding in vivo cell types in the embryonic day (E) 7.5-7.75 gastrulating mouse embryo. Extraembryonic endoderm and trophectoderm fates (grey) are not specified in this protocol. A anterior, P posterior, Pr proximal, Ds distal

5. 0.22 μm vacuum filter units. 6. 0.05% Trypsin-EDTA. 7. Hemocytometer. 8. 0.1% gelatin solution: dissolve 0.5 g gelatin in 500 mL PBS. Autoclave. 9. Serum/LIF medium: Dulbecco’s modified Eagle’s medium (DMEM) containing 0.1 mM nonessential amino acids (NEAA), 2 mM L-glutamine, 1 mM sodium pyruvate, 100 U/mL penicillin, 100 μg/mL streptomycin, 0.1 mM 2-mercaptoethanol, 10% ESC qualified fetal calf serum (FCS) (e.g., VWR), 1000 U/mL leukemia inhibitor factor (LIF). Combine components and sterile filter. Store at 4  C (see Note 1). 2.2 ESC to EpiLC Conversion

1. 1 mg/mL human plasma fibronectin-purified protein. Store at 4  C. 2. N2B27 Medium: 50% DMEM-F12, 50% Neurobasal medium, 1:200 N2 supplement (2 mL/400 mL medium), 1:100 B27

44

Sophie M. Morgani and Anna-Katerina Hadjantonakis

supplement (4 mL/400 mL medium), 2 mM L-glutamine, 100 U/mL penicillin, 100 μg/mL streptomycin, 0.1 mM 2-mercaptoethanol. Combine components and sterile filter. Store at 4  C. 3. Recombinant human FGF basic (FGF2): reconstitute to 25 μg/mL stock in sterile PBS with 0.1% bovine serum albumin (BSA). Aliquot and store at 80  C. 4. Recombinant human/murine/rat ACTIVIN A: reconstitute to 100 μg/mL stock in sterile dH2O with 0.1% BSA. Aliquot and store at 80  C. 5. Knockout serum replacement (KSR). Aliquot and store at 20  C. 6. EpiLC medium: N2B27 containing 12 ng/mL FGF2, 20 ng/ mL ACTIVIN A, 1% KSR. 7. Primary antibodies to validate EpiLC conversion: anti-KLF4 (1:200, AF3158, R&D Systems), anti-NANOG (1:500, REC-RCAB0002PF, Cosmo Bio Co), anti-OCT6 (1:100, MABN738, Millipore Sigma), anti-OTX2 (1:500, AF1979, R&D Systems). 2.3 Micropattern Coating

1. PBS with calcium and magnesium (PBS++). 2. Laminin (L2020, from Engelbreth-Holm-Swarm murine sarcoma basement membrane, Millipore Sigma) or recombinant human Laminin521 (A29248, Thermo Fisher Scientific). Thaw Laminin on ice (see Note 2), aliquot and store at 20  C. For micropattern coating, dilute to appropriate concentration (see Notes 3 and 4) in PBS++ 3. Parafilm® Sealing Film. 4. Micropatterned chips, e.g., Arena A (10-020-00-06) containing 80, 140, 225, 500, 1000 μm diameter micropatterns or Arena 1000 (10-001-00-18) containing 1000 μm diameter micropatterns (CYTOO) (see Note 5). 5. Primary antibody to validate Laminin coating (optional): antiLaminin (1:500, L-9393, Millipore Sigma) (Fig. 5c).

2.4 Micropattern Differentiation

1. ROCK inhibitor (ROCKi, Y-27632): reconstitute to 10 mM stock in sterile dH2O. Aliquot and store at 20  C. 2. Recombinant human BMP4: reconstitute to 50 μg/mL stock in sterile 4 mM HCl with 0.1% BSA. Aliquot and store at 80  C. 3. Recombinant human WNT3A protein: reconstitute to 200 μg/mL stock in PBS with 0.1% BSA. Aliquot and store at 80  C.

Micropattern Differentiation of Mouse PSCs

45

4. Posterior Differentiation Medium: N2B27 medium (see Subheading 2.2) with 12 ng/mL FGF2, 20 ng/mL ACTIVIN A, 50 ng/mL BMP4, 200 ng/mL WNT3a (see Note 6). 5. Anterior Differentiation Medium: N2B27 medium (see Subheading 2.2) with 12 ng/mL FGF2, 20 ng/mL ACTIVIN A, 200 ng/mL WNT3a. 2.5

Immunostaining

1. 4% paraformaldehyde (PFA). Aliquot and store at

20  C.

2. PBS-T: PBS++ with 0.1% Triton™ X-100. 3. Blocking buffer: PBS-T with 1% BSA and 3% serum corresponding to the host species of the secondary antibody (e.g., normal donkey serum). 4. Primary antibodies: anti-BRACHYURY (1:200, AF2085, R&D Systems), anti-CDH1/E-CADHERIN (1:500, U3254, Millipore Sigma), anti-CDH2/N-CADHERIN (1:300, sc-271,386, Santa Cruz Biotechnology), anti-CDX2 (1:200, AM392, Biogenex), anti-FOXA2 (1:500, Abcam), antiFOXF1 (1:100, ab168383, Abcam) anti-GATA6 (1:500, 5851, Cell Signaling), anti-SOX2 (1:500, 14-9811-82, eBioscience), anti-SOX17 (1:200, AF1942, R&D Systems). 5. Secondary antibodies: Alexa™ or DyLight™ Fluor conjugated secondary antibodies (1:500, Thermo Fisher Scientific). 6. Nuclear stain: Hoechst33342. 7. Fluoromount G™ slide mounting medium. 8. ImmEdge Hydrophobic Barrier PAP Pen. 9. Colorfrost Plus® Microscope Slides. 10. Optional: Deluxe diamond scribing pen.

3

Methods Steps executed at RT unless specified. Perform cell culture with sterile techniques in a laminar flow hood (see Note 7). Incubate cells at 37  C, 5% CO2, 90% humidity. Prewarm culture medium to 37  C in water bath. Follow waste disposal regulations.

3.1 Maintaining and Passaging ESCs in Serum/LIF Medium

Culture ESCs in serum/LIF medium (see Note 8) as previously described [10]. Passage every 2 days upon reaching approximately 80% confluence. 1. Coat tissue culture-grade plates with 0.1% of gelatin for 10 min (see Note 9). 2. Meanwhile, aspirate medium from confluent ESCs and wash with PBS .

46

Sophie M. Morgani and Anna-Katerina Hadjantonakis

3. Add 0.05% of Trypsin-EDTA (1 mL/well of a 6-well plate, 3 mL/10 cm plate). Incubate at 37  C until cells begin to round up and detach from the plate. 4. Pipette Trypsin-EDTA up and down onto plate surface until cells detach and dissociate into a single cell suspension. 5. Add an equal volume of serum/LIF medium. 6. Centrifuge for 3 min, 1300 rpm. 7. Aspirate supernatant. Resuspend cell pellet in fresh, prewarmed serum/LIF medium. 8. Aspirate gelatin from tissue culture plate. Replace with serum/ LIF medium. 9. Plate 1/5 of ESCs into gelatinized plate. 10. Incubate at 37  C, 5% CO2, 90% humidity. Change serum/LIF medium every day. 3.2 ESC to EpiLC Conversion

EpiLCs are generated as described [11, 12] (Fig. 2a). A typical EpiLC conversion is shown in Fig. 2b. 1. Coat tissue culture plate with 16.7 μg/mL Fibronectin (for 10 cm plates, 67 μL Fibronectin diluted in 4 mL PBS ) for 30 min at 37  C. 2. Aspirate Fibronectin and wash twice with PBS

.

3. Add EpiLC medium to tissue culture plate (7.5 mL of medium/10 cm plate) and place in incubator until ready to plate cells. 4. Trypsinize and collect ESCs (see steps 2–6 in Subheading 3.1). 5. Following centrifugation, aspirate supernatant. Resuspend cell pellet in EpiLC medium. 6. Count cells and plate 25,000 cells/cm2 (~1  105 cells/well of a 12-well plate, 1.6  106 cells/10 cm plate). 7. Culture cells in EpiLC medium for 48 h. Change medium daily. 8. Fix cells for EpiLC validation by immunostaining (see Note 10 and Subheading 3.5, Fig. 2c, d) or proceed to next step. 3.3 Micropattern Coating

Prior to setting up experiments, optimize Laminin coating concentration (see Notes 2–4). 1. In a laminar flow tissue culture hood, transfer micropatterned chip with forceps (see Note 11) to a 6-well plate. Chips (CYTOO) are packaged with micropatterns facing down. Invert (micropatterns up) in 6-well plate. 2. Immediately wash chip with PBS++ (see Note 12). Do not allow chip to dry during subsequent steps.

Micropattern Differentiation of Mouse PSCs

47

Fig. 2 ESC to EpiLC conversion. (a) Schematic diagram of ESC to EpiLC conversion [11, 12]. ESCs are cultured in serum/LIF medium on gelatin-coated plates then plated at low density onto fibronectin-coated plates for 48 h in N2B27 with 12 ng/mL FGF2, 20 ng/mL ACTIVIN A, 1% KSR. (b) Brightfield images of a typical ESC to EpiLC conversion. ESC colonies are slightly domed whereas EpiLC colonies are flattened. (c) Schematic diagram indicating dynamic marker expression, which may be used to validate the ESC to EpiLC conversion. KLF4 is lost, NANOG reduced and OTX2 and OCT6 upregulated upon EpiLC conversion. (d) Confocal optical sections of immunostained ESC and EpiLC colonies. Nuclei pseudocolored in gray, lineage markers as indicated on figure. Scale bars, 50 μm

3. Dilute Laminin to the optimal concentration in PBS++. 4. Coat chips by aspirating PBS++ and immediately cover chip with Laminin (~2 mL/well) or coat in a smaller volume by inverting (micropatterns down) on 700 μL Laminin droplets within Parafilm-lined plates (Fig. 3a). 5. Incubate chips for 2 h at 37  C. 6. Wash chips in 6-well plates with PBS++. Where droplet coating is used, invert (micropatterns up) and transfer to plate before washing. Add 10 mL PBS++/well. Gently swirl plate then aspirate 8 mL PBS++ ensuring chip remains covered with liquid (see Note 13). 7. Repeat wash with PBS++ six times.

48

Sophie M. Morgani and Anna-Katerina Hadjantonakis

Fig. 3 Micropattern differentiation of mouse EpiLCs. (a) (i) To coat micropatterns in a small volume of Laminin solution, line tissue culture plate with Parafilm. Make 700 μL Laminin droplets on surface. Using forceps, invert chips (micropatterns face down) so that they lie floating on top of droplet. Only contact edge of chip with forceps and do not allow chip to dry. Carefully transfer plate to incubator ensuring that chips do not fall off or sink to bottom of droplet. Incubate for 2 h, 37  C. (ii) Chips inverted on Laminin droplets for coating. (b) Schematic diagram of mouse PSC micropattern differentiation. Briefly, convert ESCs to EpiLCs [11, 12] (Fig. 2a). Plate 2  106 EpiLCs per Laminin-coated chip in a 6-well plate in N2B27 medium with 12 ng/mL FGF2, 20 ng/mL ACTIVIN A, 10 μM ROCKi until cells adhere forming a confluent monolayer (~2 h). Replace medium with N2B27 with 12 ng/mL FGF2, 20 ng/mL ACTIVIN A and incubate overnight. The following day, add differentiation medium: N2B27 with 12 ng/mL FGF2, 20 ng/mL ACTIVIN A, 200 ng/mL WNT3A, 50 ng/mL BMP4 for posterior differentiation or N2B27 with 12 ng/mL FGF2, 20 ng/mL ACTIVIN A, 200 ng/mL WNT3A for anterior differentiation. Differentiate for 72 h. (c) Brightfield images highlighting morphological changes during posterior micropattern differentiation of 1000 μm diameter colonies. Upon plating, cells must form a confluent monolayer. At 24 h onwards, a ridge of two to three cell layers thickness emerges at the colony edge, becoming wider and more centrally positioned over time (48–72 h). Dashed line highlights ridge in half of the colony. (d) Schematic diagram depicting side profile of micropatterned colonies. Colonies start as a monolayer and form a “volcano-like” structure as a ridge develops at periphery

Micropattern Differentiation of Mouse PSCs

49

8. Store coated micropatterns in PBS++ overnight at 4  C or proceed with next step. 3.4 EpiLC Micropattern Differentiation

1. Differentiate EpiLCs as previously described [10] (Fig. 3b) (see Subheading 3.2). 2. Using forceps, transfer Laminin-coated chips to a new 6-well plate. 3. Add 2 mL EpiLC medium containing 10 μM ROCKi. Incubate at 37  C until ready to plate cells. 4. Trypsinize and collect EpiLCs (see Subheading 3.1). 5. Following centrifugation, aspirate supernatant. Resuspend cell pellet in EpiLC medium. 6. Count cells and plate 2  106 EpiLCs/well ensuring even distribution (see Note 14). 7. Carefully move plate to the incubator to avoid swirling cells to the center of the well. Incubate for ~2 h until cells adhere and form a confluent monolayer on the micropatterns (see Note 15). 8. Aspirate medium. Gently wash 2 with PBS

(see Note 12).

9. Replace with N2B27 medium containing 12 ng/mL FGF2 and 20 ng/mL ACTIVIN A medium (no ROCKi) and incubate overnight at 37  C (see Note 16). 10. The following day, aspirate medium, carefully wash 2 with PBS and replace with either Posterior Differentiation Medium (N2B27 with 12 ng/mL FGF2, 20 ng/mL ACTIVIN A, 50 ng/mL BMP4, 200 ng/mL WNT3A) or Anterior Differentiation Medium (N2B27 with 12 ng/mL FGF2, 20 ng/mL ACTIVIN A, 50 ng/mL 200 ng/mL WNT3A). 11. Culture micropattern differentiated EpiLC for up to 72 h. Every day, aspirate medium, gently wash with PBS and replace with fresh differentiation medium (see Notes 17–22). 3.5

Immunostaining

Patterning of micropatterned colonies may be assessed by immunostaining for appropriate markers (Fig. 4a–c). 1. Gently wash micropatterns 2 with PBS

.

2. Fix with 4% PFA for 15 min (see Note 23). 3. Wash 2 with PBS

.

4. Permeabilize with PBS-T for 10 min. 5. Add blocking buffer for 30 min (see Note 24). 6. Incubate with primary antibodies diluted in PBS-T with 1% BSA, overnight at 4  C. 7. The following 3  10 min.

day

wash

micropatterns

with

PBS-T,

50

Sophie M. Morgani and Anna-Katerina Hadjantonakis

Fig. 4 Assessment of micropattern differentiation. (a) Representative confocal maximum intensity projections of 1000 μm diameter colony at 72 h of posterior differentiation. Colony immunostained with anti-CDX2, -BRACHYURY and -SOX2 antibodies (see Subheading 3.5). Three colony domains (outer, mid, center) are apparent. Key markers expressed within each domain are listed beneath single-channel images. (b) Table highlighting key events, colony appearance and marker expression during posterior micropattern differentiation. At 0 h, the colony appears relatively homogeneous by morphology and expression. At 24 h, SOX2 is downregulated and BRACHYURY (BRA) upregulated at colony edge. A small ridge can be seen at the periphery corresponding to the BRA expression domain. At 48 h, the BRA expression domain and ridge expands inwards. Embryonic and extraembryonic mesoderm markers start to be expressed at the colony periphery. Cells are observed that coexpress BRA and CDX2. Cells at edge undergo an epithelial to mesenchymal transition, downregulating E-CADHERIN and upregulating N-CADHERIN. At 72 h, both the BRA primitive streak-like domain and the embryonic and extraembryonic mesoderm domains expand inwards. A greater proportion of cells have downregulated E-CADHERIN and upregulated N-CADHERIN. (c) Representative confocal maximum intensity projections of a 1000 μm diameter colony after 72 h of anterior differentiation. Colony immunostained with anti-FOXA2, anti-SOX17 and anti-SOX2 antibodies. Two colony regions (outer and center) are apparent representing distinct cell fates. Key markers expressed within each region are listed beneath single-channel images. Scale bars, 100 μm

Micropattern Differentiation of Mouse PSCs

51

8. Incubate micropatterns with secondary antibodies, diluted in PBS-T with 0.1% BSA, 2 h at RT. 9. Wash micropatterns with PBS-T, 2  10 min. 10. Incubate micropatterns with PBS-T with 5 μg/mL Hoechst for 15 min. 11. Replace with PBS-T. 12. To mount micropatterns for imaging, draw a micropatternsized boundary on a microscope slide with a hydrophobic pen. 13. Add a drop of Fluoromount G mounting medium within the boundary. 14. Using forceps, invert (micropatterns down) immunostained chip onto mounting medium. Medium will spread to edge of chip. 15. Leave overnight on a flat surface, in a dark place to dry at RT. 16. Image micropatterns via confocal microscopy. Images of 512  512 pixels acquired using a 20 objective (see Notes 25 and 26) and 2  2 tiling gives sufficient resolution for downstream quantitative analysis as previously described [10] (see Note 27).

4

Notes 1. Micropatterned chips (CYTOO) are not considered sterile and cannot be treated with UV radiation without causing damage. Therefore, cell culture is performed in antibiotic-containing medium. 2. Thaw Laminin slowly on ice, as per manufacturer’s instructions. Thawing at higher temperatures may result in gel formation and uneven coating of chips. 3. Cells frequently adhere to chips outside of the micropatterned area (Fig. 5a). To reduce nonspecific binding, the manufacturer (CYTOO) recommends optimizing Laminin coating concentration on a per batch basis. The optimal coating concentration for Laminin521 LOT# 80153 (A29248, Thermo Fisher Scientific) is 10 μg/mL (Fig. 5b, c). 4. The spatial organization of cell fates is comparable when micropatterns are coated with Laminin (L2020, from EngelbrethHolm-Swarm murine sarcoma basement membrane, Millipore Sigma), recombinant human Laminin521 (A29248, Thermo Fisher Scientific), or recombinant human Laminin521 mixed with Fibronectin (FC010, Millipore Sigma). 5. Commercially available micropatterned chips (CYTOO) should be stored at 4  C. Under these conditions, chips have a shelf life of 6 months after production. After this time, binding of cells to the surfaces becomes suboptimal. A gradual

52

Sophie M. Morgani and Anna-Katerina Hadjantonakis

Fig. 5 Troubleshooting binding of cells outside of micropattern. When differentiating mouse EpiLCs on commercially available micropatterned surfaces (CYTOO), we frequently observed binding of cells outside of the circular micropattern, rendering these regions unusable for downstream analysis. (a) Brightfield images showing low magnification (left 2 panels) of chips. Asterisks highlight regions with elevated binding outside of micropatterns. Right panel shows high magnification image of cells growing outside of the micropattern. Dashed line marks approximate micropattern border. (b) To reduce binding outside of micropatterns, Laminin coating concentration may be titrated for each new Laminin batch. Using 10 μg/mL Laminin521, A29248, LOT: 80153 (Thermo Fisher Scientific) gave optimal cell binding. Coating with lower concentrations (5 μg/mL) resulted in reduced cell binding at micropattern edge whereas higher concentrations (20 μg/mL) resulted in elevated binding outside of micropatterns. (c) Laminin coating may be assessed directly by immunostaining with an anti-Laminin antibody. Coating with 20 μg/mL Laminin led to Laminin binding outside of micropatterns (arrowheads)

Micropattern Differentiation of Mouse PSCs

53

decrease in cell binding efficiency to chips may be observed over time. 6. Cytokines are added to differentiation medium at saturating concentrations. The effect of titrating cytokines to lower concentrations has not been assessed for this system. 7. As for all ESC experiments, general rules of good tissue culture practice should be followed. For example, medium should be prewarmed, cells should not be allowed to become over confluent, low passage ESC stocks should be maintained and, where possible, ESCs below passage number 30 used. Karyotyping and mycoplasma tests should be carried out at regular intervals. 8. While the EpiLC conversion protocol [11, 12] recommends using 2i-cultured ESCs, 2i medium contains CHIR99021, which activates WNT signaling and consequently Brachyury expression [13]. As Brachyury regulates primitive streak and mesoderm formation during gastrulation, the processes this protocol aims to recapitulate, we opt to use serum/LIFcultured ESCs. The outcome of using distinct ESC starting states has not been extensively compared for this protocol. Upon EpiLC conversion, we see comparable downregulation of KLF4, NANOG and upregulation of OTX2, POU3F1 from 2i or serum/LIF-cultured ESCs. 9. ESC lines maintained on feeders should be weaned off feeders prior to micropattern differentiation. Contaminating feeder cells will introduce additional factors and morphological heterogeneity, which may disrupt organized differentiation. 10. Prior to proceeding with micropattern differentiation, it is important to confirm that cell lines of interest undergo an efficient ESC to EpiLC conversion. We observe that cells corresponding to earlier (ESC) or later (EpiSC) developmental states do not efficiently pattern in this protocol [10] (Fig. 6a). Hence, poor conversion may prevent patterning. To note, EpiSCs maintained in the presence of WNT pathway inhibitors represent an earlier developmental state than standard EpiSCs [14–16] and show a higher degree of spatial organization on micropatterns than standard EpiSCs (Fig. 6b). However, EpiLCs are the optimal starting state to generate the three described cell fate domains (Fig. 1a). For initial validation, carry out EpiLC conversion in standard microscope compatible tissue culture vessels, facilitating direct immunostaining and imaging. 11. Carefully contact micropattern chips only at the edge of the glass surface where micropatterns are not present to avoid damaging their surface.

54

Sophie M. Morgani and Anna-Katerina Hadjantonakis

Fig. 6 Optimal starting states for mouse PSC micropattern differentiation. If an inappropriate starting cell state is used for this protocol, organized differentiation will not be observed. A homogeneous, flat epithelial layer should be observed after overnight plating of EpiLCs (as illustrated in Fig. 3c). (a) Brightfield images of unsuccessful micropattern differentiation caused by issues with the starting population. (i) Cells plated onto micropatterns contained a high proportion of differentiated cells. Yellow arrowheads highlight regions of differentiation disrupting morphology and downstream differentiation. (ii) ESCs or (iii) EpiSCs plated onto micropatterns give rise to heterogeneous, uneven colonies. While there is some evidence of organized differentiation at the edge of these colonies, the center represents a spatially disorganized mix of different fates. (b) EpiSCs cultured in standard EpiSC medium (FGF and ACTIVIN) specify fates in a disorganized manner. EpiSCs cultured in EpiSC medium with WNT pathway inhibitors (WNTi) such as XAV, show greater spatial organization of fates at the outer colony edge but still exhibit disorganized cell fates within the colony center. (c) EpiLCs must form a confluent monolayer after plating. If initial cell density is too low and a monolayer is not formed, as shown here, cells form discrete clusters and do not undergo organized differentiation

Micropattern Differentiation of Mouse PSCs

55

12. Pipette solutions onto the side of tissue culture plates rather than directly onto the surface of the micropatterns to avoid damaging micropatterns and dislodging cells. Cells are especially prone to detaching immediately after plating. 13. When washing chips/exchanging medium, chips may float to the surface. Use forceps to carefully push the micropatterned chips to the bottom of the well, contacting only the perimeter, which does not contain micropatterns. 14. Upon seeding cells, rock plate in all directions (in the horizontal plane) until cells are evenly distributed throughout well. 15. A critical step for successful micropattern differentiation is ensuring a confluent, homogeneous cell layer immediately after plating (Fig. 3c). ESC/EpiLC cultures containing a high proportion of differentiated cells, starting from ESCs or EpiSCs (see Note 10) or too low a cell density can result in an uneven, heterogeneous cell layer that fails to undergo organized differentiation. 16. ROCKi is added to cells for the first 2 h of micropattern differentiation. ROCKi reduces cell death [17, 18], which is often observed upon single cell dissociation of human ESCs and mouse EpiSCs. However, the requirement of ROCKi for mouse EpiLC micropattern differentiation has not been assessed. Removal of the ROCKi after 2 h causes cells to retract, often leaving gaps between cells. A confluent epithelial layer is reestablished after overnight incubation. 17. Fresh differentiation medium should be made each day by adding cytokines to N2B27. 18. Cell death is observed during micropattern differentiation (as with many PSC differentiation protocols), hence micropatterns are washed and fresh medium added daily to eliminate debris. 19. Temporal changes in colony morphology (Fig. 3c, d) are a good indication of successful differentiation. 20. As cells are confluent from the start of micropattern differentiation, at 72 h colonies are over-confluent, cell death is extensive, and colonies begin to detach from the surface. Therefore, cells cannot be maintained in a healthy state beyond this point. 21. Colonies may detach from chips even after fixation. Add solutions to micropatterns carefully, as described (see Note 12). 22. We have noted that different cell lines, or the same cell lines maintained in different labs, can show distinct patterning dynamics. While we mostly observed that three distinct cell layers (Fig. 4a) were specified at 72 h, we also observed that some cell lines already specified these three layers by 48 h. Thus, the timing of the protocol may need to be optimized for individual cell lines.

56

Sophie M. Morgani and Anna-Katerina Hadjantonakis

Fig. 7 Variability in micropattern differentiation. (a) Schematic diagram showing dynamic changes in cell fate domains during posterior micropattern differentiation. Cell fate domains gradually become more centrally localized (indicated by black arrows). At ideal timing and starting density, three cell fate domains can be clearly distinguished at 72 h. If left to proceed slightly past 72 h (72 h +), the BRACHYURY-expressing primitive streak-like domain will progress to a more central position within the colony so that BRACHYURY and SOX2 (posterior Epi-like) cells are intermixed (see panel c ii). (b) In addition to variation between experiments based on precise timing of fixation, variability may be observed across chips if the starting density is not even. In colonies with a lower starting density of cells (i), the onset of patterning is likely to be somewhat delayed relative to that of colonies with a higher starting density (ii). Therefore, the final patterning may appear similar to that of colonies fixed at slightly different time points (see panel a). (c) Confocal Maximum Intensity projections of two distinct immunostained colonies after 72 h of posterior micropattern differentiation. Colony 1 (i) shows three domains (outer—CDX2, mid—BRACHYURY (BRA), center—SOX2. Colony 2 (ii) has only two domains (outer—CDX2, center—SOX2 and BRA). Colony 2 appears later in differentiation as BRA-expressing cells are more centrally localized, intermixed with SOX2 cells. To note, 72 h micropatterned colonies are multiple cell layers thick. Mesenchymal populations (e.g., BRA cells) are initially at the edge of the colony but observed more centrally below the upper epithelial (SOX2) layer at later stages. The dynamic nature of micropattern differentiation and inward movement of domains over time can give slightly different outcomes (e.g., relative width and positioning of domains) depending on the precise fixation time of colonies (see Notes 22 and 23. Differences between colonies on the same chip may arise due to initial disparity in plating density that could affect the timing of differentiation (see Note 27)

23. Micropattern differentiation is a dynamic process. Slight differences in the time that the experiment is stopped, and colonies are fixed can affect the precise patterning observed (Fig. 7).

Micropattern Differentiation of Mouse PSCs

57

24. To assess the expression of multiple markers on one chip, the glass may be cut using a diamond scribe. After fixation of cells on micropatterns, line a flat surface (e.g., tissue culture plate) with Parafilm. Place chip (colony side up) on top of Parafilm and hold in place by carefully pressing down on one corner with forceps. Score along glass using a diamond scribe and break apart. To note, as scoring will damage some colonies, to ensure a high enough number of colonies per condition for analysis it is not recommended to break chips into more than three pieces. 25. Image immunostained micropatterns with the objective facing the mounted micropattern chip, as opposed to the microscope slide, so that colonies are on the surface closest to the objective. 26. While micropatterned colonies initially form a monolayer, a 3D structure emerges over time (Fig. 3c). As regions of a properly differentiated colony are multiple cell layers thick, they are best imaged by confocal microscopy (achieving proper z-sectioning) rather than standard epifluorescence microscopy, for accurate quantification. 27. Micropattern differentiation is density dependent [5, 7]. Differences in initial seeding density of EpiLCs across the chip or in relative proliferation rate of cell lines will likely influence the outcome, e.g., rate of differentiation and relative size of domains. This should be considered when comparing cell lines. When comparing cell lines, assess proliferation rates. Select appropriate control parental cell lines when assessing mutant phenotypes. References 1. Power MA, Tam PPL (1993) Onset of gastrulation, morphogenesis and somitogenesis in mouse embryos displaying compensatory growth. Anat Embryol 187(5):493–504. https://doi.org/10.1007/BF00174425 2. McDole K, Guignard L, Amat F, Berger A, Malandain G, Royer LA, Turaga SC, Branson K, Keller PJ (2018) In toto imaging and reconstruction of post-implantation mouse development at the single-cell level. Cell 175(3):859–876.e833. https://doi.org/ 10.1016/j.cell.2018.09.031 3. Turner DA, Baillie-Johnson P, Martinez Arias A (2016) Organoids and the genetically encoded self-assembly of embryonic stem cells. BioEssays 38(2):181–191. https://doi. org/10.1002/bies.201500111 4. Deglincerti A, Etoc F, Guerra MC, Martyn I, Metzger J, Ruzo A, Simunovic M, Yoney A, Brivanlou AH, Siggia E, Warmflash A (2016)

Self-organization of human embryonic stem cells on micropatterns. Nat Protoc 11 (11):2223–2232. https://doi.org/10.1038/ nprot.2016.131 5. Etoc F, Metzger J, Ruzo A, Kirst C, Yoney A, Ozair MZ, Brivanlou AH, Siggia ED (2016) A balance between secreted inhibitors and edge sensing controls gastruloid self-organization. Dev Cell 39(3):302–315. https://doi.org/10. 1016/j.devcel.2016.09.016 6. Tewary M, Ostblom J, Prochazka L, ZuluetaCoarasa T, Shakiba N, Fernandez-Gonzalez R, Zandstra PW (2017) A stepwise model of reaction-diffusion and positional information governs self-organized human perigastrulation-like patterning. Development 144(23):4298–4312. https://doi.org/10. 1242/dev.149658 7. Warmflash A, Sorre B, Etoc F, Siggia ED, Brivanlou AH (2014) A method to recapitulate

58

Sophie M. Morgani and Anna-Katerina Hadjantonakis

early embryonic spatial patterning in human embryonic stem cells. Nat Methods 11 (8):847–854. https://doi.org/10.1038/ nmeth.3016 8. Heemskerk I, Warmflash A (2016) Pluripotent stem cells as a model for embryonic patterning: from signaling dynamics to spatial organization in a dish. Dev Dynam 245(10):976–990. https://doi.org/10.1002/Dvdy.24432 9. Aach J, Lunshof J, Iyer E, Church GM (2017) Addressing the ethical issues raised by synthetic human entities with embryo-like features. elife 6:e20674. https://doi.org/10.7554/eLife. 20674 10. Morgani SM, Metzger JJ, Nichols J, Siggia ED, Hadjantonakis AK (2018) Micropattern differentiation of mouse pluripotent stem cells recapitulates embryo regionalized cell fate patterning. elife 7:e32839. https://doi.org/ 10.7554/eLife.32839 11. Hayashi K, Ohta H, Kurimoto K, Aramaki S, Saitou M (2011) Reconstitution of the mouse germ cell specification pathway in culture by pluripotent stem cells. Cell 146(4):519–532. https://doi.org/10.1016/j.cell.2011.06.052 12. Hayashi K, Saitou M (2013) Stepwise differentiation from naive state pluripotent stem cells to functional primordial germ cells through an epiblast-like state. Methods Mol Biol 1074:175–183. https://doi.org/10.1007/ 978-1-62703-628-3_13 13. Arnold SJ, Stappert J, Bauer A, Kispert A, Herrmann BG, Kemler R (2000) Brachyury is a target gene of the Wnt/beta-catenin signaling pathway. Mech Develop 91(1–2):249–258. https://doi.org/10.1016/S0925-4773(99) 00309-3 14. Kurek D, Neagu A, Tastemel M, Tuysuz N, Lehmann J, van de Werken HJG, Philipsen S, van der Linden R, Maas A, van IJcken WFJ,

Drukker M, ten Berge D (2015) Endogenous WNT signals mediate BMP-induced and spontaneous differentiation of epiblast stem cells and human embryonic stem cells. Stem Cell Report 4(1):114–128. https://doi.org/10. 1016/j.stemcr.2014.11.007 15. Sumi T, Oki S, Kitajima K, Meno C (2013) Epiblast ground state is controlled by canonical Wnt/beta-catenin signaling in the postimplantation mouse embryo and epiblast stem cells. PLoS One 8(5):e63378. https://doi.org/10. 1371/journal.pone.0063378 16. Wu J, Okamura D, Li M, Suzuki K, Luo CY, Ma L, He YP, Li ZW, Benner C, Tamura I, Krause MN, Nery JR, Du TT, Zhang ZZ, Hishida T, Takahashi Y, Aizawa E, Kim NY, Lajara J, Guillen P, Campistol JM, Esteban CR, Ross PJ, Saghatelian A, Ren B, Ecker JR, Belmonte JCI (2015) An alternative pluripotent state confers interspecies chimaeric competency. Nature 521(7552):316. https://doi. org/10.1038/nature14413 17. Ohgushi M, Matsumura M, Eiraku M, Murakami K, Aramaki T, Nishiyama A, Muguruma K, Nakano T, Suga H, Ueno M, Ishizaki T, Suemori H, Narumiya S, Niwa H, Sasai Y (2010) Molecular pathway and cell state responsible for dissociation-induced apoptosis in human pluripotent stem cells. Cell Stem Cell 7(2):225–239. https://doi.org/10.1016/j. stem.2010.06.018 18. Watanabe K, Ueno M, Kamiya D, Nishiyama A, Matsumura M, Wataya T, Takahashi JB, Nishikawa S, Nishikawa S, Muguruma K, Sasai Y (2007) A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nat Biotechnol 25 (6):681–686. https://doi.org/10.1038/ nbt1310

Chapter 5 Mouse Primordial Germ Cells: In Vitro Culture and Conversion to Pluripotent Stem Cell Lines Malgorzata Borkowska and Harry G. Leitch Abstract Primordial germ cells (PGCs) are the embryonic precursors of the gametes. Despite decades of research, in vitro culture of PGCs remains a major challenge and has previously relied on undefined components such as serum and feeders. Notably, PGCs cultured for extended periods do not maintain their lineage identity but instead undergo conversion to form pluripotent stem cell lines called embryonic germ (EG) cells in response to LIF/STAT3 signaling. Here we report both established and new methodologies to derive EG cells, in a range of different conditions. We show that basic fibroblast growth factor is not required for EG cell conversion. We detail the steps taken in our laboratory to systematically remove complex components and establish a fully defined protocol that allows efficient conversion of isolated PGCs to pluripotent EG cells. In addition, we demonstrate that PGCs can adhere and proliferate in culture without the support of feeder cells or serum. This may well suggest novel approaches to establishing short-term culture of PGCs in defined conditions. Key words Primordial germ cells, Germline, Embryonic germ cells, Pluripotency, Pluripotent stem cells, Stem cells

1

Introduction In mice, germline segregation from the pluripotent epiblast occurs shortly after implantation. It is a key event during embryogenesis, a requirement for continuation of the species. Primordial germ cells (PGCs) are the earliest progenitors of the germline. After specification PGCs proliferate and migrate to the genital ridge where, upon arrival, they undergo a period of profound epigenetic reprogramming. Thereafter, sex-specific germ cell differentiation ensues, marking the end of PGC development. The early stages of PGC development are relatively inaccessible in the embryo, and their migratory nature means PGCs progress through a range of different in vivo environments. This presents a major challenge, in particular for the study of extrinsic factors which might regulate or guide the developmental progression of

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_5, © Springer Science+Business Media, LLC, part of Springer Nature 2021

59

60

Malgorzata Borkowska and Harry G. Leitch

PGCs.In vitro culture of PGCs would appear to be an obvious system to circumvent some of these difficulties and to establish the factors necessary to support PGC development. However, hitherto PGC culture has proved difficult and relied on complex culture systems and undefined components, such as feeder cells [1]. Early attempts to culture PGCs led to the derivation of the first embryonic germ (EG) cell lines [2, 3]. Rather than bearing the hallmarks of PGCs or germ cells, EG cells are pluripotent stem cell lines which can exhibit near-identical properties to ES cells [4– 6]. Hitherto, EG cell derivation has largely been used as a system to study the pluripotent characteristics of the germline, however recent progress may well impact future attempts to culture PGCs. A comprehensive review of the PGC culture literature is beyond the scope of this chapter, but can be found elsewhere [1, 7, 8]. The requirement for a feeder-layer has been widely accepted, as PGCs cultured in serum-based medium appear to rapidly undergo apoptosis when cultured feeder-free, regardless of the extracellular matrix provided [9]. An important role of the feeder layer appears to be provision of Steel factor (SF; also known as stem cell factor and Kit-ligand), as this is highly expressed in those feeder lines which efficiently support PGC culture. Membrane-bound SF, for instance provided by the Sl4-m220 cell line, appears to be particularly important, while feeders in which Steel is knocked out are less supportive for PGC survival and proliferation [10]. This is in keeping with the phenotypes of classic mouse mutants, Steel and W [11, 12]. When supportive feeders are combined with the growth factors leukemia inhibitory factor (LIF) or basic fibroblast growth factor (bFGF) PGC proliferation is enhanced, however the combination of all three factors leads to the formation of EG cells [2, 3]. Once derived, EG cells behave identically to mouse ES cells in culture and are bona fide naı¨ve pluripotent stem cell lines, as they can contribute to the somatic tissues and germline of chimeric mice [4, 5]. While both PGCs and ES/EG cells can form teratomas [13], PGCs have not been shown to contribute to chimeras following injection into early mouse embryos [14]. This is the basis for the convention to designate PGCs as unipotent, and to refer to EG cell derivation as a reprogramming event [15]. Early studies suggested that bFGF was the trigger for the PGC to EG cell conversion. In keeping with this, the addition of bFGF is only required during the first 48 h of culture [16]. Other factors, such as Retinoic Acid (RA), Forskolin (FK) [17], or Trichostatin A (TSA) [15], can replace bFGF, although in each case paracrine bFGF activity from feeders or somatic cells was not formally ruled out. Here, we include new data that indicates that bFGF is not necessary for EG cell derivation, findings which complement our previously published work. The main focus of this chapter is to outline the traditional method of EG cell derivation and to describe the incremental improvements

EG Cell Derivation

61

that we have made to allow EG cell derivation in fully defined conditions without feeders. This will provide a range of methodologies to derive mouse EG cells, and may well prove a useful starting resource for those wishing to establish defined, feeder-free PGC culture. This chapter necessarily focusses on our own methodologies for EG cell derivation, but we would point the reader towards important contributions and alternative protocols devised by others including the Hogan [18], Matsui [19], de Felici [20, 21], Nakano [22], and Suda [23, 24] laboratories.

2

Materials

2.1

Mice

Appropriate ethical and regulatory approval should be sought prior to performing animal experiments, as per local guidelines. Both 129/Sv and C57BL/6 strains have been used to generate EG cell lines that will contribute to the somatic cells and germ line of chimeras. The 129/Sv strain is likely permissive for EG cell derivation, although we are not aware of detailed side-by-side strain comparisons. Our preference is to cross 129/Sv females with a reporter strain of mouse (such as Oct4-ΔPE-GFP [25]) to generate fluorescently labeled PGCs, and we have obtained high derivation efficiencies even on such mixed backgrounds. Inbred mouse lines are available from The Jackson Laboratories (Bar Harbor, MA, 1-800-422-6423). Noon on the day of plug is embryonic day (E) 0.5.

2.2

Dissecting Tools

To dissect the embryos, we use fine-tip forceps such as Dumont #5 forceps. Careful dissection of the embryos is required to obtain as many PGCs as possible, including those still residing in the allantois. We perform all our dissections under a dissecting light microscope with a magnification up to 6
. We dissect deciduae from uteri in ice cold PBS and dissect embryos in a separate 10 cm dish filled with room temperature dissecting medium. Routine dissecting medium is 10% Fetal Calf Serum in Dulbecco’s PBS without calcium and magnesium; but other media can be used too, e.g., DMEM.

2.3

Tissue Culture

Plasticware can be purchased from a range of suppliers. Below we list the key reagents required. In our experience, there is significant variability between suppliers for certain cytokines. We have indicated our preference, based on current inhouse testing. All tissue culturing is performed under sterile conditions in the BioMat class 2 flow cabinet. We routinely culture cells at 37  C, in 7% CO2 and 21% O2. Lower oxygen is well tolerated by PGCs, but we have not rigorously assessed if this is beneficial. We monitor the cells using an

62

Malgorzata Borkowska and Harry G. Leitch

inverted light microscope, with an epifluorescence mode if the sorted PGCs contain a fluorescent marker. Sl4-m220 feeder medium: Dulbecco’s Modified Eagle Medium (DMEM), 10% Fetal Calf Serum, L-glutamine (2 mM), Sodium Pyruvate (1 mM). FCS/LIF medium: DMEM: Nutrient Mixture F-12 (DMEM/F12), 15% Foetal Calf Serum (FCS) (Sigma) (see Note 1), 0.1 mM Nonessential amino acids, 2 mM L-Glutamine, 1 mM Sodium Pyruvate, 0.1 mM β-mercaptoethanol, 10 μg/ ml LIF, (Millipore). N2B27 [26]: 1:1 Neurobasal:DMEM/F-12 (with DMEM/F12 from Sigma), L-Glutamine 2 mM, N2 1:200 (Life Technologies), B27 1:100 (Life Technologies), 0.1 mM β-mercaptoethanol (see Note 1). 2i/LIF medium: N2B27 supplemented with 1 μM PD0325901, (Adipogen), 3 μM CHIR99021, (Cambridge Biosciences), LIF 10 μg/ml (Qkine). Growth factors/inhibitors: 25 ng/ml bFGF (Thermofisher Scientific), 2 μM Retinioic Acid (RA), (Sigma), 10 μM Forskolin (FK) (Sigma), 100 ng/ml Steel Factor (SF) (R&D). Extracellular matrices: Laminin, 10 μg/ml in DPBS without Ca2+ and Mg2+ (PBS) (Sigma), Human Plasma fibronectin, 15–20 μg/ml in PBS (Millipore), Gelatin, 0.1% in PBS, Collagen IV plates (BD, Biocoat). Trypsin: 0.25% Trypsin, 1.3 mM EDTA, 0.1% Chick Serum in PBS. Penicillin/Streptomycin (see Note 2). 2.4

Feeders

The optimal feeder cell layer is Sl4-m220. These are available upon request or from Professor Yasuhisa Matsui (Graduate School of Life Sciences, Tohoku University). This is a derivative of an immortalized fibroblast cell line derived from Steel (Sl/Sl) mutant embryos. The Sl/Sl line was transfected with Steel factor cDNA derived from an alternatively spliced mRNA transcript lacking exon 6 (encoding a 220 amino acid protein) to generate Sl4-m220. This cell line expresses the membrane-associated Steel factor at a level 3–5 times higher than the secreted form [27] (see Note 3).

2.5

Flow Cytometry

For flow cytometric separation of PGCs we filter populations containing PGCs using a 5 ml tube with a 0.22 μm pore cell strainer (Fisher) immediately prior to sorting. We recommend the MoFlo MLS high speed flow sorter (DakoCytomation—BeckmanCoulter), if available. If not, conditions should be optimized to maximize cell viability post sorting (see Note 4).

EG Cell Derivation

3

63

Methods

3.1 Standard EG Cell Derivation 3.1.1 Preparation of a Feeder Layer

As for many immortalized lines, the Sl4-m220 cell line can be phenotypically variable depending on source and history. We have generated a robustly growing subline, as have others [28]. The parental line can be very sensitive to cell density, and does not tolerate inactivation well. Our subline can routinely be split 1:5 to 1:10, using trypsin. For EG cell derivation a fresh, evenly spread feeder layer is essential. Prepare feeders the day before derivation, no later than 6 p.m. Inactivate a confluent flask with mitomycin C (MMC) (Santa Cruz) at a concentration of 3 μg/ml for 2.5–3.5 h. Wash twice with PBS to get rid of MMC before trypsinization, neutralization, centrifugation, and plating in a pre-gelatinized 24-well plate. For an even cell layer plate 3.1
105 cells in 750 μl of medium per well. The next day, cells can be washed with PBS before adding derivation medium for pre-equilibration (see Note 5).

3.1.2 Collection of PGCs for Culture

PGCs are isolated from E8.5 mouse embryos as shown in the schematics (see Fig. 1) and previously described [29]. We routinely dissect in 10% FCS in PBS, unless serum is to be avoided. In brief, the posterior fragment of the embryo containing PGCs is dissected free of the extraembryonic membranes (see Note 6). Collected posterior fragments are washed twice in PBS and then trypsinized to a single-cell suspension, by vigorous pipetting using a P1000 and a filter tip (see Note 7). The trypsin is neutralized with copious 10% serum in PBS (or serum-free equivalent) and cells are collected by centrifugation. Cells are resuspended in FCS/LIF medium supplemented with bFGF (25 ng/ml) and plated on previously prepared feeder layer (see Subheading 3.1.1). One embryo equivalent can be split between two 2 cm2 wells. After 2 days, 50% of the medium is replaced with fresh FCS/LIF medium lacking bFGF. Subsequently, medium is changed every 24–48 h without bFGF supplementation.

3.1.3 Picking Primary EG Cell Colonies to Establish EG Cell Lines

After 10–14 days, primary EG cell colonies are picked, using a mouth pipette or alternative strategy (see Note 8). Single colonies are placed in a small drop of trypsin (approximately 20 μl), and incubated until cell boundaries are clearly observed. A single cell suspension can be obtained and the trypsin neutralized using an equal volume of 10% FCS. The suspension can then be transferred to a single well of 48-well tissue culture plate, in the desired culture conditions for expansion. Thereafter EG cells are cultured in an identical manner to mouse ES cells. For culture of ES cells using 2i/LIF we recommend the recently published methods paper [30]. The pluripotency of EG cell lines should be verified by demonstration of contribution to the somatic cells and germline of a mouse chimera (see Note 9).

64

Malgorzata Borkowska and Harry G. Leitch

A

Day 1

trypsinise

Day 3 Medium change

FCS/LIF +/PD17 +/bFGF (on feeders)

2i/LIF Feeders

B

Culture

No. of PGCs plated

No. of colonies

FCS/LIF+ bFGF

800

36

FCS/LIF

800

11

800

10

800

11

FCS/LIF + PD17 FCS/LIF+bFGF+PD17

Fig. 1 Initial provision of bFGF is not necessary for EG cell derivation. (a) Schematic of derivation protocol to test for requirement of bFGF in serum conditions. (b) Quantitation of EG cell colony formation following derivation in the conditions described. All performed on Sl4-m220 feeders 3.2 EG Derivation Using 2i/LIF Swap Protocol

We have previously demonstrated that the use of 2i/LIF medium improves the efficiency and consistency of EG cell derivation [31]. This can be achieved by following a modified standard EG cell derivation protocol, in which a complete medium change to 2i/LIF medium is performed 2 days after plating PGCs. In side-byside experiments, this 2i/LIF swap protocol increases the number of EG cell colonies obtained, compared with the standard protocol. In addition, the 2i/LIF swap protocol allows the derivation of EG cells without bFGF (see Fig. 1). In the representative experiment shown, E8.5 posterior fragment were pooled, trypsinized, collected by centrifugation. An equal volume of the single suspension (estimated to contain 800 PGCs) was plated in either FCS/LIF with or without FGF or with the addition of PD173074 (PD17),

EG Cell Derivation

65

an FGF receptor inhibitor (see Fig. 1a). After 2 days the culture medium was changed to 2i/LIF. As expected, numerous EG cell colonies were recovered in the presence of FGF, however, colonies also emerged in the absence of FGF and in the presence of PD17 (see Fig. 1b). This suggests that FGF does not play a unique role in triggering reprogramming during the first 48 h. Rather it appears that FGF acts to increase the efficiency of EG cell derivation, possibly by supporting PGC proliferation as described previously [2, 32]. This protocol can also be used to obtain rat EG cells [31, 33]. 3.3 EG Cell Derivation Directly into 2i/LIF (Without Serum or bFGF) on Feeders

EG cells can be obtained by plating trypsinized E8.5 posterior fragments directly in 2i/LIF medium on feeders [31]. However, derivation efficiency is less than with the 2i/LIF swap protocol. We have investigated conditions that would support more efficient serum-free EG cell generation. ES cells can be propagated robustly in any two of the three components of 2i/LIF without serum factors or feeders [34]. We tested each two-factor combination, and also the combination of FGF with 2i/LIF. In three independent experiments, dissociated E8.5 posterior fragments were pooled and plated on feeders without serum. For each test condition the equivalent of 4.5 embryos was plated in 9 wells. Cultures were monitored for 14 days and then scored for EG cell colonies. All three experiments showed the same trend (see Fig. 2a). There is considerable experiment-to-experiment variability in PGC cultures [35] (see Note 10). We therefore normalized to the derivation efficiency in 2i/LIF (see Fig. 2b). Consistent with previous findings, a small number of colonies were recovered in 2i/LIF [31]. No colonies were recovered in 2i consistent with our findings that LIF/Stat3 pathway is required for EG cell conversion (this also indicates that LIF activity from Sl4-m220 feeders is minimal) [36]. Numerous colonies were recovered in PD/LIF indicating that GSK3 inhibition is not essential. In fact, in these experiments more colonies were recovered in PD/LIF than in 2i/LIF suggesting that CH may have a negative effect. Notably, the CH/LIF condition allows for the extensive growth of somatic cells that rapidly overtake the cultures. Addition of FGF at the beginning of culture produced more than double the number of colonies in 2i/LIF alone. Since either addition of FGF or omission of CH increases the derivation efficiency, we assessed whether the combination of these conditions would lead to a further increase. In three independent experiments, E8.5 posterior populations were plated either in 2i/LIF or PD/LIF, with or without the addition of FGF (see Fig. 2c). Culture in PD/LIF + FGF led to a fivefold increase in yield compared with 2i/LIF (see Fig. 2d), an efficiency comparable to cultures initiated in serum [31].

66

Malgorzata Borkowska and Harry G. Leitch

B

Number of colonies

100

Fold increase relative to 2i+LIF

A 2i+LIF 2i

80

CH+LIF 60

PD+LIF 2i+LIF+FGF

40 20

***

4

**

3 2 1

*

0 2i+LIF

0 Experiment 1

Experiment 2

2i

PD+LIF

CH+LIF

2i+LIF+FGF

Experiment 3

C

D 6

2i+LIF

100

PD+LIF 2i+LIF+FGF

80

PD+LIF+FGF 60 40 20 0 Experiment 1

Experiment 2

Experiment 3

Fold increase relative to 2i+LIF

Number of colonies

120

***

5

***

4

*

3 2 1 0 2i+LIF

PD+LIF

2i+LIF+FGF

PD+LIF+FGF

Fig. 2 Assessment of the contribution of 2i/LIF components, and bFGF, to EG cell derivation in serum-free medium. (a) Three independent experiments in which one component of 2i/LIF is omitted from the derivation medium. Addition of bFGF is also tested. (b) Experiments shown in a, plotted as a fold increase relative to 2i/LIF. **P < 0.01, ***P < 0.001, one-way analysis of variance (ANOVA) with Tukey’s post hoc. (c) Three independent experiments testing the effect of bFGF, in combination with 2i/LIF or PD/LIF. (d) Experiments shown in c, plotted as a fold increase relative to 2i/LIF. *P < 0.05, ***P < 0.001, ANOVA with Tukey’s post hoc. All error bars show the standard error 3.4 Derivation of EG Cells Without Feeders

Despite the high derivation efficiency of EG cells in PD/LIF + bFGF on feeders we have not obtained EG cells in this condition without feeders. However, we have noticed that PGCs cultured in PD/LIF + FGF without feeders do not undergo apoptosis immediately, as reported in other conditions [9], and can persist for up to 96 h. We therefore investigated whether the addition of further mitogenic or survival factors might enhance PGC proliferation and enable derivation of EG cells without feeder cells. E8.5 posterior fragments were trypsinized and plated in PD/LIF medium with the addition bFGF, SF, RA, and FK (henceforth collectively called four factors—4Fs) for the first 2 days of culture. Four different matrices were tested for their ability to support PGC growth and EG cell conversion—gelatin, fibronectin, collagen IV, and laminin (see Fig. 3a). On day 3, GFP-positive cells were visible either as doublets or small clusters of cells, on all four matrices (see Fig. 3b). These cells exhibited a range of morphologies as has previously been described for PGCs in culture [37] (see Fig. 3b). After 5 days, small GFP-positive colonies were visible (see Fig. 3c). Some colonies contained loosely packed cells which

A

Day 1

trypsinise

Day 3 Half medium change

PD/LIF + GFs on different ECMs

PD/LIF

B Day 3 Fibronectin

Collagen IV

Fibronectin

Gelatin

Laminin

Gelatin

Laminin

GFP

Phase

Collagen IV

C

GFP

Phase

GFP

Phase

Day 5

Fig. 3 PGC morphology during early cultures. (a) Schematic of feeder-free derivation protocol. ECMs ¼ extracellular matrices. (b) Phase contrast and fluorescence images of PGCs after 2 days in culture. Oct4-ΔPE-GFP marks PGCs. (c) Phase contrast and fluorescence images of PGCs on day 5 of culture. Arrowheads mark more rounded cells. Arrows mark cells with an elongated or spindle shape. Scale bars, 50 μm

Malgorzata Borkowska and Harry G. Leitch

generally exhibited a spindle-shaped, PGC-like morphology. However, other colonies consisted of tightly packed cells similar in appearance to EG cells. Both types of colony, as well as those with intermediate morphologies, were visible on all four matrices suggesting the cellular phenotypes are not determined by the matrix (see Fig. 3c). Larger GFP-positive colonies were still visible on day 7 and day 14 (see Fig. 4). All surviving colonies from day 10 onwards

A

Day 7 Fibronectin

Gelatin

GFP

Phase

Collagen IV

B

Day 14 Fibronectin

Laminin

Phase

Collagen IV

GFP

68

C ECM

No. of colonies

Fibronectin

17

Collagen IV

13

Laminin

8

Gelatin

2

Fig. 4 PGCs cultured without feeders form EG cell colonies. Phase contrast and fluorescence images taken on day 7 (a) and day 14 (b). All scale bars, 50 μm (c) Summary of total EG cell colony number obtained on each extracellular matrix (ECM)

EG Cell Derivation

69

had the tightly packed morphology of EG cells. After 14 days, EG cell colonies were recovered from cultures initiated on all four matrices tested, although the highest number was recovered on fibronectin while only two colonies were recovered on gelatin (

see Fig. 4c). These could be picked, trypsinized, and expanded as EG cell lines in 2i/LIF. Therefore, it can be concluded that PD/LIF with the addition of 4Fs for 2 days is sufficient to derive EG cells without the presence of a feeder layer. However, a definitive conclusion as to the optimum matrix is complicated by the differential growth of somatic cells on each. The significant growth of somatic cells on all matrices tested also calls into question the cell-autonomous ability of PGCs to convert to EG cells. Therefore, removal of contaminating somatic cells is necessary to establish a fully defined system for EG cell derivation. 3.5 Derivation of EG Cells in Fully Defined Conditions

To remove somatic cells, it is possible to isolate PGCs from transgenicembryos carrying a PGC reporter by flow cytometry. This allows PGC cultures and EG cell derivation to be monitored without contaminating somatic cells, or feeders. We have previously published an efficient, fully defined EG cell derivation protocol using flow-sorted PGCs (see Fig. 5) [36]. In short, single cell suspensions from E8.5 posterior fragments are resuspended in N2B27, filtered and PGCs are isolated by flow cytometry. We routinely use the Oct4-ΔPE-GFP transgene [25], but other PGC specific reporters are equally effective. Flow sorted PGCs are plated in CH/LIF + 4Fs on fibronectin coated plates. A half medium change to 2i/LIF is performed after 48 h. Subsequently, halfmedium changes with 2i/LIF are performed every 24–48 h. This approach allows the derivation of EG cells from singly sorted E8.5 PGCs, and for first time from E7.5 embryos [36]. This protocol may seem counterintuitive given the protocols reported in Subheading 3.4. However, we found that when somatic cells are removed, the addition of CH actually increases derivation efficiency. This suggests that the negative impact of CH on EG cell derivation from unsorted PGCs (see Fig. 2) is due to somatic overgrowth, or by other indirect effects. In addition, this publication demonstrated that PD has a negative effect on EG cell Day 1 trypsinise

FACS

Day 3 Half medium change

CH/LIF+4Fs on Fibronectin

Fig. 5 Schematic of fully defined EG cell derivation protocol

2i/LIF

70

Malgorzata Borkowska and Harry G. Leitch

derivation from sorted PGCs, if present for the first 48 h. Therefore, the high derivation efficiency from unsorted PGCs in PD/LIF (see Fig. 2) may well be due, at least in part, to a selective effect against somatic cells.

4

Notes 1. All serum used in culture media should be batch tested, due to variability in batches. Similarly, the quality of N2B27 batches varies, and can have a marked impact on EG cell derivation efficiency. This can be partially solved by making N2 inhouse and batch testing. In general, N2B27 should be tested using established ES or EG cell lines prior to undertaking EG cell derivation. We can recommend the guidance suggested by [30]. 2. For routine culturing, we do not use antibiotics in our media. However, for handling cells outside sterile conditions, e.g., sorting and collecting EG cell colonies outside of a flow cabinet, it is recommended to use penicillin/streptomycin. 3. We have not tested all combinations of derivation protocol. In particular, we have not assessed EG cell derivation efficiency when sorted PGCs are plated on feeders. However, we note a recent paper in which a modified protocol that uses the approach shown in Fig. 5 but plates sorted E9.5 PGCs onto an Sl4-m220 feeder layer [38]. This too resulted in efficient derivation of EG cells. 4. PGCs are sensitive to flow cytometry. In our experience, cuvette-based sorters lead to worse survival than jet and air devices, possibly due to the lower shear stress in the latter. 5. Do not leave the feeders in the PBS for extended period. PBS wash removes any unattached or dead cells. However, for keeping the attached cells viable and healthy, medium should be provided. For serum derivations, derivation medium can be pre-equilibrated on the feeders for 1–4 h. For derivations directly into 2i/LIF (or other serum-free medias) pre-equilibration for longer than 2 h is not recommended. 6. Posterior fragments can either be managed separately (for instance, if sex or genotype is important) or, more routinely, pooled. 7. Insufficient trypsinization is a frequent error. Well-trypsinized tissue has a “grapey” appearance and more readily forms single cell suspension when pipetted. Insufficiently trypsinized tissue forms bigger clumps which can become sticky and troublesome to disaggregate. This will undoubtedly lead to loss of PGCs.

EG Cell Derivation

71

8. Depending on the shape and size of the colony, different picking approaches can be used. Mouth pipetting works well for colonies that are round and easily detachable. Gentle scraping off a colony with a P20 or P200 pipette tip is an alternative for flatter colonies. 9. In those EG cell lines in which genomic imprints are partially or fully erased, lower contribution chimeras are desirable to minimize somatic phenotypes associated with imprint abnormalities [39]. Genomic imprints will of course be reset upon passage through the germline and so resulting offspring will be unaffected. Healthy high contribution chimeras are readily obtained from EG cells with normal imprints [6, 31]. Both PGCs and EG cells can form teratomas, therefore the teratoma assay is not an appropriate test of pluripotency for EG cells as this does not necessarily demonstrate EG cell conversion. 10. Variability in the EG cell derivation efficiency is most likely due to litter-to-litter variability in PGC numbers between “E8.5” embryos. This occurs despite setting up timed matings and routinely preforming plug checks in the morning. References 1. Leitch HG, Tang WWC, Surani MA (2013) Primordial germ-cell development and epigenetic reprogramming in mammals. Curr Top Dev Biol 104:149–187. https://doi.org/10. 1016/B978-0-12-416027-9.00005-X 2. Resnick JL, Bixler LS, Cheng L, Donovan PJ (1992) Long-term proliferation of mouse primordial germ cells in culture. Nature 359:550–551. https://doi.org/10.1038/ 359550a0 3. Matsui Y, Zsebo K, Hogan BL (1992) Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture. Cell 70:841–847 4. Labosky PA, Barlow DP, Hogan BL (1994) Mouse embryonic germ (EG) cell lines: transmission through the germline and differences in the methylation imprint of insulin-like growth factor 2 receptor (Igf2r) gene compared with embryonic stem (ES) cell lines. Development 120:3197–3204 5. Stewart CL, Gadi I, Bhatt H (1994) Stem cells from primordial germ cells can reenter the germ line. Dev Biol 161:626–628. https:// doi.org/10.1006/dbio.1994.1058 6. Leitch HG, McEwen KR, Turp A et al (2013) Naive pluripotency is associated with global DNA hypomethylation. Nat Struct Mol Biol 20:311–316. https://doi.org/10.1038/ nsmb.2510

7. Donovan PJ (1994) Growth factor regulation of mouse primordial germ cell development. Curr Top Dev Biol 29:189–225. https://doi. org/10.1016/s0070-2153(08)60551-7 8. de Felici M (2004) Experimental approaches to the study of primordial germ cell lineage and proliferation. Hum Reprod Update 10:197–206. https://doi.org/10.1093/ humupd/dmh020 9. de Felici M, Pesce M, Giustiniani Q, Di Carlo A (1998) In vitro adhesiveness of mouse primordial germ cells to cellular and extracellular matrix component substrata. Microsc Res Tech 43:258–264. https://doi.org/10.1002/ (SICI)1097-0029(19981101)43:33.0.CO;2-1 10. Matsui Y, Toksoz D, Nishikawa S et al (1991) Effect of steel factor and leukaemia inhibitory factor on murine primordial germ cells in culture. Nature 353:750–752. https://doi.org/ 10.1038/353750a0 11. Mahakali Zama A, Hudson FP, Bedell MA (2005) Analysis of hypomorphic KitlSl mutants suggests different requirements for KITL in proliferation and migration of mouse primordial germ cells. Biol Reprod 73:639–647. https://doi.org/10.1095/biolreprod.105. 042846 12. Besmer P, Manova K, Duttlinger R et al (1993) The kit-ligand (steel factor) and its receptor

72

Malgorzata Borkowska and Harry G. Leitch

c-kit/W: pleiotropic roles in gametogenesis and melanogenesis. Dev Suppl:125–137 13. Stevens LC (1983) The origin and development of testicular, ovarian, and embryoderived teratomas. In: Cold Spring Harbor conferences on cell proliferation. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, pp 23–36 14. Leitch HG, Okamura D, Durcova-Hills G et al (2014) On the fate of primordial germ cells injected into early mouse embryos. Dev Biol 385:155–159. https://doi.org/10.1016/j. ydbio.2013.11.014 15. Durcova-Hills G, Tang F, Doody G et al (2008) Reprogramming primordial germ cells into pluripotent stem cells. PLoS One 3: e3531. https://doi.org/10.1371/journal. pone.0003531 16. Durcova-Hills G, Adams IR, Barton SC et al (2006) The role of exogenous fibroblast growth factor-2 on the reprogramming of primordial germ cells into pluripotent stem cells. Stem Cells 24:1441–1449. https://doi.org/ 10.1634/stemcells.2005-0424 17. Koshimizu U, Taga T, Watanabe M et al (1996) Functional requirement of gp130mediated signaling for growth and survival of mouse primordial germ cells in vitro and derivation of embryonic germ (EG) cells. Development 122:1235–1242 18. Labosky PA, Hogan BLM (2008) Mouse primordial germ cells: isolation and in vitro culture. Methods Mol Biol 461:187–199. https://doi.org/10.1007/978-1-60327-4838_12 19. Matsui Y, Takehara A, Tokitake Y et al (2014) The majority of early primordial germ cells acquire pluripotency by AKT activation. Development 141(23):4457–4467. https://doi. org/10.1242/dev.113779 20. Farini D, Scaldaferri ML, Iona S et al (2005) Growth factors sustain primordial germ cell survival, proliferation and entering into meiosis in the absence of somatic cells. Dev Biol 285:49–56. https://doi.org/10.1016/j. ydbio.2005.06.036 21. de Felici M (2011) Nuclear reprogramming in mouse primordial germ cells: epigenetic contribution. Stem Cells Int 2011:425863. https:// doi.org/10.4061/2011/425863 22. Kimura T, Nakano T (2011) Induction of pluripotency in primordial germ cells. Histol Histopathol 26:643–650. https://doi.org/10. 14670/HH-26.643 23. Nagamatsu G, Kosaka T, Saito S et al (2013) Induction of pluripotent stem cells from primordial germ cells by single reprogramming

factors. Stem Cells 31:479–487. https://doi. org/10.1002/stem.1303 24. Nagamatsu G, Saito S, Takubo K, Suda T (2015) Integrative analysis of the acquisition of pluripotency in PGCs reveals the mutually exclusive roles of Blimp-1 and AKT signaling. Stem Cell Reports:1–29. https://doi.org/10. 1016/j.stemcr.2015.05.007 25. Yoshimizu T, Sugiyama N, de Felice M et al (1999) Germline-specific expression of the Oct-4/green fluorescent protein (GFP) transgene in mice. Develop Growth Differ 41:675–684. https://doi.org/10.1046/j. 1440-169x.1999.00474.x 26. Ying Q-L, Stavridis M, Griffiths D et al (2003) Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture. Nat Biotechnol 21:183–186. https://doi. org/10.1038/nbt780 27. Majumdar MK, Feng L, Medlock E et al (1994) Identification and mutation of primary and secondary proteolytic cleavage sites in murine stem cell factor cDNA yields biologically active, cell-associated protein. J Biol Chem 269:1237–1242 28. Ohta H, Kurimoto K, Okamoto I et al (2017) In vitro expansion of mouse primordial germ cell-like cells recapitulates an epigenetic blank slate. EMBO J 36:1888–1907. https://doi. org/10.15252/embj.201695862 29. Durcova-Hills G, Surani A (2007) Reprogramming primordial germ cells (PGC) to embryonic germ (EG) cells. Curr Protoc Stem Cell Biol 1–20. https://doi.org/10.1002/ 9780470151808.sc01a03s5 30. Mulas C, Kalkan T, von Meyenn F et al (2019) Defined conditions for propagation and manipulation of mouse embryonic stem cells. Development 146:dev173146. https://doi. org/10.1242/dev.173146 31. Leitch HG, Blair K, Mansfield W et al (2010) Embryonic germ cells from mice and rats exhibit properties consistent with a generic pluripotent ground state. Development 137:2279–2287. https://doi.org/10.1242/ dev.050427 32. Resnick JL, Ortiz M, Keller JR, Donovan PJ (1998) Role of fibroblast growth factors and their receptors in mouse primordial germ cell growth. Biol Reprod 59:1224–1229 33. Blair K, Leitch HG, Mansfield W et al (2012) Culture parameters for stable expansion, genetic modification and germline transmission of rat pluripotent stem cells. Biol Open 1:58–65. https://doi.org/10.1242/bio.2011029 34. Wray J, Kalkan T, Smith AG (2010) The ground state of pluripotency. Biochem Soc

EG Cell Derivation Trans 38:1027. https://doi.org/10.1042/ BST0381027 35. Stallock J, Molyneaux K, Schaible K et al (2003) The pro-apoptotic gene Bax is required for the death of ectopic primordial germ cells during their migration in the mouse embryo. Development 130:6589–6597. https://doi. org/10.1242/dev.00898 36. Leitch HG, Nichols J, Humphreys P et al (2013) Rebuilding pluripotency from primordial germ cells. Stem Cell Reports 1:66–78. https://doi.org/10.1016/j.stemcr.2013.03. 004

73

37. de Felici M, McLaren A (1983) In vitro culture of mouse primordial germ cells. Exp Cell Res 144:417–427 38. Nicholls PK, Schorle H, Naqvi S et al (2019) Mammalian germ cells are determined after PGC colonization of the nascent gonad. Proc Natl Acad Sci U S A 246:201910733. https:// doi.org/10.1073/pnas.1910733116 39. Tada T, Tada M, Hilton K et al (1998) Epigenotype switching of imprintable loci in embryonic germ cells. Dev Genes Evol 207:551–561

Chapter 6 Generation of Primordial Germ Cell-like Cells on Small and Large Scales Wolfram H. Gruhn and Ufuk Gu¨nesdogan Abstract The specification and development of germ cells to gametes is a unique process, which is of great biological and clinical relevance. In mammals, the founding cells of the germline are primordial germ cells (PGCs), which arise during early embryogenesis. The low number of PGCs within the developing embryo limits the study of these cells in model organisms. The generation of PGC-like cells (PGCLCs) from murine pluripotent stem cells reconstitutes the earliest stages of germ cell development and mitigates the technical constraints of studying this developmental process in vivo. Here, we describe the technical details of the PGCLC specification approach and illustrate adaptations designed to improve compatibility with methods such as chromatin immunoprecipitation by increasing the yield of PGCLC generation. Key words Mouse primordial germ cells, Embryonic development, Pluripotency, Stem cells, Cell fate decision

1

Introduction In mammals, the earliest precursors of sperm and eggs are primordial germ cells (PGCs), which are specified in early embryonic development around the onset of gastrulation [1]. In the past decades, mice have been used extensively as a model organism to understand early embryonic development in mammals. Yet, investigating the process of cellular commitment to the germ cell fate and early PGC development in mice is limited by the small number of cells involved and accessibility of embryos, which have implanted in the uterine wall prior to the time of PGC specification [2]. In 2011, Hayashi and colleagues established a system for generating murine PGC-like cells (PGCLCs) in vitro, which recapitulates the process of PGC development and thereby mitigates the ethical and technical constraints associated with studying early PGC development in mice [3]. Importantly, male and female PGCLCs

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_6, © Springer Science+Business Media, LLC, part of Springer Nature 2021

75

76

Wolfram H. Gruhn and Ufuk Gu¨nesdogan

can give rise to functional gametes when transplanted into seminiferous tubules and the ovarian bursa, respectively [3, 4]. The starting point for this approach is the use of naι__ve murine embryonic stem cells (ESCs) that are functionally equivalent to the inner cell mass (ICM) of the E3.5 preimplantation mouse embryo [5]. Next, activation of activin/nodal and fibroblast growth factors (FGF) signaling is employed to enforce exit from the naι__ve pluripotent state and promote transition into epiblast-like cells (EpiLCs), a cell type that gradually acquires primed pluripotent characteristics [3, 6]. Reminiscent of embryonic development, the transition from naι__ve to primed pluripotency is associated with the development of a transient cellular state that is permissive for acquiring the PGC fate [7]. In vitro, this developmental competence for PGCLC specification is established about 40 h after EpiLC induction. Here, PGCLC specification is triggered by stimulation of the bone morphogenetic protein (BMP) signaling pathway and aggregation of EpiLCs into embryonic bodies (EBs). Within EBs, PGCLCs mature for up to 6 days, at which time their transcriptional profile is similar to that of E9.5 migrating PGCs in vivo [3]. In summary, the PGCLC system as described here recapitulates in vitro the developmental trajectory from the ICM at E3.5 through the time of PGC specification at E6.25 to maturing PGCs at E9.5. Hereby, this approach allows to generate larger, easier accessible numbers of germ cells than the mouse model and eases the technical difficulties of investigating the functional consequences of genetic and epigenetic modifications on germ cell development. In addition, this method can serve as an entry point for approaches that mature PGCLCs further into functional gametes [8, 9]. Here, we describe the classical method of PGCLC generation using 96-well plates [3]. In addition, we illustrate the use of microwell plates for large-scale PGCLC induction, generating millions of PGCLCs required for techniques like chromatin immunoprecipitation (ChIP).

2 2.1

Material Equipment

Culture of ESCs, EpiLCs, and PGCLCs requires standard cell culture equipment, which allows to grow mammalian cells under sterile conditions. Additional equipment is listed below: 1. Ultra-low-cell binding U-bottom 96-well plates. 2. EZSPHERE™ Microplate 6-well (alternative to ultra-low-cell binding U-bottom 96-well plates). 3. 35 μm nylon mesh cell strainer.

Generation of Murine Primordial Germ Cell-like Cells

77

4. Reagents for detecting PGCLC specification, e.g., antibodies detecting PRDM1, TFAP2c, SSEA1, or CD61, or transgenic ESC lines harboring PGCLC-expressed reporter genes such as Blimp1/Prdm1-EGFP, Stella/Dppa3-EGFP, or GOF18ΔPEEGFP [2, 3, 10–12]. 2.2 Cell Culture Media

Culture media that contain non-sterile components should be filtered through a 0.2 μm filter. In general, cell culture media are stable at 4  C for up to 2 weeks if not indicated otherwise. All cytokines should be aliquoted and stored at 20  C. More than three freeze and thaw cycles should be avoided. 1. Tissue culture-grade phosphate-buffered saline (PBS): 1.54 mM potassium phosphate monobasic (136.0 g/mol), 155.17 mM sodium chloride (58.0 g/mol), 2.71 mM sodium phosphate dibasic (268.0 g/mol) in water pH 7.2. Stable at room temperature (RT) for several months. 2. 0.1% gelatine: 0.1% (w/v) porcine gelatine in tissue culturegrade water. After autoclaving, the solution is stable at RT for several months. 3. Ornithine-laminin coating solutions: Sequential ornithinelaminin coating is an alternative to gelatine and fibronectin coating. 0.01% (w/v) poly-L-ornithine in tissue culture-grade water. 10 ng/ml mouse laminin in tissue culture-grade water. Laminin solution should always be prepared freshly. 4. Fibronectin coating solution: 16.7 μg/ml purified human plasma fibronectin diluted in tissue culture-grade PBS. Should always be prepared freshly. 5. Protease solution: 0.05% trypsin, accutase or trypsin replacement, e.g., TrypLE™. 6. Mouse embryonic fibroblast (MEF) medium: Glasgow Minimum Essential Medium (GMEM) supplemented with 10% (v/v) foetal bovine serum (FBS), 2 mM L-glutamine, 100 U/ ml penicillin, 0.1 mg/ml streptomycin. 7. N2 supplement: DMEM/F-12 medium supplemented with 10 mg/ml human apo-transferrin, 0.75% (w/v) bovine serum albumin, 2.5 mg/ml human insulin, 9.9 mM putrescine dihydrochloride, 3.5 μM sodium selenite, 6.3 μM progesterone. Can be stored at 80  C for several months (see Note 1). 8. N2B27 medium: 48.2% (v/v) DMEM/F-12, 48.2% (v/v) Neurobasal-A, 0.6% (v/v) N2 supplement, 1% (v/v) 50 B27 supplement, 2 mM L-glutamine, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 50 μM beta-mercaptoethanol (see Note 2).

78

Wolfram H. Gruhn and Ufuk Gu¨nesdogan

9. 2i/LIF medium for ESC culture: N2B27 supplemented with 3 μM CHIR99021, 1 μM PD0325091, 1000 U/ml mouse leukemia inhibitory factor (LIF). 10. EpiLC medium: N2B27 supplemented with 1% (v/v) KnockOut™ Serum Replacement (KSR), 12 ng/ml basic fibroblast growth factor (bFGF), 20 ng/ml activin A. Should always be prepared freshly. 11. Basal PGCLC medium (GK15): GMEM supplemented with 15% (v/v) KSR, 0.1 mM nonessential amino acid, 1 mM sodium pyruvate, 2 mM L-glutamine, 100 U/ml penicillin, 0.1 mg/ml streptomycin, 0.1 mM beta-mercaptoethanol. 12. PGCLC induction medium: Basal PGCLC medium supplemented with 0.5 μg/ml BMP4, 0.5 μg/ml BMP8, 0.1 μg/ml stem cell factor (SCF), 50 ng/ml epidermal growth factor (EGF), 1000 U/ml mouse LIF. Should always be prepared freshly. 13. 10 mM EDTA: 10 mM ethylenediaminetetraacetic acid (EDTA) in tissue culture-grade PBS. Stable at 4  C for several months. 14. Cell suspension buffer: 3% FBS (v/v), 5 mM EDTA in tissue culture-grade PBS.

3

Method Efficient PGCLCs specification largely depends on the quality of the precursor cell types, ESCs, and EpiLCs. Here, cell morphology, growth rate, viability, and attachment rate are important indicators for the quality of the stem cell culture. Applying the protocol described here, ESC colonies should exhibit round, dome-shaped morphology, a growth rate that requires passaging every 48–72 h and viability within the cell population >95%. Handling cell suspensions and preparation of cell culture media should be conducted under sterile conditions in a laminar flow hood. The equipment used for handling should be cleaned with 70% Ethanol or UV light prior to usage. All cell types are generally cultured in a humidified incubator at 37  C and 5% CO2. The volume of culture media and the optimal number of cultured cells depend on the size of the used culture plate. All parameters described here refer to ESC and EpiLC culture in 12-well plates (3.5 cm2 surface area per well).

3.1 General Preparations

1. Choose the appropriate cell culture plate based on the number of ESCs or EpiLCs that should be seeded. Typically, 0.5–1  105 ESCs are seeded to maintain ESCs in a well of a 12-well plate, while 1.25  105 ESCs should be seeded for EpiLC induction in a well of a 12-well plate.

Generation of Murine Primordial Germ Cell-like Cells

79

2. Coating of culture plates for ESC or EpiLC culture. For ESC culture, plates should be coated either with 400 μl fibronectin for at least 1 h or 400 μl 0.1% gelatine for at least 30 min at 37  C. Alternatively, plates can be coated first with 400 μl ornithine solution for at least 1 h at RT. After removing the ornithine solution, plates should be rinsed twice with PBS and then incubated with 400 μl laminin solution for at least 1 h at 37  C. For EpiLC culture, plates need to be coated for at least 1 h with 400 μl fibronectin at 37  C. In all cases coating can be extended to up to 16 h at the indicated temperatures in a humidified incubator or sterile laminar flow hood. However, it is important that coated plates are always completely covered with coating or culture medium and do not dry out (see Note 3). 3. Culture media should equilibrate at RT for 15–25 min before usage. 3.2 Thawing Embryonic Stem Cells

1. Frozen ESCs can be stored in liquid N2 for many years or decades. Upon removal from dry ice or liquid N2, ESCs should be thawed rapidly by transferring the cryovial into a 37  C water bath. Once only a small ice clump remains the cell suspension should be transferred into a 15 ml cell culture tube containing 37  C of warm MEF medium. The ratio between cell suspension and MEF medium should be 1:10. 2. Pellet cells by centrifugation for 5 min at 400  g (see Note 4). 3. During the centrifugation time, remove the coating solution from the culture plate and add 750 μl of 2i/LIF medium supplemented with 5% FBS. 4. Discard the supernatant and resuspend the cell pellet in 1 ml of 2i/LIF medium supplemented with 5% FBS. 5. Seed 600, 300 and 100 μl of the ESC suspension in three separate wells of a 12-well plate (see Note 5). 6. Distribute the cells homogenously by moving the culture plate on an even surface following the shape of an “8” for 4–5 times. 7. Transfer the seeded ESCs into a humidified incubator and let the cells attach at 37  C for approximatively 4 h. 8. After 4 h remove the cell culture medium and replace it with 1 ml of fresh 2i/LIF medium supplemented with 5% FBS. 9. The culture medium should be replaced 24 h after seeding to remove dead cells (see Note 6). Culture the cells for further 24–48 h and replace the culture medium daily. 10. To passage the cells, remove the culture medium, add 400 μl of protease solution and incubate the cells for 3 min at 37  C.

80

Wolfram H. Gruhn and Ufuk Gu¨nesdogan

11. Break up ESC colonies into single cells by pipetting the protease solution up and down for 5–8 times and transfer the cell suspension into a 1.5 ml tube containing 600 μl of MEF medium (see Note 7). 12. Pellet the cells by centrifugation at 500  g for 4 min at RT. 13. Remove the supernatant and resuspend the cell pellet in 1 ml of 2i/LIF medium supplemented with 5% FBS. 14. Determine cell density using a Neubauer chamber or an automated cell counter. 15. Transfer cell suspension containing 0.5–1  105 cells to a freshly coated 12-well plate containing 1 ml of 2i/LIF medium supplemented with 5% FBS for maintaining the ESC line. To prepare ESCs for EpiLC induction, transfer the cells into 2i/LIF medium supplemented with 1% KSR and culture the cells for two passages in this medium (see Fig. 1a and Note 8).

Fig. 1 (a) Bright field images of Stella/Dppa3-EGFP transgenic ESCs cultured for 48 h in 2i/LIF medium supplemented with 5% FCS (upper panel) or 2i/LIF medium supplemented with 1% KSR (lower panel). Scale bar 100 μm; (b) Bright field image of EpiLCs 42 h after induction. Scale bar 200 μm; (c) Embryonic bodies 5 days after PGCLC induction (left) or non-cytokine control treatment (right). Expression of the Stella/Dppa3EGFP marking PGCLCs was detected by fluorescence microscopy. bf bright field; Scale bar 200 μm

Generation of Murine Primordial Germ Cell-like Cells

3.3

EpiLC Induction

81

1. Remove the growth medium from ESCs and add 400 μl protease solution. 2. Incubate cells for 3 min at 37  C. 3. Add 800 μl N2B27 medium and break up the ESC colonies into single cells by pipetting up and down for 5–8 times. Transfer the cell suspension into a 1.5 ml tube. 4. Pellet cells by centrifugation at 500  g for 4 min at RT. 5. Remove the supernatant, resuspend the cell pellet in 1 ml of N2B27 and determine the cell concentration using a Neubauer chamber or an automated cell counter. 6. Transfer 1.25  105 cells into a fresh 1.5 ml tube and pellet the cells by centrifugation at 500  g for 4 min at RT. 7. Remove the supernatant and resuspend the cells in 500 μl of fresh N2B27 (see Note 9). 8. Pellet cells by centrifugation at 500  g for 4 min at RT. 9. Resuspend ESCs in 1 ml of freshly made EpiLC induction medium and plate them on a fibronectin-coated 12-well dish. 10. Distribute the cells homogenously by moving the culture plate on an even surface following the shape of an “8” for 4–5 times. 11. Incubate the cells for 24 h at 37  C with 5% CO2 in a humidified incubator. 12. Replace the culture medium after 24 h with freshly made EpiLC induction medium. 13. After 40–44 h the EpiLCs should have acquired the competence for PGCLC specification. At this point the EpiLCs should have reached 70–90% confluence and should exhibit homogenously a flat, elongated morphology without any remaining characteristic dome-shaped ESC colonies (see Fig. 1b and Note 10).

3.4 Classical PGCLC Induction in 96-Well Plates

Commitment of competent EpiLCs to the PGC fate occurs in embryoid bodies (EBs) stimulated with BMP4 and other cytokines supporting PGCLC induction. The scale of PGCLC induction depends on the technical requirements of the desired experimental analysis and percentage of cells in EBs that successfully acquire the PGC identity (PGCLC specification efficiency). Typically, the PGCLC specification efficiency is >25% 4 days after induction but this can vary depending on the cell line and the quality of the batch of cytokines (see Note 11). Hence, it is important to determine the PGCLC specification efficiency for any newly generated cell line before planning large-scale experiments (see Note 12). 1. After 40–44 h of EpiLC culture, remove the EpiLC medium, and rinse the cells with 0.5 ml of PBS.

82

Wolfram H. Gruhn and Ufuk Gu¨nesdogan

2. Remove PBS, add 400 μl of protease solution, and incubate for 2–3 min at 37  C. 3. Generate single cell suspension by adding 800 μl of basal PGCLC medium and pipetting up and down 8–10 times. Transfer the cell suspension into a fresh 1.5 ml tube. 4. Pellet cells by centrifugation at 500  g for 4 min at RT. 5. Remove the supernatant, resuspend the cell pellet in 1 ml basal PGCLC medium, and determine cell density using a Neubauer chamber or an automated cell counter. 6. Here, EpiLCs should be split into two groups (1) EpiLCs for PGCLC induction and (2) EpiLCs for the negative control that will not be treated with PGCLC-inducing cytokines. In both cases 2500 EpiLCs should be seeded per well of a low adhesion 96-well plate. Transfer the desired number of EpiLCs for PGCLC induction and non-cytokine control in fresh 1.5 ml tubes (see Note 12 and Fig. 1c). 7. Pellet cells by centrifugation at 500  g for 4 min at RT. 8. Resuspend the cells in 500 μl of basal PGCLC medium by pipetting up and down 2–3 times. 9. Pellet cells by centrifugation at 500  g for 4 min at RT. 10. During centrifugation prepare the PGCLC induction medium by adding the required cytokines to the basal PGCLC medium. 11. Remove the supernatant and resuspend the pelleted EpiLCs of the induction sample in PGCLC induction medium and the EpiLCs of the control sample in basal PGCLC medium (non-cytokine negative control). In both samples the EpiLC density should be 2500 cells/100 μl medium. 12. Distribute the cells in the suspension homogenously by pipetting up and down 5–6 times and transfer 100 μl cell suspension into each well of an ultra-low-cell binding U-bottom 96-well plate (see Note 13). 13. Incubate the 96-well plate for up to 4 days in a humidified incubator at 37  C and 5% CO2. If PGCLCs should be cultured for longer than 4 days, add 100 μl fresh PGCLC induction medium per EB after 4 days of culture. 14. After the desired incubation time the EBs can be removed from the 96-well plate with a P200 pipette and processed for downstream experiments (see Note 14). 3.5 Large-Scale PGCLC Induction Using Micro-Well Plates

The number of PGCLCs that can be generated using the 96-well induction format is limited to 5  104 to 1.5  105 FACS-purified PGCLCs per 96-well plate (10 ml PGCLC induction medium). However, for a variety of techniques larger amounts of cells are required, and generating millions of PGCLCs using the classical 96-well approach is not cost-efficient.

Generation of Murine Primordial Germ Cell-like Cells

83

Fig. 2 (a) Bright field images of a 6-well EZSPHERE™ Microplate (upper part) and the micro-wells within the Microplate (lower part). Scale bar 5 mm. (b) Embryonic bodies 3 days after PGCLC induction (upper part) or non-cytokine-treated negative control (lower part) in Microplates. Shown are bright field images (left) and fluorescent microscopy images detecting expression of the Stella/Dppa3-EGFP transgene (right). Insets show images at higher magnification. Scale bar 500 μm in overview image and 100 μm in magnification

To minimize the quantity of cytokines required, it is possible to reduce the volume of medium during PGCLC induction to 30 μl/ 2500 EpiLCs and add additional 20 μl PGCLC medium after 2 days of culture [9]. However, it is important to closely monitor medium evaporation when this approach is used (see Note 13). An alternative is the use of EZSPHERE™ Microplates, which harbor >2000 micro-wells (see Fig. 2). This approach allows to generate between 8.0  104 to 1.6  105 FACS-purified PGCLCs per ml PGCLCs induction medium, which is about 10 times more compared to the classical 96-well format. However, the ratio of cells to medium is much higher in the Microplates than that in the 96-well plates, and hence the nutrients in the induction medium are used up faster in the Microplate induction. Typically, the length of PGCLC culture in Microplates is 2–3 days. All parameters described here, e.g., media volumes or EpiLC number, refer to cell culture in one well of a 6-well Microplate. 1. Add 2 ml of PBS to each well of the Microplate and wash the micro-wells by pipetting up and down 5–6 times (see Note 15). Keep the plate in PBS at RT. 2. Follow steps 1–5 described in Subheading 3.4. 3. Split EpiLCs into two groups (1) EpiLCs for PGCLC induction, and (2) EpiLCs for the negative control that will not be treated with PGCLC-inducing cytokines. For each well of a 6 well EZSPHERE™ Microplate, transfer 7.5  105 EpiLCs in a fresh 1.5 ml tube. 4. Pellet cells by centrifugation at 500  g for 4 min at RT.

84

Wolfram H. Gruhn and Ufuk Gu¨nesdogan

5. Resuspend EpiLCs in 500 μl of basal PGCLC medium by pipetting up and down 2–3 times. 6. Pellet cells by centrifugation at 500  g for 4 min at RT. 7. During the centrifugation prepare the PGCLC induction medium by adding the required cytokines to the basal PGCLC medium. 8. Remove PBS from the Microplate and add 1 ml of PGCLC induction medium or basal PGCLC medium (non-cytokine negative control). 9. After centrifugation, remove the supernatant and resuspend the pelleted EpiLCs in 1 ml of PGCLC induction medium or 1 ml of basal PGCLC medium to generate the non-cytokine negative control. In all samples the cell concentration should be 7.5  105 EpiLCs/ml medium. 10. Add the cell suspension to the Microplate and distribute the cells in suspension homogenously by moving the culture plate on an even surface following the shape of an “8” for 4–5 times. 11. Check the medium color after 24 h. If the medium starts to become yellow rather than orange, add 1 ml of fresh PGCLC induction medium (see Note 16). 12. After 2 days of culture, add 1 ml of fresh PGCLC induction medium and culture the cells for another 24 h (see Note 16). 13. Harvest the EBs (in total 3 days of culture) by using a P1000 pipette to wash the EBs out of the micro-wells into the culture medium. Transfer the suspension in a 15 ml tube (see Note 17). 14. Add 1 ml of PBS per well and wash the culture plate. 15. Combine wash PBS with the EB suspension in the 15 ml tube. 16. Pellet the EBs by centrifugation at 500  g for 5 min at RT. 17. If a single-cell suspension is required, e.g., for FACS, add 300 μl of 10 mM EDTA to the cells and incubate for 3–5 min at 37  C (see Note 18). 18. Add 500 μl of cell suspension buffer and generate a single-cell suspension by pipetting up and down for 5–10 times. 19. Pellet the cells by centrifugation at 500  g for 4 min at RT. 20. Discard the supernatant and resuspend the cells in 500 μl of cell suspension buffer. 21. Filter the cell suspension through a 35 μm nylon mesh cell strainer. 22. Determine the cell concentration using a Neubauer chamber or an automated cell counter and proceed with the desired downstream analysis (see Note 19).

Generation of Murine Primordial Germ Cell-like Cells

4

85

Notes 1. There are different formulations for N2 supplement that vary slightly in the concentrations of individual components. We prepare N2 as follows: 1.62 ml DMEM/F12 medium, 750 μl 10 mg/ml human insulin, 300 μl 100 mg/ml human apo-transferrin, 300 μl 7.5% (w/v) bovine serum albumin, 9.9 μl 0.6 mg/ml progesterone, 30 μl 160 mg/ml putrescine dihydrochloride, 3 μl 3.5 mM sodium selenite. 2. We prepare N2B27 medium as follows: 241 ml DMEM/F12, 241 ml Neurobasal-A, 3 ml freshly made N2 supplement, 5 ml B27 supplement, 5 ml 200 mM L-glutamine, 5 ml 10,000 U/ ml penicillin +10 mg/ml streptomycin, 0.5 ml 50 mM betamercaptoethanol. There are different formulations for the B27 supplement. We have been using B27 without antioxidants for mouse ESCs for years. If N2B27 medium is prepared in larger quantities (>200 ml), aliquoting the medium into 50 ml aliquots promotes the stability of the medium at 4  C. However, after more than 2 weeks at 4  C, the medium will not support normal stem cell growth anymore. The quality of the N2B27 medium can be tested by using it in a neuronal differentiation protocol [13]. 3. Naι__ve ESCs tend to attach stronger to fibronectin or ornithinelaminin than to gelatine-coated surfaces. Hence, fibronectin or ornithine-laminin coating should be chosen if it is observed that a particular ESC line attaches weakly, e.g., ESCs colonies round up easily and detach from the cell culture plate. We use fibronectin coating for ESCs cultured in 2i/LIF medium. 4. Using swing out rather than fixed angle rotors is beneficial for pelleting stem cells as the cell pellets are more defined especially when working with small cell numbers. 5. It is not beneficial to determine the exact cell number but rather to seed thawed ESCs in different densities, e.g., 60, 30, 10% of frozen cells because the thawed cells should be seeded as fast as possible and it is unclear how many ESCs in the suspension will actually attach. 6. In case of extensive cell death, rinsing the attached cells once with 1 ml PBS before adding fresh culture medium is beneficial. After thawing, ESCs should be cultured for at least 48 h before passaging to promote recovery. Between 48 h to 72 h after seeding, cells should have formed round, dome-shaped colonies between 40 and 80 μm in diameter, which require passaging (see Fig. 1a).

86

Wolfram H. Gruhn and Ufuk Gu¨nesdogan

7. It is beneficial to dissociate the ESC colonies into single cells as this makes determination of the cell number more accurate and ensures homogeneous colony size in the next culture period. 8. Supplementing 2i/LIF medium with 5% FBS is well suited to maintain ESCs as in this medium the cells attach well and are genetically stable for many passages. However, it is important to omit FBS in the culture prior to EpiLC induction as the signaling molecules in the FBS interfere with normal acquisition of competence for PGCLC induction. ESCs of some genetic backgrounds tend to detach easily from the culture plate when cultured in plain 2i/LIF medium. This effect can be mitigated by adding 1% KSR to the 2i/LIF medium. However, it is not advised to use 2i/LIF medium with 1% KSR for long-term ESC culture as this can result in profound epigenetic alterations, e.g., DNA hypomethylation at genomic imprints [14]. ESC colonies in 2i/LIF medium with 5% FBS are generally flatter and slightly larger in diameter than colonies cultured in 2i/LIF with or without 1% KSR medium (see Fig. 1a). 9. It is important to wash the cells thoroughly with N2B27 as remaining traces of the 2i/LIF medium would interfere with EpiLC induction. 10. The most important driver of differentiation is FGF signaling. The detection of remaining dome-shaped ESC-like colonies in the EpiLC culture suggests that either the bFGF signaling activity is too low or the 2i/LIF medium is not washed out efficiently during EpiLC induction. As the competence for PGCLC induction is only acquired in cells that have exited naι__ve pluripotency, it is crucial to obtain a homogenous EpiLC population to preserve the PGCLC specification efficiency. 11. The major driver for PGCLC specification is BMP4, which is commercially available from different vendors. Unfortunately, we have experienced pronounced batch-to-batch variations in the BMP4 quality. Hence, it is beneficial to test different BMP4 batches on cell lines known to specify PGCLCs well and to order larger quantities of the best batch. 12. The PGCLC specification efficiency can be determined by immunofluorescence using antibodies detecting PRDM1 and TFAP2c, by employing transgenic reporter cell lines such as Stella/Dppa3-EGFP or Blimp1/Prdm1-EGFP or using cell surface markers such as SSEA1 and CD61 [2, 3, 10, 11]. It is important to consider that many factors used to identify PGCLCs are also expressed in ESCs, e.g., Dppa3, Tfap2c, Pou5f1 or in other embryonic cell types, e.g., Prdm1 in visceral and definitive endoderm. Spontaneous reversion from 42 h EpiLCs to ESCs is minimal under normal circumstances but

Generation of Murine Primordial Germ Cell-like Cells

87

can be strongly elevated when the EpiLC differentiation has been perturbed, e.g., through reduced cell proliferation, altered activity of epigenetic modifiers or changes in the metabolic state of the cells [15]. Hence, it is important to test for ESC reversion by including a non-cytokine control, in which EpiLCs are aggregated into EBs without the PGCLC-inducing cytokines (see Fig. 1c). In addition, the confidence of PGCLC detection can be increased when several PGCLC markers are detected simultaneously, e.g., co-immunostaining of PRDM1 and TFAP2c or SSEA1 and CD61. 13. During 4- or 6-days culture, evaporation from the outer wells of a 96-well plate is significantly higher than from the inner wells. Hence, filling the 36 wells facing the edges of the plate with 150 μl PBS per well and only using the inner 60 wells for PGCLC induction ensures equal culture condition for each well. 14. 6 days after induction PGCLCs correspond transcriptionally to migratory E9.5 PGCs in vivo. However, culture beyond 6 days in the described system will not result in further PGCLC maturation. If further development of the PGCLCs is required, the day 6 PGCLCs have to be transferred to other culture systems, which are described elsewhere [8]. 15. Remove all air bubbles that are forming in the micro-wells, otherwise EpiLCs will not settle down in these wells. 16. EBs in Microplates can be easily removed from the micro-wells by shaking the plate or adding fresh medium too fast. Hence, the plate needs to be handled gently. After 24 or 48 h of culture, medium will have changed color indicating acidification. If the medium has become yellow rather than orange it is beneficial to remove 1 ml of the old culture with a P1000 pipette before adding fresh medium, but this must be done very gently in order not to disturb the EBs. 17. After 3 days of culture, the medium will require changing. As it is challenging to change the culture medium in Microplates without disturbing the EBs, it is recommended to harvest the EBs at this point. If later stages of PGCLC development need to be investigated, 2 ml of the used culture medium should be removed before adding 1 ml of fresh PGCLC induction medium. 18. The EBs formed in Microplates are small and easy to dissociate. The use of proteases for dissociation is not required. 19. The PGCLC numbers that can be generated with the microwell plates are sufficient for transcription factor ChIP in combination with next generation sequencing (ChIP-seq) using published protocols [16].

88

Wolfram H. Gruhn and Ufuk Gu¨nesdogan

Acknowledgements This work was kindly supported by Professor Azim Surani and the Wellcome Trust Senior Investigator grant (RG92113) awarded to Professor Azim Surani. U.G. is supported by a Sofja Kovalevskaja Award of the Humboldt foundation. References 1. Tang WW, Kobayashi T, Irie N, Dietmann S, Surani MA (2016) Specification and epigenetic programming of the human germ line. Nat Rev Genet 17(10):585–600. https://doi.org/10. 1038/nrg.2016.88 2. Ohinata Y, Payer B, O’Carroll D, Ancelin K, Ono Y, Sano M, Barton SC, Obukhanych T, Nussenzweig M, Tarakhovsky A, Saitou M, Surani MA (2005) Blimp1 is a critical determinant of the germ cell lineage in mice. Nature 436(7048):207–213. https://doi.org/10. 1038/nature03813 3. Hayashi K, Ohta H, Kurimoto K, Aramaki S, Saitou M (2011) Reconstitution of the mouse germ cell specification pathway in culture by pluripotent stem cells. Cell 146(4):519–532. https://doi.org/10.1016/j.cell.2011.06.052 4. Hayashi K, Ogushi S, Kurimoto K, Shimamoto S, Ohta H, Saitou M (2012) Offspring from oocytes derived from in vitro primordial germ cell-like cells in mice. Science 338(6109):971–975. https://doi.org/10. 1126/science.1226889 5. Ying QL, Wray J, Nichols J, Batlle-Morera L, Doble B, Woodgett J, Cohen P, Smith A (2008) The ground state of embryonic stem cell self-renewal. Nature 453(7194):519–523. https://doi.org/10.1038/nature06968 6. Brons IG, Smithers LE, Trotter MW, RuggGunn P, Sun B, Chuva de Sousa Lopes SM, Howlett SK, Clarkson A, Ahrlund-Richter L, Pedersen RA, Vallier L (2007) Derivation of pluripotent epiblast stem cells from mammalian embryos. Nature 448(7150):191–195. https://doi.org/10.1038/nature05950 7. Ohinata Y, Ohta H, Shigeta M, Yamanaka K, Wakayama T, Saitou M (2009) A signaling principle for the specification of the germ cell lineage in mice. Cell 137(3):571–584. https:// doi.org/10.1016/j.cell.2009.03.014 8. Hikabe O, Hamazaki N, Nagamatsu G, Obata Y, Hirao Y, Hamada N, Shimamoto S, Imamura T, Nakashima K, Saitou M, Hayashi

K (2016) Reconstitution in vitro of the entire cycle of the mouse female germ line. Nature 539(7628):299–303. https://doi.org/10. 1038/nature20104 9. Ohta H, Kurimoto K, Okamoto I, Nakamura T, Yabuta Y, Miyauchi H, Yamamoto T, Okuno Y, Hagiwara M, Shirane K, Sasaki H, Saitou M (2017) In vitro expansion of mouse primordial germ cell-like cells recapitulates an epigenetic blank slate. EMBO J 36(13):1888–1907. https://doi. org/10.15252/embj.201695862 10. Payer B, Chuva de Sousa Lopes SM, Barton SC, Lee C, Saitou M, Surani MA (2006) Generation of stella-GFP transgenic mice: a novel tool to study germ cell development. Genesis 44(2):75–83. https://doi.org/10.1002/gene. 20187 11. Weber S, Eckert D, Nettersheim D, Gillis AJ, Schafer S, Kuckenberg P, Ehlermann J, Werling U, Biermann K, Looijenga LH, Schorle H (2010) Critical function of AP-2 gamma/TCFAP2C in mouse embryonic germ cell maintenance. Biol Reprod 82 (1):214–223. https://doi.org/10.1095/ biolreprod.109.078717 12. Yoshimizu T, Sugiyama N, De Felice M, Yeom YI, Ohbo K, Masuko K, Obinata M, Abe K, Scholer HR, Matsui Y (1999) Germlinespecific expression of the Oct-4/green fluorescent protein (GFP) transgene in mice. Develop Growth Differ 41(6):675–684 13. Marks H, Kalkan T, Menafra R, Denissov S, Jones K, Hofemeister H, Nichols J, Kranz A, Stewart AF, Smith A, Stunnenberg HG (2012) The transcriptional and epigenomic foundations of ground state pluripotency. Cell 149 (3):590–604. https://doi.org/10.1016/j.cell. 2012.03.026 14. Hackett JA, Kobayashi T, Dietmann S, Surani MA (2017) Activation of lineage regulators and transposable elements across a pluripotent spectrum. Stem Cell Reports 8(6):1645–1658.

Generation of Murine Primordial Germ Cell-like Cells https://doi.org/10.1016/j.stemcr.2017.05. 014 15. Tischler J, Gruhn WH, Reid J, Allgeyer E, Buettner F, Marr C, Theis F, Simons BD, Wernisch L, Surani MA (2019) Metabolic regulation of pluripotency and germ cell fate through alpha-ketoglutarate. EMBO J 38(1): e99518. https://doi.org/10.15252/embj. 201899518

89

16. Sybirna A, Tang WWC, Pierson Smela M, Dietmann S, Gruhn WH, Brosh R, Surani MA (2020) A critical but divergent role of PRDM14 in human primordial germ cell fate revealed by inducible degrons. Nat Commun 11(1):1282. https://doi.org/10.1038/s414 67-020-15042-0

Chapter 7 Genome-Scale CRISPR Screening for Regulators of Cell Fate Transitions Valentina Carlini, Kristjan H. Gretarsson, and Jamie A. Hackett Abstract Knockout CRISPR screening enables the unbiased discovery of genes with a functional role in almost any cellular or molecular process of interest. The approach couples a genome-scale library of guide RNA (gRNA), the Cas9 endonuclease, and a faithful phenotypic read-out to systematically identify candidate genes via their loss-of-function effect. Here we provide a detailed description of the CRISPR screen protocol and outline how to apply it to decipher the gene networks that underlie developmental cell fate decisions. As a paradigm we use the in vitro model of cell state transition(s) from naive pluripotency to primordial germ cell (PGC) fate, exploiting the Stella-GFP:Esg1-tdTomato (SGET) mouse ESC line. The principles in this protocol can be readily adapted to characterize lineage regulators for other cell fate models and/or for other species. Key words Pluripotency, Stem cell, PGC, Germ cell, Lentivirus, CRISPR, Protocol, Lineage regulator

1

Introduction The emergence of CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 has heralded an era of precision editing of genetic sequence to modify or investigate its function. This powerful approach enables the functional role(s) of genes to be rapidly assessed through loss-of-function (LOF) genetics or other strategies, and has proved a landmark technological advancement more generally for biological research [1]. The LOF strategy typically exploits a guide RNA (gRNA) to direct the Cas9 nuclease to a complementary locus, where it induces a precise double-stranded break (DSB). When targeted to coding exons this leads to frameshifting-indels, resulting in homozygous gene “knockout” due to loss of functional protein. The approach has now been scaled

Valentina Carlini and Kristjan H. Gretarsson contributed equally to this work. Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_7, © Springer Science+Business Media, LLC, part of Springer Nature 2021

91

92

Valentina Carlini et al.

to a genome-wide level by using libraries of gRNA to systematically perturb the function of every gene in the genome in a pooled-cell context (one gRNA per cell) [2–6]. Such knockout “CRISPR screening” determines whether gene LOF alters cellular response to a given phenotype assay or selection (e.g., survival or reporter activity). Any observed change implies a functional interaction between the gene and the phenotype of interest. The specific gene(s) involved are identified by measuring the enrichment or depletion of gRNAs (indicative of knockouts) within the population after selection, relative to control, via next-generation sequencing (NGS). This enables unbiased forward genetics at unparalleled resolution and, consequently, CRISPR screening is a key tool to disentangle the complex interaction between gene function and myriad biological processes, for example, disease, drug response, molecular mechanisms, and cancer [7–11]. Indeed, CRISPR screening has now also been adapted to unravel the gene networks that underpin developmental cell fate transitions, including regulators of early embryogenesis and primordial germ cell (PGC) specification [12, 13]. PGCs are the founding population of the germ cell lineage, which transmit heritable genetic and epigenetic information to the next generation [14, 15]. In mammals PGCs arise after a series of cell state transitions that includes transit through naı¨ve pluripotency, and subsequently through a formative state of pluripotency that is primed to give rise to both the somatic lineages and to PGC [16, 17]. The decision to form PGC represents a critical developmental event, and is driven by exposure of formative cells to WNT and BMP signaling. This activates key germline genes including Blimp1, Prdm14, Ap2γ, Zfp296, and Nr5a2 and promotes epigenetic reprogramming [12, 18–21]. Recent progress has recapitulated specification of both human and mouse PGC in an in vitro model, by utilizing pluripotent embryonic stem cells (ESC) [22– 25]. These are induced into a formative pluripotent state (called epiblast-like cells (EpiLC) in mice), which in the presence of appropriate signaling cues (WNT and BMP) can give rise to PGC-like cells (PGCLC). These PGCLC exhibit the key molecular and functional properties of authentic PGC in vivo [26, 27], and therefore represent an ideal model to investigate the (epi)genetic and molecular mechanisms that underpin the germ cell lineage. This protocol describes a strategy to exploit unbiased CRISPR screening to identify regulators of cell fate decisions, using mouse PGCLC induction as a paradigm. To denote each cell state transition we use the Stella-GFP:Esg1-tdTomato (SGET) compoundreporter ESC line [12] (see Fig. 1). This enables identification of factors important for naı¨ve pluripotency per se, in addition to key regulators for the transition to the formative state (exit from naı¨ve pluripotency), and subsequently for PGC specification. The approach iteratively purifies cells that have successfully acquired

CRISPR Screening for Developmental Regulators

93

the appropriate precursor state for the subsequent developmental transition. Each “competent” precursor population is then utilized for two purposes: to give rise to the next cell fate, and also as the reference population to identify enriched or depleted gRNAs for that specific cell state transition (and therefore genes with a functional role) (see Fig. 2). This iterative strategy distinguishes the approach from the orthogonal comparisons in classical CRISPR screening. While this protocol is focused on identifying regulators of developmental events towards mouse PGC, it can be adapted for use in human PGC biology or indeed in any epigenetic or developmental transition model for which each successive cell state can be identified (e.g., by reporter or cell surface markers). Moreover, here we discuss CRISPR knockout screening but the principles can be readily applied to activation (CRISPRa) or inhibition (CRISPRi) screens to modulate, rather than delete, gene activity.

2 2.1

Materials Equipment

1. Biosafety level 2 (BSL2) room and tissue-grade laminar flow hood. 2. Microcentrifuge. 3. High-capacity centrifuge. 4. Fluorescence-activated cell sorter (FACS) facility. 5. CO2-controlled humidified incubator. 6. Automated cell counter, e.g., Countess II. 7. Thermal cycler. 8. Qubit fluorometer. 9. Tapestation system. 10. Electrophoresis equipment. 11. PCR hood. 12. Magnetic stand for PCR tubes. 13. Mr. Frosty freezing container.

2.2

Reagents

1. SGET embryonic stem cells(Stella-GFP:Esg1-tdTomato). 2. Lenti-X HEK 293 T cells (Takara). (a) Genome-wide sgRNA lentiviral library plasmid (e.g., Brie, Addgene #73633). 3. Lentiviral #12260).

packaging

plasmid

(e.g.,

psPAX2,

Addgene

4. Lentiviral envelope plasmid (e.g., pMD2.G Addgene #12259). 5. Lenti-X Concentrator (Takara).

94

Valentina Carlini et al.

6. Stable competent E. coli cells (High efficiency) (New England Biolab). 7. Plasmid maxiprep kit (e.g., Zymopure II plasmid maxiprep). 8. Luria Bertani (LB) broth. 9. Ultra-low attachment microwell plate (see Note 1). 10. 6- and12-well cell culture plates. 11. T225 filter-top culture flasks. 12. Stericup filter unit, 0.22 μM. 13. Tissue culture grade phosphate-buffered saline (PBS) solution. 14. NDIFF 227 (N2B27). 15. GMEM. 16. OPTI-MEM. 17. Knockout serum replacement (KSR). 18. Foetal bovine serum (FBS). 19. Dimethyl sulfoxide (DMSO). 20. Penicillin/Streptomycin. 21. Puromycin. 22. Ampicillin. 23. Polybrene. 24. Fibronectin. 25. Gelatin. 26. TrypLE. 27. PD0325901 (MEK inhibitor). 28. CHIR99021 (GSK3 inhibitor). 29. Nonessential amino acids (NEAA). 30. Sodium pyruvate. 31. β-mercaptoethanol. 32. L-glutamine. 33. Activin-A. 34. Basic fibroblast growth factor (bFGF). 35. Leukaemia inhibitory factor (LIF). 36. Bone morphogenetic protein 4 (BMP4) (R&D Systems). 37. Bone morphogenetic protein 8 (BMP8) (R&D Systems). 38. Epidermal growth factor (EGF), (R&D Systems). 39. Stem cell factor (SCF) (R&D Systems). 40. RNaseA, (DNase- and Protease- free). 41. Genomic DNA extraction kit genomic DNA, for >1 mio cells (e.g., DNeasy Blood and Tissue kit, Qiagen).

CRISPR Screening for Developmental Regulators

95

42. Genomic DNA extraction kit, for 10 μl, Zymo). 43. Qubit dsDNA BR Assay Kit. 44. Q5 Hot Start High-Fidelity 2
Master Mix (New England Biolab). 45. P5 stagger F primers (see Subheading 2.4). 46. P7 indexed R primers (see Subheading 2.4). 47. Ultrapure nuclease Free water. 48. D1000 Reagents (Agilent) & D1000 ScreenTape (Agilent). 49. SPRI beads (Beckman Coulter). 50. 80% EtOH (freshly prepared). 51. MAGeCK analysis tool (https://sourceforge.net/p/mageck/ wiki/Home/). 52. Cutadapt analysis tool (https://cutadapt.readthedocs.io/en/ stable/). 2.3 Cell Culture Media

1. ESC culture media: NDIFF 227 supplemented with 1 μM PD0325901, 3 μM CHIR99021, 1000 U/ml LIF, 1% Penicillin/Streptomycin (see Note 2). Pass through 0.22 μM filter unit. 2. EpiLC culture media: NDIFF 227 supplemented with 1% Knockout serum replacement, 20 ng/ml Activin-A, 12.5 ng/ ml bFGF, 1% Penicillin/Streptomycin. Pass through 0.22 μM filter unit. 3. PGCLC culture media: GMEM supplemented with 15% Knockout serum replacement, 0.1 mM Nonessential amino acids, 1 mM Sodium pyruvate, 1% Penicillin/Streptomycin, 0.1 mM B-mercaptoethanol, 1 mM L-glutamine, 500 ng/ml BMP4. Add the following cytokines just before use: 1000 U/ ml LIF, 100 ng/ml SCF, 500 ng/ml BMP8a (see Note 3), 50 ng/ml EGF. Pass through 0.22 μM filter unit. 4. 293T media (viral production): DMEM supplemented with 10% FBS, 1% Penicillin/Streptomycin, 6 mM L-glutamine, 25 mM HEPES, 1 mM Sodium pyruvate.

2.4 NGS Oligos for Library Preparation

3

See Note 4 and see Table 1.

Methods The method described here is optimized for the Brie pooled gRNA library [5], which contains 78,637 gRNA that target 19,674 genes in conjunction with Streptococcus pyogenes (sp) Cas9, and also carries

96

Valentina Carlini et al.

Table 1 List of primers Oligo Name P7 Index A1 P7 Index A2 P7 Index A3 P7 Index A4 P7 Index A5 P7 Index A6 P7 Index A7 P7 Index A8 P5 0 bp stagger P5 1 bp stagger P5 2 bp stagger P5 3 bp stagger P5 4 bp stagger P5 6 bp stagger P5 7 bp stagger P5 8 bp stagger

Sequence (5’-3’) CAAGCAGAAGACGGCATACGAGATCGGTTCAAGTGACT GGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTT TCCCCTGCACTGT CAAGCAGAAGACGGCATACGAGATGCTGGATTGTGACT GGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTT TCCCCTGCACTGT CAAGCAGAAGACGGCATACGAGATTAACTCGGGTGACT GGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTT TCCCCTGCACTGT CAAGCAGAAGACGGCATACGAGATTAACAGTTGTGACT GGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTT TCCCCTGCACTGT CAAGCAGAAGACGGCATACGAGATATACTCAAGTGACT GGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTT TCCCCTGCACTGT CAAGCAGAAGACGGCATACGAGATGCTGAGAAGTGACT GGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTT TCCCCTGCACTGT CAAGCAGAAGACGGCATACGAGATATTGGAGGGTGACT GGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTT TCCCCTGCACTGT CAAGCAGAAGACGGCATACGAGATTAGTCTAAGTGACT GGAGTTCAGACGTGTGCTCTTCCGATCTTCTACTATTCTT TCCCCTGCACTGT AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTA CACGACGCTCTTCCGATCTTTGTGGAAAGGACGAAACAC CG AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTA CACGACGCTCTTCCGATCTCTTGTGGAAAGGACGAAACA CCG AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTA CACGACGCTCTTCCGATCTGCTTGTGGAAAGGACGAAAC ACCG AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTA CACGACGCTCTTCCGATCTAGCTTGTGGAAAGGACGAAA CACCG AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTA CACGACGCTCTTCCGATCTCAACTTGTGGAAAGGACGAA ACACCG AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTA CACGACGCTCTTCCGATCTTGCACCTTGTGGAAAGGACG AAACACCG AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTA CACGACGCTCTTCCGATCTACGCAACTTGTGGAAAGGAC GAAACACCG AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTA CACGACGCTCTTCCGATCTGAAGACCCTTGTGGAAAGGA CGAAACACCG

P5/P7 flow cell sequences Illumina sequencing primer Vector binding sequence Stagger sequence Barcode sequence

CRISPR Screening for Developmental Regulators

3.1 Preparation of the Lentiviral gRNA Library

97

puromycin resistance. The antibiotic selection, number of cells to maintain in culture, and Cas9 variant described here are specific to this gRNA library and should be optimized if using an alternative. A lentiviral gRNA library preparation can be obtained directly from suppliers (e.g., Addgene) or can be generated in a BSL2 facility, as below. Ensure all institutional biosafety guidelines relating to lentiviral usage and CRISPR are adhered to, and the appropriate personal protective equipment (PPE) is in use. This section will take approximately 5 days. 1. If necessary, amplify the gRNA library plasmid by transforming 100 ng into each of four aliquots of stable competent E. coli (0.05 ml each), following the manufacturer’s instructions. Expand each outgrowth directly into 100 ml LB with 50 μg/ ml ampicillin for 14–16 h at 37  C. Maxiprep the library plasmid using endotoxin-free guidelines (see Note 5). Confirm that the amplified library has maintained sgRNA complexity and representation by NGS sequencing before lentiviral preparation (see Note 6). 2. Day 1. To generate lentiviral particles, seed 1.5
107 Lenti-X HEK 293T cells into each of 5
T225 filter cap flasks, with 40 ml 293T medium (total of 7.5
107 cells). Incubate in a humidified 5% CO2 chamber at 37  C for approximately 24 h. 3. Day 2. Transfect cells (when they reach 70–80% confluence) by generating a plasmid mix consisting of 26 μg pPax2 plasmid, 12 μg pMD2.G plasmid, and 32 μg Brie gRNA library plasmid in 2 ml Opti-MEM per T225 flask. Additionally prepare 150 μl of lipofectamine in 2 ml Opti-MEM per T225 flask. Combine the plasmid and lipofectamine preparations together and mix well to create the transfection mix (4 ml total per T225 flask). Incubate at room temperature for 20 min, then pipette the 4 ml dropwise into each flask. Return flasks to incubator (see Note 7). 4. Six hours after transfection aspirate the media and replace with 40 ml of fresh 293T media. 5. Day 4. To harvest the first batch of lentivirus-containing supernatant (caution: supernatants contain live lentivirus), collect the medium from each T225 flask 48 h after transfection. Pool supernatents together and filter with a 0.22 μm low protein binding filter unit. Store at 4  C (see Note 8). 6. Add 40 ml of fresh 293T media and incubate for an additional 24 h at 37  C with 5% CO2. 7. Day 5. Harvest the second batch of virus-containing supernatant from each flask 72 h after transfection, pass through a 0.22 μm filter unit, and pool with previous harvest (see step 5 in Subheading 3.1).

98

Valentina Carlini et al.

8. In order to concentrate the viral particles, transfer all clarified supernatants from step 7 (media) to a sterile container and combine 1 volume of Lenti-X Concentrator with 3 volumes of supernatant. Mix by gentle inversion and incubate the mixture at 4  C for 30 min to overnight. 9. Centrifuge the sample(s) at 1500
g for 45 min at 4  C. After centrifugation, an off-white pellet will be visible. 10. Carefully remove supernatant, taking care not to disturb the pellet. Residual supernatant can be removed with a pipette after a brief centrifugation at 1500
g. Gently resuspend the pellet in ~10 ml of NDIFF227 and aliquot the concentrated lentivirus into labeled 1.5 ml screw-cap tubes. Store viral aliquots at 80  C. If stored for more than 6 months, recalculate the infection efficiency of the lentiviral preparation (see Subheading 3.2) as prolonged storage might result in infectivity loss. 3.2 Optimization of Transduction Efficiency

It is critical to assess the infection efficiency of the lentiviral preparation. The objective is to identify the optimized titration ratio such that cells receive a single viral particle on average (and therefore a single integrating gRNA): suggested infection efficiency is 30–50%. This section will take approximately 6 days: 1. Day 1. Precoat a 12-well plate (12WP) with 0.1% gelatin for 1 h, aspirate and allow to air-dry. Seed 1.5
105 SGET mESC into nine wells of the 12WP (n ¼ 9) with 800 μl ESC culture media per well. 2. Day 2. Replace with fresh ESC culture media. Rapidly thaw a lentiviral aliquot at 37  C (see step 10 in Subheading 3.1) then keep on ice. Transduce the cells across a titration curve by adding the viral supernatant to each well in varying amounts (for example: 300 μl, 100 μl, 30 μl, 10 μl, 3 μl, 1 μl), leaving two wells virus-free (0 μl) (nontransduced controls) (n ¼ 8) (see Note 9). The cells in the final well should be collected and counted on this day, giving the number of cells that were transduced. 3. Day 3. Aspirate the virus and wash five times with PBS. Add 800 μl of fresh ESC media containing puromycin (1.2 μg/ml final concentration) to the transduced wells (n ¼ 6) and one nontransduced well (selection control, n ¼ 1) to start the antibiotic selection. Additionally, add 800 μl of ESC media without puromycin to the final nontransduced well (background control, n ¼ 1). 4. Day 5 and 6. Once no viable cells remain in the selection control (nontransduced) well, accurately count live cells in all wells using a cell counter such as countess II. Divide the number of cells in each transduced well by the total number of cells in the

CRISPR Screening for Developmental Regulators

99

background control (without puromycin) to calculate the infection efficiency of the viral supernatant (see Note 10). 5. Identify the ratio of viral supernatant to number of cells that gives an infection efficiency (puromycin resistance) of 30–50%. 3.3 Lentiviral Transduction into SGET ESC

This section describes how to generate an ESC line carrying an integrated genome-wide gRNA library to enable subsequent phenotype screening. It is essential that the cells express Cas9. The SGET ESC described here already carry an integrated single-copy of constitutively expressed Cas9. The health of the target ESC cell line is critical for obtaining accurate results. Cells should be checked regularly for mycoplasma, have less than 25 passages, proliferate well with no overt signs of differentiation, and be routinely passaged before sub-confluence with regular (daily) media changes (“feeding”). This section will take approximately 2 weeks: 1. Day 1. Precoat 3 T225 flasks and one well of a 12-well plate with 0.1% gelatin for 1 h, aspirate and allow to air-dry. The day before transduction seed 1
107 SGET mESC into each of the three gelatin precoated T225 flasks with 40 ml ESC culture media. In parallel plate 1.5
105 SGET mESC into one well of a 12-well plate to estimate the proliferation rate of your cells needed for step 2 in Subheading 3.3 (growth control). 2. Day 2. Count the cells from the growth control and use the proliferation rate to estimate the total number of cells in each T225 flask to be transduced. Rapidly thaw the appropriate number of lentiviral aliquots at 37  C, then keep on ice. Add the optimized volume of lentiviral supernatant to cells calculated at steps 4 and 5 in Subheading 3.2 to obtain an infection efficiency of 50% (see Notes 10 and 11). 3. Day 3. Aspirate the media and wash the mESC 5
times with PBS. Add fresh ESC culture media supplemented with puromycin (1.2 μg/ml final). 4. Day 4–9. Perform daily media changes and maintain the antibiotic selection for 7 days. Cells should be passaged when/if they reach 70% confluence. It is critical to passage sufficient cells to maintain coverage of the gRNA library (see Notes 10, 12, and 13). 5. Day 10–12. Following selection, the knockout SGET ESC population should be maintained in T225 flasks in ESC media without puromycin for a further 3 days to allow recovery/induce knockout, ensuring >3.2
107 cells are passaged. Cryofreeze aliquots of 5
107 cells (see Note 14) and proceed to induction of EpiLC-PGCLC for CRISPR screening when convenient (directly or later from frozen cells) (see Subheading 3.4).

100

Valentina Carlini et al.

Fig. 1 Dynamic activity of the SGET reporter. Top panel shows a schematic of SGET activity during PGCLC induction with culture conditions shown above. The lower panel(s) shows representative fluorescent images of cells or PGCLC embryoids at each transitional stage. SGET enables a “traffic-light” read-out whereby naive ESC are double-positive orange (SG+ET+), competent EpiLC are red-only (SGET+), and nascent PGCLC are preferentially green (SG+ETlow) enabling each fate to be distinguished and isolated

6. Day 12. Before continuing with Subheading 3.4 confirm that naı¨ve SGET ESC are >90% double-positive (SG+ET+) using fluorescence cytometry (see Fig. 1). 3.4 Induction of EpiLC and PGCLC with CRISPR Library

This section describes how to induce EpiLC and PGCLC from naı¨ve ESC, and when to collect samples for screen analysis and validation. This section will take approximately 8 days: 1. Day 1. After step 5 in Subheading 3.3, split the transduced SGET mESC by washing 2 times with PBS and dissociating into single-cells with 4 ml of TrypLE per T225, incubate at 37  C for 5 min and then resuspend in ESC media to dilute out the TrypLE. Count the cells and set aside the “ESC” sample of >3.2
107 cells for later genomic DNA extraction (see Fig. 2) (see Note 15 and Subheading 3.5).

CRISPR Screening for Developmental Regulators

101

2. Induce EpiLC from the remaining SGET mESC by plating 1.2
107 cells into each of 3T225, precoated with fibronectin (see Note 16), and with 40 ml of fresh EpiLC culture media. Change the media daily. 3. Day 3. After 42 h of EpiLC differentiation, wash the cells with PBS and dissociate using TrypLE (see step 1 Subheading 3.4). Resuspend EpiLC in PBS with 1% KSR. Use fluorescent activated flow cytometry (FACS) to isolate the EpiLC population that has successfully transited to the formative pluripotent state (SGET+) and that which has failed to exit naı¨ve pluripotency (SG+ET+) (see Fig. 2). 4. Set aside a fraction of both the purified “SGET+ EpiLC” sample and the “SG+ET+ EpiLC” sample for genomic DNA extraction (see Note 17). Pellet cells by centrifugation, remove the supernatant, and flash freeze. Store at 80  C for later DNA extraction (see Note 18 and Subheading 3.5). 5. For induction of PGCLC: Plate 1.5
106 of the purified SGET+ EpiLC per well of an ultra-low attachment microwell 6-well plate (see Note 1), using 3 ml of PGCLC media per well. A total of at least 23 wells should be used to ensure >400
coverage (>3.2
107 cells). This will induce the formation of 2400 individual “embryoids” per well (approximately 55,000 embryoids in total). As a control, setup one well of SGET+ EpiLC in PGCLC media without cytokines (without BMP4, BMP8, SCF, EGF and LIF), which should not be permissive for PGCLC induction (SGET). 6. Day 4–9. Perform a half-media change every day, taking care not to disturb the embryoids in each well. 7. Day 9. Six days after PGCLC induction, collect all media and spin down embryoids at 200
g for 4 min. Aspirate media and dissociate embryoids resuspending them with TrypLE (use 100 μl of TrypLE for each well of a 6-well) and incubating at 37  C for 5 min. Before proceeding, ensure they are resolved into single cells by trituration. Resuspend cells in PBS with 1% KSR. 8. Isolate PGCLC by fluorescent activated flow sorting (FACS), gating for SG+ETlow (see Fig. 2). These correspond to authentic PGC-like cells. Additionally, for control analysis, flow sort cells that have acquired somatic fate (SGET). 9. Pellet purified populations at 2000
g for 5 min, remove supernatant, and either flash freeze or proceed straight to DNA extraction (see Subheading 3.5).

102

Valentina Carlini et al.

Fig. 2 Experimental design for CRISPR screen using iterative isolation of each cell fate. The schematic shows the strategy for inducing successive cell fate transitions from competent precursors, and in parallel to collect samples by flow cytometry for DNA extraction and screening 3.5 Library Preparation

This section describes extraction of genomic DNA from each isolated population and amplification of all gRNA sequences within for NGS analysis. Specific indexed oligo sequences are used to denote each sample being amplified. This section will take 1–2 days: 1. Perform genomic DNA (gDNA) extraction of each isolated population from the PGCLC cell fate transition protocol (see Subheading 3.4). Minimally this should include: (a) naı¨ve ESC, (b) SGET+ EpiLC (competent). (c) SG+ET+ EpiLC (failed to exit naı¨ve pluripotency). (d) SG+ETlow PGCLC (authentic PGC). (e) SGET soma. Isolate genomic DNA with the DNeasy Blood and Tissue kit (for >1 mio cells) or the Quick-DNA microprep kit (for 10% to increase library diversity, while optional dark cycles can also be used. 3.6 CRISPR Screen Data Analysis

For counting and analysing gRNA frequency (indicative of knockout frequency) we use the Model-based Analysis of Genome-wide CRISPR-Cas9 Knockout (MAGeCK) tool [28]. The program takes in .fastq files containing sequencing reads of the gRNA, and generates a count table. Normalized count tables of control and treated groups are analysed using the MAGeCK negative binomial distribution significance test to generate a list of enriched or depleted sgRNAs. The relative ranking algorithm (RRA) is then used to identify genes exhibiting a significant difference across multiple targeting gRNAs between control (e.g., “SGET+ EpiLC”) precursors, and the next fate transition (e.g., “SG+ETlow PGCLC”). Below are some suggested steps for an initial overview analysis. Because the P5 primers contain stagger sequences, the variable sequence of nucleotides before the gRNA sequence needs to be

104

Valentina Carlini et al.

removed using the CutAdapt tool [29]. Here the following example .fastq files are used: l

“SGET_EpiLC.fastq” (sequenced SGET+EpiLC).

l

“SGET_PGCLC.fastq” (sequenced SG+ETlowPGCLC). 1. Remove the vector and stagger sequence with CutAdapt by running the following command in the terminal: (a) cutadapt -g TTGTGGAAAGGACGAAACACCG -SGET_EpiLC_trimmed.fastq SGET_EpiLC.fastq, (b) cutadapt -g TTGTGGAAAGGACGAAACACCG -SGET_PGCLC_trimmed.fastq SGET_PGCLC.fastq, 2. Download the list of gRNAs used in the library [5] and make a new text file (“BrieLibraryControl.txt”) with three columns: “gRNA_Name”, “gRNA_Target_Sequence” and “Target_Gene_Symbol”. 3. Generate normalized (to total read counts) count tables (“CountTable_EpiLC_PGCLC”) with MAGeCK with the following command: (a) mageck count -l BrieLibraryControl.txt –n CountTable_EpiLC_PGCLC --sample-label SGET_EpiLC, SGET_PGCLC --fastq SGET_EpiLC_trimmed.fastq SGET_PGCLC_trimmed.fastq --norm-method total, 4. With the normalized read count table generated from step 3, Subheading 3.6 (“CountTable_ EpiLC_PGCLC.count_normalized.txt”) it is now possible to compare the conditions using the test command: (a) mageck test -k CountTable_EpiLC_PGCLC.count_normalized.txt -t SGET_PGCLC -c SGET_EpiLC -n PGCLC_LOF_results --pdf_report.

The PDF report generated will reveal the top hits from the screen and changes in single gRNA frequency between the two populations (see Note 23). Alternatively, visualization of the screening data can be generated using log transformed RRA values or adjusted p-values from the readout file (PGCLC_LOF_result.gene_summary.txt) against all genes (in a custom order). Ideally the top hits should have false discovery rate (FDR) less than 0.05, at least three enriched gRNAs (“goodsgRNA”) and log fold change higher than 2. Significant hits should be technically validated by introducing the corresponding gene knockout in the SGET cells and registering the effect on PGCLC development.

CRISPR Screening for Developmental Regulators

4

105

Notes 1. For this protocol, we are using Ultra-low attachment microwell plate from Iwaki, Cat. No. 4810-900. Each well contains 2400 ultra-low attachment micro-wells that facilitate efficient and high-throughput embryoid body formation for PGCLC specification. 2. Optional: addition of 1% Knockout serum replacement (KSR) can improve ESC adhesion. 3. BMP8a and BMP8b are interchangeable. 4. We recommend use of high-quality ultramers from IDT. Take special care to avoid cross-contaminating indexed primers via aerosols. 5. A minimum of 5
107 total colony forming units (CFU) is necessary to maintain library complexity. Assess via plating a 10,000-fold dilution on LB agar. Do not overgrow bacteria since this promotes recombination. 6. Before proceeding to generate lentiviral particles (see step 2 in Subheading 3.1), we recommend to confirm that the amplified library plasmid has maintained sgRNA complexity and representation by NGS sequencing. To do this, follow from step 2 in Subheading 3.5 using the library plasmid as input, with the expectation that >90% of gRNAs should be within one logarithmic range. Notably, the vector library gRNA frequency counts also act as a control for some final analyses. 7. Transfection can alternatively be performed with other strategies such as with linear PEI (25 kDA) to reduce costs. 8. When filtering, use only cellulose acetate or polyethersulfone (PES) (low protein binding) filters. Do not use nitrocellulose filters, which bind surface proteins on the lentiviral envelope. 9. Polybrene (Hexadimethrine bromide) can be added to the culture at a final concentration of 8 μg/ml to enhance the efficiency of transduction [30], albeit we observe only negligible effect. 10. A 30–50% infection efficiency ensures that most cells receive only one gRNA. The transduction needs to be at a scale to achieve a gRNA library coverage of 400
in the final transduced cell population. For example, to achieve coverage of 400
with infection efficiency of 50% using the Brie pooled library (which has 78,637 gRNAs), a total of 6.3
107 cells need to be infected. 11. To maintain coverage of the screening library it is suggested to have at least 2.1
107 SGET in each T225 (6.3
107 cells in total are needed assuming an infection efficiency of 50%).

106

Valentina Carlini et al.

12. Generally, at least 4–7 days are required for the Cas9-induced genetic perturbation to manifest efficiently throughout the population. 13. To maintain a sufficient sgRNA library coverage of 400
, ensure a minimum number of 3.2
107 SGET cells are passaged/maintained at any time point during culture. 14. To cryofreeze cells wash them with PBS and dissociate with 4 ml of TrypLE per T225 flask. Incubate at 37  C for 5 min and resuspend in ESC media to dilute out the dissociating reagent. After counting, spin down 5
107 cells per aliquot and resuspend them in 1.5 ml freezing media (FBS with 10% DMSO). Transfer cells to cryotubes and allow them to cool slowly (1  C/min) at 80  C in a Mr. Frosty cryofreezing container. After 24 h transfer them to long-term storage in liquid nitrogen. 15. The ESC sample collected for DNA extraction can be pelleted by centrifugation, the supernatant removed, and flash frozen. Store cell pellet at 80  C until all samples are obtained. 16. Flasks should be coated with fibronectin (1:60 in PBS) between 6–24 h prior to cell seeding. Aspirate just before use. 17. The SGET+ EpiLC sample needs to be divided for both DNA extraction and PGCLC induction (see steps 4 and 5 in Subheading 3.4). 18. Ensure an appropriate number of cells (>3.2
107) to maintain library coverage are retained for DNA extraction. 19. You should generate an equal ratio master mix of the 8
P5 F primers (10 μM final concentration). Each individual P5 stagger contains a region of different length, which is important to maintain sequence diversity across the flow cell during NGS, by offsetting identical reads coming from the amplicon. The P7 indexed primers contain a unique barcode used to multiplex samples. Use a different P7 primer for each given sample. Both the P5 and P7 primers contain a region to be bound to the flow cell and vector binding sequence. 20. PCR reaction volume can be scaled up or down according to the needs, however we found that performing the PCR in >100 μl volume was inefficient. 21. If less than 4 μg of DNA is obtained from a sample ensure at least four parallel PCR reactions are still setup (each with reduced DNA), to minimize stochastic amplification bias. Additional amplification cycles may be necessary. 22. We suggest you test PCR conditions in advance to optimize number of PCR cycles.

CRISPR Screening for Developmental Regulators

107

23. A good practice when working with new screening data is to see if the genome-wide knockout has been successful. Comparing the distribution of the gRNAs from the plasmid library (control) to the distribution of the gRNAs from the initial transduced ESC cell population (sample) should reveal depletion of essential genes (e.g., ribosomal genes such as Rps5) and often, enrichment of the tumour suppressor p53 is also observed. References 1. Doudna JA, Charpentier E (2014) Genome editing. The new frontier of genome engineering with CRISPR-Cas9. Science 346 (6213):1258096. https://doi.org/10.1126/ science.1258096 2. Hsu PD, Lander ES, Zhang F (2014) Development and applications of CRISPR-Cas9 for genome engineering. Cell 157(6):1262–1278. https://doi.org/10.1016/j.cell.2014.05.010 3. Shalem O, Sanjana NE, Hartenian E, Shi X, Scott DA, Mikkelsen TS, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F (2014) Genome-scale CRISPR-Cas9 knockout screening in human cells. Science 343(6166):84–87. https://doi.org/10.1126/science.1247005 4. Joung J, Konermann S, Gootenberg JS, Abudayyeh OO, Platt RJ, Brigham MD, Sanjana NE, Zhang F (2017) Genome-scale CRISPRCas9 knockout and transcriptional activation screening. Nat Protoc 12(4):828–863. https://doi.org/10.1038/nprot.2017.016 5. Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, Smith I, Tothova Z, Wilen C, Orchard R, Virgin HW, Listgarten J, Root DE (2016) Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat Biotechnol 34(2):184–191. https://doi.org/ 10.1038/nbt.3437 6. Koike-Yusa H, Li Y, Tan EP, Velasco-Herrera Mdel C, Yusa K (2014) Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotechnol 32(3):267–273. https://doi.org/10. 1038/nbt.2800 7. Han K, Jeng EE, Hess GT, Morgens DW, Li A, Bassik MC (2017) Synergistic drug combinations for cancer identified in a CRISPR screen for pairwise genetic interactions. Nat Biotechnol 35(5):463–474. https://doi.org/10. 1038/nbt.3834 8. Tzelepis K, Koike-Yusa H, De Braekeleer E, Li Y, Metzakopian E, Dovey OM, Mupo A, Grinkevich V, Li M, Mazan M, Gozdecka M, Ohnishi S, Cooper J, Patel M, McKerrell T,

Chen B, Domingues AF, Gallipoli P, Teichmann S, Ponstingl H, McDermott U, Saez-Rodriguez J, Huntly BJ, Iorio F, Pina C, Vassiliou GS, Yusa K (2016) A CRISPR dropout screen identifies genetic vulnerabilities and therapeutic targets in acute myeloid leukemia. Cell Rep 17(4):1193–1205. https://doi.org/ 10.1016/j.celrep.2016.09.079 9. Ruiz S, Mayor-Ruiz C, Lafarga V, Murga M, Vega-Sendino M, Ortega S, FernandezCapetillo O (2016) A genome-wide CRISPR screen identifies CDC25A as a determinant of sensitivity to ATR inhibitors. Mol Cell 62 (2):307–313. https://doi.org/10.1016/j. molcel.2016.03.006 10. Fukuda K, Okuda A, Yusa K, Shinkai Y (2018) A CRISPR knockout screen identifies SETDB1-target retroelement silencing factors in embryonic stem cells. Genome Res 28 (6):846–858. https://doi.org/10.1101/gr. 227280.117 11. Parnas O, Jovanovic M, Eisenhaure TM, Herbst RH, Dixit A, Ye CJ, Przybylski D, Platt RJ, Tirosh I, Sanjana NE, Shalem O, Satija R, Raychowdhury R, Mertins P, Carr SA, Zhang F, Hacohen N, Regev A (2015) A genome-wide CRISPR screen in primary immune cells to dissect regulatory networks. Cell. https://doi.org/10.1016/j.cell.2015. 06.059 12. Hackett JA, Huang Y, Gu¨nesdogan U, Gretarsson KA, Kobayashi T, Surani MA (2018) Tracing the transitions from pluripotency to germ cell fate with CRISPR screening. Nat Commun 9(1):4292. https://doi.org/10. 1038/s41467-018-06230-0 13. Li M, Yu JSL, Tilgner K, Ong SH, KoikeYusa H, Yusa K (2018) Genome-wide CRISPR-KO screen uncovers mTORC1mediated Gsk3 regulation in naive pluripotency maintenance and dissolution. Cell Rep 24(2):489–502. https://doi.org/10.1016/j. celrep.2018.06.027 14. Tang WW, Kobayashi T, Irie N, Dietmann S, Surani MA (2016) Specification and epigenetic programming of the human germ line. Nat Rev

108

Valentina Carlini et al.

Genet 17(10):585–600. https://doi.org/10. 1038/nrg.2016.88 15. Hackett JA, Zylicz JJ, Surani MA (2012) Parallel mechanisms of epigenetic reprogramming in the germline. Trends Genet 28(4):164–174. https://doi.org/10.1016/j.tig.2012.01.005 16. Smith A (2017) Formative pluripotency: the executive phase in a developmental continuum. Development 144(3):365–373. https://doi. org/10.1242/dev.142679 17. Hackett JA, Surani MA (2014) Regulatory principles of pluripotency: from the ground state up. Cell Stem Cell 15(4):416–430. https://doi.org/10.1016/j.stem.2014.09. 015 18. Yamaji M, Seki Y, Kurimoto K, Yabuta Y, Yuasa M, Shigeta M, Yamanaka K, Ohinata Y, Saitou M (2008) Critical function of Prdm14 for the establishment of the germ cell lineage in mice. Nat Genet 40(8):1016–1022. https:// doi.org/10.1038/ng.186 19. Tu S, Narendra V, Yamaji M, Vidal SE, Rojas LA, Wang X, Kim SY, Garcia BA, Tuschl T, Stadtfeld M, Reinberg D (2016) Co-repressor CBFA2T2 regulates pluripotency and germline development. Nature 534(7607):387–390. https://doi.org/10.1038/nature18004 20. Ohinata Y, Payer B, O’Carroll D, Ancelin K, Ono Y, Sano M, Barton SC, Obukhanych T, Nussenzweig M, Tarakhovsky A, Saitou M, Surani MA (2005) Blimp1 is a critical determinant of the germ cell lineage in mice. Nature 436(7048):207–213. https://doi.org/10. 1038/nature03813 21. Kurimoto K, Yabuta Y, Ohinata Y, Shigeta M, Yamanaka K, Saitou M (2008) Complex genome-wide transcription dynamics orchestrated by Blimp1 for the specification of the germ cell lineage in mice. Genes Dev 22 (12):1617–1635. https://doi.org/10.1101/ gad.1649908 22. Hayashi K, Ohta H, Kurimoto K, Aramaki S, Saitou M (2011) Reconstitution of the mouse germ cell specification pathway in culture by pluripotent stem cells. Cell 146(4):519–532. https://doi.org/10.1016/j.cell.2011.06.052 23. Saitou M, Miyauchi H (2016) Gametogenesis from pluripotent stem cells. Cell Stem Cell 18 (6):721–735. https://doi.org/10.1016/j. stem.2016.05.001

24. Irie N, Weinberger L, Tang WW, Kobayashi T, Viukov S, Manor YS, Dietmann S, Hanna JH, Surani MA (2015) SOX17 is a critical specifier of human primordial germ cell fate. Cell 160 (1–2):253–268. https://doi.org/10.1016/j. cell.2014.12.013 25. Sasaki K, Yokobayashi S, Nakamura T, Okamoto I, Yabuta Y, Kurimoto K, Ohta H, Moritoki Y, Iwatani C, Tsuchiya H, Nakamura S, Sekiguchi K, Sakuma T, Yamamoto T, Mori T, Woltjen K, Nakagawa M, Yamamoto T, Takahashi K, Yamanaka S, Saitou M (2015) Robust in vitro induction of human germ cell fate from pluripotent stem cells. Cell Stem Cell 17 (2):178–194. https://doi.org/10.1016/j. stem.2015.06.014 26. Hikabe O, Hamazaki N, Nagamatsu G, Obata Y, Hirao Y, Hamada N, Shimamoto S, Imamura T, Nakashima K, Saitou M, Hayashi K (2016) Reconstitution in vitro of the entire cycle of the mouse female germ line. Nature 539(7628):299–303. https://doi.org/10. 1038/nature20104 27. Kurimoto K, Yabuta Y, Hayashi K, Ohta H, Kiyonari H, Mitani T, Moritoki Y, Kohri K, Kimura H, Yamamoto T, Katou Y, Shirahige K, Saitou M (2015) Quantitative dynamics of chromatin remodeling during germ cell specification from mouse embryonic stem cells. Cell Stem Cell 16(5):517–532. https://doi.org/10.1016/j.stem.2015.03. 002 28. Li W, Xu H, Xiao T, Cong L, Love MI, Zhang F, Irizarry RA, Liu JS, Brown M, Liu XS (2014) MAGeCK enables robust identification of essential genes from genome-scale CRISPR/Cas9 knockout screens. Genome Biol 15(12):554. https://doi.org/10.1186/ s13059-014-0554-4 29. Martin M (2011) Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J 17(1):10–12. https://doi. org/10.14806/ej.17.1.200 30. Denning W, Das S, Guo S, Xu J, Kappes JC, Hel Z (2013) Optimization of the transductional efficiency of lentiviral vectors: effect of sera and polycations. Mol Biotechnol 53 (3):308–314. https://doi.org/10.1007/ s12033-012-9528-5

Chapter 8 Somatic Reprograming by Nuclear Transfer Vincent Brochard and Nathalie Beaujean Abstract Somatic cell nuclear transfer (SCNT) is a powerful technique, although challenging, to study reprograming into the totipotent state of differentiated nuclei in mammals. This procedure was initially applied in farm animals, then rodents, and more recently in primates. Nuclear transfer of embryonic stem cells is known to be more efficient, but many types of somatic cells have now been successfully reprogramed with this procedure. Moreover, SCNT reprograming is more effective on a per cell basis than induced Pluripotent Stem Cells (iPSC) and provides interesting clues regarding the underlying processes. In this chapter, we describe the protocol of nuclear transfer in mouse that combines cell cycle synchronization of the donor cells, enucleation of metaphase II oocyte and Piezo-driven injection of a donor cell nucleus followed by activation of the reconstructed embryos and nonsurgical transfer into pseudo-pregnant mice. Moreover, this protocol includes two facultative steps to erase the epigenetic “memory” of the donor cells and improve chromatin remodeling by histones modifications targeting. Key words Somatic cell nuclear transfer, SCNT, Mouse embryo, HDACi

1

Introduction The scientific concept that differentiated somatic cells (established cells from the body) can be reprogramed to other cell fates was a major change in biology and its potential biomedical application has since fuelled many research programs. Cell reprograming by somatic cell nuclear transfer (SCNT) was the first and arguably most comprehensive methodology to restore totipotency to somatic cells in mammals [1]. Thereafter, induced pluripotent stem cells (iPSC) were hailed as a solution to ethical issues presented by SCNT [2, 3]. However, it presents its own scientific conundrums regarding induced pluripotency mechanisms compared to embryonic stem cell (ESC) pluripotency. On the other hand, ESC derivation requires embryo development, raising ethical issues in humans. The accessibility of iPSC methodology has brought the objectives of regenerative medicine with reprograming of patient-specific somatic cells closer but current protocols still

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_8, © Springer Science+Business Media, LLC, part of Springer Nature 2021

109

110

Vincent Brochard and Nathalie Beaujean

suffer from low efficiency related to natural epigenetic barriers and the difficulty of reactivating accurate embryonic stem (ES) cell-like transactivation expression patterns in somatic cells. We believe these problems could be overcome through a greater understanding of normal embryonic programing and somatic cell nuclear transfer (SCNT) reprograming. SCNT is indeed more effective on a per cell basis than iPSC, possibly because it recapitulates normal developmental processes. This technique is based on the transfer of a single nucleus (from the so-called donor cell) into an enucleated oocyte. The donor nucleus is then reprogramed by oocyte cytoplasmic factors to allow embryonic development. These factors are capable of reprograming the donor nucleus to totipotency thereby providing this newly reconstructed embryo with the capacity to give rise to all the cell types of an entire organism. In mammals, this process normally takes place after fertilization, when oocytes reprogram terminally differentiated sperm into a totipotent state that is gradually lost during preimplantation development. The SCNT technique was quickly adapted to many species after the success of Dolly the sheep; bovine [4], mouse [5], rabbit [6], rat [7], and more recently monkey [8]. However, success rates remain low and various strategies have been used to increase them such as the use of different donor cell types, in different cell cycle stages and the use of different enucleation techniques. In most published SCNT procedures, the donor nuclei are from quiescent differentiated cells and therefore do not require special treatment prior to transfer. Otherwise, when DNA synthesis ensues or is completed in the donor nucleus prior to its transfer, aneuploidy and chromosome damage will occur. However, it is possible to use nuclei from cells growing in culture after cellular arrest, thanks to serum starvation or culture confluence (G0 arrest), and by inhibition of DNA synthesis (G1 arrest). It has been shown that SCNT was slightly more efficient with cells arrested in the G1 phase, probably because DNA synthesis then occurs earlier after transfer, in synchrony with the ooplasmic program [9, 10]. Based on this, we describe in this chapter the preparation of the donor nuclei allowing the transfer of nuclei when in the diploid G0 or G1 state. We will also describe the Piezo-driven transfer of the donor nucleus. Whereas in most species, SNCT can be performed by electrofusion, Piezo-driven SCNT is the fastest and more efficient way of reconstructing mouse embryos [11]. Our method combines enucleation of MII metaphase oocyte and injection of a donor nucleus in a single manipulation, followed by chemical activation of the reconstructed embryos. Based on this technique, many cloned mice could be generated, either with embryonic stem (ES) cells [12, 13], fetal neurons [14], immature Sertoli cells [15], tail tip fibroblast [16], primordial germ cells [17], iPS cells [2], vaginal smear cells [18] or even “dead” cells from regular frozen mouse bodies [19].

SCNT in Mouse

111

However, abnormalities of SCNT embryonic development greatly increase as nuclei are taken from progressively more differentiated donor cells. Chromosomal protein exchange, transcription factor supply, and chromatin access upon transfer are known to be important for reprograming [20–24]. Recent technical advances, particularly low-input sequencing techniques, have also demonstrated that transcriptomic and epigenetic reprograming deficiency during SCNT [25]. Similarly, iPSC retain some epigenetic “memory” of somatic cells as residual marks, even more than for ESC derived from SCNT-embryos [26]. Indeed, chromatin accessibility is expected to be globally reprogramed to accommodate the transition from a somatic cell-type of nuclear organization to a totipotent one upon SCNT. This chromatin reprograming after SCNT has been studied for many years, showing that despite global chromatin landscape reprograming, some genomic regions are resistant to this reprograming when compared to fertilized embryos. We previously showed that these regions are enriched for the heterochromatin markers such as DNA methylation or histone repressive modifications (such as H3K9me3) [25, 27–30]. This is consistent with the fact that H3K9me3 in donor cells represents an epigenetic barrier for iPSC reprograming [31, 32]. As these DNA and histone modifications can regulate gene transcription and thereby affect embryonic genome activation (EGA), successful SCNT reprograming clearly requires reprograming of the epigenetic landscape from the donor cell to the embryonic one [33]. Many groups have attempted to increase the efficiency of generating cloned mice by modulating the chromatin state in early cloned embryos. Based on the fact that the level of H3K9 acetylation is lower in SCNT versus fertilized embryos, the use of histone deacetylases inhibitor (HDACi), such as trichostatin A (TSA), m-carboxycinnamic acid bishydroxamide (CBHA), or Scriptaid, has emerged to improve remodeling of nuclear architecture in SCNT early embryos as well as development to term [16, 23, 34, 35]. Similarly, in an attempt to induce H3K9me3 demethylation, mRNAs encoding the H3K9me3-specific demethylase Kdm4d can be injected in the SCNT embryos soon after reconstruction. This improves preimplantation development of mouse SCNT embryos, improving EGA and allowing the embryos to reach the blastocyst stage with a rate comparable to that of fertilized ones. It also increased the pup rate from less than 1% to more than 8% [32]. Remarkably, the first cloned monkeys, born last year, were obtained, thanks to the combination of HDACi and Kdm4d mRNA injection [8]. In this chapter, we therefore introduce the use of both HDACi and mRNA injections in SCNT embryos.

112

2 2.1

Vincent Brochard and Nathalie Beaujean

Materials Mice

1. B6D2F1 (C57BL/6xDBA/2) or B6CBF1 (C57BL/6xCBA/J) F1 hybrid mice, between 6 and 12 weeks old, are optimal for collection of recipient oocytes (see Note 1). Nuclear transferred embryos derived from these oocytes have better development in vitro and in vivo than oocytes from inbreed and outbred mouse strain. 2. ICR (CD-1) mice are usually used as pseudopregnant surrogate mothers, foster mothers, and vasectomized males (see Note 2).

2.2

Media and Cells

1. Cumulus derived from Cumulus-Oocytes-Complexes (COC) must be collected and used on the day of the procedure. Other cultured cells like Mouse Embryonic Fibroblast (MEF) cells need specific treatment before use. Detailed procedures are explained below. 2. M2 embryo media for oocyte collection and embryo manipulation outside the incubator (see Note 3). 3. M16 embryo media based on modified Krebs-Ringer bicarbonate solution used for embryo culture in an incubator with 5% CO2 atmosphere at 37  C at the 1-cell and 2-cell stages. 4. Kalium simplex optimized medium (KSOM) allows outbred zygotes to overcome the 2-cell block and supports in vitro and in vivo development of various mouse strains. 5. The most used activation medium is CZB where CaCl2 has been replaced by SrCl2: 82 mM NaCl, 4.8 mM KCl, 1.2 mM KH2PO4, 1.2 mM MgSO4-7H2O, 30.1 mM Sodium Lactate, 0.26 mM Sodium Pyruvate, 25 mM NaHCO3, 1 mM Glutamine, 5 mg/ml BSA, 10 mM SrCl2-6H2O (see Note 4). 6. Mouse Embryonic Fibroblast medium: DMEM High Glucose medium supplement with 10% FBS, 0.1 mM nonessential amino acids, 2 mM GlutaMAX, 50 U/ml penicillin–streptomycin, 0.1 mM 2-mercaptoethanol.

2.3

Chemicals

1. 300 IU/ml Hyaluronidase stock solution (dissolved in M2). Dissolve hyaluronidase in M2 medium directly at 300 IU/ml working concentration. Store in suitable aliquots at 20  C and thaw freshly before use (the thawed aliquots can be kept up to 48 h at 4  C). 2. 1 mg/ml Cytochalasin B stock in 20  C. Dilute at 5 μg/ml concentration in M2 and in CZB-activation medium prior to each experiment of nuclear transfer of donor cells in interphase (see Note 5).

SCNT in Mouse

113

3. HDACi: 10 mM Trichostatin A, 50 μM PDX101, 1 mM SAHA, 250 μM Scriptaid . Store aliquots at 80  C. Dilute the compounds freshly 1000 in activation and culture media before use. 4. 10 μg/ml Demecolcin: store aliquots at 20  C. Freshly dilute them 200 in cell culture media before use. 5. Mineral oil (embryo tested). 6. Hormones: 100 IU/ml Pregnant mare serum gonadotropin (PMSG) and 100 IU/ml human chorionic gonadotropin (hCG) kept at 20  C. 7. 1.7–1.8 g/ml Fluorinert FC-770. 8. Mouse mRNA solution: store aliquots at 80  C. Freshly dilute and filter them before use with a 0.22 μm filters (see Note 6). 2.4 Equipment and Tools

1. Inverted microscope equipped with Nomarski differential interference contrast (DIC) optical components, Hoffman modulation contrast (HMC) optics or polarized light system (spindle view microscopy) (see Note 7). 2. Micromanipulator set: coarse manipulator (Narishige) with motor-drive system (MMO-4; MM-94, Narishige or TransferMan 4 m, Eppendorf). 3. Manual microinjector set such as the manual microinjector CellTram Air (Eppendorf) for oocytes holding pipette and the CellTram Oil (Eppendorf) for donor nucleus injection pipette. 4. Piezo impact drive systems PMM (Prime Tech Ltd) and Piezo Xpert (Eppendorf) can both provide good results for zona pellucida piercing and oolemma penetration. 5. Humidified CO2 incubator set at 37  C and 5% CO2. 6. Stereomicroscope preferably with a heating stage or alternatively equipped with heating plates, one on the stereomicroscope and one on the side (see Fig. 1). 7. Small lab equipment to manipulate the oocytes/embryos (see Fig. 1) [36]. 8. Pipette puller and microforge, glass capillary with inner diameter 100 μm, and with inner filament for RNA injection. Readyto-use pipettes, supplied by various companies are also usable. Holding pipette: outer diameter 80–100 μm, inner diameter 10–15 μm. Enucleation pipette: inner diameter 7–10 μm blunt pipette depending on the size of the cell nuclei to inject. 9. Electronic pneumatic injector for RNA injection: femtojet injection system (Eppendorf) or equivalent.

114

Vincent Brochard and Nathalie Beaujean

Fig. 1 Bench setup. Everything must be ready for oocyte collection with tweezers, scissors, mouth manipulation pipette, Petri dishes, a hot plate, and a stereomicroscope, as previously described [36]

3

Methods In this chapter, we describe the procedure for SCNT in mouse with cumulus or MEF cell and with additional HDACi Scriptaid treatment or additional RNA microinjection to decrease epigenetic resistance. From cell culture to caesarean delivery of the cloned pups it takes about 1 month (see Fig. 2).

3.1 Superovulation and Collection of Oocytes

1. In standard light–dark cycles in the mouse room, inject 10 IU PMSG at 7 PM and 10 IU HCG 46–48 h later. 13–15 h after hCG injection, sacrifice the female mice by cervical dislocation and collect oviducts. 2. Thaw one aliquot of hyaluronidase working solution at 37  C. 3. Retrieve oocyte-cumulus cell complexes (COC) from the oviduct ampulla under a stereomicroscope in M2 medium by tearing the ampulla. Place COC in 25 μl drops of hyaluronidase solution at 37  C for few minutes to digest the intercellular matrix between oocytes and cumulus cells. Retrieve the oocytes and wash them by gently pipetting and transferring them in different separated M2 drops at least three times.

SCNT in Mouse

115

Nuclear transfer and RNA injection

Cell culture G0/G1 synchronisation Confluence/Serum deprivation

J-3

7pm PMSG

J-1

7pm HCG

J-0

9am Oocytes collection 10am Enucleation +MEF nucleus injection in M2+CB

9:30am Trypsination Store at 4 °C

Batch of 20/30 Oocytes / 30 minutes New batch at each new oocytes batch

12am Culture in Sr-Cl +CB 5pm Culture in M16 6pm RNA injection in M2 +CB

+HDACi

Batch of 10/20 Oocytes / 10 minutes 7pm Culture in M16 J+1

9am Culture in KSOM and/or Transfer

J+2 J+3 J+4 Embryo transfer Pseudopregnant 0.5 dpc and/or 2.5 dpc for blastocysts Cesarean and adoption 18.5 dpc

Fig. 2 Timing for the main SCNT steps

4. Collect good quality oocytes to M16 medium and recover them in CO2 incubator for 30 min. Around 10% of oocytes are abnormal and should be eliminated, such as oocytes with a small cytoplasm, a dark cytoplasm, or an enlarged zona. This whole procedure is optimally manipulated on a warming stage at 37  C. 3.2 Donor Cell Preparation

The somatic nuclei are selected in the diploid G0/G1 states. The cell culture protocols must be adapted according to each cell type. The most used cells are cumulus cells and fetal fibroblasts. 1. Cumulus cells: Collect fresh cumulus cells from the previous step by digesting COC. Resuspended cumulus cells by pipetting and wash them in M2 medium three times to remove residual hyaluronidase. Place a concentrated suspension of

116

Vincent Brochard and Nathalie Beaujean

cells into the micromanipulation chamber. Cumulus cell can be kept in M2 medium a few hours at 4  C before use. 2. Fetal fibroblasts donors cell synchronization in G0/G1: The principal approaches for cellular preparation are serum starvation and/or culture confluence. Plate 1–2  106 cells on a 10 cm tissue culture dish 4 days before nuclear transfer. Change cell medium on next day with low serum concentration (0.5%). Confirm cells are confluent under inverted microscopy 2 days before nuclear transfer. In interphase, cells could be collected after trypsinization. Aspirate medium and wash with Ca2+ and Mg2+ free PBS three times. Add 1.0 ml of PBS containing 0.25% trypsin and 1 mM EDTA into culture dish and incubate at 37  C for several minutes. Use inverted microscopy with phase contrast optics to confirm that 80% cells form single suspended cells. Add 3 ml of culture medium to neutralize the trypsin. Collect cells by aspirating the culture medium into centrifuge tube. Spin down trypsinized cells by centrifugation at 1000  g for 5 min. Remove residual trypsin by washing cells in PBS. Resuspend the cells with 100 μl of M2 medium and keep these highly concentrated cells at 4  C until SCNT. 3.3 Setting Up the Micromanipulation System

1. Preparation of holding and nuclei microinjection pipettes: pull the glass capillaries on a micropipette puller and produce bluntended needles on a microforge. The outside diameter (OD) and inside diameter (ID) of holding pipette should be 80 μm and 20 μm respectively. For nuclei injection pipet, the ID should be slightly smaller than donor cells (e.g., 7–8 μm for cumulus cells, 12 μm for fibroblast cells). 2. Backload approximately 2 μl of FC-770 into injection pipette and fit the capillary into actuator of Piezo system connected with pipette holder of CellTram oil microinjector. Push FC-770 to the tip of the pipette. 3. Fit holding pipette into pipette holder of the CellTram air microinjector. 4. Put the tips of both holding and injection pipettes down to the glass of the micromanipulation chamber [37]. The position of the tips should be adjusted so as to be at the same Z- and Y-level under the view of the inverted microscope. Add 1 ml of M2-CB and mineral oil in the micromanipulation chamber. Expel excess air from holding and injection pipettes.

3.4 Piezo-Operated Nuclear Transfer

1. Place 20–40 oocytes in the M2 + CB medium in the north sector of micromanipulation chamber. Each group of oocytes should be processed within less than 20 min. Wait 5 min until CB breaking cytoskeleton of oocytes. Place 2 μl of donor-cell suspension in the same drop as the oocytes.

SCNT in Mouse

117

Fig. 3 Setp-by-step for cumulus cell injection. (a) Metaphase II spindle localization, (b) ZP hole, (c) spindle in injecting pipette, (d) spindle out of injecting pipette, (e) cumulus cell, (f) clean cumulus cell nucleus, (g) nucleus before injection, (h) nucleus after injection

2. Pick a single oocyte and rotate it gently with the holding pipette from left hand. The metaphase II (MII) spindle can be recognized by DIC or Hoffman optics. Immobilize oocyte until the MII spindle is located around 3 o’clock (see Fig. 3a; see Note 8). 3. Approach the zona pellucida with injection pipette from the right-hand side. Push the FC-770 near to the tip of the injection. Drill the zona pellucida by applying a few strong piezo pulses until the zona is pierced (see Fig. 3b; see Note 9). 4. Insert the enucleation pipette into the oocyte without using piezo pulses, to avoid breaking the oolemma. The MII spindle looks like a small sphere and is harder than the cytoplasm. Remove the MII spindle by aspiration with a minimal volume of cytoplasm (see Fig. 3c, d; see Note 10). 5. Select single donor cell on the bottom of manipulation chamber. Break the cell membrane and isolate the nucleus from cytoplasm by gently aspirating it in and out of the injection

118

Vincent Brochard and Nathalie Beaujean

needle once or twice. Stabilize the donor nucleus inside of injection needle near to the tip (see Fig. 3e, f). 6. Push the injection needle through the pre-drilled hole of zona pellucida without using any piezo pulse (see Note 11). Pass injection needle through the oocyte to the opposite side in order for the donor nucleus not to come out when removing the injection needle. Puncture the ooplasm by applying a single light piezo pulse. Immediately eject the donor nucleus into the ooplasm (see Fig. 3g). 7. Withdraw the injection needle fast but gently out of the oocytes. Just before the pipette is completely out of the cytoplasm, the broken edges of the membrane must be drawn up carefully to seal the hole made by the injection needle (see Fig. 3h; see Note 12). 8. Release the reconstructed oocytes from the holding pipette. Select the next oocyte and repeat the nuclear transfer procedure (see Note 13). 9. Return the reconstructed oocytes into M16 medium in the incubator for 1 h. 3.5 Activation and Culture of Nuclear Transfer Embryos

1. Prepare 500 μl of CZB-SrCl activation medium in 4-well plates without oil overlay. Add 5 μg/ml of CB and the HDACi if desired (e.g. 25 nM Scriptaid) into activation medium and equilibrate it for 1 h in incubator at 37  C under 5% CO2. 2. Transfer reconstructed embryos into activation medium and culture for 5 h. 3. Wash the activated reconstructed embryos three times in 20 μl of M16 droplets (in culture dishes covered with mineral oil), to remove CB. Continue culture of the reconstructed embryos in M16 droplets, supplemented with the HDACi if desired, for a total duration of 10 h. 4. Wash reconstructed embryos in M16 culture medium three times and culture them in M16 (in culture dishes covered with mineral oil), until late 2-cell stage. 5. Change the culture medium from M16 to KSOM at late 2-cell stage for development in the incubator until blastocyst stage.

3.6 RNA Cytoplasmic Injection (Optional)

1. After activation in CZB-SrCl (step 2 in Subheading 3.5), embryos are rinsed and put in M16 1 h before the intracytoplasmic injection. Set up micromanipulation system as seen previously for the chamber and the holding pipette. For RNA injection, use injecting pipette prepared from glass capillary with inner filament (1.0 mm OD, 0.78 mm ID) and pulled horizontally in order to obtain a 0.4 μm tip. Fill the injecting pipette with 1–2 μl of RNA solution. Fix pipette on the air injector FemtoJet (see Note 14).

SCNT in Mouse

119

Fig. 4 RNA microinjection of SNCT embryos. (a) 1-cell embryo positioned with suction from the holding pipette and injection needle loaded with the microinjection mixture aligned in the same focal plane as the cytoplasmic membrane of the embryo. (b) The tip of the injection needle is inserted through the zona pellucida. (c) The injection needle is inserted up deeply in the cytoplasm of the embryo. (d) Once the injection needle has penetrated in the cytoplasm, the cytoplasmic membrane is relaxed and goes back to its initial position. (e) The mRNA solution is in the cytoplasm; note the swelling of the injected area. (f) Quick and smooth removal of the needle after injection

2. Under microscope, use an embryo to adjust the settings of the pipettes and the injector (see Note 15). If the RNA injection pipette is sealed, the pipette can be opened by lightly tapping the tip of the injection pipette against the holding pipette. Clean the pipette with a high-pressure pulse. 3. Transfer embryos into M2 drop in the chamber under microscope. With holding pipette apply gentle vacuum to affix one embryo to the tip of the pipette (see Fig. 4). The embryo can be gently rotated with the help of the injection pipette to locate the pronuclei not to damage it by pricking (see Note 16). Adjust focus of the microscope on the cytoplasmic membrane and adjust the position of the injection pipette that should be in the same focal plane. 4. The pipette is introduced into the cytoplasm at 2/3 depth and the injection is triggered. The injection is visually confirmed by the appearance of a lighter cytoplasmic area at the end of the pipette. 5. Injected embryos have to be maintained in room temperature for at least 10–15 min in M2 to allow the oocyte membranes to recover, before transferring them to the incubator in M16 medium (with HDACi if desired) at 37  C until late 2-cell stage. 6. Change the culture medium from M16 to KSOM at 2-cell stage for development in incubator until blastocyst stage.

120

Vincent Brochard and Nathalie Beaujean

3.7 Embryo Transfer and Caesarean Delivery

1. SCNT embryos at the 2-cell stage up to the blastocyst stage can be transferred to the oviducts of 0.5 dpc pseudopregnant ICR females by surgical technique. Transcervical nonsurgical embryo transfer could also be performed with blastocysts, in 2.5 dpc pseudopregnant recipients (see Note 17). 2. The pups are recovered by caesarean section on the day of delivery (E18.5) and nursed by lactating ICR females (see Note 18).

4

Notes 1. Experimenters must comply with concerning animals and their use.

national

regulations

2. ICR female mice have a more developed maternal instinct. They easily accept and breed the cloned pups. B6CBA F1 and B6D2 F1 could be used too. 3. M2 is a modified Krebs-Ringer solution buffered with Hepes that does not require equilibration in an incubator with 5% CO2 atmosphere, unlike M16. For M2, M16, and activation medium, antibiotics are optional. Commercial or homemade media are both usable. Embryo or cell culture-tested powder and water are used to do homemade medium, and are sterilefiltered on a 0.22 μm filters. 4. M16 can be used as an alternative activation medium when supplemented with: 10 mM SrCl and 2 mM ethylene glycol tetraacetic acid (EGTA). 5. As an inhibitor of actin polymerization, Cytochalasin B (CB) makes mouse MII oocytes more flexible. CB or Cytochalasin D are commonly used during manipulations, and Latruculin A can also be used at 5 μM [38] during activation. 6. We recommend PVDF filters with a 4 mm diameter, like Millex-GV Merck, for minimal hold-up volume. Different mRNA concentrations must be tested according to the target. For example, Kdm4d-mRNA was used at 1.8 μg/μl [32] or USP21 mRNA at 1 μg/μl [25]. 7. A heating stage can be used as it decreases the risk of thermic variations. For enucleation and reconstruction 30  C is a good compromise to clearly see the spindle, while maintaining the cells in metaphase and preventing oocyte lysis during enucleation/reconstruction. 8. The outside border of oocyte ooplasm should be sharply focused through optic while rotating and immobilizing oocyte.

SCNT in Mouse

121

9. The parameters of the piezo to drill the zona pellucida and the cytoplasmic membrane depend of your machine and your injection pipette. The level of vibrations need to be adapted and should remain as low as possible to limit possible deleterious effects of vibrations [21]. To avoid damaging the oocyte, ensure there is a large space between the zona pellucida and the oolemma. 10. Keep the oocyte in the same position with the holding pipette while selecting donor nucleus. 11. Any strong piezo pulse could impair the donor nucleus in the injection needle. 12. Try to aspirate the minimum volume of cytoplasm when sealing the membrane. 13. A skilled operator can finish the whole nuclear transfer procedure in 20–30 s. It is also possible to manipulate in two steps: first enucleating the oocyte and then injecting the donor cell. 14. The pipette can be loaded with a small volume of RNA solution (1–2 μl), deposited with a commercial tip (e.g., Microloader Eppendorf) or with a flame-casted glass capillary. All materials in contact with RNA must be RNase free. 15. Injection increases embryo mortality. A good experience of this technique is necessary to limit it. It is recommended to train on normal embryos to be able to adjust the settings of the Femtojet. Common FemtoJet settings for injection were 60–100 hPa of injection pressure, 15–20 hPa of compensation pressure, and 0.2 s injection duration but must be adjusted to each injection pipette. 16. Pseudo-pronuclei in NT embryos are clearly visible under inverted microscope after activation and the number of embryos with pseudo-pronuclei can easily be recorded to have the number of activated NT embryos. 17. Embryo transfer has to be carried out following requirements from local animal care and use committee. We recommended NSET Non-Surgical Embryo Transfer Device from ParaTech company [39]. This procedure allows the transfer of morula and blastocysts directly in the mouse uterine horns without the animal anesthesia normally required for conventional surgical procedures. It reduces the pain and stress of the animals, providing a valuable refinement of existing transfer procedures. It also greatly reduces time-consuming pre- and postsurgical processes. 18. Estimate the pregnancy progression by gestational age of pseudopregnant female.

122

Vincent Brochard and Nathalie Beaujean

References 1. Campbell KHS, McWhir J, Ritchie WA, Wilmut I (1996) Sheep cloned by nuclear transfer from a cultured cell line. Nature 380 (6569):64–66. https://doi.org/10.1038/ 380064a0 2. Takahashi K, Yamanaka S (2006) Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126:663–676. https://doi.org/10.1016/ j.cell.2006.07.024 3. Nakagawa M, Koyanagi M, Tanabe K et al (2008) Generation of induced pluripotent stem cells without Myc from mouse and human fibroblasts. Nat Biotechnol 26:101–106. https://doi.org/10.1038/ nbt1374 4. Kato Y, Tani T, Sotomaru Y et al (1998) Eight calves cloned from somatic cells of a single adult. Science 282:2095–2098. https://doi. org/10.1126/science.282.5396.2095 5. Wakayama T, Perry AC, Zuccotti M, Johnson KR, Yanagimachi R (1998) Full-term development of mice from enucleated oocytes injected with cumulus cell nuclei. Nature 394:369–374. https://doi.org/10.1038/ 28615 6. Chesne´ P, Adenot PG, Viglietta C et al (2002) Cloned rabbits produced by nuclear transfer from adult somatic cells. Nat Biotechnol 20:366–369. https://doi.org/10.1038/ nbt0402-366 7. Zhou Q, Renard JP, Le Friec G et al (2003) Generation of fertile cloned rats by regulating oocyte activation. Science 302:1179. https:// doi.org/10.1126/science.1088313 8. Liu Z, Cai Y, Wang Y et al (2018) Cloning of macaque monkeys by somatic cell nuclear transfer. Cell 172:881–887.e7. https://doi. org/10.1016/j.cell.2018.01.020 9. Kurosaka S, Nagao Y, Minami N et al (2002) Dependence of DNA synthesis and in vitro development of bovine nuclear transfer embryos on the stage of the cell cycle of donor cells and recipient cytoplasts. Biol Reprod 67:643–647. https://doi.org/10. 1095/biolreprod67.2.643 10. Wells DN, Laible G, Tucker FC et al (2003) Coordination between donor cell type and cell cycle stage improves nuclear cloning efficiency in cattle. Theriogenology 59:45–59. https:// doi.org/10.1016/S0093-691X(02)01273-6 11. Yu Y, Ding C, Wang E et al (2007) Piezoassisted nuclear transfer affects cloning efficiency and may cause apoptosis. Reproduction

133:947–954. https://doi.org/10.1530/ REP-06-0358 12. Wakayama T, Rodriguez I, Perry ACF et al (2002) Mice cloned from embryonic stem cells. Proc Natl Acad Sci 96:14984–14989. https://doi.org/10.1073/pnas.96.26.14984 13. Zhou Q, Jouneau A, Brochard V, Adenot P, Renard JP (2001) Developmental potential of mouse embryos reconstructed from metaphase embryonic stem cell nuclei. Biol Reprod 65:412–419. https://doi.org/10.1093/ biolreprod/65.2.412 14. Yamazaki Y, Makino H, Hamaguchi-Hamada K et al (2001) Assessment of the developmental totipotency of neural cells in the cerebral cortex of mouse embryo by nuclear transfer. Proc Natl Acad Sci 98:14022–14026. https://doi.org/10.1073/pnas.231489398 15. Ogura A, Inoue K, Ogonuki N et al (2005) Production of male cloned mice from fresh, cultured, and cryopreserved immature sertoli cells. Biol Reprod 62:1579–1584. https:// doi.org/10.1095/biolreprod62.6.1579 16. Kishigami S, Mizutani E, Ohta H et al (2006) Significant improvement of mouse cloning technique by treatment with trichostatin A after somatic nuclear transfer. Biochem Biophys Res Commun 340:183–189. https:// doi.org/10.1016/j.bbrc.2005.11.164 17. Miki H, Inoue K, Kohda T et al (2005) Birth of mice produced by germ cell nuclear transfer. Genesis 41:81–86. https://doi.org/10.1002/ gene.20100 18. Kuwayama H, Tanabe Y, Wakayama T, Kishigami S (2017) Birth of cloned mice from vaginal smear cells after somatic cell nuclear transfer. Theriogenology 94:79–85. https:// doi.org/10.1016/j.theriogenology.2017.02. 012 19. Wakayama S, Ohta H, Hikichi T et al (2008) Production of Healthy Cloned Mice From Bodies Frozen at -20 Degrees C for 16 Years. Proc Natl Acad Sci U S A. Nov 11;105 (45):17318–22. https://doi.org/10.1073/ pnas.0806166105 20. Gurdon JB, Wilmut I (2011) Nuclear transfer to eggs and oocytes. Cold Spring Harb Perspect Biol 3:1–14. https://doi.org/10.1101/ cshperspect.a002659 21. Gall L, Brochard V, Ruffini S et al (2012) Intermediate filaments promote nuclear mechanical constraints during somatic cell nuclear transfer in the mouse. Cell Reprogram

SCNT in Mouse 14:497–504. https://doi.org/10.1089/cell. 2012.0027 22. Liu Z, Hai T, Dai X et al (2012) Early patterning of cloned mouse embryos contributes to post-implantation development. Dev Biol 368:304–311. https://doi.org/10.1016/j. ydbio.2012.05.027 23. Maalouf WE, Liu Z, Brochard V et al (2009) Trichostatin A treatment of cloned mouse embryos improves constitutive heterochromatin remodeling as well as developmental potential to term. BMC Dev Biol 9:1–10. https:// doi.org/10.1186/1471-213X-9-11 24. Le Bourhis D, Beaujean N, Ruffini S et al (2010) Nuclear remodeling in bovine somatic cell nuclear transfer embryos using MG132treated recipient oocytes. Cell Reprogram 12:729–738. https://doi.org/10.1089/cell. 2010.0035 25. Jullien J, Vodnala M, Pasque V et al (2017) Gene resistance to transcriptional reprogramming following nuclear transfer is directly mediated by multiple chromatin-repressive pathways. Mol Cell 65:873–884.e8. https:// doi.org/10.1016/j.molcel.2017.01.030 26. Ma H, Morey R, O’Neil RC et al (2014) Abnormalities in human pluripotent cells due to reprogramming mechanisms. Nature 511:177–183. https://doi.org/10.1038/ nature13551 27. Beaujean N, Taylor J, Gardner J et al (2004) Effect of limited DNA methylation reprogramming in the normal sheep embryo on somatic cell nuclear transfer. Biol Reprod 71:185–193. https://doi.org/10.1095/biolreprod.103. 026559 28. Martin C, Beaujean N, Brochard V et al (2006) Genome restructuring in mouse embryos during reprogramming and early development. Dev Biol 292:317–332. https://doi.org/10. 1016/j.ydbio.2006.01.009 29. Pichugin A, Le Bourhis D, Adenot P et al (2010) Dynamics of constitutive heterochromatin: two contrasted kinetics of genome restructuring in early cloned bovine embryos. Reproduction 139:129–137. https://doi.org/ 10.1530/REP-08-0435 30. Ribeiro-Mason K, Boulesteix C, Brochard V et al (2012) Nuclear dynamics of histone h3 trimethylated on lysine 9 and/or phosphorylated on serine 10 in mouse cloned embryos as

123

new markers of reprogramming? Cell Reprogram 14:283–294. https://doi.org/10.1089/ cell.2011.0071 31. Chung YG, Matoba S, Liu Y et al (2015) Histone demethylase expression enhances human somatic cell nuclear transfer efficiency and promotes derivation of pluripotent stem cells. Cell Stem Cell 17:758–766. https://doi.org/10. 1016/j.stem.2015.10.001 32. Matoba S, Liu Y, Lu F et al (2014) Embryonic development following somatic cell nuclear transfer impeded by persisting histone methylation. Cell 159:884–895. https://doi.org/10. 1016/j.cell.2014.09.055 33. Sepulveda-Rincon LP, Del Llano Solanas E, Serrano-Revuelta E et al (2016) Early epigenetic reprogramming in fertilized, cloned, and parthenogenetic embryos. Theriogenology 86:91–98. https://doi.org/10.1016/j.the riogenology.2016.04.022 34. Van Thuan N, Bui HT, Kim JH et al (2009) The histone deacetylase inhibitor scriptaid enhances nascent mRNA production and rescues full-term development in cloned inbred mice. Reproduction 138:309–317. https:// doi.org/10.1530/REP-08-0299 35. Qiu X, Li N, Xiao X et al (2017) Effects of embryo aggregation and PXD101 on the in vitro development of mouse somatic cell nuclear transfer embryos. Cell Reprogram 19:337–343. https://doi.org/10.1089/cell. 2017.0027 36. Boulesteix C, Beaujean N (2015) Fluorescent immunodetection of epigenetic modifications on preimplantation mouse embryos. Methods Mol Biol. 1222:113–26. https://doi.org/10. 1007/978-1-4939-1594-1_9. 37. Brochard V, Liu Z (2015) Nuclear transfert in mouse. Methods Mol Biol. 1222:1–14. https://doi.org/10.1007/978-1-4939-15941_1 38. Terashita Y, Wakayama S, Yamagata K et al (2012) Latrunculin A can improve the birth rate of cloned mice and simplify the nuclear transfer protocol by gently inhibiting actin polymerization. Biol Reprod 86:1–6. https:// doi.org/10.1095/biolreprod.111.098764 39. Steele KH, Hester JM, Stone BJ et al (2013) Nonsurgical embryo transfer device compared with surgery for embryo transfer in mice. J Am Assoc Lab Anim Sci 52:17–21

Chapter 9 Targeted Transgenic Mice Using CRISPR/Cas9 Technology Fatima El Marjou, Colin Jouhanneau, and Denis Krndija Abstract CRISPR/Cas9 is a powerful technology that has transformed gene editing of mammalian genomes, being faster and more cost-effective than standard gene targeting techniques. In this chapter, we provide a stepby-step protocol to obtain Knock-Out (KO) or Knock-In (KI) mouse models using CRISPR/Cas9 technology. Detailed instructions for the design of single guide RNAs (sgRNA) for KO approaches and single-strand oligonucleotide (ssODN) matrix for generation of KI animals are included. We also describe two independent CRISPR/Cas9 delivery methods to produce gene-edited animals starting from zygotestage embryos, based either on cytoplasmic injection or electroporation. Key words CRISPR/Cas9 gene editing, Single guide RNA (sgRNA), Transgenic mouse, Zygote microinjection, Zygote electroporation, Constitutive Knock-Out (KO), Constitutive Knock-In (KI), Single-stranded oligodeoxynucleotides (ssODN)

1

Introduction Genetically modified mice have been crucial for our understanding of a given genomic locus in a physiological context and they constitute a valuable model system for many in vivo studies [1]. Up until recently, using conventional transgenic technologies, targeted transgenic mouse models have been generated in three steps: first, embryonic stem cells (ESCs) are genetically modified in vitro, using a homologous recombination pathway to introduce a mutation or a tag at a chosen locus; second, the modified ESCs are microinjected into a blastocyst, and third, the blastocysts are implanted into pseudopregnant females to produce chimeras whose progeny will eventually lead to a new transgenic line. This conventional transgenic technology is an expensive and long process, which requires 40 weeks on average to obtain a targeted mouse model. Recent developments in genome editing using the CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) and Cas9 (CRISPR-associated protein 9) system have enabled genome

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_9, © Springer Science+Business Media, LLC, part of Springer Nature 2021

125

126

Fatima El Marjou et al.

editing in various organisms, such as plants, bacteria, and mammals. Also, using this technology it is possible to generate targeted mutations directly in mouse zygotes. The CRISPR/Cas9 complex, which associates a single guide RNA (sgRNA) to the nuclease Cas9, scans genomic DNA to find the specific target sequence (20 bases) followed by the protospacer adjacent sequence (PAM), e.g., 50 -NGG in the case of Streptococcus pyogenes Cas9. PAM recognition is essential for CRISPR/Cas9 complex to successfully bind the targeted DNA sequence and induce DNA double-strand breaks (DSBs) via Cas9 nuclease activity. DSBs are most efficiently repaired by the Non-Homologous End-Joining (NHEJ) DNA repair pathway, which is error-prone and will introduce errors by creating insertions or deletions (InDels). This pathway has been successfully exploited in generation of KO mouse models, either by using only one sgRNA to introduce a frameshift mutation in the coding sequence, or two sgRNAs to delete a critical exon or transcriptional regulatory elements. The second pathway involved in endogenous repair processes— homology-directed repair (HR)—is less prevalent and employs homologous recombination process to accurately correct DNA damage, using the sister chromatid DNA as a template. Generation of targeted KI models rely on this pathway, whereby a donor matrix containing two homology arms specific to the targeted locus and flanking the transgene is provided. The HR machinery can employ this donor matrix instead of the sister chromatid to repair DSBs, and thus, a genetic mutation is introduced in a highly targeted manner. Compared to conventional transgenic technology, CRISPR/Cas9 technology has some important advantages: it is inexpensive, fast, and straightforward [2–12]. Designing specific sgRNAs is rather simple, CRISPR/Cas9 genome editing can be performed directly in mouse zygotes and founder animals can be obtained within 3 weeks after injection, although mosaicism is possible. Subsequent breeding for germline transmission can be set up in less than 12 weeks post injection. Altogether, the first generation of heterozygous animals carrying the desired mutation can be obtained in less than 6 months, which is considerably faster compared to conventional transgenic methods. In this chapter, we first describe the main steps for optimal design of sgRNA, as well as ssODN design for a targeted mutation. Next, we explain how to deliver CRISPR/Cas9 complex to mouse embryos, by cytoplasmic injection or electroporation of zygotes. Using either of these approaches and around 150 zygotes per session of injection/electroporation usually yields 20% to 30% success rate for the generation of KO or KI mouse line. We also provide an optimized protocol for mouse genotyping, including the PCR primers design.

CRISPR/Cas9 Transgenic Mice

2

127

Materials

2.1 Preparation of CRISPR/Cas9 Solution for Injection and Electroporation

1. Brinster buffer: 10 mM pH ¼ 7.4; EDTA ¼ 0.25 mM. 2. 10 μg/μl Cas9 protein. 3. TracrRNA and specific CrRNA. 4. 0.45 μm filter. 5. Opti-MEM.

2.2

Superovulation

1. Two mouse strains are commonly used for transgenesis: C57BL6/N and B6D2/F1. 2. 20 C57BL6/N females, 4 weeks old, and 20 C57BL6/N males, over 6 weeks old, or 15 B6D2/F1 females, 6–7 weeks old, and 15 B6D2/F1 males, over 6 weeks old. 3. Pregnant Mare’s Serum Gonadotropin (PMSG). Synchro-Part PMSG 600. 4. Human Chorionic CHORULLON® 1500.

2.3 Embryo Collection

Gonadotropin

(hCG)

1. Mouth pipette. 2. Glass capillary: external diameter 1 mm, length 100 mm. 3. Hyaluronidase. 4. M2 buffer (e.g., Sigma). 5. Embryo development medium: cleave medium (e.g., Cook) (see Note 1). 6. Sterile and suitable embryo culture paraffin oil. 7. Humidified incubator, 37  C, 5% CO2.

2.4 Cytoplasmic Microinjection

1. Inverted microscope. 2. Oil hydraulic joystick micromanipulator. 3. Electronic microinjectors (e.g., Femtojet). 4. Microinjection pipette: glass capillary (external diameter 1 mm, inner diameter 0.6 mm). 5. Embryo-holding pipette. 6. Pipette puller. 7. Tips: external diameter 0.6 mm, inner diameter 0.3 mm.

2.5 Embryo Electroporation

1. Zygote electroporator (e.g., Nepagene NEP21).

2.6

1. Vasectomized OF1 males, over 6 weeks old.

Embryo Transfer

2. A glass chamber with 1 mm gap platinum plate electrodes (e.g., CUY5001P1-1.5, Nepagene).

2. CD1 Females over 8 weeks old.

128

Fatima El Marjou et al.

3. Absorbable 6.0 suture thread. 4. Wound clips. 5. Anesthesia: 7.5 mg/kg Xylazine, 40 mg/kg ketamine, and 0.5 mg/kg flunitrazepam. 6. Heating pad. 2.7 Genomic Analysis

1. Lysis buffer: 67 mM Tris-HCl pH 8.8, 16 mM (NH4)2 SO4, 0.5% Tween 20; 300 μg/ml Proteinase K.

2.7.1 PCR Analysis

2. Mouse genotyping kit. 3. Thermal cycler. 4. Agarose gel. 5. Gel electrophoresis equipment.

2.7.2 Sequencing Analysis

3 3.1

1. PCR extraction kit. 2. 5 μM specific sequencing primers.

Methods sgRNA Design

We recommend to obtain your target DNA sequence using a genome browser (e.g., Ensembl website https://www.ensembl. org/Mus_musculus/Info/Index). The next step is to choose a specific gRNA against this specific genomic location and we recommend the CRISPOR web tool (http://crispor.tefor.net/) [13] (see Fig. 1). To generate KO models, it is recommended to select two different sgRNAs in order to delete the critical exon common to all transcript variants (see Note 2). Alternatively, KO models can be also be created by the deletion of a functional domain of the protein using two sgRNAs. 1. Paste your target sequence (see Note 3). 2. Choose Mus musculus species and select the appropriate genetic background (see Note 4).

Fig. 1 sgRNA design pipeline on CRISPOR website. Using CRISPOR tool [13], step 1: paste your target sequence. Step 2: Choose Mus musculus species and the genetic background. Step 3: choose your nuclease enzyme with its specific PAM

CRISPR/Cas9 Transgenic Mice

129

Fig. 2 Single guide RNA selection using Crispor web tool. Using CRISPOR tool [13], (a) The target sequence is annotated with PAMs of putative sgRNA sequences in different colors depending on their specificity: green for specificity higher than 50, yellow for specificity between 30 and 50, and red for specificity lower than 30. (b) The resulting table represents all sgRNA ranked according to their specificity

3. Choose your nuclease enzyme with its specific PAM. In our case, we are using NGG PAM sequence specific to Streptococcus pyogenes Cas9 nuclease (see Note 5). 4. Analyze the results, which will be presented as a window with the submitted sequence and a table that is grouping all putative sgRNAs: the sequence is annotated with the putative sgRNAs thanks to their PAM sequence and sgRNA specificity is encoded by color code (see Fig. 2) [14]. The table contains all possible sgRNAs for the given sequence, ranked from highest to lowest specificity score (see Note 6). 5. Choose the sgRNA with the highest specificity score, preferably higher than 80, and avoid predicted off-targets on the same chromosome as your targeted mutation (see Note 6). 6. The sgRNA can be obtained/ordered directly from a number of companies (see Note 7) or can be generated in the lab, using PCR-based cloning and in vitro transcription (IVT) [2]. The

130

Fatima El Marjou et al.

CRISPOR website also provides the sequences required for cloning, adapted for the selected cloning vector (click on Cloning/primer PCR in the table). 3.2 Single Strand Oligonucleotide Matrix Design

Success rate for obtaining a KI mouse will depend on sgRNA efficiency and specificity, but even more on the design of donor matrix. To insert a sequence coding for a small tag (e.g., HA, Flag, or c-Myc) or to insert a point mutation, a single-strand oligonucleotide (ssODN) is used as a template. It can be purchased as purified ssODN. Several steps are important to take into account for ssODN design to enhance the success rate of correct insertions: 1. Design the homology arms to be between 60–80 bp long [2, 3, 15, 16]. 2. Choose the sgRNA closest to the desired insertion site (less than 20–25 bp) [17] (see Note 8). 3. To prevent Cas9 endonuclease from cutting the donor matrix, it is important to introduce (in the donor matrix) a silent mutation in the PAM sequence (NGG) or in the targeted sgRNA sequence. “GG” can be changed but avoid NAG and NGA sequences which can still be recognized by Cas9 nuclease [14]. 4. To preserve the correct amino acid sequence after change in the DNA sequence, verify the coding amino acid availability in mouse: https://www.kazusa.or.jp/codon/ 5. When introducing a point mutation, it is very practical to also introduce a restriction enzyme recognition site which will simplify the mouse genotyping (see Note 9). To help with the design, the Watcut web tool can be used: http://watcut. uwaterloo.ca/template.php

3.3 Preparation of CRISPR/Cas9 Solution

To prepare sgRNA/Cas9 solution, sgRNAs are either produced by in vitro transcription [2] or can be commercially obtained. Here, we describe a commercial system with two components: the CRISPR RNA (crRNA) and transactivating RNA (tracrRNA). 1. crRNA and tracrRNA are resuspended in nuclease-free water at 1 μg/μl. 2. To get a chimeric sgRNA, 5 μg of crRNA and 10 μg of tracrRNA (5 μl of 1 μg/μl crRNA and 10 μl of 1 μg/μl tracrRNA) are mixed. 3. This solution is then put into a thermocycler with the following conditions: 95  C for 5 min and then ramp down to 25  C at 5  C/min (see Note 10). This solution can be aliquoted and stored at -80  C. From this step, CRISPR/Cas9 delivery can be performed by either cytoplasmic injection or electroporation of zygotes (see below).

CRISPR/Cas9 Transgenic Mice

131

(a) Preparation for cytoplasmic injection: Cytoplasmic injection is a robust technical approach to create KO and KI mouse models. 4. A final volume of 60 μl is prepared in Brinster buffer by adding sgRNA and Cas9 protein at the following final concentration: 50 ng/μl sgRNA and 50 ng/μl Cas9 protein. Cas9 protein and sgRNA are mixed by pipetting. 5. The solution is incubated for 15 min at room temperature (RT) to allow for the formation for ribonucleoprotein (RNP) complex. 6. If needed for KI projects, ssODN can be added at 50 ng/μl (see Note 11). 7. The solution is then filtered through Millipore 0.45 μm filters and kept at 4  C (see Note 12). or (b) Preparation for electroporation procedure: Electroporation is an alternative to cytoplasmic injection; it is technically less demanding and can be less time-consuming. About 35 embryos can be easily electroporated simultaneously in less than 5 min, whereas a well-trained user would require 45 min to perform cytoplasmic injections in the same number of embryos. Moreover, zygote survival and the genome editing efficiency have recently been reported to be higher than with cytoplasmic injections [18–22]. 8. A final volume of 15 μl is prepared in Opti-MEM buffer with following final concentrations: 200 ng/μl sgRNA and 500 ng/ μl Cas9 Protein. Cas9 protein and sgRNA are mixed by pipetting. 9. This reaction is incubated for 15 min at RT. 10. If needed for KI projects, ssODN can be added at 200 ng/μl (see Note 11). The solution is then stored at 4  C and used in the same day for zygote electroporation experiment. 3.4 Superovulation and Mating

1. C57BL6/N or B6D2/F1 females are superovulated with 5 U PMSG (100 μl) injection followed by 5 U hCG (100 μl) injection 46–48 h later (see Note 13). 2. These females are mated with fertile C57BL6/N or B6D2/F1 males. 3. On the next morning, test for the presence of a vaginal plug to confirm mating.

3.5 Embryos Harvesting

1. Petri dishes (30 mm) are prepared with four Cleave medium or M2 drops and prewarmed at 37  C 5% CO2 (see Note 1).

132

Fatima El Marjou et al.

2. 100 mm Petri dish is prepared with two hyaluronidase drops (300 μg/μl in M2 medium) and six M2 drops for washes. 3. Plugged females are sacrificed by cervical dislocation. Oviducts located between the ovary and uterus are removed and placed in an M2 drop in 100 mm Petri dish. 4. Swollen ampullas are transferred in a hyaluronidase solution. They are cut with a 26G needle to allow for embryos enclosed in cumulus to be released. After an incubation of 2–3 min, the hyaluronidase will remove the follicle cells from embryos. 5. Individual embryos are collected with a mouth pipette and washed four to six times in M2 drop medium. Washed embryos are placed in prewarmed Cleave or M2 medium dishes at 37  C 5% CO2. 3.6 Cytoplasmic Microinjection

1. To prepare the injection dish for embryos, a 30-μl M2 drop is put in the center of a 60-mm Petri dish lid and covered with paraffin oil. Fertilized embryos visualized by the presence of two polar bodies and two nuclei are selected and put in the M2 drop. The lid is then put under the microscope. 2. The microinjection capillaries are made using a vertical pipette puller (see Note 14). For the holding pipette, the commercially available ones can be used. 3. 1 μl of Cas9/sgRNA solution, kept at 4  C during the injection session, is loaded into the microinjection capillary with a thin pipette tip. The capillary is then mounted onto the micromanipulator under an angle of approximatively 25 which will lead to a successful zygote cytoplasm penetration. 4. The tip of the microinjection capillary needs to be physically broken to allow for Cas9/sgRNA mixture release. This can be achieved by gently moving and touching the holding pipette with the capillary tip, using the fine micromanipulator. To validate that the pipette was broken correctly, the microinjection pipette is positioned into the oil drop; pressing the “clean function” button on Femtojet apparatus will induce a high pressure in the pipette leading to small drops exiting from the hole, validating that it is open. After this step, one can proceed to zygote cytoplasmic injections (see Note 15). 5. A single embryo is kept immobilized by the holding pipette under the microscope so that one of its nuclei is in focus. Using the micromanipulator, the microinjection pipette is carefully moved to enter the embryo through the zona pellucida and to reach the cytoplasm. Then, the Cas9/sgRNA solution is injected using the following Femtojet parameters (see Note 16). Around 40 embryos are injected per M2 drop. 6. Injected embryos are then collected and washed three times in M2 or Cleave medium in prewarmed dishes and put back at 37  C 5% CO2.

CRISPR/Cas9 Transgenic Mice

133

Table 1 Nepagene NEP21 mouse zygoteelectroporation parameters Set parameters Poring pulse

Transfer pulse

Number Decay Number Decay rate rate Voltage Length Interval of Voltage Length Interval of Polarity pulses (%) Polarity (V) (ms) (ms) pulses (%) (V) (ms) (ms) 40

3.5

50

3.7 Embryo Electroporation

4

10

+

5

50

50

5

40

+/

Several probes are available for mouse zygote electroporation. The CUY5001P1-1.5 probe, which requires only 5–10 μl of CRISPR/ Cas 9 solution, is recommended for mouse zygote electroporation. The parameters entered are described in Table 1. 1. 10 μl of Cas9/sgRNA solution is put into CUY5001P1-1.5 probe (see Fig. 3). 2. Around 30 embryos are washed three times in Opti-MEM and aligned into the Cas9/sgRNA solution, taking care to avoid embryos getting stuck to the electrodes. 3. The impedance value is recorded; it should read between 0.2 to 0.4 kΩ (see Note 17). 4. A combined electric pulse consisting of two types of pulses is applied to zygotes. The first type of pulse (the poring pulse) allows for pores formation in zygotes zona pellucida. Then, the second type of pulse (the transfer pulse) delivers an electrical pulse with a polarity change which improves delivery of RNP complexes into zygotes. 5. Afterward, the electroporated embryos are collected with a mouth pipette, avoiding as much as possible aspiration of the Cas9/sgRNA solution. 6. Embryos are collected and washed three times in M2 or Cleave medium in prewarmed dishes and put back at 37  C 5%/CO2.

3.8 Embryo Transfer in Pseudopregnant Females

1. On the day of step 1 in Subheading 3.4 (PMSG injection day of donor females), CD1 Females (in the range of 25–35 g of weight per female) are moved into a cage previously occupied by a vasectomized OF1 male. This enhances synchronization of female estrus 3–4 days later due to exposure to male pheromones from the urine contained in the litter (the Whitten effect) [23]. This strategy is used to increase the number of pseudopregnant females. 2. Females in oestrus are selected 48 h later, and put in a cage together with an OF1 vasectomized male. Oestrus can be

134

Fatima El Marjou et al.

Fig. 3 Mouse embryo electroporation. Experimental setup for electroporation of mouse zygotes (left and middle). Scheme recapitulating the three steps for electroporation of mouse zygotes using Nepagene NEP21 apparatus (right). Step 1: Poring pulse forms holes in the zona pellucida. Step 2: First transfer pulse allows RNP delivery into the zygote. Step 3: Polarity is reversed, which increases RNP delivery

visualized by different parameters: swollen vaginal tissue, gaping vaginal opening, bright pink membranes. 3. The next morning, females with a plug are selected and used for embryo transfer. 4. Plugged females are anesthetized with 100 μl of anesthetic solution per 20 g mouse body weight. Females are kept on a heating pad until fully anesthetized. 5. The mouse flank is shaved. 6. A small incision is made on the shaved skin and the fat pad is pulled to the side to expose ovary, oviduct, and uterus. 7. A small hole is introduced in the first loop oviduct with microsurgery scissors. 8. A capillary is introduced into the hole and 12–15 embryos are injected into the ampulla (see Note 18). 9. The reproductive track is then gently put back into the body and the incision is closed using absorbable thread for the muscle and staples for the skin. 10. Repeat steps 5–8 for the other flank. 11. The females are kept on a heated pad to enhance their surgical recovery until they awake from anesthesia. 12. The delivery is expected 18–19 days later.

CRISPR/Cas9 Transgenic Mice

3.9

Genotyping

135

1. Genomic DNA preparation. (a) Ear samples are collected from a 3-week-old mouse. (b) Add 50 μl of lysis buffer. (c) Incubate at 56  C during 3 h with agitation. (d) Proteinase K is inactivated by heating samples at 95  C for 25 min. 2. PCR analysis. (a) Primers are chosen within the flanking regions of the targeted DNA region and inside the deleted region. Several couples of primers should be designed to fully characterize the targeted region (see Fig. 4). Keep in mind that the deleted fragment can be reinserted in inverted sense or as a tandem repeat head to head or head to tail. Primers should be designed to verify the absence of this type of DNA rearrangements (see Fig. 5). For KI projects, primers are designed in flanking DNA regions and also in the transgene. (b) Performed genotyping PCR using a mouse genotyping kit. Typically, 1 μl representing 100–250 ng genomic DNA and 0.5 μM of each primer is added in 25 μl final volume of the PCR mix. Touchdown PCR program is recommended because it provides high specificity and efficiency [24] (see Note 19). 3. Sequencing: A sequencing analysis need to be run on genotyping PCR product to further analyze the putative founders. (a) PCR products are purified using a PCR purification kit (see Note 20). (b) Sent for sequencing with appropriate primers to a specialized facility or a sequencing company. The exact sgRNA cut location can be checked using Sanger sequencing approaches (see Notes 21 and 22).

3.10 Germline Transmission

1. The F0 founder (confirmed by PCR and sequencing) is crossed with an inbred control mouse to achieve germline transmission, i.e., GLT (see Notes 23 and 24). 2. Genotype and sequence F1 pups as in steps 2 and 3 in Subheading 3.9 to confirm if the genomic modification is inherited (see Notes 25 and 26). 3. It is recommended to backcross mouse founders to inbred control strain for at least three generations to eliminate putative off-targets by chromosomal segregation (see Note 27).

136

Fatima El Marjou et al. F2

sgRNA1

F3

F1

sgRNA2

20kb R3

R1

R2

Fig. 4 Primer designs to identify mice with deleted DNA region. Wild-type mouse: PCR1: F1/R3- F2/R3: WT band should be amplified. PCR2: F3/R1- F3/R2: WT band should be amplified. PCR3: F1/R1, F2/R2: no amplification possible due to too large amplicon size. Mouse with a heterozygote deletion: PCR1: F1/R3F2/R3: WT band should be amplified. PCR2: F3/R1- F3/R2: WT band should be amplified. PCR3: F1/R1, F2/R2: a specific band should be amplified. Mouse with a homozygous deletion: PCR1: F1/R3- F2/R3: no amplified band. PCR2: F3/R1- F3/R2: no amplified band. PCR3: F1/R1, F2/R2: a specific band should be amplified

Fig. 5 Combination of several primers to detect various DNA rearrangements

4

Notes 1. Cleave medium is used for in vitro embryo development until blastocyst stage. In case embryo transfer will be performed on the same day or the day after, incubation in M2 medium is also possible. 2. One 50 sgRNA and one 30 sgRNA are chosen flanking the critical exon. Check for the presence of an alternative ATG start codon in downstream exons to prevent any truncated protein expression. Moreover, it is best to avoid selecting only

CRISPR/Cas9 Transgenic Mice

137

one sgRNA in N-terminus protein sequence because alternative start codons can often be found downstream and be used to initiate translation. 3. Enter a genomic DNA and not cDNA sequence to generate a Knock-Out model. 4. Several mouse genomes are available, because several assemblies from different years exist. 5. Streptococcus pyogenes Cas9 system is the best characterized, and it gave rise to a powerful tool for genome editing. However, depending on the targeted genomic sequence, other nucleases from other bacteria strains such as Aureus or Thermophilus or Cas12a (Cpf1) may be used. 6. Clicking on the sgRNA sequence in the first window will redirect you to the table with the sgRNA sequence. Off-target mutations on other (nontargeted) chromosomes will be eliminated by chromosome segregation after several back crossings. 7. Two RNA types are ordered: crRNA which is specific to the targeted sequence and TracrRNA which is common for all the crRNA. Synthetic sgRNAs chemically synthesized can also be ordered. 8. The distance between the sgRNA cutting site and the desired insertion/mutation site should be the smallest possible, to enhance the integration/mutation efficiency. 9. PCR band gel analysis cannot be used to distinguish between a wild-type sequence and a sequence with a single nucleotide substitution. Introducing a restriction enzyme site beforehand will allow to distinguish a wild-type mouse from a KI mouse via an enzymatic digestion of the PCR product. 10. Alternatively, the solution can be boiled in a water bath and then left to cool down at room temperature. 11. Take into consideration the final volume when you add DNA matrix. 12. The sgRNA/Cas9 protein with or without DNA matrix is kept in the fridge during zygote injection session. 13. Animal house should get an approval number and the transgenic facility and researchers should gain authorization from ethics committee to perform experiments on mouse models. 14. This is a crucial step. Typically, 15 embryos are injected before the capillary gets clogged and becomes unusable. The vertical pipette puller parameters should be determined at the beginning of the session to allow for their production

138

Fatima El Marjou et al.

throughout the injection session. However, due to heat deformation, parameters sometimes need to be reset during the injection session. 15. Breaking the capillary tip is a sensitive step: if the capillary opening is too small, it will often lead to the clogging of the capillary, whereas if the opening is too big, it may lead to zygote lysis. 16. Manual injection mode, injection pressure Pi: 150–300 hPa, compensation pressure Pc: 117 hPa; injection time should be less than 0.7 s. A gentle movement observed in the cytoplasm indicates that Cas9/sgRNA mix has been successfully injected into the embryo. 17. If the value is too low, remove a small volume of Cas9/sgRNA solution and it will increase the impedance; if the impedance is too high, add a small volume of Cas9/sgRNA solution. 18. To easily visualize the embryo-transfer, the capillary is filled in the following order: oil-air bubble-M2 medium-air bubblegrouped embryos and air bubble-M2 medium. In this way, a successful embryo-transfer is visualized by the presence of air bubbles in the ampulla. 19. Touchdown PCR program: 95  C: 3 min; 15 cycles of [95  C: 15 s, 70  C: 15 s (1  C at each cycle) and 72  C: 15 s/kb]; followed by 20 cycles of [95  C: 15 s, 55  C: 15 s; 72  C: 15 s/ kb]; 72  C: 5 min; 4  C: 1. 20. Before purification, check that PCR reaction amplifies only the specific band with a good efficiency. 21. Typically, 5 μl of the purified PCR product (20–80 ng/μl) and 5 μl of primers (5 μM), premixed in a 1.5 ml tube can be sent directly to a sequencing company. 22. F0 founders often present a mosaic genotype which means that several genomic events occurred during DNA repair processes. This is due to NHEJ pathway which is acting at the zygote stage, but also at later stages of embryonic development (see Fig. 6). 23. Genome editing is done at zygote stage, which typically allows to achieve more than 95% GLT. 24. The wild-type mouse background choice may depend on your research project; most commonly, C57BL6/N or J strains are used. 25. Because of mosaicism, the F1 generation can present a variation of genetic modifications found in F0 founders.

CRISPR/Cas9 Transgenic Mice

139

Fig. 6 Examples of Sanger sequencing chromatograms indicating sgRNA cut locations and indels. sgRNA sequence is underlined in pink, PAM sequence is marked with a blue rectangle and sgRNA cut location with a dashed line. (a) Sequence of a wild-type mouse with the sgRNA target sequence and expected cut location. (b, c) Corresponding sequences from two mutant mice present indels at two different positions

26. If the targeted genetic modifications found in ear DNA sample are found in the F1 generation, germline transmission of the mutation has occurred, which means that this specific genetic event is present in the genomic DNA of germ cells. 27. After three backcrosses, the F1 offspring will receive 87.5% of the wild-type genetic background, thus “diluting” any putative off-target mutations.

Acknowledgments We are grateful to Iva Simeonova, Deborah Bourc’his, and Edith Heard laboratory members, in particular Juliane Glaser, Joan Barau and Rafael Galupa, for constructive discussions allowing improvement in CRISPR/Cas9 technology development at Institut Curie. We would like to thank animal facility manager Isabelle Grandjean for her support in establishing the transgenic facility, and Celine Daviaud and Mickael Garcia for their technical advice, in particular on optimizing animal husbandry.

140

Fatima El Marjou et al.

References 1. DeChiara TM (2001) Gene targeting in ES cells. Methods Mol Biol 158:19–45. https:// doi.org/10.1385/1-59259-220-1:19 2. Yang H, Wang H, Shivalila CS (2013) One-step generation of mice carrying reporter and conditional alleles by CRISPR/Casmediated genome engineering. Cell 154:1370–1379. https://doi.org/10.1016/j. cell.2013.08.022 3. Wang H, Yang H, Shivalila CS (2013) One-step generation of mice carrying mutations in multiple genes by CRISPR/Casmediated genome engineering. Cell 153:910–918. https://doi.org/10.1016/j. cell.2013.04.025 4. Inui M, Miyado M, Igarashi M (2014) Rapid generation of mouse models with defined point mutations by the CRISPR/Cas9 system. Sci Rep 4:5396. https://doi.org/10.1038/ srep05396 5. Greenberg MVC, Glaser J, Borsos M (2017) Transient transcription in the early embryo sets an epigenetic state that programs postnatal growth. Nat Genet 49:110–118. https://doi. org/10.1038/ng.3718 6. Miura H, Gurumurthy CB, Sato T (2015) CRISPR/Cas9-based generation of knockdown mice by intronic insertion of artificial microRNA using longer single-stranded DNA. Sci Rep 5:12799. https://doi.org/10. 1038/srep12799 7. Yoshimi K, Kunihiro Y, Kaneko T (2016) ssODN-mediated Knock-In with CRISPRCas for large genomic regions in zygotes. Nat Commun 7:10431. https://doi.org/10. 1038/ncomms10431 8. Barau J, Teissandier A, Zamudio A (2016) The DNA methyltransferase DNMT3C protects male germ cells from transposon activity. Science 354:909–912. https://doi.org/10. 1126/science.aah5143 9. Chu VT, Weber T, Graf R (2016) Efficient generation of Rosa26 knock-in mice using CRISPR/Cas9 in C57BL/6 zygotes. BMC Biotechnol 16:4. https://doi.org/10.1186/ s12896-016-0234-4 10. Jung CJ, Zhang J, Trenchard E (2017) Efficient gene targeting in mouse zygotes mediated by CRISPR/Cas9-protein. Transgenic Res 26(2):263–277. https://doi.org/ 10.1007/s11248-016-9998-5

11. Mizuno S, Dinh TT, Kato K (2014) Simple generation of albino C57BL/6J mice with G291T mutation in the tyrosinase gene by the CRISPR/Cas9 system. Mamm Genome 25:327–334. https://doi.org/10.1007/ s00335-014-9524-0 12. Wang B, Kunyu L, Wang A, Reiser M (2015) Highly efficient CRISPR/HDR-mediated knock-in for mouse embryonic stem cells and zygotes. BioTechniques 59:201–208. https:// doi.org/10.2144/000114339 13. Concordet JP, Haeussler M (2018) CRISPOR: intuitive guide selection forCRISPR-Cas9 genome editing experiments and screens. Nucleic Acids Res 46:W242–W245. https:// doi.org/10.1093/nar/gky354 14. Hsu PD, Scott DA, Weinstein JA (2013) DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 31(9):827–832. https://doi.org/10.1038/nbt.2647 15. Richardson CD, Ray GJ, DeWitt MA (2016) Enhancing homology-directed genome editing by catalytically active and inactive CRISPRCas9 using asymmetric donor DNA. Nat Biotechnol 34:339–344. https://doi.org/10. 1038/nbt.3481 16. Renaud JB, Boix C, Charpentier M (2016) Improved genome editing efficiency and flexibility using modified oligonucleotides with TALEN and CRISPR-Cas9 nucleases. Cell Rep 14:2263–2272. https://doi.org/10. 1016/j.celrep.2016.02.018 17. Jiang W, Bikard D, Cox D (2013) RNA-guided editing of bacterial genomes using CRISPRCas systems. Nat Biotechnol 31:233–239. https://doi.org/10.1038/nbt.2508 18. Teixeira M, Py BF, Bosc C, Laubreton D (2018) Electroporation of mice zygotes with dual guide RNA/Cas9 complexes for simple and efficient cloning-free genome editing. Sci Rep 8(1):474. https://doi.org/10.1038/ s41598-017-18826-5 19. Chen S, Lee B, Lee AY (2016) Highly efficient mouse genome editing by CRISPR ribonucleoprotein electroporation of zygotes. J Biol Chem 291(28):14457–14467. https://doi. org/10.1074/jbc.M116.733154 20. Wang W, Kutny PM, Byers SL (2016) Delivery of Cas9 protein into mouse zygotes through a series of electroporation dramatically increases the efficiency of model creation. J Genet

CRISPR/Cas9 Transgenic Mice Genomics 43(5):319–327. https://doi.org/ 10.1016/j.jgg.2016.02.004 21. Remy S, Chenouard V, Tesson L, Usal C (2017) Generation of gene-edited rats by delivery of CRISPR/Cas9 protein and donor DNA into intact zygotes using electroporation. Sci Rep 7(1):16554. https://doi.org/10.1038/ s41598-017-16328-y 22. Tro¨der SE, Ebert LK, Butt L (2018) An optimized electroporation approach for efficient CRISPR/Cas9 genome editing in murine

141

zygotes. PLoS One 13(5):e0196891. https:// doi.org/10.1371/journal.pone.0196891 23. Marsden HM, Bronson FH (1964) Estrous synchrony in mice: alteration by exposure to male urine. Science 144:1469–1469. https:// doi.org/10.1126/science.144.3625.1469 24. Korbie D, Mattick J (2008) Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat Protoc 3:1452–1456. https://doi.org/10.1038/nprot.2008.133

Chapter 10 Whole-Mount Immunofluorescence Staining of Early Mouse Embryos Frederick C. K. Wong Abstract Immunofluorescence staining enables the visualization of protein expression at a cellular or even sub-nuclear level. Whole-mount staining preserves the three-dimensional spatial information in biological samples allowing a comprehensive interpretation of expression domains. Here we describe the sample processing, protein detection using antibodies and confocal imaging of isolated preimplantation to early postimplantation mouse embryos up to Embryonic day 8.0 (E8.0). Key words Immunofluorescence, Whole-mount, Embryo, Preimplantation, Postimplantation, Immunohistochemistry

1

Introduction Murine preimplantation development involves the progressive restriction of developmental potency from the totipotent zygote resulting in the establishment of three embryonic lineages: the preimplantation epiblast, the primitive endoderm, and the trophectoderm organized in a spheroid structure known as the blastocyst [1]. Upon implantation of the blastocyst, the epiblast undergoes epithelialization and lumenogenesis leading to the formation of the proamniotic cavity, eventually resulting in a structure commonly known as the “egg cylinder.” Subsequently, signaling from the trophectoderm-derived extraembryonic ectoderm patterns the distal-most visceral endoderm cells and establishes the first axis in the embryo: the embryonic-abembryonic (or proximal-distal) axis [2, 3]. Movement in the visceral endoderm proximally towards one side of the expanding egg-cylinder results in the formation of the anterior visceral endoderm (AVE) and establishes the anteriorposterior axis [4]. The AVE patterns the epiblast by expressing antagonists of posterior signals resulting in the underlying epiblast cells adopting anterior fates [5, 6]. The posterior signals initiate the

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_10, © Springer Science+Business Media, LLC, part of Springer Nature 2021

143

144

Frederick C. K. Wong

formation of the primitive streak, a morphological hallmark of gastrulation, that is crucial for the establishment of the three primary germ layers of the embryo: the ectoderm, mesoderm, and the definitive endoderm [3]. The establishment of the blastocyst to the onset of gastrulation are coupled with significant changes in gene expression [7–10] highlighting the diverse cellular identities arising from a highly regulated sequence of lineage specification. Some of these genes interact in a regulatory network to establish the different lineage identities and regulate developmental events [1, 3, 11–13]. Capturing the dynamics of gene expression during this period of early development requires both the detection of gene expression level coupled with spatiotemporal information. While single-cell RNA sequencing techniques give an in-depth overview of the wide array of cellular identities, the accompanying spatial information is missing and can only be inferred in silico. Historically, hybridizationbased RNA detection techniques were applied to whole-mount samples to visualize broad expression domains [14]. Stained samples can be sectioned for better visualization at the cellular level [15]. Sectioning can be further adapted to perform spatial transcriptomic analysis [16, 17]. While RNA-based methods benefit from detecting noncoding genes and cells expressing secreted cytokines (e.g., Bmp), the expression of functional proteins from coding genes can only be inferred and some coding genes can be regulated on the posttranscriptional level. Conventionally, protein expression can be detected using specific antibodies on sectioned samples and visualized by a colored dye-producing chemical reaction (immunohistochemistry [18]) or by fluorophore conjugation (immunofluorescence [19]). Although sectioning benefits from performing many different stainings from the same sample using adjacent sections, the spatial information is restricted to the single plane and the specific orientation of the sample during embedding. To circumvent these obstacles, wholemount immunofluorescence staining coupled with inverted confocal microscope imaging presents a powerful method of visualizing gene expression patterns at the protein level with the complete structure of the early mouse embryo in a semi-quantitative manner [20, 21] and will be the focus of this chapter. This method involves broadly the following steps: (1) sample fixation, (2) sample permeabilization, (3) nonspecific antigen blocking, (4) specific antigen staining using primary antibodies, (5) fluorophore labeling using conjugated secondary antibodies, (6) sample postprocessing, and (7) imaging. Depending on the imaging setup, we were able to optimize the detection of four channels (three nuclear-localized proteins plus a nuclear stain). Embryos later than E8.0 can also be stained using the following method, but due to its larger size (and increased tissue complexity) some adaptation will be required, particularly the fixation/staining times as well as sample postprocessing.

Whole-Mount Immunofluorescence Staining

2

145

Materials Prepare all solutions in cell culture-grade phosphate buffered saline (PBS), pH 7.4, to prevent unwanted growth in stained samples as no sodium azide is added to any buffers. Prepare and store all buffers at room temperature (unless stated otherwise). Use analytical-grade reagents where possible. 1. Cell culture-grade phosphate buffered saline solution 1
, pH 7.4 (PBS). 2. Fixing solution: 4% Paraformaldehyde, PBS (see Note 1). 3. PBSTr solution: 0.5% Triton X-100, PBS. Make a stock solution of 10% PBSTr by dispensing 100% Triton X-100 first before adding PBS (see Note 2). Use a magnetic stirrer to mix completely. Then simply dilute the 10% stock 1:20 in PBS on the day of sample preparation. 4. PBSTw solution: 0.01% Tween-20, PBS. Make a stock solution of 10% PBSTw by dispensing 100% Tween-20 first before adding PBS (see Note 2). Use a magnetic stirrer to mix completely. Then simply dilute the 10% stock 1:1000 in PBS. The 0.01% PBSTw solution is premade and stored until used. 5. Neutralization buffer: 1 M Glycine, 0.1% PBSTr, pH 7.0–8.0. Weigh 75.07 g of glycine and transfer to 850 mL of PBS in a beaker. Use a magnetic stirrer to dissolve the glycine and mix the solution while the pH is adjusted between 7.0 and 8.0 with NaOH. Adjust volume to 990 mL with PBS and add 10 mL of 10% PBSTr. Mix well and filter with a 0.22 μm filter. 6. Blocking buffer: 3% donkey whole serum (see Note 3), 1% bovine serum albumin, PBSTw. Store at 4  C for up to a week (see Note 4). 7. Combination of specific primary antibodies. 8. Secondary antibody conjugates: Alexa488, Alexa568, Alexa647 (see Note 5) and DyLight405 (optional, see Note 6). Aliquots of conjugated secondary antibodies are stored at 4  C. 9. DAPI: 5 mg/mL 40 ,6-Diamidino-2-phenylindole dihydrochloride solution in water. Store at 4  C in aluminium foil-wrapped tube (see Note 6). 10. TDE (optional): 99% 2,20 -Thiodiethanol solution [22] (see Note 7). Dilutions are done in PBSTw (for 10–50%) or PBS (for 97% with optional 1 μg/mL DAPI, see Note 8). 11. Benzyl alcohol and benzyl benzoate (BABB) (optional, for embryos E6.5 or later): 1 part benzylalcohol, 2 parts benzylbenzoate v/v [23] (see Note 6). Make fresh every time (see Note 1).

146

Frederick C. K. Wong

12. Ethanol: 100% solution. Dilutions are done in PBSTw (for 30–50%) or PBS (for 80–96%) (see Note 1). 13. Acidic Tyrode’s solution. 14. Polystyrene 24-well plate, with flat bottom. 15. Transwells: 12 μm pore size to fit a well of a 24-well plate. For example, Millipore #PIXP01250 (see Note 9). 16. Confocal microscope. Preferably an inverted system for sample loading flexibility (see Note 10). 17. Stereo “dissection” microscope preferably with a tilting mirror illumination. 18. Imaging well: Attofluor Cell Chamber or iBidi μ-Slide eight wells for sample mounting to an inverted confocal microscope. Both are compatible with BABB (see Fig. 2c, d). 19. Pulled glass mouth pipette and mouth pipette holder (for E5.5 or earlier embryos) or low-binding wide bore pipette tips (for E6.5 or later embryos). 20. Forceps. 21. Plastic chamber for overnight incubation. 22. Imaging spacer with diam.
thickness: 9 mm
0.12 mm. 23. Optional but recommended: Matte black stage plate for stereo microscopes.

3

Methods When using the transwells, the volume of buffers used per well of a 24-well should be 700 μL to 1 mL. All incubations, except fixation, are performed on an orbital shaker set at 80 rpm at room temperature or on a gyro rocker set at 24 rpm at 4  C. Incubations after addition of secondary antibodies are all done in the dark by using aluminium foil-covered boxes. All 4  C incubations for overnight or longer are placed in a humidified box containing wet tissue paper with the 24-well plate elevated by cut strippettes. 1. Collect mouse embryos from stages E0.5 to E8.0 (late headfold) and transfer into a primed transwell (see Note 9, Fig. 1a, b) in a PBS-containing well of a 24-well plate. 2. Transfer the embryos/transwell into the next well (see Note 9, Fig. 1c, d) containing cold fixing solution and fix at 4  C for the following times according to stage/size of the embryo (see Note 11): (a) E0.5 to E5.5: 15 min. (b) E6.0 to E6.5: 1 h. (c) E7.0 to E8.0: 2 h.

Whole-Mount Immunofluorescence Staining

147

Fig. 1 Processing embryos using 12 μm pore transwells. (a) Representative transwells. (b) E6.5 embryos (red arrows) are loaded into the transwell compartment in a well of a 24-well plate loaded with 1 mL of PBS. The 24-well plate is placed on a matte black stage for visualization by eye. (c) Transferring the embryo-containing transwell from one well to the next, using the well edges to reduce the volume of solution inside the transwell without completely removing it (see Note 9). (d) The meniscus (cyan arrow) will reduce in a short period of time due to cohesion to the underlying well edge (blue arrow). It is important not to let the meniscus touch the transwell membrane (see Note 9)

3. Transfer the embryos/transwell into PBS-containing wells (see Note 12).

two

subsequent

4. Transfer the embryos/transwell into a well containing PBSTr. Incubate at room temperature for 20 min. 5. Transfer the embryos/transwell into a well containing neutralization buffer. Incubate at room temperature for 15 min. 6. Wash by transferring the embryos/transwell into six consecutive wells containing PBSTw. Incubate at room temperature for 10 min each. 7. Transfer the embryos/transwells into a well containing blocking buffer. Incubate at 4  C overnight. 8. Transfer the embryos/transwells into a well containing primary antibody diluted 1:200 in blocking buffer. Incubate at 4  C for at least 2 days (see Note 13). 9. Wash by transferring the embryos/transwell into six consecutive wells containing PBSTw. Incubate at room temperature for 10 min each. 10. Transfer the embryos/transwells into a well containing fluorophore-conjugated secondary antibody raised in donkey

148

Frederick C. K. Wong

(see Note 3) diluted 1:500 to 1:1000 in blocking buffer with optional 1 μg/mL DAPI (see Note 6). Incubate at room temperature for 3–5 h in the dark. 11. Wash by transferring the embryos/transwell into six consecutive wells containing PBSTw. Incubate at room temperature for 10 min each. 12. Transfer the embryos/transwells into a well containing PBS. Incubate at room temperature for 10 min. 13. Stained embryos can be stored at 4  C in PBS in the dark (see Note 8). 14. For preimplantation embryos (E0.5 to E3.5) with an intact zona pellucida: (a) Remove the embryos in the transwell using pulled glass mouth pipette into a 50 μL drop of Acidic Tyrode’s solution on the lid of the 24-well plate. Incubate in room temperature for 30 s to 1 min until removal of the zona pellucida (see Note 14, Fig. 2a). (b) Wash the embryos by transferring through three fresh drops of PBS. (c) Transfer to a coverslip with a spacer in 8–10 μL of PBS (see Fig. 2b). Sandwich another coverslip on top with particular care when covering the drop to spread it evenly in the spacer. It is recommended to proceed directly to step 15 (imaging) although storage of embryo-containing coverslips can be done at 4  C in the dark up to a week as long as no evaporation takes place (see Note 8). (d) Alternatively, zona-free embryos can be placed in PBS in an iBidi μ-slide (see Fig. 2c) or an Attofluor chamber with a coverslip (see Fig. 2d) and let to settle for 15–30 min at room temperature. Ensure embryos adhere to the coverslip before proceeding to step 15 (imaging) to avoid movements caused by local convection during imaging. For peri-implantation embryos (E4.0 to E5.5): (a) Transfer to a coverslip with a spacer in 8–10 μL of PBS (see Fig. 2b). Sandwich another coverslip on top with particular care when covering the drop to spread it evenly in the spacer. It is recommended to proceed directly to step 15 (imaging) although storage of embryo-containing coverslips can be done at 4  C in the dark up to a week as long as no evaporation takes place (see Note 8). (b) Alternatively, zona-free embryos can be placed in PBS in an iBidi μ-slide (see Fig. 2c) or an Attofluor chamber with a coverslip (see Fig. 2d) and let to settle for 15–30 min at room temperature. Ensure embryos adhere to the

Whole-Mount Immunofluorescence Staining

149

Fig. 2 Loading stained embryos onto an inverted confocal microscope. (a) Transferring E0.5 to E3.5 preimplantation embryos through a series of 20 μL drops of Acidic Tyrode’s solution under a stereo microscope using a pulled glass needle and mouth pipette. This is used for removing zona-pellucida of E0.5 to E3.5 embryos. If transwell method proves too difficult to recover E4.5 and E5.5 stage embryos, this droplet method can be used for the entire staining procedure instead of transwells. (b) A spacer is adhered to one coverslip. 8–10 μL of mounting solution is added to the center of the spacer hole. Embryos will then be transferred to this drop by pulled glass pipettes as in a. This is then sandwiched using another coverslip carefully not to allow the drop to spill over into spacer. (c) An iBidi μ-Slide mounted on an inverted confocal microscope. Embryos can be loaded in the middle of the well (red arrow). Below: when finding invisible BABBcleared embryos, fluorescent light can be used to quickly find embryos by DAPI emission. (d) The assembly of the Attofluor chamber housing a round coverslip. Once the coverslip is mounted load water to ensure no leakages. Other mounting solutions can then be loaded after water removal and isopropanol cleaning. Embryos can be loaded in the middle of the coverslip (red arrow)

coverslip before proceeding to step 15 (imaging) to avoid movements caused by local convection during imaging. For BABB clearing (embryos E6.5 or later, see Note 15): (a) Transfer the embryos/transwells through a series of wells containing 30%, 50%, 80%, 96% and twice in 100% ethanol. Incubate at room temperature for 30 min to 1 day each (see Note 16). (b) Add fresh BABB to the imaging well of choice. The Attofluor Cell Chamber can take up to 1 mL of BABB, alternatively the iBidi μ-Slide well can take up to 200 μL of BABB (see Fig. 2c, d).

150

Frederick C. K. Wong

(c) Remove the embryos from the transwell using a low-binding wide bore pipette tip and wait for the embryos to settle at the orifice of the tip by gravity. Transfer the embryos in the imaging well by briefly touching the surface of BABB with the tip (see Note 17). Incubate at room temperature for 5–15 min until the embryo is no longer visible when placed on top of a matte black stage. Proceed directly to step 15 (imaging). It is not recommended to store embryos in BABB overnight. For TDE clearing (embryos E6.0 to E8.0, see Note 15): (a) Remove the embryos in the transwell using a low-binding wide bore pipette tip. (b) Transfer the embryos through a series of wells containing 10%, 25%, 50%, 80% and twice in 97% TDE. Incubate at room temperature for 30 min each. Proceed directly to step 15 (imaging). Stained embryos can be left in 97% TDE at 4  C in the dark for up to a week (see Note 8). 15. Proceed to imaging (see Note 18, Fig. 3).

Fig. 3 Confocal stack image representations. Representative E4.5 peri-implantation blastocysts and E6.5 postimplantation blastocysts were imaged on an inverted confocal using the Attofluor cell chamber with a circular coverslip (see Fig. 2b for setup). Embryos were immunostained using specific antibody against OCT4 (Pou5f1) and nuclear DNA counterstained with DAPI. OCT4 is a pluripotency factor, present in the inner cell mass of E4.5 blastocysts and in epiblast cells of E6.5. A midline Z-stack is shown for DAPI (grey) and OCT4 (cyan). A Z-stack maximal projection as well as the 3D reconstruction are also shown. Imaging parameters are detailed on the right. Images are processed in Fiji

Whole-Mount Immunofluorescence Staining

4

151

Notes 1. Hazardous solution. Please use and dispose correctly in accordance to local safety procedures. As benzyl alcohol and benzyl benzoate (BABB) is an organic solvent, special labware are needed to contain BABB. 2. Triton X-100 and Tween-20 are highly viscous, it is recommended to use a stripette to transfer the required volume into a glass bottle, detach the pipette gun, wait for 5 min with the stripette standing upwards and pipette out the remaining volume for complete transfer. 3. To simplify primary antibody combinations, all secondary antibodies should be raised in donkey. Never refreeze donkey serum aliquots. 4. It is best to make a fresh buffer for each staining experiment. Poor quality serum will result in uninterpretable immunofluorescence staining. 5. We routinely use these combinations of fluorescent dyes which were optimized with our imaging system with minimal bleed through. Different imaging systems will have different excitation laser wavelengths and filter sets. It is strongly advised to determine the best combination for each imaging system. 6. DAPI can be used in many clearing solutions such as TDE. However BABB can cause a fluorescence shift in DAPI into the 488 [24] or even 568 channels. Use of an anti-mouse nuclear antigen primary antibody coupled with DyLight405conjugated secondary antibody could mitigate this issue. 7. Clearing solutions, especially dehydrating steps before BABB, reduce or completely sequester native fluorescence from fluorescent proteins. Use of primary antibodies against the fluorescent protein is advised. It is highly recommended to use secondary antibodies with fluorophore-conjugates emitting in the same channel as the fluorescent protein. 8. Storage longer than a week may result in fussy nuclear DAPI staining, which can be mitigated by adding 1 μg/mL DAPI to the storage solution. Do not let the samples dry out. Use parafilm to seal off edge of an iBidi μ-slide for instance. 9. The transwell acts as a sieve to transfer your embryos from one buffer-containing well to the next (see Fig. 1). Pore sizes less than 12 μm drain liquid too slowly. To prime these transwells for use, immerse transwell in PBS-containing well of a 24-well plate, the inside of the transwell will remain dry due to surface tension. Pipette PBS into the transwell to break the surface tension at the porous membrane before placing embryo samples inside. To transfer the transwell to the next buffer, use

152

Frederick C. K. Wong

forceps to carefully take the transwell and place it on top and between the edges of two adjacent wells of a 24-well plate (see Fig. 1c), surface adhesion will drain the liquid inside the transwell (see Fig. 1d). It is critical that the meniscus inside the transwell do not reach the porous membrane to avoid compressing the embryo samples. Alternatively, manual pipette transferring using pulled glass mouth pipettes (for E5.5 or earlier embryos) or low-binding wide bore pipette tips (for E6.5 or later embryos) can be used. Embryos maybe adhesive to pipette tips in PBS solutions, but this issue is mitigated in the presence of proteins such as BSA or detergents such as Tween20. 10. For example: Leica SP8 (inverted) equipped with a white light laser module, a multi immersion HC PL APO 20
/0.70 IMM and a water immersion HCX IRAPO L 25
/0.95 W objectives. Upright confocal systems may also be used but will be incompatible with the iBidi μ-slide or Attofluor chambers. Adaptations such as the coverslip-spacer method (see Fig. 2b) can be used instead. Multiple overlapping spacers maybe needed for larger (E6.5 or later stage) embryos. Always use immersion objectives with the immersion fluid having a matching refractive index to the mounting solution of the embryos. Mismatches will be apparent in E6.5 or later staged embryos at the far side from the objective between 405/DAPI and 647 channels. 11. Size of sample and fixation time is positively correlated. For later somite-stage embryos, fixation time may be increased to 3.5 h or more. However, over-fixation can mask some antigens leading to antibody inaccessibility therefore each application requires optimization. Reducing PFA concentration to 1% for longer fixation times may improve in some cases. 12. Fixed embryos of different stages can be grouped by the combination of primary antibody and pooled into one transwell for ease of process. They can also be stored at 4  C for up to a week after which staining quality reduces. 13. The crucial point about this method is whole-mount immunofluorescence staining takes longer time for antibody to penetrate through the sample. For larger samples more time may be necessary. A good starting dilution for many antibodies is 1:200 even if they are used at a higher dilution on flat cultured cells. Some antibody may require 1:50 to 1:100. Due to multichannel acquisition, controls are highly recommended when using a combination of primary antibody host species and its corresponding fluorophore conjugates for the first time. Secondary antibody cross-reactivity can be controlled by using single primary antibody staining labeled with all three

Whole-Mount Immunofluorescence Staining

153

secondary antibodies. Nonspecificity of the primary antibody is harder to control without gene knock-out lines, isotype controls (serum IgG from the same host species as the primary antibody, preferably from the same supplier) can be used. If prior knowledge of the mRNA expression domain is known for the specific gene in embryos of a particular stage, immunofluorescent signals from the negative regions serve as a reliable internal negative control for subsequent quantifications. 14. Keeping the zona pellucida during staining minimizes embryos sticking to the transwell membrane but are more difficult to immobilize on coverslips for imaging. Acid Tyrode’s solution dissolves the zona pellucida but prolonged exposure would damage the embryo. Process a manageable number of embryos at a time and leave it in Acid Tyrode’s solution for the minimal amount of time necessary (see Fig. 2a). Avoid letting the embryo stick to the lid. Alternatively, intact embryos with zona pellucida can be mounted in Vectashield (refractive index of glycerol) or Prolong Glass (refractive index of oil) and immobilized in between coverslips separated by spacers (see Fig. 2b). 15. The clearing transparency of TDE is less superior than BABB with imaging depth of ~200 μm (DAPI intensity start reducing at ~180 μm) compared to 400 μm+. However, TDE’s relative nontoxicity, water solubility, lack of shift in DAPI fluorescence, absence of autofluorescence in sub-500 nm channels and preservation of cell morphology makes TDE a decent compromise for imaging mouse embryos up to E8.0. 16. Total dehydration is absolutely critical for BABB as precipitation may form. 17. Surface tension will transfer the embryos into BABB. This will also minimize the transfer of ethanol. Total transparency of embryos up to E13.5 can be achieved rapidly within 5 min. 18. Both 97% TDE and BABB have a refractive index similar to oil therefore a 20
oil immersion objective should be able to cover the whole field of view. PBS mounted zona-free embryos can be imaged using water immersion objectives. References 1. Saiz N, Plusa B (2013) Early cell fate decisions in the mouse embryo. Reproduction 145(3): R65–R80. https://doi.org/10.1530/REP12-0381 2. Takaoka K, Hamada H (2012) Cell fate decisions and axis determination in the early mouse embryo. Development 139(1):3–14. https:// doi.org/10.1242/dev.060095

3. Tam PPL, Loebel DAF (2007) Gene function in mouse embryogenesis: get set for gastrulation. Nat Rev Genet 8:368–381. https://doi. org/10.1038/nrg2084 4. Rivera-Pe´rez JA, Mager J, Magnuson T (2003) Dynamic morphogenetic events characterize the mouse visceral endoderm. Dev Biol 261:470–487. https://doi.org/10.1016/ S0012-1606(03)00302-6

154

Frederick C. K. Wong

5. Perea-Gomez A, Rhinn M, Ang SL (2001) Role of the anterior visceral endoderm in restricting posterior signals in the mouse embryo. Int J Dev Biol 45:311–320 6. Perea-Gomez A, Vella FDJ, Shawlot W, OuladAbdelghani M, Chazaud C, Meno C, Pfister V, Chen L, Robertson E, Hamada H, Behringer RR, Ang SL (2002) Nodal antaginists in the anterior visceral endoderm prevent the formation of multiple primitive streaks. Dev Cell 3:745–756. https://doi.org/10.1016/ S1534-5807(02)00321-0 7. Boroviak T, Loos R, Lombard P, Okahara J, Behr R, Sasaki E, Nichols J, Smith A, Bertone P (2015) Lineage-specific profiling delineates the emergence and progression of naive pluripotency in mammalian embryogenesis. Dev Cell 35:366–382. https://doi.org/10.1016/j. devcel.2015.10.011 8. Guo G, Huss M, Tong GQ, Wang C, Li Sun L, Clarke ND, Robson P (2010) Resolution of cell fate decisions revealed by single-cell gene expression analysis from zygote to blastocyst. Dev Cell 18:675–685. https://doi.org/10. 1016/j.devcel.2010.02.012 9. Cheng S, Pei Y, He L, Peng G, Reinius B, Tam PPL, Jing N, Deng Q (2019) Single-cell RNA-Seq reveals cellular heterogeneity of pluripotency transition and X chromosome dynamics during early mouse development. Cell Rep 26(10):2593–2607.e2593. https://doi.org/ 10.1016/j.celrep.2019.02.031 10. Pijuan-Sala B, Griffiths JA, Guibentif C, Hiscock TW, Jawaid W, Calero-Nieto FJ, Mulas C, Ibarra-Soria X, Tyser RCV, Ho DLL, Reik W, Srinivas S, Simons BD, Nichols J, Marioni JC, Go¨ttgens B (2019) A single-cell molecular map of mouse gastrulation and early organogenesis. Nature 566(7745):490–495. https://doi.org/ 10.1038/s41586-019-0933-9 11. Chazaud C, Yamanaka Y, Pawson T, Rossant J (2006) Early lineage segregation between epiblast and primitive endoderm in mouse blastocysts through the Grb2-MAPK pathway. Dev Cell 10:615–624. https://doi.org/10.1016/j. devcel.2006.02.020 12. Nishioka N, Inoue K-i, Adachi K, Kiyonari H, Ota M, Ralston A, Yabuta N, Hirahara S, Stephenson RO, Ogonuki N, Makita R, Kurihara H, Morin-Kensicki EM, Nojima H, Rossant J, Nakao K, Niwa H, Sasaki H (2009) The hippo signaling pathway components Lats and Yap pattern Tead4 activity to distinguish mouse trophectoderm from inner cell mass. Dev Cell 16(3):398–410. https://doi.org/10. 1016/j.devcel.2009.02.003 13. Niwa H, Toyooka Y, Shimosato D, Strumpf D, Takahashi K, Yagi R, Rossant J (2005)

Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell 123:917–929. https://doi.org/10.1016/j. cell.2005.08.040 14. Cajal M, Lawson KA, Hill B, Moreau A, Rao J, Ross A, Collignon J, Camus A (2012) Clonal and molecular analysis of the prospective anterior neural boundary in the mouse embryo. Development 139:423–436. https://doi.org/ 10.1242/dev.075499 15. Takemoto T, Uchikawa M, Yoshida M, Bell DM, Lovell-Badge R, Papaioannou VE, Kondoh H (2011) Tbx6-dependent Sox2 regulation determines neural or mesodermal fate in axial stem cells. Nature 470:394–398. https:// doi.org/10.1038/nature09729 16. Peng G, Suo S, Chen J, Chen W, Liu C, Yu F, Wang R, Chen S, Sun N, Cui G, Song L, Tam PPL, Han JDJ, Jing N (2016) Spatial transcriptome for the molecular annotation of lineage fates and cell identity in mid-gastrula mouse embryo. Dev Cell 36:681–697. https://doi. org/10.1016/j.devcel.2016.02.020 17. Sta˚hl PL, Salme´n F, Vickovic S, Lundmark A, Navarro JF, Magnusson J, Giacomello S, Asp M, Westholm JO, Huss M, Mollbrink A, Linnarsson S, Codeluppi S, Borg A˚, Ponte´n F, Costea PI, Sahle´n P, Mulder J, Bergmann O, Lundeberg J, Frise´n J (2016) Visualization and analysis of gene expression in tissue sections by spatial transcriptomics. Science 353(6294):78. https://doi.org/10.1126/science.aaf2403 18. Downs KM (2008) Systematic localization of Oct-3/4 to the gastrulating mouse conceptus suggests manifold roles in mammalian development. Dev Dyn 237:464–475. https://doi. org/10.1002/dvdy.21438 19. Sasaki K, Nakamura T, Okamoto I, Yabuta Y, Iwatani C, Tsuchiya H, Seita Y, Nakamura S, Shiraki N, Takakuwa T, Yamamoto T, Saitou M (2016) The germ cell fate of cynomolgus monkeys is specified in the nascent amnion. Dev Cell 39(2):169–185. https://doi.org/10. 1016/j.devcel.2016.09.007 20. Osorno R, Tsakiridis A, Wong F, Cambray N, Economou C, Wilkie R, Blin G, Scotting PJ, Chambers I, Wilson V (2012) The developmental dismantling of pluripotency is reversed by ectopic Oct4 expression. J Cell Sci 125: e1.1–e1e1. https://doi.org/10.1242/jcs. 115147 21. Wymeersch FJ, Huang Y, Blin G, Cambray N, Wilkie R, Wong FCK, Wilson V (2016) Position-dependent plasticity of distinct progenitor types in the primitive streak. eLife 5: e10042. https://doi.org/10.7554/eLife. 10042

Whole-Mount Immunofluorescence Staining 22. Staudt T, Lang MC, Medda R, Engelhardt J, Hell SW (2007) 2,20 -Thiodiethanol: a new water soluble mounting medium for high resolution optical microscopy. Microsc Res Tech 70 (1):1–9. https://doi.org/10.1002/jemt. 20396 23. Dodt HU, Leischner U, Schierloh A, J€ahrling N, Mauch CP, Deininger K, Deussing JM, Eder M, Zieglg€ansberger W, Becker K

155

(2007) Ultramicroscopy: three-dimensional visualization of neuronal networks in the whole mouse brain. Nat Methods 4:331–336. https://doi.org/10.1038/nmeth1036 24. Wallingford JB (2010) Preparation of fixed Xenopus embryos for confocal imaging. Cold Spring Harb Protoc 5:1–8. https://doi.org/ 10.1101/pdb.prot5426

Chapter 11 Investigating the Inner Cell Mass of the Mouse Blastocyst by Combined Immunofluorescence Staining and RNA Fluorescence In Situ Hybridization Maud Borensztein Abstract Immunofluorescence and RNA fluorescence in situ hybridization (FISH) methods enable the detection of, respectively, proteins and RNA molecules in single cells. Adapted to preimplantation mouse embryos, these techniques allow the investigation of transcriptional dynamics in the first embryonic and extraembryonic lineages and can circumvent the limited amount of starting material. This can as well be coupled to examination of chromatin modification, i.e., histone marks, by immunofluorescence. Here is outlined an immunofluorescence protocol combined to nascent RNA-FISH after immunosurgery of the mouse inner cell mass of the blastocyst to study early changes in transcription and/or histone marks of both primitive endoderm and epiblast cells. The method describes the different steps from coverslips and FISH probe preparation to inner cell mass isolation and immunofluorescence followed by RNA-FISH. Furthermore, this is applicable to earlier developmental stages and other mammalian species provided little technical adjustments. Key words Immunosurgery, IF/RNA-FISH, Preimplantation embryo, Nascent transcripts, Inner cell mass

1

Introduction After fertilization, the totipotent zygote differentiates in both embryonic and extraembryonic tissues. The first lineage segregation appears between the trophectoderm and the inner cell mass (ICM) of the blastocyst, during mouse preimplantation development, and is quickly followed by the partition of the ICM into primitive endoderm (extraembryonic) and epiblast (embryo proper) cells [1]. To ensure the formation of the whole organism, each cell adopts one of these specific fates by expressing a defined set of genes [2]. This is finely regulated and safeguarded by transcription factors and epigenetic modifications. Most of the

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_11, © Springer Science+Business Media, LLC, part of Springer Nature 2021

157

158

Maud Borensztein

chromatin marks, including histone modifications, are stable and inheritable over cell divisions, allowing gene expression’s memory as well as restrictive developmental potency. However, there are specific developmental periods where genome-wide chromatin reprogramming occurs: the zygote, the ICM in blastocyst, and during the germline formation [3]. All three are critical developmental periods, witnessing intense transcriptomic and epigenomic changes, for which a better understanding is fundamental. In the case of the ICM and germline in mouse females, it also includes transcriptional reactivation and important epigenetic remodeling of an entire chromosome: the inactive X chromosome [4, 5]. Besides, the blastocyst stage is the first developmental period where extraembryonic and embryonic lineages are segregated. Conventionally, lineage segregation between trophectoderm, primitive endoderm, and epiblast is studied by detection and visualization of lineage-specific proteins with antibodies coupled to fluorochrome (immunofluorescence IF) [6]. Transcriptional activity of cells from different lineages is concomitantly accessible by combining RNA fluorescence in situ hybridization (FISH) to detect nascent transcripts of specific genes based on the complementarity hybridization of fluorescent DNA probes, to target nascent RNA sequences. Combining IF/RNA-FISH is a very powerful technique to study an association of protein(s), histone mark (s), and gene transcription, with respect to cell lineage and positioning within the embryo. This approach has been successfully used to decipher the unique transcriptional dynamics of X-linked genes in regard to histone mark enrichment (e.g., H3K27me3) and/or cell lineage information (e.g., Nanog) in the same female embryo [4, 5]. Because the inner cell mass thickness, as well as the discrete signal obtained from single locus by nascent RNA-FISH, it is advised to remove the trophectoderm cells to enhance the detection of the FISH signal in the ICM, in particular when combined to IF. Elimination of the surrounding trophectoderm is performed by immunosurgery procedure, based on complement-dependent antibody toxicity of the mouse blastocyst [7]. First, the whole blastocyst is incubated in anti-mouse serum (here anti-mouse blood cell serum made in rabbit is used), with antibodies binding all reachable trophectoderm cells, the inner cell mass being impermeable to antimouse serum. Then, blastocyst is incubated into guinea pig complement, resulting to death of trophectoderm-only cells. This method is very effective to perform tens of ICM isolation and is suitable to other mammalian blastocyst, provided the use of appropriate serum for the studied species. Here is described a complete protocol to perform IF/RNAFISH in ICM (or in whole preimplantation embryos with omission of the immunosurgery step). Before embryo collection, it first

Combined Immunofluorescence and RNA-FISH after Immunosurgery

159

requires coating of glass coverslips to allow efficient adherence of the embryos, as well as FISH probe fluorescent tagging by nick translation. Then mouse embryos are retrieved at the appropriate day of development (from 3.25 to 4.5 days of gestation for the blastocyst stage), followed by (optional) immunosurgery of the ICMs. At this point, ICMs undergo sequential immunostaining and RNA-FISH followed by washes and imaging the day after. Notably, this protocol enables the study of proteins, histone modifications, and nascent transcription in scarce amount of material, both in wild-type and mutant context. Here, ICM analysis is the focus of this method chapter, but similar approaches can be applied to the study of other stages (mouse preimplantation stages from zygote to 4.5 days of gestation) as well as other mammalian species.

2

Materials

2.1 Coated Glass Coverslips

1. Coverslips, 18 mm
18 mm, 1.5 mm thickness, borosilicate glass. 2. 50 ml plastic tubes, sterile. 3. Tweezers. 4. Petri dish, 100 mm
20 mm. 5. Fiber cleaning papers, ultralow dust wipe. 6. Water bath. 7. Water, sterile, suitable for cell culture. 8. Denhardt’s solution: 3
SSC, 0.2 mg/ml BSA, 0.2 mg/ml Ficoll-400, and 0.2 mg/ml polyvinylpyrrolidone (PVP40) in sterile water (see Note 1). 9. Methanol/glacial acetic acid solution: Prepare a 3:1 (v/v) solution of methanol and glacial acetic acid, freshly prepared. 10. Triethanolamine solution: Prepare a 0.25% (v/v) glacial acetic acid and 0.1 M triethanolamine solution in sterile water, freshly prepared (see Note 2). 11. 100% ethanol.

2.2 Nick Translation Labeling of RNA-FISH Probes

1. Water, sterile, suitable for cell culture. 2. 1–2 μg DNA, extracted from BAC or fosmid (see Note 3). 3. 0.2 mM fluorescent dUTP (e.g., Spectrum Green or Spectrum Red or Cy5). 4. 0.1 mM dTTP. 5. dNTPs mix (0.1 mM each of dATP, dCTP, and dGTP). 6. 10
nick translation buffer, available from nick translation kit. 7. Nick translation enzyme, available from nick translation kit. 8. 2% agarose gel and electrophoresis device.

160

Maud Borensztein

2.3 Blastocyst Collection and Immunosurgery

1. Small plastic tissue culture dishes (35 mm
10 mm and 100 mm
15 mm), sterile. 2. Tweezers and scissors for dissection. 3. Mouth-controlled holder. 4. Glass pipettes, finely drawn, and glass capillaries. 5. Micropipette puller and microforge. 6. Coated glass coverslips (see Subheadings 2.1 and 3.1). 7. M2 culture medium, suitable for mouse embryo. 8. Acidic Tyrode’s solution, suitable for mouse culture. 9. Anti-mouse serum (e.g., anti-mouse red blood cells) (see Note 4). 10. Guinea pig serum complement (see Note 4). 11. 1
phosphate buffer saline (PBS), filtered, sterile, suitable for cell culture. 12. Mineral oil. 13. Binocular microscope. 14. Hot plate or 37  C incubator.

2.4 Immunofluorescence Staining

1. 6-well plates, sterile. 2. Dark humidified chamber, see Fig. 3e. 3. Fine frost slides, 76
26 mm. 4. Tweezers. 5. Vacuum pump, optional. 6. Fiber cleaning papers, ultralow dust wipe. 7. 0.25% trypsin/5 mM EDTA, diluted in 1
PBS. 8. 1% bovine serum albumin (BSA), suitable for embryoculture, resuspended in 1
PBS. 9. 1
PBS, filtered, sterile, and suitable for cell culture. 10. 4% paraformaldehyde (PFA) (see Note 5). 11. 3% PFA, freshly prepared from 4% PFA in 1
PBS. 12. Permeabilization solution: 0.5% Triton X-100, 2 mM vanadylribonucleoside complex (VRC) in 1
PBS, freshly prepared (see Note 6). 13. 40 U/μl RNAse inhibitor (inhibits RNAses A, B, and C). 14. Blocking solution: 1% BSA fraction V (7.5% stock solution), 1 U/μl RNAse inhibitor, in 1
PBS. 15. Primary and fluorescent dye conjugated secondary antibodies. Use a different fluorescent dye than the RNA-FISH probes. 16. Binocular microscope.

Combined Immunofluorescence and RNA-FISH after Immunosurgery

2.5 Probe Mix Preparation

161

1. Fluorescent labeled DNA probe(s), see Subheadings 2.2 and 3.2. 2. Denatured single-stranded DNA fragment mixture, from fish sperm (see Note 7). 3. 1 mg/ml mouse Cot-1 DNA. 4. 3 M Sodium acetate, pH 5.2. 5. 100% ethanol. 6. 70% ethanol. 7. 2
hybridization buffer: 20% dextran sulfate, 2 mg/ml BSA, 20 mM VRC, and 4
SSC in sterile water (see Note 8). 8. Formamide (FA), molecular biology grade (see Note 9). 9. Thermomixers for 1.5 ml tubes.

2.6

RNA-FISH

1. 6-well plates, sterile. 2. Dark humidified chamber, see Fig. 3e. 3. Fine frost slides, 76
26 mm. 4. Vacuum pump, optional. 5. Tweezers. 6. Filter papers, 70-mm-diameter, high-quality cotton linters (e.g., Whatman filter paper). 7. Binocular microscope. 8. 1
PBS, filtered, sterile, and suitable for cell culture. 9. 4% paraformaldehyde (PFA) (see Note 5). 10. 2
SSC solution: Dilute 20
SSC in water. 11. Probe(s)/hybridization mix, see Subheadings 2.5 and 3.5.

2.7 Washes and Imaging

1. 50% FA/2
SCC solution: 50% formamide, 2
SSC (20
stock solution) in water. Adjust the pH to 7.2–7.4 with 1 M HCl and pre-warm at 42  C (see Note 9). 2. 2
SSC solution: Dilute 20
SSC in water and pre-warm half of the solution at 42  C. 3. 3 mg/ml DAPI (40 ,6-diamidino-2-phenylindole), optional. 4. Mounting medium. 5. Fiber cleaning papers, ultralow dust wipe. 6. Filter papers, 70-mm-diameter, high-quality cotton linters (e.g., Whatman filter paper). 7. Fine frost slides, 76
26 mm. 8. Nail polish. 9. Inverted laser-scanning confocal microscope.

162

3

Maud Borensztein

Methods This chapter focuses on ICM of the mouse blastocyst, but this method can be applied to earlier developmental stages, by omitting the immunosurgery step (see steps 6–13 in Subheading 3.3). This protocol is also applicable to other mammalian species of interest, provided some technical adjustments such as the immunosurgery serum, the FISH probes, and Cot-1 repetitive DNA origin. All the procedures should be carried out under an RNAse-free environment. Gloves and lab coat should be worn throughout all bench steps, and appropriate care should be taken when handling and disposing toxic solutions (i.e., methanol/glacial acetic acid solution, paraformaldehyde, and formamide), according to in-house health and safety regulations.

3.1 Coated Glass Coverslips

1. Transfer coverslips in a 50 ml tube filled with 25 ml of Denhardt’s solution as indicated in Fig. 1a (see Note 10). 2. Incubate 3 h at 65  C in a water bath. 3. Transfer coverslips in a 50 ml tube filled with 25 ml of methanol/glacial acetic acid solution (see Note 10 and Fig. 1a). 4. Incubate 20 min at room temperature (RT). 5. Transfer coverslips in a 50 ml tube filled with 25 ml of triethanolamine solution (see Note 10 and Fig. 1a). 6. Incubate 10 min at RT. 7. Empty the 50 ml tube and gently drop the coverslips in a Petri dish (see Fig. 1b). 8. Using a tweezer, wash the coverslips one at a time in water (twice) and in 100% ethanol (twice) as depicted in Fig. 1c. 9. Dry coverslips on a fiber cleaning paper, protected from dust (see Fig. 1c). 10. Stock the coverslips in a clean 50 ml tube at RT for up to 6 months.

3.2 Nick Translation Labeling of RNA-FISH Probes

All reagents should be thawed on ice and the 1.5 ml tube prechilled on ice before adding the mix. 1. Prepare a mix in ice with the following reagents in the prechilled 1.5 ml tube: (19.5  x) μl of water x μl of DNA extracted from BAC or fosmid (1–2 μg) 2.5 μl of fluorescent dUTP 5 μl of dTTP 10 μl of dNTPs mix 5 μl of 10
nick translation buffer

Combined Immunofluorescence and RNA-FISH after Immunosurgery

163

Fig. 1 Preparation of coated glass coverslips. (a) Using clean gloves, transfer glass coverslips one by one in Denhardt’s solution (see step 1 in Subheading 3.1) or methanol/glacial acetic acid solution (see step 3 in Subheading 3.1) or triethanolamine solution (see step 5 in Subheading 3.1). (b) After incubation in triethanolamine solution, empty the 50 ml tube and then gently drop the coverslips in a Petri dish. Then pick coverslips one by one with a tweezer. (c) Quickly wash each coverslip in water (two times) and then ethanol (two times) and dry on a clean fiber cleaning paper

164

Maud Borensztein

2. Mix all the reagents and quickly spin down, and then return the tube to ice. 3. Add 8 μl of nick translation enzyme (see Note 11). 4. Incubate overnight at 15  C, protected from light. 5. Stop the reaction by transferring the tube at 20  C for at least 1 h. 6. Use a small amount of the probe to check its size on a 2% agarose gel (see Note 12). At this step, the DNA probe is labeled and can be kept at 20  C for long-time storage. 3.3 Blastocyst Collection and Immunosurgery

All animal work must be undertaken under the national ethical guidelines. Embryos are handled under a binocular, with a mouthcontrolled holder and a fine glass pipette. The volume of each drop is 30 μl and is done on the cover of a culture dish, except otherwise stated. When mouth pipetting the embryos in a new solution, fill the glass pipette with the next step solution to avoid diluting the drop with the previous solution. Transferring the embryos successively through two to three drops minimize the carried-over solution. 1. Dissect the uterus of a pregnant female mouse on the appropriate day and transfer it into an inverted lid of a plastic dish filled with warm M2 culture medium. Follow procedures as described in [8]. 2. Flush the embryos from the uterus with warm M2. Follow procedures as described in [8]. 3. Collect the embryos in a drop of M2 on a new lid of a plastic dish (see Fig. 3a as an example of drops’ organization). 4. Wash quickly the embryos in two drops of M2. 5. If needed, remove the zona pellucida by transferring the embryos in two successive drops of acidic Tyrode’s solution at room temperature, and rinse them in two drops of fresh M2 as soon as the zona pellucida removal is observed (see Note 13). 6. Dilute anti-mouse serum 1:5 in M2 medium and prepare a small culture dish with three drops of anti-mouse serum as indicated in Fig. 2a (see Notes 4 and 14). 7. Transfer the embryos from the first to the third drop of antimouse serum using the mouth pipette, and incubate in the last drop for 30 min at 37  C (see Note 15). 8. Wash quickly the embryos in two drops of M2 on a new lid of a plastic dish.

Combined Immunofluorescence and RNA-FISH after Immunosurgery

165

Fig. 2 Immunosurgery of the inner cell mass of mouse blastocysts. (a) Example of a small plastic dish (35 mm
10 mm) with three drops of anti-mouse serum (or guinea complement) and filled with mineral oil. Embryos are washed in first and second drops and incubated in the third drop. E4.25 blastocysts before (b, c) and after (d) immunosurgery. Scale bars, 50 μm

9. Dilute guinea pig complement 1:5 in M2 medium, and prepare a small culture dish with three drops of guinea pig complement as indicated in Fig. 2a (see Notes 4 and 14). 10. Transfer the embryos from the first to the third drop of complement using the mouth pipette, and incubate in the last drop for 10–30 min at 37  C (see Notes 15 and 16). 11. Stop the incubation as soon as the trophectoderm cells are lysed by washing the embryos in two drops of M2 on a new lid of a plastic dish (see Note 17). 12. Prepare thin glass capillaries with a pipette puller, and cut them at about 100 μm in diameter with a microforge following manufacturer’s recommendations for both instruments (see Note 18). 13. Remove debris of the trophectoderm by mechanical aspiration of the ICM one at a time through the thin glass capillary controlled with the mouth holder. Transfer the ICMs in a clean M2 drop (see Note 19 and Fig. 2). 3.4 Immunofluorescence Staining

1. Prepare the appropriate amount of 3% PFA at RT and of permeabilization and blocking solutions on ice (see Note 6). 2. Transfer the ICMs from step 13 in Subheading 3.3 with the mouth pipette in a drop of 0.25% trypsin/5 mM EDTA, and incubate at RT for 3–5 min (see Fig. 3a and Note 20). 3. Wash the ICMs through three drops of 1% BSA. 4. Place the appropriate number of coated coverslips (see Subheading 3.1) on the lid of a Petri dish with a tweezer (see Fig. 3b).

166

Maud Borensztein

Fig. 3 Experimental organization for ICM transfer and handling on coverslips. (a) Organization of 30 μl drops on the cover of a plastic dish. (b) Up to six coverslips can be placed on the lid of a Petri dish (with a clean tweezer). A 0.5 μl drop of 1
PBS is placed in the middle of each coverslip before quick transfer of the ICMs; see steps 4–6 in Subheading 3.4. (c) Coverslips with ICM facing up are transferred to a 6-well plate. Each wash/incubation is done with 2 ml of solution, and solution exchange is quickly performed by aspirating with one hand followed by addition of the following solution with the other hand to avoid drying of the samples. (d) Each coverslip is placed on a glass slide to be handled under the binocular and in the humid chamber. A 20 μl drop of liquid is deposited in between the slide and the coverslip to allow easy dissociation. (e) Organization of a humid chamber with the glass slides. Samples are facing up on the coverslip, laid on the slide. Drop of solution (blocking, antibody incubation, RNA-FISH mix) is deposited on top of the samples under a binocular, and slides are then positioned inside the humid chamber as illustrated here (see steps 15, 18, and 22 in Subheading 3.4 and steps 6 and 7 in Subheading 3.6)

5. Pipette a 0.5 μl drop of 1
PBS in the middle of each coverslip (see Fig. 3b). 6. Quickly transfer the appropriate number of ICMs per coverslip in the 0.5 μl drop of 1
PBS by mouth pipetting (see Note 21). 7. Let the ICMs settle down and stick to the coverslip for a couple of minutes, and then aspirate the surrounding PBS with a thin glass capillary (use the same capillaries than in step 12 in Subheading 3.3). 8. Transfer the coverslips into a six-well plate, one per well and ICMs up, with a tweezer, and let dry for 3 min (see Fig. 3c and Note 22). Once the coverslips are transferred to a 6-well plate, each incubation is made in the same well with a 2 ml volume of solution. Exchange of solutions is made by aspirating the old solution with a vacuum pump with one hand and quick

Combined Immunofluorescence and RNA-FISH after Immunosurgery

167

addition of the new solution with a 10 ml pipette with the other hand (see Fig. 3c). These steps are also described here [9]. 9. Fix with 3% PFA for 10 min at RT. 10. Wash three times in 1
PBS. 11. Incubate on ice in the permeabilization solution for 10–15 min depending on the developmental stage of the ICMs (see Note 23). 12. Wash three times in 1
PBS. 13. Prepare a humidified chamber as depicted in Fig. 3e. 14. Place one annotated frost slide on a Petri dish, add a 20 μl drop of water on the slide, and place one coverslip on top of the water drop, with ICMs side up on top of the slide (see Fig. 3d). 15. Place the Petri dish with the slide and coverslip under a binocular, and pipette a 30 μl drop of blocking solution directly on the ICMs. Then transfer the slide and coverslip in the chamber (see Fig. 3e). Repeat steps 14 and 15 for all the coverslips. 16. Incubate for 15 min at RT. 17. Blot excess of blocking solution surrounding the ICMs with the edge of fiber cleaning paper. 18. Add 20 μl of primary antibody, diluted in blocking solution, directly on the ICMs (see Note 24 and Fig. 3e). Incubate for 1 h 30 min to 2 h at RT in the humidified chamber. During this incubation step, begin the FISH probe preparation (see Subheading 3.5). 19. After the 2-h incubation, transfer the coverslips back to the six-well plate. 20. Wash three times 5 min in 1
PBS. 21. Take each coverslip one by one with a tweezer, drain the excess of PBS from the coverslip with the edge of a fiber cleaning paper, and rest each coverslip on a slide as in step 14. 22. Add 30 μl of secondary antibody, diluted in blocking solution, directly on the ICMs (see Note 24 and Fig. 3e). Incubate for 30 min at RT in a dark humidified chamber. 23. Transfer the coverslips back to the six-well plate. 24. Wash three times 5 min in 1
PBS. Continue with step 1 in Subheading 3.6. 3.5 Probe Mix Preparation

Chill 100% and 70% ethanol on ice and set two thermomixer for 1.5 ml tubes at 37 and 75  C. Take care to protect tubes from light during the probe mix preparation as the FISH probes are labeled with fluorochromes (see Subheading 3.2).

168

Maud Borensztein

For one coverslip and one probe: 1. Combine on ice in a 1.5 ml tube: 5 μl of labeled probe (see step 8 in Subheading 3.2) 2 μl of DNA mixture from fish sperm (see Note 7) 5 μl of mouse Cot-1 (see Note 25) 0.7 μl of 3 M sodium acetate Vortex 2. Precipitate by adding 70 μl of cold 100% ethanol and vortex for 30 s. 3. Spin for 30 min, >13,000
g, at 4  C. 4. Pour off the supernatant and wash with 500 μl of chill 70% ethanol; vortex for 30 s. 5. Spin for 5 min, >13,000
g, at 4  C. 6. Pour off the supernatant and air-dry the pellet. Do not overdry. 7. Add 5 μl of formamide on top of the pellet (see Note 26). Do not pipet up and down. 8. Incubate for 30 min at 37  C in a thermomixer with agitation to resuspend the probe. 9. Make sure the pellet is well resuspended in warm FA by pipetting up and down. 10. Incubate for 8–10 min at 75  C to denaturate the probe(s) in a thermomixer with agitation. 11. Incubate for 1 h at 37  C in a thermomixer with agitation to proceed to the competition with Cot-1 (see Note 25). 12. Quench probe on ice. 13. Add 5 μl of 2
hybridization buffer (see Note 26). Mix well avoiding bubbles. This step should be performed at the last moment, when the coverslips are ready in step 4, Subheading 3.6. 3.6

RNA-FISH

1. Fix the coverslips (see step 24 in Subheading 3.4) in 4% PFA for 10 min at RT. 2. Wash three times 1 min in 1
PBS. 3. Wash two times 1 min in 2
SSC. 4. Place the coverslips with tweezers on a filter paper (e.g., Whatman paper) to remove the excess of 2
SCC (see Note 27). This should take 1–5 min maximum. 5. Place one annotated frost slide on a Petri dish, add a 20 μl drop of water on the slide, and place one coverslip on top the water drop, with ICM side up on top of the slide (see Fig. 3e).

Combined Immunofluorescence and RNA-FISH after Immunosurgery

169

6. Carefully pipet a 10 μl drop of probe mix preparation (see step 13 in Subheading 3.5) directly on the ICMs under the binocular. 7. Transfer the slides and coverslips in a dark chamber, humidified with used 50% FA/2
SSC (see Subheading 3.7 and Note 28). 8. Incubate for 15–20 h at 37  C. 3.7 Washes and Imaging

1. Freshly prepare the different solutions and pre-warm at 42  C accordingly. 2. Remove the coverslips from the slides by gently sliding them off with a tweezer and transfer them in a six-well plate. Addition of few μl of 50% FA/2
SSC around the coverslip can help. 3. Wash three times 5 min in 50% FA/2
SSC at 42  C (see Note 28). 4. Wash three times 5 min in 2
SSC. Optional, during the second wash, add the DAPI solution (0.2 μl of DAPI at 3 mg/μl in 2 ml of 2
SSC). First wash is performed at 42  C and then second and third at RT. 5. Prepare annotated microscope slides and deposit 15 μl of mounting medium on each slide. 6. Roughly blot the excess of 2
SSC from the coverslips on a filter paper, and mount the ICM-attached coverslips, ICMs side down, on the slides. 7. Allow the mounting medium to spread for few seconds. Wipe out the excess of medium with a fiber cleaning paper. 8. Seal the coverslips with nail polish. Slides can be stored at 80  C for months; however, it is advised to image the ICMs in the following days. 9. Process to imaging on a confocal microscope with a
60 objective and 0.2 μm Z-sections. Examples of IF combined to RNA-FISH on mouse inner cell mass cells can be observed in the following papers [4, 5].

4

Notes 1. Prepare Denhardt’s solution the night before the experiment and filter. Otherwise, the solution can be made in advance, autoclaved, and stored at 4  C for up to 6 months. To prepare 105 ml of Denhardt’s solution, add to 90 ml of sterile water 15.8 ml of 20
SCC, 0.021 g of BSA, 0.021 g of Ficoll-400, and 0.021 g of PVP40.

170

Maud Borensztein

2. Prepare 20 ml of triethanolamine solution by mixing 19.7 ml of sterile water, with 50 μl of glacial acetic acid and 260 μl of triethanolamine. 3. To detect nascent RNA transcription, use a DNA probe spanning mostly introns of the gene of interest. 4. Upon reception of anti-mouse serum and complement, quickly proceed with restoration in cold water and aliquot them on ice. Aliquots of 20 μl are recommended and are stored at 80  C for up to 1 year. On the day of immunosurgery (see Subheading 3.3), aliquots of serum and complement are diluted 1:5 in M2 medium. After 6 months, efficiency of the serum and most likely of the complement can decrease. Then, use the serum and complement at a working dilution of 1:4 in M2 medium. Do not freeze back thawed aliquots. 5. 4% PFA is prepared from powder, resuspended in 1
PBS, filtered, and then kept in small aliquots at 20  C for several months. Aliquots are made for single use; do not freeze them again. 6. To prepare 12 ml of permeabilization solution (volume for six coverslips), first agitate to dissolve 60 μl of Triton-X 100 in 11.80 ml of 1
PBS at room temperature for at least 10 min. Once dissolved, chill the tube on ice before adding 120 μl of 200 mM VRC, and then always keep the solution on ice before use. VRC is a ribonuclease inhibitor and is important to protect RNA integrity in the samples. 7. Fish sperm DNA, such as salmon sperm DNA, is used as a carrier during probe preparation. It is also recommended to prevent nonspecific hybridization reactions. 8. 2
hybridization buffer can be kept after use at 20  C for up to a month with no more than three cycles of freeze-thaw. To prepare the buffer, first thaw dextran sulfate (50% stock solution), and then incubate for 10 min at 60  C to allow pipetting the appropriate amount because dextran sulfate is very viscous. Mix 40 μl of 50% dextran sulfate with 20 μl of 20
SSC; vortex well; then add 20 μl of 10 mg/ml molecular biology-grade BSA, 10 μl of sterile water, and 10 μl of 200 mM VRC; vortex well; and keep on ice. 9. Once the formamide bottle is open, prepare 1 and 25 ml aliquots and keep at 20  C for long-term storage. 10. Coverslips are transferred by hand, one by one in each 50 ml tube. Be careful to wear clean gloves, without talc, at each step (see Fig. 1a). 11. Carefully pipette and do not vortex once the enzyme is added.

Combined Immunofluorescence and RNA-FISH after Immunosurgery

171

12. Appropriate size of a DNA probe for FISH is between 50 and 500 bp. If the DNA fragment is too big, add 3 μl of nick translation enzyme to the tube and incubate an additional 2–4 h at 15  C. 13. Embryos should be cultured in acidic Tyrode’s solution for no more than 5 min and kept in suspension by mouth pipetting. The embryos become easily attached to the bottom of the plastic dish at this step, and this could damage them when pipetted to the next solution. 14. Each aliquot of serum or complement (20 μl) is freshly diluted just before use to a final volume of 100 μl. 90 μl are used to pipet three drops on the bottom of a small tissue dish and then covered by mineral oil to avoid evaporation and allow better heat transfer (see Fig. 2a). 15. Incubation can be done on a hot plate or in a 37  C incubator, suitable for cell or embryo culture. 16. It is very important not to overexpose the embryos to complement; otherwise, all the cells will be lysed. This step should be carefully monitored under a binocular to stop the reaction as soon as the ICM is well visible within trophectoderm debris. 17. Avoid any contamination of mineral oil by changing the glass pipette to transfer the embryos. 18. For convenience, thin glass capillaries should be prepared in advance. They should then be kept in a clean box to avoid any contamination. Alternatively, glass capillaries could be pulled under flame and the glass back break at the proper diameter (slightly bigger than the ICM of the blastocyst stage of interest). 19. Two to five up and down in the glass capillary should be enough to remove all the debris surrounding the ICM. If more mechanical dissociation is needed, it means that the complement incubation step was too short or the complement (or anti-mouse serum) efficiency has decreased. In case of the second option, use a lower dilution of complement and antimouse serum (1:4 in M2). At this step, ICMs could be used for other downstream applications such as quantitative RT-PCR or RNA sequencing. 20. This step should be performed under a binocular to closely monitor the ICM aspect. Stop the reactivation by washing in 1
BSA (step 3 in Subheading 3.4) as soon as the outer cell contour is visible. In any case, do not keep the ICM for more than 5 min in 0.25% trypsin/5 mM EDTA. This step allows a more flatten ICM on the coverslip for imaging but is optional.

172

Maud Borensztein

21. From one to five ICMs can be transferred on the same coverslip and processed with the same combination of antibodies and RNA-FISH probes. If downstream genotyping of the ICM is needed, it is recommended to process only one ICM per coverslip. 22. Three minutes for drying is specific of ICMs after immunosurgery. When processing whole preimplantation embryos, let the embryos dry on the coverslips for 30 min at RT for either IF combined to RNA-FISH or RNA-FISH alone. 23. Timing and temperature are critical for this step. Incubation time is, respectively, 10 min, 13 min, and 15 min for ICM isolated from early, mid, and late blastocysts. If the experiment is carried out with earlier developmental stages, modify the permeabilization time accordingly: 3 min for 2-/4-cell stage, 4 min for 8-cell stage, 5 min for 16-cell stage, 8 min for 32-cell stage, and 15 min for a blastocyst. It is recommended to use a foil sheet in between the six-well plate and the ice to allow a better transmission of the cold. 24. Concentration and incubation timing of primary and secondary antibodies should be tested according to manufacturer’s recommendations and/or published data. Do not extend primary antibody incubation over 2 h to avoid loss of RNA-FISH signal. And in general a dilution of 1:50 and 1:200 is a good start, respectively, for primary and secondary antibodies. We recommend to test antibody specificity first by immunofluorescence only. 25. Mouse Cot-1 is a 50–300 bp fragmented DNA, enriched in repetitive sequences. It is used to hybridize to mouse repeats found in the BAC or fosmid sequence and then to avoid the nonspecific hybridization of the probe to repetitive genome sequences during RNA-FISH. If the probe sequence does not contain repetitive DNA, there is no need to perform Cot-1 competition. In this case, do not add Cot-1 in step 1 in Subheading 3.5 and skip step 11 in Subheading 3.5. Cot-1 DNA is not added neither if the RNA-FISH probe targets a repetitive element such as LINEs or SINEs [10, 11]. 26. If one probe is used per coverslip, resuspend this probe with 5 μl of FA per coverslip and then add the same amount of 2
hybridization buffer as the volume of FA to obtain a probe mix preparation with a final concentration of 1
hybridization buffer and 50% FA. If two (or three) different probes are used per coverslip, resuspend each probe with 2.5 μl (or 1.7 μl) of FA in step 7 in Subheading 3.5, and pool the two (or three) probes with 5 μl of 2
hybridization buffer in step 13 in Subheading 3.5 for a final volume of 10 μl.

Combined Immunofluorescence and RNA-FISH after Immunosurgery

173

27. Wait for the coverslips to begin to dry before adding the probe mix preparation. It is important not to dilute the probe mix preparation in SSC as we aimed to obtain a 10 μl drop on top of the ICMs. 28. Recycle the unused 50% FA/2
SSC solution for the next experiments (for humid chambers, see step 7 in Subheading 3.6). Store the solution in a close bottle at 4  C.

Acknowledgments I am grateful to Prof Edith Heard for her constant support and critical input. I thank Dr. Ikuhiro Okamoto, Dr. Katia Ancelin, and Patricia Diabangouaya for their experimental assistance and advices, respectively, in ICM immunosurgery, IF combined to RNA-FISH, and RNA-FISH on preimplantation embryos. References 1. Chazaud C, Yamanaka Y (2016) Lineage specification in the mouse preimplantation embryo. Development 143:1063–1074. https://doi. org/10.1242/dev.128314 2. Boroviak T, Loos R, Lombard P et al (2015) Lineage-specific profiling delineates the emergence and progression of naive pluripotency in mammalian embryogenesis. Dev Cell 35:366–382. https://doi.org/10.1016/j. devcel.2015.10.011 3. Surani MA, Hayashi K, Hajkova P (2007) Genetic and epigenetic regulators of pluripotency. Cell 128:747–762. https://doi.org/10. 1016/j.cell.2007.02.010 4. Borensztein M, Okamoto I, Syx L et al (2017) Contribution of epigenetic landscapes and transcription factors to X-chromosome reactivation in the inner cell mass. Nat Commun 8:1–14. https://doi.org/10.1038/s41467017-01415-5 5. Okamoto I, Otte AP, Allis CD et al (2004) Epigenetic dynamics of imprinted X inactivation during early mouse development. Science 303:644–649. https://doi.org/10.1126/sci ence.1092727 6. Chazaud C, Yamanaka Y, Pawson T, Rossant J (2006) Early lineage segregation between epiblast and primitive endoderm in mouse

blastocysts through the Grb2-MAPK pathway. Dev Cell 10:615–624. https://doi.org/10. 1016/j.devcel.2006.02.020 7. Solter D, Knowles BB (1975) Immunosurgery of mouse blastocyst. Proc Natl Acad Sci U S A 72:5099–5102. https://doi.org/10.1073/ pnas.72.12.5099 8. Nagy A, Gertsenstein M, Vintersten K, Behringer R (2003) Manipulating the mouse embryo: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY 9. Okamoto I (2018) Combined immunofluorescence, RNA FISH, and DNA FISH in preimplantation mouse embryos. Methods Mol Biol 1861:149–159. https://doi.org/10.1007/ 978-1-4939-8766-5_12 10. Ancelin K, Syx L, Borensztein M et al (2016) Maternal LSD1/KDM1A is an essential regulator of chromatin and transcription landscapes during zygotic genome activation. Elife 5: e08851. https://doi.org/10.7554/eLife. 08851 11. Ranisavljevic N, Okamoto I, Heard E, Ancelin K (2017) RNA FISH to study zygotic genome activation in early mouse embryos. Methods Mol Biol 1605:133–145. https://doi.org/10. 1007/978-1-4939-6988-3

Chapter 12 Mapping of Chromosome Territories by 3D-Chromosome Painting During Early Mouse Development Katia Ancelin, Yusuke Miyanari, Olivier Leroy, Maria-Elena Torres-Padilla, and Edith Heard Abstract Following fertilization in mammals, the chromatin landscape inherited from the two parental genomes and the nuclear organization are extensively reprogrammed. A tight regulation of nuclear organization is important for developmental success. One main nuclear feature is the organization of the chromosomes in discrete and individual nuclear spaces known as chromosome territories (CTs). In culture cells, their arrangements can be constrained depending on their genomic content (e.g., gene density or repeats) or by specific nuclear constrains such as the periphery or the nucleolus. However, during the early steps of mouse embryonic development, much less is known, specifically regarding how and when the two parental genomes intermingle. Here, we describe a three-dimensional fluorescence in situ hybridization (3D-FISH) for chromosome painting (3D-ChromoPaint) optimized to gain understanding in nuclear organization of specific CTs following fertilization. Our approach preserves the nuclear structure, and the acquired images allow full spatial analysis of interphase chromosome positioning and morphology across the cell cycle and during early development. This method will be useful in understanding the dynamics of chromosome repositioning during development as well as the alteration of chromosome territories upon changes in transcriptional status during key developmental steps. This protocol can be adapted to any other species or organoids in culture. Key words Mouse embryo, Chromosome territories, 3D DNA FISH, Nuclear organization

1

Introduction An extensive reprogramming of the two parental genomes characterizes the onset of mouse preimplantation development, at the time when totipotency is established. The chromatin landscapes of the two genomes, inherited from the gametes, are first drastically remodeled [1, 2]. This is followed by a progressive maturation of the histone content during the transition from totipotency to pluripotency, up to the blastocyst stage [3]. Early post-fertilization stages are also characterized by important changes of nuclear morphology and organization [2, 4, 5]. These large changes occur at

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_12, © Springer Science+Business Media, LLC, part of Springer Nature 2021

175

176

Katia Ancelin et al.

the unusual lamina organization at the nuclear periphery [5], chromocenter assembly, in particular from the paternal genome [4, 6], along with the formation of the uniquely patterned embryonic nucleoli termed NLBs (Nucleolar like Bodies) [7, 8]. Functional interactions have been reported for those specific nuclear compartments that are mostly correlated with the silent portion of the genome [2]. Whether a specific 3D-genome patterning is strictly required for developmental progression is still not clear, but failure to recapitulate the unique embryonic nuclear organization can be associated with embryonic arrest. In the case of somatic cell nuclear transfer (SCNT), the developmental potential of cloned embryos correlates not only with the number of NLBs formed but also with the attachment of the centromeres to the NLBs, which drives a specific radial distribution for the chromosomes [6]. It is thus tempting to associate improper resetting of nuclear architecture of the donor nuclei with the high rate failure in SCNT [9]. The protein composition seems also to play a crucial role in specific nuclear compartments as in the case of the histone chaperone NPM2, which is known to be stored in the NLBs. Its maternal loss leads to abnormal nucleolus organization and arrest of developmental progression beyond few cell cleavages [10]. Another important genomic feature of nuclear organization are the chromosome territories [11]. Interphase chromosomes can be visualized by FISH techniques using chromosome paint, and they occupied specific nuclear spaces called chromosome territories (or CTs) [11]. Preferential 3D organization for entire chromosome has been mapped into details with new approaches of chromosome conformation capture assays (such as high-throughput chromatin conformation capture-based assays or Hi-C) that decipher all interaction contacts, at the whole genome scale [12]. More recently, Hi-C variations have been applied to preimplantation embryos [13–15]. These works show that the contact maps at the early stages following fertilization (zygote and up to eight-cell stage) are quite different compared with those from embryonic stem cells or other differentiated cells. In fact, the specific domains of interactions found in later stages are absent; instead, other interaction domains are found, enriched in H3K27me3 marks, and regulated by the polycomb machinery [16]. They correlate with a unique parental gene expression pattern, from the two-cell stage (at the embryonic genome activation) up to blastocyst stage [17]. How the chromosomes behave within the nuclear space and how the two homologues act in respect to each other, specially when they are epigenetically distinct such as the paternal inactive X chromosome versus the maternal one [18], remain important open questions to date. In terms of nuclear organization in cultured cells, CTs can adopt a specific radial positioning depending on the chromosome

3D-Chromo-Paint During Early Mouse Development

177

gene density [19]. Non-random spatial arrangement for gene-rich or gene-poor chromosomes is triggered in bovine preimplantation only after the embryonic genome activation, pointing toward a connection between nuclear organization and transcription already at the earliest stages of development [20]. The relative position within the nuclear space can also be constrained by specific compartments, such as the nucleolus [21] or the nuclear periphery, as in the case of the Xi [22, 23]. Mapping the spatial and temporal 3D of chromosome territories is thus relevant in order to better understand changes in nuclear organization as development progresses. In this chapter, we provide a detailed protocol for performing 3D DNA FISH accompanied with chromosome paint (3D-ChromoPaint) in preimplantation mouse embryos. Our method should be easily transferable to any other species or other 3D structures such as organoids, in order to investigate the nuclear changes in CTs upon lineage decision or cell differentiation.

2 2.1

Materials Hardwares

1. Petri dishes 10 mm  35. 2. Tweezers for dissection (fine stainless steel Dumont #5). 3. Scissors (fine, stainless steel, dissection). 4. Dissection binocular with 100 magnification. 5. Pasteur pipette: pulled the thin extremity as shown in Fig. 1, referred as transfer pipette. 6. Aspirator tube assemblies for mouth pipette (see Fig. 1) [24]. 7. 4  3 cm Petri dishes. 8. Flexible U-bottom 96-well plate. 9. Dry heating block. 10. Microfuge. 11. Hybridization oven. 12. Water bath. 13. Glass bottom microwell dishes: 35 mm Petri dishes, 14 mm microwell, 1.5 coverglass. 14. Inverted confocal microscope. 15. Plan-Apo DICII (numerical aperture 1.4) 63 oil immersion objective. 16. 3D image visualization and analysis software (e.g., Imaris software).

178

Katia Ancelin et al.

Fig. 1 Equipment setup from embryo collection to the post-hybridization washes. (a) Binocular holding the dishes for preparation of DNA FISH embryos (prefixation to fixation). (b) Hybridization plate with four drops under mineral oil. The first and second drops are pre hybridization buffer, the third corresponds to Cot-1 mix, and the last to the probe mix. (c) Plates are directly denatured on a dry heating plate. (d) One U-bottom 96-well plate is used for post-hybridization washes. The wash solution is applied only to the middle well. (e) The plate is put to float in a water bath 2.2

Solutions

All solutions are prepared with double processed (i.e., distilled and sterile) tissue culture water. 1. Agarose solution: 1% agarose dissolved in 0.9 % NaCl solution. 2. M2 medium for embryo. 3. Acid Tyrode’s solution. 4. PFA 4% (see Note 1). 5. 1 PBS. 6. PBS-Tp: 1 PBS, 0.05% Triton X-100, 1 mg/ml polyvinylpyrrolidone (PVP). 7. First fixative buffer: 1% PFA in PBS-Tp.

3D-Chromo-Paint During Early Mouse Development

179

8. First permeabilization buffer: 0.5% PFA, 0.4% Triton X-100, 1 mg/ml PVP in 1 PBS (see Note 2). 9. Second fixative buffer: 4% PFA, 0.05% Triton X-100, 1 mg/ml PVP (see Note 2). 10. Second permeabilization buffer: 0.5% Triton X-100 in 1 PBS 1 mg/ml PVP (see Notes 2 and 3). 11. Mouse-specific chromosome paints (e.g., Cambio, MetaSystems) (see Note 4). 12. Fluorescent dUTP (e.g., Spectrum Green (SG) or Spectrum Red (SR)). 13. Nick translation kit containing nick translation enzyme, dNTP solution (0.1 mM each of dGTP, dATP, dCTP), and 10 nick translation buffer. 14. DNA, molecular biology grade from fish sperm. 15. Mouse Cot-1 DNA: 1 mg/ml. 16. 2 hybridization buffer (Hyb 2): 20% dextran sulfate, 4 SSC, 1 mM EDTA, 0.1% Triton X-100, 2 mg/ml PVP, 1 mg/ml BSA (see Notes 5 and 6). 17. Deionized formamide (FA). 18. Pre-hybridization buffer: Hyb 2 diluted 1:1 with FA. 19. 3 M sodium acetate pH 5.2. 20. 70% and 100% ethanol. 21. SSC-Tp washing solution: 2 and 0.2 SSC each with 0.5% Triton X-100, 1 mg/ml PVP. 22. Mineral oil. 23. Polylysine solution: 0.1% in water. 24. Non-hardening mounting medium (e.g., VECTASHIELD) with DAPI.

3

Methods Our chapter focuses on mouse preimplantation embryos up to blastocyst stage, but this method can be applied to any other species of preimplantation embryos, provided some adjustments, such as embryo collection, the removal of the zona pellucida, or most likely hybridization conditions (this also applies when testing new probes; see details below). All usage of animals for experimentation must comply with national rules and be approved by referenced ethical committees. From beginning of the procedure (embryo collection) until the end (mounting for imaging), the embryos are moved from one solution to the next using a mouth aspirator device connected to a glass transfer pipette and under a binocular.

180

Katia Ancelin et al.

3.1 Preparation of Preimplantation Embryos

1. Prepare four agarose-coated plates by pouring 2 ml of agarose solution into 3 cm Petri dishes, and let them cool until solidified (see Note 7). 2. Once agarose plates are ready, add the following buffers: 1 ml of first fixative buffer to the first plate, 1 ml of the first permeabilization buffer to the second, 1 ml of the second fixative buffer to the third, and finally 1 ml of PBS-Tp to the last one. Label the lids accordingly. Keep aside. 3. Embryos are collected in M2 medium, after flushing the oviduct/uterus depending on the developmental stages as described [25], using a mouth aspirator device connected to a transfer pipette (see Fig. 1). After removal of the zona pellucida with acid Tyrode’s solution, neutralize immediately by placing the embryos in M2 medium. 4. Transfer the embryos into first fixative buffer for 1 min at room temperature (see Fig. 1) (see Notes 8 and 9). 5. Transfer the embryos into first permeabilization buffer for 1 min at room temperature (see Notes 8–10). 6. Transfer the embryos into second fixative buffer for 10 min at room temperature (see Notes 9 and 11). 7. Wash with PBS-Tp for 10 min at room temperature (see Note 12).

3.2 Generating and Labelling Probes for DNA FISH by Nick Translation

It is also possible to detect a specific genomic locus within a given chromosome, simultaneously when using a chromosome paint probe. In that case, the probes for DNA FISH need to cover introns and exons for specific gene(s) and will result in a punctuate signal at the corresponding genomic locus. We have been successfully using BACs to produce DNA probes by nick translation. 1. 1 μg of BAC is mixed with water up to a volume of 17.5 μl. Add 2.5 μl of 0.2 mM SR-dUTP or SG-dUTP, 10 μl of dNTP solution (0.1 mM each of dGTP, dATP, dCTP), 5 μl of 0.1 mM dTTP, 5 μl of 10 nick translation buffer, and 10 μl of nick translation enzyme. 2. The enzymatic reaction is incubated for 16 h at 15  C in the dark (see Notes 13 and 14). 3. The reaction is inactivated by freezing at least 2 h at Probes can be stored for up to 6 months at 20  C.

3.3 Probes and Cot-1 Blocking Mix Preparation

20  C.

1. For chromosome paint combined with DNA FISH, mix the two probes (painting probes and DNA FISH probes; each labelled with different fluorophores). For each hybridization reaction, combine approximatively 100 ng of probes (DNA labelled) and between 1 and 5 μl of chromosome paint (see

3D-Chromo-Paint During Early Mouse Development

181

Note 15) with 50 μg of Cot-1 DNA (see Note 16) and 5 μg of fish sperm DNA (as a carrier), precipitate with EtOH, and centrifuge during 30 min at 15,000  g at 4  C. 2. Rinse the pellet with 70  C EtOH and air-dry for 5 min. 3. Resuspend the pellet in 1 μl of FA at 37  C for some minutes (up to 30 min). 4. 1 μl of 2 hybridization buffer is added to the tube just before using it to finalize the probe mix. The final volume is then 2 μl. 5. Cot-1 blocking mix is prepared with 10 μg of mouse Cot-1 DNA and 5 μg of fish sperm DNA precipitated by EtOH. The pellet is resuspended with 5 μl of FA and combined before usage with 5 μl of 2 hybridization buffer. The final concentration of the Cot-1 blocking mix is at 1 μg/μl with 50% FA. 3.4 Hybridization of Preimplantation Embryos

Care should be taken to protect from light during all the incubation steps (either in closed box/incubator or wrapped with protective foil, for example). 1. Prepare the hybridization plate by spotting onto a 3 cm Petri dish 1 μl drops of pre-hybridization mix (twice), Cot-1 blocking mix (once), and probe mix (once for each set of probes tested), and cover everything with mineral oil to prevent evaporation (see Fig. 1b). Place at 37  C until further usage (in incubator). 2. Incubate fixed preimplantation embryos (from step 7 in Subheading 3.1) in second permeabilization buffer for 1 h at 37  C (see Note 17). 3. Embryos are briefly washed in PBS-Tp, for example, using the agarose plate of the step 7 in Subheading 3.1. 4. Transfer the embryos to the first drop of pre-hybridization buffer spotted on the hybridization plate for 5 min (see Fig. 1b) (see Note 18). 5. Transfer them to the second drop of pre-hybridization buffer. 6. Equilibrate at 37  C for 15 min. 7. Transfer the embryos to the third drop consisting of Cot-1 blocking mix. 8. Equilibrate the embryos in the mixture overnight at 37  C (see Note 19). 9. Place the whole plate on a heating stage at 83  C for 10 min for DNA denaturation (so that the embryos within the Cot-1 mix and the probe mix are both subjected to the same heat treatment) (see Fig. 1c) (see Note 20). 10. Transfer the plate back at 37  C for at least 2 h (up to 5 h) for Cot-1 competition with repetitive sequences of the genome.

182

Katia Ancelin et al.

11. Transfer the embryos from the Cot-1 mix to the probe mix. 12. Incubate the plate at 37  C for one to three nights (in case of chromosome painting) (see Notes 21 and 22). 3.5 Post-hybridization Washes and Mounting for Imaging

1. Set a water bath at 45  C. 2. Prepare a U-bottom 96-well plate with one well containing 150 μl of 2 SSC-Tp, two wells each with 150 μl of 0.2 SSC-Tp, and finally one well with 150 μl of 1 PBS-Tp. Cover the solution of each well with 100 μl of mineral oil (see Fig. 1d) (see Note 23). 3. Transfer the embryos from the probe mix (see step 11 in Subheading 3.4) to the first well of the U-bottom plate containing 2 SSC-Tp for a quick rinse. 4. Transfer the embryos into the next drop containing 0.2 SSC-Tp. 5. Incubate at 45  C for 15 min (see Fig. 1e). 6. Repeat the two previous steps (see Note 24). 7. Transfer the embryos into the next drop containing 1 PBS-Tp. 8. Prepare the plate for imaging in which to mount the embryos: precoat for 5 min with polylysine solution the glass bottom and air-dry. When dry, spot 1 μl of 1 PBS per probe condition for mounting groups of embryos and cover with mineral oil (see Note 25). 9. Transfer the embryos from the washing plate to the imaging plate, into the drop of 1 PBS. 10. Incubate the plate with embryos 10 min at 45  C to let them settle at the bottom. 11. Exchange the 1 PBS to a gradient series of mounting media (30, 60, and 100%) using a Pasteur pipette with a broader opening due to the viscosity of the mounting media. Incubate the embryos in each series for at least 10 min at 45  C. 12. Plate is stored at 4  C (protected from light) if the image acquisition are not done on the same day.

3.6 Image Acquisition and Analysis

1. Microscopy In the examples we show in Fig. 2, we imaged the embryos following chromosome paint and DNA FISH with an inverted confocal microscope with a Plan-Apo DICII (numerical aperture 1.4) 63 oil objective. It is critical to have used the correct coverslip thickness and the correct oil adapted to the lens in order to obtain correct images. In order to capture the 3D structure of the mouse embryos post staining, Z sections were taken every 0.4 μm, which allows a good reconstruction when using 3D render images (see

3D-Chromo-Paint During Early Mouse Development

183

Fig. 2 Example of 3D-ChromoPaint and image reconstruction. (a) 3D view of a male two-cell stage embryo marked with chromosome paint against chromosome 13 in red and chromosome X in green. The polar body (bottom) is also stained for one copy of each chromosome. (b) Same embryo after 3D rendering of the FISH image. (c) 3D image reconstruction for three eight-cell stage embryos. (d) Example of image obtained for a blastocyst. X chromosomes are shown in green, and the red dots denote a specific DNA FISH signal obtained for a single genomic locus

below). Acquisition on a confocal microscope might take up to 1 h per embryo if four colors are used, specifically at the blastocyst stage. 2. Analysis It is possible to visualize and analyze in 3D the 3D-ChromoPaint embryo image acquisition using dedicated software. Here we used Imaris (Bitplane) software to segment nuclei and chromosome territories as well as to report specific genomic locus position in 3D. Corresponding 3D features (e.g., a radial position for a given chromosome territory, a volume, inter distances between chromosome territories) can next be quantitatively assessed (see Fig. 2b–d).

184

Katia Ancelin et al.

(a) 3D segment nuclear shell using surpass mode (more accurate in manual mode). (b) 3D segment chromosome territories using surpass mode (automatic threshold). (c) Compute 3D distance map in order to get the distance to the nucleus surface of any other defined object border. This allows measuring 3D radial distances. (d) Measurements from the 3D segmented images are next used for graphical or statistical analysis.

4

Notes 1. PFA prepared from powder can be aliquoted and stored in small aliquot at 20  C. 2. Prefixation, pre-permeabilization, and fixation are prepared fresh every time embryos are collected. 3. RNAse treatment can be added during the permeabilization step in order to make sure the signal detected is from genomic DNA, as well as to help for the probe specificity. In that case RNAse (DNAse-free) is added at 0.02% final (from a 10 mg/ml stock). 4. Mouse-specific chromosome paints are commercially available (e.g., Cambio and MetaSystems). 5. Adjust the hybridization buffer pH around 7 with NaOH. 6. Prepare small aliquots of hybridization buffer (about 20 μl; stored at 20  C for up to 6 months), and thaw each of them only once or twice. 7. Agarose-coated plates can be stored at 4  C for some weeks, tightly wrapped (e.g., aluminum paper) as to prevent evaporation. 8. The timing of the first steps of fixation and permeabilization is crucial and should be strictly followed with a timer at hands. The embryos will tend to lyse or to become sticky for further manipulation if these two steps are any longer than 1 min each. 9. The embryos tend to spin into many directions into the liquid once they are added to the different fixative and permeabilization solutions. Keep them under control at all moments with the pipette, and practice first with few embryos at a time (e.g., between 1 and 5). 10. Permeabilization solution must be prepared fresh every time a new hybridization is done. During the 1 min incubation time into first permeabilization buffer, aspirate slowly into the pipette the medium in close proximity to the embryos to promote removal of some cytoplasmic content. This step is

3D-Chromo-Paint During Early Mouse Development

185

crucial for reducing the autofluorescence of preimplantation embryos. 11. Incubation into second fixative buffer can be extended up to 20 min. 12. After fixation, embryos can be stored in PBS-Tp for up to 1 month before starting the procedure of second permeabilization and hybridization. However, once the embryos are incubated into the second permeabilization, they need to be further processed for hybridization. 13. The optimal range size of a FISH probe obtained by nick translation is between 50 and 300 base pairs, short enough to enter the nucleus and long enough to be specific. 14. DNA FISH probes should be tested along with chromosome paint to assess if the probe is recognizing the expected chromosome. Ideally, one should always test new sets of probes along with probes for which the hybridization pattern is known. 15. The amount of labelled mouse chromosome paint is dependent on the origin (i.e., which company it is purchase from). This needs to be tested, but generally between 1 and 5 μl gives a good range for initial tests. 16. Cot-1 DNA: competition is required for most probes as they can contain repeat sequences that will cross hybridize and increase background unless competed away prior to hybridization. The amount required to be added to BAC probes from the nick translation reaction ranges from 2 to 10 μg; however it needs to be top up as indicated in case of staining along with a chromosome paint probe. 17. The second permeabilization treatment can be done into a well of a flexible U-bottom 96-well plate or onto one agarosecoated 3 cm Petri dish. 18. For blastocyst stage, incubate with increasing dextran dilution series (1.25, 2.5, 5, and 10%) for 15 min each to prevent the blastocoel cavity to collapse. 19. Equilibration in Cot-1 blocking mix can also be for 3 h at 56  C. 20. In order to homogenize the denaturing temperature between the heating stage and the Petri dish, carefully add 100 μl of water at the center of the flat surface of the hot plate before putting the dish. Beware of not spilling water on the electrical device anywhere else than a small drop at the center. 21. For overnight (or for several days) incubation, use an incubator with homogeneous temperature. Alternatively, the Petri dish for hybridization can be set on a floating stage on a water bath with a lid. Take care of shielding the plate from light during the incubation.

186

Katia Ancelin et al.

22. 37  C is a routinely used temperature in our conditions for hybridization. However, hybridization temperature might vary depending on the probe and needs to be tested (up to 45  C). 23. The flexible U-bottom 96-well plate can float when put in a filled water bath. To promote equilibrium, the designated well for washes should be in the middle of the plate (equivalent distances from each edge). Be gentle when putting the plate to float in the water bath, and use some tools to prevent the plate to float too freely in the water (see Fig. 1e). 24. Additional washes or else washes with lower concentration of SSC (down to 0.1) can be performed if stringency of detection needs to be increased. Increase of the temperature is also an option depending on the hybridization temperature (45  C for 37  C, 50  C for 45  C). Alternatively, if the signal is too weak, and background low, the stringency can be reduced by doing washes in 1 SSC-Tp. 25. It is important to use 1 PBS without any Triton or PVP to promote the adhesion of the embryos to the bottom of the plate in order to be able to image without them moving. Do not transfer the embryos directly into mounting medium as they would tend to collapse and next float in the drop rather than sticking to the bottom. The preparation of the plate for imaging is similar to the one for hybridization, and small drops are covered with mineral oil.

Acknowledgments We thank the Institut Curie animal facility for animal welfare and husbandry and the imaging facility PICT-IBiSA@BDD (member of France-Bioimaging ANR-10-INBS-04 and UMR3215/U934) for technical assistance. This work was supported by ANR-09-Blanc0114 to METP and EH and Labex DEEP:ANR-11-LBX-0044, IDEX PSL: ANR-10-IDEX-0001-02 PSL to E.H. References 1. Burton A, Torres-Padilla M-E (2010) Epigenetic reprogramming and development: a unique heterochromatin organization in the preimplantation mouse embryo. Brief Funct Genomics 9:444–454. https://doi.org/10. 1093/bfgp/elq027 2. Borsos M, Torres-Padilla M-E (2016) Building up the nucleus: nuclear organization in the establishment of totipotency and pluripotency during mammalian development. Genes Dev 15:611–621. https://doi.org/10.1101/gad. 273805.115

3. Zheng H, Huang B, Zhang B et al (2016) Resetting epigenetic memory by reprogramming of histone modifications in mammals. Mol Cell 63:1066–1079. https://doi.org/10. 1016/j.molcel.2016.08.032 4. Probst AV, Almouzni G (2008) Pericentric heterochromatin: dynamic organization during early development in mammals. Differentiation 76:15–23. https://doi.org/10.1111/j.14320436.2007.00220.x 5. Borsos M, Perricone SM, Schauer T et al (2019) Genome–lamina interactions are

3D-Chromo-Paint During Early Mouse Development established de novo in the early mouse embryo. Nature 569:729–733. https://doi.org/10. 1038/s41586-019-1233-0 6. Martin C, Beaujean N, Brochard V et al (2006) Genome restructuring in mouse embryos during reprogramming and early development. Dev Biol 292:317–332. https://doi.org/10. 1016/j.ydbio.2006.01.009 7. Aguirre-Lavin T, Adenot P, Bonnet-Garnier A et al (2012) 3D-FISH analysis of embryonic nuclei in mouse highlights several abrupt changes of nuclear organization during preimplantation development. BMC Dev Biol 12:30. https://doi.org/10.1186/1471-213X-12-30 8. Fulka H, Aoki F (2016) Nucleolus precursor bodies and ribosome biogenesis in early mammalian embryos: old theories and new discoveries. Biol Reprod 94(6):143. https://doi. org/10.1095/biolreprod.115.136093 9. Martin C, Brochard V, Carole M et al (2006) Architectural reorganization of the nuclei upon transfer into oocytes accompanies genome reprogramming. Mol Reprod Dev 73:1102–1111. https://doi.org/10.1002/ mrd.20506 10. Burns KH, Viveiros MM, Ren Y et al (2003) Roles of NPM2 in chromatin and nucleolar organization in oocytes and embryos. Science 300:633–636. https://doi.org/10.1126/sci ence.1081813 11. Cremer T, Cremer M (2010) Chromosome territories. Cold Spring Harb Perspect Biol 2:1–22. https://doi.org/10.1101/ cshperspect.a003889 12. Lieberman-Aiden E, Van Berkum NL, Williams L et al (2009) Comprehensive mapping of long-range interactions reveals folding principles of the Human Genome. Science 326:289–294. https://doi.org/10.1126/sci ence.1181369 13. Flyamer IM, Gassler J, Imakaev M et al (2017) Single-nucleus Hi-C reveals unique chromatin reorganization at oocyte-to-zygote transition. Nature 544:110–114. https://doi.org/10. 1038/nature21711 14. Du Z, Zheng H, Huang B et al (2017) Allelic reprogramming of 3D chromatin architecture during early mammalian development. Nature 547:232–235. https://doi.org/10.1038/ nature23263 15. Ke Y, Xu Y, Chen X et al (2017) 3D chromatin structures of mature gametes and structural reprogramming during mammalian

187

embryogenesis. Cell 170:367–381.e20. https://doi.org/10.1016/j.cell.2017.06.029 16. Du Z, Zheng H, Kawamura Y et al (2020) Polycomb group proteins regulate chromatin architecture in mouse oocytes and early embryos article polycomb group proteins regulate chromatin architecture in mouse oocytes and early embryos. Mol Cell Biol 77:1–15. https://doi.org/10.1016/j.molcel.2019.11. 011 17. Collombet S, Ranisavljevic N, Nagano T et al (2020) Parental-to-embryo switch of chromosome organization in early embryogenesis. Nature 580:142–146. https://doi.org/10. 1038/s41586-020-2125-z 18. Galupa R, Heard E (2018) X-chromosome inactivation: a crossroads between chromosome architecture and gene regulation. Annu Rev Genet 52:535–566. https://doi.org/10. 1146/annurev-genet-120116-024611 19. Croft JA, Bridger JM, Boyle S et al (1999) Differences in the localization and morphology of chromosomes in the human nucleus. J Cell Biol 145:1119–1131. https://doi.org/10. 1083/jcb.145.6.1119 20. Koehler D, Zakhartchenko V, Froenicke L et al (2009) Changes of higher order chromatin arrangements during major genome activation in bovine preimplantation embryos. Exp Cell Res 315:2053–2063. https://doi.org/10. 1016/j.yexcr.2009.02.016 21. Heride C, Ricoul M, Kieˆu K et al (2010) Distance between homologous chromosomes results from chromosome positioning constraints. J Cell Sci 123:4063–4075. https:// doi.org/10.1242/jcs.066498 22. Zhang LF, Huynh KD, Lee JT (2007) Perinucleolar targeting of the inactive X during S phase: evidence for a role in the maintenance of silencing. Cell 129:693–706. https://doi. org/10.1016/j.cell.2007.03.036 23. Namekawa SH, Payer B, Huynh KD et al (2010) Two-step imprinted X inactivation: repeat versus genic silencing in the mouse. Mol Cell Biol 30:3187–3205. https://doi. org/10.1128/mcb.00227-10 24. Ranisavljevic N, Okamoto I, Heard E, Ancelin K (2017) RNA FISH to study zygotic genome activation in early mouse embryos. Methods Mol Biol 1605:133–145. https://doi.org/10. 1007/978-1-4939-6988-3_9 25. Hogan B, Beddington R, Costantini F, Facy E (1994) Manipulating the mouse embryo. Cold Sring Harbor Laboratory Press, New York

Chapter 13 Deciphering the Early Mouse Embryo Transcriptome by Low-Input RNA-Seq Raquel Pe´rez-Palacios, Patricia Fauque, Aure´lie Teissandier, and De´borah Bourc’his Abstract Early preimplantation embryos are precious and scarce samples that contain limited numbers of cells, which can be problematic for quantitative gene expression analyses. Nonetheless, low-input genome-wide techniques coupled with cDNA amplification steps have become a gold standard for RNA profiling of as minimal as a single blastomere. Here, we describe a single-cell/single-embryo RNA sequencing (RNA-seq) method, from embryo collection to sample validation steps prior to DNA library preparation and sequencing. Key quality controls and external Spike-In normalization approaches are also detailed. Key words Single-embryo RNA-seq, Single-cell RNA-seq, scRNA-seq, Low-input transcriptomics, Embryonic gene expression, Spike-In

1

Introduction Embryonic preimplantation development comprises the period from the fertilization of the female gamete by the spermatozoon to the implantation of the embryo into the uterus of the mother. This embryonic period entails global epigenetic remodelling that harmonizes with dramatic and dynamic transcriptional changes at each developmental stage. It is crucial then to understand the gene expression changes underlying the different embryonic events occurring during this period: from the locked transcriptional quiescence and specialization of the gametes, through the acquisition of transcriptional autonomy and totipotency, to the progression toward the first cell fate determination. The embryology and developmental biology fields have bloomed thanks to the development of low-input profiling techniques. The problem of the scarcity of the embryonic samples has been overcome by low-input genome-wide gene expression methods that provide a snapshot of the transcriptional status of a single

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_13, © Springer Science+Business Media, LLC, part of Springer Nature 2021

189

190

Raquel Pe´rez-Palacios et al.

embryo or single blastomere at a specific moment. Their sequential application to different embryonic stages brings information about transcriptional changes, developmental players, and developmental pace. Moreover, single-cell or single-embryo RNA-sequencing (scRNA-seq) strongly reduces the number of embryos that needs to be analyzed due to its inherent characteristic of extracting information individually from all samples (increasing the power of the analysis while using low number of embryos), being therefore key to the study of genetic models of early compromised development. Furthermore, single-cell techniques can shed light onto another layer of complexity: the study of transcriptional heterogeneity within cells of the same embryo and between embryos. The low-input RNA-seq method detailed here is generally referred as the Tang method [1] from which different variants of the protocol have been applied from single blastomeres [2] to single embryos [3]. In brief, after embryo collection at the developmental stages of interest, embryos are either dissociated into single blastomeres or directly processed as whole. Each single embryo or single cell is then transferred into an individual sample tube and lysed to allow all RNAs to be released. Subsequently, polyadenylated RNAs are reverse transcribed into first-strand cDNAs using oligo-dT primers containing anchor sequences. The newly synthesized strand is further polyadenylated to allow the synthesis of the second strand. Finally, cDNAs are amplified via PCR using the poly(T) primers as adaptors for priming the DNA polymerase reaction, and cDNAs are purified and size-selected prior to DNA library preparation for sequencing (see Fig. 1). It is important to highlight the main characteristics of this method. On the one hand, as it is based on the amplification of the cDNA via oligo-dT primer adaptors, this technique uniquely targets polyadenylated mRNAs. This approach also makes the amplification to be 30 biased, limiting the coverage of transcriptional start sites (TSS). This stands in contrast to other single-cell RNA-seq amplification methods such as the SMART-seq/SMARTseq2 that are based on switching template technology at the 50 of the transcript and provide full-length cDNA amplifications [4, 5]. On the other hand, it is a robust, easy-to-implement, low-input genome-wide method of great application to all embryonic preimplantation stages, which provides good coverage of medium to highly expressed genes. Here, we describe a single-cell/single-embryo RNA-seq technique from embryo collection to sample validation prior to DNA library preparation and sequencing. As commented above, this method can be applied to both single embryos and single-cell blastomeres after embryo dissociation, the major differences residing in the starting quantity of endogenous RNA of the sample, requiring therefore optimization of the number of cycles of amplification. Finally, we also stress the utility of adding exogenous

Single-Cell/Single-Embryo RNA-Seq Cell lysis buffer

Sample tube preparation section 3.1

191

Addition of Spike-In (optional)

Embryo collection and zona pellucida removal section 3.2

single-cell dissociation single-embryo processing

Ca++-, Mg++-free medium

single-cell processing

Cell lysis

RNA

section 3.3

Reverse transcription of polyadenylated mRNA

AAAAAAAA

Addition of UP1 primers UP1

section 3.3

Free-primers removal

Poly(A) tailing of cDNA and mRNA removal

AAAAAAAA

section 3.3

2nd strand cDNA synthesis

AUP2

section 3.3

cDNA amplification by PCR

TTTTTTTT AAAAAAAA

Forward PCR primer (AUP2)

section 3.3

Addition of AUP2 primers

Addition of AUP1 primers

Reverse PCR primer (AUP1)

cDNA purification (PCR and gel purification)

QC control and samples selection

section 3.5

section 3.4 Concentration and size distribution measurements section 3.6

DNA library preparation and sequencing

Fig. 1 Flowchart of the single-cell/single-embryo RNA-seq method. Before embryo collection, sample tubes containing cell lysis buffer are prepared with optional addition of Spike-In molecules to the reaction mix. Embryos are then collected and denuded. Single embryos are directly processed or dissociated into single cells before sample processing. Single-cell/single-embryo samples are then lysed, and the released polyadenylated mRNAs are retrotranscribed. After addition of Poly(A) tail to the first-strand cDNA, second-strand cDNA is synthesized and cDNAs are amplified by PCR using oligo-dT primers with anchor sequences. Finally, cDNAs are purified and size-selected on agarose gel before DNA library preparation and high-throughput sequencing

192

Raquel Pe´rez-Palacios et al.

Spike-In molecules in single-cell/single-embryo RNA-seq. The addition of these artificial transcripts is well known for allowing the detection of technical variations and for providing basis for further normalization in bioinformatic analyses. Moreover, the inclusion of Spike-In molecules is also a highly reliable way to quantify potential differences in total levels of endogenous RNA among samples and identify phenomena of hypertranscription or reduced transcription occurring at the genome-wide scale.

2

Materials

2.1 Cell Lysis Buffer Preparation

1. GeneAmp® 10 PCR buffer II and MgCl2, from ThermoFisher Scientific. 2. 10% Nonidet P-40 substitute. 3. 0.1 M DTT (dithiothreitol). 4. dNTP mix (2.5 mM/each). 5. SUPERase-In® (20 U/μl), from ThermoFisher Scientific. 6. Ambion® RNase Inhibitor (40 U/μl), cloned, from ThermoFisher Scientific. 7. Universal primer UP1, 100 μM: 50 -ATATGGATCCGGCGC GCCGTCGACTTTTTTTTTTTTTTTTTTTTTTTT-30 (see Note 1). 8. ERCC Spike-In, from ThermoFisher Scientific (optional). 9. Nuclease-free water. 10. 0.2 ml thin-wall PCR tubes, free of RNase, DNase, DNA, and PCR inhibitors. 11. RNase decontamination solution. 12. Mini-spin. 13. PCR cooling block. 14. Enzyme cooler. 15. PCR workstation.

2.2 Embryo Collection and Dissociation

1. Plastic tissue culture dishes, 35  15 mm, sterile. 2. Tweezers and scissors for dissection. 3. Mouth-controlled holder and micropipettes. 4. Embryo-handling pipetter and tips. 5. M2 culture medium. 6. Hyaluronidase. 7. Acidic Tyrode’s solution, suitable for mouse culture. 8. Ca2+- and Mg2+-free M2 medium, final concentration in sterile water (1): 97 mM NaCl, 4.7 mM KCl, 1.19 mM KH2PO4,

Single-Cell/Single-Embryo RNA-Seq

193

3.2 μl/ml 60% liquid sodium lactate (~38.8 mM), 5.5 mM glucose, 50 U/ml penicillin/streptomycin, 25 mM NaHCO3, 0.01 mM phenol red, 0.3 mM Na pyruvate, 0.52 mM EGTA, 4 mg/ml bovine serum albumin (BSA) (see Note 2). 9. PBS-AcBSA: dissolve acetylated BSA (1 mg/ml working concentration) in sterile 1 PBS (see Note 3). 10. Binocular microscope. 11. Hot plate. 12. 0.2 ml thin-wall PCR tubes, free of RNase, DNase, DNA, and PCR inhibitors. 2.3 Reverse Transcription and cDNA Amplification

1. SuperScript® III reverse transcriptase, from ThermoFisher Scientific. 2. Ambion® RNase Inhibitor (40 U/μl), cloned, from ThermoFisher Scientific. 3. T4 gene 32 protein (1–10 U/μl). 4. ExoSAP-IT®, from ThermoFisher Scientific. 5. GeneAmp® 10 PCR buffer II and MgCl2 from ThermoFisher Scientific. 6. 100 mM dATP. 7. Terminal deoxynucleotidyl transferase, recombinant (15 U/μl). 8. RNAse-H (2 U/μl). 9. TaKaRa Ex Taq® DNA Polymerase Hot Start, from Ozyme. 10. 10 Ex Taq buffer with MgCl2 included in the TaKaRa Ex Taq® DNA Polymerase Hot Start kit. 11. dNTP mix (2.5 mM/each). 12. Amino-blocked universal primers, 100 μM: AUP1 (NH2ATATGGATCCGGCGCGCCGTCGACTTTTTTTTTTTTT TTTTTTTTTTT) and AUP2 (NH2-ATATCTCGAGGGCG CGCCGGATCCTTTTTTTTTTTTTTTTTTTTTTTT) (see Note 4). 13. Nuclease-free water. 14. 0.2 ml thin-wall PCR tubes, free of RNase, DNase, DNA, and PCR inhibitors. 15. 1.5 ml low-retention microcentrifuge tubes, free of RNase, DNase, DNA, and PCR inhibitors. 16. RNAse decontamination solution. 17. Thermocycler. 18. Mini-spin. 19. PCR cooling block. 20. Enzyme cooler. 21. PCR workstation.

194

Raquel Pe´rez-Palacios et al.

2.4 Sample Quality Control

1. SYBR-based quantitative PCR kit. 2. Real-time instrument. 3. Housekeeping gene primers: H2faz (Fwd: ACAGCGCAGCC ATCCTGGAGTA, Rev: TTCCCGATCAGCGATTTGTGGA) [6]; Gapdh (Fwd: CATACCAGGAAATGAGCTTG, Rev: ATGACATCAAGAAGGTGGTG); Tbp (Fwd: AAGAGAGCCACGGACAACTG, Rev: TTCACATCACAGCTCCCCAC).

2.5 cDNA Purification

1. PCR purification kit. 2. Agarose gel electrophoresis equipment. 3. Loading buffer with bromophenol blue dye. 4. Scalpels, sterile. 5. 1.5 and 2 ml microcentrifuge tubes, sterile. 6. Gel extraction kit. 7. Nuclease-free water.

2.6 Sample Validation for Library Preparation

1. DNA size distribution quantification instruments and buffers (TapeStation®, Bioanalyzer®, or similar technologies). 2. Concentration quantification instruments and buffers (Qubit® or similar technologies). 3. Library kit reagents and adapters.

3

Methods All materials, reagents, and equipment used in this protocol should be destined exclusively—when possible—to this technique. 0.2 ml thin-wall PCR tubes and 1.5 ml microcentrifuge tubes are closed before opening the external plastic bag to avoid any external contamination. Embryo manipulation micropipettes and tips should be sterilized for 5 min under ultraviolet light just before usage. Gloves should be changed at every step, and lab coat should be worn throughout bench steps. It is recommended to prepare all heating temperatures in sequential PCR programs in a thermocycler to reduce experimental timing. Surfaces and gloves should be cleaned with a RNase decontamination solution for the following steps: steps 1–4 in Subheading 3.1 and steps 1–5 in Subheading 3.3. It is also highly recommended to use a PCR workstation (hood) for the following steps: steps 2–4 in Subheading 3.1 and steps 1–12 in Subheading 3.3. Buffers will be preferably mixed by finger tapping, or when needed, a very quick and gentle vortex will be performed.

Single-Cell/Single-Embryo RNA-Seq

195

1. Thaw all reagents used at 4  C on ice, and prepare an enzyme block at 20  C.

3.1 Cell Lysis Buffer Preparation

2. Dilute the UP1 primers to 0.5 mM concentration in cold, nuclease-free water (1 μl into 199 μl of water). 3. Prepare single-cell lysis as given in Table 1 (see Note 5). It is recommended the addition of Spike-In RNAs to the cell lysis buffer mix (see Note 6). Table 1 Cell lysis buffer Reagents

Final concentration Volume for 1 reaction (μl)

10 PCR buffer II (without MgCl2), GeneAmp® kit 0.9 ®

0.45

25 mM MgCl2, GeneAmp kit

1.35 mM

0.27

10% NP40 substitute

0.45%

0.225

0.1 M DTT

4.5 mM

0.225

0.5 μM UP1 primer

12.5 nM

0.125

dNTP mix (2.5 mM each)

0.045 mM (each)

0.09

SUPERase-IN (20 U/μl)

0.18 U/μl

0.045

RNase inhibitor (40 U/μl)

0.36 U/μl

0.045

Nuclease-free water

–

2.575

ERCC Spike-In

To be determined

0.1

®

4. Add 4.15 μl of cell lysis buffer mix to each sample tube, quickly spin down the tubes, and reserve on a PCR cooling block set on ice (see Notes 7 and 8). 3.2 Embryo Collection and Dissociation

1. Collect preimplantation embryos from pregnant female mice (using superovulation or natural mating with studs) on the appropriate day and timing in pre-warmed M2 culture medium (see Note 9) [7]. The use of animals should be performed in accordance with the national ethical guidelines. 2. Transfer the embryos in acidic Tyrode’s solution at 37  C, and rinse in three consecutive drops while pipetting the embryos continuously up and down. 3. Transfer and rinse in three drops of fresh pre-warmed M2 medium as soon as the zona pellucida removal is evident. 4. If single-cell dissociation is required, transfer the embryos in three drops of pre-warmed Ca2+- and Mg2+-free M2 medium covered by mineral oil set on a 37  C warm plate. Pipette

196

Raquel Pe´rez-Palacios et al.

continuously the embryo up and down using an embryo handling pipetter and thin sterile tips to mechanically help the cell dissociation (see Note 10). 5. Wash the dissociated embryonic cells or the single denuded embryos in three drops of PBS-AcBSA solution. 6. Transfer individual single cells or single embryos carrying the minimum possible amount of PBS-AcBSA ( 30 ng) or 10% (for input DNA < 30 ng). 3. When possible, verify the sonication by loading 5–10 ng of sonicated DNA on a 2.5% agarose gel in TBE 1, and run at 180 V for 30 min. 4. Perform bisulfite conversion with the EZ DNA MethylationGold kit according to the manufacturer’s instructions (see Note 10). Briefly, mix 20 μL of fragmented DNA with 130 μL of CT conversion reagent, and incubate 10 min at 98  C and 150 min at 64  C and then hold at 4  C. Perform washing and desulfonation steps on a Zymo-Spin IC Column following the manufacturer’s instructions, and elute with 15 μL M-Elution Buffer preheated at 65  C in a 1.5 mL low-binding microtube (see Note 11). 5. Transfer the bisulfited DNA in a 0.2 mL PCR tube. Denature in a thermocycler at 95  C for 2 min and place the tube 2 min on ice. 6. Prepare a mix containing 11.5 μL of low EDTA TE, 4 μL of buffer G1, 4 μL of reagent G2, 2.5 μL of reagent G3, 1 μL of enzyme G4, 1 μL of enzyme G5, and 1 μL of enzyme G6 (see Note 12). Add this mix to the 15 μL of denatured DNA from step 5 (final volume, 40 μL), and incubate in a thermocycler at 37  C for 15 min and 95  C for 2 min, and then hold at 4  C. 7. Prepare a mix containing 2 μL of reagent Y1 and 42 μL of enzyme Y2 (see Note 13). Add this mix to the sample from the

216

Ambre Bender et al.

previous step (final volume, 84 μL), and incubate in a thermocycler at 98  C for 1 min, 62  C for 2 min, and 65  C for 5 min, and then hold at 4  C. 8. Quickly spin and transfer the sample from the PCR tube to a 1.5 mL low-binding microtube. Add 101 μL of AMPure beads first into the empty PCR tube (to recover the leftover liquid), and then add it to the sample in the 1.5 mL microtube and mix by pipetting up and down. Incubate 5 min at room temperature. 9. Spin down the sample. Place the tube on a magnetic rack and wait 5 min until the solution is completely clear. 10. Discard the supernatant (99.5%). 6. For optimal DNA recovery, wait 5 min after adding the preheated (65  C) Tris–HCl buffer (e.g., EB Buffer from Qiagen) to the column before spinning. 7. 14/16/18/20 cycles can be used for RRBS starting with less than 15 ng DNA. 8. In our conditions, we usually choose two cycles below the first cycle that generates a detectable signal on the gel (see Fig. 2). If

Genome-Wide Bisulfite Sequencing from Low Amounts of DNA

219

the protocol works well, 12 cycles are sufficient when starting with 100 ng DNA, and no more than 18 cycles should be used when starting with 5 ng DNA. 9. We usually use 24 μL out of the 40 μL of converted DNA for the final PCR and keep the rest as a backup. However, in the case of very small amounts of starting DNA, it is recommended to use the 40 μL in the final PCR and adjust the volume of H2O in the PCR mix accordingly. 10. We did not test the Qiagen EpiTect Bisulfite Kit for WGBS libraries. 11. The experiment can be stopped at this point by storing the DNA at 20  C for up to 1 week. 12. For each step of the Accel-NGS Methyl-Seq DNA Library Kit, thaw enzymes on ice 10 min before use. 13. Mix well enzyme Y2 by pipetting up and down before use. 14. We recommend four and seven cycles when the amount of starting DNA is 50–100 ng and seven and ten cycles when the amount of starting DNA is 99% efficiency (germ cell purity). 2. For isolation of germ cells using the Oct4-EGFP reporter mouse line, access to a fluorescence-activated cell sorting (FACS) instrument and knowledge about its operation, or access to a facility that can provide the know-how as a service are required. There are alternative methods to isolate germ cells such as magnetic-activated cell sorting (MACS) using antibodies against surface antigens such as CD115 (SSEA-1) or E-cadherin. However, these methods generally do not isolate germ cells to a purity that is high enough to claim genomewide profiles of chromatin to be specific of germ cells. If one opts for such approaches, we strongly advise validation of germ cell purity before proceeding with CUT&RUN, library preparation, and sequencing. 3. Experiments involving live animals must be approved by an animal welfare committee according to the current legislation of the region in which the experiments are taking place. We use male studs that are homozygous for the Oct4-EGFP reporter allele to obtain timed pregnancies for collection of embryonic germ cells. The morning when a mating is confirmed is timed as 0.5 days post coitum (dpc). 4. Recombinant Protein A-Protein G hybrid (pA/G) fused to micrococcal nuclease (MNase); pA/G-MNase can be obtained by bacterial expression using the expression vector provided by Addgene (Plasmid #123461). We perform recombinant expression and purification essentially as recommended by the Ni-NTA Spin Columns Kit (Qiagen). 5. We normally collect cells in low-binding 1.5 ml tubes adapted into the FACS collection tubes placed under the FACS stream. If a setup for adapting 1.5 ml tubes is not available on your sorter, a standard FACS collection tube cut in appropriate height serves this purpose well. It is important to make sure collection tubes are aligned with the stream to prevent cells from breaking when crashing into the walls of the tube. We advise to test the stream alignment with an empty collection tube before sorting your samples. 6. 30 μl of Concanavalin A-coated magnetic beads binds in excess to all the germ cells sorted from one male embryo at stages between 13.5 and 18.5 days post coitum (dpc). If performing CUT&RUN on more embryos, scale up accordingly. Germ cells from earlier stages collected in lower number can be

262

Srinivasa Abishek Prakash and Joan Barau

bound to 15 μl instead. We do not recommend using less than 15 μl on CUT&RUN in 1.5 ml tubes because if samples are split into multiple profiles, visual inspection of bead magnetic separation becomes more difficult to follow throughout all the steps. 7. Throughout the protocol, several steps of “briefly spin down liquid” are included to remove the liquid-bead droplets in the walls and lids of tubes. These steps are usually performed using a tabletop “personal” microcentrifuge by placing the tubes and closing the lead for around 1 s. It is important to avoid strong and long-lasting centrifugal forces on the beads as this stress can break attached cells and nuclei, leading to loss of material and releasing all undigested DNA into solution. 8. The usual high signal over low background of CUT&RUN allows robust genome-wide profiling of chromatin from hundreds of cells. It is possible to split the germ cells isolated from a single embryo into different tubes, each one to be used downstream in the genome-wide chromatin profiling of a different target (e.g., a different primary antibody). We found that with the losses accounted for during and post FACS isolation, CUT&RUN libraries have optimal diversity when the experiment is done starting from 1500 to 2000 cells or more. If multiple profiles are to be done in germ cells of a single embryo, we recommend splitting in multiples of these numbers. Lower numbers are also possible, albeit at an increase of sequencing costs and effort due to higher proportion of duplicated reads that are normally discarded. As a guide, using the Oct4-EGFP reporter mouse line, usually from 6000 to 20,000 germ cells are typically isolated by FACS from a single male embryo at stages between 13.5 and 18.5 days post coitum (dpc). The numbers are similar for early meiotic germ cells in females around 13.5–15.5 dpc. Smaller number of primordial germ cells can also be obtained from 9.5 to 12.5 dpc in both sexes. Recovery also strongly depends on the method chosen for dissection and dissociation of genital ridges and gonads. 9. Optimal antibody dilution will depend on the abundance of target epitopes, number of cells, and antibody concentration and batch. Dilutions stay within the range normally used for immunofluorescence (a “default” 1:100–1:200 is recommended). We also recommend antibody dilution and specificity to be tested in advance by immunofluorescence. 10. We usually add pA/G-MNase to a final concentration of 1 μg/ ml. An appropriate dilution will depend on the batch of purified recombinant pA/G-MNase in use. pA/G-MNase is usually used in excess without affecting the protocol as unbound,

Low Germ Cell Number CUT&RUN

263

inactive fusion protein is removed by washes and activation is done later in a controlled manner. 11. To prevent overdigestion and preliminary release of chromatin monomers bound by pA/G-MNase tubes, the solution should be stably maintained at 0  C. The best way to achieve that is by making sure tubes are kept in a wet ice bucket (compact, stable mixture of ice and water). An aluminum rack inserted into wet ice that has been equilibrated to 0  C can also be used. 12. The default digestion time is 30 min. If the desired target is found to generate increased background signal, reduce the digestion time. If specific signal is found to be too low, digestion time can be increased. 13. At this point the protocol can be stopped by storing the supernatants frozen at 20  C for later DNA extraction. 14. We found that one phenol:chloroform:isoamyl alcohol in Phase Lock Gel tubes that allow complete isolation of the phenolic phase and maximum recovery is enough to obtain a clean sample for library preparation. 15. At this point the DNA can be stored frozen at 20  C for later library preparation. 16. A shorter extension time favors the amplification of the smaller, specific DNA fragments over unspecific large molecular weight DNA that is carried over during the final steps of CUT&RUN [15]. We typically use a combined single step of 10-s annealing and extension at the optimal temperature for the primers being used for library amplification.

Acknowledgments We would like to thank Franc¸ois Dossin (Heard lab, EMBL Heidelberg) for advice on CUT&RUN modifications, Martin Mo¨ckel (Protein Expression Facility, IMB Mainz) for advice and technical help, and Violeta Morin for comments on the protocol. This work was supported by the Genomics, FACS, and Animal Core Facilities of the Institute of Molecular Biology in Mainz. References 1. Schmid M, Durussel T, Laemmli UK (2004) ChIC and ChEC; genomic mapping of chromatin proteins. Mol Cell 16:147–157. https:// doi.org/10.1016/j.molcel.2004.09.007 2. Skene PJ, Henikoff S (2017) An efficient targeted nuclease strategy for high-resolution mapping of DNA binding sites. Elife 6:1–35. https://doi.org/10.7554/eLife.21856

3. Zhang W, Chen Z, Yin Q et al (2019) Maternal-biased H3K27me3 correlates with paternal-specific gene expression in the human morula. Genes Dev 33:382–387. https://doi.org/10.1101/gad.323105.118 4. Uyehara CM, McKay DJ (2019) Direct and widespread role for the nuclear receptor EcR in mediating the response to ecdysone in

264

Srinivasa Abishek Prakash and Joan Barau

Drosophila. Proc Natl Acad Sci U S A 116:201900343. https://doi.org/10.1073/ pnas.1900343116 5. Ernst C, Eling N, Martinez-Jimenez CP et al (2019) Staged developmental mapping and X chromosome transcriptional dynamics during mouse spermatogenesis. Nat Commun 10:1251. https://doi.org/10.1038/s41467019-09182-1 6. Zheng X, Gehring M (2019) Low-input chromatin profiling in Arabidopsis endosperm using CUT&RUN. Plant Reprod 32:63–75. https://doi.org/10.1007/s00497-01800358-1 7. Oomen ME, Hansen AS, Liu Y et al (2019) CTCF sites display cell cycle-dependent dynamics in factor binding and nucleosome positioning. Genome Res 29:236–249. https://doi.org/10.1101/gr.241547.118 8. Park SM, Cho H, Thornton AM et al (2019) IKZF2 drives leukemia stem cell self-renewal and inhibits myeloid differentiation. Cell Stem Cell 24:153–165.e7. https://doi.org/10. 1016/j.stem.2018.10.016 9. Thakur J, Henikoff S (2018) Unexpected conformational variations of the human centromeric chromatin complex. Genes Dev 32:20–25. https://doi.org/10.1101/gad. 307736.117 10. Liu N, Hargreaves VV, Zhu Q et al (2018) Direct promoter repression by BCL11A controls the fetal to adult hemoglobin switch. Cell 173:430–442.e17. https://doi.org/10.1016/ j.cell.2018.03.016 11. Hainer SJ, Bosˇkovic´ A, McCannell KN et al (2019) Profiling of pluripotency factors in

single cells and early embryos. Cell 177:1319–1329.e11. https://doi.org/10. 1016/j.cell.2019.03.014 12. Derek Janssens SH (2019) CUT&RUN: targeted in situ genome-wide profiling with high efficiency for low cell numbers. Protocols.io. https://www.protocols.io/view/cut-amprun-targeted-in-situ-genome-wide-profilingzcpf2vn/metadata. Accessed 1 Oct 2019 13. Zhu Q, Liu N, Orkin SH, Yuan G-C (2019) CUT&RUNTools: a flexible pipeline for CUT&RUN processing and footprint analysis. Genome Biol 20:192. https://doi.org/10. 1186/s13059-019-1802-4 14. Meers MP, Bryson TD, Henikoff JG, Henikoff S (2019) Improved CUT&RUN chromatin profiling tools. Elife 8:e46314. https://doi. org/10.7554/eLife.46314 15. Skene PJ, Henikoff JG, Henikoff S (2018) Targeted in situ genome-wide profiling with high efficiency for low cell numbers. Nat Protoc 13:1006–1019. https://doi.org/10. 1038/nprot.2018.015 16. Meers MP, Tenenbaum D, Henikoff S (2019) Peak calling by Sparse Enrichment Analysis for CUT&RUN chromatin profiling. Epigenetics Chromatin 12:42. https://doi.org/10.1186/ s13072-019-0287-4 17. Spiller CM, Burnet G, Bowles J (2017) Mouse fetal germ cell isolation and culture techniques. In: Methods in molecular biology. Humana, New York, pp 173–183 18. Meers MP, Bryson TD, Henikoff JG, Henikoff S (2019) Improved CUT&RUN chromatin profiling tools. Elife 8:1–16. https://doi.org/ 10.7554/elife.46314

Chapter 18 DamID to Map Genome-Protein Interactions in Preimplantation Mouse Embryos Mrinmoy Pal, Jop Kind, and Maria-Elena Torres-Padilla Abstract Investigating the chromatin landscape of the early mammalian embryo is essential to understand how epigenetic mechanisms may direct reprogramming and cell fate allocation. Genome-wide analyses of the epigenome in preimplantation mouse embryos have recently become available, thanks to the development of low-input protocols. DNA adenine methyltransferase identification (DamID) enables the investigation of genome-wide protein-DNA interactions without the requirement of specific antibodies. Most importantly, DamID can be robustly applied to single cells. Here we describe the protocol for performing DamID in single oocytes and mouse preimplantation embryos, as well as single blastomeres, using a Dam-LaminB1 fusion to generate high-resolution lamina-associated domain (LAD) maps. This low-input method can be adapted for other proteins of interest to faithfully profile their genomic interaction, allowing us to interrogate the chromatin dynamics and nuclear organization during the early mammalian development. Key words Mouse embryo, Low-input DamID, Single-cell genomics, LADs, Nuclear organization

1

Introduction Unveiling the features and mechanisms behind nuclear organization at the earliest stages of mammalian embryogenesis is essential to understand how the parental genomes are reprogrammed to establish totipotency. In the mouse, the two gametes correspond to very different architectures, in terms of their genome packaging. The sperm is mostly devoid of histones, and the paternal DNA is packaged in a highly compacted configuration through interactions with protamines. In contrast, the oocyte contains histones, which have accumulated a number of histone modifications during oocyte growth. After fertilization, an extensive chromatin remodeling process ensues, which involves changes in histone modifications, de novo deposition of histone variants, transcriptional activation of retrotransposons, but also changes in the 3D genome.

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_18, © Springer Science+Business Media, LLC, part of Springer Nature 2021

265

266

Mrinmoy Pal et al.

The position of the genome within the 3D nuclear space has emerged as a key epigenetic feature [1–3]. The association with the nuclear lamina, the primary scaffold of the nuclear envelope, is a hallmark of nuclear organization. In higher eukaryotes, chromatin in the proximity of the nuclear lamina tends to be more heterochromatic and gene-poor [4, 5]. These domains are referred to as lamina-associated domains (LADs), ranging in size of 10 kb–10 Mb in mammalian cells (~0.5 Mb median), and display distinctive genomic features. Globally, genes within LADs tend to be lowly expressed, while genes located within the inner nuclear space or inter-LADs (iLADs) display in general much higher transcriptional activity [4–6]. During the last few years, genomic approaches applied to in vivo mouse embryos have enabled us to revisit our molecular understanding of embryonic chromatin [7–13]. However, these approaches have only recently become available, mainly because of the specialist skills required to manipulate the embryo but, most importantly, because of the scarcity of the material available. Low-input methods to investigate the molecular makeup and 3D organization of the chromatin are therefore a valuable tool. Among them, the development of a robust single-cell protocol for DamID was pioneering [14]. This method is based on the ability of the Escherichia coli DNA adenine methyltransferase (Dam) to methylate adenines at the N6 position (m6A) within GATC motifs [15]. Because endogenous m6A methylation is practically undetectable across most eukaryotes, the methylation catalyzed by ectopic Dam can be identified based on a methylation-sensitive restriction enzyme and the subsequent amplification and sequencing of the methylated genomic DNA. Dam can be tethered to, e.g., a nuclear region of interest by expressing low amounts of a fusion protein between Dam and a component of the nuclear lamina. Indeed, DamID has been used to map interactions of specific proteins, or nuclear compartments, and the genome of several eukaryotes, including C. elegans [16], Drosophila [17], but also mammalian cells [4, 5]. In fact, a considerable amount of our knowledge on LADs stems from DamID using a LaminB1 fusion protein. As mentioned above, DamID for LaminB1 has been successfully adapted to single cells and can be used for readouts of imaging, using an innovative m6A-tracer fused to a fluorescent reporter [18], or also of next-generation sequencing [14]. In this chapter, we provide a detailed protocol for performing DamID in preimplantation mouse embryos. We have used this protocol to map LADs in mouse oocytes and embryos [19], but we propose that it can be easily amenable to try with other fusion proteins. Globally, the protocol involves four parts. The first one concerns embryo manipulation, including dissection, microinjection and mRNA production, culture, and collection. The second one includes all the molecular biology steps necessary to produce

DamID in Mouse Embryos

267

high-quality DamID libraries. The third one includes the sequencing protocol and pipelines. Lastly, bioinformatic analyses can be performed to address a number of different questions. Because the sequencing protocols are rather universal based on standard sequencer equipment and bioinformatic methods have been described elsewhere [14], we only provide a brief overview of the third and fourth parts. Most of the chapter is therefore focused on the implementation of the first two parts of the DamID pipeline. While we have optimized all the above steps for LaminB1 fusions, the protocol may be used for other fusions to interrogate interactions between the genome and other proteins of interest. The main limitation toward this goal can be the natural residence timing of the protein of interest on its target DNA, which may or may not enable efficient methylation. From an experimental viewpoint, using alternative fusion proteins will only require further optimization of the critical steps, which in our view would be (1) optimal concentrations of Dam-fusion (typically DamID experiments are performed under very low concentrations of Dam to avoid nonspecific methylation), (2) determining the optimal time to enable DNA methylation by the Dam-fusion of interest, and (3) determining optimal amplification conditions for library preparation, which may vary depending on the extent of Dam methylation achieved by the fusion of interest.

2 2.1

Materials Hardware

1. Microinjection system. 2. CO2 incubator with active humidification. 3. Benchtop centrifuge with tube and plate rotors. 4. Nucleic acid spectrophotometer such as NanoDrop™. 5. Conventional gel electrophoresis equipment. 6. Real-time thermal cycler with 96-well plate format. 7. Thermal cycler with 96-well plate format. 8. Fluorometer such as Qubit. 9. Automated electrophoresis system such as Bioanalyzer or TapeStation. 10. (Access to a facility providing) Illumina sequencer. 11. Optional: UV PCR workstation. 12. Optional: liquid-handling robot (e.g., Nanodrop II).

2.2 Plasmid Constructs and mRNA Preparation

1. pRN3P-m6A-Tracer-EGFP (Addgene plasmid 139403): Insert codes for m6A-Tracer-EGFP fusion protein. m6A-Tracer is a C-terminal fragment of DpnI enzyme that specifically recognizes and binds Gm6ATC.

268

Mrinmoy Pal et al.

2. pRN3P-HA-AID-Dam-LaminB1: Insert codes for E. coli DNA adenine methyltransferase (Dam) fused with murine LaminB1 protein. The fusion protein also contains a HA-tag and an auxin-inducible degron (AID) allowing conditional control of protein stability. 3. pRN3P-HA-AID-Dam-only (Addgene plasmid 136065): Insert ORF codes for HA-tagged DNA adenine methyltransferase which contains an AID domain. 4. pRN3P-TIR1–3
Myc (Addgene plasmid 119766): Insert codes for a 3
Myc-tagged plant auxin receptor called transport inhibitor response 1 (TIR1). 5. pRN3P-mbEGFP (Addgene plasmid 139402): Insert codes for a membrane-targeted GAP43-EGFP fusion protein. 6. SfiI enzyme plus 10
CutSmart buffer. 7. Sodium dodecyl sulfate (SDS): 20% SDS prepared in Milli-Q water. 8. Proteinase K: 20 mg/mL stock aliquots stored at 20  C. 9. TE: 10 mM Tris–HCl pH 7.5 with 1 mM EDTA prepared in nuclease-free water. 10. In vitro transcription kit (e.g., mMESSAGE mMACHINE T3 Transcription Kit). 2.3 Embryo and Oocyte Manipulation and Collection

1. Pregnant mare serum gonadotropin (PMSG) and human chorionic gonadotropin (hCG) 100 IU/mL (store aliquoted at 20  C). 2. M2. 3. BSA-free M2. 4. Calcium-free M2. 5. M16. 6. Paraffin oil (embryo tested). 7. 3-Isobutyl-1-methylxanthine (IBMX): 200 mM stock prepared in DMSO. 8. 0.5% pronase: diluted in M2 and stored at 20  C. 9. K-modified simplex optimized medium (KSOM). 10. 500 μM Indole-3-acetic acid (IAA): prepared in KSOM (see Note 1). 11. Fluorospheres. 12. 35 mm dish. 13. 8-well PCR strips. 14. DamID buffer: 10 mM Tris acetate pH 7.5, 10 mM magnesium acetate, and 50 mM potassium acetate.

DamID in Mouse Embryos

2.4 Single-Cell DamID and Next-Generation Sequencing

269

1. 3
Lysis buffer: 10 mM Tris acetate pH 7.5, 10 mM magnesium acetate, 50 mM potassium acetate, 2% Tween-20, 2% IGEPAL CA-630, and freshly added 2 mg/mL Proteinase K. 2. DpnI enzyme plus 10
CutSmart buffer. 3. T4 DNA ligase (5 U/μL) plus buffer. 4. 50 μM DamID double-stranded adapter: Dissolve Adapter_top and Adapter_bottom to 100 μM in annealing buffer, and then mix equal volumes of both oligonucleotides in a tightly closed tube. Place tube in a container with boiling water and let cool to room temperature to allow slow annealing of adapters. Adapter_top 50 CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGA 30 Adapter_bottom 50 TCCTCGGCCGCG 30 5. Annealing buffer: 100 mM potassium acetate and 30 mM HEPES pH 7.5. 6. 25 μM barcoded PCR primers: 50 CODGTGGTCGCGGCCGAGGATC 30 .

NNNNNNBAR-

7. PCR mix (e.g., MyTaq red reaction mix). 8. SPRI beads. 9. Spin column purification kit. 10. End-It DNA End-Repair Kit. 11. Klenow fragment (30 !50 exo-). 12. Kit for library preparation (onto DNA fragments) (e.g., TruSeq Nano DNA LT library kit).

3

Methods

3.1 Considerations for the Experimental Design

The experimental DamID design involves the expression of a fusion protein of interest and the untethered Dam enzyme as a control. For single-cell DamID (scDamID), the Dam-fusion and the untethered enzyme cannot be simultaneously expressed in the same cell, yet the information obtained from untethered Dam expression can be used to normalize/control for intrinsic Dam methylation activity. Detection of nonspecific contacts will result in interaction profiles that are very similar to profiles obtained with the untethered Dam. As Dam marks primarily open chromatin regions, it also provides reliable insight into single-cell chromatin accessibility [19, 20] (see Note 2). DamID involves the in vivo expression of the Dam-fusion protein over a period of time, and therefore protein-DNA interaction represents cumulative interaction profiles of all contacts that occurred within the chosen time frame. This is fundamentally different from methods like chromatin immunoprecipitation

270

Mrinmoy Pal et al.

(ChIP) that records only snapshots of current chromatin states. Therefore, it is important to control for the time window in which the lamina-DNA interactions are recorded. Here we used the AID/TIR1 degron system because of the rapid induction upon auxin washouts [21]. An important consideration for determining the time of induction is that, on the one hand, enough time is allowed for sufficient m6A methylation for single-cell detection, yet on the other hand, the induction should not exceed, e.g., the duration of one interphase (see Note 3). Another consideration is that upon DNA replication the DamID-mark goes undetected due to the inability of DpnI to digest hemimethylated DNA. Sufficient time should therefore be allowed for the restoration of the fully methylated m6A state in G2 phase (which is recommended), or cells should be harvested prior to the initiation of DNA replication at G1/S phase. Time windows of Dam-methylation should therefore be carefully chosen depending on the embryonic stage of interest. In our experience, 4–6 h of Dam expression is sufficient to obtain robust methylation profiles. Optimizing the concentration of mRNA for injections is crucial. The first step in optimizing this condition involves DamID amplifications of embryos injected with mRNA concentration series, followed by gel electrophoresis of 8 μL of DamID PCR products (of a 50 μL reaction), to verify smear intensity and distribution of fragment size. For a typical successful scDamID experiment, a clearly visible smear is expected to appear within 25–30 cycles of PCR (see Fig. 3 for an example). Non-injected embryos serve as important PCR amplification controls. Of the experimental conditions that meet this criterion, Illumina sequencing can be performed to obtain information on overall sample quality. For Dam-LaminB1, the genomic profiles are expected to differ from the untethered Dam control and display a genomic organization in large Mb-scale continuous stretches of m6A enrichment. Such parameters can be assessed by computing autocorrelation (ACF) scores of consecutive genomic regions (e.g., 100 kb bins) and determining the length of runs of continuous stretches of m6 A enrichment on binarized DamID-scores (for details on both methods, see ref. 20). Additionally, a very simple metric to assess the quality of a dataset is to determine the enrichment of m6A reads in target regions (e.g., LADs) over nontarget regions. For the latter, some a priori knowledge about the expected characteristics of the respective interaction profiles is required. 3.2 mRNA Preparation

1. Linearize the plasmids by SfiI enzyme so that T3 promoter site is upstream of the sequences to be transcribed. Prepare reactions with 10 μg of plasmid DNA, 5 μL of 10
CutSmart buffer, and 5 μL of SfiI enzyme, and make up the volume to 50 μL with water.

DamID in Mouse Embryos

271

2. Incubate overnight at 50  C. 3. Assess complete digestion of plasmid DNA using gel electrophoresis. 4. Eliminate SfiI and possible RNase, by subjecting the sample to Proteinase K treatment. To 50 μL of reaction mixture, add of 50 μL water, 2 μL of 20 mg/mL Proteinase K, and 2.5 μL of 20% SDS. 5. Incubate at 37  C for 50 min. 6. Heat-inactivate Proteinase K at 72  C for 10 min. 7. Purify linearized plasmid by phenol-chloroform extraction followed by ethanol precipitation, and resuspend pellet in 20 μL of RNase-free TE. 8. Use 1 μg of linearized plasmid to perform in vitro transcription following manufacturer’s instructions of the chosen kit. 9. Purify mRNA by LiCl precipitation to remove unincorporated nucleoside triphosphates and other impurities. Resuspend pellet in 10 μL of RNase-free TE. 10. Assess RNA quality by running it on a freshly prepared 1% agarose gel. Incubate RNA at 70  C for 10 min to resolve secondary structure, and chill on ice before loading. Quantitate using a NanoDrop or alike. 11. Prepare the mRNA mix as described below and store aliquots at 80  C. We typically do not reuse injection mixtures, but fresh aliquots can be stored at 80  C for years. The membrane GFP mRNA is encoded by a GAP43–EGFP cDNA, which contains a dual palmitoylation sequence and serves as a positive control for microinjection, so that only GFP-positive embryos are collected for downstream DamID. An alternative reporter for controlling microinjection can be used. mRNA mix for AID-Dam-LaminB1 injections (see Fig. 1): l

100 ng/μL membrane-EGFP

l

250 ng/μL TIR1

l

150 ng/μL m6A-tracer

l

AID-Dam-LaminB1 – 5 ng/μL for oocyte or zygote collection – 10 ng/μL for 2-cell collection – 20 ng/μL for 8-cell collection – 100 ng/μL for blastocyst collection mRNA mix for AID-Dam-Only injections (see Fig. 1):

l

100 ng/μL membrane-EGFP

l

250 ng/μL TIR1

272

Mrinmoy Pal et al.

Fig. 1 Schematic of embryo manipulation and collection according to developmental stages. Culture media, recommended concentration of Dam-LaminB1 or Dam-only in the mRNA mixture, the timings of microinjection, auxin washout (through IAA removal), and embryo collection for DamID are indicated l

150 ng/μL m6A-tracer

l

AID-Dam-Only – 20 ng/μL for oocyte or zygote collection – 20 ng/μL for 2-cell collection – 40 ng/μL for 8-cell collection – 100 ng/μL for blastocyst collection

DamID in Mouse Embryos

3.3 Embryo Microinjection and Culture

273

Mate 5–8-weeks-old F1 (CBA
C57BL/6J) females with CAST/ EiJ males for hybrid crosses (see Note 4) and with F1 males for non-hybrid crosses. Induce superovulation by intraperitoneal injection of 10 IU of PMSG and hCG 46–48 h later. Culture oocytes or embryos in a 37  C, 5% CO2 incubator in appropriate media drops covered with paraffin oil prepared on a 35 mm dish. In all embryonic stages from the 2-cell stage, we control DamID temporally, with the addition of auxin, which is done at different times, as described below. See Fig. 1 for a schematic summary of the embryo manipulation and collection process. 1. For DamID in oocytes: Isolate GV oocytes 44–48 h after PMSG injection and microinject the mRNA mix. Culture the oocytes in M16 supplemented with 200 μM IBMX. Collect 6–8 h after microinjection. 2. For DamID in zygotes: Obtain early zygotes 20 h post hCG upon natural matings and microinject. Culture zygotes in KSOM drops. Collect at 26–28 h post hCG. 3. For DamID in 2-cell stage embryos: Inject late zygotes collected at 26–28 h post hCG. Culture them in KSOM containing 500 μM IAA. Wash out (see Note 5) IAA at 40–42 h post hCG and culture them in KSOM drops for 6–8 h before collection. 4. For DamID in 8-cell stage embryos: Inject both blastomeres of late 2-cell embryos harvested 46–48 h post hCG and culture in IAA-containing media. Wash out auxin at 64–66 h post hCG, and collect the 8-cell stage embryos around 72–74 h post hCG. 5. For DamID in blastocysts: Microinject four-cell embryos (at least two blastomeres) collected at 60–62 h post hCG. Wash out IAA at 90–92 h post hCG when blastocysts start to caveat and collect embryos after 6–8 h.

3.4 Embryo Collection

3.4.1 For Oocyte Collection

Place 3 mL of DamID buffer into an agar-coated 35 mm dish and keep it at room temperature. Prepare 8-well PCR strips with 2 μL of DamID buffer per tube (see Note 6). 1. Remove zona pellucida by incubating the GV oocytes with 0.5% pronase prepared in M2 for 10 min at 37  C. 2. Transfer the oocytes to the agar-coated dish containing DamID buffer. 3. Take up oocyte(s) just to the tip of a new glass capillary and place into the 8-well PCR strip. 4. Keep full 8-well PCR strips on ice and freeze them at 80  C until downstream processing.

274

Mrinmoy Pal et al.

3.4.2 For Collection of Zygotes, 2-Cell and 8-Cell Stage

1. Remove zona pellucida by treating the embryos with 0.5% pronase prepared in M2 for 10 min at 37  C. 2. Wash the embryos through calcium-free M2 and incubate for 5 min. Mechanically separate the polar bodies from the embryos with a thin glass capillary by pipetting up and down in calcium-free M2. If single blastomere DamID is performed, mechanical dissociation of individual blastomeres is performed at this step and in the same calcium-free M2 medium, but using an appropriate glass pipette depending on the size of the blastomeres. 3. After removing the polar bodies, transfer the embryos or single blastomeres to the agar-coated dish containing DamID buffer. 4. Take up embryo(s) or single blastomeres with new glass capillary and place into the 8-well PCR strip. 5. Freeze the 8-well PCR strips at 80  C and store until further processing.

3.4.3 For Blastocyst Collection

1. Remove zona pellucida by treating the embryos with 0.5% pronase containing M2 for 10 min at 37  C. Pronase treatment in blastocysts may be shorter, due to the natural thinning of the zona pellucida in embryos at later stages. 2. Incubate the embryos in BSA-free M2 containing 1:50 dilution of Fluorospheres in order to label the trophectoderm (TE) (outer layer of cells). Wash out residual Fluorospheres after 2 min. Do not over-incubate; otherwise, labeling of inner cell mass (ICM) may also occur. 3. Keep embryos in calcium-free M2 for 25 min and perform mechanical disaggregation by repeated mouth pipetting with a finely pulled glass pipette (see Note 7). A heated stage is preferred, in order to maintain the temperature at 37  C. If this is not available, performing the mechanical separations in small groups (two to three) of embryos is advised. 4. Separate Fluorosphere-positive TE cells from ICM cells under a fluorescent microscope (see Fig. 2). 5. Transfer the ICM cells to the agar-coated dish containing DamID buffer. Place them into the 8-well PCR strip using the tip of a fresh glass capillary and freeze them to store.

3.5 Processing Single Embryos or Single Blastomeres for DamID

Following the transfer of single embryos or single blastomeres into PCR strips or 96-well plates, all subsequent additive reactions are performed in the same well without cleaning the sample in between, to keep material loss at a minimum. All subsequent steps are performed at room temperature, unless otherwise specified. If available, using a multistep pipette or liquid-handling robot will highly decrease hands-on time and increase throughput.

DamID in Mouse Embryos

275

Fig. 2 Representative images showing labeling of inner and outer cells using Fluorospheres. Dissociated cells were imaged under green fluorescence (left panel) or bright-field (right panel). Arrowheads point to inner cells, as can be seen from the lack of fluorescence signal throughout the cell membrane

A decontaminated working environment, such as a UV PCR workstation, is advised. 1. Prepare an appropriate amount of 3
lysis buffer including freshly added Proteinase K, and keep on ice until dispensation. Per sample well, 1 μL of 3
lysis buffer is needed. 2. Dispense 1 μL of 3
lysis buffer per well, and centrifuge at 1000
g for 1 min to ensure the cells are at the bottom of the well. 3. Incubate plates at 42  C overnight to lyse cells and digest all proteins. 4. The next day, incubate plates at 80  C for 20 min to heat inactivate Proteinase K. 5. The plates can now be stored at 20  C until further downstream processing. 3.6 DamID: Amplification of Dam-Marked Genomic Fragments

Genomic DNA that has been methylated at GATC motifs is specifically digested, leaving blunt ends to which a universal adapter is ligated. Using barcoded primers that hybridize to this adapter, the methylated fragments are specifically enriched for by PCR. To avoid cross contamination, take care not to touch samples between wells or cause spill overs. 1. Add 6.9 μL of 1
CutSmart buffer and 0.1 μL of DpnI enzyme to prepare DpnI digestion mix. Dispense 7 μL of digestion mix to each well. 2. Incubate plates at 37  C for 8 h to digest methylated DNA. 3. Incubate plates at 80  C for 20 min to heat inactivate DpnI, and then cool on ice (see Note 8).

276

Mrinmoy Pal et al.

4. Assemble adapter ligation mix and add 10 μL of mix to each well. Adapter ligation mix per well: 9.7 μL of 1
T4 ligase buffer, 0.05 μL of 50 μM adapter, and 0.25 μL of T4 ligase (see Note 9). 5. Incubate plates at 16  C for 12–16 h. 6. Incubate plates at 65  C for 10 min to heat inactivate T4 ligase, and then cool on ice. 7. Add 2 μL of 25 μM cell-specific, barcoded PCR primer to each well. Take care because each barcoded primer corresponds to a single sample. 8. On ice, assemble PCR mix and add 28 μL of mix to each well. PCR mix per well: 28 μL of PCR buffer including polymerase (e.g. 10 μL of 5
MyTaq Red Reaction buffer, 0.5 μL of MyTaq polymerase, and 17.5 μL of nuclease-free water). 9. Run the assembled reactions in a thermocycler using the program as described: Step 72  C for 10 min

1 2

94  C for 1 min

65  C for 5 min

72  C for 15 min

3–6

94  C for 1 min

65  C for 1 min

72  C for 10 min

7–35

94  C for 1 min

65  C for 1 min

72  C for 2 min

When testing new uncharacterized samples, evaluate PCR product by agarose gel electrophoresis after 22 cycles, and adjust cycles as necessary. 10. Run 8 μL of PCR product on 1% agarose gel to check control samples, smear intensity, and distribution of fragment size. Include a 1 kb + DNA ladder. Run more or fewer cycles of PCR if necessary. See Fig. 3 for an example of DamID PCR result. 3.7 Preparation of Illumina Sequencing Libraries

The amplified product is multiplexed by pooling together all samples with different barcodes. The pools are subsequently cleaned by gel extraction. Gel extraction is desired because of a frequently observed contaminating product of low molecular weight that impacts on Illumina sequencing efficiency (see Fig. 4 for example of pooled samples containing the undesired PCR product). This PCR product is likely caused by the formation and amplification of double-stranded adapter concatemers. After gel extraction, the samples are additionally cleaned with a PCR purification spin column or bead purification step and further processed into libraries for deep sequencing.

Fig. 3 Representative examples of successful scDamID PCR amplifications of six blastomeres of the 2-cell stage and two negative (empty) controls. The lowmolecular-weight material is excess PCR primer

Fig. 4 Example of a successful removal of a common scDamID contaminating product followed by successful Illumina library preparation. On the left is a representative example of pooled scDamID samples prior to gel purification. Gel purification is required to remove the undesired product (indicated with an asterisks). To the right is an Illumina library with the desired molecular weight distribution and without the contaminating product

278

Mrinmoy Pal et al.

1. Evaluate PCR product on gel and estimate relative concentration of the different samples. 2. Pool barcoded samples together according to their estimated concentration; the aim is to generate a mixture with equal numbers of molecules across the samples (see Note 10). 3. Purify the pooled samples by gel extraction followed by PCR purification on spin columns or with SPRI beads (2
bead volume to sample), and elute in 30 μL of nuclease-free water. 4. Measure the concentration of purified PCR products by NanoDrop. 5. Of 300 ng purified PCR product, blunt the 30 or 50 overhanging ends in a 50 μL reaction according to DNA End-Repair Kit instructions. 6. Purify the DNA by PCR purification spin columns, and elute in 30 μL of nuclease-free water. 7. Add a 30 adenine to the DNA ends by incubation at 37  C for 30 min with Klenow (30 !50 exo-) (30 μL of DNA, 5 μL of 10
buffer, 0.1 μL of 100 mM dATP, 0.5 μL of enzyme, 14.4 μL of nuclease-free water) followed by heat inactivation at 75  C for 20 min. 8. Purify the DNA with SPRI beads (1.8
bead volume to sample), and elute in 25 μL of nuclease-free water. 9. Ligate the Illumina indexed Y-shaped double-stranded adapters (provided in the Illumina TruSeq Nano DNA LT library kit) by incubation at room temperature for 2 h (25 μL of DNA, 2.5 μL of double-stranded adapter, 0.5 μL of 5 U/μL T4 DNA ligase, 4 μL of 10
T4 ligase buffer, 8 μL of nuclease-free water) followed by heat inactivation at 65  C for 20 min. 10. Purify the DNA two times with SPRI beads of 1.8
bead volume to sample, followed by 1.2
bead volume to sample, and elute in 50 μL of nuclease-free water. 11. Perform PCR with 25 μL of the eluted DNA (25 μL of DNA, 10 μL of 5
MyTaq Red Reaction buffer, 0.5 μL of MyTaq polymerase, 1 μL 2.5 μM Illumina oligo mix and 13.5 μL of nuclease-free water) for upto nine PCR amplification cycles (94  C for 1 min; 94  C for 30 s, 58  C for 30 s and 72  C for 30 s for six to nine cycles, and 72  C for 2 min). 12. Run 8 μL of the PCR reaction mixture on 1% agarose gel to check smear intensity and distribution of fragment size. Include a 1 kb + DNA ladder. Adjust the number of cycles of PCR if necessary. 13. Purify the DNA by PCR purification spin columns first, followed by a final purification with SPRI beads (1.6
bead volume to sample), and elute in 25 μL of nuclease-free water.

DamID in Mouse Embryos

279

14. Measure the concentration of each library with a Qubit fluorometer, per manufacturer’s instructions. 15. Evaluate the fragment distribution of each library with an automated electrophoresis system such as Agilent Bioanalyzer or TapeStation. 16. For Dam-LaminB1 in embryos, sequence single end to a depth of approximately 500 K raw reads per single-cell sample. 17. Typically, for Illumina multiplex sequencing, four to ten libraries are combined in a single sequencing reaction. Each library consists of 20–50 single cells mixed in appropriate equimolar ratios judged from the agarose gel images. 3.8 Raw Data Processing and Visualization

4

Raw reads are demultiplexed by their library-specific index and by their sample-specific DamID barcode, after which the DamID primer sequence is removed and sequences are aligned to the reference genome. Reads per GATC are counted, summed across sequencing lanes, aggregated in genomic segments, and optionally smoothened for visualization. Dam methylation across the genome is typically calculated using either an “Observed over Expected (OE)” pipeline [14] based on methylation enrichment across genomic bins or an enrichment pipeline based on the log2 ratio of Dam-LaminB1 over Dam-Only [22].

Notes 1. Prepare 0.25 M stocks (500
) of IAA in water and store aliquots at 20  C for up to 2 years. Use one aliquot only once. 2. The preferential methylation of accessible chromatin regions by untethered Dam poses a challenge for Dam-protein fusions for which binding profiles are expected to overlap with open chromatin regions like promoters and enhancers and therefore resemble untethered Dam profiles. A potential solution could be the use of Dam mutants with reduced intrinsic activity and DNA affinity [23]. 3. Depending on the construct, the cell type and degron or induction system, timing of the protein stabilization/expression may need to be optimized. We have good experiences with inductions between 4 and 24 h. 4. Hybrid crosses are required to obtain parent-of-origin-specific information. Performing reciprocal crosses (mate CAST/EiJ females with F1 males) is recommended to confirm that the parent-of-origin-specific differences are not a result from a genetic bias derived from different strains. 5. Washing out the auxin involves moving the embryos through an uncovered drop of 500 μL KSOM without IAA followed by

280

Mrinmoy Pal et al.

wash through three to four drops of KSOM without IAA in a final dish. 6. During cell collection, it is recommended to include empty wells (0 cell) as negative control (see Fig. 3). 7. For mechanical disaggregation, the pipette tip should be flamepolished to remove any sharp edges, and the inner diameter should be almost half of the diameter of the embryo. 8. In conventional DamID, a digestion step with MboI is included to destroy and thereby avoid PCR amplification of fragments with unmethylated GATCs. We do not include this MboI digestion in scDamID, but it is not advised against per se. 9. Lowering the double-stranded adapter concentration from 0.2 μL [14] to 0.05 μL of 50 μM stock concentration helped in reducing this contaminant of embryo samples. It is possible that lowering the double-stranded adapter below 0.05 μL would reduce the contaminating product further without compromising for sample complexity. This has not been tested. 10. We recommend pooling multiple experimental conditions in the same library to avoid batch effects (or, at the very least, enable batch correction). Therefore, if the number of samples exceeds the number of available barcodes, take care to add barcodes to your samples such that multiple conditions can be pooled together. While one library per condition does facilitate future re-sequencing of particular samples, it is best practice not to pool in that manner until after you have established potential differences between experimental conditions.

Acknowledgments Work in the Torres-Padilla lab is funded by the Helmholtz Association, the German Research Council (CRC 1064), and H2020 Marie-Curie Actions ITN EpiSystem and ChromDesign. M.P. is funded through the ChromDesign ITN under the Marie Skłodowska-Curie grant agreement No 813327. J.K. is funded through ERC-Stg EpiID. The Oncode Institute is supported by KWF Dutch Cancer Society. We thank Adam Burton for providing the images shown in Fig. 2. References 1. Bonev B, Cavalli G (2016) Organization and function of the 3D genome. Nat Rev Genet 17:661–678. https://doi.org/10.1038/nrg. 2016.112 2. Hug CB, Vaquerizas JM (2018) The birth of the 3D genome during early embryonic

development. Trends Genet 34:903–914. https://doi.org/10.1016/j.tig.2018.09.002 3. Zheng H, Xie W (2019) The role of 3D genome organization in development and cell differentiation. Nat Rev Mol Cell Biol 20:535–550. https://doi.org/10.1038/ s41580-019-0132-4

DamID in Mouse Embryos 4. Guelen L, Pagie L, Brasset E, Meuleman W, Faza MB, Talhout W, Eussen BH, de Klein A, Wessels L, de Laat W, van Steensel B (2008) Domain organization of human chromosomes revealed by mapping of nuclear lamina interactions. Nature 453:948–951. https://doi.org/ 10.1038/nature06947 5. Peric-Hupkes D, Meuleman W, Pagie L, Bruggeman SWM, Solovei I, Brugman W, Gr€a f S, Flicek P, Kerkhoven RM, van Lohuizen M, Reinders M, Wessels L, van Steensel B (2010) Molecular maps of the reorganization of genome–nuclear lamina interactions during differentiation. Mol Cell 38:603–613. https://doi. org/10.1016/j.molcel.2010.03.016 6. Akhtar W, de Jong J, Pindyurin AV, Pagie L, Meuleman W, de Ridder J, Berns A, Wessels LFA, van Lohuizen M, van Steensel B (2013) Chromatin position effects assayed by thousands of reporters integrated in parallel. Cell 154:914–927. https://doi.org/10. 1016/j.cell.2013.07.018 7. Liu X, Wang C, Liu W, Li J, Li C, Kou X, Chen J, Zhao Y, Gao H, Wang H, Zhang Y, Gao Y, Gao S (2016) Distinct features of H3K4me3 and H3K27me3 chromatin domains in pre-implantation embryos. Nature 537:558–562. https://doi.org/10.1038/ nature19362 8. Zhang B, Zheng H, Huang B, Li W, Xiang Y, Peng X, Ming J, Wu X, Zhang Y, Xu Q, Liu W, Kou X, Zhao Y, He W, Li C, Chen B, Li Y, Wang Q, Ma J, Yin Q, Kee K, Meng A, Gao S, Xu F, Na J, Xie W (2016) Allelic reprogramming of the histone modification H3K4me3 in early mammalian development. Nature 537:553–557. https://doi.org/10.1038/ nature19361 9. Ke Y, Xu Y, Chen X, Feng S, Liu Z, Sun Y, Yao X, Li F, Zhu W, Gao L, Chen H, Du Z, Xie W, Xu X, Huang X, Liu J (2017) 3D chromatin structures of mature gametes and structural reprogramming during mammalian embryogenesis. Cell 170:367–381.e20. https://doi.org/10.1016/j.cell.2017.06.029 10. Flyamer IM, Gassler J, Imakaev M, Branda˜o HB, Ulianov SV, Abdennur N, Razin SV, Mirny LA, Tachibana-Konwalski K (2017) Single-nucleus Hi-C reveals unique chromatin reorganization at oocyte-to-zygote transition. Nature 544:110–114. https://doi.org/10. 1038/nature21711 11. Gassler J, Branda˜o HB, Imakaev M, Flyamer IM, Ladst€atter S, Bickmore WA, Peters J-M, Mirny LA, Tachibana K (2017) A mechanism of cohesin-dependent loop extrusion organizes zygotic genome architecture. EMBO J

281

36:3600–3618. https://doi.org/10.15252/ embj.201798083 12. Wu J, Xu J, Liu B, Yao G, Wang P, Lin Z, Huang B, Wang X, Li T, Shi S, Zhang N, Duan F, Ming J, Zhang X, Niu W, Song W, Jin H, Guo Y, Dai S, Hu L, Fang L, Wang Q, Li Y, Li W, Na J, Xie W, Sun Y (2018) Chromatin analysis in human early development reveals epigenetic transition during ZGA. Nature 557:256–260. https://doi.org/10. 1038/s41586-018-0080-8 13. Wang C, Liu X, Gao Y, Yang L, Li C, Liu W, Chen C, Kou X, Zhao Y, Chen J, Wang Y, Le R, Wang H, Duan T, Zhang Y, Gao S (2018) Reprogramming of H3K9me3dependent heterochromatin during mammalian embryo development. Nat Cell Biol 20:620–631. https://doi.org/10.1038/ s41556-018-0093-4 14. Kind J, Pagie L, de Vries SS, Nahidiazar L, Dey SS, Bienko M, Zhan Y, Lajoie B, de Graaf CA, Amendola M, Fudenberg G, Imakaev M, Mirny LA, Jalink K, Dekker J, van Oudenaarden A, van Steensel B (2015) Genome-wide maps of nuclear lamina interactions in single human cells. Cell 163:134–147. https://doi.org/10.1016/j.cell.2015.08.040 15. van Steensel B, Henikoff S (2000) Identification of in vivo DNA targets of chromatin proteins using tethered Dam methyltransferase. Nat Biotechnol 18:424–428. https://doi. org/10.1038/74487 16. Ikegami K, Egelhofer TA, Strome S, Lieb JD (2010) Caenorhabditis elegans chromosome arms are anchored to the nuclear membrane via discontinuous association with LEM-2. Genome Biol 11:R120. https://doi.org/10. 1186/gb-2010-11-12-r120 17. Pickersgill H, Kalverda B, de Wit E, Talhout W, Fornerod M, van Steensel B (2006) Characterization of the Drosophila melanogaster genome at the nuclear lamina. Nat Genet 38:1005–1014. https://doi.org/10.1038/ ng1852 18. Kind J, Pagie L, Ortabozkoyun H, Boyle S, de Vries SS, Janssen H, Amendola M, Nolen LD, Bickmore WA, van Steensel B (2013) Singlecell dynamics of genome-nuclear lamina interactions. Cell 153:178–192. https://doi.org/ 10.1016/j.cell.2013.02.028 19. Borsos M, Perricone SM, Schauer T, Pontabry J, de Luca KL, de Vries SS, RuizMorales ER, Torres-Padilla M-E, Kind J (2019) Genome–lamina interactions are established de novo in the early mouse embryo. Nature 569:729–733. https://doi.org/10. 1038/s41586-019-1233-0

282

Mrinmoy Pal et al.

20. Rooijers K, Markodimitraki CM, Rang FJ, de Vries SS, Chialastri A, de Luca KL, Mooijman D, Dey SS, Kind J (2019) Simultaneous quantification of protein–DNA contacts and transcriptomes in single cells. Nat Biotechnol 37:766–772. https://doi.org/10.1038/ s41587-019-0150-y 21. Nishimura K, Fukagawa T, Takisawa H, Kakimoto T, Kanemaki M (2009) An auxinbased degron system for the rapid depletion of proteins in nonplant cells. Nat Methods 6:917–922. https://doi.org/10.1038/ nmeth.1401

22. Marshall OJ, Brand AH (2015) damidseq_pipeline: an automated pipeline for processing DamID sequencing datasets. Bioinformatics 31:3371–3373. https://doi.org/10.1093/bio informatics/btv386 23. Szczesnik T, Ho JWK, Sherwood R (2019) Dam mutants provide improved sensitivity and spatial resolution for profiling transcription factor binding. Epigenetics Chromatin 12:36. https://doi. org/10.1186/s13072-019-0273-x

Chapter 19 Understanding Chromosome Structure During Early Mouse Development by a Single-Cell Hi-C Analysis Noe´mie Ranisavljevic, Maud Borensztein, and Katia Ancelin Abstract Over the past two decades, the development of chromosome conformation capture technologies has allowed to intensively probe the properties of genome folding in various cell types. High-throughput versions of these C-based assays (named Hi-C) have released the mapping of 3D chromosome folding for the entire genomes. Applied to mammalian preimplantation embryos, it has revealed a unique chromosome organization after fertilization when a new individual is being formed. However, the questions of whether specific structures could arise depending on their parental origins or of their transcriptional status remain open. Our method chapter is dedicated to the technical description on how applying scHi-C to mouse embryos at different stages of preimplantation development. This approach capitalized with the limited amount of material available at these developmental stages. It also provides new research avenues, such as the study of mutant embryos for further functional studies. Key words Single-cell Hi-C, 3D genome organization, Chromosome conformation capture, Mouse preimplantation embryo

1

Introduction The eukaryotic genome is tightly packaged in the nucleus, and its spatial organization preserves its functionality, notably at the level of gene expression regulation. Through direct visualization or thanks to the advent of chromosome conformation capture (3C) techniques, the folding of the genome has been extensively explored in numerous organisms, cell types, or specific tissues at late stages of development [1, 2]. Recently, the map of all the interaction contacts for whole genomes has been achieved using Hi-C approaches [3]. Altogether, new layers of chromosome organization have been described, some largely conserved between species and constant during cellular differentiation [4, 5]. Interestingly, the implementation of Hi-C down to the level of a single cell has uncovered the refine dynamic of chromosome arrangement

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_19, © Springer Science+Business Media, LLC, part of Springer Nature 2021

283

284

Noe´mie Ranisavljevic et al.

during the different phases of the cell cycle when the genomes undergo marked restructuration and condensation [6, 7]. Fertilization is another crucial step in genome remodeling, with the encounter of two very specialized cells, the oocyte and the sperm, that give rise to a new individual. From this initial process and until implantation, the newly fertilized egg—or zygote—undergoes extensive chromatin changes of the two parental genomes in order to proceed for further development [8]. Recently, single-nucleus Hi-C [9] as well as low-input Hi-C techniques [10, 11] were applied to study genome organization in oocytes, zygotes, and up to blastocysts. Despite some discrepancies between the reports, these works provide essential understanding in the unique dynamic of short- and long-range contacts contributing to the folding of early mouse chromosomes. However, the precise dynamic for the formation/disappearance of the different contacts, in link with allelic information and gene activity, is still largely unknown. Single-cell approaches not only overcome the issue of paucity of available materials but also allow selecting a posteriori during the analysis step. Cells undergoing mitosis and thus displaying the most of condensation and the least of discrete short-range contact (under 25 Mb) can be discriminated from the cells in interphase and with the most short-range contacts [7]. This can be used for building pseudo-bulk Hi-C maps with as much of short-range contacts as possible when one is interested in the interplay between chromosome folding and allelic origin, for example. In this chapter, we describe a step-by-step method to produce single-cell Hi-C data applied to preimplantation mouse embryos [12]. The pipeline used to analyze these scHi-C data is detailed in Chapter 20 of this book. We focus in particular on (a) how embryos are dissociated into single blastomeres for different stages of development and (b) an optimized procedure for Hi-C on these specific cells and divergent from the one for cells grown in culture [13]. Library preparation and sequencing can be achieved as previously described by Nagano et al. in mouse T helper cells [13].

2

Materials

2.1 Preimplantation Embryo Isolation and Manipulation

1. Petri dish 10 mm  35, sterile. 2. Tweezers for dissection (fine stainless steel Dumont #5). 3. Scissors (fine, stainless steel, dissection). 4. Binocular microscope with 100 magnification and heating stage. 5. Pasteur pipette with a pulled extremity; will be referred to as transfer pipette (see Fig. 1a).

Single Cell Hi-C in Mouse Preimplantation Embryos

285

Fig. 1 Equipment setup for embryo collection and single-cell picking. (a) Transfer pipette assembly: a small aspirator tube with a mouth adaptor is connected to a filter tip and a modified Pasteur pipette (the extremity is pulled to a diameter of approximately 150 μm with a right angle as shown in the zoom). (b) Thin glass capillaries between 50 and 100 μm are used to move single cell from one drop to another. (c) Presentation of the drop organization for the steps in Subheading 3.2

6. Aspirator tube assembly (see Fig. 1a). 7. M2 medium with HEPES, without penicillin and streptomycin, suitable for embryoculture. 8. Acidic Tyrode’s solution, suitable for embryoculture. 9. Hyaluronidase: 0.3 mg/ml in M2 medium. 2.2 Preimplantation Embryo Dissociation into Single Cells

1. Petri dish 10 mm  35, sterile. 2. Aspirator tube assembly with Pasteur pipette as depicted in the previous section. 3. Micropipette puller and microforge. 4. Thin glass capillaries (see Note 1 and Fig. 1b). 5. Adaptor for capillaries to fit on the aspirator tube assembly. 6. 1 PBS, pH 7.4. 7. Acetylated BSA solution: 1 mg/ml prepared in 1 PBS (see Note 2). 8. Binocular microscope with heating stage.

286

Noe´mie Ranisavljevic et al.

Table 1 Mix for calcium- and magnesium-free M2 culture medium STOCK A component (store at 4  C for 6 months maximum) NaCl 2.84 g KCl 0.178 g 0.081 g KH2PO4 Sodium lactate (60%, liquid) 2.175 g Glucose 0.5 g Penicillin G potassium 0.03 g Streptomycin sulfate 0.025 g Cell culture water 50 ml STOCK B component (store at 4  C for 6 months maximum) 1.051 g NaHCO3 Phenol red 0.002 g Cell culture water 50 ml STOCK C component (store at 4  C for 6 months maximum) Sodium pyruvate 0.036 g Cell culture water 10 ml

9. EGTA (powder). 10. BSA (lyophilized powder, suitable for cell culture). 11. Water, sterile-filtered, suitable for cell culture. 12. Calcium- and magnesium-free M2 culture medium is prepared as detailed in Table 1. To prepare 10 ml of the medium for single-cell dissociation, add 1 ml of STOCK A, 1 ml of STOCK B, and 0.1 ml of STOCK C with 2 mg of EGTA and 40 mg of BSA, to water (sterile-filtered, suitable for cell culture). Filter before use and store at 4  C for up to 3 weeks. 13. Highly purified recombinant cell dissociation enzyme solution (e.g., TrypLE). 14. Sterile filter unit and syringe. 15. Mineral oil, suitable for embryoculture. 2.3 Single-Cell Fixation, Digestion, Labeling, and Ligation

1. 16% formaldehyde solution. 2. 1 PBS, pH 7.4. 3. Water (molecular biology grade). 4. 2 M glycine: to prepare 1 ml of 2 M glycine, add 150 mg glycine (ultrapure, 75.07 MW) to water and mix well. 5. 20% NP-40 (also known as IGEPAL) solution (see Note 3). 6. 25 stock solution protease inhibitor cocktail (e.g., cOmplete EDTA-free tablets): one tablet is dissolved in 2 ml of water and aliquoted for storage at 20  C (see Note 4). 7. 20% SDS solution.

Single Cell Hi-C in Mouse Preimplantation Embryos

287

8. 20% Triton X-100 (see Note 5). 9. 5 U/μl MboI (in our hands, the one from New England Biolabs is suitable). 10. 10 NEBuffer 3. 11. 10 mg/ml BSA. 12. 100 mg/ml polyvinylpyrrolidone (PVP) solution. 13. 1.24 NEB 3 Buffer: for 1 ml add 124 μl of 10 NEBuffer 3 (10), 10 μl of 10 mg/ml BSA, 20 μl of PVP to 846 μl of water, and mix it well (see Note 5). 14. Fixation buffer: for 2 ml of fixation buffer, add 250 μl of 16% formaldehyde; 200 μl of 10 PBS; 40 μl of PVP to 1510 μl of water (see Note 5). 15. Quenching buffer: for 400 μl of quenching buffer, add 400 μl of fixation buffer and 25 μl of 2 M glycine (0.125 M final concentration). Chill the tube on ice. 16. Permeabilization buffer: 10 mM Tris–HCl, 10 mM NaCl, 0.2% (vol/vol) NP-40, 1 cOmplete EDTA-free final. To prepare a volume of 1 ml, add 10 μl of 1 M Tris–HCl (pH 8.0); 10 μl of 1 M NaCl; 10 μl of 20% NP-40; 10 μl of 10 mg/ml BSA to 920 μl of water. Then add 40 μl of cOmplete EDTA-free solution, mix it well, and chill the buffer on ice (see Notes 5 and 6). 17. 10 T4 DNA ligase reaction buffer (in our hands, the one from New England Biolabs is suitable). 18. 1 U/l T4 DNA ligase (in our hands, the one from Life Technologies is suitable). 19. Ligation mix: for 1 ml, add 100 μl of 10 T4 DNA ligase reaction buffer, 10 μl of 10 mg/ml BSA to 880 μl of water. Mix well and chill the tube on ice. Carefully add 10 μl of T4 DNA ligase just before adding the chilled mix to the cells. 20. 10 mM dCTP. 21. 10 mM dGTP. 22. 10 mM dTTP. 23. 0.4 mM biotin-14-dATP. 24. 5000 U/ml DNA polymerase I, large (Klenow) fragment (in our hands, the one from New England Biolabs is suitable). 25. Acetylated BSA solution: 1 mg/ml acetylated BSA prepared in 1 PBS (see Note 2). 26. Petri dish 10 mm  35, sterile. 27. Pasteur pipettes and/or thin capillary glasses. 28. Aspirator tube assemblies for calibrated microcapillary pipettes. 29. Silicone tubing (6.0 mm bore, 2.0-mm-thick wall).

288

Noe´mie Ranisavljevic et al.

30. Phase-contrast microscope. 31. Microfuge. 32. Thermomixer. 33. 1.5 ml tubes optimized for nucleic acid recovery in sample (e.g., DNA LoBind tubes). 34. PCR strips.

3

Methods In this section, we describe the different steps to obtain single cells from collected mouse preimplantation embryos and to process them through the Hi-C procedure until freezing. The following steps toward library preparation and sequencing are similar to the ones previously described for somatic cells [13]. In this protocol, it is highly recommended to only use freshly prepared solutions at each step, unless otherwise stated. Every single cell or embryo transfer is done under the binocular with a mouth pipette.

3.1 Preimplantation Embryo Collection, Manipulation, and Single-Cell Dissociation

1. Collect embryos in M2 medium as described [14], using a mouth aspirator device connected to a transfer pipette. 2. For zygote collection, remove cumulus cells by culturing embryos for a few minutes in hyaluronidase at room temperature. Help dissociation by pipetting the embryos up and down under the binocular microscope, and then rinse them in three drops of fresh M2 medium. 3. Transfer the embryos in acidic Tyrode’s solution at room temperature, and rinse them in two drops of fresh M2 as soon as the zona pellucida is removed. 4. Wash the embryos extensively in three drops of calcium- and magnesium-free M2 solution. 5. To remove the second polar body in zygotes or to isolate individual cells (blastomeres) in cleaved embryos, incubate embryos in calcium- and magnesium-free M2 medium for 5–30 min, depending on the embryonic stage (see Note 7). 6. Mechanically dissociate the embryos by mouth pipetting up and down with a thin glass capillary. 7. Wash single cells three times in acetylated BSA solution (see Note 2) before proceeding to scHi-C without delay.

3.2

Cell Fixation

For a good overview of the organization of the drops in the Petri dish, see Fig. 1c: 1. Prepare two 30–40 μl drops of fixation buffer on a Petri dish. 2. Transfer the cells quickly from acetylated BSA solution through the two drops of fixation buffer (see Note 8).

Single Cell Hi-C in Mouse Preimplantation Embryos

289

3. Fix for exactly 10 min at room temperature (see Note 9). 4. Prepare two 30–40 μl drops of ice-cold quenching buffer on a Petri dish. Transfer the cells quickly from fixation buffer to the first quenching buffer drop and then to the second (see Note 10). Chill the Petri dish on ice for 5 min (see Note 11). 5. Prepare three 30–40 μl drops of acetylated BSA solution on a Petri dish to wash. The third drop is contained within a circle made with a hydrophobic pen. Transfer the cells from quenching buffer to the first drop of acetylated BSA solution and then to the two consecutives drops, one after the other. At this step, the cells can be kept in acetylated BSA solution on ice if needed, without exceeding 3 h (e.g., to process a new batch of embryo/single-cell dissociation/fixation) (see Note 12). 3.3 Cell Permeabilization and First Restriction Digestion

1. Prepare two circles with the hydrophobic pen on the Petri dish, and fill them with two 30–40 μl drops of ice-cold permeabilization buffer. Transfer the single cells from acetylated BSA solution (see step 5 in Subheading 3.2) to the first drop of permeabilization buffer for rinsing and next to the second drop. 2. Incubate the cells for 30 min by placing the Petri dish on ice. Cover with a lid to reduce evaporation, and monitor that the drop containing the cells does not dry. 3. Prepare two circles with the hydrophobic pen on the Petri dish, and fill them with two 30–40 μl drops of 1.24 NEB3 buffer. Transfer the cells from permeabilization buffer to the first and then to the second drop (see Note 13). 4. Prepare a mix of 200 μl of 1.24 NEB3 buffer and 3 μl of 20% SDS in a DNA low-binding tube. Mix well (see Note 14). 5. Transfer the cells from the 1.24 NEB3 buffer drop (see step 3) to the low-binding tube. 6. Shake with a gentle agitation (e.g., at 550 rotation per minute (rpm) for a 3 mm mixing orbit) for 1 h at 37  C on a thermomixer. 7. Add 20 μl of 20% Triton X-100 (final concentration 1.8%, vol/vol), and shake at 550 rpm for 1 h at 37  C on a thermomixer (see Note 15). 8. Add 1250 U of MboI (25 μl of 25 U/μl solution), and shake at 550 rpm at 37  C on a thermomixer for 12–16 h (see Note 15).

3.4 Biotin Labeling and Hi-C Ligation

1. Add the following components to the sample as in Table 2 (see Note 14). 2. Shake at 550 rpm for 1 h at 37  C on a thermomixer. 3. Spin the tube at 500  g for 5 min at 4  C (see Note 16).

290

Noe´mie Ranisavljevic et al.

Table 2 Biotin labeling and Hi-C ligation mix Components

Amount per tube (μl)

Final concentration or units

dCTP, 5 mM

1.56

28.4 M

dGTP, 5 mM

1.56

28.4 M

dTTP, 5 mM

1.56

28.4 M

Biotin-14-dATP, 0.4 mM

19.5

DNA polymerase I, large (Klenow) fragment

5.2

28.4 M 50 U

4. Remove the supernatant, leaving ~50 μl. 5. Add the ligation mix. 6. Incubate the sample at 16  C for 4 h at 550 rpm on a thermomixer (see Note 17). 3.5 Single-Cell Isolation

1. Spin the tube at 500  g for 5 min at 4  C (see Note 16). 2. Remove the supernatant leaving ~50 μl, and resuspend the pellet with 100 μl of acetylated BSA solution using a large Pasteur pipette. 3. With the large Pasteur pipette, make several drops of acetylated BSA solution on a Petri dish with the cell suspension. 4. Under the microscope, collect all the single cells, and wash them in three drops of acetylated BSA solution by mouth pipetting. 5. Pick and isolate the single cells in PCR tubes (one cell/tube) with a minimum amount of liquid by mouth pipetting. Proceed rapidly for freezing at 80  C (after a quick spin if the drop is not at the bottom of the tube) (see Note 18).

4

Notes 1. Prepare thin glass capillaries with a micropipette puller, and cut them at about 80–100 μm in diameter with a microforge following manufacturer’s instructions. 2. To prepare 2 ml of acetylated BSA solution, add 100 μl of acetylated BSA (20 mg/ml) and 200 μl 10 PBS to 1700 μl of water. Mix well, filter the solution, aliquot and store at 20  C (200 μl per aliquot) for 1 year. 3. Freshly prepare the NP-40 solution on the day of the cell permeabilization. Make sure it is well mixed.

Single Cell Hi-C in Mouse Preimplantation Embryos

291

Table 3 Timing for incubation for single-cell dissociation Embryonic stage

Incubation time in calcium- and magnesium-free M2 medium

One-cell embryo

20–30 min (until the second polar body is detached)

Two-cell embryo

20 min

Four-cell embryo

10–15 min

Eight-cell embryo

5–10 min

Blastocyst

5 min in TrypLE instead of calcium-/magnesium-free medium

4. cOmplete EDTA-free solution can be stored at 20  C in 50 μl aliquots. Check the tablet expiration date and report it on the solution stored at 20  C. 5. Freshly prepare the solution on the day of the experiment. Mix well before use. 6. To prepare 500 ml of 1 M Tris–HCl (pH 8.0) buffer, add 60.75 g (121.14 MW) to water and add HCl to adjust the pH to 8. To prepare 500 ml of 1 M NaCl buffer, add 29.22 g (58.44 MW) to water. These solutions can then be kept at room temperature for months. 7. The first polar body is lost during zona pellucida removal. For two-cell stage embryos and onward, the second polar body is removed during single-cell dissociation. Below in Table 3 is given the approximate timing for incubation time in calciumand magnesium-free M2 culture medium to dissociate into single cells. 8. While using the mouth pipette to transfer cells from solution to solution, make sure to fill the pipette with the new solution and to use as little volume as possible to reduce carryover. Transferring the cells through at least two drops of the new solution allows reducing the carryover too. The same Petri dish may be used through the whole procedure. Make sure the drops do not mix or dry and are well identified if prepared in advance. 9. Follow the appropriate health and safety regulations to handle formaldehyde solution, as it is toxic. 10. When transferring cells through different solution drops, they might sometimes end up at the surface of the drop. Make sure to retrieve them all. 11. Using a foil sheet on ice allows a better transmission of the cold. 12. Use a lid for the Petri dish to reduce evaporating, and make sure the drop containing the cells does not dry. When processing smaller cells (such as 64-cell stage blastomeres), the size of

292

Noe´mie Ranisavljevic et al.

the drops can be reduced to 5 μl, and work should be performed under oil to avoid evaporation. 13. Cells tend to spin up to the surface of the drop when transferred from permeabilization to 1.24 NEB3 buffer. We recommend to transfer a small number of cells and to keep them in sight throughout the whole process. 14. 20% SDS is very corrosive: add it to the NEB3 buffer before adding the cells in order to homogenize it in the buffer as much as possible. 15. When adding a new solution to the tube containing the single cells, avoid pipetting up and down. Prefer depositing the new solution along the tube wall, and next transfer the tube on a mixer at low speed for gentle homogenization thereafter. 16. As cell number is low, prefer a centrifuge with a horizontal axis of rotation. If 1.5 ml tubes do not fit in the centrifuge, use a 50 ml Falcon filled with some paper to hold the 1.5 ml tube inside. 17. If needed, the incubation can be extended up to overnight. 18. The cells can be stored at 80  C for several weeks before proceeding to library preparation.

Acknowledgments We thank Edith Heard for her strong scientific commitment and constant support during this project. We thank Takashi Nagano and Peter Fraser for their experimental expertise and technical support during the optimization of the Hi-C procedure on single mouse blastomeres. We thank the Institut Curie Animal facility for animal welfare and husbandry. This work was supported by FRM FDM20140630223 and FDM 40917 to N.R. and by funding allocated to Pr Edith Heard (Labex DEEP, ANR-11-LBX-0044; IDEX PSL, ANR-10-IDEX-0001-02 PSL). References 1. Kempfer R, Pombo A (2019) Methods for mapping 3D chromosome architecture. Nat Rev Genet. https://doi.org/10.1038/ s41576-019-0195-2 2. Bickmore WA, van Steensel B (2013) Genome architecture: domain organization of interphase chromosomes. Cell 152:1270–1284. https://doi.org/10.1016/j.cell.2013.02.001 3. Lieberman-Aiden E, van Berkum NL, Williams L, Imakaev M, Ragoczy T, Telling A et al (2009) Comprehensive mapping of longrange interactions reveals folding principles of

the human genome. Science 326:289–293. https://doi.org/10.1126/science.1181369 4. Dixon JR, Selvaraj S, Yue F, Kim A, Li Y, Shen Y et al (2012) Topological domains in mammalian genomes identified by analysis of chromatin interactions. Nature 485:376–380. https:// doi.org/10.1038/nature11082 5. Nora EP, Lajoie BR, Schulz EG, Giorgetti L, Okamoto I, Servant N et al (2012) Spatial partitioning of the regulatory landscape of the X-inactivation centre. Nature 485 (7398):381–385. https://doi.org/10.1038/ nature11049

Single Cell Hi-C in Mouse Preimplantation Embryos 6. Nagano T, Lubling Y, Stevens TJ, Schoenfelder S, Yaffe E, Dean W et al (2013) Single-cell Hi-C reveals cell-to-cell variability in chromosome structure. Nature 502:59–64. https://doi.org/10.1038/nature12593 7. Nagano T, Lubling Y, Va´rnai C, Dudley C, Leung W, Baran Y et al (2017) Cell-cycle dynamics of chromosomal organization at single-cell resolution. Nature 547:61–67. https://doi.org/10.1038/nature23001 8. Eckersley-Maslin MA, Alda-Catalinas C, Reik W (2018) Dynamics of the epigenetic landscape during the maternal-to-zygotic transition. Nat Rev Mol Cell Biol 19:436–450. https://doi. org/10.1038/s41580-018-0008-z 9. Flyamer IM, Gassler J, Imakaev M, Branda˜o HB, Ulianov SV, Abdennur N et al (2017) Single-nucleus Hi-C reveals unique chromatin reorganization at oocyte-to-zygote transition. Nature 544:110–114. https://doi.org/10. 1038/nature21711 10. Lu F, Liu Y, Inoue A, Suzuki T, Zhao K, Zhang Y (2016) Establishing chromatin regulatory landscape during mouse preimplantation

293

development. Cell 165:1375–1388. https:// doi.org/10.1016/j.cell.2016.05.050 11. Du Z, Zheng H, Huang B, Ma R, Wu J, Zhang X et al (2017) Allelic reprogramming of 3D chromatin architecture during early mammalian development. Nature 547:232–235. https://doi.org/10.1038/nature23263 12. Collombet S, Ranisavljevic N, Nagano T et al (2020) Parental-to-embryo switch of chromosome organization in early embryogenesis. Nature 580:142–146. https://doi.org/10. 1038/s41586-020-2125-z 13. Nagano T, Lubling Y, Yaffe E, Wingett SW, Dean W, Tanay A et al (2015) Single-cell Hi-C for genome-wide detection of chromatin interactions that occur simultaneously in a single cell. Nat Protoc 10:1986–2003. https:// doi.org/10.1038/nprot.2015.127 14. Hogan B, Beddington R, Costantini F (1994) Manipulating the mouse embryo: a laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. https://doi.org/10. 1007/978-1-60327-019-9_13

Chapter 20 Bioinformatic Analysis of Single-Cell Hi-C Data from Early Mouse Embryo Samuel Collombet, Yuvia A. Pe´rez-Rico, Katia Ancelin, Nicolas Servant, and Edith Heard Abstract The adaptation of Hi-C protocols to enable the investigation of chromosome organization in single cells opens new avenues to study the dynamics of this process during embryogenesis. However, the analysis of single-cell Hi-C data is not yet standardized and raises novel bioinformatic challenges. Here we describe a complete workflow for the analysis of single-cell Hi-C data, with a main focus on allele-specific analysis based on data obtained from hybrid embryos. Key words scHi-C, Mouse preimplantation, Single cell, Allele-specific analysis

1

Introduction In recent years, the dynamics of chromosome organization during early mammalian embryogenesis have been the subject of several studies [1–3], thanks to the adaptation of Hi-C protocols to work with low-input material. In that respect, single-cell Hi-C (scHi-C) protocols [3–6] offer a considerable number of advantages compared to standard Hi-C. First, it requires a lower amount of material, proving useful to study early embryos that are difficult to obtain in high numbers. It is also possible to determine the sex and/or genotype of individual cells after sequencing, allowing to investigate the 3D structural analysis of the sexual chromosomes and differences between male and female embryos [7]. Moreover, single cells can also be phased along the cell cycle in order to identify mitotic cells in which chromosome organization is dramatically modified [8, 9]. Finally, scHi-C allows studying the potential heterogeneity of chromosome organization within a cell population and identifying novel subgroup(s) of cells [7, 10]. This chapter provides a complete workflow for the processing and analysis of scHi-C data. While it is applicable to any scHi-C

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3_20, © Springer Science+Business Media, LLC, part of Springer Nature 2021

295

296

Samuel Collombet et al.

dataset, it highlights the specificities and pitfalls of data generated from hybrid mouse preimplantation embryos. The method to produce scHi-C data from such embryos is described in detail in Chapter 19 of this book and reference [7]. The workflow (see Fig. 1) is presented in a step-by-step manner in the following sections, and a complete code using the same nomenclature for each step of this protocol is available at the following link: https:// github.com/heard-lab/scHiCembryo Note: G1/G2 (genome 1 / genome 2): for allele-specific annotation, the two parental genomes or genotypes. For hybrid mouse data, these are the two strains of inbred mice crossed (e.g., C57BL/6J and CAST). For human data, this could be the phased parental haplotypes.

Before Starting the Analysis: Data Organization Analysis of scHi-C data requires an important amount of computational work. It is therefore highly recommended to run such analysis on a distributed cluster, in small independent jobs. In this protocol, we will process each single cell independently. We therefore advise to create one directory (or folder) per single cell, in which all data and results per single cell will be written: hicPro/data_processing/{single_cell_ID}

where {single_cell_ID} should be a short identifier, e.g., “2CSE_1” and “8CSE_1,” respectively, for “2-cell stage embryo, cell 1” and “8-cell stage embryo, cell 1.”

2

Data Processing: Read Pair Mapping and Filtering Processing of scHi-C data includes the same steps than for bulk Hi-C data. Many programs have been developed for the processing of these data (e.g., [11–14]) which can be used for scHi-C. Here we use HiC-Pro, which provides a complete workflow from raw reads to valid contacts, including allele-specific analysis [11]. In short, reads are individually mapped on the reference genome (N-masked for allele-specific analysis), and only pairs of uniquely mapped reads are kept. If cells have a hybrid background and annotated variants allowing allele-specific analysis (usually obtained by crossing two different inbred strains), read pairs are then assigned to the parental allele. Next, read pairs are assigned to restriction fragments and valid pairs filtered (removing dangling end and circular products). More information about HiC-Pro, in particular about the files

scHi-C Bioinformatic Pipeline multiple stages single cells raw data fastq

... raw data fastq mapping and processing HiC-Pro (section 2)

all Hi-C single cells contacts

...

Hi-C contacts

QC filtering sex assignment cell cycle phasing (section 3 to 6) filtered Hi-C single cells contacts

...

Hi-C contacts

single cell merging (section 7) pseudo-bulk Hi-C Hi-C ... per group contacts (stage, sex, genotype...) contacts computing contacts enrichment matrix (section 8)

computing matrix (section 7) computing single cell contact matrix (section 11)

HiC-Pro Hic-Pro contacts ... contacts matrix matrix

Z-score ... Z-score matrix matrix

Domain calling 3dNetMod (section 9)

computing domains enrichment and filtering (section 9) Domains ... Domains merging domains from all groups

Hi-C matrix

...

merged domains

Hi-C matrix computing merged domains contacts count (section 11)

Domain Domain contact ... contact enrichment enrichment unsupervised clustering (section 10)

contacts per domain

...

contacts per domain

domain dynamics

single cell analysis Monocle (section 11) UMAP pseudotime

Fig. 1 Diagram of the scHi-C analysis workflow

Integration (section 11)

computing merged domains enrichment per group (section 10)

297

298

Samuel Collombet et al.

required for allele-specific analysis, can be found in its documentation. Required Files 1. Demultiplexed fastq file containing the raw scHi-C data, two files (read1 and read2) per single cell. 2. HiC-Pro configuration file. 3. Chromosome size file (tab separated file: ). 4. Genome-wide restriction fragment coordinates for the restriction enzyme used in the protocol in BED format (which can be generated using HiC-Pro). 5. Bowtie2 genome index. For Allele-Specific Analysis 1. Annotated variants between the two alleles in VCF format. For mouse inbred strain crosses, most of the lab strains can be extracted from the Mouse Sanger Database annotation using HiC-Pro. Alternatively, a custom-generated VCF file can be used. 2. Bowtie2 genome index with the annotated variants is replaced by “N” (N-mask, can be generated from the variants VCF and genome fasta using bedtools maskfasta). HiC-Pro requires data to be organized into one main data directory and one sub-directory per sample for each run. However, as we want to independently process each single cell, we advise to create the following path: hicPro/data_processing/{single_cell_ID}/data/{single_cell_ID}

in which the pair of fastq files (or multiple pairs of fastq files in case of more than one sequencing run of the same sample) should be found. 2.1

Mapping

In this step we map the reads, pair mapped reads by ligation product (contact pair), and assign them to one allele (for allelespecific analysis). This is done by running HiC-Pro using the option -s mapping -s quality_checks. We advise to set the following as output directory: hicPro/data_processing/{single_cell_ID}/hicPro/

The results of the quality checks in these steps can reveal problems in sequencing, library preparation, or contamination, for example, rather than in the Hi-C protocol itself. See HiC-Pro documentation for further information.

scHi-C Bioinformatic Pipeline

Output

Files:

299

hicPro/data_processing/{single_cel-

l_ID}/hicPro/bowtie_results:

directory containing all the results of mapping and quality checks.hicPro/data_proces-

sing/{single_cell_ID}/hicPro/bowtie_results/bwt2/ {single_cell_ID}:

2.2

Processing

directory containing the final results.

Here we assign read pairs to restriction fragments, and filter the valid pairs, before splitting them by allelic status (see Note below). This is done by running HiC-Pro using the options -s proc_hic -s quality_checks -s merge_persample. Input Files: The directory created in Subheading 2.1: hicPro/data_processing/{single_cell_ID}/hicPro/bowtie_results/bwt2

Output

Files:

hicPro/data_processing/{single_cel-

l_ID}/hicPro/hic_results:

directory containing all final

results. hicPro/data_processing/{single_cell_ID}/hicPro/hic_results/data/{single_cell_ID}:

directory containing the files with contact pairs, either total or split by allele (marked _G1 and _G2). Note: Allelic information of contact pairs is annotated in the last column (13th) of the HiC-Pro output file as “g1-g2,” where g1 and g2 are code values for read1 and read2, respectively, meaning: 0: The read was not assigned to an allele (not overlapping a variant) 1: Read assigned to genome 1 2: Read assigned to genome 2 3: Conflicting assignment

As most Hi-C contacts are in cis, HiC-Pro considers as G1 any contact pair from which the two reads are assigned to G1 (1-1), or at least one of them is assigned to G1 (1-0 or 0-1), which we will refer to as a general cis contact. Strict cis contacts (1-1 or 2-2) can be further extracted by filtering the total contact file by its 13th column.

300

3

Samuel Collombet et al.

Extract Quality Metrics The distribution of contacts within the following groups is an important criterion to evaluate the quality of scHi-C data as it will be explained in Subheading 4: 1. cis contacts (same chromosome, without considering allelespecific information). 2. trans contacts between different chromosomes. 3. Contacts per chromosome. 4. Short-range contacts (typically 17 Mb). Note: Steps (4) and (5) are used for cell cycle phasing (see below). It can also be interesting to split contacts in more refined groups of distance to further explore the data.

And for allele-specific analysis: 6. cis contacts on G1 (annotated 1-1, 1-0, or 0-1), and G2, respectively (annotated 2-2, 2-0, or 0-2). 7. cis contacts on G1 and G2, per chromosome. 8. trans genome contacts (1-2 or 2-1). Note: Given the large size of contact files, it is not advisable to load them in memory but rather to parse them and filter them (using awk or any other parsing command) to concomitantly count contact pairs for each group or to save the filtered contacts to a file and count them later (counting can be done using a simple wc-l). Once all of these values have been calculated for each single cell, they can be combined into one table using simple bash commands.

Input Files: The contact files for each single cell created in Subheading 2.2: hicPro/data_processing/{single_cell_ID}/hicPro/hic_results/data/{single_cell_ID}. Output: A table hicPro/stats/dataDescription_stats. tsv with rows representing single cells and each metric as a column.

scHi-C Bioinformatic Pipeline

301

Note: For some of these groups, it is useful to create files with filtered contact pairs for further analysis, especially for groups 1 (cis), 6 (cis on G1 and G2, respectively), and 8 (trans)—the last one in order to study genome intermingling that is particularly relevant for embryos. In our hands, the main interest of the other groups is to obtain the number of contact pairs per group per single cell for downstream quality controls; thus contact files do not need to be saved.

4

Quality Filtering The first quality checks for scHi-C are the total number of contacts and the fraction of trans contacts per cell. Given the relatively small number of scHi-C experiments published so far, no robust threshold of coverage has been established yet. We have previously set a threshold of 75,000 contacts (all filtered, valid contacts) and 25,000 allele-specific (general cis contacts) contacts based on the distribution of contacts that we have observed (see Fig. 2a) in our data [7]. On the one hand, a more stringent threshold can be applied tomore deeply sequenced single cells; on the other hand, some information might still be retrieved from more shallow sequencing. Regarding the fraction of trans contacts, while a very small fraction (such as 2%) is usually expected from bulk Hi-C data

contacts per single cell (millions)

A

Oocyte

1,25

1CSE

2CSE

4CSE

8CSE

64CSE

1.00 0.75 0.50 0.25 0 0

0.05

0.10

0.15

0.2 0

0.05

0.10

0.15

0.2 0

0.05

0.10

0.15

0.2 0

0.05

0.10

0.15

0.2 0

0.05

0.10

0.15

0.2 0

0.05

0.10

0.15

0.2

0.6

0.8

Allele specifc contacts per single cells (millions)

contacts per single cell (millions)

B Oocyte

1CSE

2CSE

4CSE

8CSE

64CSE

1,25 1.00 0.75 0.50 0.25 0 0.0

0.2

0.4

0.6

0.8 0.0

0.2

0.4

0.6

0.8 0.0

0.2

0.4

0.6

0.8 0.0

0.2

0.4

0.6

0.8 0.0

0.2

0.4

0.6

0.8 0.0

0.2

0.4

Fraction of trans contacts

Fig. 2 Quality controls: coverage and fraction of trans contacts. (a) Scatter plot of total number of contacts (yaxis) versus allele-specific contacts (x-axis) per single cell, at different stages. Vertical and horizontal lines indicate the lower thresholds for selecting good quality single cells (75,000 total contacts and 25,000 allele specific contacts). (b) Total number of contacts (y-axis) and trans contacts (x-axis) per single cell.

302

Samuel Collombet et al.

[15], scHi-C data shows a significantly higher fraction of trans contacts due to the method. Different thresholds for quality control—ranging between 15% and 50%—have then been applied [4, 6, 9]. Although a high median fraction of trans contact (> 20%) could indicate experimental problems in the chromosome conformation capture preparation, the threshold for filtering out low-quality single cells should be adapted to each experiment. For instance, we set up a threshold of 20% based on the distribution of the fraction corresponding to trans contacts per cell (see Fig. 2b). Input File: The table created in Subheading 3. Output: The same table with an additional column defining if a single cell is filtered out or if it passed the quality criteria.

5

Sex Assignment The relative coverage of the sexual chromosomes can be used to determine for each single cell the sex of the embryo from which it originated. Using allele-specific data, this can be achieved by comparing the relative coverage of the maternal X chromosome divided by the total coverage from X chromosome(s), as well as the fraction of contacts from the Y chromosome (over the total number of contacts per single cell) (see Fig. 3a). Female diploid cells should have a negligible number of contacts from the Y chromosome and a ratio of maternal/(maternal + paternal) X chromosome around 0.5. In contrast, male diploid cells should have a higher number of Y chromosome contacts and a ratio of maternal/(maternal + paternal) X chromosome around 1. In addition, female haploid cells (or female cells that have lost an X chromosome) have no contact from the Y chromosome, but a ratio of maternal/paternal X chromosome around 1. Of note, these cells can correspond to unfertilized oocytes, or else to the polar body, which can easily be mistaken as a blastomere when picking cells from blastocyst stage embryos. In the absence of allele-specific information, sex can still be determined using the relative coverage of the X and Y chromosomes for most of the samples (see Fig. 3b), but polar bodies could be harder to identify. Input File: The table created in Subheading 4. Output: The same table with an additional column indicating the sex of the single cell.

6

Cell Cycle Phasing During mitosis, chromosomes are condensed and lose their organization in compartments and topologically associated domains

scHi-C Bioinformatic Pipeline

Oocyte

1CSE

2CSE

4CSE

8CSE

64CSE

1.00 0.75 0.50

10

20 00

0.

0.

00

15

05

00 0.

00

20 0 0.

00

0.

0.

00

15

10

05 0.

00

00

20 0

0.

15

0.

00

10

00 0.

05 00

0.

00

20 0 0.

15

00

00 0.

0.

05

10

00

00 0.

20 0 00

0.

0.

10

15 00

0.

05 00

0.

0.

00

20 0

15

00 0.

00

00

0.

0.

00

0

05

10

0.25

0.

ratio of maternal contacts on the X chromosome (mat/[mat+pat])

A

303

fraction of contacts on the Y chromosome Oocyte

1CSE

2CSE

4CSE

8CSE

64CSE

0.08 0.06 0.04

20

0.

00

15

0.

00

10 00

0.

0.

00

05

20 0 00

0.

0.

00

15

10

05

00

00 0.

0.

20 0 00

0.

0.

00

15

10

05

00

00

0.

0.

00

20 0

15 00

0.

0.

10 00

0.

0.

00

05

20 0 00

0.

15 00

0.

10 00

00

05 0.

0.

20 0

0.

00

15

00

00 0.

0.

05 00 0.

10

0.02

0

fraction of contacts on the X chromosome

B

fraction of contacts on the Y chromosome

sex:

haploid female or excluded

diploid female

diploid male

Fig. 3 Sex assignment. (a) Scatter plot of the proportion of maternal contacts on the X chromosome (relative to the sum of maternal and paternal contacts) versus the proportion of contacts on the Y chromosome (relative to total contacts), colored by inferred sex. The red rectangle (middle-left) indicates female diploid cells, the blue one male diploid cells (top right), and the black haploid female cells (top left). Haploid cells stand for unfertilized oocytes (oocyte and 1CSE) or polar bodies (64CSE). (b) Proportion of contacts on the X and Y chromosomes. Cells are colored by the sex as defined in a. Note that haploid female cells are not as well discriminated as in a.

(TADs) [8, 9]. They display a lower fraction of short-range contacts (at the TAD scale) and a higher fraction of long-range contacts (or mitotic contacts, due to global chromosome compaction). Therefore it is important to distinguish the blastomeres according to their cell cycle and filter out cells in mitosis in order to study chromosome structure at the TAD scale. It is also essential when comparing different developmental stages where the proportion of mitotic cells is different. As the threshold to define a mitotic and non-mitotic cell depends on the cell type and developmental stage, we advise to adapt the cell cycle phasing to each dataset. In our case, we compared the number of short-range (>25 kb and 2 Mb and 25 kb and 2 Mb and 70% of their size overlaps with other domains) and keeping only the one with the highest enrichment score. As more than two domains might be redundant, this can be performed iteratively by finding every pair of domains overlapping by more than 70%: for each pair exclude the weakest domain, and repeat this comparison until no more redundant domains can be identified. This can be performed using an R script described in [7] and available at https://github.com/heard-lab/ HicTools (script FilterRegions_MinMutualOverlap_maxScore.r). Input Files: Domains with Subheading 9.2. Output: Filtered domains.

10

their

average

Z-score

from

Analysis of Domain Dynamics

10.1 Merging Domains from Multiple Stages into a Single Annotation

In order to analyze the dynamics of domain strength through different developmental stages, it is first necessary to establish a unique set of domains and quantify their contact enrichment for each stage. For allele-specific analysis, domains found for each parental genome can also be merged together in the same way and contact enrichment re-quantified for each allele. As in Subheading 9.3, we need to avoid redundancy between domains called at different stages by merging all domains and applying the same iterative filter method. Input Files: Filtered domains from Subheading 9.3, for each stage and/or group defined in Subheading 7. Output: Merged list of domains in bed format.

10.2 Contact Enrichments for Each Pseudo-Bulk Group

Using the unique set of domains from Subheading 9.1, we can now compute the contact enrichment for each domain at each stage and calculate their average Z-score as in Subheading 9.2. Next, these

scHi-C Bioinformatic Pipeline

309

scores are combined in a table, where each domain is a row and each stage is a column. For allele-specific analysis, the average Z-score for each domain is calculated for each of the two genomes, at each stage, and one final table is created for each parental genome. Input Files: Merged domains from Subheading 10.1 and enrichment matrices from Subheading 8.2, for each stage and/or group defined in Subheading 7. Output: A table with domains as rows, groups as columns, and average enrichment as values. 10.3 Clustering Analysis

We used an unsupervised clustering (Fig. 5) to define the general dynamics of structural domains through stages or between conditions and identify groups of domains showing similar dynamic patterns, which is useful for later correlation with other types of genomic datasets. The accompanying code provides functions to perform K-mean clustering on the domain Z-score table and to visualize the results. Input Files: Table from Subheading 10.2.

Note: Defining the “optimal” number (k) of clusters is a general problem that has been well documented [22]. While metrics have been proposed to automatically define this number (our code provides a function to that end), we would suggest to always test several values of k and compare the results in terms of biological significance.

Note: For allele-specific data, it is possible to concatenate horizontally the two allele-specific tables to perform a single clustering analysis on both allelic dynamics. However, if one allele displays high dynamics, smaller changes on the other allele might be missed. In that case, it is therefore advisable to perform separate clustering on each allelic table and compare the results.

310

Samuel Collombet et al.

Fig. 5 Clustering domains based on their contact enrichment dynamics. Heat map of domain clustering, with each domain as a row and each stage as a column. Color intensity represents the enrichment of contacts in domains at each stage, on the maternal (red, left) and paternal (blue, right) genomes

scHi-C Bioinformatic Pipeline

11

311

Domain Dynamics in Single Cells

11.1 Quantification of Contacts Per Domain in Single Cells

Contacts per domain can also be quantified for each single cell. However, it is not possible to calculate an enrichment matrix (Zscores) at the single cell level because their contact matrices are highly sparse. We can therefore simply compute contact counts per domain in each single cell.

11.1.1 Computing Single-Cell Matrices for Contact Quantification

Single-cell matrices in cool format for quantification can be computed as done for pseudo-bulk data in step 1 from Subheading 7.2. Although a higher resolution than the one used for domain calling (40 kb) is not necessary for quantification, it can be interesting to compute a single cell matrix at a 10 kb resolution for visualization and data inspection. Input Files: Single-cell contact files from Subheading 2.2. Output Files: Single-cell contact matrix in cool format.

11.1.2 Computing Contact Counts Per Domain or Single Cell

This can be performed using the same function as in Subheading 9.2. Note: To quantify contacts by single cell, the diagonal of the matrix should be excluded (option: -k 1 hicSummarizeScorePer Region).

As in Subheading 9.2, these scores are combined in a table, where each domain is a row and each single cell is a column. For allele-specific analysis, one count table is created for each parental genome. Input Files: Merged domains from Subheading 10.1 and singlecell contact matrix from step 1 in Subheading 11.1. Output Files: A table with domains as rows, single cells as columns, and contact count as values. 11.2 Single-Cell Analysis Using Monocle

In order to map domain dynamics along single cell trajectories, we need to reduce the space of scHi-C data to a two- to threedimensional space. Here we use the R program Monocle [23], which offers an easy-to-use interface for recent single-cell analysis algorithms.

312

Samuel Collombet et al.

Note: Recent algorithms have been developed for embedding of scHi-C data [10, 24]. While we only use Monocle in this protocol, other software could capture different aspects of single cell dynamics. Thus, we advise to compare the results of different methods

11.2.1 Data Processing with Monocle

First, data needs to be formatted in “cell_data_set” format for Monocle, which contains both the domain quantification table and single cell and domain annotation. Data can then be pre-processed with Monocle, converting contact counts to a logarithmic scale (norm_method ¼ “log”). Input File: Table of contact counts per domain for each single cell from step 2 in Subheading 11.1. Dimensionality reduction for inferring and visualizing trajectories such as t-SNE [25] and UMAP [26] is usually not performed directly on the complete feature (domains in this case) space, but on a pre-reduced space. Here we use principal component analysis (PCA; method ¼ “PCA”) and compute the first 50 components.

Note: While principal components can be used as a reduced space to project single cells, methods such as UMAP and t-SNE better capture the “real” proximity between single cells and are used for subsequent analysis.

Note: While classical PCA is usually performed using the first few dimensions, as a pre-dimensionality reduction step, it is advisable to use a larger number of dimensions, e.g., between 50 and 100. This can be evaluated by plotting the percentage of variance explained by dimension and selecting the last dimension in which the explained variance seems to plateau. Additional dimensions do not have negative effects on the results, but they can contain relevant biological information about a small subset of cells.

scHi-C Bioinformatic Pipeline

313

Fig. 6 Single-cell projection in a two-dimensional space using UMAP. Single cells represented in the two dimensions from UMAP [26] 11.2.2 Single-Cell Projection in a 2D Space Using UMAP

After PCA, a two-dimensional space can be inferred using UMAP [26] or t-SNE [25]. The advantages of each algorithm are still debated (see refs. 26, 27), and we would advise comparing the results to fully interpret the scHi-C data. Note: While Monocle offers a function for the visualization, it can also be interesting to extract the inferred dimensions to generate custom representations. This can be done using the function reducedDims.

Once represented in a two-dimensional space, single cells can be colored according to different parameters, such as developmental stage, sex, and cell cycle phasing (Fig. 6). This can be used to interpret the distribution of cells and their possible clustering.

Note: Including the sexual chromosome leads to a very clear distinction between male and female cells, in particular in allelespecific analysis as one of the two chromosomes will not get any

(continued)

314

Samuel Collombet et al.

contact (chrY in female cell and paternal chrX in male). This can be quickly observed by comparing the result of UMAP/tSNE single cell embedding including and excluding domains on sexual chromosomes.

11.2.3 Pseudotime Ordering

Monocle can be used to order single cells in pseudotime along an inferred trajectory in reduced space. Such analysis can ease the interpretation of the data, in particular to visualize the quantitative dynamics of domains. Nevertheless, it should be interpreted carefully as the structure of the data is highly dependent on the parameters used for the analysis and not necessarily on the real temporal timing of biological events.

Note: Comparison of the pseudotime and the cell cycle phasing inferred in Subheading 6 should at least partially correlate, and discrepancies may help to better interpret the data and optimize parameters for the analyses.

11.2.4 Visualizing Domain Dynamics in Single Cells

It is possible to visualize the dynamics of domain strength as a color scale on points representing single cells either in the reduced space (Subheading 11.2.2) or along pseudotime (Subheading 11.2.3). However, domains represent regions of preferential contact in a population of cells but are not present as is in every cell at a given time [28, 29]. Therefore, the contact enrichment of one domain in a single cell shows very high variability and is hard to interpret. Nonetheless, it is possible to pool together multiple domains showing similar dynamics based on the clustering from Subheading 10.3, to interpret single-cell trajectories, and to characterize different subpopulations.

Acknowledgments We thank Peter Fraser, Takashi Nagano, and Csilla Varnai for helpful discussions about sc-HiC data analysis, as well as Fidel Ramirez and Gauthier Richard for their help with HicExplorer. Samuel Collombet is supported by an EMBO fellowship (EMBO ALTF 275-2018).

scHi-C Bioinformatic Pipeline

315

References 1. Du Z, Zheng H, Huang B et al (2017) Allelic reprogramming of 3D chromatin architecture during early mammalian development. Nature 547:232–235. https://doi.org/10.1038/ nature23263 2. Ke Y, Xu Y, Chen X et al (2017) 3D chromatin structures of mature gametes and structural reprogramming during mammalian embryogenesis. Cell 170:367–381.e20. https://doi. org/10.1016/j.cell.2017.06.029 3. Flyamer IM, Gassler J, Imakaev M et al (2017) Single-nucleus Hi-C reveals unique chromatin reorganization at oocyte-to-zygote transition. Nature 544:110–114. https://doi.org/10. 1038/nature21711 4. Nagano T, Lubling Y, Stevens TJ et al (2013) Single-cell Hi-C reveals cell-to-cell variability in chromosome structure. Nature 502:59–64. https://doi.org/10.1038/nature12593 5. Stevens TJ, Lando D, Basu S et al (2017) 3D structures of individual mammalian genomes studied by single-cell Hi-C. Nature 544:59–64. https://doi.org/10.1038/ nature21429 6. Ramani V, Deng X, Qiu R et al (2020) Sci-HiC: a single-cell Hi-C method for mapping 3D genome organization in large number of single cells. Methods 170:61–68. https://doi.org/ 10.1016/j.ymeth.2019.09.012 7. Collombet S, Ranisavljevic N, Nagano T et al (2020) Parental-to-embryo switch of chromosome organization in early embryogenesis. Nature 580:142–146. https://doi.org/10. 1038/s41586-020-2125-z 8. Naumova N, Imakaev M, Fudenberg G et al (2013) Organization of the mitotic chromosome. Science 342:948–953. https://doi. org/10.1126/science.1236083 9. Nagano T, Lubling Y, Va´rnai C et al (2017) Cell-cycle dynamics of chromosomal organization at single-cell resolution. Nature 547:61–67. https://doi.org/10.1038/ nature23001 10. Zhou J, Ma J, Chen Y et al (2019) Robust single-cell Hi-C clustering by convolutionand random-walk–based imputation. Proc Natl Acad Sci U S A 116:14011–14018. https://doi.org/10.1073/pnas.1901423116 11. Servant N, Varoquaux N, Lajoie BR et al (2015) HiC-Pro: an optimized and flexible pipeline for Hi-C data processing. Genome Biol 16:259. https://doi.org/10.1186/ s13059-015-0831-x 12. Durand NC, Shamim MS, Machol I et al (2016) Juicer provides a one-click system for

analyzing loop-resolution Hi-C experiments. Cell Syst 3:95–98. https://doi.org/10.1016/ j.cels.2016.07.002 13. Wingett S, Ewels P, Furlan-Magaril M et al (2015) HiCUP: pipeline for mapping and processing Hi-C data. F1000Res 4:1310. https:// doi.org/10.12688/f1000research.7334.1 14. Wolff J, Bhardwaj V, Nothjunge S et al (2018) Galaxy HiCExplorer: a web server for reproducible Hi-C data analysis, quality control and visualization. Nucleic Acids Res 46:W11–W16. https://doi.org/10.1093/nar/gky504 15. Lajoie BR, Dekker J, Kaplan N (2015) The Hitchhiker’s guide to Hi-C analysis: practical guidelines. Methods 72:65–75. https://doi. org/10.1016/j.ymeth.2014.10.031 16. Kerpedjiev P, Abdennur N, Lekschas F et al (2018) HiGlass: web-based visual exploration and analysis of genome interaction maps. Genome Biol 19:125. https://doi.org/10. 1186/s13059-018-1486-1 17. Ramı´rez F, Bhardwaj V, Arrigoni L et al (2018) High-resolution TADs reveal DNA sequences underlying genome organization in flies. Nat Commun 9:189. https://doi.org/10.1038/ s41467-017-02525-w 18. Cohen NM, Olivares-Chauvet P, Lubling Y, Baran Y (2017) SHAMAN: bin-free randomization, normalization and screening of Hi-C matrices. BioRxiv. https://doi.org/10.1101/ 187203 19. de Wit E (2019) TADs as the caller calls them. J Mol Biol. https://doi.org/10.1016/j.jmb. 2019.09.026 20. Zhan Y, Mariani L, Barozzi I et al (2017) Reciprocal insulation analysis of Hi-C data shows that TADs represent a functionally but not structurally privileged scale in the hierarchical folding of chromosomes. Genome Res 27:479–490. https://doi.org/10.1101/gr. 212803.116 21. Norton HK, Emerson DJ, Huang H et al (2018) Detecting hierarchical genome folding with network modularity. Nat Methods 15:119–122. https://doi.org/10.1038/ nmeth.4560 22. Schw€ammle V, Jensen ON (2010) A simple and fast method to determine the parameters for fuzzy c–means cluster analysis. Bioinformatics 26:2841–2848. https://doi.org/10.1093/bio informatics/btq534 23. Qiu X, Mao Q, Tang Y et al (2017) Reversed graph embedding resolves complex single-cell trajectories. Nat Methods 14:979–982. https://doi.org/10.1038/nmeth.4402

316

Samuel Collombet et al.

24. Liu J, Lin D, Yardimci G, Noble W (2018) Unsupervised embedding of single-cell Hi-C data. Bioinformatics 34:i96–i104. https://doi. org/10.1093/bioinformatics/bty285 25. van der Maaten L, Hinton G (2008) Visualizing data using t-SNE. J Mach Learn Res 9:2579–2605 26. Becht E, McInnes L, Healy J et al (2018) Dimensionality reduction for visualizing single-cell data using UMAP. Nat Biotechnol. https://doi.org/10.1038/nbt.4314 27. Kobak D, Berens P (2019) The art of using t-SNE for single-cell transcriptomics. Nat

Commun 10:5416. https://doi.org/10. 1038/s41467-019-13056-x 28. Szabo Q, Jost D, Chang J-M et al (2018) TADs are 3D structural units of higher-order chromosome organization in Drosophila. Sci Adv 4:eaar8082. https://doi.org/10.1126/ sciadv.aar8082 29. Bintu B, Mateo LJ, Su J-H et al (2018) Superresolution chromatin tracing reveals domains and cooperative interactions in single cells. Science 362. https://doi.org/10.1126/science. aau1783

INDEX A Allele-specific analysis.................298, 300, 308, 309, 311

B Bisulfite conversion ..................................... 208, 212, 215 Blastocysts.....................2, 3, 5, 13, 27, 31–39, 111, 117, 119, 121, 125, 136, 143, 144, 150, 157–173, 175, 176, 179, 183, 185, 251, 271, 273, 274, 284, 291, 302

C Cell fate decisions............................................................ 92 CHIP-seq .......................................................87, 241–252 Chromatin profiling ............................................. 254, 262 Chromosome conformation capture (3C) ......... 176, 283 Chromosome territories (CTs) ........................... 175–186 Clustered regularly interspaced short palindromic repeats (CRISPR)................................... 91–107, 125–139 Confocal microscopy ................................................51, 57 Constitutive Knock-In (KI).......126, 129, 131, 135, 137 Constitutive Knock-Out (KO)................... 126, 128, 131 CRISPR/Cas9 gene editing......................................... 126 Cultures ................ v, 1–9, 11, 12, 14, 16, 20, 22, 31–39, 42, 45–47, 51, 53, 55, 57, 59–71, 76–87, 94, 97–99, 101, 105, 106, 110, 112–117, 119, 127, 145, 159–161, 164, 165, 171, 178, 192, 195, 245, 266, 272, 273, 284–286, 291 CUT&RUN ......................................................... 255–265

D Differentiation.......................1, 2, 32, 41–57, 59, 85–87, 99, 101, 177, 283 DNA adenine methyltransferase identification (DamID) ..................................266–276, 278, 280 DNA FISH .................................178, 180, 182, 183, 185 DNA methylation ....... 32, 111, 207–219, 221–239, 267

E Early embryos......................................111, 222, 295, 307 Ectoderm ........................................................31, 143, 144 Egg cylinder ..................................................... 31–39, 143 Embryonic development .............. 31, 32, 38, 39, 42, 75, 76, 110, 111, 138, 207

Embryonic gene expression....................... 144, 189, 199, 202, 203 Embryonic germ cells .......................................... 253–263 Embryos ......................v, 1–9, 11–16, 18, 22, 23, 25–28, 31–36, 38, 39, 41, 42, 59–63, 65, 68, 71, 75, 76, 109–113, 117, 119, 121, 126, 127, 131–134, 136–138, 143–153, 157–160, 164, 165, 171–173, 176–183, 185, 186, 189–205, 241–252, 254, 256, 258, 261, 262, 265–280, 284–287, 289, 291, 295–314 Endoderm................................................ 32, 86, 143, 144 Epiblast ....................... 6, 31, 41, 59, 143, 150, 157, 158 Epiblast-like cells (EpiLCs) ....................... 42, 46, 47, 53, 57, 76, 78, 81–84, 86, 87, 92 Epigenome profiling ..................................................... 241 Epigenomes ................................................................... 241

F Fluorescent reporters .......................................12, 25, 266

G Gastrulation.........................................41, 42, 53, 75, 144 Germ cells ........................... 59, 60, 75, 76, 92, 139, 207, 254–256, 258, 260–262 Germline ............................. 59, 60, 63, 71, 92, 126, 135, 139, 158, 253

H Histone deacetylases inhibitor (HDACi) ...................111, 113, 114, 117, 119 Histone modifications............... 111, 158, 159, 241–253, 260, 265

I IF/RNA-FISH .............................................................. 158 Immunofluorescence (IF)........................ 3, 86, 143–152, 157–173, 261, 262 Immunohistochemistry ................................................ 144 Immunosurgery ................................ 158, 159, 162, 170, 172, 173 Implantation .................1, 2, 11, 31, 32, 35, 39, 59, 143, 189, 284

Katia Ancelin and Maud Borensztein (eds.), Epigenetic Reprogramming During Mouse Embryogenesis: Methods and Protocols, Methods in Molecular Biology, vol. 2214, https://doi.org/10.1007/978-1-0716-0958-3, © Springer Science+Business Media, LLC, part of Springer Nature 2021

317

EPIGENETIC REPROGRAMMING DURING MOUSE EMBRYOGENESIS: METHODS

318 Index

Inner cell mass (ICM)................... 2, 3, 6, 32, 36, 38, 39, 76, 150, 157–173, 274 In vitro .................14, 15, 19, 21, 23, 25, 27, 32, 38, 39, 42, 59–71, 75, 76, 92, 112, 125, 129, 136, 268, 271

L Lamina-associated domains (LADs) ................... 266, 270 Lentivirus...................................................................97, 98 Lineage regulator ............................................................ 92 Live imaging ................................... 11, 12, 25, 26, 28, 38 Low input ................................... 111, 189–205, 242, 249 Low-input CHIP-seq........................................... 243–254 Low input DamID ........................................................ 268 Low-input transcriptomics .................................. 189–205

AND

PROTOCOLS

R Reduced representation bisulfite sequencing (RRBS).....................................208, 211, 215, 221 RNA electroporation ................................................23, 25 RNA FISH......................... 158–162, 168, 169, 172, 173 RNA microinjection.........................................22, 27, 114

S

Mesoderm............................................................... 53, 144 Microfabricated cell culture devices .........................11–28 Micropatterns ..............42, 44, 46, 47, 49, 51, 53, 55–57 Mural trophectoderm ...............................................31–40

Single cell Hi-C (scHi-C) ................... 283–292, 295–314 Single-cell RNA-seq (scRNA-seq) ...................... 190, 224 Single-embryo RNA-seq...................................... 190, 192 Single guide RNA (sgRNA) ...........................93, 97, 105, 106, 126, 128, 129, 131–133, 135–139 Single-stranded oligodeoxynucleotides (ssODN)......126, 129, 131 Soft-lithography ........................................................16, 26 Somatic cell nuclear transfer (SCNT) ................ 109–111, 114, 116, 119, 176 Spike-in .............................. 190, 192, 195, 199, 202, 237 Stem cells ............... 1, 34, 42, 59–71, 76, 78, 85, 92–94, 109, 125, 176

N

T

Nascent transcripts ........................................................ 158 Native chromatin .......................................................... 244 Next-generation sequencing (NGS) ................92, 94, 97, 101, 105, 106, 241, 244, 249 Nuclear organization ..........................111, 176, 177, 265

3D DNA FISH.............................................................. 177 3D genome.................................................. 176, 265, 284 Topologically associated domains (TADs) ......... 303, 306 Transgenic ........................... 1, 68, 77, 86, 125–139, 255 Trophectoderm (TE) ........................ 2, 31, 32, 143, 157, 158, 165, 171, 274

M

P Patterning .............................. 32, 42, 47, 53, 55, 56, 176 Photolithography ......................................................16, 26 Pluripotency .................1–9, 32, 63, 71, 76, 86, 92, 101, 109, 150, 175 Pluripotent stem cells (PSC) ........................... 41–57, 109 Postimplantation embryo ............................................. 150 Preimplantation embryos ...................... 2, 3, 11–28, 148, 172, 176, 179, 181, 185, 195, 222, 244, 287, 296 Primitive endoderm (PE) ............ 2, 3, 31, 143, 157, 158 Primitive streak (PS) .............................................. 53, 144 Primordial germ cells (PGCs) ................... 59–71, 75, 76, 81, 92, 93, 101, 110, 262

W Whole genome bisulfite sequencing (WGBS)....................................208, 209, 212, 219 Whole-mount ...............................................143–150, 152

Z Zygote electroporation ..................................25, 131, 133 Zygote microinjection .................................................... 23