Encyclopedia of Genetics: New Research 1536144517, 9781536144512

Table of contents :
Contents
Preface
Chapter 1
Speciation in Diatoms: Patterns,
Mechanisms, and Environmental Change
Abstract
Introduction
Phylogenetic Relationships
Reproduction in Diatoms
Studying Speciation in Diatoms
Patterns of Speciation in Diatoms
Marine Records
Freshwater Records
Reproductive Isolation
Mate Discrimination
Temporal Isolation
F1 Hybrid Sterility and Inviability
The Genetics of Reproductive Isolation
Diatoms: A Model System to Study the Consequences of Climatic Change on Speciation
Paleontological History
Events Leading to Speciation
Conclusion
Acknowledgments
References
Chapter 2
Sympatric Speciation of Island Plants: The Natural Laboratory of Lord Howe Island
Abstract
Introduction
Allopatric and Peripatric Speciation
Sympatric and Parapatric Speciation
Empirical Studies of Speciation
Approaches Studying Sympatric Speciation
Causes of Reproductive Isolation during Sympatric and
Parapatric Speciation
Speciation-with-Gene-Flow
Homoploid Hybrid Speciation
Polyploid Speciation
Lord Howe Island: A Model System for Studying Speciation
Lord Howe Island Formation and Climate
The Vegetation of LHI and the Impact of Human Settlement
Why Study Speciation on LHI?
Conclusion
References
Chapter 3
Speciation of Arabian Gazelles
Abstract
Introduction
Major Clades of Gazelles
Extant Species of Smaller Gazelles
Parallel, Adaptive Speciation of Species Pairs
A Taxonomic Review of the Genus Gazella
Conclusion
Acknowledgments
References
Chapter 4
Chromosome Plasticity, Adaptation and Speciation in Malaria Mosquitoes
Abstract
Introduction
1. A Role of Chromosome Polymorphism in Ecological Adaptations of Malaria Mosquitoes
2. Ecological Heterogeneity of Malaria Mosquitoes is a Major Challenge to Vector Control
3. Chromosome Plasticity in Adaptation and Evolution of Malaria Mosquitoes
3.1. Chromosome Arms Evolve at Different Rates
3.2. Genomic Landscapes and Nonuniform Rates of Inversions Fixation
3.3. Polymorphic Inversions and Parallel Adaptations
3.4. Nuclear Architecture and Chromosome Plasticity
4. Heterochromatin and Speciation in Malaria Mosquitoes
5. Significance of High-Quality Genome Assemblies for Studying Mosquito Evolution
Conclusion
Acknowledgments
References
Chapter 5
Transcriptional Differentiation Across the Four Subspecies of Drosophila mojavensis
Abstract
Introduction
Analysis of Transcriptional Divergence
Ecological Divergence in the D. mojavensis Transcriptome
Transcriptional Divergence and Speciation
Conclusion
Acknowledgments
References
Chapter 6
Evolution of Male Courtship Songs in the Drosophila buzzatii Species Cluster
Abstract
Introduction
Phylogeny of D. buzzatii Cluster Species
Host Cactus, Biogeography and Ecology of D. buzzatii Cluster Species
Description of Courtship Songs and Comparative Methods
Phylogenetic Reconstruction
Mapping Song Traits onto the Phylogeny
Differences in Courtship Song Components
Character Mapping Analysis of Courtship Song
Conclusion
Evolution of Courtship Songs
Acknowledgments
References
Chapter 7
Abstract
Introduction
Nasonia Wasps
Courtship and Mating Behaviour
Patterns of Mate Discrimination: No Choice Experiments
Choice Experiments: Implications of Male-Male Competition
Genetics of Mate Discrimination
Other Traits Involved in Prezygotic Isolation
Reinforcement
Chemical Communication and Their Role in Species Discrimination
Conclusion
Acknowledgments
References
Chapter 8
Abstract
Introduction
A Systems Approach to Postmating, Prezygotic Phenotypes
What System Underlies Postmating, Prezygotic Phenotypes?
Cell Signaling and Phosphorylation as Mechanisms Underlying Postmating, Prezygotic Phenotypes
Using Phosphorylation Studies to Identify Ligand and Receptor Genes Underlying Postmating, Prezygotic Reproductive Isolation
Pathways Leading to Postmating, Prezygotic Reproductive Isolation
Membrane Channels and Reproductive Isolation Caused by Protein-Protein Interactions Outside the Female Reproductive Tract
Species-Specific, Receptor-Gated Membrane Channels
Species-specific, Male-female Protein Interactions within the Female Reproductive Tract
Mechanisms Triggering Phosphorylation within the Female Reproductive Tract
Conclusion
Acknowledgments
References
Chapter 9
The Molecular and Evolutionary Basis of Hybrid Sterility: From Odysseus to Overdrive
Abstract
Introduction
Odysseus
Overdrive
Conclusion
References
Chapter 10
The Role of Transposable Elements in Speciation
Abstract
Introduction
Mechanism I: Genomic Disease
TE Suppression by Small RNAs: A Molecular Mechanism for Speciation
Evidence for Mechanism I
Drosophila Hybrid Dysgenesis
TE Derepression in Interspecific Animal Hybrids
TE Derepression in Plant Hybrids
Mechanism II: Mechanical Incompatibility
Evidence for Mechanism II
Structural Variation Caused by TE Activity
Structural Variations Associated with Reproductive Isolation
A TE Induced Structural Variant That Causes Isolation
Mechanism III: Genomic Resetting
Conclusion
Acknowledgments
References
Chapter 11
Hybrid Incompatibility: Are Cellular Processes the Battlefields of Genomic Conflict?
Abstract
1. Hybrid Incompatibility
2. Conflict-Driven HI
3. Prdm9 and Other Recombination-Association Genes
4. The Centromere and Associated Structures
5. A Call for the Evolutionary Genetics of the Cell
References
Chapter 12
Processes in Organic and Cultural Evolution
Abstract
Introduction
Individual Development and Evolution
The Problem of Evolutionary Change
Aim
Evolutionary Developmental Biology
Heterochrony
Environment-Independent Natural Selection
Population Biology
A Mathematical Analysis
An Application to Bacteria
Development and Evolution
The Relationship between Development and Evolution
The Regularity of Condensation
Condensation and Terminal Addition
An Explication of the Regular Temporal Structure of Evolution
Empirical Support
Complexity
Common Views
The Assessment of Complexity
Accelerating Evolution
A Self-Reinforcing Feedback Process
Complexity and the Tree of Life
Some Authors’ Views of Evolution
Complexity and a New View of the Evolutionary Process
Competition for Room in the Complexity Space
The Tree of Life
The Appearance of Mankind
Cultural Evolution
Universal Darwinism
Steps of Cultural Evolution
Analogies between Biological and Cultural Evolution
Natural Selection in Cultural Evolution
The Process of Heredity in Cultural Evolution
Complexity in Cultural Evolution
The Evolution of Verbal Language
Condensation and Terminal Addition
Processes in the Evolution of Written Language
Processes in Scientific Evolution
The Human Species – a Unique Species
Conclusion
References
Chapter 13
Natural Selection and Diabetes Mellitus
Abstract
Introduction
Materials and Methods
Results
Discussion
Conclusion
References
Chapter 14
Genetic Drift among Native People from South American Gran Chaco Region Affects Interleukin 1 Receptor Antagonist Variation
Abstract
Text
Background
Uniparental Y Chromosome Variability
X Chromosome Variability
Uniparental Mitochondrial Variability
Autosome Non Coding Variation
Autosome Coding Variation in the Interleukine 1 Receptor Antagonist
Discussion
References
Chapter 15
Alternative Splicing and Neurological Disorders: Focus on Parkinson’s Disease
Abstract
1. Introduction
2. The Alternative Splicing Machinery
3. Alternative Splicing in the Nervous System and Neurological Diseases
4. Genetics of Parkinson’s Disease: Basic Concepts
5. Alternative Splicing of Genes Involved in the Dominantly Inherited Forms of Parkinson’s Disease
5.1. SNCA
5.2. LRRK2
6. Alternative Splicing of Genes Involved in the Recessively Inherited forms of Parkinson’s Disease
6.1. PARK2
6.2. PINK1
6.3. DJ1
6.4. ATP13A2
6.5. PLA2G6
6.6. FBXO7
7. Alternative Splicing of Other PD Genes
7.1. SNCAIP
7.2. MAPT
7.3. MAO-B
7.4. SRRM2
8. Whole-Genome RNA Expression Studies Reveal Overall Alternative Splicing Changes in PD
9. Epigenetic Regulation of PD Alternative Splicing
Conclusion
Acknowledgments
References
Chapter 16
Tau Alternative Splicing in Alzheimer’s Disease
Abstract
RNA Splicing
Alzheimer’s Disease
Conclusion
References
Chapter 17
The Role of Splicing Factors in Cancer Prognosis and Treatment
Abstract
Introduction
General Splicing Mechanism
Splicing Regulatory Factors
Alternative Splicing and Cancer
Mutations in the Core Splicing Machinery Related to Cancer
Cancer-Related Changes in Splicing Factors Expression
Splicing Regulators That Have Been Considered Oncogenes or Tumor Suppressors
Regulation of Proto-Oncogenes by Splicing Factors
The Role of Alternative Splicing in Cancer Progression
Therapeutic Tools Developed to Regulate Splicing Factors Activity and Cancer
Conclusion
References
Chapter 18
Nonsense-Mediated Decay and Human Disease
Abstract
Introduction
NMD Mechanism
NMD Factors Related to Particular Diseases
Genetic Diseases Linked to NMD
Relevance of NMD in Human Condition
Therapies for NMD-Related Diseases
Conclusion
References
Chapter 19
Alternative Splicing Alterations in Alzheimer’s Disease
Abstract
Introduction
Alternative Splicing of Pivotal AD Genes
Tau
APP (Amyloid Precursor Protein) Gene
Alternative Splicing of Genes involved in Aβ Processing
BACE 1 (β-site APP Cleaving Enzyme 1)
Presenilins
Nicastrin
APH-1
AIDA-1
Clusterin
FE65 Family Proteins
Apolipoprotein E (APOE)
Alternative Splicing of Other Candidate Genes
Acetylcholinesterase
Tissue Transglutaminase
Estrogen Receptor α
Brain Derived Neurotrophic Factor (BDNF)
Tropomyosin Receptor Kinase B (TrkB)
Excitatory Amino Acid Transporter 2 (EAAT2)
Ion Channels
Synapsin
Regulator of Calcineurin (RCAN1)
Glial Fibrillar Acidic Protein (GFAP)
Ubiquilin-1
CDKN1A Interacting Zinc Finger Protein 1 (CIZ1)
Differentially Expressed in Normal and Neoplastic Tissues MAPK-Activating, Death Domain Protein (DENN/MADD)
Diazepam-Binding Inhibitor (DBI)
Conclusion
References
Chapter 20
Plant RNA-Binding Proteins Implicate mRNA Processing in Abscisic Acid (ABA) Responses
Abstract
1. Introduction
2. Splicing Factors
2.1. snRNP Factors
2.2. SR and hnRNPs Proteins
2.3. Other Splicing Regulators
3. Non-Splicing Proteins
3.1. CAP Binding Proteins
3.2. RNA Helicases and Pentatricopeptide Repeat Proteins
3.3. Other RNA-Binding Proteins
Conclusion
References
Chapter 21
Comprehensive Analyses of Alternative Exons in Neuronally Differentiated P19 cells
Abstract
Introduction
Materials and Methods
Cell Culture and RNA Purification
Exon Arrays
Signal Estimations
Extraction of Candidate Exons and Genes
Semi-Quantitative RT-PCR
GO Analyses, Pathway Analyses, and Text Mining
Results
Extraction of Alternative Exon Candidates
Semi-Quantitative RT-PCR of the Candidate Exons
GO Analyses of the Candidate Exons
Extraction of Potentially Important Exons by Pathway Analyses and Text Mining
Informatics and Experimental Analyses of Splicing Isoforms
Discussion
Acknowledgments
References
Chapter 22
Identification of Genuine Alternative Splicing Variants for Rare or Long-Sized Transcripts
Abstract
1. Introduction
2. Synthesis of Full-Length cDNA Using the Vector-Capping Method
3. Analysis of Full-Length cDNA Clones
3.1. Retina-Derived Full-Length cDNA Libraries
3.2. Characterization of Eye-Specific Genes
3.2.1. Aryl Hydrocarbon Receptor Interacting Protein-Like 1 (AIPL1)
3.2.2. LIM Momeobox 3 (LHX3)
3.2.3. Neural Retina-Specific Leucine Zipper Protein (NRL)
3.2.4. OTX2 Antisense RNA 1 (OTX2-AS1)
3.3. Characterization of Long-Sized Genes
3.3.1. Very-Long-Sized Genes
3.3.2. Golgin B1 (GOLGB1)
3.3.3. Filamin A, Alpha (FLNA)
3.3.4. Filamin B, Beta (FLNB)
3.3.5. Eyes Shut Homolog (EYS)
4. Full-Length cDNA Libraries Derived from Other Species
5. Problems on Identification of AS Variants
5.1. AS Variants of Rare or Long-Sized Genes
5.2. Synthesis of Full-Length cDNA
(1) Oligo(dT) Priming
(2) Reaction Conditions
(3) PCR Step
(4) Restriction Enzyme Treatment
(5) Size Fractionation
5.3. Vector-Capping Method
Conclusion
References
Chapter 23
An Epigenetic View on Alternative Splicing
Abstract
1. Introduction
2. Alternative Splicing and RNA Pol II Elongation Rate
3. Nucleosomes and Alternative Splicing
4. Chromatin Remodeling and Alternative Splicing
5. Histone Post-Translational Modifications and Alternative Splicing
6. Intragenic DNA Methylation and Alternative Splicing
Conclusion
References
Chapter 24
Alternative RNA Splicing and Regulation of Nitric Oxide Signaling
Abstract
Abbreviations
Introduction
NO/cGMP Pathway and Its Role in Physiology
Neuronal Nitric Oxide Synthase (nNOS)
Endothelial Nitric Oxide Synthase (eNOS)
NO-Inducible Heterodimeric Soluble Guanylyl Cyclase (sGC)
cGMP-Dependent Protein Kinase G (PKGI)
cGMP Phosphodiesterases (PDEs)
Cyclic Nucleotide Gated Ion Channels (CNGCs)
Conclusion
References
Chapter 25
Alternative Splicing by Analyzing a Human mRNA Diversity Using Data of FLJ Human cDNAs
Abstract
Introduction
Identification of Transcription Products Produced by Variety of Tne Human mRNA
Construction of the Custom DNA Microarray for Analysis of mRNA Variation
Analysis of Alternative Splicing Using NT2 Cells
Induced Neuronal Differentiation by Retinoic Acid
Analysis of Relationship between mRNA Variation by Alternative Splicing and the Gene Function
Conclusion
References
Chapter 26
Alternative Splicing in Human Immune System and Autoimmune Diseases
Abstract
Alternative Splicing and Immune Cell Function
Alternative Splicing and Cytokine Response
Dysregulated Splicing in Autoimmune Diseases
Summary
References
Chapter 27
Poly(ADP-Ribosyl)ation Regulates Alternative Splicing
Abstract
Introduction
1. Regulation of Alternative Splicing by PARylation
1.1. Interaction of hnRNPs with Poly(ADP-ribose)
1.2. Inhibition of RNA-Binding Ability of hnRNP Proteins by PARylation
1.3. Splicing Regulation by PARylation of hnRNPs
1.4. Splicing Regulation by PARylation of S/R Proteins
2. Regulation of Splicing by PARP1 during the Transcription Process
2.1. Coupling Transcription with Splicing by Epigenetic Mechanisms
2.2. Chromatin Remodeling by PARP1
2.3. Linking Transcription with Splicing by PARP1
3. Perspectives
Acknowledgments
References
Chapter 28
Patent Roadmap for the Biosensor Space
Abstract
Introduction
Personalized Medicine
History of Personalized Medicine
Landscape of Personalized Medicine
“An Ounce of Prevention Is Worth a Pound of Cure” -Benjamin Franklin
The Exigent Need for Personalized Medicine
“Declare the Past, Diagnose the Present, Foretell the Future” -Hippocrates
Bioinformatics
Wearable Technology
Lifestyle Wearables
Medical and Healthcare Wearables
Diagnostic Wearables: Real-time Medicine
Therapeutic Implantables/Embeddables: The Future of Personalized Medicine
The Cloud and Home Automation as the Next Frontier: Analytics and Provisioning
Internet of Things Ecosystem
Challenges
The Broad-Sweeping Implications
Value of Patents
Patent Strategy
Step 1
Step 2
Step 3
Hypothetical Valuation Case Study
Step 1
Step 2
Step 3
Impact of Alice and Mayo on IP
Patent Prosecution
IP Due Diligence
Claim Drafting in the Wake of Bilski, Mayo, Myriad & Alice
Licensing
Enforcement
FDA’s Role in the ‘App’ World
Reimbursement
Can Intellectual Property and Open Source Co-Habitate?
Big Data and Privacy: Big Challenge of the Future
HIPAA and the Age of Big Data: Old Laws New Problems
Acknowledgments
References
Chapter 29
Avoidant/Restrictive Food Intake Disorder in a Female Patient Affected by Marfan Syndrome
1Centre for Inherited Cardiovascular Diseases, IRCCS,
Fondazione Policlinico San Matteo, Pavia, Italy
2Fondazione Istituto Neurologico Nazionale C. Mondino,
IRCCS, Pavia, Italy
Abstract
Introduction
1. Marfan Syndrome
2. Association between Marfan Syndrome and Psychiatric Disorders
3. Selective Feeding
4. L.’s Clinical Case
Conclusion
References
Chapter 30
Optimizing Oil Production in B. napus by Gene Stacking: Transgenic Co-Expression of DGAT1 and Partially-Suppressed mtPDCK Cumulatively Enhance Seed Lipid Deposition
Abstract
Introduction
Materials and Methods
Plant Material and Target Genes
Production of Transgenic Lines
A. Thaliana DGAT1 Lines
T. majus DGAT1 and T. majus SDM DGAT1 Lines
mtPDCK Suppression Lines
Two-Gene Stack Lines
Field Trials
Analysis of Seed Oil Content and Composition in Transgenic Lines
Protein Analyses
Results
DGAT1 Lines
Repressed Mitochondrial PDCK Lines
Increases in Brassica napus Seed Oil Content in Transgenic Lines Expressing the Two-Gene Construct Containing the SDM T. majus DGAT1 Plus A/S B. napus mtPDCK
Discussion
Single Gene Transfers for Improvements in Oil Content
Gene Stacking
Gene Stacking for Improvements in Oil Composition
Gene Stacking for Improvements in Oil Content
Effects on Seed Weight
Effects of the 2-Gene Stack on Protein Content
Future Studies and Conclusion
Acknowledgments
References
Chapter 31
Periodontitis: A Common Oral Disease the Genetic Susceptibility
Abstract
1. Periodontitis - A Brief Introduction
2. Review of Genetic Studies on Periodontitis
2.1. Periodontitis Associated with Other Genetic Disorders
2.2. Inheritability of Periodontal Disease: Family Aggregation and Twin Studies
2.3. Heredity Mode and Heterogeneity: Segregation Analysis and Early Linkage Study
2.4. Complex Common Disease Associated with Single Nucleotide Polymorphisms
2.4.1. Candidate Gene Association Study
2.4.2. Cytokine
2.4.2.1. Interleukins (IL)
IL-1
IL-4 and IL-13
IL-6
IL-10
2.4.2.2. Tumor Necrosis Factor Alpha
2.4.2.3. Cell Surface Receptors
The Fc Gamma Receptor Genes
Toll-Like Receptor
Vitamin D Receptor
2.4.2.4. Matrix Metalloproteinases
2.4.2.5. Summary of Candidate Gene Study
2.4.3. Genome-Wide Association Study (GWAS)
2.5. Future Direction
3. Functional Study
3.1. Observation at the mRNA and Protein Level
3.2. Annotation
3.2.1. Computational Annotation
3.2.2. Experimental Annotation
3.3. Epigenetic Regulation of Gene Expression and Gene-Environment Interactions
Conclusion and Future Direction
Acknowledgments
References
Chapter 32
Genomic Imprinting and the Brain: Neuron-Specific Switching of Gene Expression at Imprinting Regions
Abstract
Introduction
Overview of the SNRPN-UBE3A Domain
Bipartite IC of the SNRPN-UBE3A Domain
Developmental Regulation of the Bipartite IC
The Role of U Exon Transcription in Maternal Silencing of Snrpn
Regulation of Paternal Expression of Ube3a-ATS
Neuron-Specific Chromatin Decondensation and Localization of Paternal Transcripts to Their Transcription Sites
Model of Paternal Ube3a Silencing by Ube3a-ATS Transcripts
Overview of the DLK1-DIO3 Domain
Overview of the GRB10 Domain
Conclusion
References
Chapter 33
Pharmacogenomics Focusing on Phase Two Metabolizing Enzymes
Abstract
Introduction
UGT Gene Super Family Encodes Critical Phase Two Metabolizing Enzymes
Future Perspective
References
Chapter 34
Sexual Dimorphism in Insect Longevity: Insights from Experimental Evolution
Abstract
Introduction
1. The Role of Natural Selection in Shaping Insect Longevity
2. Sexual Conflict and Evolution of Sexual Dimorphism in Longevity
3. Mechanistic Causes of Sex-Specific Ageing
3.1. Neuroendocrine Regulation of Ageing
3.2. Metabolic Differences between Sexes and Longevity Consequences
3.2.1. Nutritional Basis of Ageing
3.2.2. Stress Resistance and Life-Span
3.2.3. The Roles of Mitochondria
Acknowledgments
References
Chapter 35
Evidence of Natural and Sexual Selection Shaping the Size of Nuptial Gifts among a Single Bush-cricket Genus (Poecilimon; Tettigoniidae): An Analysis of Sperm Transfer Patterns
Abstract
Introduction
Materials and Methods
Species and Sites
Spermatophore Consumption Time, Male Body Mass and Spermatophore Mass
Sperm Transfer
Analysis
Sperm Transfer and Spermatophore Consumption
Relative Spermatophore Mass and Proportion of Sperm Transferred
Phylogenetic Independent Comparisons
Results
Spermatophore Consumption and Sperm Transfer
Relative Spermatophore Mass and Proportion of Sperm Transferred
Discussion
Acknowledgments
References
Chapter 36
Mate Choice Copying in Both Sexes of the Guppy: The Role of Sperm Competition Risk and Sexual Harassment
Abstract
Introduction
Materials and Methods
Study Species and Animal Maintenance
Experiment 1
Experiment 2
Statistical Analysis
Experiment 1
Experiment 2
Results
Experiment 1: Mate Choice Copying in Males and Females
Preference for Large Mating Partners
Changes in Individual Preferences
Experiment 2: Preference for Different Copying Situations
Discussion
Acknowledgments
References
Chapter 37
Sexual Selection under Parental Choice: Mating Strategies and Reproductive Success
Abstract
Introduction
Parent-Offspring Conflict over Mating
The Model of Parental Choice
Sexual Selection under Parental Choice in Human Societies
Sexual Selection under Parental Choice in Pre-Industrial Societies
Sexual Selection under Parental Choice in Post-Industrial Societies
In-Law Preferences
Male Mating Strategies
Polymorphism in Mate Choice
The Evolution of Rape
Circumventing Parental Choice
Circumventing Female Choice
Conclusion
References
Chapter 38
Melon Germplasm Characteristics, Diversity, Preservation and Uses
Abstract
1. General Introduction: The Need for Germplasm Banks
2. Collection, Conservation, Characterization and Evaluation of Melon Resources
3. Melon Genetic Resources Management
3.1. Morphological Markers
3.2. Biochemical Markers: Isozymes
3.3. Genetic Markers
3.4. Core Collections
4. Uses of Melon Germplasm
5. Challenges and Prospects
References
Chapter 39
Preservation and Characterization of Woodland Grape (Vitis vinifera ssp. sylvestris GMEL.) Genotypes of the Szigetköz, Hungary
Abstract
Introduction
Materials and Methods
Results
Discussion
Acknowledgment
References
Chapter 40
A Mini Review on Morphological and Genetic Diversity of Sweet (Prunus Avium L.) and Sour Cherry (Prunus Cerasus L.) Cultivars
Abstract
Introduction
Morphological Traits
Isoenzyme Analysis
Genetic Diversity Studies with Molecular Markers
Sweet Cherry
Sour Cherry
S-Allele Genotyping
Conclusion
References
Chapter 41
Research on Purple Seed Stain of Soybean: Germplasm Screening and Genetic Resistance
Abstract
Introduction
Disease Symptoms
The Causal Agents
Disease Development and Epidemiology
Disease Management
Soybean Germplasm Screening for Resistance to Purple Seed Stain
Evaluation of Soybean Cultivars for Reaction to Cercospora Leaf Blight
Genetic Resistance
Summary
Acknowledgments
References
Chapter 42
Somatic and Gonadal Tissue Cryopreservation: An Alternative Tool for the Germplasm Conservation in Wild Mammals
Abstract
1. Introduction
2. The Testicular Tissue
2.1. Tissue Source
2.2. Tissue Preparations
2.3. Cryopreservation Techniques and Evaluations
Freezing Protocols
Addition of Cryoprotectant Agents
Tissue Analysis
2.4. Use of Testicular Tissue in the Conservation Programs
3. The Ovarian Tissue
3.1. Tissue Source and Preparation
3.2. Cryopreservation Techniques and Evaluations
3.3. Current Applications of Ovarian Tissue in Conservation Programs
4. The Somatic Tissue
4.1. Tissue Sources
Skin Biopsy
Others Sources of Somatic Tissues
4.2. Tissue Preparations
4.3. Cryopreservation Techniques and Evaluations
4.4. Use of Somatic Tissue in the Conservation Programs
5. General Considerations
References
Biographical Sketch
Chapter 43
Mitochondrial Gene Diversity of the Mega-Herbivorous Species of the Genus Tapirus (Tapiridae, Perissodactyla) in South America and Some Insights on Their Genetic Conservation, Systematics and the Pleistocene Influence on Their Genetic Characteristics
Abstract
Introduction
Materials and Methods
Molecular Procedures
Data Analyses
Genetic Diversity, Linkage and Heterogeneity Analyses
Phylogenetic Analyses
Demographic Changes
Spatial Structure
Results
Gene Diversity, Genetic Heterogeneity and Phylogenetic Considerations for the Latin American Tapir Taxa
Demographic Changes in Latin American Tapirs
Spatial Structure
Discussion
Genetic Conservation of the Latin American Tapirs
Systematics of the Neotropical Tapirs and the Case of the Alleged “T. Kabomani”
The Impact of the Pleistocene Changes on the Phylogeography of T. pinchaque and T. terrestris
Acknowledgments
References
Chapter 44
Strategies for Gene Prospecting of Plants in Response to Drought and Salinity
Abstract
1. Introduction
2. Genes Coding for Proteins Involved in Reponse to Drought and Salinity in Plants
2.1. Basic Leucine Zipper Proteins and Abscisic Acid
2.2. Late Embryogenesis Abundant Proteins
2.3. Calcineurin B-like proteins
2.4. Trehalose-6-Phosphate Synthases and Phosphatases
2.5. Pyrroline-5-Carboxylate Synthases and Reductases
2.6. Aquaporins
3. Approaches to Identification of Genes in
Response to Drought and Salinity
3.1. Differential Display Reverse Transcription-Polymerase Chain Reaction
3.2. cDNA-Amplified Fragment Length Polymorphism
3.3. Microarray
3.4. Suppression Subtractive Hybridization
3.5. Next Generation Sequencing
4. Plant Genetic Transformation
4.1. Agrobacterium-Mediated Genetic Transformation
4.2. Biolistic-Mediated Genetic Transformation
Conclusion
References
Chapter 45
Clinical Evidence and the Genetic Effects of Traditional Chinese Medicine for the Management of Proteinuria in Patients with Diabetic Nephropathy
Abstract
Introduction
Clinical Evidence of TCM for Proteinuria in DN Patients
What Are the Results of Randomized Controlled Trials Studying the Anti-Proteinuric Effects of TCM in Patients with DN?
TCM as a Monotherapy
TCM Extract
Tripterygium Glycoside
Formulae
Tangjiang Shenkang (TJSK)
Qiyao Xiaoke (QYXK)
Combination Therapy with TCM and Western Medicine
Astraglus
Other TCM
What Do the Systematic Reviews and Meta-Analyses Report in This Area?
TCM Extract
Breviscapine
Tripterygium Glycoside
Ligustrazine
Ginkgo Biloba Extract
Puerarin
Individual Traditional Chinese Medicinal Herb
Astraglus
Formulae
Xuezhikang
Danhong
Tongxinluo
Other TCM
What Are the Limitations with Respect to this Clinical Evidence?
The Effects of TCM on DN at the Genetic Level
What Are the Effects of TCM on DN at the Genetic Level in Animal Experiments?
TCM Extract
Gypenosides
Breviscapine
Artemisinin
Individual Traditional Chinese Medicinal Herb
Astraglus
Formulae
Shenxiao Kang (SXK)
What Are the Effects of TCM on DN at the Genetic Level in Humans?
The Association between the Clinical Evidence and the Genetic Effects of TCM
What Is the Association?
How to Relate Them?
Summarization of Current Literature
Clinical Evidence
Genetic Effects
Conclusion
Conflict of Interest
Acknowledgments
References
Chapter 46
Biochemistry and Genetics of Ansamycin Antibiotics
Abstract
Introduction
Maytansinoids
Benzenoid Ansamycins
Ansamitocin
Geldanamycin
Macbecin
Herbimycin
Mycotrienins (Ansatrienins), Trierixin and Quinotrierixin
Cytotrienin
Trienomycin
Naphthalenoid Ansamycins
Rifamycin
Rifampicin
Rifabutin
Rifapentine
Salinisporamycin
Hygrocin
New Bioactive Ansamycin
Chaxamycins
Juanlimycins
References
Chapter 47
BRCA Gene Mutations Mediate Particularly High TNBC Risk by Defective Estrogen Signaling
Abstract
Introduction
Interactions between Endogenous Estrogens and Well Functioning, Wild BRCA Genes
Defective Estrogen Signaling Associated with BRCA Gene Mutations
Decreased ER-Alpha Expression in Cells with BRCA Gene Mutation
Decreased Estradiol-Liganded Transcriptional Activity of ERs in BRCA Gene Deficient Cells
Defensive Counteractions against BRCA Gene Defects
Increased Aromatase Activity Associated with BRCA Gene Mutation
Hyperestrogenism as Compensatory Mechanism in Women with BRCA Gene Mutation
Increased Ligand-Independent Transcriptional Activity in Cells with BRCA1 Mutation
Hormonal Risk Factors for Overall Breast Cancer and TNBC
Correlations between Menopausal Status and TNBC Risk
Correlations between Reproductive History and the Risk of Different Breast Cancer Subtypes
Conclusion
References
Chapter 48
Genotype-Phenotype Relationships in Language Processes in Rett Syndrome
Abstract
1. Introduction
1.1. Rett Syndrome (RTT)
1.2. Standard Form of Clinical Features
1.3. Clinical Features of Variant Form
2. Genotype Characterization
2.1. Mutations in MECP2 Gene
2.2. MECP2 Proteine’s Structure
3. Phenotypes with Gene Mutation MECP2
4. Language in Rett Syndrome
5. Methods
5.1. Participants
5.2. Material
Cognitive Measures
Linguistic Measures
Respiratory Evaluation
5.3. Procedure
5.4. Results
Conclusion
References
Chapter 49
Marfan Syndrome: A Rare and Sometime Very Disabling Genetic Disorder
Abstract
Introduction
History of Marfan Syndrome
Genetic Causation and Frequency of Marfan Syndrome
Clinical Findings in Patients with Marfan Syndrome
Diagnostic Studies for the Study of Patients Suspected of Having Marfan Syndrome
Treatment of Patients with Marfan Syndrome
Discussion
References
Chapter 50
Marfan Syndrome and Periodontitis
Abstract
1. Marfan Syndrome: A Systemic Connective Tissue Disorder
2. Periodontitis: An Oral Connective Tissue Disorder
3. TGF-( Is a Common Critical Factor in MFS and Periodontitis
4. Clinical Observation of Periodontitis in MFS Patients
Conclusion
Acknowledgments
References
Chapter 51
Combined Pectus Correction and Aortic Valve Sparing Root Replacement in Marfan Patients
Abstract
Most of Chest Wall Deformities Are Pectus Excavatum (PE)
Operative Techniques for Pectus Excavatum
Methods
Results
Discussion
Conclusion
References
Chapter 52
Severe Periodontitis in Marfan Syndrome
Abstract
1. Cardiac problems and Angiotensin II Receptor Blocker (ARB) in Marfan Syndrome
2. Periodontal Disease in Marfan Syndrome
3. ARB and Periodontal Disease
References
Chapter 53
Preimplantation Genetic Diagnosis for Marfan Syndrome
Introduction
References
Chapter 54
Anuran Cytogenetics: An Overview
Abstract
1. Cytogenetics, Taxonomy and Phylogenetic Inferences
1.1. Inferences of Evolutionary Changes in Diploid Number
1.2. Inferences Related to Chromosomal Morphology or Chromosomal Markers
2. Cytogenetics as a Helpful Taxonomic Tool
3. How to Study Frog Chromosomes
4. PcP190 Satellite DNA
4.1. Satellite DNA as Chromosome Markers
4.2. PcP190 satDNA in Engystomops: Sequences and Chromosome Locations
5. Sex Chromosomes in Anura
5.1. Sex Determination in Anurans: More Questions Than Answers
5.2. Sex Chromosome Differentiation
5.3. Sex Chromosome Turnover and Occasional Recombination between Sex Chromosomes
5.4. New Technologies in the Study of Sex Chromosomes in Anurans
6. B Chromosomes in Anura: General Properties and Exceptions
References
Chapter 55
Human Cytogenetic Biomonitoring
Abstract
An Introduction to Human Biomonitoring
Cytogenetic Biomarkers in Human Biomoniroting
Chromosomal Aberrations (CAs): Mechanisms and Methodology
Micronucleus (MN): Mechanisms and Methodology
Sister Chromatid Exchanges (SCEs): Mechanisms and Methodology
CAs, MN, SCEs and Risk Predictivity of Human Diseases
Application in Other Human Cells
Conclusion
Acknowledgments
References
Chapter 56
Complex Karyotypes and Their Detection in Hematologic Malignancies: The Ongoing Role for Classical Cytogenetics
Abstract
Introduction
Genomic Instability and Chromosomal Aberrations
Methods of Detection of Chromosomal Aberrations
Complex Karyotype in Selected Hematologic Malignancies
Myelodysplastic Syndrome (MDS)
Adult Acute Myeloid Leukemia (AML)
Chronic Lymphocytic Leukemia (CLL)
Mantle Cell Lymphoma (MCL)
Multiple Myeloma (MM)
Conclusion
References
Chapter 57
Natural Hybridization between Chromosomal Discrepant Species and the Role of Hybrid Speciation in the Genus Astyanax
Abstract
Introduction
Material and Methods
Results
Discussion
Acknowledgments
References
Chapter 58
Trichorhinophalangeal Syndrome (TRPS) Revisited
Abstract
Introduction
Phenotype of TRPS Type I, II and III Patients
TRPS Type I Patients
TRPS Type II Patients
TRPS Type III Patients
Genetics
Diagnosis
Clinical Diagnosis
Genetic Diagnosis
Differential Diagnosis
Treatment
Genetic Counseling
References
Chapter 59
Epigenetic Modifications and Developmental Origin of Health and Diseases (DOHaD)
Abstract
Abbreviations
1. Introduction
2. What Is Epigenetics?
2.1. DNA Methylation
2.2. MicroRNAs
3. Evidence from Human Cohorts
3.1. Fetal Programming Hypothesis
3.2. DNA Methylation and Fetal Programming Hypothesis
3.3. MicroRNAs and Fetal Programming Hypothesis
4. Evidence from Animal Experiments
4.1. DNA Methylation and Animal Experiments
4.1.1. Maternal Nutrition
4.1.2. Paternal Nutrition
4.2. MicroRNAs and Animal Experiments
4.2.1. Maternal Nutrition
4.2.2. Paternal Nutrition
5. Developmental Plasticity and Reversibility
Conclusion and Further Perspective
References
Chapter 60
Effects of Oxidative Stress on Epigenetic Mechanisms
Abstract
Abbreviations
1. Epigenetic Mechanisms
1.1. DNA Methylation
1.2. Histone Post-translational Modifications
1.3. Micro RNAs and Epigenetic
2. Oxidative Stress
3. Interactions between Oxidative Stress and Epigenetic Mechanisms
3.1. Oxidative Stress - DNA Methylation
3.2. Oxidative Stress - Histone Post-Translational Modifications
3.3. Oxidative Stress – miRNAs
Conclusion
References
Chapter 61
Epigenetic Modifications and Their Potential Role in Tumorigenesis
Abstract
Abbreviations
1. Introduction
2. The Dysregulation of Epigenetic Factors in Various Cancers
2.1. The Deregulation of DNA Methylation in Cancer
2.2. The Deregulation of Histone Lysine Methylation in Cancer
2.3. The Deregulation of Histone Lysine Demethylases in Cancer
3. Histone Lysine Acetylation in Cancer
3.1. The Deregulation of Histone Lysine Acetyltransferases in Tumor Proliferation and Metastasis
3.2. The Deregulation of Histone Lysine Deacetylases (KDACs) in Cancer
4. Histone Acetylation “Code” as a Diagnostic Marker for Cancer Progression
5. Epigenetic Modifications in Oncogenes and Tumor Suppressor Genes
6. Epigenetic Modifications in Cellular Signaling Pathways
6.1. NF-(B Signaling Pathway
6.2. STAT3 Signaling Cascade
6.3. Wnt/(-Catenin Signaling Pathway
7. Epigenetic Modification in Cancer Stem Cells
8. Epigenetic Modifications Associated with Cancer Chemo- and Radio-Resistance
9. Pharmacological Inhibitors of Epigenetic Modifications
Perspectives and Conclusion
Acknowledgment
Conflict of Interest
References
Chapter 62
Alzheimer’s Disease: An Insight from Epigenetic Perspective
Abstract
Abbreviations
1. Introduction
2. Pathogenesis of Alzheimer's Disease
2.1. Aβ Hypothesis
2.2. Tau Hypothesis
2.3. Oxidative Stress in Alzheimer’s Disease
2.4. Metal Dyshomeostasis in Alzheimer’s Disease
2.5. Mitochondrial Dysfunction in Alzheimer’s Disease
2.6. Neuroinflammation in Alzheimer’s Disease
2.7. Mutations and Polymorphisms in Alzheimer’s Disease
3. Epigenetic Changes in Alzheimer's Disease
3.1. DNA Methylation
APP Gene
BACE, PS1 and DNMT Genes
Neprilysin (NEP)
3.2. Histone Modifications
3.3. MicroRNAs
4. Future Perspectives
References
Chapter 63
Epigenetic Mechanisms in Cardiovascular Diseases
Abstract
Abbreviations
1. Epigenetic Mechanisms
2. Epigenetic Mechanisms in Heart Development
2.1. DNA Base Modifications
2.2. Histone Code
2.3. MiRNAs and lncRNAs
3. Epigenetic Mechanisms in CVDs
3.1. DNA Base Modifications
3.2. Histone Code
3.3. MiRNAs and lncRNAs
4. Cardiovascular Risk Factors and Epigenetics
5. Epigenetics-Based Therapeutic Strategies in CVDs
Conclusion
References
Chapter 64
Insights from Epigenomics Analysis of Sperm: Sperm Development and Male Infertility
Abstract
Abbreviations
Introduction
1. Sperm Cell Development
2. Epigenetic Reprogramming of Male Germ Cells
2.1. DNA Methylation
2.2. Histone Modifications
2.3. Chromatin Remodeling
2.4. Small RNAs
3. Epigenetic Dysregulation: Male Infertility
3.1. Male Infertility
3.2. Genomic Imprinting
3.3. DNA Methylation
4. Epigenetics in ART (Assisted Reproductive Techniques)
5. Epigenetic Make-Up of Induced Pluripotent Stem Cells/PGC from Adult Cells
Conclusion
References
Chapter 65
Epigenetics, Inflammation and Inflammatory Related-Diseases:
A General Look
Abstract
Abbreviations
1. Introduction
1.1. DNA Methylation and Inflammation
1.2. Histone Modifications and Inflammation
1.3. Non-Coding RNAs and Inflammation
1.3.1. Long Non-Coding RNAs
1.3.2. Micro RNAs
2. Epigenetics and Inflammatory Disorders
2.1. Inflammatory Bowel Disease (IBD)
2.2. Rheumatoid Arthritis (RA)
2.3. Systemic Lupus Erythematous (SLE)
2.4. Multiple Sclerosis (MS)
2.5. Diabetes
2.6. Bacterial Infections
3. Epigenetics, Inflammation and Cancer
Conclusion
References
Chapter 66
A New Molecular Approach to Obesity: Epigenetic Perspective
Istanbul University Cerrahpasa Medical Faculty,
Department of Medical Biology, Istanbul, Turkey
Abstract
Abbreviations
1. Obesity and Its Molecular Pathogenesis
2. Epigenetics: Basic Mechanisms
3. Obesity: From an Epigenetic Perspective
3.1. Programmed Obesity and the Epigenome
3.2. Epiobesigenic Genes
Conclusion
References
Chapter 67
Genetics and Evolution of Entomopathogenic Fungi
Abstract
Entomopathogens Role in Nature
Biological Control
Plants Manipulate Fungal Entomopathogens
The Ecology of Fungal Entomopathogens in the Rhizosphere
Entomopathogenic Fungi and Their Interactions with the Insect Immune System
Classification
Important Species
Mode of Action
Adhesion and Germination
Penetration
Reproduction and Replication
Isolation of Entomopathogenic Fungi
Isolation by Serial Dilution
Direct Isolation of Entomopathogenic Fungi from Insects
Isolation of Entomopathogenic Fungi from Soil
Morphological Characteristics of Entomopathogenic Fungi
Beauveria bassiana
Metarhizium anisopliae
Paecilomyces lilacinus
Nomurae rileyi (Metarhizium rileyi)
Lecanicillium (=Verticillium) lecanii
Isaria fumosorosea
Hirsutella thompsonii
Aschersonia aleyrodis
Entomophthora muscae
Molecular Identification of Entomopathogenic Fungi
Genetic Diversity among Entomopathogenic Fungal Strains
Beauveria spp
Metarhizium spp
Paecilomyces spp
Genes Involved in Virulence of Entomopathogenic Fungi
Molecular Phylogeny of Entomopathogenic Fungi and Their Biogeographic Implications
Evolution of Pathogenicity Genes in Entomopathogens
Contraction and Expansion of Different Gene Families
Entomopathogen Fungi Pathogenicity versus Insect-Host Defense
Genetic Improvement of Entomopathogenic Fungi for Insect Biocontrol
Future Trends
Conclusion
Acknowledgments
References
Biographical Sketch
Chapter 68
Mitochondrial Population Genetics Inferences about the Phylogeography and Systematics of the Tayra (Eira barbara, Mustelidae, Carnivora)
Abstract
Introduction
Materials and Methods
Samples
Molecular Analyses
Data Analyses
Genetic Diversity
Phylogenetics Analyses
Heterogeneity Analyses
Demographic Changes
Results
Genetic Diversity and Phylogenetic Inferences
Genetic Distances and Genetic Heterogeneity among Putative Morphological Subspecies of Eira barbara
Demographic Evolutionary Changes in the Tayra
Discussion
Genetic Diversity
Genetic Heterogeneity, Gene Flow and the Systematics of the Tayra
Temporal Splits in the Tayras
Acknowledgments
References
Chapter 69
The Precision Medicine and Precision Public Health Approaches to Cancer Treatment and Prevention: A Cross-Comparison
Abstract
From the Human Genome Project to the Precision Medicine Initiative
Definitions of Precision Medicine and Precision Public Health
Pharmacogenomic Interventions and Cost-Effectiveness
The Precision Medicine Approach to Lung Cancer
The Precision Medicine Approach to Breast Cancer
The Precision Medicine Approach to Colorectal Cancer
Taking Precision Medicine Beyond the Personalized Level
Public Health Interventions and Cost-Effectivness
The Precision Public Health Approach to Lung Cancer
The Precision Public Health Approach to Breast Cancer
The Precision Public Health Approach to Colorectal Cancer
Conclusion: Continuity and Emergence in Precision Health Approaches
References
Chapter 70
Neuropsychological Profile of People with Williams Syndrome (WS)
Abstract
Introduction
Intellectual Ability
Perceptual Skills (Visual and Auditory)
Oral Language
Memory Abilities
Executive and Attentional Functions
Discussion and Perspectives
References
Chapter 71
Preimplantation Genetic Diagnosis (PGD) for Chromosome Rearrangements
Introduction
Embryo Biopsy
Pregnancy History of Chromosome Rearrangement Carriers
PGD for Balanced Reciprocal Translocation
PGD for Robertsonian Translocation
PGD for Complex Chromosome Rearrangement (CCR)
Application of Comprehensive Chromosome Screening (CCS) into PGD for Balanced Chromosome Rearrangements
Conclusion
References
Biographical Sketch
A. Positions
B. Selected Peer-Reviewed Publications
Chapter 72
A Family-Based Association Study between the BDNF Gene and Attention Deficit Hyperactivity Disorder in Mexican Children and Adolescents
Abstract
Introduction
Material and Methods
Patients and Participants
Ethic Considerations
Clinical Evaluation
Genotyping Tests
Statistical Analysis
Results
Discussion
Conclusion
Acknowledgments
Financial Support
Statement of Interest
Ethical Standards
References
Chapter 73
Petroleum Microbiology and Genetics
Abstract
1. Introduction
1.1. Formation of Petroleum in Relation to Geological Processes
1.1.1. The Origins of Oil
1.1.2. Determinant Factors of the Petroleum’s Occurrence in Sedimentary Basins
1.1.2.1. Generating Rock
1.1.2.2. Reservoir Rocks
1.1.2.3. Conversion of Kerogen into Oil
1.1.3. Petroleum Migration and Accumulation: Primary and Secondary Migration
1.2. Petroleum Composition
1.3. General Concepts Concerning Oil Industry: Exploitation, Recovery and Refining Process
1.4. Petroleum and the Environment: Pollution and Environmental Impacts
1.4.1. Acidification of the Oceans
1.4.2. Oil Spills
1.5. The Microbiome of Oil Reservoirs
1.6. Petroleum Degrading Genes and Metabolic Pathways
1.7. Biofilms in the Petroleum Industry
1.8. Metagenomics for Marine Microbial Communities
1.9. Microbiologically-Influenced Corrosion (MIC)
1.10. Microbial Control Methods Related to Oil Industry
1.11. Bioremediation of Organic and Hydrocarbon Pollutants
1.12. Reservoirs Souring
Conclusion
References
Chapter 74
Estrogen Activated ERs are the Chief Genetic Safeguards of Somatic and Reproductive Health in Mammalians
Abstract
Introduction
Fundamental Roles of ER Signaling in the Physiology of Mammalians
ER-Signaling Is in Strong Mutual Correlation with DNA Stabilizer Genes and Their Protein Products
Correlations between ER-Signaling and the BRCA System for Safe DNA Replication
The Circular Functional Mainstream of Three Crucial Genetic Units Involved in Maintaining Genomic Stability
I. Transcriptional Activities of ESR1 Promoter Regions
II. Transcriptional Activities of BRCA1 Promoter Regions
III. Transcriptional Activities of CYP19 Aromatase Promoter Regions
Upregulative and Down-Regulative Crosstalk between ER-Alpha and BRCA1 in Physiologic and Malignant Cell Proliferations
Tumor Cells Exhibit Remnants of the Machinery of Genome Stabilization Providing Circumstances for Self-Directed Domestication and Elimination
Clinical Data on Tumor Responses to Antiestrogen Treatment
Experimental Data on Tumor Responses to Antiestrogen Treatment
Conclusion
References
Chapter 75
Motor Abilities are Related to Specific Genotypes in Rett Syndrome
Abstract
1. General Introduction
1.1. Genetics and Clinical Features of RTT
1.2. MECP2 Mutations and Functions
1.3. CDKL5 and FOXg1 Gene Mutations
1.4. Severity and Genotype-Phenotype Relationships
2. Motor Features in Rett Syndrome
2.1. Motor Characteristics According to Rett Syndrome Stages
2.2. Neurological and Muscle Symptoms
3. Methods
3.1. Participants
3.2. Material
3.2.1. Motor Scale
3.3. Results
Conclusion
References
Chapter 76
A Longitudinal Study on the Development of a Boy with Fragile X Syndrome: Developmental Trends and Adaptive Changes in a Single Case Report
Abstract
1. Introduction
2. Method
2.1. Subject
2.2. Measures
2.3. Procedure
3. Results
4. Discussion
References
Chapter 77
Cornelia De Lange Syndrome: A Review
Abstract
Introduction
Clinical Features
Neuropsychiatric and Neurosensory
Craniofacial
Musculoskeletal
Cardiovascular and Pulmonary Findings
Gastrointestinal
Genitourinary
Pathogenesis and Causes
Diagnosis
Treatment
Support Services
Conclusion
References
Further Reading
Chapter 78
Cognitive-Behavioral Phenotype in Klinefelter Syndrome (KS) and Other Sex Chromosomal Aneuplodies (SCAs):
Clinical Variability
Abstract
1. Introduction
2. Present Study
3. Results
3.1. Developmental and Clinical History
3.2. DSM-IV Diagnosis
3.3. IQ and Adaptive Behavior
3.3.1. SCL-90
3.3.2. SCQ
3.4. Bem Sex Role Inventory
4. Discussion
Conclusion
References
Chapter 79
Transcranial Direct Current Stimulation (tDCS) and Cognitive Empowerment for the Functional Recovery of Diseases with Chronic Impairment and Genetic Etiopathogenesis
Abstract
1. Introduction
2. Current Study
2.1. Methods
2.1.1. Participants
2.2. Procedure
2.3. tDCS Stimulation Protocol
2.4. Results
2.4.1. Comparative Analyses
2.4.2. Statistical Analyses
2.4.3. Production of Vowels
2.4.4. Production of Consonants
2.4.5. Production of Words
2.4.6. Quantitative EEG Analysis
Conclusion
References
Chapter 80
Control of Force and Timing during Unimanual and Bimanual Tapping Movements of Adolescents with Down Syndrome
Abstract
Introduction
Method
Participants
Apparatus and Measurements
Procedure
Statistical Analysis
Results
Discussion
Conclusion
References
Chapter 81
Management of Executive Function Following Assisted Cycling Therapy
in Adolescents with Down Syndrome
Abstract
Introduction
Methods
Results
Discussion
Strengths and Limitations
Conclusion
References
Biographical Sketch
Chapter 82
Endocrine Features and Management of Endocrine Problems in Down Syndrome
Abstract
Introduction
Length, Height and Growth Hormone Axis
Weight and Nutritional Habits
Puberty and Fertility
Thyroid Function and Disorders
Bone Mineral Status and Metabolism
Autoimmune Diseases
Conclusion
References
Chapter 83
Autosomal Dominant Polycystic Kidney Disease: Pathophysiology and Treatment
Abstract
1. Introduction
2. Primary Cilia and Cystic Kidney
3. Liver Cysts
4. Pancreatic Cysts
5. Diverticulitis
6. Pain
7. Hypertension
7.1. Endothelin
7.2. Primary Cilia and Nitric Oxide
7.3. Angiotensin
8. Left Ventricular Hypertrophy
9. Aneurysm
10. Therapeutic Treatments for Cardiovascular Complications
11. Modern Therapies to Halt Progression of Renal Cysts
11.1. cAMP
11.2. mTOR
11.3. EGFR
11.4. Other Potential Targets
Summary
References
Chapter 84
Hereditary Haemorrhagic Telangiectasia or Rendu-Osler-Weber Syndrome
Abstract
Introduction
HHT Is a Rare Disease in Spite of Its Autosomal Dominance
HHT Clinical Diagnostic Criteria
Clinical Symptoms
Epistaxis
Mucocutaneous Telangiectases
Pulmonary AVMs
Hepatic AVMs
Brain AVMs
Spinal AVMs
Gastrointestinal Bleeding
HHT Genetics
Structure of Endoglin and ALK1
The TGF-β Pathway
Functional Implications of Endoglin and ALK1
General Clinical Recommendations for Management of HHT Patients
Treatment
Epistaxis
Pulmonary AVMs
Liver AVMs
Brain AVMs
Pregnancy
Pediatrics and HHT
References
Chapter 85
Osteogenesis Imperfecta
Abstract
Introduction
Classification and Genetics
Biochemical Causes
Clinical Features
Fractures
Dental Abnormalities
Sclerae
Premature Deafness
Cardiovascular Problems
Excessive Sweating
Joint Laxity
Neurological Problems
Impaired Growth
Temperament
Life Expectancy
Radiology and Densitometry
Densitometry
Clinical Biochemistry
Differential Diagnoses
Management
Drug Therapy
Pain Relief
Orthopaedic Surgery
Surgery for Basilar Invagination
Deafness
Dental Care
Education
Acknowledgments
References
Chapter 86
Autosomal Dominant Disorders Associated to Breast Cancer
Abstract
Breast Cancer
Li-Fraumeni Syndrome
TP53
2. Cowden Syndrome
PTEN (Phosphatase and Tension Homolog)
3. Peutz-Jeghers Syndrome
STKT11 Gene
References
Chapter 87
Fragile X Syndrome
Abstract
Introduction
Fragile X Syndrome
FMRP (Fragile X Mental Retardation Protein)
Animal Models for FXS
Genetic Counseling
Newborn Screening (NBS)
Treatment
Conclusion
References
Chapter 88
Fragile X-Associated Primary Ovarian Insufficiency (FXPOI)
Abstract
Introduction
Defining the Disorder
Diagnosis and Genetic Counselling
Mechanisms Producing FXPOI
Mouse Models
Conclusion
References
Chapter 89
Fragile X-Associated Tremor/Ataxia Syndrome
Abstract
Introduction
Fragile X-Associated Tremor/Ataxia Syndrome
FXTAS Clinical and Cognitive Overview
FXTAS Neuroimaging and Neuropathological Profiles
Molecular Genetics Overview
FXTAS Treatment
Conclusion
References
Chapter 90
Psychiatric Aspects in Fragile X Syndrome and Related Phenotypes
Abstract
Introduction
Fragile X Syndrome
Autism Disorders
Hyperactivity Disorders
Mood Disorders
Anxiety Disorders
Premutation Carriers
Fragile X Associated Tremor Ataxia Syndrome (FXTAS)
Conclusion
References
Chapter 91
Clinical Features Associated with FMR1 Premutation Carriers
Abstract
Introduction
Clinical Features Associated with FMR1 Premutation Carriers
Neuropathy
Immune-Mediated Disorders
Migraines
Neurocognitive Features
Current Understanding of the Molecular Mechanisms Underlying Premutation-Associated Pathologies
Conclusion
References
Chapter 92
Genetic Counseling of FMR1
Abstract
Introduction
Genetic Counseling in FMR1-Associated Disorders
Assessment Risk Based on CGGs Expansion
Normal Range and Intermediate Alleles
Premutation Alleles
Full Mutation Alleles
Genetic Counseling Based on FMR1 Alleles
Intermediate Alleles
Premutation Alleles
Full Mutation Alleles
FMR1 Point Mutations/Deletions
Reproductive Options for Premutation/Full Mutation Carriers
Prenatal Diagnosis for FXS
Preimplantational Diagnosis for FXS
Offspring Renouncement and Adoption
Donor Germline Cell
FMR1 Testing Guidelines
Conclusion
References
Chapter 93
Treatment of Fragile X Spectrum: FXS, FXTAS and FXPOI
Abstract
Introduction
Fragile X Syndrome
The FMRP Protein and the Synapse
The Glutamate Receptor (mGluR) Hypothesis
The GABA Hypothesis
Therapeutic Approaches in FXS
MGluR5 Inhibitors
GABA-A Agonists
GABA-B Agonists
AMPA Agonists
NMDA Receptor Antagonists
Additional Treatments
Final Remarks
Fragile X-Associated Tremor-Ataxia Syndrome (FXTAS)
Fragile X-Associated Primary Ovary Insufficiency (Fxpoi)
Conclusion
References
Chapter 94
Privacy and Progress in Whole Genome Sequencing(
Executive Summary
Basic Ethical Principles for Assessing Whole Genome Sequencing
Recommendations
Strong Baseline Protections while Promoting Data Access and Sharing
Recommendation 1.1.
Recommendation 1.2.
Data Security and Access to Databases
Recommendation 2.1.
Recommendation 2.2.
Recommendation 2.3.
Consent
Recommendation 3.1.
Recommendation 3.2.
Recommendation 3.3.
Recommendation 3.4.
Facilitating Progress in Whole Genome Sequencing
Recommendation 4.1.
Recommendation 4.2.
Public Benefit
Recommendation 5.1.
Introduction
The Potential of Whole Genome Sequencing
The Challenge of Privacy
Terminology
The Promise of Whole Genome Sequencing
Privacy Concerns
Policy and Governance
Ethical Principles
Respect for Persons
Public Beneficence
Responsible Stewardship
Intellectual Freedom and Responsibility
Democratic Deliberation
Justice and Fairness
The Commission’s Process
About This Report
Work of Previous Commissions
Section 1. Ethical Principles
The Public Benefit of Whole Genome Sequencing
Privacy Concerns Raised by Whole Genome Sequencing
Privacy and the Law
The Meanings of Privacy
Restricted Access
Autonomy
The Value of Medical Privacy
Privacy in Whole Genome Sequencing
Privacy and the Ethical Principles
Reconciling Competing Ethical Claims
Newborn Screening
Conclusion
Section 2. Policy and Governance
Privacy Concerns about Genetic and Whole Genome Sequence Data
Current Sharing of Specimens and Whole Genome Sequence Data
U.S. Federal Agency Activity
International Biorepositories
Commercial Genetic Testing Companies
Privacy Regulations
U.S. Privacy Regulations
Identifying Information under HIPAA
International Approaches to Regulating Genetic Information
Legal Protections of Genetic and Whole Genome Sequence Data
Conclusion
Section 3. Analysis and Recommendations
Strong Baseline Protections While Promoting Data Access and Sharing
An Example of Computational Access
Recommendation 1.1.
Data Protections That Move with the Data
Recommendation 1.2.
Data Security and Access to Databases
Recommendation 2.1.
Recommendation 2.2.
Recommendation 2.3.
Consent
Recommendation 3.1.
BioVU: An Opt Out Database
Recommendation 3.2.
Recommendation 3.3.
Recommendation 3.4.
Facilitating Progress in Whole Genome Sequencing
Recommendation 4.1.
Recommendation 4.2.
Public Benefit
Recommendation 5.1.
Appendix I: Glossary of Key Terms
Appendix II: Genetic and Genomic Background Information
Understanding Basic Genetic Architecture
Mendelian Genetics
Why It Is Good to Have Two Copies of Each Chromosome
Gene-Environment Interactions
Genetic Variation
Sickle Cell Anemia
How Genetic Variants Translate into Disease
Sequencing Strategies
The Challenges of Analyzing Whole Genome Sequence Data and Identifying Disease Associations
Appendix III: Guest Presenters to the Commission Regarding Privacy and Whole Genome Sequencing
Appendix IV: U. S. State Genetic Laws*
End Notes
Chapter 95
Genetic Testing: Scientific Background for Policymakers(
Abstract
Introduction
Fundamental Concepts in Genetics
Cells Contain Chromosomes
Chromosomes Contain DNA
DNA Codes for Protein
Genotype Influences Phenotype
Genetic Tests
What Is a Genetic Test?
Policy Issues
How Many Genetic Tests are Available?
What Are the Different Types of Genetic Tests?
Policy Issues
The Genetic Test Result
Policy Issues
Characteristics of Genetic Tests
Analytical Validity
Clinical Validity
Clinical Utility
Policy Issues
Coverage by Health Insurers
Policy Issues
Regulation of Genetic Tests by the Federal Government
End Notes
Chapter 96
Evolution of Human Genome Analysis: Impact on Diseases Diagnosis and Molecular Diagnostic Labs
Abstract
1. Increased Human Genome Knowledge through Progress in Sequencing Technology
2. The Genetic Diagnosis: A Multi Technical Approach for Neurodevelopmental and Metabolic Disorders
2.1. Mendelian Single Gene Disorders: At the Mutation or Gene Level
2.1.1. Targeted Mutations
2.1.2. Targeted Gene
2.2. Genetic Disease Panels: The Intermediate Decision
2.3. The “Omic” Approach, a Comprehensive Interrogation
3. The Future of Molecular Diagnostic Lab: What Will Be Kept and What Will Bot
4. The Non-Targeted Genetic Strategy Generates New Ethical Challenges
4.1. Consent Form
4.2. Data Storage and Sharing
4.3. Incidental Findings
Conclusion and Future
Acknowledgments
References
Chapter 97
Improvements in HSV-1- Derived Amplicon Vectors for Gene Transfer
Abstract
HSV-1 Background
HSV-1 Epidemiology and Clinical Features
HSV-1 Virion Structure
HSV-1 Genome
HSV-1-Derived Vectors
Amplicon Vectors
Amplicon Vector Properties
Amplicon Production Systems
Helper DNA-Based Packaging Methods
Helper Virus-Based Packaging Methods
LaL and LaL(J HSV-1 Helper System
Further Improvements of Amplicon Vectors Technology
Elimination of Bacterial DNA from the Amplicon Genome
Modification of the Complementing Cell Lines
VCre4 Cell Line
Amplicon Vectors and Cancer
Amplicon Vectors and Vaccines
Amplicon Vectors and Behaviour
Amplicon Vectors and Neurodegenerative Diseases
Ataxias
Alzheimer Disease
Parkinson Disease
Narcolepsy
Amplicon Vectors and Nervous System Damage
Ischemia
Neurotoxicity
Neurotrophins
Neuropathic Pain
Acknowledgments
References
Chapter 98
Advances in Viral Genome Research of Papillomaviruses
Abstract
Introduction
Strategies Used to Identify Papillomavirus Genomes
PCR-Based Methods
Metagenomic Methods
A Model for Research in Papillomavirus: Advances in Bovine Papillomavirus Knowledge
References
Chapter 99
Synthetic Synthesis of Viral Genomes
Abstract
Introduction
Essential Elements of Viral Genomes
Essential Genes
Organization and Modulation of Viral Genomes
Methodologies for Genomic Manipulation
Genomic Sequencing
Genetic Manipulations
Synthesis of New Viral Genomes
Genetic Circuits
Monitoring the Expression of Genetic Elements
Colorimetric Assays
Green Fluorescent Protein (GFP)
Luminescence
Aptamers
Detection of Cellular mRNAs
Debugging
Examples of Projects on Synthetic Genomes
Prospects
Conflict of Interest
Acknowledgment
References
Chapter 100
Novel Bioinformatics Method to Analyze More Than 10,000 Influenza Virus Strains Easily at Once: Batch-Learning Self Organizing Map (BLSOM)
Abstract
Introduction
Materials and Methods
Viral Genome Sequences
Batch-Learning Self-Organizing Map (BLSOM)
Result
Oligonucleotide BLSOM for All Virus Genome Sequences
Oligonucleotide BLSOM for Influenza Virus Genomes
Diagnostic Tetranucleotides Responsible for Host-Dependent Separation
Chronological Changes Visualized for Human Viruses
H17N10 Strains Isolated from Bat
BLSOM for Codon Usage
BLSOM for Amino-Acid and Peptide Composition
Conclusion
Acknowledgments
References
Chapter 101
Oncogenes: Classification, Mechanisms of Activation, and Roles in Cancer Development Role of Oncogenes in Gynecological Pathology
Abstract
Introduction
Oncogenes in Gynecological Cancers
Breast Cancer
Ovarian Cancer
Endometrial Cancer
Cervical Cancer
Gestational Trophoblastic Disease
Oncogenes and Cancer Therapy
Oncogenes in Reproductive Endocrinology
Endometriosis
Conclusion
References
Chapter 102
The Classification, Mechanisms of Activation and Roles in Cancer Development of Oncogenes
Centro de Investigación Biomédica de Occidente, Instituto Mexicano del Seguro Social, Guadalajara, Jalisco, México
Abstract
Introduction
Oncogenes
Oncogene Classification
Growth Factors and Growth Factor Receptors
Transcription Factors
Chromatin Remodelers
Signal Transducers
Apoptosis Regulators
Chronic Inflammation as Activation Mechanism
Reprogramming of Metabolic Pathways in Cancer
Metabolic Activity in Cell Proliferation
PI3K/Akt/mTOR Signaling Pathway
Regulation of Glycolysis by HIF-1
Metabolic Changes and Cancer Cells
Cancer Initiation and Progression
Oncogenes as Therapeutic Targets
MicroRNA Genes
References
Chapter 103
Dicer and MicroRNAs: Oncomirs Are the Next Frontier of Oncogenes Affecting Cancer Etiology and Tumor Progression
Abstract
Introduction
MicroRNA and Cancer
MicroRNA-Based Therapies in Cancer
MicroRNA Biogenesis and Degradation
Let-7 Family
Let-7 in Cell Differentiation
Let-7 and Cancer: Ras, HMGA2 and the Cell Cycle
Regulation of Let-7
MiR-17-92 Family and Organization of miRNA Clusters
Regulation of the miR-17-92 Family and Its Roles Cancer
Causes of Alterations in miRNA Expression
Chromosomal Instability
Epigenetic Regulations
Abnormalities in miRNA Biogenesis Machineries
Drosha
DGCR8
Exportin-5
The Structure of Dicer
Dicer in Early Development
The Role of Dicer in Cancer
Regulation of Dicer
Argonautes
References
Chapter 104
The Role of the Epidermal Growth Factor Receptor as a Therapeutic Target in Glioblastoma and Other Malignancies
Abstract
Introduction
The EGFR and Its Role in Tumorigenesis
Epithelial-to-Mesenchymal Transition
Extracellular Matrix and Microenvironment
Mechanisms of Resistance to Current Therapy of GB
Conclusion
References
Chapter 105
Tumor Suppressors Involved in DNA Repair and Carcinoprevention
Abstract
Abbreviations
1. Introduction
2. Relationship between DNA Repair and Carcinogenesis
3. Signal Transduction of p53 and BRCA1 in DNA Repair Pathway
4. Protein Interaction and Functional Interplay between PTEN and p53
5. Perspective
Acknowledgments
Competing Interests Statement
References
Chapter 106
Molecular Pathogenesis of Neurofibromatosis Type 1
Abstract
Introduction
Epidemiology of NF1
Clinical Features of NF1
Skin Manifestations
Skeletal and Osseous Abnormalities
Vascular Lesions
Psychiatric Disorders and Cognitive Dysfunction
Rare Manifestations
RASopathies
Dysplasia and Developmental Defects
Molecular Genetics of NF1
Genetic Diagnosis
Tumors Associated with NF1
Disease Modifier Genes in NF1
Molecular Pathogenesis of NF1
Using Systems Approaches to Study NF1
Current Treatment and Disease Management
Conclusion
References
Chapter 107
Imaging of Plexiform Neurofibromas in Neurofibromatosis Type 1
Abstract
Introduction
Imaging Appearance of Plexiform Neurofibromas
Plexiform Neurofibroma Types
Volumetric Analysis
Cranial Nerves
Spinal Nerves
Neck, Mediastinum, Chest
Abdomen, Pelvis
Malignant Peripheral Nerve Sheath Tumors (MPNSTs)
Conclusion
References
Chapter 108
Surgical Treatment of Giant Neurofibromas
Abstract
Introduction
Surgical Techniques
Discussion
Conclusion
References
Chapter 109
Neurofibromatosis Type 1-Associated
Nervous System Tumors
and Current Treatment Strategies
Abstract
Introduction
Central Nervous System Tumors in Children with NF1
Low Grade Glioma: Clinical Presentation
Low Grade Glioma: Imaging Characteristics
Low Grade Glioma: Prognosis
Low Grade Glioma: Treatment Modalities
1. Role of Surgery
2. Radiation Therapy
3. Chemotherapy
4. Targeted Therapy
RAS-MAPK Pathway
Peripheral Nervous System Tumors in Children with NF1
Plexiform Neurofibromas: Clinical Presentation
Plexiform Neurofibromas: Imaging Characteristics
Plexiform Neurofibromas: Prognosis
Plexiform Neurofibromas: Treatment Modalities
1. Role of Surgery
2. Radiation Therapy
3. Chemotherapy
4. Targeted Therapy
a) mTOR Pathway
Interferon Treatment
b) Anti-angiogenic Treatment
c) Tyrosine Kinase Inhibitor Treatment
Malignant Peripheral Nerve Sheath Tumor (MPNST): Clinical Presentation
MPNST: Imaging Characteristics
MPNST: Prognosis
MPNST: Treatment Modalities
1. Role of Surgery
2. Radiation Therapy
3. Chemotherapy
4. Targeted Therapy
a) Tyrosine Kinase Inhibitor Treatment
b) Angiogenic Pathways
c) Cytoskeletal Remodeling
Conclusion
References
Chapter 110
Outcome Measures for Optic
Pathway Gliomas
Abstract
Introduction
Epidemiology of OPGs
Presentation of OPGs
Clinical Symptoms
Diagnostic Imaging
Pathology
Management of OPGs
Clinical Course
Surveillance
Treatment
Outcome Measures
Anatomical Outcomes (MRI)
Visual Outcomes
Alternative Outcome Measures
Diffusion and Perfusion Imaging
Diffusion Tensor Imaging
Positron Emission Tomography
Visual Evoked Potentials
Optical Coherence Tomography
Conclusion
References
Chapter 111
Neurofibromatosis Type 1 Bone
Disease: Diagnosis and Management
Abstract
Introduction
Spinal Manifestations : Scoliosis
Management of Scoliosis
Dural Ectasia
Long Bone Dysplasia
Leg Length Inequality/Segmental Hypertrophy
Sphenoid Wing Dysplasia
Pectus Deformities
Generalized Bone Bisorders
Osteopenia/Osteoporosis
Fractures
Bone Cysts; Non-Ossifying Fibromas
Others: Ossifying Subperiosteal Hematoma
Muscle Involvement in NF1
Conclusion
References
Chapter 112
Cognition and Behaviour in Neurofibromatosis Type 1: Pathogenesis and Emerging Therapies
Abstract
Introduction
1. NF1 Cognitive Phenotype
1.1. Intelligence
1.2. Visuospatial Function
1.3. General Language
1.4. Learning and Memory
1.5. Attention
1.6. Executive Functions
1.7. Academic Achievement and Learning Disability
2. The Social and Behavioral Phenotype
3. Neurodevelopmental Aspects
4. Pathogenesis of Cognitive Impairments
4.1. Human Neuroimaging Studies
4.1.1. Structural
4.1.2. Functional
4.2. Insights from Animal Models
5.0. Neurocognitive Therapies in NF1
Conclusion
References
Chapter 113
Communication Disorders Associated with Neurofibromatosis Type 1
Abstract
Introduction
NF1 and Manifestations of the Head and Neck
NF1 and Voice Disorders
NF1 and Resonance/Velopharyngeal Functioning
NF1 and Fluency
Speech Production Problems Associated with NF1
Expressive and Receptive Language and Intelligence in NF1
Gaps and Opportunities
Assessment
Conclusion
References
Appendix 1: Prevalence of Communication Disorders Observed in the Population of Individuals with NF1 and the General Population (in percent)
Appendix 2: Glossary of Terms
Chapter 114
Children with Neurofibromatosis Type 1: Functioning in the Classroom
Abstract
Introduction
The International Classification of Functioning, Disability and Health– Children and Youth version (ICF-CY) (WHO, 2007)
Conceptual Framework of the ICF-CY
The Ecological Validity of Cognitive Assessments Tools
Evaluation of Cognitive and Functional Problems
The Use of Virtual Reality Environments and Questionnaires to Evaluate Day-to-Day Cognitive Functioning
Virtual Reality (VR)
Functional Questionnaires
Describing the Attention Deficit profile of Children with NF1 Using a Virtual Classroom Environment (Gilboa, Rosenblum, Fattal-Valevski, Toledano-Alhadef, Rizzo, & Josman, 2011a; Gilboa, Rosenblum, Fattal-Valevski, Toledano-Alhadef, Rizzo, & Josman, 2...
The EF of Children with NF1 and its Relation to their Academic Skills
The Activity of Handwriting
The Handwriting Performance of Children with NF1 (Gilboa, Josman, Fattal-Valevski, Toledano-Alhadef, & Rosenblum, 2010a)
Jonathan: Case Study
Referral to Occupational Therapy
Major Findings and Discussion
Executive Function
Attention
Writing
Recommendations
Conclusion
References
Index
Blank Page

Citation preview

GENETICS - RESEARCH AND ISSUES

ENCYCLOPEDIA OF GENETICS NEW RESEARCH (8 VOLUME SET) VOLUME

No part of this digital document may be reproduced, stored in a retrieval system or transmitted in any form or by any means. The publisher has taken reasonable care in the preparation of this digital document, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained herein. This digital document is sold with the clear understanding that the publisher is not engaged in rendering legal, medical or any other professional services.

GENETICS - RESEARCH AND ISSUES Additional books and e-books in this series can be found on Nova’s website under the Series tab.

GENETICS - RESEARCH AND ISSUES

ENCYCLOPEDIA OF GENETICS NEW RESEARCH (8 VOLUME SET) VOLUME

HEIDI CARLSON EDITOR

Copyright © 2019 by Nova Science Publishers, Inc. All rights reserved. No part of this book may be reproduced, stored in a retrieval system or transmitted in any form or by any means: electronic, electrostatic, magnetic, tape, mechanical photocopying, recording or otherwise without the written permission of the Publisher. We have partnered with Copyright Clearance Center to make it easy for you to obtain permissions to reuse content from this publication. Simply navigate to this publication’s page on Nova’s website and locate the “Get Permission” button below the title description. This button is linked directly to the title’s permission page on copyright.com. Alternatively, you can visit copyright.com and search by title, ISBN, or ISSN. For further questions about using the service on copyright.com, please contact: Copyright Clearance Center Phone: +1-(978) 750-8400 Fax: +1-(978) 750-4470 E-mail: [email protected]. NOTICE TO THE READER The Publisher has taken reasonable care in the preparation of this book, but makes no expressed or implied warranty of any kind and assumes no responsibility for any errors or omissions. No liability is assumed for incidental or consequential damages in connection with or arising out of information contained in this book. The Publisher shall not be liable for any special, consequential, or exemplary damages resulting, in whole or in part, from the readers’ use of, or reliance upon, this material. Any parts of this book based on government reports are so indicated and copyright is claimed for those parts to the extent applicable to compilations of such works. Independent verification should be sought for any data, advice or recommendations contained in this book. In addition, no responsibility is assumed by the publisher for any injury and/or damage to persons or property arising from any methods, products, instructions, ideas or otherwise contained in this publication. This publication is designed to provide accurate and authoritative information with regard to the subject matter covered herein. It is sold with the clear understanding that the Publisher is not engaged in rendering legal or any other professional services. If legal or any other expert assistance is required, the services of a competent person should be sought. FROM A DECLARATION OF PARTICIPANTS JOINTLY ADOPTED BY A COMMITTEE OF THE AMERICAN BAR ASSOCIATION AND A COMMITTEE OF PUBLISHERS. Additional color graphics may be available in the e-book version of this book.

Library of Congress Cataloging-in-Publication Data

ISBN: HERRN

Published by Nova Science Publishers, Inc. † New York

CONTENTS VOLUME 1 Preface Chapter 1

Chapter 2

xv Speciation in Diatoms: Patterns, Mechanisms, and Environmental Change Joshua T. Cooper and John P. Masly Sympatric Speciation of Island Plants: The Natural Laboratory of Lord Howe Island Alexander S. T. Papadopulos, William J. Baker and Vincent Savolainen

Chapter 3

Speciation of Arabian Gazelles Hannes Lerp, Torsten Wronski, Thomas M. Butynski and Martin Plath

Chapter 4

Chromosome Plasticity, Adaptation and Speciation in Malaria Mosquitoes Igor V. Sharakhov

Chapter 5

Chapter 6

Transcriptional Differentiation Across the Four Subspecies of Drosophila mojavensis Luciano M. Matzkin and Therese A. Markow Evolution of Male Courtship Songs in the Drosophila buzzatii Species Cluster Cássia C. Oliveira, Maura H. Manfrin, Fábio de M. Sene and William J. Etges

Chapter 7

Prezygotic Isolation in the Parasitoid Wasp Genus Nasonia Maartje C. W. G. Giesbers, Sylvia Gerritsma, Jan Buellesbach, Wenwen Diao, Bart A. Pannebakker, Louis van de Zande, Thomas Schmitt and Leo W. Beukeboom

Chapter 8

Where to Look for Speciation Genes When Divergence Is Driven by Postmating, Prezygotic Isolation Jeremy L. Marshall

1

37

59

83

119

135

161

189

vi Chapter 9

Contents The Molecular and Evolutionary Basis of Hybrid Sterility: From Odysseus to Overdrive Nitin Phadnis and Harmit S. Malik

Chapter 10

The Role of Transposable Elements in Speciation Eric T. Watson and Jeffery P. Demuth

Chapter 11

Hybrid Incompatibility: Are Cellular Processes the Battlefields of Genomic Conflict? Norman A. Johnson

203 223

247

Chapter 12

Processes in Organic and Cultural Evolution Börje Ekstig

257

Chapter 13

Natural Selection and Diabetes Mellitus Svetlana Shtandel

301

Chapter 14

Genetic Drift among Native People from South American Gran Chaco Region Affects Interleukin 1 Receptor Antagonist Variation Cecilia Inés Catanesi and Laura Angela Glesmann

331

VOLUME 2 Chapter 15

Alternative Splicing and Neurological Disorders: Focus on Parkinson’s Disease Velia D’Agata, Valentina La Cognata and Sebastiano Cavallaro

345

Chapter 16

Tau Alternative Splicing in Alzheimer’s Disease Gonzalo Emiliano Aranda-Abreu, María Elena Hernández Aguilar, Fausto Rojas Durán, Sonia Lilia Mestizo Gutiérrez and Jorge Manzo Denes

373

Chapter 17

The Role of Splicing Factors in Cancer Prognosis and Treatment Rebeca Martínez-Contreras and Nancy Martínez-Montiel

383

Chapter 18

Nonsense-Mediated Decay and Human Disease Nancy Martínez-Montiel and Rebeca Martinez-Contreras

407

Chapter 19

Alternative Splicing Alterations in Alzheimer’s Disease T. A. Ishunina and D. F. Swaab

427

Chapter 20

Plant RNA-Binding Proteins Implicate mRNA Processing in Abscisic Acid (ABA) Responses Raquel F. Carvalho, Vera S. Nunes and Paula Duque

453

Comprehensive Analyses of Alternative Exons in Neuronally Differentiated P19 cells Hitoshi Suzuki and Toshifumi Tsukahara

475

Identification of Genuine Alternative Splicing Variants for Rare or Long-Sized Transcripts Seishi Kato

495

Chapter 21

Chapter 22

Contents

vii

Chapter 23

An Epigenetic View on Alternative Splicing Gabriele A. Fontana, Aurora Rigamonti and Silvia M. L. Barabino

515

Chapter 24

Alternative RNA Splicing and Regulation of Nitric Oxide Signaling Iraida G. Sharina

533

Chapter 25

Alternative Splicing by Analyzing a Human mRNA Diversity Using Data of FLJ Human cDNAs Takao Isogai and Ai Wakamatsu

551

Alternative Splicing in Human Immune System and Autoimmune Diseases Xiang Guo

569

Chapter 26

Chapter 27

Poly(ADP-Ribosyl)ation Regulates Alternative Splicing Yingbiao Ji and Alexei V. Tulin

583

Chapter 28

Patent Roadmap for the Biosensor Space Mohamed C. Azeez, Unisha Patel and Dennis Fernandez

595

Chapter 29

Avoidant/Restrictive Food Intake Disorder in a Female Patient Affected by Marfan Syndrome A. P. Verri, A. Serio, M. Grasso, I. Brega and F. Clerici

Chapter 30

Optimizing Oil Production in B. napus by Gene Stacking: Transgenic Co-Expression of DGAT1 and Partially-Suppressed mtPDCK Cumulatively Enhance Seed Lipid Deposition Elizabeth-France Marillia, Tammy Francis and David C. Taylor

Chapter 31

Periodontitis: A Common Oral Disease the Genetic Susceptibility Ying Zheng, You-Qiang Song and W. Keung Leung

Chapter 32

Genomic Imprinting and the Brain: Neuron-Specific Switching of Gene Expression at Imprinting Regions Masamitsu Eitoku and Hidenori Kiyosawa

Chapter 33

Pharmacogenomics Focusing on Phase Two Metabolizing Enzymes Kung-Hao Liang

649

657 689

715 739

VOLUME 3 Chapter 34

Chapter 35

Sexual Dimorphism in Insect Longevity: Insights from Experimental Evolution Jelica Lazarević, Biljana Stojković and Nikola Tucić Evidence of Natural and Sexual Selection Shaping the Size of Nuptial Gifts among a Single Bush-cricket Genus (Poecilimon; Tettigoniidae): An Analysis of Sperm Transfer Patterns J. McCartney, M. A. Potter, A. W. Robertson, K-G. Heller and D. T. Gwynne

747

777

viii Chapter 36

Chapter 37

Contents Mate Choice Copying in Both Sexes of the Guppy: The Role of Sperm Competition Risk and Sexual Harassment Claudia Zimmer, Alexandros S. Gavalas, Benjamin Kunkel, Janina Hanisch, Sara Martin, Svenja Bischoff, Martin Plath and David Bierbach Sexual Selection under Parental Choice: Mating Strategies and Reproductive Success Menelaos Apostolou and Marianna Zacharia

Chapter 38

Melon Germplasm Characteristics, Diversity, Preservation and Uses C. Mallor and A. Díaz

Chapter 39

Preservation and Characterization of Woodland Grape (Vitis vinifera ssp. sylvestris GMEL.) Genotypes of the Szigetköz, Hungary Gizella Jahnke, Zóra Annamária Nagy, Gábor Koltai, Edit Hajdu and János Májer

Chapter 40

Chapter 41

Chapter 42

Chapter 43

Chapter 44

A Mini Review on Morphological and Genetic Diversity of Sweet (Prunus Avium L.) and Sour Cherry (Prunus Cerasus L.) Cultivars Ioannis Ganopoulos, Panagiotis Madesis, Filippos A. Aravanopoulos, Athanasios Tsaftaris, Thomas Sotiropoulos and Konstantinos Kazantzis

795

813 825

845

859

Research on Purple Seed Stain of Soybean: Germplasm Screening and Genetic Resistance Shuxian Li, Pengyin Chen, Bo Zhang and Grover Shannon

871

Somatic and Gonadal Tissue Cryopreservation: An Alternative Tool for the Germplasm Conservation in Wild Mammals Alexsandra Fernandes Pereira, Alexandre Rodrigues Silva, Gabriela Liberalino Lima and Andréia Maria da Silva

881

Mitochondrial Gene Diversity of the Mega-Herbivorous Species of the Genus Tapirus (Tapiridae, Perissodactyla) in South America and Some Insights on Their Genetic Conservation, Systematics and the Pleistocene Influence on Their Genetic Characteristics Manuel Ruiz-García, Armando Castellanos, Luz Agueda Bernal, Diego Navas, Myreya Pinedo-Castro and Joseph Mark Shostell Strategies for Gene Prospecting of Plants in Response to Drought and Salinity Deyvid Novaes Marques, Nicolle Louise Ferreira Barros, Diehgo Tuloza da Silva, Fabiano Melo de Brito and Claudia Regina Batista de Souza

909

959

Contents Chapter 45

Clinical Evidence and the Genetic Effects of Traditional Chinese Medicine for the Management of Proteinuria in Patients with Diabetic Nephropathy Xiang Tu, XueFeng Ye, Quan Hu, ChunGuang Xie, ChengShi He, Ming Chen, James B. Jordan and Sen Zhong

ix

993

Chapter 46

Biochemistry and Genetics of Ansamycin Antibiotics Amit Kumar Jha and Jae Kyung Sohng

Chapter 47

BRCA Gene Mutations Mediate Particularly High TNBC Risk by Defective Estrogen Signaling Zsuzsanna Suba

1045

Genotype-Phenotype Relationships in Language Processes in Rett Syndrome Alessandra Falzone, Antonio Gangemi and Rosa Angela Fabio

1061

Marfan Syndrome: A Rare and Sometime Very Disabling Genetic Disorder Henry J. Mankin and Keith P. Mankin

1079

Chapter 48

Chapter 49

Chapter 50

Marfan Syndrome and Periodontitis Jun-ichi Suzuki and Yasunobu Hirata

Chapter 51

Combined Pectus Correction and Aortic Valve Sparing Root Replacement in Marfan Patients Jean-Philippe Verhoye and Jacques Tomasi

1017

1093

1099

Chapter 52

Severe Periodontitis in Marfan Syndrome Naoto Suda

1107

Chapter 53

Preimplantation Genetic Diagnosis for Marfan Syndrome Anver Kuliev and Svetlana Rechitsky

1113

VOLUME 4 Chapter 54

Anuran Cytogenetics: An Overview Cíntia Pelegrineti Targueta, Stenio Eder Vittorazzi, Kaleb Pretto Gatto, Daniel Pacheco Bruschi, Ana Cristina P. Veiga-Menoncello, Shirlei M. Recco-Pimentel and Luciana Bolsoni Lourenço

1117

Chapter 55

Human Cytogenetic Biomonitoring Armanda Teixeira-Gomes, Solange Costa and João Paulo Teixeira

1157

Chapter 56

Complex Karyotypes and Their Detection in Hematologic Malignancies: The Ongoing Role for Classical Cytogenetics Helena Urbankova

1177

x Chapter 57

Contents Natural Hybridization between Chromosomal Discrepant Species and the Role of Hybrid Speciation in the Genus Astyanax Francisco de Menezes Cavalcante Sassi, Snaydia Viegas Resende, Rubens Pazza and Karine Frehner Kavalco

Chapter 58

Trichorhinophalangeal Syndrome (TRPS) Revisited N. Selenti, M. Tzetis, E. Tsoutsou and H. Fryssira

Chapter 59

Epigenetic Modifications and Developmental Origin of Health and Diseases (DOHaD) Jia Zheng and Xinhua Xiao

1193

1203

1211

Chapter 60

Effects of Oxidative Stress on Epigenetic Mechanisms Yildiz Dincer and Onur Baykara

1225

Chapter 61

Epigenetic Modifications and Their Potential Role in Tumorigenesis Muthu K. Shanmugam, Frank Arfuso and Gautam Sethi

1241

Chapter 62

Alzheimer’s Disease: An Insight from Epigenetic Perspective Yildiz Dincer and Zeynep Sezgin

1291

Chapter 63

Epigenetic Mechanisms in Cardiovascular Diseases Mehmet Güven and Bahadir Batar

1323

Chapter 64

Insights from Epigenomics Analysis of Sperm: Sperm Development and Male Infertility Dheepa Balasubramanian, Eisa Tahmasbpour and Ashok Agarwal

1361

Epigenetics, Inflammation and Inflammatory Related-Diseases: A General Look Müge Sayitoğlu and Yücel Erbilgin

1383

Chapter 65

Chapter 66

A New Molecular Approach to Obesity: Epigenetic Perspective Burcu Bayoglu and Mujgan Cengiz

1419

VOLUME 5 Chapter 67

Genetics and Evolution of Entomopathogenic Fungi A. Garcia, M. Michel, S. Villarreal, F. Castillo, E. Osorio, M. T. García-Ruiz, F. Veana, A. C. Flores and R. Rodríguez

Chapter 68

Mitochondrial Population Genetics Inferences about the Phylogeography and Systematics of the Tayra (Eira barbara, Mustelidae, Carnivora) Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia, Juan Manuel Ortega and Joseph Mark Shostell

1491

The Precision Medicine and Precision Public Health Approaches to Cancer Treatment and Prevention: A Cross-Comparison Stephen M. Modell, Sharon L. R. Kardia and Toby Citrin

1525

Chapter 69

1447

Contents Chapter 70

Chapter 71

Chapter 72

Neuropsychological Profile of People with Williams Syndrome (WS) Anne-Sophie Pezzino, Nathalie Marec-Breton and Agnès Lacroix

1547

Preimplantation Genetic Diagnosis (PGD) for Chromosome Rearrangements Chun Kyu Lim

1569

A Family-Based Association Study between the BDNF Gene and Attention Deficit Hyperactivity Disorder in Mexican Children and Adolescents Alan López-López, Miriam Margot Rivera-Angles, Carlos Alfonso Tovilla-Zárate, Roberto Molina-Solís, Araceli Valencia-Hernández, Luis Gómez-Valencia, Thelma Beatriz González-Castro, Isela E Juárez-Rojop, María Lilia López-Narváez, Ana Fresan and Yazmin Hernández-Díaz

Chapter 73

Petroleum Microbiology and Genetics Joana Montezano Marques, Carla Thais Moreira Paixão, Gabriel Villar Monte Palma Pantoja, Artur Luiz da Costa da Silva and Diego Assis das Graça

Chapter 74

Estrogen Activated ERs are the Chief Genetic Safeguards of Somatic and Reproductive Health in Mammalians Zsuzsanna Suba

Chapter 75

Motor Abilities are Related to Specific Genotypes in Rett Syndrome R. A. Fabio, T. Caprì, M. Lotan, G. E. Towey and G. Martino

Chapter 76

A Longitudinal Study on the Development of a Boy with Fragile X Syndrome: Developmental Trends and Adaptive Changes in a Single Case Report María Auxiliadora Robles-Bello, Nieves Valencia-Naranjo and David Sánchez-Teruel

Chapter 77

Cornelia De Lange Syndrome: A Review Elizabeth A. M. Frost

Chapter 78

Cognitive-Behavioral Phenotype in Klinefelter Syndrome (KS) and Other Sex Chromosomal Aneuplodies (SCAs): Clinical Variability A. P. Verri, C. D’Angelo, A. Cremante, F. Clerici, A. Mauri and C. Castelletti

Chapter 79

xi

Transcranial Direct Current Stimulation (tDCS) and Cognitive Empowerment for the Functional Recovery of Diseases with Chronic Impairment and Genetic Etiopathogenesis Antonio Gangemi, Tindara Caprì, Rosa Angela Fabio, Paola Puggioni, Alessandra Maria Falzone and Gabriella Martino

1589

1601

1633 1649

1669

1683

1697

1715

xii

Contents VOLUME 6

Chapter 80

Chapter 81

Chapter 82

Chapter 83

Chapter 84

Control of Force and Timing during Unimanual and Bimanual Tapping Movements of Adolescents with Down Syndrome Nobuyuki Inui and Junya Masumoto Management of Executive Function Following Assisted Cycling Therapy in Adolescents with Down Syndrome Shannon D. R. Ringenbach, Simon D. Holzapfel, Madeline Richter and Jay L. Alberts Endocrine Features and Management of Endocrine Problems in Down Syndrome Stefano Stagi, Elena Sandini, Elisabetta Lapi, Perla Scalini and Maurizio de Martino Autosomal Dominant Polycystic Kidney Disease: Pathophysiology and Treatment Ashraf M. Mohieldin, Viralkumar S. Upadhyay, Albert C. M. Ong and Surya M. Nauli Hereditary Haemorrhagic Telangiectasia or Rendu-Osler-Weber Syndrome Roberto Zarrabeitia, Cristina Amado, Virginia Albiñana and Luisa-María Botella

1727

1741

1757

1783

1807

Chapter 85

Osteogenesis Imperfecta Colin R. Paterson

1831

Chapter 86

Autosomal Dominant Disorders Associated to Breast Cancer Nelly Margarita Macías-Gómez

1849

Chapter 87

Fragile X Syndrome M. Milà

1859

Chapter 88

Fragile X-Associated Primary Ovarian Insufficiency (FXPOI) Maria-Isabel Tejada

1873

Chapter 89

Fragile X-Associated Tremor/Ataxia Syndrome L. Rodriguez-Revenga

1883

Chapter 90

Psychiatric Aspects in Fragile X Syndrome and Related Phenotypes E. Mur and M. Milà

1895

Chapter 91

Clinical Features Associated with FMR1 Premutation Carriers M. I. Alvarez-Mora and L. Rodriguez-Revenga

1911

Chapter 92

Genetic Counseling of FMR1 I. Madrigal

1927

Chapter 93

Treatment of Fragile X Spectrum: FXS, FXTAS and FXPOI F. J. Ramos and M. P. Ribate

1941

Contents

xiii

VOLUME 7 Chapter 94

Privacy and Progress in Whole Genome Sequencing Presidential Commission for the Study of Bioethical Issues

1955

Chapter 95

Genetic Testing: Scientific Background for Policymakers Amanda K. Sarata

2045

Chapter 96

Evolution of Human Genome Analysis: Impact on Diseases Diagnosis and Molecular Diagnostic Labs Julie Gauthier, Isabelle Thiffault, Virginie Dormoy-Raclet and Guy A. Rouleau

Chapter 97

Improvements in HSV-1- Derived Amplicon Vectors for Gene Transfer Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez, Carlos A. Bueno, Anna Salvetti, Diana A. Jerusalinsky and Alberto L. Epstein

2057

2079

Chapter 98

Advances in Viral Genome Research of Papillomaviruses A. C. Freitas, A. L. S. Jesus, A. P. D. Gurgel and M. A. R. Silva

2115

Chapter 99

Synthetic Synthesis of Viral Genomes Monique R. Eller, Roberto S. Dias, Rafael L. Salgado, Cynthia C. da Silva and Sérgio O. De Paula

2131

Chapter 100

Novel Bioinformatics Method to Analyze More Than 10,000 Influenza Virus Strains Easily at Once: Batch-Learning Self Organizing Map (BLSOM) Yuki Iwasaki, Toshimichi Ikemura, Kennosuke Wada, Yoshiko Wada and Takashi Abe

Chapter 101

Chapter 102

Oncogenes: Classification, Mechanisms of Activation, and Roles in Cancer Development Role of Oncogenes in Gynecological Pathology Ciro Comparetto and Franco Borruto The Classification, Mechanisms of Activation and Roles in Cancer Development of Oncogenes Patricio Barros-Núñez, Mónica Alejandra Rosales-Reynoso and Clara Ibet Juárez-Vázquez

2149

2163

2193

VOLUME 8 Chapter 103

Chapter 104

Dicer and MicroRNAs: Oncomirs Are the Next Frontier of Oncogenes Affecting Cancer Etiology and Tumor Progression Ha T. Nguyen and Mandi M. Murph

2227

The Role of the Epidermal Growth Factor Receptor as a Therapeutic Target in Glioblastoma and Other Malignancies Andrej Pala, Christian Rainer Wirtz and Marc-Eric Halatsch

2255

xiv

Contents

Chapter 105

Tumor Suppressors Involved in DNA Repair and Carcinoprevention Yasuko Kitagishi and Satoru Matsuda

2267

Chapter 106

Molecular Pathogenesis of Neurofibromatosis Type 1 Ming-Jen Lee, Alton Etheridge, David J. Galas and Kai Wang

2279

Chapter 107

Imaging of Plexiform Neurofibromas in Neurofibromatosis Type 1 Eva Dombi, Nicholas Patronas and Brigitte Widemann

2299

Chapter 108

Surgical Treatment of Giant Neurofibromas Stamatis Sapountzis, Ji Hoon Kim, Abid Rashid and Hung-Chi Chen

2317

Chapter 109

Neurofibromatosis Type 1-Associated Nervous System Tumors and Current Treatment Strategies Nilika Shah Singhal and Sabine Mueller

2329

Chapter 110

Outcome Measures for Optic Pathway Gliomas Peter M. K. de Blank, Grant T. Liu and Michael J. Fisher

Chapter 111

Neurofibromatosis Type 1 Bone Disease: Diagnosis and Management Elizabeth K. Schorry and Alvin H. Crawford

2375

Cognition and Behaviour in Neurofibromatosis Type 1: Pathogenesis and Emerging Therapies Jonathan M. Payne, Natalie A. Pride and Kathryn N. North

2391

Chapter 112

Chapter 113

Chapter 114

Communication Disorders Associated with Neurofibromatosis Type 1 Heather L. Thompson, David A. Stevenson, Sean M. Redmond, Bruce L. Smith and David H. Viskochil Children with Neurofibromatosis Type 1: Functioning in the Classroom Yafit Gilboa, Sara Rosenblum, Aviva Fattal-Valveski and Naomi Josman

2349

2421

2441

Index

2461

Related Nova Publications

2477

PREFACE This 8 volume encyclopedia set presents important research on genetics. Some of the topics discussed herein include the speciation of Arabian gazelles, tau alternative splicing in Alzheimer’s disease, Cornelia de Lange syndrome and autosomal dominant polycystic kidney disease. Chapter 1 - Diatoms represent one of the most speciose groups of organisms within the microeukaryota— they occupy almost every aquatic niche worldwide, provide important functions within ecosystems as a major contributor of carbon dioxide fixation from the atmosphere, and also serve as a major contributor to the base of the aquatic food web. Despite this striking example of biodiversity and their ecological importance, the author know relatively little about the speciation processes at work in this group of organisms. In this chapter, the author review the patterns of speciation in marine and freshwater diatoms with respect to their paleontological, environmental, and genetic evolutionary histories. The author summarize the evidence for sex and hybridization among diatom species, and discuss recent work on understanding the mechanisms of reproductive isolation that limit gene flow in the microeukaryota. The author also discuss aspects of diatom genome evolution that provide clues to the genetic basis of speciation in this group. Finally, the author end with a discussion of a natural model system that presents a unique opportunity to address some of the outstanding questions in diatom speciation. Chapter 2 - The evolution of new species without geographic isolation has received a great deal of attention over the past decade. The mechanisms that can lead to speciation of vascular plants in biogeographic sympatry fall broadly into three categories; speciation with ongoing gene flow (which is often, but not always, synonymous with ecological speciation), hybrid speciation and polyploid speciation. Here, with a particular focus on plant species, the author briefly review the concepts and research on sympatric speciation and its causes. Hybrid speciation and polyploid speciation have occasionally been dismissed as special (“simple”) cases of sympatric speciation and the author consider that, although they are distinctive, there are significant obstacles to overcome before new species can be generated by these mechanisms. As such they are deserving of as much research attention as is currently afforded to speciation with gene flow. The author argue that it remains important to continue identifying cases of speciation in sympatry, in order to gain a better understanding of how all of these mechanisms can drive speciation in restricted areas (rather than simply to quantify sympatric speciation per say) and the author elaborate on the usefulness of Lord Howe Island as a model system for speciation research with this in mind.

xvi

Heidi Carlson

Chapter 3 - Gazelles are distributed across Africa and Asia and are adapted to arid and semi-arid environments. In this chapter, the author discuss potential factors promoting the divergence of lineages within this group (i.e., speciation events). The most recent common ancestor of gazelles is thought to have emerged during the Miocene (12-14 Ma) and to have split into the extant genera Nanger and Eudorcas (both endemic to Africa), Antilope (endemic to Asia), and Gazella (present in Africa, the Middle East and Asia). Within Gazella, two major clades are thought to have evolved allopatrically: (1) a predominantly Asian Clade (G. bennettii, G. subgutturosa, G. marica, G. leptoceros, and G. cuvieri) and (2) a predominantly African Clade (G. dorcas/ G. saudiya, G. spekei, G. gazella, and G. arabica). At present, both clades meet in North Africa and, especially, in Arabia. Other splits in this group are better explained by adaptive speciation in response to divergent ecological selection. In both clades, parallel evolution of sister species pairs (a desert-adapted form and a humid mountain-adapted form) can be inferred; desert-dwelling G. dorcas in Africa and G. saudiya in Arabia have a sister group relationship with mountain-dwelling G. gazella in the Levant and G. arabica in Arabia. This relationship exists within Africa between the desert-dwelling slender-horned gazelle (G. leptoceros) and the mountain-dwelling Cuvier’s gazelle (G. cuvieri) of the Atlas Mountains. A third species pair occurs in Asia; desert-dwelling goitred gazelle (G. subgutturosa) and mountain-dwelling chinkara (G. bennettii). These (ecological) speciation events correlate with ecology and behavior: the mountain forms being browsers, sedentary, territorial, and living in small groups, while the desert forms are grazers, migratory/ nomadic, non-territorial, and living in herds. Furthermore, cryptic sister species (G. gazella, G. arabica), with strikingly similar phenotypes, exist within presumed ‘G. gazella’, alluding to a possible allopatric origin of this divergence following an isolation of humid mountain regions during hyper-arid phases. On the other hand, phenotypes within G. arabica tend to be variable, but are difficult or impossible to distinguish genetically. Chapter 4 - Nonrandom distribution of rearrangements is a common feature of eukaryotic chromosomes that is not well understood in terms of genome organization and evolution. In malaria mosquitoes, chromosomal inversions—genome rearrangements that flip chromosomal segments by 1800—are often highly nonuniformly distributed among five chromosomal arms. These rearrangements are associated with epidemiologically important adaptations and, possibly, speciation in mosquitoes. A fundamental question is whether the genomic content of the chromosomal arms is associated with inversion polymorphism and fixation rates. This chapter highlights important differences in evolutionary dynamics of the sex chromosome and autosomes and reviews data about association between characteristics of the genome landscape and rates of chromosomal evolution. Recent studies suggest that a unique combination of various classes of genes and repetitive DNA in each arm, rather than a single type of repetitive element, is likely responsible for arm-specific rates of rearrangements. Additional factors, such as spatial constrains imposed by the nuclear architecture, may be responsible for the nonuniform distribution of rearrangements. Another important question is whether polymorphic inversions on homologous chromosomal arms of distantly related mosquito species nonrandomly share similar sets of genes. The available data indicate that natural selection favors specific gene combinations within polymorphic inversions when distant species are exposed to similar environmental pressures. This knowledge could be useful for the discovery of genes responsible for an association of inversion polymorphisms with phenotypic variations in multiple species. In this chapter, I also review the literature about a possible role of heterochromatin in speciation of malaria mosquitoes. The existing data demonstrate the

Preface

xvii

elevated evolutionary plasticity of the heterochromatic portion of the mosquito genome. Finally, I discuss the importance of high-quality genome assemblies for reconstructing a gene order-based phylogeny and studying mosquito evolution. Chapter 5 - Local adaptation can play a fundamental role in the isolation of populations. While less well-studied than differentiation in sequence variation, changes in transcriptional variation during speciation also are fundamental to the evolutionary process. Drosophila mojavensis offers an unprecedented opportunity to examine the role of transcriptional differentiation in local adaptation. Drosophila mojavensis is a cactophilic fly composed of four ecologically distinct subspecies that inhabit the deserts of western North America. Each of the four subspecies utilizes necrotic tissue of different cactus host species characterized by distinct chemical profiles. The subspecies in Baja California, Mexico uses Stenocereus gummosus (Agria), in mainland Sonora it uses S. thurberi (Organ Pipe), in the Mojave Desert the host is Ferocactus cylindraceus (Red Barrel) and in Santa Catalina Island, USA, Opuntia littoralis (Prickly Pear) is the host. In this chapter the author examine how the adaptation to the different environmental conditions across the four subspecies have shaped their transcriptional profiles. Using complete D. mojavensis genome microarrays the author examined the transcriptome of third instar larvae from all four subspecies reared in standard laboratory media free of necrotic cactus-derived compounds. This experimental strategy focused on differences between constitutively expressed genes and not genes induced by necrotic cactus-derived compounds. The subspecies exhibited significant differential expression of genes that likely underlie the adaptation to different cactus hosts, such as detoxification genes (Glutathione S-transferases, Cytochrome P450s and UDP-Glycosyltransferases) and chemosensory genes (Odorant Receptors, Gustatory Receptors and Odorant Binding Proteins). Chapter 6 - Acoustic signals produced to attract mates before, during, and after courtship are frequently involved with sexual selection, sexual isolation, and reproductive isolation in Drosophila spp. and other animals, yet few studies have revealed how courtship songs evolve in a larger phylogenetic context. Therefore, the author mapped different acoustic components of courtship songs in the monophyletic Drosophila buzzatii species cluster onto an independently derived period (per) gene + chromosome inversion phylogeny to assess the concordance of courtship song evolution with species divergence. These cactophilic flies are distributed throughout several biomes in southern South America and include the sibling species D. buzzatii, D. koepferae, D. serido, D. borborema, D. seriema, D. antonietae, and D. gouveai. All seven species produced two song types; primary and secondary pulse songs, except for D. borborema and D. gouveai that produced no secondary songs. Courtship songs were characterized by analyzing six commonly studied acoustic components including burst duration (BD), carrier frequency (CF), pulse length (PL), pulse number (PN), inter-burst interval (IBI), and inter-pulse interval (IPI). Significant intra- and inter-specific song variation was observed for BD, PN, and IBI, while CF, PL, and IPI varied in a more species-specific manner, albeit with some overlap. Thus, some song components may be better species recognition signals than others. Multivariate clustering analyses resolved all species into distinct, non-overlapping groups. Mapping individual song traits (BD, IBI, and IPI) as well composites of these song variables onto our (per) gene + chromosome inversion phylogeny revealed no phylogenetic signal when different comparative mapping methods were used. Hence, the evolution of courtship songs in D. buzzatii cluster species was uncorrelated with the degree of species divergence. These findings reinforce previous observations that courtship songs evolve rapidly enough to erase any signature of evolutionary affinity between closely related animal species.

xviii

Heidi Carlson

Chapter 7 - Nasonia (Hymenoptera: Pteromalidae) are small haplodiploid parasitoids of flesh- and blowfly pupae that have become model organisms for speciation research. The genus consists of four closely related species that harbor species-specific Wolbachia bacteria that cause postmating reproductive isolation. Antibiotic curing allows for interspecific crosses and genetic exchange between species which, together with haploidy of males, facilitates genetic analysis of fitness traits. In this chapter the author synthesize the current knowledge on the different prezygotic isolation factors that act in the Nasonia genus, and on the genetic basis of these traits. A major prezygotic isolation factor is courtship behaviour. Species differ in male courtship behaviour, and there is large variation in interspecific mate discrimination depending on species pair. The author summarize data on the strength of prezygotic isolation barriers between all possible species pairs and present new data on mate discrimination in choice and no-choice experiments. In tests of reinforcement, the author found no stronger female mate discrimination of N. vitripennis strains occurring in microsympatry with N. giraulti compared to that of allopatric N. vitripennis strains. Additionally, the author present data on the significance of cuticular hydrocarbon profiles for assortative mating in males and discuss other factors that may be involved in prezygotic isolation, including pheromone communication, within-host-mating and sneaking behaviour. Chapter 8 - Not all genes are equally important during the process of speciation. This premise underlies a basic question in evolutionary biology – “Does divergence at any one gene, or set of genes, play a particularly important role in speciation?” The answer to this question may appear to be no for some forms of reproductive isolation, but there may indeed be ‘kinds of genes’ that routinely play a role in speciation when divergence is driven by postmating, prezygotic traits. Here, I outline the kinds of molecular pathways and interactions that underlie postmating, prezygotic phenotypes which ultimately points to the kinds of genes where the author should look for species-specificity. Interestingly, it is only when the author consider the entire system of interacting sex proteomes, cell structure, membrane dynamics, and physiological pathways that a picture of where species-specific interactions likely occur becomes clear. While this approach points to several kinds of pathways and gene types, a notable finding is that cell membrane receptors (like G-protein coupled receptors and receptor tyrosine kinases) that line the inside of the female reproductive tract and trigger post-copulation cell signaling should be considered the kinds of genes that routinely contribute to reproductive isolation and speciation when divergence is driven by postmating, prezygotic phenotypes. Chapter 9 - Speciation, the process by which one species splits into two, involves the evolution of reproductive barriers such as the sterility or inviability of hybrids between previously interbreeding populations. One of the earliest intrinsic barriers to gene flow to evolve between geographically isolated populations is the sterility of hybrids of the heterogametic sex. The Dobzhansky-Muller model describes how hybrid incompatibilities that underlie intrinsic postzygotic reproductive barriers such as hybrid sterility may evolve. A major goal in speciation research is to identify the genes that underlie hybrid incompatibilities. The identification of such genes opens the door to understanding the molecular pathways which, when tinkered by evolution within species, lead to sterility in hybrids, and promises to reveal the biological forces that drive the evolution of hybrid sterility genes. While very few hybrid sterility genes have been identified so far, the idea that the evolution of DNA-protein interfaces driven by intragenomic conflict may cause hybrid sterility is gaining wider acceptance. Here the author describe how the molecular and evolutionary insights from two hybrid sterility genes

Preface

xix

– Odysseus and Overdrive – have illuminated the role of heterochromatin in the molecular basis of hybrid sterility and the role of genetic conflict as a driving force in speciation. Chapter 10 - With innovative DNA sequencing technologies has come a new appreciation for the content of animal and plant genomes. Overwhelmingly, a picture has been painted in which mobile and repetitive elements dominate the genomic landscape. Mobile genetic elements have recently been shown to contribute coding and regulatory sequences during their proliferation, leading to functional and regulatory novelty as well as element-mediated rearrangements coinciding with speciation events. Additionally, dormant elements occasionally erupt in bouts of excision and transposition in interspecific hybrids, resulting in a suite of maladaptive traits. The potential for mobile elements as key players in the evolution and diversification of genomes and species is immense yet in many respects transposable elements still remain the “dark matter” of the genome. This is particularly true of their role in speciation, and in order to fully appreciate their role, much work is still needed. In this chapter, the author investigate the evidence for transposable elements as drivers of diversification and speciation. Chapter 11 - Recent studies suggest that much hybrid incompatibility results as a consequence of conflict between different components of the genome (genomic conflict). In this chapter, I argue that the battlegrounds for much of the conflict-driven hybrid incompatibility consist of various cellular structures and processes. These include the recombination machinery, centromeres and kinetochores, and heterochromatin and its associated proteins. I conclude with a call to integration between cell biology and evolutionary biology in the study of the evolutionary genetics of hybrid incompatibility. Chapter 12 - In the present work, I give an all-embracing macroevolutionary perspective on processes of the evolution of life and culture on earth. First, I investigate a complementary form of natural selection that diverges from the traditional form in that it is acting independently of the external environment. This form of natural selection is found as a result of a mathematical analysis of the conditions for population growth. I extend my investigation as well to other evolutionary processes than the organic, such as the evolution of human language and the evolution of science, thereby suggesting other possible forms of underlying explanatory processes. I examine the concept of complexity and show that it implies new insights into the ways natural selection has been acting in forming the evolutionary and developmental processes. Especially, complexity is found to be growing in an accelerating mode, a process that is explained as the combined result of natural selection and a self-reinforcing feedback process. The use of the concept of complexity opens the possibility of construction of a new form of a Tree of Life, which, in contrast to traditional forms, combines complexity and time. Such an illustration of the evolutionary process explains the observation that most species live without great changes over vast periods of time. For species at the highest level of complexity there is no competition from species at still higher levels and these species can therefore, if conditions are beneficent, form new species at still higher levels. The process explains the emergence of new species and the general trend of evolution towards cumulatively higher complexity levels. The cumulative addition of species with successively higher complexity implies that the latest appearing species is the one of the highest level of complexity. At present, this species is the human species. Chapter 13 - Advances in modern medicine enable a change in the tension of intragroup selection in human populations. Thus, implementation of insulin for type 1 diabetes mellitus (DM) treatment considerably lowered the selection tension for this symptom and converted it from the sub-lethal to the one with a lowered adaptability. Increasing variety of type 1 DM and

xx

Heidi Carlson

type 2 DM is being observed recently in different populations. Moreover, recently the heterogeneity of type 1 DM and type 2 DM has also been observed. The investigation was aimed to study the influence of the selection on the evolution of DM clinical forms. Global implementation of insulin therapy into type 1 DM treatment caused the prevalent increase of this disease. Currently, there is a positive selection trend for type 2 DM, which is the original cause for the prevalence increase within the population, and the negative one for type 1 DM determines its prevalence within the population approximately on the same level. Intrapopulation change of gene frequencies, susceptible for type 1 and 2 DM, predetermined the development of such DM clinical forms as LADA (latent autoimmune diabetes in adults). It also resulted in the increasing number of patients with an absolute insulin deficiency of type 2 DM, which is a more complicated form of this DM type. Polymorphisms association, changing the immune response and forming the susceptibility to type 1 (С1858Т of the gene PTPN22, A49G of the gene CTLA4) and type 2 (Е23К of the gene KNJ11 participating in insulin insufficiency formation) with different DM forms illustrates the result of decreasing the selection tension against type 1 DM after insulin therapy implementation into the public health services practice. Chapter 14 - Genetic variation is generally responsible for ethnic differences in certain diseases, including inflammatory processes. The antagonist of cytokine IL-1, IL-1Ra, has been widely studied among Caucasian and African populations for genetic polymorphisms, and interethnic differences have been documented.  However, the variation and genotype distribution of polymorphisms from these genes among South American Amerindians are thus far unknown. The author present the results for a VNTR located in the IL-1Ra second intron, in a sample of 169 individuals belonging to 5 Native American populations from Argentina and Paraguay, identified as native according to their self designation, and their geographic location. The author also compare this data with the results obtained from a sample of non-native Argentinian people. Among the five known alleles of the VNTR, the author found only two (alleles 1 and 2) in the native populations from Gran Chaco, and heterozygosity was 19%. The allele 2 which is considered proinflammatory (IL-1Ra * 2) has been found in homozygosity at a considerable frequency among native individuals. However, the association of this allele with inflammatory disease previously demonstrated for other populations of the world, might not be acting in the same way for native people, probably due to local adaptation. This would indicate that the allele 2 will probably not have a negative influence on individuals of native origin who have homozygous genotype 2-2. On the contrary, few records on inflammatory disease are available for the native people. It seems that the increment on allele 2 is not related to any adaptive process but to genetic drift, that changes randomly the allele frequencies of different genetic regions along the genome. The effect of genetic drift has already been demonstrated with genetic markers located in autosomes, X and Y chromosomes. These results indicate that the author must be very cautious when studying populations that passed a process of genetic drift, which can become a confounding factor in epidemiological studies. This information will contribute to a future understanding of the association of this polymorphism with disease, and its incidence in different ethnic groups. Chapter 15 - Alternative splicing (AS) is a fundamental mechanism of gene expression regulation that extremely expands the coding potential of genomes and the cellular transcriptomic and proteomic diversity. This dynamic and finely-tuned machinery is particularly widespread in the nervous system and is critical for both neuronal development and functions. Alternative splicing defects, therefore, frequently underlie neurological disorders. In

Preface

xxi

this chapter, the author will focus on Parkinson’s disease (PD), the second most common neurodegenerative disorder worldwide. The author will provide a current overview on the impact of alternative splicing in PD by representing the multiple splicing transcripts produced from the major PD-linked genes and their regulation in PD states. Furthermore, the author will review the studies describing global splicing expression changes revealed by whole-genome transcriptomic approaches. The author will also summarize the current knowledge about the alternative splicing modulation in PD through non-coding RNAs (miRNA and lcnRNA) molecules. Assessing the role of alternative splicing on PD pathobiology may represent a central step toward an improved understanding of this complex disease. Chapter 16 - The microtubule-associated protein (MAP) tau is essential for the development of neuronal cell polarity. Tau protein is preferentially localized in the axon, whereas MAP2, another neuron-specific microtubule-associated protein, is localized in the somatodendritic domain. Previous studies have demonstrated that the localization of these proteins depends, at least in part, on mRNA subcellular localization - of tau mRNA into the axon and MAP2 mRNA into the dendrite. Tau protein plays a pivotal role in the pathophysiology of Alzheimer’s disease, in which its hyperphosphorylation promotes aggregation and microtubule destabilization. Tau undergoes alternative splicing, which generates six isoforms in the human brain, due to the inclusion/exclusion of exons 2, 3 and 10. Dysregulation of the splicing process of tau exon 10 is sufficient to cause tauopathy, and has been shown to be influenced by b -amyloid peptides, while there has been less research conducted on the splicing of other exons. This study found that the effects of -amyloid (42) on the alternative splicing of tau exon 2/3 and 6 caused formed cell processes to retract in differentiated cells and altered the expression of exon 2/3 in cell culture. Expression of exon 6 was repressed under -amyloid treatment. Although the molecular mechanism for this amyloidtau interaction remains to be determined, it may have potential implications for the understanding of the underlying neuropathological processes in Alzheimer’s disease. Chapter 17 - Alternative splicing is a co-transcriptional mechanism that regulates eukaryotic gene expression that affects almost 90% of the human genes. In this mechanism, different combinations of exons and introns can be identified and removed from the pre-mRNA, allowing multiple mRNA configurations of joined sequences to arise from a single gene, increasing the coding potential of the genome. Alternative splicing events are catalyzed by a large complex known as the spliceosome, which is conformed by more than 300 proteins and ribonucleoproteins. At the catalytic core of the spliceosome, the small nuclear ribonucleoproteins (snRNPs) U1, U2, U4, U5 and U6 are found. The auxiliary factors responsible for the fine regulation of this mechanism include two major groups: the SR proteins and the hnRNP family. Malfunctions of alternative splicing events can affect the natural expression of a large number of transcripts, including several factors involved in apoptosis or cell survival, molecular processes intimately associated with cancer evolution. In many cases, specific splicing factors or mutated components of the splicing machinery are linked to an anomalous event. Moreover, a switch in specific splicing factors occurs in particular types of cancer where the concomitant outcome is the production of non-functional proteins with added, deleted, or altered domains affecting tumorigenesis. With all this evidence, several strategies have been developed to regulate alternative splicing in which central or auxiliary splicing factors are the target of modulatory molecules. Given the combination of elements needed to regulate alternative splicing, the mechanisms underlying the functional and physiological

xxii

Heidi Carlson

implications of these tools are also diverse. Collectively, these strategies are intended to improve cancer prognosis, therapeutic and treatment. Chapter 18 - The precise control of protein production is essential for the appropriate cell physiology and survival. However, single mutations or accidentally introduced errors can occur during the flow of genetic information. In eukaryotic cells, some messenger RNA (mRNA) molecules leave the nucleus after splicing but further mechanisms are involved in the ultimate outcome of the correspondent protein. One of such systems corresponds to the mRNA surveillance network that includes nonsense-mediated mRNA decay (NMD), an important quality control system that ensures the accuracy of transcripts, to maintain a healthy cellular homeostasis. NMD eliminates anomalous mRNAs harboring premature termination codons (PTCs) to prevent the production of potentially harmful truncated proteins, but it can also regulate the steady state of many physiological mRNAs. Targets for NMD are sometimes linked to mutations or introduced errors but the vast majority can be generated as a result of alternative splicing. The key components required for NMD include the UPF and SMG proteins. These factors interact with a set of proteins (the exon junction complex or EJC) that are deposited just upstream of exon-exon junctions after mRNA splicing and orchestrate a regulated mechanism in order to identify PTCs and either sequester these mRNAs or target them for degradation. Some of these factors are linked to particular disorders and could be modulated in order to correct the defect. The NMD pathway is physiologically and medically important, because an escape from NMD can result in severe clinical phenotypes. Consistent with this, it is estimated that more than 60% of human genes have alternatively spliced products that generate at least one PTC isoform and that approximately 30% of inherited genetic disorders are caused by nonsense mutations or by frameshifts that generate nonsense codons. Initially associated as a genetic cause for beta-thalasemia, the NMD process has expanded from the haematopoietic system and it has reached different kind of human disorders, including cystic fibrosis, Duchenne muscular dystrophy, Hurler syndrome, recessive spinal muscular atrophy and polycystic kidney disease. Finally, it is predicted that some cancers are aided by NMD and the repression of this mechanism may be a potential target for the treatment of certain cancers. In this regard, pharmacological agents have been developed for the treatment of diseases caused by premature stop mutations, including aminoglycosides, but the whole therapeutic potential of NMD targets to correct genetic disorders remains to be exploited. Chapter 19 - Alzheimer’s disease (AD) is the most common type of dementia in the elderly population with a higher prevalence in women. Memory impairment and cognitive decline in AD are primarily linked to its neuropathological hallmarks, i.e., cholinergic neuronal atrophy and death, presence of intraneuronal neurofibrillary tangles and accumulation of amyloid β (Aβ) deposits within the extracellular senile plaques. Consequently, genes encoding Aβ, tau and proteins involved in Aβ procession received the most careful scientific attention. However, a growing body of evidence suggests that AD pathogenesis is not limited to the changes of AD genes’ expression, but also depends on their alternative splicing. Therefore, the present review focuses on data concerning alternative splicing changes in AD. First of all, pivotal AD genes (APP (amyloid precursor protein), tau, presenilin 1 (PS-1) and 2 (PS-2) and apolipoprotein E (APOE)) have a number of splice variants with divergent functions that are differentially expressed in AD and normal brain tissues. Second, alternative splicing of genes involved in Aβ processing and metabolism is also affected in AD. This group includes BACE-1 (β-site APP cleaving enzyme 1), nicastrin and APH-1 which are components of the γ-secretase complex, AIDA-1 (protein that binds to the intracellular domain of AβPP following cleavage by γ-

Preface

xxiii

secretase; FE65 (binds to the cytoplasmic tail of βPP). Finally, splice variants of such candidate AD genes as acetylcholinesterase (cholinergic deficit is one of the central mechanisms in AD development), estrogen receptor α (ERα) (estrogen deficiency is one of the predisposing to AD factors), BDNF (brain derived neurotrophic factor that is crucial for neuronal survival and synaptic transmission) and its receptor TrkB, excitatory aminoacid transporter 2 (EAAT2) (colocalized with tau in dystrophic neurons), genes of the ion channels and neurotransmitter receptors, synapsin, RCAN-1 (regulator of calcineurin), neuronal GFAP, ubiquilin-1 (related to the proteasomal degradation of proteins and interaction with PS-1 and PS-2) and genes involved in the regulation of the cell cycle and apoptosis (CIZ1, DENN/MADD) should be considered as important elements of the AD pathogenesis. Together, these data show that a lot of changes in alternative splicing are intimately linked to AD, which should be, thus, considered as a disorder with compromised and disregulated splicing events. Chapter 20 - Posttranscriptional control of gene expression is crucial for biological processes. In particular, alternative splicing allows the same gene to produce multiple proteins and is thus a key generator of functional complexity. This posttranscriptional regulatory mechanism is a prevalent feature of eukaryotic genomes, being currently estimated to occur in over 50% of plant genes. RNA-binding proteins (RBPs) are known to control many aspects of RNA metabolism, from pre-mRNA splicing to the transport and stability of mRNA transcripts. The Arabidopsis and rice genomes contain about 200-250 genes predicted to encode RBPs, but few of these proteins have been characterized in plants. As sessile organisms, plants are continuously exposed to environmental challenges that affect their growth and development. The phytohormone abscisic acid (ABA) is crucial in the coordination of plant responses to various abiotic stress factors. Interestingly, several RNA-metabolism genes have recently been implicated in the ABA pathway, providing a link between mRNA processing and ABAmediated plant stress responses. Indeed, the loss- or gain-of-function of genes encoding different classes of RBPs directly involved in constitutive and alternative pre-mRNA splicing, such as snRNP factors or SR and hnRNP proteins, has been shown to result in striking ABAresponse plant phenotypes. Functional roles in ABA biosynthesis or signaling have also been reported for other RBPs, including cap-binding proteins, RNA helicases, pentatricopeptide repeat proteins or poly(A) processing enzymes. Taken together, these data support the notion that posttranscriptional networks act as central coordinators of plant stress responses, namely by targeting key components of ABA signal transduction machinery. Future identification of the direct targets of these RBPs should uncover the molecular mechanisms underlying the mode of action of these proteins in the regulation of the ABA pathway. Chapter 21 - Alternative splicing occurs in most human genes and contributes to protein diversity by producing multiple mRNAs from each gene. Many of these alternative isoforms are expressed in a spatio-temporal manner and play important functional roles in many biological processes including neuronal events. Here, neuronal-specific splicing was comprehensively investigated by using P19 cells. GeneChip Exon Array analyses were performed of total RNA purified from cells during different stages of the differentiation process. Nine filtering conditions were used to efficiently and readily extract alternative exon candidates. A total of 262 candidate exons (236 genes) were obtained. Semi-quantitative RTPCR results of 30 randomly selected candidates suggested that the expression levels of 87% of the candidates were at least 2-fold different between undifferentiated and differentiated cells. Gene ontology and pathway analyses also showed that many of these 236 candidate genes played important roles in neuronal events. These results suggested that this novel method to

xxiv

Heidi Carlson

determine alternative exons was successful and efficient. In addition to the known neuronal functions, informatics analyses demonstrated that alternative splicing events of 11 candidate genes played important cell cycle functions. These results suggest that this novel method also provides a way to determine the functional roles of previously unknown alternative splicing events. Chapter 22 - Only sequence analysis of full-length transcripts can identify genuine alternative splicing variants. However, it was difficult to obtain full-length cDNAs for rare or long-sized transcripts. Recently, the author have developed a powerful method, named a vectorcapping method, to construct a size-unbiased full-length cDNA library containing rare or verylong-sized cDNA clones with >10kbp inserts. The characteristic of the full-length cDNA contained in this library is that the intactness of the 5’-end capped site sequence of the cDNA can be assured by the presence of an additional dG at its 5’ end. Since this full-length cDNA is derived from a single mRNA, this library enables us to perform in-depth analysis of genuine alternative splicing variants. Using the vector-capping method, the author prepared full-length cDNA libraries from human retina-derived cell lines and analyzed the full sequence of the clones. As a result, the author found many novel alternative-splicing variants for rare or longsized transcripts. In this chapter, I show the examples of these variants including very-longsized transcripts with >7kbp that were identified by us for the first time. Chapter 23 - Genome-wide analysis indicate that alternative splicing of mRNA precursors (pre-mRNAs) affects the vast majority of human genes. Alternative splicing provides a fundamental mechanism to increase transcriptome complexity, allowing the production of two or more mRNA variants that often encode proteins with different, sometimes opposite functions. Its importance is underscored by the observation that misregulated alternative splicing can lead to human diseases. Pre-mRNA splicing has long been known to be regulated by cis-acting sequence elements and trans-acting protein factors. In higher eukaryotes, it mostly occurs co-transcriptionally so that it is not surprising that a role for chromatin and epigenetic factors in the regulation of exon inclusion is now emerging. In this review, the author will discuss the most recent findings on the roles played by chromatin structure on the modulation of the cotranscriptional splicing reactions. In particular, the author will focus our attention on how the modulation of the transcribing RNA polymerase II, the changes in nucleosome architecture and the presence of different histone modifications contribute to the regulation of the splicing process. Chapter 24 - Alternative splicing expands transcriptome diversity and allows cells to meet the requirements of an ever-changing extracellular environment. It has been more than 30 years since nitric oxide (NO), a gaseous free radical, was recognized as a critical physiologic signaling molecule. Since then the list of known NO-directed functions has grown substantially to include regulation of smooth muscle function in vascular and gastrointestinal systems, inhibition of platelet aggregation and adhesion, neurotransmission and neuromodulation, regulation of cellular respiration and cytotoxicity, mitochondrial biogenesis and, immune defense. However, the importance of alternative splicing in regulation of enzymatic components of NO signaling pathway started to emerge only recently. Our understanding of the mechanisms governing this process remains very limited and awaits systematic investigation. In this chapter the author will attempt to summarize the available information on alternative splicing of major enzymes mediating canonical NO transduction through the secondary messenger cGMP. The author will highlight evidence accumulated from different laboratories that suggest splicing of enzymes in the NO/cGMP pathway, including nitric oxide

Preface

xxv

synthases, heterodimeric soluble guanylylcyclase and cGMP-dependent protein kinase, is very complex and strongly affects NO signaling in response to various environmental cues. Future studies will certainly bring new, exciting insights into the role that alternative splicing plays in NO/cGMP biology. Chapter 25 - Genes could produce multiple protein-coding transcripts by alternative splicing (AS). It was known that AS is related to several diseases in generating biological and functional diversity. So, analysis of the mRNA diversity of genes would be important for understanding gene function. Previously, we obtained 1.46 million human full-length cDNAs (FLJ cDNA) and sequenced their 5’-ends. The author selected approximately 55 thousand cDNAs from FLJ cDNA and sequenced completely. Our FLJ cDNAs were constructed by an optimized oligo-capping method. Thus, by using 5’-EST data, a lot of valuable information was obtained regarding the diversity of the transcription start site (TSS) and amino acid sequences at the N-terminal ends of proteins. The author found that alternative TSSs were utilized for tissue-specific expression. Using this data, the author constructed FLJ Human cDNA Database ver. 3.2, http://flj.lifesciencedb.jp. But, a lot of AS-related information still remains to be extracted from our 1.4 million cDNA resources. From a huge number of human sequence information, the author selected only the reliable cDNAs for the analysis of the mRNA diversity. And, the author developed probes which can analyze the mRNA diversity. As a result, by comparing our constructed 5,784 pairs of independent probes, the author are able to detect the expression profiles of splicing patterns in 3,413 genes. Moreover, using these probes, the author analyzed the mRNA diversity of genes after inducing neuronal differentiation in human NT2 teratocarcinoma cells using all-trans retinoic acid (RA). Analyses of NT2 cells identified 452 RA-responsive genes. The mRNA diversity analysis revealed that the rate of genes that showed AS in their N-terminus, internal region, C-terminus, is almost the same, respectively. Chapter 26 - Alternative splicing of pre-messenger RNA is nearly universal, involving more than 90% of human genes. It’s an essential step in gene expression and responsible for much of the proteome diversity in mammalian genomes. The immune system requires a great diversity of functional proteins and immune cells need to respond to various foreign invasions rapidly. Alternative splicing provides one more layer of regulation that is essential for the function of human immune system. Many immune genes have been found to undergo alternative splicing, which plays an important role in the regulation of immune cell activation and function. Dysregulated splicing has been shown to be involved in various immune disorders, such as systemic lupus erythematosus (SLE) and rheumatic arthritis (RA). It may be a direct cause of the disease, or a modifier of disease susceptibility and severity. Further understanding of how alternative splicing may be used as a general mechanism in immune response is essential for our research in the pathophysiology of autoimmune diseases and development of new therapeutics for those diseases. This chapter provides an updated review about alternative splicing in human immune system as well as the relationship between dysregulated splicing and autoimmune diseases, particularly SLE and RA. Chapter 27 - Poly(ADP-ribosyl)ation is a major post-translational modification performed by Poly(ADP-ribose) Polymerases (PARP1). PARP1 utilizes NAD as the substrate to synthesize a long linear and branching poly(ADP-ribose) (pADPr), ranging in length from 2 to 200 units of ADP-ribose. PARP1 can modify a variety of proteins by attaching pADPr to the target proteins in either a covalent or noncovalent manner. In this way, Poly(ADP-ribosyl)ation is involved in a number of biological processes, including transcription regulation, stress responses, and apoptosis. Recent studies have demonstrated that several splicing factors,

xxvi

Heidi Carlson

including hnRNPs and S/R proteins, are poly(ADP-ribosyl)ated via noncovalent binding by PARP1. Here, the author describe how poly(ADP-ribosyl)ation regulates alternative splicing by modulating the activities of these splicing factors. In addition, the author discuss a possible role of PARP1 in coupling transcription with splicing. Chapter 28 - Genetic and behavioral data mining will revolutionize health/lifestyle delivery and outcomes, in much the same way the Internet delivered meaningful social outcomes by providing the infrastructure for information to be collected and connections to be made in ways that had not been possible hitherto. Genetic databases and lifestyle correlations via the cutting edge field of bioinformatics, wearable technology and personalized medicine will be the next echelon of information to be reconnoitered and used through the Internet to enrich our lives. Thanks to smart phones and wearable technology, it will all commence from the palm of our hands. In this review, the author will spotlight the emerging fields of bioinformatics, personalized medicine and biosensor technology: historical insights, current issues, and future trends. In particular, the author will embark on an in-depth look into the sub-fields of personalized medicine and wearable systems for health and lifestyle management. The healthsector, being information intensive, will exploit IT-led platforms that capture personalized health data in real-time and have connectivity with a cloud backbone to intelligently process the information to deliver real-time analytics and actions. Various roadmaps are presented offering aggressive offensive and defensive IP strategies and solutions to companies in the bioinformatics and biosensor space. How does current patent law and policy in the wake of the AIA reforms and Supreme Court decisions in Alice and Mayo impact on this field and on the strategic guidepost? What’s more, the author will reopen the patent troll reform debate: will it create a sweeping sea change, or be just another talking point. How do the sweeping provisions of Obamacare touch upon the field of wearable health systems and bioinformatics? Moreover, how can the author reconcile proprietary value with the growing trends of the open-source movement and the big health data initiatives that lie at the intersection of private and non-profit sectors? Finally, all of this big health data begs an inquiry into issues of privacy and a host of other ethical concerns. With the right strategies in their IP toolkit, bioinformatics and wearable startup companies will not only bolster their current patent position, but also be able to leverage it into a significant competitive advantage. More importantly, the broader public will be able to avail themselves of the utility of these flash-bulb popping innovations that promise to capture personalized health data in real-time to deliver targeted and improved health outcomes. Chapter 29 - Marfan syndrome is a heritable disorder of connective tissue that is transmitted as an autosomal dominant trait and is characterized by the mutation in the fibrillin 1 gene (FBN1). At present, the diagnosis of Marfan syndrome, based on Ghent criteria, considers both clinical evaluation (in which it is possible to observe alterations in eye, osteoarticular apparatus and cardiovascular system) and genetic evaluation (that reveals a FBN1 gene mutation). Moreover, the author take into account the presence of affected relatives suffering of the same syndrome. The diagnosis of Marfan syndrome is often complex because of the evolution of the phenotype with age and because of the inter-individual variation in the clinical presentation even among the affected family members. According to a recent review, Marfan syndrome is often associated with a range of psychiatric problems like anxiety disorders, depressive disorders, schizophrenia, neurodevelopmental disorders (autism spectrum disorder and attention deficit/hyperactivity disorder) and eating disorders. The author report a 16 years old female patient (MF) (kg 43, H 165 cm, BMI 16.9) who came to our outpatient service for a selective feeding successively diagnosed as Avoidant/Restrictive Food Intake

Preface

xxvii

Disorder (ARFID; DSM 5). “Selective feeding” refers to children who restrict the ingestion of food to a limited number of “favourite” foods, typically five or six different foods. ML., indeed, eats only pasta, sweets and a few other foods. Beyond the altered feeding behaviour, she was diagnosed with a mild intellectual disability (IQ=57; VIQ=61; PIQ=62) and reduced adaptive levels in the socialization and communication domains of the Vineland Adaptive Behavior Scales (VABS). This patient presented ligamentous laxity, long-limbed body habitus suggestive for Marfan syndrome. Therefore, she was addressed to the cardiologist: the echocardiographic evaluation showed mild dilatation of aortic root, with rectilinear sinotubular junction and enlarged ascending aorta (z score=2). Z-scores of the aortic root at the level of the aortic annulus, sinuses of Valsalva, sinotubular junction, and ascending aorta measured from the parasternal long axis in diastole using leading-edge-to-leading-edge technique. The eye examination was normal. Sanger sequencing of the FBN1 gene identified the c.7501G>A (p.Val250lle) variant/mutation. The missense mutation/varianti is not reported in UMD, Enseble, Exome variant server and dbSNP. The SIFT, PoliPhen2, Mutation Tester (software tool) for predicting damaging of missense mutations and variants gave the following results: PoliPhen2: benign; Mutation Tester: disease causing, SIFT: tolerant. Her mother carries the same mutation. ML. is affected by ARFID, (mild) intellectual disability and adaptive disorders often associated with Marfan syndrome, confirming and extending the results obtained in the review previously described. Moreover, the author underline the importance in multidisciplinary diagnosis and care (also) in these cases. Chapter 30 - The author have previously shown that introduction of single genes encoding diacylglycerol acyltransferases (DGAT1s) or partially-silenced mitochondrial pyruvate dehydrogenase kinase (mtPDCK), each had the capacity to enhance seed oil content in Arabidopsis. In the current study, the author report the cumulative effects of expressing a twogene stack: a site-directed mutagenized DGAT1 from Tropaeolum majus (TmDGAT1 Ser197to-Ala197) and an anti-sense mtPDCK from B. napus (A/S mtPDCK) introduced into B. napus cultivar DH12075 to alter seed oil content. Compared to plasmid-only controls, the best lines of the two-gene construct showed, on average, a 23.6% proportional increase (11.6% net increase as % of DW) in oil content which is near-additive to the best results obtained in transgenic experiments with the single genes. These findings demonstrate the utility of stacking two specific transgenes controlling the key steps in two very different metabolic streamsmitochondrial carbon flux (mtPDCK; “push”) and triacylglycerol assembly via the Kennedy pathway (DGAT1; “pull”), to bring about significant increases in oil content in B. napus. This approach holds promise for similar use in other oilseed crops. Chapter 31 - It is well known that genetic variations can in part affect human oral health. Periodontitis is a common dental noncommunicable disease (NCD). According to the World Health Organization, periodontitis affects 20% of the world population. Periodontal inflammation could eventually induce alveolar bone resorption, causing tooth mobility and tooth loss, which ultimately affects oral function, oral health and the individual’s quality of life. Family study, twins study and linkage analysis in the early years revealed that genetic influence contributes to periodontal disease. Since the first single nucleotide polymorphisms (SNP) study on chronic periodontitis in 1997, many genetic loci were found to be associated with periodontitis, including IL-1, Fc gamma receptor and complement component 5 genes. Population structure or earlier investigations employing a less desirable sample size may lead to various limitations or bias and therefore diverse results. Meta-analysis reports have proved the association between periodontitis and SNPs in some regions, such as IL1 and HLA. With

xxviii

Heidi Carlson

development of the technologies, multiple genes can be analyzed in a single assay, and even whole genome SNPs can be screened. Seven genome-wide association studies (GWASs) investigated the potential genetic risk locus for periodontitis and found GLT6D1 is significantly associated with aggressive periodontitis. In the future, whole genome sequencing, together with replication in multiple populations and functional studies, could potentially disclose the nature of periodontitis as an NCD. Chapter 32 - Imprinted regions of the mammalian genome are commonly composed of one or more paired paternally and maternally imprinted genes and differentially methylated regions (DMRs). These DMRs are methylated in an allele-specific manner during germ-line or early embryonic development, and they regulate allele-specific gene expression. Although genes in most imprinted regions are expressed ubiquitously among tissues, some imprinted regions manifest tissue-specific gene expression patterns. The brain is a major site of tissue-specific gene expression from imprinted regions in embryonic tissues. The author summarize several imprinted regions that show neuron-specific gene expression patterns. First, the author describe the SNRPN-UBE3A domain, which contains three brain-specific imprinted genes, SNORD115, UBE3A-ATS and UBE3A, as well as one imprinted gene with a brain-specific promoter, SNRPN. Second, the author discuss the DLK1-DIO3 domain, which contains the braindominant imprinted genes SNORD112, SNORD113 and SNORD114 as well as numerous brainspecific imprinted miRNAs. Third, the author provide an overview of Grb10, which also has a brain-specific promoter and switches the imprinted allele during early neurogenesis. Our chapter reviews these imprinted regions and describes the similarities and differences of the neuron-specific imprinting switch in each region. Chapter 33 - Treatment of human diseases in general has dual goals: to treat effectively, at the cost of minimal adverse side effects. However, person-to-person differences on drug efficacy and adverse reactions have been frequently observed. Pharmacogenomic studies intend to address such differences based on personal genomic variants such as single nucleotide polymorphisms. In the past, success has been achieved on the identification of major histocompatibility complex genomic variants which are associated to immune-mediated adverse drug effects. Additionally, genomic variants on the direct drug targets have been found to be associated to drug efficacy. Besides immunological and drug-target factors, one other critical factor is on the drug metabolism mediated by various xenobiotic metabolizing and detoxification enzymes. They determine how quickly the drugs can be metabolized and then excreted from the body, thereby affecting drug efficacy and toxicity. Human xenobiotic metabolizing enzymes are categorized by their phases in the metabolozing processes: the modification phase (phase 1), the conjugation phase (phase 2), and further modification and excretion (phase 3). Previously, genes involved in phase 1 have been extensively studied in pharmacogenomics. In comparison, genes in phase 2 received less attention, despite the fact that they are no less important. These genes include Uridine DiphosphoGlucuronosyltransferases and others. This Chapter presents the genomic variants on phase 2 genes which can account for the drug efficacy and adverse reactions. Chapter 34 - In species with separate sexes, gender differences in longevity are widespread and the extent and direction of these differences varies tremendously among taxa. To understand sexual dimorphism in longevity and explain how different forms of selection shape longevity and other fitness-related traits within and among species, it is important to obtain information on the genetic architecture (the number of genes and degree of inter- and intragenic interactions) and various mechanistic causes which underlie mortality variation between

Preface

xxix

the sexes. Here the author review recent empirical studies on gender differences in longevity in insect species, from both mechanistic and evolutionary perspective. Whenever it was possible, the author focus on data obtained from the laboratory evolution experiments because the study of evolution under controlled conditions may provide valuable evidence not only for the effects of natural and sexual selection in shaping sex-specific longevities and mortality rates but also it offers novel insights into the mechanistic basis of these differences. Chapter 35 - During mating, male bush-crickets transfer a complex spermatophore to the female. The spermatophore is comprised of a large nuptial gift which the female consumes while the sperm from the ejaculate-containing ampulla are transferred into her. Two main functions of the nuptial gift have been proposed: the ejaculate protection hypothesis and the parental investment hypothesis. The former, founded on sexual selection theory, predicts that the time to consume the gift is no longer than necessary to allow for full ejaculate transfer. The latter maintains that gift nutrients increase the fitness or quantity of offspring and hence the gift is likely to be larger than is necessary for complete sperm transfer. With an aim to better understanding the primary function of nuptial gifts, the author examined sperm transfer data from field populations of five Poecilimon bush-cricket taxa with varying spermatophore sizes. In the species with the largest spermatophore, the gift was four times larger than necessary to allow for complete sperm transfer and is thus likely to function as paternal investment. Species with medium and small gifts were respectively sufficient and insufficient to allow complete sperm transfer and are likely to represent, to various degrees, ejaculate protection. The author also found that species that produce larger spermatophores transfer greater proportions of available sperm than species producing smaller spermatophores, and thus achieve higher paternal assurance. Chapter 36 - Mate choice copying was mostly described as a strategy employed by females to assess the quality of potential mates, but also males can copy other males’ mate choice. In both cases, focal individuals show an increased propensity to copulate with a potential mating partner they could observe interact sexually with another individual (the ‘model’). Sexual interactions, however, convey additional—partly conflicting—information to the choosing individual: females may try to avoid sexually active males due to a rougher courtship or coercive mating attempts, and males may respond to an increased sperm competition risk (SCR). How do females and males respond to different copying situations, in which the model individual either resides in the vicinity of a potential mating partner without physical contact (i.e., no harassment, and low SCR), or interacts sexually with the potential mating partner? Do individuals copy less in the latter situation? The author investigated these questions in the guppy (Poecilia reticulata), a livebearing fish with internal fertilization, strong SCR among males, and frequent sexual harassment of females. Focal individuals could choose to associate with a large or a small stimulus fish, and mate choice tests were repeated after the previously non-preferred stimulus fish could be seen associating (low harassment and low SCR) or physically interacting (high harassment and high SCR) with a model individual. In a control treatment, no model was presented. The author found both males and females to copy similarly in both copying treatments, while no response was observed in the control. This contrasts with a study reporting that Atlantic molly (P. mexicana) males copy less under elevated SCR. Even though the author lack a compelling explanation as to why both congeners might differ, the author are tempted to argue that strong(er) benefits arising from copying may have selected guppies to copy in a broader range of contexts, including situations where the choosing individual incurs harassment or SCR.

xxx

Heidi Carlson

Chapter 37 - Across pre-industrial human societies mating is regulated, with arranged marriage, in which male parents select spouses for their female relatives, being the primary mode of long-term mating. This chapter reviews the model of sexual selection under parental choice that offers a good account for these patterns of human mating. This model postulates that parent-offspring conflict over mating induces parents to control the mate choices of their children, and the spouses they select for them are individuals who conform best to their preferences. By doing so, parents become a significant evolutionary force affecting the course of sexual selection. The model is applied in order to achieve a comprehension of the evolution of specific mating strategies. In particular, it is argued that in a context where mate choice is regulated, at least three mating strategies can thrive: addressing parental choice, addressing female choice and circumventing parental and female choice by force. Chapter 38 - The need for germplasm banks that safeguard the melon genetic resources is more than justified by the genetic erosion aggravated in the last few decades, not only in the cultivated materials, but also in traditional landraces and wild relatives. The classical and new technologies employed in all stages, from the sample prospecting to resources management, with the conservation and evaluation of the plant resources in between, are described. An added value to these germplasm collections is the use of the genetic resources there preserved in the melon breeding programs. The access to wild genetic resources make possible to exploit them, for instance, for germplasm enhancement incorporating disease resistances in elite varieties. In this sense, conventional breeding methods have rendered unquestionable benefits to agriculture, which can be accelerated by the appearance of new biotechnological tools and genomic resources as a result of the increasing number of vegetable species whose genomes have been or are being sequenced. All germplasm banks, and those preserving vegetable resources like melon in particular, will have to face up to the challenge of characterizing genetically their collections in order to maximize their use in breeding strategies assisted by molecular tools, like molecular markers. At the same time, the use of molecular markers can help to efficiently manage the resources by the creation of core collections. This would alleviate the problems derived from the high number of entries in many of them that is compromising some of the purposes for which they have been created, the conservation and the use of the genetic diversity originally prospected. The advantages in terms of labor and economical investment of preserving, characterizing and using a reduced subset of samples without a considerable sacrifice of the genetic diversity, are undeniable. Chapter 39 - The evolution of cultivated plants played important role in the ascent of humanity. A large number of theories exist about the evolution of the European grapevine (Vitis vinifera ssp. sativa L.), it is supposed, that woodland grape itself, or crossing with other species could be the progenitor. The woodland grape (Vitis vinifera ssp. sylvestris GMEL.) in Hungary is a protected species. The quest and preservation of its populations are significant in terms of nature conservation and reserve of biodiversity as well. In the years of 2010-2015 32 woodland grape genotypes were collected in the Szigetköz, Hungary and ex-situ preserved in the genebank National Agricultural Research and Innovation Centre, Research Institute for Viticulture and Enology, in Badacsonytomaj, Hungary. In 2015-2016 these genotypes were characterised by SSR analysis and were compared with 20 grape rootstocks and 16 Vitis vinifera ssp. sativa cultivars to ensure the true-to-typeness. Based on the results dendogram was constructed. In the dendogram the Vitis vinifera ssp. sylvestris accessions form an distinct group, but are closer to the Vitis vinifera ssp. sativa cultivars, than to the rootstocks. This raises the probability, that these accessions are true-to-type woodland grapes.

Preface

xxxi

Chapter 40 - Two major cherry species are grown for their fruit, the diploid sweet cherry and the tetraploid sour cherry. Cherries are characterized by high genetic diversity mainly due to their self-incompatibility propagation system. Estimation of the species phenological and genetic diversity has been performed using a number of different traits and marker systems including morphological and anatomical characteristics, as well as isoenzyme and molecular markers. Different molecular markers have been used, spanning from restriction fragment length polymorphisms (RFLPs) to single nucleotide polymorphisms (SNPs), simple sequence repeat (SSR) markers being the most frequently. Moreover, molecular markers have also been used to mark and trace specific agronomic traits, such as self-(in)compatibility (S-alleles) or fruit weight thus developing functional markers. The markers reviewed herein will be useful not only for monitoring the genetic diversity in cherry breeding programs, but also for gene conservation, while these or other markers may permit marker-assisted selection for favorable agronomic traits. Chapter 41 - Soybean purple seed stain (PSS) causes seed decay and purple seed discoloration, resulting in overall poor seed quality and reduced market grade and value. It is a prevalent soybean disease that also affects seed vigor and stem establishment. PSS is caused by the fungus Cercospora kikuchii and other Cercospora spp. The most common symptom of this disease occurs on the seed. Infected seeds may appear healthy or have discoloration in seed coat varying from pink to light or dark purple spots with range in sizes from a small speck to the entire seed coat. Warm and humid environments favor pathogen growth and disease development. Management strategies for this disease include crop rotation with non-legume or non-host crops, fungicides applications, and tilling the soil to disrupt spore dissemination. Along with these strategies, the use of resistant cultivars may provide more reliable and economical control of PSS, especially when environmental conditions are conducive for disease development. In this chapter, general information about the PSS and an overview of research on germplasm screening and genetic resistance are presented and discussed. Chapter 42 - The tissue cryopreservation represents an interesting tool for the conservation of animal biodiversity. The establishment of tissue banks has been indicated as a practical approach to the preservation of species and, associated with other biotechniques, it could provide the rescue or multiplication of endangered species. In general, a large number of wild species have been having their gonadal and somatic tissue cryopreserved and for this purpose, the vitrification is the method routinely used. There is a diversity in cryobiological properties and requirements among cell types within tissues, presenting a challenge for its procedure. Nevertheless, even with those obstacles, studies have shown satisfactory results in many wild mammalian species. The gonadal tissue use involves the possibility for the reestablishment of endocrine functions of the testes and ovary allowing the preservation and posterior use of spermatozoa and/or spermatogonial stem cell and oocytes for other assisted techniques. Recent developments in the autografting and xenografting of testes and ovary clearly demonstrated the potential value of cryopreserving gonadal tissue. Already on the somatic tissue, skin samples have been widely utilized because of the possibility of sampling a large group of animals, without a dependency of limitations regarding gender or age. Moreover, this tissue can be obtained quite easily at using a simple methodology with a reduced cost. In this sense, this chapter highlights the importance of applying tissue cryopreservation to wild mammals conservation at showing the most recent studies in this area and the perspectives for its use in conservative programs.

xxxii

Heidi Carlson

Chapter 43 - The author sequenced mitochondrial genes (COI, COII, Cyt-b) of accepted Latin America tapir species (Tapirus pinchaque, T. terrestris and T. bairdii) as well as an alleged new species, T. kabomani. The mountain tapir (T. pinchaque) is a relatively rare large mammal species. Some population censuses indicate that no more than 2,000 mountain tapirs are left in the wilderness areas of Colombia, Ecuador and Peru. Our results showed that the gene diversity levels are medium to low with respect to other mammals sequenced for the same or similar genes. However, these gene diversity levels are not impoverished, which means that the genetic situation of this species is not as critical as its population censuses suggest. It will be crucial to determine the gene diversity levels in certain populations not included in the current work (the eastern and, possibly, western Andean Cordilleras in Colombia as well as the Tabaconas Namballe National Sanctuary in Peru), because they are probably the smallest populations of this species. On the other hand, the lowland tapir (T. terrestris), the species with the largest geographical distribution in Latin America, showed the highest gene diversity levels of all the other tapir species studied. Additionally, the genetic structure of T. terrestris is clearly more robust than that of T. pinchaque. Different geographic populations of both species showed different demographic trends throughout time. Our results including five samples of T. kabomani showed this taxon to be a haplogroup within T. terrestris, reducing the likelihood of T. kabomani being a new full species. Finally, the author also analyzed the influence of diverse Pleistocene climatic changes on the mitochondrial haplotype diversification of T. terrestris and T. pinchaque. The Pleistocene Refugia and the Recent Lake hypotheses probably played integral roles in the evolutionary history of T. terrestris. In contrast, the Pleistocene Refugia hypothesis involving the Andes, which probably played an important part in the genetic diversification of other mammals, did not have a significant impact on T. pinchaque. Chapter 44 - Plants are responsible for a significant part of food supply for the entire world, and through agriculture they play an extremely important socio-economic role for the mankind. Therefore, the development of genetically improved crops becomes even more relevant for it aims at an everlasting enhancement of agronomic traits of interest. For many years, plant genetic improvement program has been based in empiric selection of the target traits; however, significant advances were obtained in the last years. Many tools, allowing crops to be improved with greater optimization of the time needed to reach the necessary modifications, are currently available. Regarding the methods used in the genetic improvement, molecular studies have been essential to identify which genes are important for each specific agronomic trait, such as those related to tolerance to abiotic stress. Such studies contribute not only to a better understanding of the endogenous defense mechanisms of plants at molecular level by which these organisms adapt when facing hostile conditions, but also contribute to the generation of stress-tolerant crops by genetic engineering. These programs aim a significant productivity and sustainability that can be reached through soil preservation that is directly related to less necessity of farm inputs. Better adapted crop cultivars make it possible, as well as better use and decontamination of water resources. In this chapter the author attempt at providing an overview regarding strategies that have been used for prospection of genes related to the response of plants to abiotic stress. The combination of biotechnological and bioinformatics tools used in the identification of stress-related genes and development of genetically engineered crops by silencing and/or over-expression of specific genes will be presented in this chapter. Emphasis will be given to the drought and salinity that represent a major part of abiotic

Preface

xxxiii

stresses by which the plants are often exposed, leading to serious production losses in many important crops worldwide. Chapter 45 - Proteinuria is the hallmark of diabetic nephropathy (DN) and vastly increases the incidence of cardio-vascular disease and mortality. Traditional Chinese Medicine (TCM) has been used for diabetes and its complications for thousands of years and appears to be promising in the treatment of proteinuria in DN patients. Clinical trials evaluating TCM for proteinuria, either used as a monotherapy or in combination with western medicine, has produced positive results. Although a large number of clinical studies have been conducted, the clinical evidence with regard to TCM for proteinuria in patients with DN remains inconclusive. The recent progression of evidence will be introduced in this chapter. Current basic research has disclosed that TCM might affect a variety of genes regarding DN etiology. This chapter will analyze recent achievements in this area and address the issue of the association between clinical evidence and the genetic effects of TCM. Chapter 46 - Ansamycins are composed of secondary metabolites possessing a high degree of activity against numerous types of Gram-positive and Gram-negative bacteria. Structurally, ansamycins are characterized by the presence of core structures including an aromatic moiety (benzene or naphthalene derivative) and an aliphatic chain. Most ansamycins were isolated and characterized from Actinomycetes, while a few were mined in higher plants, for example, maytansine and colubrinol. Due to the development of microbiological techniques, genetic engineering and recombinant proteins, a wealth of different types of ansamycins have been mined along with their biosynthetic gene clusters. This resulted in developed strategies for enhancement of ansamycin production as well as synthesis of novel structure derivatives. In this chapter, the author will describe the biochemistry and genetics of the most important members of ansamycin antibiotics and their applications as cytotoxic, anti-tumor, anti-parasitic and anti-bacterial agents. Thereafter, the future of ansamycins will be discussed to outline the most critically applied aspects in the last. Chapter 47 - Ubiquitously expressed protein products of BRCA1 and BRCA2 genes are implicated in processes fundamental to all cells, including DNA repair and recombination, checkpoint control of cell cycle, and transcription. BRCA gene mutations lead to disruption of BRCA proteins in mutation carrier cases and induce susceptibility to specific types of cancer. Among women with germline BRCA mutations near 50% of mammary malignancies are triple negative breast cancer (TNBC) presenting with a high grade histologically. Among women with breast cancer, TNBC was established in 57.1% of BRCA1-mutation positive and in 23.3% of BRCA2-mutation positive cases, whereas in only 13.8% of BRCA-proficient women. Although BRCA gene mutation carrier women usually exhibit clinical symptoms of defective estrogen receptor (ER) signaling; such as anovulatory infertility and early menopause, the serum estrogen levels of these patients are consequently elevated. In these cases, a compensatory feedback mechanism aims to break through the inherited or acquired ER resistance by increased estrogen synthesis so as to maintain the cellular estrogen surveillance. The higher the estrogen overproduction of BRCA-mutation positive cases, the higher the possibility of tumor-free survival. In conclusion, BRCA1 and BRCA2 gene mutations seem to increase the breast cancer risk, particularly that of TNBC, in case of insufficient compensation of defective ER signaling. Upregulation of these genes by means of elevated estrogen levels of high parity, artificial hormonal cycle created by oral contraceptives or a pregnancy mimicking high estrogen dose may decrease the excessive cancer risk of BRCA mutation positive women.

xxxiv

Heidi Carlson

Chapter 48 - Rett syndrome (RTT) is a neurodevelopmental disorder mainly caused by mutations in the MECP2 gene affecting around 1 in 10,000 female births. Mutations in the MECP2 gene have been associated with the onset of RTT. Clinical manifestations include severe linguistic and motor impairments that are the core of phenotype symptoms. Some patients show a moderate level of conservation of linguistic functions while others lose the use of functional verbal communication. The objectives of the present chapter are to study in depth the latest theoretical approaches to the link between linguistic processes and the specific RTT genotype. This chapter begins with a theoretical overview on cognitive alterations and then focuses on linguistic specific impairments characterized by the loss of articulation or the production of few functional sounds. A restricted sample shows the presence of verbal speech (Preserved Speech Variant). Renieri et al. (2009) proposed the term “Zappella variant” rather than “preserved speech variant” to describe milder forms of RTT, because other aspects, besides speech, are involved. The second part proposes a preliminary research which analyses the correlation between linguistic phenotype and specific genotype. Chapter 49 - Marfan Syndrome was originally described by Antoine Bernard-Jean Marfan in 1896 and is an uncommon inherited connective tissue abnormality which occurs as an autosomal dominant genetic disorder with frequent mutations. The patients have normal mentation but have a characteristic increase in height, abnormally long limbs, arachnodactyly, joint hypermobility, distinctive facial features, scoliosis, ectopia lentis, dural ectasia and array of aortic and cardiac abnormalities that are often life threatening. The genetic cause of the disease has been identified. Although some medical and surgical treatments are currently in practice they are not always helpful. The orthopaedic problems are often significant and sometimes require complex surgical interventions. Chapter 50 - Marfan syndrome (MFS) is a systemic connective tissue disorder that is caused by mutations in the extracellular matrix protein fibrillin-1. While MFS is considered to be at high risk of dental disorders and cardiovascular disease (CVD), little causal relationship has been provided to date. In this article, the author reviewed the prevalence of periodontitis in patients with MFS to assess the relationship between periodontal bacterial burden and CVD in MFS patients. Chapter 51 - Introduction: Pectus deformities can coexist with cardiovascular diseases. This association is well known in tissue conjonctive disorders such as Marfan's syndrom. Combined procedures can be performed safely and represent an interesting alternative in such situations. Valve sparing aortic root replacement has excellent long term outcomes and has become an increasigly popular alternative to aortic root replacement especially in young marfan patients to avoid lifelong anticoagulation. The author present our serie of single-stage pectus correction and cardiac surgery, and emphasize the role of aortic valve sparing interventions in such situations by a review of the literature. Methods: A retrospective review was conducted of patients who underwent chest deformity repair and cardiac surgery at the same time from January 2007 to May 2014. All datas were collected propestively in our data base. A review of literature was conducted to collect all published cases of combined valve sparing root replacement and correction of a chest wall deformity. Results: Including our serie (4 patients) 12 patients underwent a combined Tirone David and chest wall deformity correction. 10 patients underwent a Nuss procedure, 2 patients a modified Ravitch procedure. Conclusion: Combined technique of valve sparing aortic root replacement and correction of a chest wall deformity especially by Nuss technique is safe and effective. This strategy has excellent midterm results for both aortic and chest wall pathologies.

Preface

xxxv

Chapter 52 - Marfan syndrome frequently causes cardiac complications such as, aneurysm and dilatation of the aortic root. Many Marfan syndrome patients have these cardiovascular problems, and the surgical replacement of aortic and mitral valve, and aortic roots is frequently required. In addition, cases are associated with severe periodontitis, which is a chronic inflammation of the gingiva, periodontal ligament, and alveolar bone. Because of the surgical replacement, it is essential to prevent dental infection, such as infectious endocarditis caused by the periodontitis. In Marfan syndrome, an unfavorable oral hygiene due to the crowded teeth and narrow dental arch had been thought as a cause of severe periodontitis. However, clinical and basic studies have highlighted the genetic background as a pathogenesis of the severe periodontitis. It is suggested that cell alignment and tissue architecture of periodontal ligament are impaired in the model mice of Marfan syndrome. The model mice were more susceptible to alveolar bone resorption after the infection of Porphyromonas gingivalis, which is known to cause chronic periodontitis. It is likely that activated TGF-β signaling upregulates IL-17 and TNF-α levels, resulted in the increased alveolar bone resorption. In this review, the perspective of the dental management and the effect of angiotensin II receptor blocker are discussed. Chapter 53 - Preimplantation genetic diagnosis (PGD) was introduced 24 years ago with the purpose of performing genetic testing before pregnancy, in order to establish only unaffected pregnancies and avoid the need for pregnancy termination, which is the major limitation of traditional prenatal diagnosis. Despite the requirement for ovarian hyperstimulation and in vitro fertilization (IVF), needed to perform genetic testing of oocyte or embryo prior to transfer, PGD has been accepted in most parts of the world. Thousands of PGD cycles have now been performed for single gene disorders, with PGD presently offered for some indications that have never been practiced in prenatal diagnosis, such as late onset diseases with genetic predisposition, and preimplantation HLA typing. The present paper describes our experience on PGD for Marfan syndrome, caused by FBN1 gene, which was performed in 38 cases, as part of our PGD experience of 2,860 cycles for single gene disorders, which is the world’s largest PGD experience. Chapter 54 - The order Anura currently encompasses over 6,800 amphibian species distributed in 56 families and is an interesting group for cytogenetic studies. Whereas some groups of species present conservative karyotypes, others are highly variable in diploid number or number/location of diverse chromosomal markers, such as nucleolus organizer regions, heterochromatic bands and specific satellite DNA sites. In some cases, karyotypic variation overcomes morphological diversification, turning cytogenetics into a useful tool for taxonomy. Special variation is observed with respect to sex chromosomes and sex determination systems, with both female and male heterogameties observed. Although most species already karyotyped do not show sex chromosome heteromorphism, distinct levels of differentiation are observed between the sex chromosomes of several species, which makes this group particularly interesting for studies of sex chromosome evolution. In this chapter, the author explore the use of cytogenetic data for studies of frogs as well as the insights that hypotheses of phylogenetic relationships have added to this issue. In addition, the author provide a brief review of PcP190 satellite DNA (with new data for the genus Engystomops), sex chromosome systems and B chromosomes found in Anura. Chapter 55 - Humans are daily exposed to a variety of potentially harmful agents in the air they breathe, liquids they drink, food they eat and products they use. Long-standing evidence of the bond between health and environment has led to the recognition for the need of sustainable development. On the other hand, there is an increasing global awareness of the

xxxvi

Heidi Carlson

inevitable limits of individual health care and the need to complement such services with effective public health strategies. According to World Health Organization (WHO), cancer is a leading cause of death worldwide. Additionally, at least 200 000 people die every year from occupational or work-related cancers. Exposure assessment aims at prevention. Establishing the health effects of various activities and exposures requires information about the levels of exposure and the biological effects resulting from the interaction between the organism and the chemical agent. The resulting data provides a basis for designing effective prevention and mitigation strategies. Cytogenetic endpoints have long been applied in surveillance of human genotoxic exposure and early effects of genotoxic carcinogens. Assays measuring chromosomal aberrations (CAs), micronucleus (MN) and sister chromatid exchange (SCE) in lymphocytes are well-established techniques extensively used in human biomonitoring studies to assess DNA damage at the chromosomal level. The relevance of cytogenetic alterations as a cancer risk biomarker is further supported by epidemiologic data linking CAs and MN with cancer risk in human populations. Thus, the use of cytogenetic markers in human biomonitoring is of paramount importance due to its predictability regarding deleterious effects resulting from the exposure to environmental stressors. Chapter 56 - The great era for classical cytogenetics started sixty years ago with the description of the twenty-three pairs of human chromosomes and the discovery of the Philadelphia chromosome, the first known chromosomal defect associated with a specific type of cancer. Since then many recurrent chromosomal aberrations linked to specific hematological malignancies have been detected. The vast majority of these abnormalities can be detected by modern molecular genetic methods so it might seem there is no longer a need for microscopy. However, there is still a significant portion of hemato-oncologic patients for which the classical cytogenetic investigation is appropriate, i.e., cases with complex karyotypes. Complex karyotypes are characterized by the presence of three or more unrelated chromosomal aberrations co-existing in a single clone. Their occurrence is associated with adverse outcomes across the entire spectrum of hematologic malignancies. These aberrations are also a powerful diagnostic indicator for molecular targeted therapies, allogeneic stem cell transplantation or other generally more aggressive treatment strategies. Since the presence of complex karyotypes would be missed when using only molecular genetic methods, this highlights the irreplaceable role of classical cytogenetics as a first-tier analysis for the evaluation of complex structural chromosomal abnormalities in hemato-oncologic patients. Ideally, classical cytogenetics is then followed by more precise molecular genetic methods to identify specific chromosomal aberrations more deeply. Here the author focus on the complex karyotype issues in the myelodysplastic diseases, leukemias, lymphomas and multiple myelomas as seen daily in our center. Chapter 57 - Initially identified as Astyanax schubarti on the basis of morphological characteristics, its chromosomal analysis revealed a unique diploid number in the genus. With 42 chromosomes and the impossibility of homologous pairing, the karyotype of the individual was compared to a set of haploid complements of Astyanax schubarti (2n = 36 chromosomes) and Astyanax fasciatus (2n = 48 chromosomes). Natural hybrids are rare. The viability of a hybrid between species with such chromosomal discrepancy may offer important hypotheses to explain the morphological, molecular, and cytogenetic diversity of the genus. Chapter 58 - There are three distinct subtypes of Trichorhinophalangeal syndrome (TRPS); TRPS type I, TRPS type II and TRPS type III. Features common to all three subtypes include sparse, slowly growing scalp hair, laterally sparse eyebrows, a bulbous tip of the nose (pear-

Preface

xxxvii

shaped), and protruding ears. The diagnosis of TRPS is based in typical clinical and radiographic features, as well as in the identification of causative mutations in the TRPS1 gene (TRPS type I and III) and in loss of functional copies of the TRPS1 and EXT1 genes (TRPS type II). The mode of inheritance in TRPS I and III is autosomal dominant, however de novo deletions of TRPS1 and EXT1 genes are the main defect of TRPS II. Parental balanced chromosomal rearrangements are an important cause of interstitial aberrations in TRPS. In cases of cytogenetically-invisible alterations, parental FISH analysis as well as aCGH should be considered as part of the clinical baseline testing. Treatment of clinical problems of TRPS types is mainly supportive and includes ectodermal and skeletal issues. The number of distinct syndromes as TRPS is rapidly increasing and their confirmation is necessary especially in cases that typical features are absent. Clinical geneticists should provide information for the families and advise them how to overcome problems. Chapter 59 - It is generally believed that genotype and adult lifestyle elements are primary risks of some metabolic diseases such as insulin resistance, obesity and diabetes mellitus in later life. However, increasing evidence demonstrates that early life malnutrition during the period of gestation and/or lactation may increase our susceptibility to such metabolic diseases in later life. The underlying mechanism is still not very clear. Recently, epigenetics is hypothesized to be the important molecular basis of the imbalanced early life nutrition and glucose metabolism disorders, which is known as "Developmental Origin of Health and Diseases" (DOHaD). Currently, there are substantial epidemiological studies and experimental animal models that have demonstrated nutritional disturbances during the critical periods of early life development can significantly impact the predisposition to developing some metabolic diseases in later life. The fundamental mechanism is that early developmental nutrition can regulate epigenetic modifications of some genes associated with development and metabolism. DNA methylation is the first discovered and one important epigenetic modification. MicroRNAs are recognized as an important epigenetic modification and they are a major class of small non-coding RNAs (about 20-22 nucleotides) which can mediate posttranscriptional regulation of target genes with cell differentiation and apoptosis. Recent studies suggest that DNA methylation and microRNAs maybe the crucial modulators of fetal epigenetic programming in nutrition and metabolic disorders. This chapter will focus on how early life nutrition can alter the epigenome, produce different phenotypes and alter disease susceptibilities, especially for impaired glucose metabolism. Chapter 60 - Oxidative stress is a state in which production of reactive oxygen species exceeds the capacity of antioxidant systems. Reactive oxygen species have one or more unpaired electrons, making them highly reactive with other cellular molecules such as protein, lipid, and nucleic acid. The peroxidation of polyunsaturated fatty acids in biological membranes results in impaired membrane integrity. Oxidatively modified proteins lose their capacity to carry out the physiological functions and they may form intracellular aggregates. Attacks of reactive oxygen species to DNA results in strand breakages and base oxidation. Major DNA oxidation product is 8-hydroxydeoxyguanosine which has a pro-mutagenic potential. Due to these damaging effects, oxidative stress plays an important role in various pathologies such as cancer, diabetes, chronic inflammatory diseases and neurodegenerative disorders. Epigenetic changes are regular and natural events which regulate gene expression without changing base sequences on DNA. Dysregulation of regular epigenetic mechanisms is a contributory factor for many of human pathologies. Recently, reactive oxygen species have been shown to cause epigenetic dysregulations that play a pivotal role in human disorders. The basic epigenetic

xxxviii

Heidi Carlson

mechanisms and their dysregulation by reactive oxygen species have been reviewed in this chapter. Chapter 61 - Cancer is one of the deadliest malignancies that have plagued mankind for decades. Epigenetic mechanism(s) play a central role in the homeostasis of normal cell proliferation and differentiation. Global epigenetic modifications are frequently associated with cancer initiation, progression, as well as metastasis. These changes include DNA methylation, histone lysine methylation/demethylation, acetylation/ deacetylation, including methylation and acetylation of non-histone proteins, and can alter the expression of various oncogenic signaling cascades, which in-turn can lead to uncontrolled proliferation. In this chapter, the author primarily focus on the major epigenetic changes that occur in oncogenes, tumor suppressor genes, transcription factors and cancer stem cells, which in turn mediate tumor growth. These modifications are controlled by regulatory enzymes such as DNA methyltransferase, histone acetyltransferases, histone deacetylase, lysine acetyltransferase, and arginine and lysine methyl transferases. In addition, the author also describe a few selected pharmacological agents that can modulate the action of these enzymes and display significant potential for cancer therapy. Chapter 62 - Alzheimer's Disease is one of the most common neurodegenerative disorders. Many efforts have been directed to prevent AD due to its rising prevalence and the lack of an effective curative treatment. Epigenetic changes are involved in regulation of gene expression, and may mediate various pathologies. Epigenetic changes are reversible so that can be easily modulated. Modulation of dysregulated epigenetic mechanisms is a promising therapeutic approach for many diseases. There is some evidence for epigenetic dysregulation at various levels contributing to AD pathogenesis. Despite the recent rapid accumulation of knowledge about AD pathogenesis, the role of epigenetic modifications has not been understood exactly. This chapter provides a brief overview about the role of epigenetic changes that are linked to AD pathogenesis and emerging targets for new therapeutic strategies in this field. Chapter 63 - Cardiovascular disease (CVD) is not a single condition, but an umbrella term used to describe a range of common diseases affecting the heart and the circulatory system. The term commonly includes diseases of the cardiac muscle and of the vascular system supplying the heart, brain, and other vital organs. Many of these conditions can be life-threatening. CVD is the leading cause of death in the world, affecting all populations, irrespective of demographic or socioeconomic differences and is responsible for one third of all deaths. In the present chapter, the author focus on the epigenetic control of embryonic cardiac development and the role of epigenetic mechanisms in CVD observed from results in human, animal and cell culture studies’ approaches. The author discuss the main epigenetic mechanisms involved in heart development and major CVDs such as coronary heart disease (CHD), heart failure (HF), myocardial infarction (MI), hypertension, stroke, arrhythmias, cardiomyopathy and cardiac hypertrophy (CH). Additionally, this chapter also focuses on the epigenetic modifiers that are involved in the development of CVD, and the potential utility of epigenetics-based therapeutic strategies in CVD. Chapter 64 - Extensive characterization has been performed on the genes and genetic mutations that are involved in spermatogenesis and male infertility, but the vast role of the sperm’s transcriptome and epigenome in male reproduction has yet to be completely explored. Recent research has established that epigenetic remodeling of the sperm is necessary for development and for its function following fertilization. The histone- retained regions of the sperm have been recently shown to carry the bivalent marks of activating histone H3 lysine K4

Preface

xxxix

trimethylation and the repressive H3 lysine K27 trimethylation. These bivalent histone marks facilitate the dynamic changes in stage-specific gene expression during sperm development. The paternal epigenome bears unique and important epigenetic modifications determined to be potentially important to the developing embryo, but the complete scope of its contribution is still emerging. Additionally, advances in assisted reproductive techniques have also suggested that alterations in the epigenetic profile in infertile men are transmitted to the developing embryo. This review will highlight the latest advances in epigenome profiling of the chromatin modifications during the development of immature to a mature sperm as well as provide a glimpse into the future role of epigenetic mechanisms in the generation of new germ cells/gametes from induced pluripotent stem cells, to treat male infertility. Chapter 65 - Epigenetic is defined as the study of mitotically and/or meiotically heritable changes in the gene function without changing DNA sequence and playing crucial roles both in normal development and human diseases. The molecular basis of epigenetic process consists of histone modifications, DNA methylation, positioning of histone variants, and non-coding RNAs. Genome-wide patterns of DNA and chromatin modifications together called as ‘epigenomes’. Epigenomes undergo precise, coordinated, reversible changes through the developmental stages and so contributes to the lineage and tissue specific expression of genes. In addition to the tissue specific impact, environmental factors such as nutrients, toxins, infections and hypoxia can also influence epigenomes. Distinct or global changes in the epigenetic landscape are hallmarks of chronic inflammation associated diseases. Alteration in methylation status of CpG sites, monoallelic silencing, and other epigenetic regulatory mechanisms have been observed in key inflammatory response genes. Epigenetic changes including DNA methylation, histone modification and noncoding RNA expression, were found associated with acute and chronic inflammatory disorders. Recently, therapies targeting epigenetic mechanisms are trending options for the treatment of chronic and degenerative disorders. Epigenetic drugs that are applied on animal models and some clinical trials are displaying positive therapeutic effects. Not only mono therapies but also combined usage of HDAC or DNMT inhibitors could be the next step for the epigenetic therapeutic modulations. Scope of this chapter is to provide an overview of the epigenetic modifications in inflammation and inflammation driven diseases. Chapter 66 - Obesity is a public health problem leading to morbidity and mortality throughout the world. It arises from the interactions between genetics and environmental factors. In recent years, susceptibility to obesity has been also linked to epigenetic factors. Epigenetics, is the study of heritable changes in gene expression which do not involve in the underlying DNA sequence. The epigenetic mechanisms include DNA methylation, covalent histone modifications, chromatin folding, miRNAs, and polycomb group repressive complexes. Both dietary factors and individual behaviors affect obesity development via epigenetic mechanisms. Epigenetic mechanisms are also linked to programmed changes in gene expression as a result of early environmental exposures during pregnancy which alter offspring growth and development. There is evidence that nutrient and environmental exposures during pregnancy may affect fetal/newborn development and result in offspring obesity or metabolic syndrome which is a cluster of metabolic abnormalities. Obesity related genes, epiobesigenes, display methylation patterns playing important roles in the development of obesity which are potential future epigenetic biomarkers of obesity. The susceptibility genes have been reported as FGF2, PTEN, CDKN1A, and ESR1, functional in adipogenesis; SOCS1 and SOCS3, functional in inflammation, and COX7A1, LPL, CAV1, and IGFBP3 which are functional in

xl

Heidi Carlson

fat metabolism and insulin signaling. It is important to prevent this era’s epidemic, obesity, since it leads to chronic diseases including hypertension, atherosclerosis, insulin resistance, and moreover metabolic syndrome. It may be easier to prevent the progress of the disease by revealing the epigenetic mechanisms especially methylation profiles of the susceptibility genes. Chapter 67 - Entomopathogenic fungi have been mentioned as one of the best alternatives for insect pest control. These fungi cause insects death. More than 750 fungal species have been described infecting insects, some of the most utilized for insect control are: Beauveria bassiana and Metarhizium anisopliae. This is evidence of cosmopolitan distribution of entomopathogenic fungi and its evolutionary success, this type of fungi is related to a serie of interactions among fungi, plants, and insects. In this chapter, the main objective is to review and discuss the most recent information on genetics and evolution of entomopathogenic fungi. In this chapter are covered the following themes: Entomopathogens role in nature, Entomopathogenic fungi and their interactions with the insect immune system, Isolation and identification of entomopathogenic fungi, Genetic diversity among strains of entomopathogenic fungus, Genes involved in virulence of entomopathogenic fungi, Molecular phylogeny of entomopathogenic fungi and their biogeographic implications, Evolution of entomopathogenicity in fungi, Genetic improvement of entomopathogenic fungi for insect biocontrol, Future trends and Conclusions. Chapter 68 - The author sequenced the mitochondrial (mt) ND5 gene of 100 specimens of Eira barbara (Mustelidae, Carnivora). The samples represented six out of the seven putative morphological subspecies recognized for this Mustelidae species (E. b. inserta, E. b. sinuensis, E. b. poliocephala, E. b. peruana, E. b. madeirensis, and E. b. barbara) throughout Panama, Colombia, Venezuela, French Guiana, Brazil, Ecuador, Peru, Bolivia, Paraguay, and Argentina. The main results show that the genetic diversity levels for the overall samples and within each one of the aforementioned putative taxa were very high. The phylogenetic analyses showed that the ancestor of the Central and South-American E. barbara originated during the Miocene or Pliocene (6.3-4 millions of years ago, MYA). Furthermore, the ancestors of some geographical groups, (we detected at least four) originated during the Pliocene (3.7-2.5 MYA). These four groups (or lineages) were placed in the Cesar-Antioquia Departments (northern Colombia), Bolivia and northwestern Argentina, northern-central Peru, and in the trans-Andean area of Ecuador. However, during the Pleistocene, this species experienced a strong population expansion and many haplotypes expanded their geographical distributions. They became superimposed on the geographical areas of older geographical groups that originally differentiated during the Pliocene. Until new molecular studies are completed, including those with nuclear markers, the author proposed the existence of only two subspecies of E. barbara (E. b. inserta in southern Central America, and E. b. barbara for all South America). All of the demographic analyses showed a very strong population expansion for this species in the last 400,000 YA during the Pleistocene. Chapter 69 - Like other forms of diagnostics, genetic testing comes with a retinue of costs and benefits. Significant benefits in terms of morbidity and mortality have accrued to individuals tested for more prevalent genetic conditions like cystic fibrosis and sickle cell disease, including persons seen in the emergency room or identified through public health surveillance. These benefits do not mitigate the drawbacks of genetic testing, false and missed diagnoses and sheer cost among them. Both medicine and public health have aimed at means of maximizing genetic test benefits in the interventions that they apply. The President’s Precision Medicine Initiative (PMI) holds promise in that its results could be used to tailor

Preface

xli

medical treatments to the individual characteristics of patients, “precision” implying a more accurate and precise regimen overall. The National Cancer Institute (NCI) has already launched the NCI-MATCH precision medicine trial, which assigns targeted treatments based on the genetic abnormalities in a tumor, regardless of cancer type. Other trials, such as the NCI Pediatric MATCH trial, are yet to happen. The efficacy of cancer treatments also intersects public health concerns. The Evaluation of Genomic Applications in Practice and Prevention (EGAPP) Working Group has evaluated the use of UGT1A1 genotyping to determine the best dose of irinotecan to prevent side effects when treating patients for metastatic colorectal cancer. Analytic validity does not always equate with improved patient outcomes, however, thus the public health emphasis on development of a suitable evidence base for precision medical and public health efforts. The public health approach to precision medicine, or “precision public health”, differs from the medical approach in several important ways: (1) population-based with attention to at-risk populations, as opposed to being strictly individualized; (2) focus on primary and secondary prevention, rather than frank disease (tertiary prevention); and (3) prioritizing interventions that have already demonstrated readiness for large-scale implementation, in contrast to the undertaking of novel clinical trials. Precision public health is exemplified in the Centers for Disease Control and Prevention’s emphasis on the implementation of Tier 1 genetic tests that have passed systematic review for analytic and clinical validity and utility – the use of family history for referral for hereditary breast and ovarian cancer genetic testing (BRCA1/2 mutations), and hereditary nonpolyposis colorectal cancer cascade screening (Lynch syndrome MLH1, MSH2, MSH6 mutations). This paper will cross-compare the precision medical approach to cancer based on pharmacogenomic regimens using companion diagnostics, and the public health approach to precision management of hereditary cancer for 3 cancer types – lung, breast, and colorectal. It will describe methods of early detection and consider how lives can be saved through precise management – from predictive testing and cancer monitoring of the at-risk population, to tailored chemoprevention that fits the needs of the individual. In the population context, a cascade screening “multiplier effect” exists in that relatives can also be assessed and followed for mutations identified in the proband. Cost-benefit analyses (T4 translational research) of medical and public health approaches will be closely examined and compared. Points of commonality between the two approaches will also be discussed, since primary/secondary and tertiary disease prevention represent a continuum. These analyses point to the value of allocating resources towards the health of at-risk populations. Questions remain if particular forms of genetic testing are to become “universalized”, and if the needs of all atrisk groups, including racial-ethnic, are to be addressed. Chapter 70 - Williams syndrome (WS) is a genetic neurodevelopmental disorder (prevalence close to 1 in 20,000-30,000 births) resulting from the deletion of 16-25 genes on the long arm of Chromosome 7. Individuals with WS have an intelligence quotient of 40-70. Theirs is a unique neuropsychological profile, characterized by an apparent dissociation between cognition and language, as language is relatively well preserved, compared with other cognitive skills. However, a more complex profile is now emerging, with good lexical, shortterm memory (especially auditory-verbal) and face processing skills, but visuospatial (especially local processing of information), executive (planning and inhibition), memory (working memory and long-term) and attentional deficits. Individuals with WS also have specific auditory-perceptual cognitive skills (hyperacusis), category-specific perception of speech sounds, and musical skills that exceed their cognitive level. Other behavioral characteristics include hypersociability. In this chapter, the author provide a review of the

xlii

Heidi Carlson

literature on the specific neuropsychological profile of individuals with WS, from a cognitivebehavioral and neuroanatomical point of view. Early studies of the neuropsychological profile in WS focused on the dissociation between cognition and language. Since then, research has shown this syndrome to be more complex. Our aim is to highlight the heterogeneity of the cognitive profiles observed in this syndrome, and to identify the factors that might explain this heterogeneity. The complexity and specific features of the neuropsychological profile in WS need to be understood in order to develop therapeutic and learning methods adapted to the developmental pace of individuals with WS. Chapter 71 - Chromosome rearrangements are the most common genetic abnormalities in humans. Abnormal chromosomal configurations are formed among non-homologous chromosomes to allow full synapsis of homologous chromosomes at meiosis I of chromosome rearrangement carriers. These abnormal chromosomal configurations result in the production of gametes with various chromosomal complements due to malsegregation of derivative chromosomes or recombination. Most of the gametes have unbalanced chromosomal complements and only a small number of gametes have normal or balanced chromosomal complements. Carriers of balanced chromosome rearrangements are phenotypically normal but they are at an increased risk of abnormal pregnancies due to the unbalanced gametes. However, chromosome rearrangement carriers who cannot have babies or experience repeated abortions or abnormal pregnancies can have healthy babies after introduction of PGD. Balanced reciprocal translocation is the most common chromosome rearrangement. Thirty-two types of gametes can be produced in meiosis of reciprocal translocation carrier. According to the results that analyze the meiotic segregation of embryos from PGD cycles of reciprocal translocation carriers, 2:2 segregation is the main segregation mode. The meiotic segregation might be affected by the gender of carriers. The frequency of balanced embryos was not different between female and male carriers. However, the frequencies of 2:2 segregation, especially adjacent-1 segregation, 3:1 and 4:0 segregation were significantly different between female and male carriers. Robertsonian translocation is also common chromosome rearrangement in humans. Gametes with eight different chromosomal complements can be produced in Robertsonian translocation carriers. The frequency of balanced embryos was higher in male carriers than in female carriers. Carriers of complex chromosome rearrangements (CCR), very rare chromosome rearrangements, can achieve pregnancy by PGD although the number of normal or balanced embryos was extremely low. Although it is very difficult to estimate the rate of normal or balanced embryos, the rate is estimated to be less than 10% in PGD for CCR carriers. The 3:3 segregation and chaotic segregation (meiotic segregation whose meiotic segregation cannot be defined) are prevalent segregation modes in carriers of three-way translocation. In PGD cycles of CCR carriers, cycle cancellation is very frequent due to the absence of the normal of balanced embryos. Therefore, it is important that a large number of embryos are obtained in one cycle. Occasionally, abnormalities of chromosome rearrangementunrelated chromosomes are observed in embryos or abortuses although chromosome rearrangement-related chromosomes are normal or balanced. At present, PGD that diagnose all 24 chromosomes using array-CGH, SNP array or NGS is carried out worldwide. In those PGD cycles, the risk that embryo transfer is cancelled might be increased. However, the rate of normal or balanced embryos is unexpectedly increased and pregnancy rate is improved. Surely, PGD is the very effective assisted reproductive technique in achieving pregnancy of chromosome rearrangement carriers by preventing repeated abortions that chromosome rearrangement carriers usually experience. In the field of PGD for chromosome

Preface

xliii

rearrangements, the next stage will be the development of technique that can discriminate between normal embryos and balanced embryos. Chromosome rearrangements, such as translocation (reciprocal or Robertsonian), inversion and complex chromosome rearrangements, are the most common genetic abnormalities in humans. Chromosome rearrangements are classified as balanced or unbalanced. Carriers of balanced chromosome rearrangements have the normal chromosomal complements but carriers of unbalanced chromosome rearrangements have additional or missing chromosomal material. Generally, the incidence of balanced chromosome rearrangements is about 0.19% of newborns. Carriers of balanced chromosome rearrangements are phenotypically normal because they have all the genetic materials. However, they are at an increased risk of implantation failure, repeated abortions or birth of chromosomally unbalanced offspring. Of course, not all carriers of balanced chromosome rearrangements experience the abnormal pregnancies. The abnormal pregnancies are resulted from the unbalanced gametes generated during meiosis of chromosome rearrangement carriers. Abnormal chromosomal configurations are formed to allow full synapses of homologous chromosomes during meiosis of balanced chromosome rearrangement carriers. The unbalanced gametes are produced as a results of malsegregation of these abnormal chromosomal configuration. Most of the gametes produced during meiosis of chromosome rearrangement carriers have unbalanced chromosomal complements. These unbalanced gametes result in implantation failure, repeated abortions or birth of chromosomally unbalanced offspring. After the first successful clinical application of preimplantation genetic diagnosis (PGD) in 1990, PGD has been widely used worldwide to select normal or balanced embryos in in vitro fertilization and embryo transfer (IVF-ET) programs of balanced chromosome rearrangement carriers. Cleavage-stage fluorescence in situ hybridization (FISH) has been widely used to PGD for carriers of balanced chromosome rearrangements till the early 2010s and PGD based on array comparative genomic hybridization (CGH) or next generation sequencing (NGS) is widely applied nowadays. The only abnormalities of rearranged chromosomes can be diagnosed in FISH-based PGD and the abnormalities of other chromosomes cannot be diagnosed. However, abnormalities of all 24 chromosomes can be diagnosed after the application of array CGH or NGS into PGD. Chapter 72 - Aims: Attention deficit hyperactivity disorder (ADHD) is a multifactorial psychiatric and neurobehavioral disorder. The brain-derived neurotrophic factor gene (BDNF) has been proposed as a strong candidate for this pathology. The aim of this study was to determine a family-based association between three polymorphisms of the BDNF gene and the ADHD in a Tabascan-Mexican population. Methods: The author analyzed the rs6265, rs12273363 and rs11030119 polymorphism of the BDNF gene through a family-based association study. A total of 105 individuals grouped in family-trios (mother, father and ADHD patient) were studied. Allelic and haplotypic transmission were assessed through transmission disequilibrium test (TDT), using HaploView software. Results: No statistically significant association was observed between the BDNF gene polymorphisms and the ADHD etiology in Tabascan-Mexican families: rs6265 (χ2 = 1.33; p = 0.24); rs12273363 (χ2 = 1.33; p = 0.24); rs11030119 (χ2 = 0.66; p = 0.41). Furthermore, no preference of transmission was observed for any of the haplotypes. Conclusions: It was not possible to prove any association between the BDNF gene polymorphic variants and ADHD in a Mexican population. Future studies comprising larger samples are necessary to determine the potential role of the BDNF gene in ADHD.

xliv

Heidi Carlson

Chapter 73 - Petroleum can be characterized as an oily, flammable substance, less dense than water, with a distinctive scent and color ranging from black to dark brown. The petroleum industry includes some global processes that can be highlighted by the environmental risks they present. At offshore platforms, the danger of a spill is aggravated by the density of the oil, which floats and is carried quickly through sea currents. Thus, in addition to the marine fauna, coastal fauna and flora (e.g., mangroves and estuaries) can also be affected by a leakage. Petroleum is predominantly composed of hydrocarbons, these can be degraded by several species of bacteria, which are of great interest for the bioremediation of contaminated environments. Among these species the author can mention Pseudomonas, Sphingomonas, Mycobacterium, Microbacterium and Gordonia. The success of a bioremediation process depends on numerous factors such as microbial biomass, population diversity, enzymatic activity, pH, temperature, and carbon source. Moreover, the strains have their genetic potential for bioremediation investigated through methods of analysis concerning genes related to the degradation of aliphatic and aromatic hydrocarbons mostly by oxygenases, such as the polycyclic aromatic hydrocarbon ring-hydroxylating dioxygenases (PAH-RHDα), and alkB (for n-alkane degradation) genes. The study of autochthonous microbial communities is of crucial importance for the understanding of the genetic and biotechnological potential of bioremediation in environments close to the areas of extraction and susceptible of contamination; it is also of great interest for industry and biotechnological development. This chapter covers the main aspects of petroleum, regarding its exploitation aspects, the process of geological formation, and environmental impacts. It will include topics in microbiology and genetics; for instance, metabolic pathways of hydrocarbon biodegradation, biofilm dynamics associated to the oil industry, metagenomics of communities in marine environments, corrosion influenced by microorganisms (CIM), microbial control methods related to the petroleum industry, and bioremediation will be discussed. Chapter 74 - In healthy individuals, the incessant activity of regulatory genetic mechanisms ensures the metabolic and proliferative equilibrium of cellular activity. In case of accidental defects occurring in any part of the system, a coordinated counteraction of numerous mediators may successfully help in the restoration of physiologic processes by means of either overexpression or hyperactivity. Even serious defects of genome stabilizer mechanisms may be kept in balance for a long duration, showing the clinical signs of good health. By contrast, due to the exhaustion of the compensatory processes, DNA defects may develop and lead to the clinical manifestations of diseases. Estrogen activated estrogen receptors (ERs) are the primary initiators and organizers of the up-regulatory circle of genome stabilization in correlation and crosstalk with aromatase enzyme and genome safeguarding proteins, such as BRCAs. The promoter regions of ESR1, BRCA1, and CYP19 aromatase genes exhibit strong triangular partnership for the harmonized regulation of the synthesis of ERs, BRCA proteins and aromatase enzyme, which can be reconstructed from the meticulous details of earlier scientific results. Considering the extreme capacities of ER-signaling for self-restoration, it is obvious that antiestrogen treatment, either ER binding by a false ligand or inhibition of estrogen synthesis, may provoke extreme compensatory actions in genetically proficient cases. Analyses of the results of genetic studies on tumor cells have shown that upregulation of ER-signaling induced by natural estrogen or antiestrogen is a beneficial defensive process even in tumor cells, promoting their domestication and elimination. A schematic representation of the main stream of upregulative genome stabilizing circle visualizes the possibilities for extreme counteractions against the toxic effects of antiestrogens. The presented complex genome

Preface

xlv

stabilizer mechanisms reveal that cancer cells may preserve their residual capacity for the upregulation of ER-signaling, even if the efforts are not satisfactory. Chapter 75 - Rett syndrome (RTT) is a rare, neurodevelopmental genetic disorder that develops in early childhood and influences many functions within neurobehavioural domains. The core of phenotype symptoms includes severe linguistic and motor impairments. The onset of RTT is characterised by a gradual or sudden loss of speech and hand function followed by a slow decrease in acquired gross motor skills with subsequent severe functional dependence. RTT is associated primarily with mutations in MECP2, a gene located on the long arm of the X chromosome (Xq28). The severity of impairments depends not only on genotype, but on the extent of X inactivation. However, CDKL5 and FOXg1 gene mutations have been also identified in girls affected by atypical RTT. Despite sharing neurological features, subjects with RTT present considerable clinical variability. Research on effects of genotype of RTT is expanding in many directions. The current chapter, will discuss the correlations between genotype and motor abilities in subjects with RTT. The main aim of this chapter is to relate functional outcomes, in particular motor impairments, to mutation type in patients with RTT. This chapter begins with a theoretical overview on genetic alterations in RTT and then focuses on motor specific impairments. In the second part of this chapter, the author propose a preliminary research which analyzes the correlation between motor phenotype and specific genotype. Chapter 76 - Fragile X syndrome (FXS) is the most common inherited cause of intellectual disability. However, findings reported in cross-sectional studies on this population are heterogeneous. This chapter focuses on the longitudinal assessment of a boy with FXS from 12 months through to 6 years of age using two tests: one that assesses psychomotor development and another that assesses neuropsychological maturity. The child had attended an Early Childhood Development Intervention Center-ECDIC since 12 months old. He was administered the Brunet-Lézine Revised Scale of Psychomotor Development in Early Childhood until 36 months and underwent CUMANIN neuropsychological testing from age 3 to 6. The results obtained allow us to observe trends in the boy’s psychomotor development and neuropsychological maturity over time. Significant commonalities between these results and those of previous cross-sectional studies are discussed. Furthermore, some conclusions are drawn that may prove valuable to professionals and researchers interested in this syndrome. Chapter 77 - Cornelia de Lange syndrome (CdLS), also known as Bushy syndrome, Amsterdam dwarfism and Brachmann- de Lange syndrome is a genetic multi system disorder, usually caused by spontaneous mutation. Although present from birth, it may not always be immediately diagnosed. The estimated incidence is about 1:10,000-30,000 births. Both sexes are affected. Mortality is high early in life and neurosensory, craniofacial, musculoskeletal, cardiac and gastrointestinal abnormalities are all apparent. There is no known cure and treatment is supportive, requiring a team support system. Chapter 78 - Background: SCAs are the most frequently occurring chromosomal abnormalities with an incidence of 1 in 400 births. As the number of X chromosomes increases, the phenotypic severity increases as well and it is estimated that cognitive abilities decrease by 10–15 IQ points for each additional X chromosome. Aim of this paper is to illustrate clinical variability of cognitive-behavioral phenotype in the different SCAs. Design and Methods: The sample was composed by 53 subjects (mean age = 21.16 yrs, range: 13-54) with karyotype 47, XXY (73%), 49, XXXXY (7%), 48, XXYY (9%), mosaicism 47, XXY/48, XXXY (2%), 47, XYY (5%), 48, XXXY (2%), 49, XXXYY (2%). Only 5 subjects have been diagnosed

xlvi

Heidi Carlson

prenatally (4 KS and 1 XXYY). Primary caregivers completed a comprehensive questionnaire detailing birth, medical, developmental and psychological history. Cognitive and behavioral assessment was performed with clinical interviews using DSM 5 criteria and psychometric questionnaires (WISC-R, WAIS-R, CPM, Token Test, VABS, SCL90, SCQ). Twenty-one sex and age matched subjects karyotypically normal were also evaluated from the behavioural point of view. Results: Mean IQ in typical KS was 87.45 ± 2 ds (sd = 20.12) range 45-123, VIQ 91.74 (sd = 19.55) range 50-130 and PIQ 86.87 (sd = 20.87) range 50-126. Mean IQ in other SCAs was 68.71 (sd = 20.81) range 45-106, VIQ 69.36 (sd = 21.97) range 47-113 and PIQ 74.72 (sd = 21.70) range 45-112. In CPM KS subjects scored 27.75 (range 13-36) and 31.50 in the Token Test (range 21-35) while in CPM the other SCAs subjects scored 22.27 (range 10-35) and 22.50 (range 9-31) in the Token Test (p94% NJ bootstrap support, supporting the notion that these are three new reducing PKS clades. As fungal polyketides from these entomopathogens represent valuable natural product resources, these PKSs phylogeny and expression data would be important for further studies of valuable polyketides in the future. Metarhizium is a frequently isolated from soil environments. However, profound knowledge of natural occurrence and distribution, genetic diversity and community structure of the species is required to evaluate consequences of biocontrol initiatives (Meyling and Eilenberg, 2007). In 2009, Bischoff et al., provided a multilocus phylogeny of the Metarhizium anisopliae (Metschn.) Sorokin lineage and revised the taxonomy recognizing nine species within the M. anisopliae lineage, including several cryptic species. Given the cryptic diversity within the M. anisopliae lineage, discrimination of species cannot solely be based on morphology but requires the use of molecular methods for accurate identification. For species discrimination, 5’ end of the elongation factor 1a has been highlighted as a reliable marker (Bischoff et al., 2009). However, this region does not provide sufficient resolution for identification of genotypes within species. Thus, for genotyping and assessing within species diversity, simple sequence repeat (SSR) markers are currently among the most suitable markers (Enkerli and Widmer, 2010). Enkerli et al., (2005) and Oulevey et al., (2009) have developed SSR markers for strain-level genotyping within the M. anisopliae lineage, which have successfully been used to investigate molecular diversity of isolates collection (Velasquez et al., 2007; Oulevey et al., 2009). In 2014, Steinwender et al., evaluated Metarhizium community in soil from an agricultural field in Denmark using Tenebrio molitor as bait insect. By sequence analysis of 5’ end of elongation factor 1a and their genotypic diversity characterized by multilocus simple sequence repeat (SSR) typing, 123 isolates were identified. In this study, Metarhizium brunneum was most frequent (78.8%) followed by M. robertsii (14.6%), while M. majus and M. flavoviride were infrequent (3.3% each). It revealed co-occurrence of at four Metarhizium species in the soil of the same agro ecosystem with a single M. brunneum multilocus genotype being highly prevalent. Abundance of a single genotype could be due to variability among Metarhizium genotypes in response to biotic and abiotic factors prevalent in the ecosystem (Bidochka et al., 2005). Moreover, five genotypes of M. brunneum and six genotypes of M. robertsii were identified among the isolates based on SSR fragment length

1466

A. Garcia, M. Michel, S. Villarreal et al.

analysis, demonstrating to be highly effective in detecting genotypic diversity beyond what could be found by sequencing 5’ EF-1α within the M. anisopliae lineage. Additionally, the entomopathogenic hyphomycete Paecilomyces fumosoroseus is a promising candidate for biocontrol of the Silverleaf Whitefly Bemisia tabaci-argentifolii (Hemiptera: Aleyrodidae), which is considered as a major insect pest in field and greenhouse crops (Lacey et al., 1996). Since 1995, Tigano-Milani et al., demonstrated intraspecific genetic variation in this fungus by RAPD-PCR and tRNA-PCR. However, the analysis of 28S-rDNA sequences did not provide enough information for differentiation of P. fumosorosesus isolates. Fargues et al., (2002) investigated the genetic variability in 48 isolates of this fungus by analyzing the RFLPs and sequence data of the internal transcribed spacer sequences ribosomal RNA gene (rDNA-ITS). Digestion with six endonucleases (AluI, HaeIII, Hin6I, HpaII, NdeII, and SmaI) allowed their separation into three distinct groups. The group 1 was composed of strains isolated only from the host B. tabaci-argentifolii. By contrast, the group 3 included strains from various insect host and geographical origins. These data were strongly supported by phylogenetic analysis of rDNA-ITS sequence that recognized three monophyletic groups within the P. fumosoroseus complex. Thus, these molecular tools could be useful to assess genetic relatedness of these species into the monitoring of such biocontrol products. Genetic variations has been also suggested in P. farinosus according to the broad geographic and host origins and morphological variation correlated with one or more distinguishing adaptations. In the study of Chew et al., (1997) the genetic relatedness of twenty isolates of P. farinosus collected from seven insect species in eastern Canada was determined by RAPD analysis. All P. farinosus isolates were clearly distinguished from three other entomopathogenic fungi, including P. fumosoroseus; however, RAPD banding patterns did not correlate with ecological backgrounds or morphological phenotypes. These observations support the conclusion that P. farinosus from eastern Canada is not composed of strains which can be separated on the basis of the ecological or morphological criteria selected.

EVOLUTION OF PATHOGENICITY GENES IN ENTOMOPATHOGENS Entomopathogenous fungi have devolped production of different enzyme and metabolites to parasitize susceptible insect hosts, among them, hydrolytic, assimilatory, and/or detoxifying enzymes such as lipase/esterases, catalases, cytochrome P450s, proteases, and chitinases; and (b) secondary metabolites which facilitate infection (Ortiz-Urquiza and Keyhani, 2013). In B. bassiana bacterial-like toxins and effector-type proteins were reported (Xiao et al., 2012). Evolution of the genes codifying for these enzymes has been in a convergent way. Phylogenomic studies of different species in the Cordyceps/Metarhizium genera suggest that have evolved into insect pathogens independently of each other, and that their similar large secretomes and gene family expansions are due to convergent evolution (Zheng et al., 2011). Sequencing of B. bassiana genome confirmed that ascomycete entomopathogenicity is polyphyletic and convergent evolution to insect pathogenicity (Xiao et al., 2012). Lipases are the first enzymes synthesized by the entomopathogenic fungi, in Beauveria bassiana and Metarhizium robertsii was reported a cytochrome P450 subfamily, these enzyme break down long-chain alkenes and fatty acids (Sanchez-Perez et al., 2014). Then, proteases

Genetics and Evolution of Entomopathogenic Fungi

1467

are synthesized. The catalytic function of proteases is to hydrolyze proteins releasing amino acids which could be used for fungal nutrition (Ventura-Sobrevilla et al., 2015). One of the protease produced are subtilisin type (Pr1) which are considered as virulence indicators. This type of enzyme are regulated by a signal transduction mechanism activated by the protein kinase A (PKA) mediated by AMPc (Sanchez-Perez et al., 2014). Other important group of enzyme produced by the entomopathogen fungi is chitinases which are used to break down the insect chitin. Entomopathogens fungi descend from plant–asociated fungi. Quiroz-Velasquez et al., (2014), studying the transcriptome of Lagenidium giganteum which is an oomycete entomopathogenic mentioned that alignments of the cellulose synthase sequence indicated that this fungus appears to be evolved from a phytopathogenic ancestor. In addition, these fungal species have retained genes indicative of plant associations, and may share similar cores of virulence factors. Members of the glycoside hydrolase family 5 subfamily 27 (GH5_27) have been proposed as putative virulence factors which may be active on the host insect cuticle, these genes are shared by different entomopathogenic fungi. These virulence factors may be very host specific with a very low risk of attacking non-target organisms or beneficial insects (Shahid et al., 2012). Metarhizium and Beauveria are also found as plant symbionts. Recent studies showed that these fungi are more closely related to grass endophytes and developed genes for insect pathogenesis while maintaining an endophytic lifestyle. Some genes for insect pathogenesis may have been co-opted from genes involved in endophytic colonization. In contrast, other genes may be multifunctional and serve in both lifestyles (Barelli et al., 2015).

Contraction and Expansion of Different Gene Families Different entomopathogenic fungi such as Ophiocordyceps polyrhachis-furcata, Beauveria bassiana, Metarhizium robertsii, Metarhizium acridum, Cordyceps militaris, and Ophiocordyceps sinensis have similar genes implicated in pathogenicity and virulence. In B. bassiana, many species-specific virulence genes and gene family expansions and contractions correlate with host ranges and pathogenic strategies (Xiao et al., 2012). Contractions of some gene families in this type of fungi are implicated in narrow host-range insect species (specialists), some of these genes are cuticle-degrading genes and families of pathogen-insect interaction (PHI) genes. In some of the most specialized entomopathogens such as O. polyrhachis-furcata, for many genes-families has the least number of genes found (Wichadakul et al., 2015). Reduction in gene family sizes was reported in other entomopathogen (Hirsutella thompsonii) (Agrawal et al., 2015). The loss of different genes involved with pathogenicity result in a reduced capacity to exploit larger ranges of insect hosts and therefore in the different level of host specificity. Specialization is associated with retention of sexuality and rapid evolution of existing protein sequences (Hua et al., 2014). It is reported a co-evolution between entomopathogens and insect-host which in some case followed different patterns. Jensen et al., (2009) indicated that because of a high diversification over time among dipteran insects, the insect pathogenic fungi associated with these insects have also diversified. On the other hand, expansions of genes involved in 1) the production of bacterial-like toxins, and 2) retrotransposable elements have been mentioned in O. polyrhachis-furcata, in comparison to other entomopathogenic fungi. Expansions of gene families suggest an adaptation to particular environments or sophisticated mechanisms underlying pathogenicity

1468

A. Garcia, M. Michel, S. Villarreal et al.

through retrotransposons (Wichadakul et al., 2015). Similar pattern of evolutionary expansion of gene families such as chitinases, lipases, and proteases has been reported for Beauveria bassiana, Cordyceps militaris, and Metarhizium anisopliae which could be attributed to their insect killing strategies and host ranges (Agrawal et al., 2015). Generalist entomopathogens attack a wide range of insects; this condition has been associated with protein-family expansion, loss of genome-defense mechanisms, genome restructuring, horizontal gene transfer, and positive selection that accelerated after reinforcement of reproductive isolation. Generalists evolved from specialists via transitional species with intermediate host ranges and that this shift paralleled insect evolution (Hua et al., 2014). Species from the Metarhizium and Beauveria genera are recognized as generalists infecting a range of insects (Meyling et al., 2011).

Entomopathogen Fungi Pathogenicity versus Insect-Host Defense Insects have evolved different mechanisms in response to pathogens attack, some of these mechanisms are: production of (epi) cuticular antimicrobial lipids, proteins, and metabolites; (b) shedding of the cuticle during development; and (c) behavioral-environmental adaptations (Ortiz-Urquiza et al., 2013). After 25th generations under constant selective pressure from Beauveria bassiana, the larvae of Greater wax moth, Galleria mellonella, exhibited significantly enhanced resistance, which was specific to this pathogen, and not to another insect pathogenic fungus, Metarhizium anisopliae (Dubovskiy et al., 2013). It was hypothesized by the same authors that insects developed a transgenerationally primed resistance which was achieved not by compromising life-history traits but rather by prioritizing and re-allocating pathogen-species-specific augmentations to integumental front-line defenses that are most likely to be encountered by invading fungi. However, there is a coevolution between entomopathogen virulence factors and host defense molecules of insects. Virulence is thought to co evolve as a result of reciprocal selection between pathogens and their hosts. Because of shorter generation times and smaller genomes, microbes exhibit a high evolutionary adaptability in comparison with their hosts. In contrasts, insects can only compete with its pathogens if they develop mechanisms providing a comparable genetic plasticity (Vilcinskas, 2010). During B. bassiana infection, Galleria mellonella systemic immune defenses are suppressed in favor of a more limited but targeted repertoire of enhanced responses in the cuticle and epidermis of the integument (Dubovskiy et al., 2013). If a diversification of fungal proteinases for pathogenesis arose, an expansion of host proteinase inhibitors subsets contributing to insect innate immunity may occur. For example, the spectrum of proteolytic enzymes encompasses thermolysin-like metalloproteinases and this is associated with the pathogen-virulence. This spectrum putatively promoted the evolution of corresponding host inhibitors of these virulence factors (Vilcinskas, 2010). The same authors mentioned other molecular adaptations for host insect’s defense such as sensing and feedback-loop regulation of microbial metalloproteinases. The genetic events behind the countermeasures in host defense effectors are gene or domain duplication and shuffling by recombination. The entomopathogens also develop different strategies in order to avoid the host insect’s defenses. It has been proposed that M. anisopliae and B. bassiana survive to insect phagocytic haemocytes which are analogous to the mammalian macrophages as consequence of adaptations that have evolved in order to avoid predation by soil amoebae (Bidochka et al., 2010).

Genetics and Evolution of Entomopathogenic Fungi

1469

GENETIC IMPROVEMENT OF ENTOMOPATHOGENIC FUNGI FOR INSECT BIOCONTROL Mycoinsecticides are being used for the control of many insect pests as an environmentally acceptable alternative to chemical insecticides uses (Leger et al., 1996; Hussain et al., 2014; Ortiz, et al., 2015). From 1960s, a substantial number of mycoinsecticides have been developed worldwide (Sardul et al. 2012). All groups of insects may be affected and over 700 species of fungi from around 90 genera are pathogenic to insects (Khachatourians and Sohail, 2008). Basically, the fungi pathogen activity depends on the ability of its enzymatic equipment, consisting of lipases, proteases and chitinases, which are in charge of breaking down the insect’s integument (Sardul et al., 2012). Besides exoenzymes, the entomopathogenic fungi are reported to secrete toxin proteins and metabolites in vitro and sometime in vivo as well. There are a number of toxic compounds in the filtrate of entomopathogenic fungi such as small secondary metabolites, cyclic peptides and macromolecular proteins (Khan et al., 2012). To improve both commercial and technical efficiency of these entomopathogen fungi, a large number of studies had been conducting to improve their virulence which can be achieved by understanding the mechanisms of fungal pathogenesis and genetically modifying targeted genes. In response, Fan et al., (2010) in order to accelerate penetration speed and have better target protein-chitin on the cuticle, they constructed a hybrid protease (CDEP-BmChBD) by fusion of a chitin binding domain BmChBD from Bombyx mori chitinase to the C-terminal of CDEP1, a subtilisin-like protease from B. bassiana. After comparing studies, the hybrid protease was able to bind chitin and released greater amounts of peptides/proteins from insect cuticles. The insecticidal activity of B. bassiana was improved by including proteases, CDEP-1 or CDEP: BmChBD produced in Pichia pastoris, as an additive, however, the improved effect of CDEP: BmChBD was significantly higher than that of CDEP-1. Expression of the hybrid protease in B. bassiana also significantly increased fungal virulence compared to wild-type and strains overexpressing the native protease. These results demonstrated that rational design of virulence factor is a potential strategy for strain improvement by genetic engineering. Recently, a cytochrome P450 subfamily, referred as CYP52XI and MrCYP52 has been identified in Beauveria bassiana and Metarhizium robertsii, respectively (Sanchez-Perez et al., 2014). Entomopathogens such as M. anisopliae and B. bassiana are well characterized in respect to pathogenicity to several insects and have been used as myco-biocontrol agents for biological control of agriculture pests worldwide (Sardul et al., 2012). Lenger et al., (2012) reported the development of a genetically improved entomopathogenic fungus because integration of copies from the gene encoding a regulated cuticle degrading protease (Prl) which were inserted into the genome of M. anisopliae. Prl was constitutively overproduced in the hemolymph of Manduca sexta, activating the prophenoloxidase system. The combined toxic effects of Prl and the reaction products of phenoloxidase caused larvae challenged with the engineered fungus to exhibit a 25% reduction in time of death and reduced food consumption by 40% compared to infections by the wildtype fungus. In addition, infected insects were rapidly melanized, and the resulting cadavers were poor substrates for fungal sporulation. Fang et al., (2009) found that overexpression of a subtilisin-like protease (Pr1A) or a chitinase (Bbchit1) resulted in increased virulence of M. anisopliae and B. bassiana,

1470

A. Garcia, M. Michel, S. Villarreal et al.

respectively. In this study, they found that a mixture of the B. bassiana Pr1A homolog (CDEP1) and Bbchit1 for degradation of insect cuticle were in vitro more efficient than either CDEP1 or Bbchit1 alone. Based on this, they constructed three plasmids; (1) Bbchit1, (2) CDEP1, and (3) a fusion gene of Bbchit1 linked to CDEP1 each under the control of the constitutive gpd promoter from Aspergillus nidulans. B. bassiana transformants secreting the fusion protein (CDEP1:Bbchit1) which penetrated the cuticle significantly faster than the wild type or transformants overexpressing either Bbchit1 or CDEP1. Compared to the wild type, the transformant overexpressing CDEP1 showed a 12.5% reduction in LT (50), without a reduction in LC (50). The LT (50) of the transformant expressing CDEP1:Bbchit1 was reduced by 24.9%. Strikingly, expression of CDEP1:Bbchit1 resulted in a 60.5% reduction in LC (50), more than twice the reduction obtained by overexpression of Bbchit1 (28.5%). This work represents a significant step towards the development of hypervirulent insect pathogens for effective pest control.

FUTURE TRENDS It is very important to investigate more about the relation of entomopathogenic fungi to grass endophytes and how they developed genes for insect pathogenesis while maintaining an endophytic lifestyle. Although, there is known that some genes for insect pathogenesis may have been co-opted from genes involved in endophytic colonization, it is important to understand the protein changes that lead this adaptation. On the other hand, it has been mentioned that other genes may be multifunctional and serve in both lifestyles, but still there lack of knowledge about the genes modification and protein changes to have this dual activity. Advances in molecular tools for phylogeny analysis could lead to significant new insights that should allow us a better understand of the ecology of fungal entomopathogens as well as their additional roles in nature, including as plant endophytes, antagonists of plant pathogens, beneficial rhizosphere-associates and possibly even plant growth promoters. Although some entomopathogen fungi are well known, some of the fungi of the Entomophtorales order such as Entomophtora, Erynia and Pandora species are poorly investigated because, the culture medium used to propagate entomopathogens such as Beauveria, Metarhizium, and Lecanicillium, are not the most adequate for these especial entomopathogens.

CONCLUSION Different fungal entomopathogenic species such as B. bassiana, M. acridum, M. anisopliae, and Metarhizium brunneum have showed commercial potential for insect control, and are considered as friendly mycoinsecticide. The complete genome of some entomopathogen fungi such as B. bassiana has been sequenced, which has revealed multiples gene associated with virulence. In addition, many bacterial-like toxins and effector-type proteins were also discovered. Entomopathogenic fungi are able to adapt to different environments by activating well-define gene sets. During infection entomopathogenic fungi, many genes are involved in seven steps: host adhesion, germination, cuticle degradation,

Genetics and Evolution of Entomopathogenic Fungi

1471

growth as blastospores, host colonization and killing, immune response interactions and hyphal extrusion and conidiation.

ACKNOWLEDGMENTS A. Garcia, M. Michel, and S. Villarreal want to thank to the National Council of Science and Technology of Mexico (CONACYT) for the financial support during their postgraduate studies.

REFERENCES [1]

[2]

[3]

[4]

[5]

[6]

[7]

[8]

[9]

Adsure, S. P., and Mohite, P., B. 2015. Efficacy of entomopathogenic fungi against gram pod borer, Helicoverpa armigera (HUB.) on chickpea. Journal of Global Biosciences, 4 (8): 3154-3157. Agrawal, Y., Khatri, I., Subramanian, S., Shenoy, B. D., 2015. Genome sequence, comparative analysis, and evolutionary insights into chitinases of entomopathogenic fungus Hirsutella thompsonii. Genome Biol. Evol. 916–930 DOI:10.1093/gbe/evv037. Ainsworth, G., 1973. Introduction and keys to higher taxa. In: The fungi: An advanced treatise. Ainsworth, G., F. Sparrow and A. Sussman. Academic Press, New York (IVA): 1-7. Amnuaykanjanasin, A., Ponghanphot, S., Sengpanich, N., Cheevadhanarak, S., Tanticharoen, M., 2009. Insect-specific polyketide synthases, potential PKS-NRPS hybrids, and novel PKS clades in tropical fungi. Appl. Environ. Microbiol. 75, 37213732. Barelli, L., Moonjely, S., Behie, S. W., Bidochka, M. J., 2015. Fungi with multifunctional lifestyles: endophytic insect pathogenic fungi. Plant Mol Biol. DOI 10.1007/s11103-015-0413-z. Barreto, C. C., Staats, C. C., Schrank, A., Vainstein, M. H., 2004. Distribution of chitinases in the entomopathogen Metarhizium anisopliae and effect of Nacetylglucosamine in protein secretion. Current microbiology, 48(2), 102-107. Becerra, V. V., Paredes, M. C., Rojo, C. M., France, A. L., 2007. RAPD and ITS reveal molecular variation of Chilean populations of Beauveria bassiana. Agricultura Técnica. 67(2), 115-125. Berlanga, P. A. Mª. 1997. Aislamiento, identificación y conservación de hongos entomopatógenos. Memoria del II Curso Taller de Producción de Agentes de Control Biológico. Tecoman, Colima. 18-30. [Isolation, identification and conservation of entomopathogenic fungi. Report of the 2nd Course on the Production of Biological Control Agents. Tecoman, Colima. 18-30] Bidochka, M. J., Clark, D. C., Lewis, M. W., Keyhani, N. O., 2010. Could insect phagocytic avoidance by entomogenous fungi have evolved via selection against soil amoeboid predators? Microbiology 156: 2164–2171.

1472

A. Garcia, M. Michel, S. Villarreal et al.

[10] Bidochka, M. J., Small, C. L. N., Spironello, M., 2005. Recombination within sympatric cryptic species of the insect pathogenic fungus Metarhizium anisopliae. Environ. Microbiol. 7, 1361–1368. [11] Bischoff, J. F., Rehner, S. A., Humber, R. A., 2009. A multilocus phylogeny of the Metarhizium anisopliae lineage. Mycologia, 101(4), 512–530. [12] Blackwell, M., Hibbett, D. S., Taylor, J. W., Spatafora, J. W., 2006. Research coordination networks: a phylogeny of the kingdom Fungi (Deep Hypha). Mycol. 98, 829–837. [13] Boomsma, J. J; Jensen, A. B; Meyling, N. V; Eilenberg, J., 2014. Evolutionary interaction networks of insect pathogenic fungi. Annu. Rev. Entomol. 59:467-85. [14] Broetto, L., Da Silva, W. O. B., Bailão, A. M., De Almeida Soares, C., Vainstein, M. H. and Schrank, A., 2010, Glyceraldehyde-3-phosphate dehydrogenase of the entomopathogenic fungus Metarhizium anisopliae: cell-surface localization and role in host adhesion. FEMS Microbiology Letters, 312: 101–109. DOI: 10.1111/j.15746968.2010.02103.x. [15] Bruck, D. J., 2010. Fungal entomopathogens in the rhizosphere. BioControl, 55(1), 103112. [16] Bulat, S. A., Lubeck, M., Alekhina, I. A., Jensen, D. F., Knudsen, I. M. B., Lubeck, P. S., 2000. Identification of a universally primed-PCR-derived sequence characterized amplified region marker for an antagonistic strain of Clonostachys rosea and development of a strain-specific PCR detection assay. Appl. Environ. Microbiol., 66:4758–4763. [17] Bustillo, A., 2001. Hongos en insectos y posibilidades de uso en el control biológico de plagas en Colombia. In: seminario Uso de entomopatógenos en Colombia. Sociedad Colombiana de Entomología. 30-53. [Fungi in insects and possibilities of use in the biological control of pests in Colombia. In: seminar Use of entomopathogens in Colombia. Colombian Society of Entomology. 30-53]. [18] Cabrera, R. I., Domínguez, D. 1987. Hirsutella nodulosa e Hirsutella kirchneri; dos nuevos hongos patógenos del ácaro del moho Phyllocoptruta oleivora. Ciencia y Técnica en la agricultura, Cítricos y otros Frutales, 10 (2):135-138. [Hirsutella nodulosa and Hirsutella kirchneri; Two new pathogenic fungi of the mold mite Phyllocoptruta oleivora. Science and Technology in agriculture, Citrus and other Fruit trees, 10 (2): 135-138]. [19] Cañedo, V and Ames, T., 2004. Manual de laboratorio para el manejo de hongos entomopatógenos. Primera edición. Centro Internacional de la Papa. [Laboratory manual for the management of entomopathogenic fungi. First edition. International Potato Center]. [20] Chew, J. S. K., Strongman, D. B., MacKay, R. M., 1997. RFLP analysis of rRNA intergenic spacer region of 23 isolates of the entomopathogen Paecilomyces farinosus. Can. J. Bot. 75, 2038-2044. [21] Chooi, Y. H., Tang, Y., 2012. Navigating the Fungal Polyketide Chemical Space: From Genes to Molecules. J Organ. Chem. 77, 9933-9953. [22] Cory, J. S., and Ericsson, J. D., 2010. Fungal entomopathogens in a tritrophic context. BioControl, 55(1), 75-88. [23] Cory, J. S., and Hoover, K., 2006. Plant-mediated effects in insect–pathogen interactions. Trends in ecology & evolution, 21(5), 278-286.

Genetics and Evolution of Entomopathogenic Fungi

1473

[24] Cox, R. J., 2007. Polyketides, proteins and genes in fungi: programmed nano-machines begin to reveal their secrets. Organ. Biomol. Chem. 5, 2010-2026. [25] De Faria, M., and S. Wraight., 2007. Mycoinsecticides and Mycoacaricides: A comprehensive list with worldwide coverage and international classification of formulation types. Biological Control 43:237256. [26] Díaz, B. M., López Lastra, C. C., Oggerin, M., Fereres, A., Rubio, V., 2008. Identificación de hongos entomopatógenos asociados a pulgones en cultivos hortícolas en la zona centro de la Península Ibérica. [Identification of entomopathogenic fungi associated with aphids in horticultural crops in the central area of the Iberian Peninsula]. Bol. San. Veg. Plagas, 34: 287-296. [27] Driver, F., Milner, R. J., Trueman, J. W. H., 2000. A taxonomic revision of Metarhizium based on a phylogenetic analysis of rDNAsequence data. Mycol. Res. 104, 134–150. [28] Dubovskiy I. M, Whitten MM, Yaroslavtseva ON, Greig C, Kryukov VY, Grizanova EV, Mukherjee K, Vilcinskas A, Glupov VV, Butt TM. 2013. Can insects develop resistance to insect pathogenic fungi?. PLoS One 8(4):e60248. doi: 10.1371/journal.pone.0060248. Epub 2013 Apr 1. [29] Ebrahimi, S. Sabbagh, S. K, Aminaei, M., Khosravimoghadam, F., Rostami, F., 2015. Genetic diversity of Paecilomyces variotii isolates by SSR marker in Kerman province, Iran. Mycologia Iranica. 2(1), 38 – 45. [30] Elósegui, C. O., Jiménez, R. J., Carr, P, A., 2006. Aislamiento, identificación y caracterización morfométrica de aislados nativos de hongos mitospóricos con potencialidad para el control de especies de insectos plaga. [Isolation, identification and morphometric characterization of native isolates of mitosporic fungi with potential for the control of plague insect species]. Fitosanidad, 10 (4):265-272. [31] Elósegui, C. O. Primera edición. Métodos artesanales de reproducción de plaguicidas a partir de hongos entomopatógenos y antagonistas. Instituto de Investigaciones de Sanidad Vegetal. 2006. [First edition. Artisan methods of reproduction of pesticides from entomopathogenic fungi and antagonists. Plant Health Research Institute. 2006]. [32] Enkerli, J., Kolliker, R., Keller, S., Widmer, F., 2005. Isolation and characterization of microsatellite markers from the entomopathogenic fungus Metarhizium anisopliae. Molecular Ecology Notes, 5:384-386. [33] Enkerli, J., Widmer, F., 2010. Molecular ecology of fungal entomopathogens: molecular genetic tools and their applications in population and fate studies. Biocontrol 55, 17–37. [34] Enkerli, J., Widmer, F., Gessler, C. Keller, S., 2001. Strain-specific microsatellite markers in the entomopathogenic fungus Beauveria brongniartii. Mycological Research, 105, 1079-1087. [35] Fan Y, Pei X, Guo S, Zhang Y, Luo Z, Liao X, Pei Y., 2010. Increased virulence using engineered protease-chitin binding domain hybrid expressed in the entomopathogenic fungus Beauveria bassiana. Microb Pathog. 49(6):376-80. DOI: 10.1016/ j.micpath.2010.06.013. [36] Fan Y, Ortiz-Urquiza A, Kudia RA, Keyhani NO., 2012. A fungal homologue of neuronal calcium sensor-1, Bbcsa1, regulates extracellular acidification and contributes to virulence in the entomopathogenic fungus Beauveria bassiana. Microbiology 158(7):1843-51. DOI: 10.1099/mic.0.058867-0. [37] Fang W, Feng J, Fan Y, Zhang Y, Bidochka MJ, Leger RJ, Pei Y., 2009. Expressing a fusion protein with protease and chitinase activities increases the virulence of the insect

1474

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47] [48]

[49]

[50]

A. Garcia, M. Michel, S. Villarreal et al. pathogen Beauveria bassiana. J Invertebr Pathol., 102(2):155-9. DOI: 10.1016/ j.jip.2009.07.013. Fang W, Leng B, Xiao Y, Jin K, Ma J, Fan Y, Feng J, Yang X, Zhang Y, Pei Y., 2005. Microbiology. All Rights Reserved. Cloning of Beauveria bassiana Chitinase Gene Bbchit1 and Its Application To Improve Fungal Strain Virulence. Applied and Enviromental Microbiology 71(1): 363-370. DOI:10.1128/AEM.71.1.363–370. FAO. Resistencia a los antiparasitarios: estado actual con énfasis en América Latina. Roma: Dirección de producción y sanidad animal de la FAO, 2003. 33-35. [Antiparasitic resistance: current status with emphasis on Latin America. Rome: FAO Production and Animal Health Division, 2003. 33-35]. Fargues, J., Bon, M-C., Manguin, S., Couteaudier, Y., 2002. Genetic variability among Paecilomyces fumosoroseus isolates from various geographical and host insect origins based on the rDNA-ITS regions. Mycol. Res. 106, 1066-1074. Fernandes, E. K. K., Moraes, A. M. L., Pacheco, R. S., Rangel, D. E. N., Miller, M. P., Bittencourt, V. R. E. P., Roberts, D. W., 2009. Genetic diversity among Brazilian isolates of Beauveria bassiana: comparisons with non-Brazilian isolates and other Beauveria species. Journal of Applied Microbiology. 107, 760-774. Flores, M. A., Pucheta, D. M., Ramos-López, M. A., Rodríguez, N. S., Ramos, E. G., Juárez, R. D. 2013. Estudio del hongo entomopatógeno Isaria fumosorosea como control microbiológico de la mosquita blanca Bemicia tabaci. Interciencia, 38 (7):523-527. [Study of the entomopathogenic fungus Isaria fumosorosea as a microbiological control of the whitefly Bemicia tabaci. Interscience, 38 (7): 523-527]. Freed, S., Jin, F. L., Ren, S. X., 2011. Determination of genetic variability among the isolates of Metarhizium anisopliae var. anisopliae from different geographical origins. World J Microbiol Biotechnol. 27. 359–370. Galidevara S, Reineke A, Koduru UD., 2016. In vivo expression of genes in the entomopathogenic fungus Beauveria bassiana during infection of lepidopteran larvae. J Invertebr Pathol. 2(136):32-34. DOI: 10.1016/j.jip.2016.03.002. Garrido-Jurado, I., Fernandez-Bravo, M., Campos, C., Quesada-Moraga, E., 2015. Diversity of entomopathogenic Hypocreales in soil and phylloplanes of five Mediterranean cropping systems. Journal of Invertebrate Pathology. 130, 97–106. Gauthier, N., Dalleau-Clouet, C., Fargues, J., 2007. Microsatellite variability in the entomopathogenic fungus Paecilomyces fumosoroseus: genetic diversity and population structure. Mycologia, 99:693-704. Gerson, U., Kenneth, R., Muttath, T. l. 1979. Hirsutella thompsonii a fungal pathogen of mites. II Host-pathogen interacctions. Ann. Appl. Biol. 91:29-40. Ghikas, D. V., Kouvelis, V. N., Typas, M. A., 2010. Phylogenetic and biogeographical implications inferred by mitochondrial intergenic region analyses and ITS15. 8S-ITS2 of the entomopathogenic fungi Beauveria bassiana and B. brongniartii. BMC Microbiol. 10, 174. Goble, T. A., Conlong, E. E., Hill, M. P., 2015. Virulence of Beauveria brongniartii and B. bassiana against Schizonycha affinis white grubs and adults (Coleoptera: Scarabaeidae). J. Appl. Entomol. 139, 134–145. Golo PS, Santos HA, Perinotto WM, Quinelato S, Angelo IC, Camargo MG, Sá FA, Massard CL, Fernandes ÉK, Roberts DW, Bittencourt VR., 2015. The influence of

Genetics and Evolution of Entomopathogenic Fungi

[51]

[52]

[53] [54]

[55]

[56]

[57]

[58]

[59]

1475

conidial Pr1 protease on pathogenicity potential of Metarhizium anisopliae senso latu to ticks. Parasitol Res. 114(6):2309-15. DOI: 10.1007/s00436-015-4426-y. Guan Y, Wang DY, Ying SH, Feng MG., 2015. A novel Ras GTPase (Ras3) regulates conidiation, multi-stress tolerance and virulence by acting upstream of Hog1 signaling pathway in Beauveria bassiana. Fungal Genet Biol. 82:85-94. DOI: 10.1016/ j.fgb.2015.07.002. Guo, L. D., 2010. Molecular diversity and identification of endophytic fungi. In Gherbawy, Y., Voigt, K. editors. Molecular Identification of Fungi. Springer Heidelberg Dordrecht London New York. Springer, 277-296. Hassan, A. E. M., Dillion, R. J., and A. K. Charnley., 1989. J Invert. Pathol, 54, 227279. Hernández, M. A. A., Rosón, Á. C., Daquinta, R., C. Trujillo, M., R. 2005. Evaluación in vitro de la patogenicidad de Aschersonia aleyrodis webber sobre algunos insectos plaga de interés económico. [In vitro evaluation of the pathogenicity of Aschersonia aleyrodis webber on some plague insects of economic interest]. Fitosanidad, 9(4): 2934. Hernández, V., V. M., Berlanga P., A. M., Garza G. E., 1997. Detección de Metarhizium flavoviridae sobre Schistocerca piceifrons (Orthoptera: Acrididae) en las Islas Socorro, Archipiélago de Revillagigedo, [Detection of Metarhizium flavoviridae on Schistocerca piceifrons (Orthoptera: Acrididae) in the Socorro Islands, Revillagigedo Archipelago], México. Vedalia 4: 45-46. Hesketh, H., Roy, H. E., Eilenberg, J., Pell, J. K., & Hails, R. S., 2009. Challenges in modelling complexity of fungal entomopathogens in semi-natural populations of insects. In The Ecology of Fungal Entomopathogens (pp. 55-73). Springer Netherlands. Hibbett, D. S., Binder, M., Bischoff, J. F., Blackwell, M., Cannon, P. F., Eriksson, O., Huhndorff, S., James, T., Kirk, P. M., Lücking, R., Lumbsch, T., Lutzoni, F., Matheny, P. B., McLaughlin, D. J., Powell, M. J., Redhead, S., Schoch, C. L., Spatafora, J. W., Stalpers, J. A., Vilgalys, R., Aime, M. C., Aptroot, A., Bauer, R., Begerow, D., Benny, G. L., Castlebury, L. A., Crous, P. W., Dai, Y.-C., Gams, W., Geiser, D. M., Griffith, G. W., Gueidan, C., Hawksworth, D. L., Hestmark, G., Hosaka, K., Humber, R. A., Hyde, K., Köljalb, U., Kurtzman, C. P., Larsson, K.-H., Lichtwardt, R., Longcore, J., Mialikowska, J., Miller, A., Moncalvo, J.-M., Mozley-Standridge, S., Oberwinkler, F., Parmasto, R., Reeb, V., Rogers, J. D., Roux, C., Ryvarden, L., Sampaio, J. P., Schuessler, A., Sugiyama, J., Thorn, R. G., Tibell, L., Untereiner, W. A., Walker, C., Wang, Z., Weir, A., Weiss, M., White, M., Winka, K., Yao, Y.-J., Zhang, N., 2007. A higher-level phylogenetic classification of the fungi. Mycol. Res. 111, 509–547. Hua, X., Xiao, G., Zhenga, P., Shanga, Y., Sub, Y., Zhangb, X., Liub, X., Zhana, S., Legerc R. J., Wanga, Ch., 2014. Trajectory and genomic determinants of fungalpathogen speciation and host adaptation. PNAS 111(47):16796–16801. Hubka, V., and Kolarik, M., 2012. ß-tubulin paralogue tubC is frequently misidentified as the benA gene in Aspergillus section Nigri taxonomy: primer specificity testing and taxonomic consequences. Persoonia 29, 1–10. Hussain, A., Tian, MY., Ahmed S., Shahid M., 2012. Current status of entomopathogenic fungi as mycoinsecticides and their inexpensive development in liquid cultures. In García M. D., (Ed.), Zoology InTech, Available from: http://www.intechopen.com/ books/zoology/current-status-ofentomopathogenic-fungi-as-mycoinecticides-andtheir-inexpensive-development-in-liq.

1476

A. Garcia, M. Michel, S. Villarreal et al.

[60] Hussain, A., Rizwan-ul-Haq, M., Al-Ayedh, H., Al-Jabr, A. M. 2014. Mycoinsecticides: Potential and future perspective. Recent Patents on Food, Nutrition & Agriculture, 6:4553. [61] Inglis, G. A., Enkerl, J., Goettel, M. S. Laboratory Techniques Used for Entomopathogenic Fungi: Hypocreales. pp. 189-253. In: L. Lacey (Ed.). Manual of Techniques in Insect Pathology.2da. Edition Academic Press. 2012. [62] Jensen, A. B.; Eilenberg, J; Lastra, C. L., 2009: Differentially aphid and fly host driven divergence of obligate insect pathogenic Entomophthora species. FEMS Microbiology Letters 300: 180-187. [63] Jensen, A., B., Thomsen L., Eilenberg. J. 2006. Value of host range, morphological, and genetic characteristics within the Entomophthora muscae species complex. Mycol., Res 110: 941-950. [64] Junges Â, Boldo JT, Souza BK, Guedes RL, Sbaraini N, Kmetzsch L, Thompson CE, Staats CC, de Almeida LG, de Vasconcelos AT, Vainstein MH, Schrank A., 2014. Genomic analyses and transcriptional profiles of the glycoside hydrolase family 18 genes of the entomopathogenic fungus Metarhizium anisopliae. PLoS One. 18; 9(9):e107864. DOI: 10.1371/journal.pone.0107864. [65] Keller, S., Kalsbeek V., Eilenberg J., 1999. Redescription of Entomophthora muscae (Cohn) Fresenius. Sydowia, 51 (2): 197-209. [66] Khachatourians G. G., Sohail S. Q., 2008. Entomopathogenic fungi, In: Brakhage A. A., and Zipfel P. F. (eds.), Biochemistry and molecular biology, human and animal relationships, 2nd Edition. The Mycota VI, Springer-Verlag, Berlin, Heidelberg. [67] Khan S, Nadir S, Lihua G, Xu J, Holmes KA, Dewen Q., 2016. Identification and characterization of an insect toxin protein, Bb70p, from the entomopathogenic fungus, Beauveria bassiana, using Galleria mellonella as a model system. J Invertebr Pathol. 133:87-94. DOI: 10.1016/j.jip.2015.11.010. [68] Khan, S., Guo L., Maimaiti Y., Mijit M., Qiu D., 2012. Entomopathogenic fungi as microbial biocontrol agent. Molecular Plant Breeding, 3(7):63-79 (DOI: 10.5376/mpb.2012.03.0007). [69] Khudhair M. W., Alrubeai, H. F., Khalaf, M .Z., Shbar, A. K., Hamad, B. S., Khalaf, H. S., 2014. Occurrence and distribution of entomopathogenic fungi in Iraqi agroecosystems. Int. J. Entomol. Res. 2: 117-124. [70] Koduru UD, Galidevara S, Reineke A, Pathan AAK., 2014. Bioinformatic tools in the analysis of determinants of pathogenicity and ecology of entomopathogenic fungi used as microbial insecticides in crop protection. In: Kavi Kishor PB, Rajib Bandopadhyay, Prashanth Suravajhala (eds). Agricultural Bioinformatics. 215-234. [71] Lacey, L. A., Fransen, J. J., Carruthers, R. I., 1996. Global distribution of naturally occurring fungi of Bemisia, their biologies and use as biological control agents. In Bemisia 1995: taxonomy, biology, damage, control and management (D. Gerling & R. Mayer, eds): 401-433. Intercept, Andover. [72] Leão MP, Tiago PV, Andreote FD, de Araújo WL, de Oliveira NT., 2015. Differential expression of the pr1A gene in Metarhizium anisopliae and Metarhizium acridum across different culture conditions and during pathogenesis. Genet Mol Biol. 38(1):86-92. DOI: 10.1590/S1415-475738138120140236.

Genetics and Evolution of Entomopathogenic Fungi

1477

[73] Leger, R. J., Lokesh Joshi, Michael J. Bidochka, and Donald W. Roberts., 1996. Construction of an improved mycoinsecticide overexpressing a toxic protease. Proc. Natl. Acad. Sci. 93:6349-6354. [74] Li, J., Li, H., Bi, X., Zhang, K. Q., 2013. Multiple gene genealogical analyses of a nematophagous fungus Paecilomyces lilacinus from China. Journal of Microbiology. 51(4), 423–429. [75] Liu, M., Chaverri, P., Hodge, K., T., 2006. A taxonomic revision of the insect biocontrol fungus Aschersonia aleyrodis, its allies with white stromata and their Hypocrella sexual states. Mycological Research, 110(5): 537–554. [76] Lobo LS, Luz C, Fernandes ÉK, Juárez MP, Pedrini N., 2015. Assessing gene expression during pathogenesis: Use of qRT-PCR to follow toxin production in the entomopathogenic fungus Beauveria bassiana during infection and immune response of the insect host Triatoma infestans. J Invertebr Pathol. 128:14-21. DOI: 10.1016/j.jip.2015.04.004. [77] López-Llorca, L. V., and Jansson, H. B., 2001. Biodiversidad del suelo: control biológico de nemátodos fitopatógenos por hongos nematófagos. Cuadernos de biodiversidad: publicación cuatrimestral del Centro Iberoamericano de la Biodiversidad, (6), 12-15. [Soil biodiversity: biological control of phytopathogenic nematodes by nematophagous fungi. Biodiversity Notebooks: quarterly publication of the Ibero-American Center for Biodiversity, (6), 12-15]. [78] Luan, F., Zhang, S., Wang, B., Huang, B., Li, Z., 2012. Genetic diversity of the fungal pathogen Metarhizium spp., causing epizootics in Chinese burrower bugs in the Jingting Mountains, eastern China. Mol Biol Rep. 40(1), 515-23. [79] Luo X, Keyhani NO, Yu X, He Z, Luo Z, Pei Y, Zhang Y., 2012. The MAP kinase Bbslt2 controls growth, conidiation, cell wall integrity, andvirulence in the insect pathogenic fungus Beauveria bassiana. Fungal Genet Biol 49(7):544-55. DOI: 10.1016/j.fgb.2012.05.002. [80] MacLeod, D., M., Muller-Kogler, E., Wilding N., 1976. Entomophthora species with E. muscae-like conidia. Mycologia, 68: 1–29. [81] Mains, E., B., 1959. North American Species of Ashersonia Parasitic on Aleyrodidae. Journal of Insect Pathology, 1:43-47. [82] Marmaras, V. J., N. D. Charalambidis, C. G. Zervas., 1996. Immune response in insects: the role of phenoloxidase in defense reactions in relation to melanization and sclerotization. Archives of Insect Biochemistry and Physiology 31:119-133. [83] Mayerhofer, J., Lutz, A., Widmer, F., Rehner, S. A., Leuchtmann, A., Enkerli, J., 2015. Multiplexed microsatellite markers for seven Metarhizium species. Journal of Invertebrate Pathology. 132, 132–134. [84] McCoy, C. W., 1981. Pest Control by the fungus Hirsutella thompsonii pp. 449-512. In: Burges H. D. (ed) Academic Press, Londres. Microbial Control of Pest and Plant Diseases 1970-1980. [85] Meyling NV, Thorup-Kristensen K; Eilenberg J., 2011. Below- and aboveground abundance and distribution of fungal entomopathogens in experimental conventional and organic cropping systems. Biological Control, 59: 180-186. [86] Meyling, N. V., Eilenberg, J., 2007. Ecology of the entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae in temperate agroecosystems: potential for conservation biological control. Biol. Control 43, 145–155.

1478

A. Garcia, M. Michel, S. Villarreal et al.

[87] Meyling, N. V., Lübeck, M., Buckley E. P., Eilenbera, J., Rehner, S. A., 2009. Community composition, host range and genetic structure of the fungal entomopathogen Beauveria in adjoining agricultural and seminatural habitats. Molecular Ecology. 18, 1282-1293. [88] Meyling, N. V., Pilz, C., Keller, S., Widmer, S. Enkerli, J., 2012. Diversity of Beauveria spp. isolates from pollen beetles Meligethes aeneus in Switzerland. Journal of Invertebrate Pathology. 109, 76-82. [89] Motta-Delgado, P. A., and Murcia-Ordoñez, B., 2011. Hongos entomopatógenos como alternativa para el control biológico de plagas/Entomopatogenic fungi as an alternative for biological pest control/fungos entomopatogênicos como alternativa para o controle biológico de pragas. [Entomopathogenic fungi as an alternative for the biological control of pests / Entomopatogenic fungi as an alternative for biological pest control / entomopathogenic fungi as an alternative for or biological control of pragas]. Revista Ambiente & Água, 6(2), 77. [90] Nielsen, C., Jensen, A. B., Eilenberg, J., 2008. Survival of entomophthoralean fungi infecting aphids and higher flies during unfavorable conditions and implications for conservation biological control. In: Ekesi, S., Maniania, N. K. (Eds.), Use of Entomopathogenic Fungi in Biological Pest Management. Research SignPost, Kerala, India, 13–38. [91] Oliveira, I., Pereira, J. A., Quesada-Moraga, E., Lino-Neto, T., Bento, A., & Baptista, P., 2013. Effect of soil tillage on natural occurrence of fungal entomopathogens associated to Prays oleae Bern. Scientia Horticulturae, 159, 190-196. [92] Ortiz-Urquiza A, Luo Z, Keyhani NO., 2015. Improving mycoinsecticides for insect biological control. Appl Microbiol Biotechnol., 99(3):1057-68. DOI: 10.1007/s00253014-6270-x. [93] Ortiz-Urquiza, A., Keyhani, N.O., 2013. Action on the surface: Entomopathogenic fungi versus the insect cuticle. Insects, 4:357-374; DOI:10. 3390/insects4030357. [94] Oulevey, C., Widmer, F., Kölliker, R., Enkerli, J., 2009. An optimized microsatellite marker set for detection of Metarhizium anisopliae genotype diversity on field and regional scales. Mycol. Res. 113, 1016–1024. [95] Pantou, M. P., Mavridou, A., Typas, M. A., 2003. IGS sequence variation, group-I introns and the complete nuclear ribosomal DNA of the entomopathogenic fungus Metarhizium: excellent tools for isolate detection and phylogenetic analysis. Fungal Genet. Biol. 38, 159. [96] Pérez, C. N., 2004. Manejo ecológico de plagas. [Ecological management of pests]. Primera edición. CEDAR. [97] Peterson, S. W., 2008. Phylogenetic analysis of Aspergillus species using DNA sequences from four loci. Mycologia 100, 205-226. [98] Punya, J., Swangmaneecharern, P., Pinsupa, S., Nitistaporn, P., Phonghanpot, S., Kunathigan, V., Cheevadhanarak, S., Tanticharoen, M., Amnuaykanjanasin, A., 2015. Phylogeny of type I polyketide synthases (PKSs) in fungal entomopathogens and expression analysis of PKS genes in Beauveria bassiana BCC 2660. Fung. Biol. 119, 538-550. [99] Qin Y, Ortiz-Urquiza A, Keyhani NO., 2014. A putative methyltransferase, mtrA, contributes to development, spore viability, protein secretion and virulence in the

Genetics and Evolution of Entomopathogenic Fungi

[100]

[101]

[102]

[103]

[104]

[105]

[106] [107]

[108] [109] [110]

[111]

[112]

[113]

1479

entomopathogenic fungus Beauveria bassiana. Microbiology. 160(Pt 11):2526-37. DOI: 10.1099/ mic.0.078469-0. Quiroz-Velasquez, P. F., Abiff, S. K., Fins, K. C., Conway, Q. B., Salazar, N. C., Delgado, A. P., Dawes, J. K., Douma, L. G., Tartar, A., 2014. Transcriptome analysis of the entomopathogenic oomycete Lagenidium giganteum reveals putative virulence factors. Appl. Environ. Microbiol. 80(20): 6427-6436. Rehner, S. A., Buckley, E. P., 2003. Isolation and characterization of microsatellite loci from the entomopathogenic fungus Beauveria bassiana (Ascomycota: Hypocreales). Mol. Ecol. Notes 3, 409–411. Rehner, S. A., Buckley, E. P., 2005. A Beauveria phylogeny inferred from nuclear ITS and EF1α sequences: evidence for cryptic diversification and links to Cordyceps telemorphs. Mycol. 97, 84–98. Rehner, S. A., Posada, F., Buckley, E. P., Infante, F., Castillo, A., Vega, F. E., 2006. Phylogenetic origins of African and Neotropical Beauveria bassiana s.l. pathogens of the coffee berry borer, Hypothenemus hampei. J. Invert. Pathol. 93, 11–21. Reineke, A., Brischoff-Schaefer, M., Rondot, Y., Galidevara, S., Hirsch, J., Devi, K. U., 2014. Microsatellite markers to monitor a commercialized isolate of the entomopathogenic fungus Beauveria bassiana in different environments: Technical validation and first applications. Biological Control. 70, 1–8. Rosas-García NM, Ávalos-de-León O, Villegas-Mendoza JM, Mireles-Martínez M, Barboza-Corona JE, Castañeda-Ramírez JC., 2014. Correlation between pr1 and pr2 gene content and virulence in Metarhizium anisopliae strains. J. Microbiol. Biotechnol. 24(11): 1495-1502 http://dx.DOI.org/10.4014/jmb.1404.04044. Rosewich, U. L., McDonald, B. A., 1994. DNA fingerprinting in fungi. Methods Mol. Cel. Biol. 5, 41-48. Rostami, F., Khosravi, M. F., Kazem, S. S., Saeidi, S., 2015. Comparison of PCR-RFLP based on ribosomal regions and ssr markers in genetic diversity of pistachio die-back caused by Paecilomyces variotii. Gene Cell Tissue. 2(1), 2-4. Samson, R. A., 1974. Paecilomyces and some allied Hyphomycetes. Studies in Mycology, 6: 80-83. Samson, R. A., McCoy, C. W., O’Donnell, K. L., 1980. Taxonomy of the acarine parasite Hirsutella thompsonii. Mycologia, 72: 359-377. Samson, R. A., Visagie, C. M., Houbraken, J., Hong, S. B., Hubka, V., Klaassen, C. H. W., Perrone, G., Seifert, K. A., Susca, A., Tnney, J. B., Varga, J., Kocsubé, S., Szigeti, G., Yaguchi, T., Frisvad, J. C., 2014. Phylogeny, identification and nomenclature of the genus Aspergillus. Studies in Mycology 78, 141-173. Sánchez-Pérez, L. C, Barranco-Florido, J. E., Rodríguez-Navarro, S., CervantesMayagoitia, J. F., Ramos-López, M. Á., 2014. Enzymes of entomopathogenic fungi, advances and insights. Advances in Enzyme Research, 2:65-76. http://dx.DOI.org/ 10.4236/aer.2014.22007. Sansores-Lara LI, Palomo-Kumul J, Mijangos C., 2014. Manual de producción y formulación de hongos entomopatógenos: Manejo de hongos entomopatogenos, EAE. [Manual of production and formulation of entomopathogenic fungi: Management of entomopathogenic fungi, EAE]. Sandhu, S. S., Sharma A. K., Beniwal V., Goel G., Batra P., Kumar A., Jaglan S., Sharma AK., Malhotra S., 2012. Myco-biocontrol of insect pests: Factors involved, mechanism

1480

[114]

[115]

[116]

[117]

[118]

[119] [120]

[121]

[122] [123]

[124]

[125]

[126]

[127]

A. Garcia, M. Michel, S. Villarreal et al. and regulation. J. Pathogens, Vol. 2012. 10.1155/2012/126819. DOI:10.1155/2012/126819. Schoch, C. L., Seifert, K. A., Huhndorf, S., et al., 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proceedings of the National Academy of Sciences of the USA 109, 6241–6246. Sevim A, Donzelli BGG, Wu D, Demirbag Z, Gibson DM, Turgeon BG., 2012. Hydrophobin genes of the entomopathogenic fungus, Metarhizium brunneum, are diferentially expressed and corresponding mutants are decreased in virulence. Curr Genet 58:79-92. DOI 10.1007/s00294-012-0366-6. Shahid, A. A., Rao, A. Q., Bakhsh, A., Husnain, T., 2012. Entomopathogenic fungi as biological controllers: New insights into their virulence and pathogenicity. Arch. Biol. Sci., Belgrade, 64 (1): 21-42, DOI:10. 2298/ABS1201021S21. Steinwender, B. M., Enkerli, E., Widmer, F., Eilenber, J., Thorup-Kristensen, K., Meyling, N. V., 2014. Molecular diversity of the entomopathogenic fungal Metarhizium community within an agroecosystem. Journal of Invertebrate Pathology. 123, 6–12. Sugimoto, M., Koike M., Hiyama N., Nagao H., 2002. Genetic, morphological, and virulence characterization of the entomopathogenic fungus Verticillium lecanii. Journal of Invertebrate Pathology 82:176–187. Tanada, Y. and H. K. Kaya., 1993. Insect pathology. Primera edición. Academic Press, San Diego, California. Tellez, J. A; Cruz, R. M. G; Mercado, F. Y; Assaf, T.; Arana, C. A., 2009. Mecanismos de acción y respuesta en la relación de hongos entomopatógenos e insectos. [Mechanisms of action and response in the relation of entomopathogenic fungi and insects]. Revista Mexicana de Micología. 30: 73-80. Tigano-Milani, M. S., Honeycutt, J., Lacey, L. A., Assis, R., McClelland, M., Sobral, W. S., 1995. Genetic variability of Paecilomyces fumosoroseus isolates revealed by molecular markers. J. Inv. Pathol. 65, 274-282. Tulloch, M., 1976. Genus Metarhizium. T. Brit. Mycol. Soc. 66, 407–411. Valero-Jiménez CA, Wiegers H, Zwaan BJ, Koenraadt CJM, van Kan JAL., 2016. Genes involved in virulence of the entomopathogenic fungus Beauveria bassiana. Journal of Invertebrate Pathology. 133: 41-49. Vega, F. E., Goettel, M. S., Blackwell, M., Chandler, D., Jackson, M. A., Keller, S., and Pell, J. K., 2009. Fungal entomopathogens: new insights on their ecology. Fungal Ecology, 2(4), 149-159. Velasquez, V. B., Carcamo, M. P., Merino, C. R., Iglesias, A. F., Duran, J. F., 2007. Intraspecific differentiation of Chilean isolates of the entomopathogenic fungi Metarhizium anisopliae var. anisopliae as revealed by RAPD, SSR and ITS markers. Genetics Mol. Biol. 30, 89–99. Ventura-Sobrevilla J., Boone D., Rodriguez-Herrera R., Martinez-Hernandez J. L., Aguilar C., 2015. Microbial biosynthesis of enzymes for food applications. In edited by Rickey Yada. Improving and Tailoring Enzymes for Food Quality and Functionality. Elsevier. 85-99. Vilcinskas, A., 2010. Coevolution between pathogen-derived proteinases and proteinase inhibitors of host insects, Virulence, 1:3, 206-214, DOI: 10.4161/viru.1.3.12072.

Genetics and Evolution of Entomopathogenic Fungi

1481

[128] Visalakshy, P. G., Krishnamoorthy, A., & Kumar, A. M., 2005. Note: Effects of plant oils and adhesive stickers on the mycelia growth and conidiation of Verticillium lecanii, a potential entomopathogen. Phytoparasitica, 33(4), 367-369. [129] Wang C and St Leger RJ., 2007. The MAD1 Adhesin of Metarhizium anisopliae links adhesion with blastospore production and virulence to insects, and the MAD2 adhesin enables attachment to plants. Eukaryot Cell 6(5): 808-816. DOI: 10.1128/EC.00409-06. [130] Wang Z, Meng H, Zhuang Z, Chen M, Xie L, Huang Bo., 2013. Molecular cloning of a novel subtilisin-like protease (Pr1A) gene from the biocontrol fungus Isaria farinose. Appl Entomol Zool 48:477–487 DOI: 10.1007/s13355-013-0208-0. [131] Wang ZL, Li F, Li C, Feng MG., 2014. Bbssk1, a response regulator required for conidiation, multi-stress tolerance, and virulence of Beauveria bassiana. Appl Microbiol Biotechnol. 98(12):5607-18. DOI: 10.1007/s00253-014-5644-4. [132] White, T. J., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and direct sequencing of fungal ribosomal RNAgenes for phylogenetics. In PCR Protocols: a guide to methods and applications (M. A. Innis, D. H. Gelfand, J. J. Sninsky & T. J. White, eds): 315-322. Academic Press, San Diego. [133] Wichadakul, D., Kobmoo, N., Ingsriswang, S., Tangphatsornruang, S., Chantasingh, D., Luangsa, J. J., Eurwilaichitr, L., 2015. Insights from the genome of Ophiocordyceps polyrhachis-furcata to pathogenicity and host specificity in insect fungi. BMC Genomics, 16:881. [134] Xiao, G., Ying, S. H., Zheng, P., Wang, ZL., Zhang, S., Xie, X. Q., Shang, Y., Leger, R. J., Zhao, G. P., Wang, Ch., Feng, M.G., 2012. Genomic perspectives on the evolution of fungal entomopathogenicity in Beauveria bassiana. Scientific Reports, 2: 483. DOI: 10.1038/srep00483. [135] Xie X-Q, Wang J, Huang B-F, Ying S-H, Feng M-G., 2010. A new manganese superoxide dismutase identified from Beauveria bassiana enhances virulence and stress tolerance when overexpressed in the fungal pathogen. Appl Microbiol Biotechnol 86:1543-1553. DOI: 10.1007/s00253-010-2437-2. [136] Xie XQ, Guan Y, Ying SH, Feng MG., 2013. Differentiated functions of Ras1 and Ras2 proteins in regulating the germination, growth, conidiation, multi-stress tolerance and virulence of Beauveria bassiana. Environ Microbiol. 15(2):447-62. DOI: 10.1111/j.1462-2920.2012. 02871.x. [137] Zare, R., Gams, W., 2001. A revision of Verticillium sect. Prostata IV. The genera Lecanicillium and Simplicillium gen. Nova Hedwigia, 73:1-50. [138] Zhang S, Xia YX, Kim B, Keyhani NO., 2011. Two hydrophobins are involved in fungal spore coat rodlet layer assembly and each play distinct roles in surface interactions, development and pathogenesis in the entomopathogenic fungus, Beauveria bassiana. Mol Microbiol. 80(3):811-26. DOI: 10.1111/j.1365-2958.2011.07613.x. [139] Zheng, P., Xia, Y., Xiao, G., Xiong, Ch., Hu, X., Zhang, S., Zheng, H., Huang, Y., Zhou, Y., Wang, S., Zhao, G. P., Liu, X., Leger, R. J., Wang, Ch., 2011. Genome sequence of the insect pathogenic fungus Cordyceps militaris, a valued traditional Chinese medicine. Genome Biology, 12:R116. [140] Zimmermann, G., 2007. Review on safety of the entomopathogenic fungus Metarhizium anisopliae. Biocontrol Sci. Technol. 17, 879–920. [141] Zimmermann, G., 1986. The Galleria baits method for detection of entomopathogenic fungi in soil. J. Appl. Entomol. 102:213-215.

1482

A. Garcia, M. Michel, S. Villarreal et al.

BIOGRAPHICAL SKETCH Name: Raúl Rodríguez-Herrera Affiliation: School of Chemistry- Universidad Autónoma de Coahuila Education: Agriculture minor Horticulture. 1981. Universidad Autónoma Agraria Antonio Narro. México M. S. Plant Breeding. 1986. Universidad Autónoma Agraria Antonio Narro. México Ph. D. Plant Breeding 1999. Texas A&M University. USA. Post-doctorate and sabbatical training 1999, 2014. United States Department of Agriculture. USA Address: School of Chemistry Universidad Autónoma de Coahuila Blvd. V. Carranza e Ing. José Cárdenas S/n Col. Republica Saltillo Coahuila 25280 México Research and Professional Experience: 1999-to date Full professor- Universidad Autónoma de Coahuila- México 1999 Post-doctorate training Texas A&M University-USDA USA 1997-1998 Graduate Assistant Texas A&M University-USA 1986-1998 Researcher-National Research Institute for Forestal, Agricultural and LivestockMexico 1982-1984 Administrator- Ministry of Agrarian Reform-Mexico Professional Appointments: Mexican Society of Biotechnology and Bioengineering. México Directive Committee Symposium “Genomes and Proteomes in XXI Century.” México Institute of Food Technologists. USA Mexican Association of Food Science (AMECA). Mexico Honours 1981. Graduated with honours from the UAAAN. 1988. Award to outstanding research. PCCMCA Congress. San José, Costa Rican. 1990. Award to outstanding research. PCCMCA Congress. San Salvador, El Salvador. 2001. Distinguished as National Researcher- Level 2 Mexico. 2003. National Prize on Food Science and Technology. CONACYT-Coca Cola México, D. F. 2005. Coahuila State Prize for outstanding Food Research Project. Saltillo Coahuila, Mexico. 2005. National Agro-Bio Prize on Agricultural Biotechnology-Mexico Publications Last 3 Years: Selected Publications (Total 216 refereed publications, 60 divulgation papers, 51 book chapters, 5 books, 6 patents, 8 bulletins, recent refereed publications are listed).

Genetics and Evolution of Entomopathogenic Fungi 1.

2.

3.

4.

5.

6.

7.

8.

9.

10.

11.

1483

Meléndez Rentería, NP., Aguilar, CN., Rodríguez Herrera, R., Nevárez Moorillón, GV., 2013. Microbiological effect of fermented Mexican oregano (Lippia berlandieri Schauer) waste. Waste and Biomass Valorization. DOI 10.1007/s12649-013-9222-2 M. Cruz-Requena, H. De La Garza-Toledo, C. N. Aguilar-González, A. Aguilera-Carbó, H. Reyes-Valdés, M. Rutiaga and R. Rodríguez-Herrera. 2013. Chemical and molecular properties of sotol plants (Dasylirion cedrosanum) of different sex and its fermentation products. International Journal of Basic and Applied Chemical Sciences 3 (1):. 41-49. Diana B. Muñiz-Márquez, Guillermo C. Martínez-Ávila, Jorge E. Wong-Paz, Ruth Belmares-Cerda, Raúl Rodríguez-Herrera, Cristóbal N. Aguilar. 2013. Ultrasoundassisted extraction of phenolic compounds from Laurus nobilis L. and their antioxidant activity.” Ultrasonics Sonochemistry 20: 1149–1154. doi: 10.1016/j.ultsonch.2013. 02.008. Juan A. Ascacio-Valdés, José J. Buenrostro, Reynaldo De la Cruz, Leonardo Sepúlveda, Antonio F. Aguilera, Arely Prado, Juan C. Contreras, Raúl Rodríguez and Cristóbal N. Aguilar. 2014. Fungal biodegradation of pomegranate ellagitannins. Basic Journal of Microbiology. 54:28-34. DOI 10.1002/jobm.201200278. Ascacio-Valdés, Juan, Burboa, Edgardo, Aguilera-Carbo Antonio F., Aparicio Mario, Pérez-Schmidt Ramón, Rodríguez Raúl, Aguilar Cristóbal N. (2013). An antifungal ellagitannin isolated from Euphorbia antisyphilitica Zucc. Asian Pac J Trop Biomed. 3(1): 41–46. doi: 10.1016/S2221-1691(13)60021-0. IF = 0.371. T. López, A. Prado-Barragán, G.V. Nevárez-Moorillón, J. C. Contreras, R. Rodríguez and C.N. Aguilar. 2013. Incremento de la capacidad antioxidante de extractos de pulpa de café por fermentación láctica en medio sólido CyTA – Journal of Food, [Increase in antioxidant capacity of coffee pulp extracts by lactic acid fermentation in solid medium CyTA - Journal of Food], 11(4):359-365. dx.doi.org/10. 1080/19476337.2013.773563. Luis C. Mata, Catalina Chavez, Raúl Rodríguez-Herrera, Daniel Hernández-Castillo and Cristobal N. Aguilar. 2013. Growth inhibition of some phytopathogenic bacteria by cellfree extracts from Enterococcus sp. British Biotechnology Journal, 3(3): 359-366. Emilio Ochoa-Reyes, Gabriela Martínez-Vazquez, Saul Saucedo-Pompa, Julio Montañez, Romeo Rojas-Molina, Miguel A. de Leon-Zapata, Raúl Rodríguez-Herrera and Cristóbal N. Aguilar. 2013. Improvement of shelf life quality of green bell peppers using edible coating formulations. Journal of Microbiology, Biotechnology and Food Sciences, 2 (6) 2448-2451 Tanya Cecilia Espinoza-Hernández, Raúl Rodríguez-Herrera, Cristóbal Noé AguilarGonzález, Faustino Lara-Victoriano, Manuel Humberto Reyes-Valdés and Francisco Castillo- Reyes. 2013. Characterization of three novel pigment-producing Penicillium strains isolated from the Mexican semi-desert. African Journal of Biotechnology 12(22): 3405-3413. Lorena Lara-Fernández, Heliodoro de la Garza-Toledo, Jorge E. Wong-Paz, Ruth Belmares, Raúl Rodríguez-Herrera and Cristóbal N. Aguilar. 2013. Separation conditions and evaluation of antioxidant properties of boldo (Peumus boldus) extracts. Journal of Medicinal Plant Research, 7(15): 911-917. Delgado-García, M. Cruz Hernández, M.A., De la Garza-Rodríguez, I., Balagurusamy N, Aguilar, C., Rodríguez-Herrera, R. 2013. Characterization of halophilic microorganisms isolated from Mexican saline soils, ARPN Journal of Agricultural and Biological Science, 8(6):457-464.

1484 12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

22.

A. Garcia, M. Michel, S. Villarreal et al. Ascacio-Valdés, J., Aguilera-Carbo Antonio F., Rodríguez Raúl, Aguilar Cristóbal N. (2013). Análisis de ácido elágico en algunas plantas del semidesierto mexicano. [Analysis of ellagic acid in some plants of the Mexican semi-desert]. Revista Mexicana de Ciencias Farmacéuticas. 44(2): 36-40. Y.N. Mora, J.C. Contreras, C. N. Aguilar, P. Meléndez, I. De la Garza, R. Rodríguez, 2013. Chemical composition and functional properties from different sources of dietary fiber. American Journal of Food and Nutrition. 1(3):27-33. DOI:10.12691/ajfn-1-3-2. Mondragon-Preciado, G., Escalante-Minakata, P., Osuna-Castro, J.A., Ibarra-Junquera, V., Morlett-Chavez, J.A., Aguilar-Gonzalez, C.N., Rodriguez-Herrera, R., 2013. Bacteriocinas: características y aplicación en alimentos. [Bacteriocins: characteristics and application in food]. Investigacion y Ciencia 59: 64-70. M. Cruz-Requena, C.N. Aguilar-González, J. Espinoza-Velázquez, M.H. Reyes-Valdés and R. Rodríguez-Herrera. 2013. AFLPs loci associated with polyembryonic maize using selective genotyping analysis. Israel Journal of Plant Sciences. 61(1-4):46-50. DOI: 10.1080/07929978.2014.950045 Jorge E. Wong-Paz, Diana B. Muñiz-Márquez, Pedro Aguilar-Zárate, Raúl RodríguezHerrera and Cristóbal N. Aguilar. 2013. Microplate quantification of total phenolic content from plant extracts obtained by conventional and ultrasound methods. Phytochem. Anal. DOI 10.1002/pca.2512. D.B. Muñiz-Márquez, R. Rodríguez, N. Balagurusamy, M.L. Carrillo, R. Belmares, J.C. Contreras, G.V. Nevárez & C.N. Aguilar (2014) Phenolic content and antioxidant capacity of extracts of Laurus nobilis L., Coriandrum sativum L. and Amaranthus hybridus L., CyTA - Journal of Food, 12:3, 271-276, DOI: 10.1080/19476337 .2013.847500 V. Padilla-García, F. Castillo-Reyes, C. N. Aguilar-González, A. Cuenca-Arana, A. Téllez-Jurado, M. H. Reyes-Valdez and R. Rodríguez-Herrera. 2014. Molecular characterization of six tannase-producers Aspergillus strains using PCR-RFLP of ITS and IGS regions and RAPD´s. International Journal of Molecular Biology 8(12): 451459. GCG Martinez-Avila, A.F. Aguilera, S. Saucedo, R. Rojas, R. Rodriguez and CN Aguilar. 2014. Fruit wastes fermentation for phenolic antioxidants production and their application in manufacture of edible coatings and films, Critical Reviews in Food Science and Nutrition. 54(3):303-11 DOI:10.1080/10408398.2011.584135 ISSN 1040-8398 (Print), 1549-7852 (Online). JCR FI= 4.510. Salvador Eduardo Vásquez Rivera, Mayra Alejandra Escobar-Saucedo, Diana Morales, Cristóbal Noé Aguilar and Raúl Rodríguez-Herrera. 2014. Synergistic effects of ethanolic plant extract mixtures against food-borne pathogen bacteria. African Journal of Biotechnology 13(5): 699-704. Norma P. Meléndez, Virginia Nevárez-Moorillón, Raúl Rodríguez-Herrera, José C. Espinoza and Cristóbal N. Aguilar. 2014. A microassay for quantification of 2,2diphenyl-1- picrylhydracyl (DPPH) free radical scavenging. African Journal of Biochemistry Research 8(1):14-18. Dulce A. Flores-Maltos, Solange I. Mussatto, Juan C. Contreras Esquivel, Juan J. Buenrostro, Raúl Rodríguez, José A. Teixeira and Cristóbal N. Aguilar. 2014. Typical Mexican agroindustrial residues as supports for solid-state fermentation. American Journal of Agricultural and Biological Sciences 9 (3): 289-293.

Genetics and Evolution of Entomopathogenic Fungi 23.

24.

25.

26.

27.

28.

29.

30.

31.

32.

33.

1485

Reynaldo De la Cruz Quiroz, Sevastianos Roussos, Daniel Hernández, Raúl Rodríguez, Francisco Castillo, and Cristóbal N. Aguilar. 2014. Challenges and opportunities of the bio-pesticides production by solid-state fermentation: filamentous fungi as a model. Critical Reviews in Biotechnology. (doi:10.3109/07388551.2013.857292). Veana F., Fuentes-Garibay J.A., Aguilar C.N., Rodríguez-Herrera R., Guerrero-Olazarán M., Viader-Salvadó J. M. (2014). Gene encoding a novel invertase from a xerophilic Aspergillus niger strain and production of the enzyme in Pichia pastoris. Enzyme and Microbial Technology 63: 28-33. M. Delgado, J. Mendez, R. Rodríguez-Herrera, C.N. Aguilar, M. Cruz-Hernández & N. Balagurusamy (2014): Characterization of phosphate-solubilizing bacteria isolated from the arid soils of a semi-desert region of north-east Mexico, Biological Agriculture & Horticulture: An International Journal for Sustainable Production Systems, 30(3):211– 217. DOI: 10.1080/01448765.2014.909742 Jorge E. Wong-Paz, Juan C. Contreras-Esquivel, Diana Muñiz-Marquez, Ruth Belmares, Raul Rodriguez, Patricia Flores and Cristobal N. Aguilar. 2014. Microwave-assisted extraction of phenolic antioxidants from semiarid plants. American Journal of Agricultural and Biological Sciences 9 (3): 299-310. ISSN: 1557-4989doi:10.3844/ ajabssp.2014. 299.310. K. Cruz-Aldaco, C. N. Aguilar, A. Ilyina, R. Rodríguez-Herrera and J. L. MartínezHernández. 2014. Surface adhesion fermentation for lipase production by Mucor griseocyanus Micol. Apl. Int., 26(1): 9-16. J.A. Borrego-Terrazas, F. Lara-Victoriano, A.C. Flores-Gallegos, F. Veana, C.N. Aguilar and R. Rodríguez-Herrera. 2014. Nucleotide and amino acid variation of tannase gene from different xerophylic Aspergillus strains. Canadian Journal of Microbiology. 60: 509–516. 10.1139/cjm-2014-0163. Chávez-González, Mónica L.; Guyot, Sylvain; Rodríguez-Herrera, Raúl, PradoBarragán, Arely; Aguilar, Cristóbal N. 2014. Production profiles of phenolics from fungal tannic acid biodegradation in submerged and solid-state fermentation. Process Biochemistry. 49(4):541-546. Ayerim Hernández-Almanza, Julio Montanez-Sáenz, Cristian Martínez-Ávila, Raúl Rodríguez-Herrera, Cristóbal N. Aguilar. 2014. Carotenoid production by Rhodotorula glutinis YB-252 in solid-state fermentation. Food Bioscience 7:31–36. Hernández-Almanza, Ayerim; Cesar Montanez, Julio; Aguilar-González, Miguel A.; Martínez-Ávila, Cristian; Rodríguez-Herrera, Raúl; Aguilar, Cristóbal N. 2014. Rhodotorula glutinisas source of pigments and metabolites for food industry. Food Bioscience. 5(3):64-72. Burboa E.A., Ascacio V., J.A., Zugasti C., A., Rodriguez H., R., Aguilar G., C.N. 2014. Capacidad antioxidante y antibacteriana de extractos de residuos de candelilla. [Antioxidant and antibacterial capacity of candelilla waste extracts]. Revista Mexicana de Ciencias Farmaceuticas. 45(1):51-56. Sepúlveda, L.; Buenrostro -Figueroa, J. J.; Ascacio-Valdés, J A.; Aguilera-Carbó, A. F.; Rodríguez -Herrera, R.; Contreras-Esquivel, J. C.; Aguilar, C. N. 2014. Submerged culture for production of ellagic acid from pomegranate husk by Aspergillus niger GH1. Micología Aplicada International, 26(2): 27-35.

1486 34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

A. Garcia, M. Michel, S. Villarreal et al. Veana F., Martínez-Hernández J. L., Aguilar C. N., Rodríguez-Herrera R. and Michelena G. 2014. Utilization of molasses and sugar cane bagasse for production of fungal invertase in solid state fermentation using Aspergillus niger GH1. BMJ, 45(2): 373-377. JuanBuenrostro-Figueroa, Alberto Ascacio-Valdés, Leonardo Sepúlveda, Reynaldo De la Cruz, Arely Prado-Barragán, Miguel A. Aguilar-González, Raúl Rodríguez, Cristóbal N. Aguilar (2014). Potential use of different agroindustrial by-products assupports for fungal ellagitannase production undersolid-state fermentation. Food and Bioproducts Processing 9(2): 376–382. Buenrostro, J., Huerta, S., Prado, A., Ascacio, J., Sepulveda, L., Rodriguez-Herrera R., Aguilera, A., Aguilar, C.N., 2014. Continuous production of ellagic acid in a packed-bed reactor. Process Biochemistry 49: 1595–1600. Reynaldo de la Cruz, Juan A. Ascacio, José J. Buenrostro, Leonardo Sepúlveda, Raúl Rodríguez, Arely Prado-Barragán, Juan C. Contreras, Antonio Aguilera & Cristóbal N. Aguilar. 2014. Optimization of ellagitannase production by Aspergillus niger GH1 by solid state fermentation. Preparative Biochemistry & Biotechnology. 45:7, 617-631, DOI:10.1080/10826068.2014.940965. Flores-Gallegos AC., Morlett-Chávez JA., Aguilar CN., Riutort M., Rodríguez-Herrera R., 2014. Gene encoding inulinase isolated from Penicillium citrinum ESS and its molecular phylogeny. Applied Biochemistry and Biotechnology. 175:1358-1370 DOI 10.1007/s12010-014-1280-9 Flores-Gallegos, A.C., Morlett-Chavez J.A., Rodríguez-Herrera R. 2014. Inulin potential for enzymatic obtaining of prebiotic oligosaccharides. Critical Reviews in Food Science and Nutrition. DOI:10.1080/10408398.2013.807220. Delgado-García, M., Aguilar, C.N., Contreras-Esquivel, J.C. and Rodríguez-Herrera, R. 2014. Screening for extracellular hydrolytic enzymes production by different halophilic bacteria. Mycopath 12(1): 17-23. F. Veana, D. G. Rodríguez-Reyna, E. T. Aréchiga-Carvajal, C. N. Aguilar and R. Rodríguez-Herrera. 2014. Isolation of a putative Invertase gene from the xerophilic Aspergillus niger GH1 strain. Mycopath (2014) 12(2): 77-82. M. Govea Salas, A.M. Rivas Estilla, Jesus Morlett, Sonia Amelia Lozano Sepúlveda, R. Rodríguez Herrera, C.N. Aguilar González. 2014. P420 gallic acid has antiviral effect against hepatitis c virus (hcv), which is mediated by its antioxidant activity. Journal of Hepatology (Impact Factor: 11.34). 60(1):S208. DOI: 10.1016/S0168-8278(14)60582-. Naivy Y. Nava-Cruz, Miguel A. Medina-Morales, Jose L. Martinez, R. Rodriguez, and Cristobal N. Aguilar. 2015. Agave biotechnology: an overview. Critical Reviews in Biotechnology. 35(4):546-559. (doi:10.3109/07388551.2014.923813). Silvia Marina González-Herrera, Raul Rodriguez Herrera, Mercedes Guadalupe López, Olga Miriam Rutiaga, Cristobal Noe Aguilar, Juan Carlos Contreras Esquivel, Luz Araceli Ochoa Martínez, (2015),”Inulin in food products: prebiotic and functional ingredient,” British Food Journal, 117 (1): 371 – 387. Jorge E. Wong-Paz, Juan C. Contreras-Esquivel, Raúl Rodríguez-Herrera, María L. Carrillo-Inungaray, Lluvia I. López, Guadalupe V. Nevárez-Moorillón, Cristóbal N. Aguilar. (2015). Total phenolic content, in vitro antioxidant activity and chemical composition of plant extracts from semiarid Mexican region. Asian Pacific Journal of Tropical Medicine 8(2): 104-111.

Genetics and Evolution of Entomopathogenic Fungi 46.

47.

48.

49.

50.

51.

52.

53.

54.

55.

1487

Virgilio Cruz, Romeo Rojas, Saúl Saucedo-Pompa, Dolores G. Martínez, Antonio F. Aguilera-Carbó, Olga B. Alvarez, Raúl Rodríguez, Judith Ruiz, and Cristóbal N. Aguilar. 2015. Improvement of shelf life and sensory quality of pears using a specialized edible coating. Journal of Chemistry 1-7. Article ID 138707. Miguel A. De León-Zapata, Aide Sáenz-Galindo, Romeo Rojas-Molina, Raúl RodríguezHerrera, Diana Jasso-Cantú,Cristóbal N. Aguilar. 2015. Edible candelilla wax coating with fermented extract of tarbush improves the shelf life and quality of apples. Food Packaging and Shelf Life. 3:70-75 doi:10.1016/j.fpsl.2015.01.001. Jose Antonio Fuentes-Garibay, Cristobal Noe Aguilar, Raul Rodrıguez-Herrera, Martha Guerrero-Olazaran, Jose Marıa Viader-Salvado. 2015. Tannase sequence from a xerophilic Aspergillus niger strain and production of the enzyme in Pichia pastoris. Molecular Biotechnology 57:439–447. DOI 10.1007/s12033-014-9836-z. Flores-Gallegos, A.C., Morlett-Chávez, J.M., Contreras-Esquivel, J.C., Aguilar, C.N., Rodríguez-Herrera, R. 2015. Comparative study of Mexican fungal strains for thermostable inulinase production. Journal of Bioscience and Bioengineering. 119 (4):421-426, http://dx.doi.org/ 10.1016/j.jbiosc.2014.09.020. Castillo-Reyes, F., Hernández-Castillo, FD., Gallegos-Morales, G., Flores-Olivas, A., Rodríguez-Herrera, R., Aguilar, CN., 2015. Efectividad in vitro de Bacillus y polifenoles de plantas nativas de México sobre Rhizoctonia-Solani. [In vitro effectiveness of Bacillus and polyphenols of plants native to Mexico on Rhizoctonia-Solani]. Revista Mexicana de Ciencias Agrícolas. 6(3): 549-562. Marselino Avendaño-Sanchez, José Espinoza-Velázquez, Alondra Gutiérrez-López, Adriana Carolina Flores-Gallegos, Raúl Rodríguez-Herrera. 2015. Secuencias nucleotídicas de la región ITS en familias S1 y PL de maíces poliembriónicos. [Nucleotide sequences of the ITS region in S1 and PL families of polyembryonic maizes]. Revista Mexicana de Ciencias Agrícolas 6(3): 509-521. Garduño-Velázquez, S., Quero-Carrillo, AR., Bonnett, D., Rodríguez-Herrera, R., PérezHernández, A., Hernández-Garay, A. 2015. Nivel de ploidía en poblaciones de Leptochloa dubia (Kunth) Nees nativas de México. [Level of ploidy in populations of Leptochloa dubia (Kunth) Nees native to Mexico]. Revista Mexicana de Ciencias Agricolas, 6(3):539-548. González-Morales S., Cruz-Requena, M., Rodríguez-Vidal A, Aguilar-González C.N., Rebolloso-Padilla O, and Rodríguez-Herrera R 2015. Persistence of transgenic genes and proteins during soybean food processing. Food Bioscience, 1 1: 4 3 – 4 7. Marco Mata-Gómez, Solange I. Mussatto, Raul Rodríguez, Jose A. Teixeira, Jose L. Martinez, Ayerim Hernandez, Cristóbal N. Aguilar. 2015. Gallic Acid Production with Mouldy Polyurethane Particles Obtained from Solid State Culture of Aspergillus niger GH1. Applied Biochemistry and Biotechnology (online). DOI 10.1007/s12010-015-1634y Santiago Garduño Velázquez, Raúl Rodríguez Herrera, Adrián Raymundo Quero Carrillo, Javier Francisco Enríquez Quiroz, Alfonso Hernández Garay y Alejandra Pérez Hernández. 2015. Diversidad morfológica, citológica y valor nutritivo de siete nuevos genotipos de pasto buffel (Cenchrus ciliaris L.) y un cultivar tolerante al frío. [Morphological, physiological and nutritive value of seven new genotypes of buffel grass (Cenchrus ciliaris L.) and a cold tolerant cultivar]. Revista Mexicana de Ciencias Agrícolas 6(7): 1679-1687.

1488 56.

57.

58.

60.

61.

62.

63.

64.

65.

A. Garcia, M. Michel, S. Villarreal et al. Juan de Dios Hernández-Quintero, M. Humberto Reyes-Valdés, Dulce V. MendozaRodríguez, Martha Gómez-Martínez y Raúl Rodríguez-Herrera. (2015). Estudio de los cromosomas mitóticos y meióticos del sotol (Dasylirion cedrosanum Trel.). [Study of the mitotic and meiotic chromosomes of sotol (Dasylirion cedrosanum Trel.)]. YTON International Journal of Experimental Botany. 84(1):107-113 Mayra Alejandra Escobar-Saucedo, Raúl Rodríguez-Herrera, Alfonso Reyes-López, Marisol Cruz-Requena, Héctor Flores-Chávez, Cristóbal N. Aguilar. 2014. Análisis genético y bromatológico de siete mutantes de manzano (Malus domestica Borkh) del cultivar Golden Delicious. [Genetic and bromatological analysis of seven apple mutants (Malus domestica Borkh) from the cultivar Golden Delicious]. Ecosistemas y Recursos Agropecuarios 1(3):269-279. Aarón Casas Acevedo, Cristóbal Noé Aguilar González, Heliodoro De La Garza Toledo, Jesús Antonio Morlett Chávez, Didier Montet, Raúl Rodríguez Herrera. 2015. Importancia de las levaduras no-Saccharomyces durante la fermentación de bebidas alcohólicas. Investigacion y Ciencia 65(5):73-79.Muñiz-Marquez, D. M., Contrerasesquivel J.C., Rodriguez-Herrera R., Wong-Paz, J.E., Texeira A., Musato SI., Aguilar CN., 2015. Influence of thermal effect on sugars composition of Mexican Agave syrup. CyTA - Journal of Food, 13:4, 607-612 DOI. .org/10.1080/1947 6337.2015.1028452. Gabiela Macias de la Cerda, Fabiola Veana, Juan Carlos Contreras Esquivel, Cristóbal Noé Aguilar y Raúl Rodríguez Herrera. 2015. Cinética de crecimiento de Fusarium oxysporum cultivado en diferentes niveles de glucosa y pectina. [Growth kinetics of Fusarium oxysporum grown in different levels of glucose and pectin]. Revista Investigación y Ciencia (ACEPTADO). Mayela Govea-Salas, Ana Maria Rivas-Estilla, Raul Rodríguez-Herrera, Sonia A. Lozano-Sepúlveda, Cristobal N. Aguilar-Gonzalez, Alejandro Zugasti-Cruz, Tanya B. Salas-Villalobos and Jesus Antonio Morlett-Chávez. 2015. Gallic acid decreases hepatitis C virus expression through its antioxidant capacity. Experimental and Therapeutic Medicine. DOI: 10.3892/etm.2015.2923. Eduardo Osorio, Francisco Daniel Hernández Castillo, Raúl Rodríguez Herrera, Sostenes Edmundo Varela Fuentes, Benigno Estrada Drouaillet y José Alberto López Santillan. 2015. Actividad antagónica de trichoderma spp. sobre Rhizoctonia solani in vitro. [Antagonistic activity of trichoderma spp. about Rhizoctonia solani in vitro]. Revista Investigación y Ciencia (ACEPTADO). Francisco Castillo-Reyes, Francisco Daniel Hernández-Castillo, Julio Alberto ClementeConstantino, Gabriel Gallegos-Morales, Raúl Rodríguez-Herrera and Cristóbal Noé Aguilar. 2015. In vitro antifungal activity of polyphenols-rich plant extracts against Phytophthora cinnamomi Rands. Africa Journal of Agricultural Research. 10(50):45544560. Mónica L. Chávez-González, Lluvia I. López-López, Raúl Rodríguez-Herrera, Juan C. Contreras-Esquivel, Cristóbal N. Aguilar. 2015. Enzyme-assisted extraction of citrus essential oil. Chemical Papers. DOI: 10.1515/chempap-2015-0234. Pedro Aguilar-Zárate, Mario A. Cruz, Julio Montañez, Raúl Rodríguez-Herrera, Jorge E. Wong-Paz, Ruth E. Belmares, Cristóbal N. Aguilar, 2015. Gallic acid production under anaerobic submerged fermentation by two bacilli strains. Microbial Cell Factories. 14:209.

Genetics and Evolution of Entomopathogenic Fungi 66.

67.

68.

69.

70.

1489

De la Cruz R, Ascacio JA, Buenrostro J, Sepúlveda L, Rodríguez R, Prado-Barragán A, Contreras JC. Aguilera A, Aguilera CN. 2015. Optimization of ellagitannase producion by Aspergillus niger GH1 by solid-state fermentation. Preparative Biochem Biotechnol. 45(7). Pp 617-631. doi: 10.1080/10826068.2014.940965. Ascacio-Valdes, J.A., Aguilera-Carbo, A.F., Buenrostro, J.J., Prado-Barragan, A., Rodriguez-Herrera, R. Aguilar, C.N. 2015. The complete biodegradation pathway of ellagitannins by Aspergillus niger in solid-state fermentation. J. Basic Microbiol. 55, 1–8. Silvia Marina Gonzalez-Herrera, Olga Miriam Rutiaga-Quiñones, Cristobal Noe Aguilar, Luz Araceli Ochoa-Martínez, Juan Carlos Contreras-Esquivel, Mercedes G. Lopez, Raúl Rodríguez-Herrera. 2016. Dehydrated apple matrix supplemented with Agave fructans, inulin, and oligofructose. LWT - Food Science and Technology. 65:1059-1065. Miguel A. De León-Zapata, Lorenzo Pastrana-Castro, María Luisa Rua-Rodríguez, Olga Berenice Alvarez-Pérez, Raul Rodríguez-Herrera & Cristóbal N. Aguilar. 2016. Experimental protocol for the recovery and evaluation of bioactive compounds of tarbush against postharvest fruit fungi. Food Chemistry 198: 62–67. Dulce A. Flores-Maltos, Solange I. Mussatto, Juan C. Contreras-Esquivel, Raúl Rodríguez-Herrera, J.A. Teixeira, Cristóbal N. Aguilar 2016. Biotechnological production and applications of fructooligosaccharides Critical Reviews in Biotechnology. 36(2)18:1-9. doi:10.3109/07388551.2014.953443. Books

Aguilar, C.N., R. Rodríguez H., S. Saucedo P., D. Jasso C. 2008. Phyto-chemicals from Mexican semi-desert: from plant to natural chemicals and biotechnology. Ed. Path Design. Saltillo Coahuila México 579 p (in Spanish). Soto-Cruz, O., P.M. Ángel, A. Gallegos-Infante and R. Rodríguez-Herrera. 2008. Advances in Food Science and Food Biotechnology in Developing Countries. AMECA. Saltillo Coahuila México 330 p. Rodríguez H., R., O. Soto C., J.L. Martínez, C.N. Aguilar. 2009. Proteomes and Genomes in the XXI century: Environmental Biotechnology. Ed. Valle del Candamo, Monclova Coah. México 356 p. (in Spanish). Rodríguez Herrera, R., Aguilar González, C.N., Simpson-Williamson, J.K., Gutiérrez Sánchez, G.. 2011 Phytopathology in the omics era. Signpost Research. Kerlala India. 366p. ISBN 978-81-308-0438-5. Flores AC., González VM., Aguilar CN., Rodríguez R., 2014. Microbial Biofertilizers. Ed. Plaza y Valdes. 434p. ISBN: 978-607-402-177-1. Mexico (in Spanish).

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 68

MITOCHONDRIAL POPULATION GENETICS INFERENCES ABOUT THE PHYLOGEOGRAPHY AND SYSTEMATICS OF THE TAYRA (EIRA BARBARA, MUSTELIDAE, CARNIVORA) Manuel Ruiz-García1,, Nicolás Lichilín-Ortíz1, Yolanda Mejia1, Juan Manuel Ortega1 and Joseph Mark Shostell2 1

Laboratorio de Genética de Poblaciones-Biología Evolutiva, Unidad de Genética. Departamento de Biología, Facultad de Ciencias. Pontificia Universidad Javeriana, Bogotá DC, Colombia 2 Department of Math Science and Technology, University of Minnesota Crookston, Crookston, MN, US

ABSTRACT We sequenced the mitochondrial (mt) ND5 gene of 100 specimens of Eira barbara (Mustelidae, Carnivora). The samples represented six out of the seven putative morphological subspecies recognized for this Mustelidae species (E. b. inserta, E. b. sinuensis, E. b. poliocephala, E. b. peruana, E. b. madeirensis, and E. b. barbara) throughout Panama, Colombia, Venezuela, French Guiana, Brazil, Ecuador, Peru, Bolivia, Paraguay, and Argentina. The main results show that the genetic diversity levels for the overall samples and within each one of the aforementioned putative taxa were very high. The phylogenetic analyses showed that the ancestor of the Central and South-American E. barbara originated during the Miocene or Pliocene (6.3-4 millions of years ago, MYA). Furthermore, the ancestors of some geographical groups, (we detected at least four) originated during the Pliocene (3.7-2.5 MYA). These four groups (or lineages) were placed in the Cesar-Antioquia Departments (northern Colombia), Bolivia and northwestern 

Corresponding Author’s Email: [email protected], [email protected].

1492

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

Argentina, northern-central Peru, and in the trans-Andean area of Ecuador. However, during the Pleistocene, this species experienced a strong population expansion and many haplotypes expanded their geographical distributions. They became superimposed on the geographical areas of older geographical groups that originally differentiated during the Pliocene. Until new molecular studies are completed, including those with nuclear markers, we proposed the existence of only two subspecies of E. barbara (E. b. inserta in southern Central America, and E. b. barbara for all South America). All of the demographic analyses showed a very strong population expansion for this species in the last 400,000 YA during the Pleistocene.

Keywords: Tayra, Eira barbara, mitochondrial ND5 gene, putative geographical subspecies, genetic diversity, phylogeography, population expansion during the Pleistocene

INTRODUCTION Tayra (Eira barbara) is a Mustelidae (Carnivora, Mammalia) with a long, and slender body. Its length varies from 56 to 71 cm, not including a 37 to 46 cm long bushy tail. Its weight ranges from 2.7 to 7 kg with males larger than females. This species has short, dark brown to black fur that is relatively uniform across the body, limbs, and tail, except for a yellow or orange spot on the chest. The fur on the head and neck is much paler, typically tan or greyish in color. The head has small, rounded, ears, long whiskers and black eyes with a blue-green shine. The feet have toes of unequal length with tips that form a strongly curved line when held together. The claws are short and curved, but strong, being adapted for climbing and running rather than digging. This species occurs from southern Veracruz (Mexico) throughout Central America and across South America to northern Argentina save for the high Andes and the Caatinga and Cerrado (eastern Brazil; Emmons and Feer 1990). It is one of the most common medium-size predators throughout its range (Emmons and Feer 1990). E. barbara is a diurnal, sometimes crepuscular species (González-Maya et al., 2015), with a solitary behavior and large home range (Sunquist et al., 1989). Emmons and Feer (1990) showed that the tayra inhabits tropical and subtropical forests, secondary rain forests, gallery forests, gardens, cloud forests, and dry scrub forests. Hall and Dalquest (1963) affirmed that it can live near human disturbed habitats. It frequently occurs in agricultural areas and along the edge of human settlements. Tayra usually inhabits areas below 1,200 m, but there are reports of it being in areas as high as 2,400 m (Eisenberg 1989, Emmons and Feer 1990) and it is common at 2,000 m (Cuarón et al., 2016). Its diet is omnivorous, including fruits, carrion, small vertebrates, insects, honey and small vertebrates such as marsupials, rodents, and iguanids among others (Cabrera and Yepes 1960, Hall and Dalquest 1963, Emmons and Feer 1990). This species is listed as Least Concern (Cuarón et al., 2016). Cabrera (1957) and Hall (1981) recognized seven morphological subspecies, two in Central America and five in South-America: 1- E. b. senex (Thomas in 1900). The type locality is Hacienda Tortugas, Jalapa, Veracruz, Mexico; 2- E. b. inserta (Allen in 1908), with the type locality in Ulse, Matagalpa, Nicaragua; 3- E. b. sinuensis (Humboldt in 1812), with the type locality for the Sinu River in the Bolivar Department in northern Colombia; 4- E. b. poliocephala (Traill in 1821), with type locality Demerara in Guyana; 5- E. b. madeirensis (Lonnberg in 1913), with type locality in Humaitá, Madeira River, Brazilian Amazon; 6- E. b.

Mitochondrial Population Genetics Inferences …

1493

peruana (Nehring in 1886), with type locality in YuracYaku in the San Martin Department in Peru and 7- E. b. barbara (Linnaeus in 1758) with the type locality assigned by Lonnberg (1913) to Pernanbuco, Brazil. See Figure 1. Although it is a relatively common species, only one preliminary study on its molecular population genetics and infra-specific systematics has been published (Ruiz-García et al., 2013). Therefore, we expanded upon our initial molecular population genetics study with mitochondrial genes of the tayra with the following main aims: 1- To estimate the mitochondrial levels of genetic diversity in the overall tayra population and in some putative morphological subspecies; 2- To determine if there is a correlation between the molecular clades obtained in the phylogenetic analyses with the traditional putative morphological and geographical subspecies of tayras; 3- To estimate the possible temporal splits in the mitochondrial diversification within the evolution of the tayra; and 4- To determine if demographic evolutionary changes have characterized the natural history of the tayra.

MATERIALS AND METHODS Samples We sequenced 100 tayras at the mt ND5 gene. The samples came from 11 countries and represent seven of the eight putative morphological subspecies (Table 1 & Figure 1). They are: 1- Argentina, eight individuals (putative E. b. barbara); 2- Bolivia, 16 specimens (putative E. b. barbara); 3- Brazil, nine exemplars (four putative E. b. barbara; five putative E. b. madeirensis); 4- Colombia, 12 individuals (three putative E. b. madeirensis; nine putative E. b. sinuensis); 5- Ecuador, 27 specimens (four putative E. b. sinuensis; 23 putative E. b. madeirensis); 6- French Guiana, five exemplars (putative E. b. poliocephala); 7- Panama, one individual (putative E. b. inserta); 8- Paraguay, four specimens (putative E. b. barbara); 9Peru, 17 exemplars (nine putative E. b. peruana; eight putative E. b. madeirensis); 10- Trinidad and Tobago, one individual (putative E. b. poliocephala). Thus, these samples represent six out of the seven putative morphological subspecies recognized for this species. The DNA of some of the tayra individuals we analyzed was extracted from hairs obtained from animals found alive in diverse Indian communities throughout Central and South America. Another fraction of the DNA was obtained from skins, bones, and teeth of hunted individuals of E. barbara. We requested permission to collect biological materials from these skins, bones, and teeth that were already present in the Indian communities. In the case of the skins, we sampled 1-2 cm2. Communities were visited only once. All sample donations were voluntary, and no financial or other incentive was offered for supplying specimens for analysis. For more information about sample permissions, see the Acknowledgment section.

1494

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

Figure 1. Map with the approximate geographical distributions of the six putative geographical tayra’s subspecies (Eira barbara) sequenced at the mitochondrial ND5 gene. X represent localities where samples were obtained.

Molecular Analyses The DNA from skins and bones was extracted using the phenol-chloroform procedure (Sambrook et al., 1989), whereas DNA samples from hairs and teeth were extracted with 10% Chelex resin (Walsh et al., 1991). Primers and PCR conditions for the ND5 gene (265 bp) were brought to a volume of 25 l with 13.5 l of Mili-Q H2O, 3 l of MgCl2 1 mM, 1 l of dNTPs 0.2 mM, 1 l of each primer (0.1 M), 2.5 l of buffer 10X, and one unity of Taq Polymerase with 50-100 ng of DNA. We used the primers L12673 and H12977 (5’GGTGCAACTCCAAATAAAAGTA -3’ and 5´- AGAATTCTATGATGGATCATGT 3’; Waits et al., 1999). The PCR temperatures were 95° for 5 minutes followed by 10 cycles of 1 minute at 95°C, 1 minute at 64°C and 1.5 minute at 72°C, 25 cycles of 1 minute at 95°C, 1 minute at 60°C and 1.5 minute at 72°C and one final extension of 15 minutes at 72°C. All amplifications, including positive and negative controls, were checked in 2% agarose gels. Those samples that amplified were purified using membrane-binding spin columns (Qiagen). The PCR products were sequenced in both directions using the Big Dye™ kit in an ABI 377A automated DNA sequencer. A consensus of the forward and reverse sequences was determined using the Sequencher program. It is possible that some of the sequences represent numts (mitochondrial DNA fragments inserted into the nuclear genome) rather than true mtDNA (Chung and Steiper, 2008). However, we note that all amino acid translations of the obtained sequences showed the presence of initial start and terminal stop codons and the absence of premature stop codons. Protein translation was also checked to evaluate the possible presence of numts. Nevertheless, the mutations we observed were synonymous changes, thus suggesting that there were no numts in the sequences.

Mitochondrial Population Genetics Inferences …

1495

Table 1. Samples of taya (Eira barbara), by countries, localities and putative geographic subspecies, sequenced at the mitochondrial ND5 gene for this work Country Panama Colombia

Number of samples studied 1 12

Localities

Putative geographic subspecies E. b. inserta 9 E. b. sinuensis 3 E. b. madeirensis

Trinidad & Tobago French Guiana Ecuador

1

1 Chiriqui 2 Agustín Codazzi-Cesar 1 PNN Los Katios-Chocó 1 Zaragoza-Antioquia 1 Yarumal-Antioquia 1 PNN Tama, Norte de Santander 2 El Tuparro-Vichada 1 San Martín-Meta 1 Playa Blanca-Guainia 1 Puerto Arara-Amazonas 1 Leticia-Amazonas 1 Rio Claro

5

5 Camopi River

E. b. poliocephala

27

4 E. b. sinuensis 22 E. b. madeirensis

Peru

17

3 Yarinacocha-Pastaza 2 Sucua-Morona Santiago 2 La Perla-Santo Domingo de Tsáchilas 2 Miashi-Zamora 2 Pillaro-Tungurahua 2 Canelos-Pastaza 2 Sarayaku-Pastaza 1 Coca-Napo 1 Misahuallí-Napo 1 La Bonita-Napo 1 Macuma-Morona Santiago 1 Loreto-Napo 1 Hushafindi-Napo 1 Pichincha 1 Miazal-Morona Santiago 1 Yangana-Loja 1 Cononaco-Pastaza 1 Tinigua-Napo 1 Nuevo Rocafuerte-Napo 2 Iquitos-Loreto 1 Caballococha-Loreto 1 Nauta-Loreto 1 Luceropata-Loreto 1 Puerto Venus-Loreto 1 Lamas-San Martin 1 Moyobamba-San Martin 1 Rioja-San Martin 1 Nuevo Cajamarca-San Martin 1 Bagua Grande-Amazonas 1 Oxamarca-Cajamarca 1 Puerto Bermudez-Pasco

E. b. poliocephala

8 E. b. madeirensis 9 E. b. peruana

1496

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al. Table 1. (Continued)

Country

Number of samples studied

Bolivia

16

Brasil

9

Paraguay

4

Argentina

8

Localities 1 Bolognesi-Ucayali 1 Seshea-Ucayali 1 Manu-Madre de Dios 1 Marcapata-Cusco 3 Ballivian-Beni 1 Piso Firme-Beni 1 Nicolas Suarez-Pando 1 Sena-Pando 1 Franz Tamayo-La Paz 1 Coripata-La Paz 1 Cajuata-La Paz 1 Totora-Cochabamba 1 Pojo-Cochabamba 1 Vila vila-Cochabamba 1 Julpe River-Cochabamba 1 El Cerro-Santa Cruz 1 Puerto Pailas-Santa Cruz 1 San Jose de Chuiquitos-Santa Cruz 3 Foz de Iguazu-Parana 3 Novo Airao-Negro RiverAmazonas 1 Moora-Negro River-Amazonas 1 Paumari-Yavari River-Amazonas 1 Tres Rios-Rio de Janeiro 2 Los Cedrales 2 Loma Grande 2 Salta 1 Abra Pampa-Jujuy 1 Humahuaca-Jujuy 1 La Cocha-Tucuman 1 Burruyacu-Tucuman 1 El Dorado-Misiones 1 San Javier-Misiones

Putative geographic subspecies

E. b. barbara

4 E. b. barbara 5 E. b. madeirensis

E. b. barbara E. b. barbara

Data Analyses Genetic Diversity The statistics used to determine the genetic diversity in the overall tayra sample and within the five South American putative tayra subspecies were as follows: the haplotypic diversity (Hd), the nucleotide diversity (), the average number of nucleotide differences (K), and the statistic by sequence. These statistics were obtained using the DNAsp 5.1 software (Librado and Rozas, 2009).

Mitochondrial Population Genetics Inferences …

1497

Phylogenetics Analyses The sequence alignments were carried out manually as well as with the DNA Alignment program (Fluxus Technology Ltd.). MrModeltest v2.3 software (Nylander, 2004) and Mega 6.05 software (Tamura et al., 2013) were applied to determine the best evolutionary mutation model. The Akaike and Bayesian information criteria (AIC and BIC; Akaike, 1974; Schwarz, 1978) were used to determine the best evolutionary nucleotide model in the overall sequence set of E. barbara. Phylogenetic trees were constructed by using two procedures: Maximum Likelihood (MLT) and Bayesian analysis (BI). The ML trees were obtained using the RAxML v.7.2.6 software (Stamatakis, 2006). To select the best fitting model, 50 independent iterations were run using three data partitions (codon 1, codon 2, and codon 3). Additionally, 50 iterations were run using two data partitions (codons 1+2 combined, and codon 3). For each sequence data set, the GTR + G model (General Time Reversible + gamma distributed rate variation among sites; Tavaré, 1986) was used to search for the ML tree and topologic support was estimated with 500 bootstrap replicates using GTR. A BI tree was completed with the BEAST v. 1.8.1 program (Drummond et al., 2012). Four independent iterations were run using three data partitions (codon 1, codon 2, and codon 3) with six MCMC chains sampled every 10,000 generations for 30 million generations after a burn-in period of 3 million generations. We checked for convergence using Tracer v1.6 (Rambaut et al., 2013). We plotted the likelihood versus generation and estimated the effective sample size (ESS > 200) of all parameters across the four independent analyses to determine convergence and optimal results. The results from different runs were combined using LogCombiner v1.8.0 and TreeAnnotator v1.8.0 software (Rambaut and Drummond, 2013). A Yule speciation model and a relaxed molecular clock with an uncorrelated log-normal rate of distribution (Drummond et al., 2006) were used. Posterior probability values provide an assessment of the degree of support of each node on the tree. The tree was visualized in FigTree v. 1.4 software (Rambaut, 2012). This BI tree was used to estimate the time to most recent common ancestor (TMRCA) for the different nodes. We used a prior of 24.0 + 1 MYA (95% confidence interval: 26.24-22.36 MYA) for the split between the ancestors of Eira and one Procyonidae, as Potos flavus. This prior followed the results of Koepfli et al., (2008). Following Pennington and Dick (2010), the previous BI temporal estimates belong to one of two different approaches for inferring divergence times. The first approach is based on fossilcalibrated DNA phylogenies. The second approach is named “borrowed molecular clocks” and uses direct nucleotide substitution rates inferred from other taxa. For this second approach, we used a median joining network (MJN) with the help of Network 4.6.10 software from Fluxus Technology Ltd (Bandelt et al., 1999). The  statistic (Morral et al., 1994) was estimated and transformed into years of divergence among the haplotypes studied. To determine the temporal splits, it is necessary to estimate a mutation rate at the mt ND5 gene. We used a nucleotide divergence of 1.22% per each million years (Culver et al., 2000), which yielded one mutation each 309,310 years. This estimate was obtained for Felidae. In this work, we assumed that this mutation rate could be similar in Mustelidae. The networks are more appropriate for intraspecific phylogenies than tree algorithms because they explicitly allow for the co-existence of ancestral and descendant haplotypes, whereas trees treat all sequences as terminal taxa (Posada and Crandall, 2001).

1498

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

Heterogeneity Analyses Several procedures were carried out to estimate the genetic heterogeneity among the diverse putative tayra subspecies analyzed. To determine the overall genetic heterogeneity in E. barbara, we used the statistics GST, ST, NST and FST (Nei, 1973; Hudson et al., 1992). Additionally, we relied on the HST, KST, KST*, Z, Z*, and Snn tests (Hudson, 2000), and the chi-square test on the haplotypic frequencies with permutation tests using 10,000 replicates to measure genetic heterogeneity. Also, we estimated the genetic heterogeneity by subspecies pairs within E. barbara. For this task, we used three procedures: 1- Exact tests with Markov chains, 10,000 dememorizations parameters, 20 batches, and 5,000 iterations per batch; 2Indirect gene flow estimates (Nm) from the FST statistic with a n-dimensional island model (Slatkin, 1985; Ruiz-García, 1993, 1994, 1997, 1999; Ruiz-García and Álvarez, 2000); and 3Kimura 2P genetic distances (Kimura, 1980). These genetic heterogeneity statistics were completed with DNAsp 5.1 (Librado and Rozas, 2009) and Arlequin 3.5.1.2 (Excoffier and Lischer, 2010). Demographic Changes We relied on three procedures to detect possible historical population changes in the tayra: 1- We used the Strobeck's S statistic (Strobeck, 1987), Fu and Li D* and F* tests (Fu and Li, 1993), the Fu FS statistic (Fu, 1997), the Tajima D test (Tajima, 1989) and the R2 statistic (Ramos-Onsins and Rozas, 2002). A 95% confidence interval and probabilities were obtained with 10,000 coalescence permutations. 2- The mismatch distribution (pairwise sequence differences) was obtained following the method of Rogers and Harpending (1992) and Rogers et al., (1996). We used the raggedness rg statistic to determine the similarity between the observed and the theoretical curves. 3- A Bayesian skyline plot (BSP) was obtained by means of the BEAST v. 1.8.1 and Tracer v1.6 software. The Coalescent-Bayesian skyline option in the tree priors was selected with four steps and a piecewise-constant skyline model with 30,000,000 generations (the first 3 million discarded as burn-in), kappa with log Normal [1, 1.25] and Skyline population size with uniform [0, infinite; initial value 80]. In the Tracer v1.6, the marginal densities of temporal splits were analyzed and the Bayesian Skyline reconstruction option was selected for the trees log file. A stepwise (constant) Bayesian skyline variant was selected with the maximum time as the upper 95% high posterior density (HPD) and the trace of the root height as the treeModel.rootHeight. To determine the time range for possible demographic changes for E. barbara, we consider that the evolution of this taxon occurred during the last 4 MY.

RESULTS Genetic Diversity and Phylogenetic Inferences The BIC showed that the best nucleotide substitution model was T92 + G (7,649.51). In contrast, the AIC detected GTR + G + I (5,881.29) as the best model. The genetic diversity levels in the overall studied sample of tayra were very high. For the 100 individuals analyzed, we found 70 different haplotypes with Hd = 0.983 + 0.006,  = 0.0422 + 0.0048 and k = 11.175 + 5.117. The genetic diversity for four out of five South American putative morphological subspecies were very similar, all of them with very high genetic

Mitochondrial Population Genetics Inferences …

1499

diversity levels (Hd = 0.991-0.960 and  = 0.0562-0.0308). The genetic diversity of E. b. poliocephala was somewhat lower (Hd = 0.600 and  = 0.0176), although the sample size for this putative subspecies was the lowest (Table 2). The MLT and BI can be seen in Figures 2 and 3. Both phylogenetic trees showed that the first diverging branch represented the animal sampled in northcentral Panama (putatively, E. b. inserta) (MLT: low bootstrap 28%; BI: p = 1). All of the South American specimens we analyzed were placed in the remaining cluster. However, although putatively animals from five different subspecies were included, very few significant clades were observed, and only partially related to the morphological subspecies. The first diverging cluster in the South American animals was one composed by three animals from northern Colombia (Cesar and Antioquia Departments; 50% and p = 0.97, respectively), which corresponded with the putative E. b. sinuensis. Nevertheless, a Bolivian exemplar and many other specimens “a priori” classified as E. b. sinuensis by their geographical origins that did not belong to this cluster, were present in the BI, within this clade. Henceforth, there was only a partial correspondence between this clade and E. b. sinuensis. There were other interesting clades in both phylogenetic trees. 1- One was composed of three individuals from the Pacific area of trans-Andean Ecuador (61% and p = 1, respectively), which also partially corresponded with E. b. sinuensis; 2Another cluster was composed of individuals from different areas of Bolivia and mainly by individuals from northwestern Argentina (Salta, Jujuy and Tucuman provinces) in MLT (41%). In the BI, this group was only composed of five individuals from northwestern Argentina (p = 0.96). This cluster was partially correlated with E. b. barbara. In the BI there was another cluster with several Bolivian and Argentinian specimens (p = 0.84). It was separated from the first Argentinian cluster we aforementioned. However, as we commented for E. b. sinuensis, this relationship was incomplete because other individuals “a priori” classified as E. b. barbara were dispersed by other clusters; 3- Another cluster of certain relevance was detected in the MLT and BI. It was composed of individuals of central Peru and one individual from the northern Peruvian Amazon (80% and p = 0.72, respectively). This cluster also partially supported the existence of the morphological subspecies E. b. peruana; 4- Small clusters of animals from the Ecuadorian and Colombian Amazon were present. One of them contained two animals from the Ecuadorian and Colombian Amazon (62% and p = 1, respectively) and other three from the Ecuadorian Amazon (73% and p = 1; 89% and p = 1; 28% and p = 0.8, respectively). These very locally restricted clusters were inside the putative morphological subspecies, E. b. madereinsis. Many other individuals of E. b. madereinsis were distributed in clusters with other individuals “a priori” considered different morphological subspecies. Table 2. Genetic diversity in the overall sample of Eira barbara and in the five putative South American morphological subspecies at the mt ND5 gene represented by the number of haplotypes (NH), the haplotype diversity (Hd), the nucleotide diversity (), and the average number of nucleotide differences (K) Eira barbara taxa Overall Sample E. b. sinuensis E. b.poliocephala E. b. peruana E. b. madeirensis E. b. barbara

NH 70 12 14 13 26 25

Hd 0.983 + 0.006 0.987 + 0.065 0.600 + 0.147 0.989 + 0.063 0.960 + 0.009 0.991 + 0.012

 0.0422 + 0.0048 0.0562 + 0.0311 0.0176 + 0.0093 0.0517 + 0.0299 0.0308 + 0.0071 0.0412 + 0.0092

K 11.175 + 5.117 14.884 + 8.344 4.667 + 2.556 13.703 + 7.324 8.162 + 3.233 10.928 + 4.111

1500

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

Figure 2. (Continued).

Mitochondrial Population Genetics Inferences …

Figure 2. (Continued).

1501

1502

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

Figure 2. Maximum likelihood tree with the 100 specimens of tayra (Eira barbara) sequenced at the mitochondrial ND5 gene. The number in the nodes are the bootstrap percentages. The procyonidae, Potos flavus, was employed as outgroup. In different colors, some relevant clusters which showed a limited correspondence with some putative morphological geographic subspecies of E. barbara.

Mitochondrial Population Genetics Inferences …

Figure 3. (Continued).

1503

1504

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

Figure 3. (Continued).

Mitochondrial Population Genetics Inferences …

1505

Figure 3. Bayesian tree with the 100 specimens of tayra (Eira barbara) sequenced at the mitochondrial ND5 gene. The three numbers in the nodes are the posteriori probabilities, estimated temporal splits in the nodes in millions of years, and the 95% high posterior density of these temporal splits. The procyonidae, Potos flavus, was employed as outgroup. In different colors, some relevant clusters which showed a limited correspondence with some putative morphological geographic subspecies of E. barbara.

The BI temporal split estimate showed an initial divergence of the ancestors of the Panamanian individual (E. b. inserta) and South-American specimens around 6.26 MYA (95%: 5.4-8.49 MYA; Miocene divergence). The ancestor of the clade from northern Colombia split around 3.7 MYA (1.55-6.37 MYA). The ancestor of the animals from northwestern Argentina diverged around 3.15 MYA (1.01-4.23 MYA). In contrast, the ancestors of animals of northcentral Peru, trans-Andean Ecuador and one of the Ecuadorian Amazonas clusters diverged 2.88 MYA (1.23-4.2 MYA), 2.35 MYA (0.31-2.7 MYA), and 1.49 MYA (0.42-3.74 MYA), respectively.

1506

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

Figure 4. Median Joining Network (MJN) for the haplotypes detected in 100 tayra (Eira barbara) sequenced at the mitochondrial ND5 gene. In light blue, one haplotype of E. b. inserta; in pink, haplotypes of E. b. barbara; in green, haplotypes of E. b. peruana; in yellow, haplotypes of E. b. madeirensis; in black, haplotypes of E. b. sinuensis; and in brown, haplotypes of E. b. poliocephala. Therefore, the five putative geographical subspecies of South American tayras and one Central America subspecies were represented in this analysis. Little red circles are extinct or not found haplotypes.

The MJN analysis revealed a view very similar to the phylogenetic trees (Figure 4). The major fraction of haplotypes were distributed irrespective of the geographical distribution of the morphological subspecies. For instance, the most frequent haplotypes (H1, H30, H7, H49, H19 and H9) included individuals of different putative subspecies: H1 contained exemplars classified “a priori” as madereinsis, sinuensis and barbara; H30 and H7 were composed of madereinsis and peruana individuals; H49 enclosed individuals of sinuensis; H19 consisted of specimens of sinuensis, peruana, madereinsis, and barbara, whilst H9 included poliocephala and peruana. Therefore, some haplotypes were widely distributed, which agrees quite well with extensive gene flow of this species across all of South America. Many of these main haplotypes presented other small haplotypes in star-like form, which is highly related to possible population expansions across the entire South American range of the tayra. Nevertheless, the MJN, as the phylogenetic trees, detected some haplotype clusters to be well delimited geographically. For example, there were the cases of the Central American individual (H66),

Mitochondrial Population Genetics Inferences …

1507

the Cesar-Antioquia cluster (H65, H67, and H68), the trans-Andean Ecuadorian cluster (H45, H63, and H64), and the central Peruvian cluster (H11, H13, H18, and H20). The MJN temporal splits were slightly less than that those obtained with BI, but relatively similar. The temporal splits among these haplotypes and the main groups can be seen in Table 3. Some of these time splits are interesting. The divergence between the Panamanian individual and H7 was estimated to occur around 4.02 + 0.31 MYA. The temporal divergence between clusters from the areas of northwestern Argentina, Cesar-Antioquia area (northern Colombia), trans-Andean Ecuador, and north-central Peru in reference to H7 were 3.73 + 0.65 MYA, 3.29 + 0.57, 1.04 + 0.31 MYA, and 2.89 + 0.47 MYA, respectively. Therefore, the phylogenetics tree and the MJN analyses showed that the ancestor of Central and South American tayras originated during the Miocene or Pliocene. Also, the ancestors of some geographical groups, at least four of certain relevance, originated during the Pliocene and first part of the Pleistocene. However, during the Pleistocene (as we will show later), tayra experienced a strong population expansion and many haplotypes expanded their geographical distributions. They superimposed onto the geographical areas of these older and geographical groups that originally differentiated during the Pliocene.

Genetic Distances and Genetic Heterogeneity among Putative Morphological Subspecies of Eira barbara The Kimura 2P genetic distances among all of the comparison pairs of the six putative morphological subspecies of tayra are shown in Table 4. The differentiation between the Central American subspecies (E. b. inserta) and the five South American subspecies was elevated (5.5% - 7.8%), which confirmed that the Central America taxon is, at least, a different subspecies. It is interesting to note that the less differentiated South American taxon with regard to the Central American one was E. b. sinuensis (5.5%). It was the South American taxon closest geographically. The genetic distances with the other four South American taxa ranged from 7.1%-7.8%. In contrast, the genetic distances among the five South American subspecies were very small. They ranged from 0.1% to 1.2%. The pairs of subspecies with the greatest genetic distances were E. b. poliocephala-E. b. sinuensis (1.2%) and E. b. poliocephala-E. b. barbara (0.9%). The overall genetic heterogeneity for all five South American tayra subspecies taken together was significant (Table 5), but the genetic heterogeneity was relatively small. For example, the FST and the ST statistics showed values of 0.095 and 0.109, respectively. Their respective gene flow estimates of 4.75 and 4.10, were relatively high among the putative SouthAmerican subspecies. The analysis of subspecies pair comparisons with exact probability tests (Table 6) only showed two significant pairs: E. b. madereinsis-E. b. barbara (p = 0.0066 + 0.0017) and E. b. madereinsis-E. b. poliocephala (p = 0.0135 + 0.0034). In this analysis, the Central American taxon was deleted because only one sequence was analyzed. The estimates of Nm by subspecies pair comparisons (Table 7) clearly yielded that the values lower than 1 (which is considered the limit for low gene flow; Wright, 1943) always implied the Central American taxon: E. b. inserta-E. b. peruana (Nm = 0.584), E. b. inserta-E. b. barbara (Nm = 0.459), E. b. inserta-E.

1508

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

b. madereinsis (Nm = 0.286), E. b. inserta-E. b. poliocephala (Nm = 0.137). Only a South American taxon, E. b. sinuensis, (Nm = 1.202) had a more substantial gene flow with E. b. inserta. This agrees quite well with that determined in the phylogenetic trees and in the genetic distance analysis. The gene flow estimates among the South American taxa were all above 1, ranging from 2.469 to 11.847. These values strongly correlate to elevated historical gene flows among the populations of tayra throughout South America. Table 3. Temporal splits among different Eira barbara’s lineages estimated by means of a Median Joining Network (MJN). Values of temporal splits are in millions of years. SD = Standard deviation Lineages compared

 + SD

Between the Panamanian haplotype (inserta) and H49 (sinuensis) Between the Bolivian and northern-western Argentinian haplotypes and H7 (madereinsis, peruana) Between the Cesar-Antioquia (northern Colombia) haplotypes and H7 (madereinsis, peruana) Between the trans-Andean Ecuadorian haplotypes and H7 (madereinsis, peruana) Between the northcentral Peru and H7 (madereinsis, peruana) Between H9 (poliocephala, peruana) and H19 (sinuensis, peruana, madeirensis, barbara) Between H9 (poliocephala, peruana) and H7 (madereinsis, peruana) Between H19 (sinuensis, peruana, madeirensis, barbara) and H7 (madereinsis, peruana) Between H49 (simuensis) and H7 (madereinsis, peruana) Between H30 (sinuensis) and H7 (madereinsis, peruana) Between H9 (poliocephala, peruana) and H1 (madeirensis, sinuensis) Between H19 (sinuensis, peruana, madeirensis, barbara) and H1 (madeirensis, sinuensis) Between H49 (sinuensis) and H1 (madeirensis, sinuensis) Between H7 (madereinsis, peruana) and H1 (madeirensis, sinuensis) Between H30 (sinuensis) and H1 (madeirensis, sinuensis)

13.000 + 1.000

Temporal divergence 4.021 + 0.309

12.077 + 2.097

3.735 + 0.648

10.625 + 1.829

3.286 + 0.565

3.375 + 1.008

1.043 + 0.311

9.333 + 1.523

2.886 + 0.471

1.000 + 0.500

0.309 + 0.154

1.363 + 0.454

0.422 + 0.140

0.454 + 0.454

0.141 + 0.141

1.429 + 0.714

0.441 + 0.220

0.625 + 0.625

0.193 + 0.193

2.400 + 0.600

0.742 + 0.185

1.200 + 0.600

0.371 + 0.185

2.454 + 0.818 0.643 + 0.643

0.759 + 0.253 0.198 + 0.198

1.500 + 0.790

0.463 + 0.231

Mitochondrial Population Genetics Inferences …

1509

Table 4. Kimura 2P genetic distance (Kimura, 1980) in percentages (%) among six different morphological subspecies of Eira barbara (Mustelidae) (below main diagonal) and standard deviations in percentages (%) (above main diagonal) at the mt ND5 gene. 1 = E. b. barbara; 2 = E. b. peruana; 3 = E. b. madeirensis; 4 = E. b. poliocephala; 5 = E. b. sinuensis; 6 = E. b. inserta; 7 = Potos flavus (Procyonidae) 1 1 2 3 4 5 6 7

0.2 0.2 0.9 0.3 7.1 27.5

2 0.1 0.1 0.5 0.5 7.7 27.5

3 0.1 0.1

4 0.4 0.2 0.4

0.8 0.4 7.4 28.5

5 0.1 0.1 0.1 0.5

1.2 7.8 24.6

5.5 26.5

6 1.4 1.5 1.5 1.5 1.2

7 3.5 3.5 3.7 3.2 3.5 3.5

24.9

Table 5. Overall genetic heterogeneity and gene flow (Nm) statistics for the five putative South American subspecies of Eira barbara at the mt ND5 gene. * P < 0.05; ** P < 0.01 Estimated Genetic Differentiation 2 = 313.351 df = 272 HST = 0.0236 KST = 0.0559 KST* = 0.0362 ZS = 2279.890 ZS* = 7.360 Snn = 0.511

P

Gene flow

0.0429* 0.0001** 0.0001** 0.0001** 0.0001** 0.0001** 0.0001**

GST = 0.0336 γST = 0.0951 NST = 0.1108 FST = 0.1086

Nm = 14.40 Nm = 4.75 Nm = 4.01 Nm = 4.10

Table 6. Exact probability tests (P) (below main diagonal) and standard deviations (above main diagonal) among six different putative morphological subspecies of Eira barbara by means of the mt ND5 gene. 1 = E. b. barbara; 2 = E. b. peruana; 3 = E. b. madeirensis; 4 = E. b. poliocephala; 5 = E. b. sinuensis; 6 = E. b. inserta. * = Significant probability 1 1 2 3 4 5 6

1.0000 0.0066* 0.2307 0.4044 ---------

2 0.0000 0.0679 0.3472 0.4796 ----------

3 0.0017 0.0071 0.0135* 0.1032 ----------

4 0.0138 0.0132 0.0034 0.0893 ---------

5 0.0197 0.0088 0.0201 0.0036 -----------

6 ----------------------------------------

1510

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

Demographic Evolutionary Changes in the Tayra All of the demographic change statistics indicated population expansion in the tayra (Strobeck's S statistic, P = 0.0001; Tajima D = -2.258, p = 0.0040; Fu & Li D* = -3.175, p = 0.0115; Fu & Li F* = -3.335, P = 0.0052; Fu’s Fs = -52.632, P = 0.00001; and R2 = 0.037, P = 0.0041). Table 7. Gene flow (Nm) estimates (below main diagonal) among six different putative morphological subspecies of Eira barbara by means of the mt ND5 gene. 1 = E. b. barbara; 2 = E. b. peruana; 3 = E. b. madeirensis; 4 = E. b. poliocephala; 5 = E. b. sinuensis; 6 = E. b. inserta

1 2 3 4 5 6

1

2

3

4

5

9.8245 9.2893 2.6879 7.1919 0.4597

11.8471 5.3236 5.8729 0.5843

2.2686 4.8435 0.2862

2.4691 0.1373

1.2019

6

Figure 5. Historical demographic analysis by means of the mismatch distribution procedure (pairwise sequence differences) for the mitochondrial ND5 gene studied in the overall sample of Eira barbara. The analysis showed a clear population expansion of this species during the Pleistocene.

The mismatch distributions also indicated population expansion (rg = 0.0040, P = 0.00280) (Figure 5). Assuming one year as one generation in the tayra, the population expansion began 343,586 YA, during the Pleistocene. The BSP analyses also determined a strong female population expansion during the Pleistocene for the tayra (Figure 6). The analyses showed the beginning of the expansion around 400,000 YA, very similar to the temporal estimate previously showed. Therefore, there is incontrovertible evidence that the tayra experienced a strong population expansion during the Pleistocene, as was previously suggested by the MJN analysis.

Mitochondrial Population Genetics Inferences …

1511

Figure 6. Bayesian skyline plot analysis (BSP) to determine possible demographic changes across the natural history of the overall sample of tayra (E. barbara) sequenced at the mitochondrial ND5 gene. The analysis showed a clear female population expansion during the Pleistocene. On the x-axis, time in millions of years; on the y-axis, log effective population size of females.

DISCUSSION Genetic Diversity The levels of nucleotide diversity found in E. barbara ( = 0.0422) were quite high. They were higher than those found in many other neotropical carnivores. For example, they were higher than three fox species (Lycalopex culpaeus:  = 0.008, Ruiz-García et al., 2013a; Lycalopex sechurae:  = 0.015, Ruiz-García et al., 2013a; Cerdocyon thous:  = 0.019, Tchaika et al., 2006), three otter species (Lontra felina:  = 0.005, Vianna et al., 2010; Lontra longicaudis:  = 0.011, Ruiz-García et al., 2017a; Pteronura brasiliensis: = 0.0086, RuizGarcía et al., 2017a), and two vulnerable Neotropical cats (Leopardus jacobita:  = 0.0047, Ruiz-García et al., 2013b; Leopardus guigna:  = 0.00461, Napolitano et al., 2013). The values of E. barbara were similar to those found in certain Neotropical cats, which are characterized by very elevated genetic diversity levels (Puma yaguaroundi:  = 0.0661; Ruiz-García and Pinedo-Castro, 2013 and Ruiz-García et al., 2017b; Leopardus pajeros:  = 0.0513, RuizGarcía et al., 2013b; Leopardus pardalis:  = 0.068, Eizirik et al., 1998; Leopardus wiedii:  = 0.035-0.074, Ruiz-García et al., 2017c). These high levels of genetic diversity in “a priori” neutral markers, as that we studied, could be related with the fact that many other genes in the genome of a given species contains enough variability for the action of natural selection (Kimura, 1986). This could be the origin of the great morphological variation and behavior plasticity found in the tayra. Emmons and Freer (1990) determined that tayras could live in a wide variety of habitats such as tropical and subtropical forests, primary rain forest (as throughout the Amazonian forest in Brazil, Peru,

1512

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

Colombia and Ecuador), secondary rain and gallery forests (as in the Llanos of Venezuela and Colombia), gardens, plantations, and cloud forests. They also inhabit dry scrub and deciduous forests (as in the Pantanal in Brazil, Paraguay and Bolivia) and tall grass savannas (as in Argentina, Bolivia, and Paraguay). Sunquist et al., (1989) showed that the extreme plasticity of this species for habitat preferences, activity periods, and diet preferences may reduce interspecific competition between E. barbara and other carnivores. This could also be the explanation why Konecny (1989) found no significant habitat preference for this mustelid in Belize. The abundance of the tayra throughout much of Central and South America may be a consequence of its ecological flexibility compared to sympatric carnivores. Associated with this, the tayra is a generalist predator, consuming a variety of fruits, carrion, small and medium vertebrates, insects, and honey (Cabrera and Yepes, 1960; Galef et al., 1976; Hall and Dalquest, 1963; Konecny, 1989; Sunquist et al., 1989).

Genetic Heterogeneity, Gene Flow and the Systematics of the Tayra Our results clearly showed that the specimen sampled in Central America was highly divergent from all of the individuals sampled in South America. However, the genetic heterogeneity among the putative morphological subspecies of South American tayras, although significant, is very small as we found with the FST statistic, exact probability tests, and genetic distances. The indirect gene flow estimates were clearly higher than 1. Wright (1943) stated that in an island model, if Nm > 1, then gene flow is important enough to erase the genetic heterogeneity among populations. In a stepping-stone model, this amount must be larger than 4 (Trexler, 1988). In both models, Nm < 0.5 means that the populations are highly disconnected from a reproductive point of view. For instance, the gene flow estimates between E. b. inserta and E. b. poliocephala (Nm = 0.137), E. b. inserta and E. b. madereinsis (Nm = 0.286) and E. b. inserta and E. b. peruana (Nm = 0.459) showed that the Central American taxon is completely isolated from these three South American taxa. However, recall that certain genetic relatedness was detected between the Central American taxon and the most northern South American taxon (E. b. sinuensis). Additionally, we found several gene flow comparison pairs between South American taxa, such as E. b. madereinsis-E. b. barbara (Nm = 9.289) and E. b. madereinsis-E. b. poliocephala (Nm = 2.168). They were elevated, although these comparison pairs showed significant heterogeneity. This might be explained according to Alledorf and Phelps (1981), who argued that the most correct interpretation of Nm > 1 is that the populations share the same alleles, although not necessarily with the same allele frequencies. By means of simulations, these authors showed that significant allele divergence occurred in 50% of the generations with a gene flow of Nm = 50. Significant allele divergence happened on most occasions when Nm = 10. The tayra seems to have a strong dispersion capacity, which could be related with these high gene flow estimates detected for all the putative South American subspecies. For instance, in the Venezuelan and Colombian Llanos, tayras are usually found along gallery forests. However, tayras cross these extensive grasslands at night, presumably moving from one forest to another covering long distances (Defler, 1980). Taking into consideration all these facts, we suggest that the six putative morphological subspecies analyzed could be reduced to two different subspecies: E. b. inserta for southern Central America and E. b. barbara for all South America. The name should be E. b. barbara

Mitochondrial Population Genetics Inferences …

1513

because it was given by Linneus in 1758 versus E. b. sinuensis given by Humboldt in 1812, E. b. peruana given by Nehring in 1886, E. b. madeirenis given by Lonnberg in 1913 and E. b. poliocephala given by Traill in 1821. In reference to the putative northern Central America subspecies (E. b. senex), we cannot add any comment on its systematics because no individual of this putative subspecies was analyzed. Therefore, it is essential to sample tayras from this putative subspecies to determine its relationships with other tayra taxa. Here we suggest another alternative point of view. As we showed, the first tayra’s splits originated during the Miocene-Pliocene and beginning of the Pleistocene. However, during the Pleistocene, tayra experienced a strong population expansion and many haplotypes expanded their geographical distributions and they became superimposed on the geographical areas of older geographical groups that originally differentiated during the Pliocene. We suggest that future studies analyze nuclear genes to determine if there was hybridization between the older geographical groups (northern Colombia, part of Bolivia and northwestern Argentina, transAndean area of Ecuador, and north-central Peru) and the tayra’s population that expanded throughout South America during the Pleistocene. If data support this, then our view of a unique tayra’s subspecies in South America should be valid. On the contrary, if there was little or no hybridization between the original groups and Pleistocene colonizers in sympatry, then the number of subspecies in South America could be higher. Therefore, the northern Colombian population (Cesar, Antioquia and possibly nearby areas) should be named E. b. sinuensis and the northern central Peruvian population should be named E. b. peruana. Also, the Bolivian and especially the northwestern Argentinian population should be defined as a new subspecies (tentatively E. b. saltensis). The trans-Andean Ecuadorian population should be defined as a new subspecies (tentatively E. b. aequatorialis). The remaining populations of tayra in South America should be named as E. b. barbara. Additionally, the range distribution of E. b. sinuensis and E. b. peruana should be more restricted than traditionally accepted (see Presley, 2000). Even, if some reproductive isolation mechanism had emerged between the Central and the South America tayras due to the old split estimated during the Miocene-Pliocene, both tayra populations should be consider two different species (E. barbara and E. inserta; this last should be E. senex if both Central American forms of tayra were genetically undifferentiated because senex was firstly named by Thomas in 1900 and inserta was named by Allen in 1908). Only future nuclear genetic studies can clarify which of the two points of view is more acceptable.

Temporal Splits in the Tayras Our results showed that the divergence between the Central and the South American tayras occurred around 6.3 to 4 MYA (Miocene or Pliocene periods depending of the temporal estimation). Johnson and O´Brien (1997) and Johnson et al., (2006) showed that seven of the eight primary lineages of felids radiated in the early part of the Late Miocene (10.8-6.2 MYA). There was a noteworthy cooling of the global climate near the end of the Middle Miocene. This period of cooling coincides with formation of a permanent Antarctic ice sheet in the Middle and in the Late Miocene and an Arctic ice sheet in the Pliocene. A large peak of diversification in many vertebrate taxa occurred during the Pliocene epoch. The cold and dry climate during the Pliocene, coincides with the onset of high latitude glacial cycles, causing an explosive expansion of low-biomass vegetation, including grasslands and steppe at mid-latitudes and

1514

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

development of taiga at high latitudes of Eurasia and North America. These changes were correlated with the diversification of prey species such as muroid rodents and passerine birds that exploited these new habitats, which in turn provided new niches for little or medium carnivores, such as the tayra. Additionally, this Pliocene period agrees quite well with the last phase of rising of the Andes as shown by Dollfus (1974) and Clapperton (1993) (see, for instance, the rising of the “tablazos” of Piura, Peru) and very high volcanic activity in the Andes, with replacement of rainforests with steppe and grassland environments. Our initial divergence estimates in the tayra agrees relatively well with other molecular studies in the reconstruction of the phylogenetic relationships in the Mustelidae (Bryant et al., 1993; Dragoo and Honeycutt, 1997; Koepfli and Wayne, 1998, 2003; Sato et al., 2003, 2004; Flynn et al., 2005; Fulton and Strobeck, 2006; Koepfli et al., 2008). Two molecular studies are fundamental to understanding the phylogenetics of the Mustelidae (Koepfli and Wayne, 2003; Koepfli et al., 2008). In the first study, the authors used five nuclear gene segments and the mt Cyt-b gene. The genes APOB, FES, GHR, RH01 and mtCyt-b clustered E. barbara together with Martes americana, Martes pennanti and Gulo gulo. On the other hand, CHRNA1 clustered E. barbara with Meles meles and Arctonyx collaris. The major part of the trees generated by these authors showed that Mustelinae and Melinae were polyphyletic within the Mustelidae, whereas Lutrinae was monophyletic. The authors of the second study analyzed 22 nuclear and mitochondrial gene segments and determined Mustelidae to consist of seven primary groups. These groups include four major clades and three monotypic lineages. It also included Eira barbara clustered into the subfamily Martinae, together with Martes and Gulo, the most divergent taxa within this subfamily (100% of bootstrap and posterior probability of 1). In that study, the branch of E. barbara diverged from the other Mustelidae around 6.7-7.7 MYA (calculated using the mean values), which agrees with our estimate. These molecular results are not in conflict with the fossil record we know and understand for Mustelidae in America. Many species of Mustelidae appeared in North America during the Late Miocene-Early Pliocene. For instance, Cernictis hesperus, from the Pinole Tuff Local Fauna of California, has been dated radiometrically to have lived 5.3-5.5 MYA (Tedford et al., 2004; Baskin, 2011). Other cases of extinct genera appearances are Trogonictis and Sminthosinis as well as extant genera such as Lutra and Mustela during the Hemphilian period (4.7-5.9 MYA, Tedford et al., 2004). There is also Legionarictis fortidens from the Barstovian (Middle Miocene) marine Temblor Formation in California (Tseng et al., 2009). This form has shown a very close resemblance to other Miocene Mustelidae genera such as Dehmictis, Eirictis, Iberictis, and Trochictis, all from the Old World. The form also closely resembles Sminthosinis, Trigonictis (all from the New World), and, especially, with two extant genera, Galictis and Eira (Ray et al., 1981; Ginsburg and Morales, 1992; Baskin, 1998; Ginsburg, 1999). In fact, the cladistic analysis of Tseng et al., (2009) determined that this genus could be an evolutionary basal stage closely related to Eira. At the Longdan Fauna of the Gansu Province in China, a similar fossil to Eira was found by Qiu et al., (2004) from the Late Pliocene (Eirictis robusta; 2.58-2.15 MYA). However, the cladistic analysis of Tseng et al., (2009) determined that this mustelid was not very close to Eira and it is probably younger than Eira. Two possible fossil species of Eira have been described from post-Pliocene deposits of Maryland and Virginia under the names Galera macrodon and G. perdicida. However, the former has been assigned to Trigonictis based on additional material collected from deposits of the Blancan land mammal age from Washington, Idaho, Nebraska, Kansas, Texas, North Carolina, and Florida (Ray et al., 1981). Trigonictis is considered an intermediate form between Galictis and Eira

Mitochondrial Population Genetics Inferences …

1515

and could be ancestral to both. The second species may be Mephitis (Alston, 1882). In addition, extinct species of Eira were noted from the Pliocene of the Eastern Hemisphere, but specific names were not given (Scott, 1937). Hershkovitz, (1972) claimed that Eira and other endemic monotypic mustelid genera, such as Lyncodon and Pteronura, may have evolved in South America and moved north as part of the north and south American interchange across the Panamanian land bridge. In contrast, fossil records suggest that Eira may have a North American origin (Ray et al., 1981). Therefore, the process of diversification within Eira could be at the end of the first mustelid diversification peak or at the beginning of the second mustelid diversification peak detected by Koepfli et al., (2008). In either case, this mitochondrial diversification process occurred before the Panamanian land bridge (3-2.5 MYA). Therefore, Eira’s could have radiated in North America before South America in concordance with the fossil record (Ray et al., 1981) and against the view of Hershkovitz (1972). If so, tayras arrived in South America before the complete formation of the Panamanian land bridge, coinciding with the Choco-Panama island bridge (Galvis, 1980), which could have been used by the ancestors of the current E. barbara to colonize northern South America from Central America. During the upper Pliocene orogeny, the present Tuira, Atrato and Sinu river basins and the nearby lowlands were raised above sea level. Thus, the mountains of southern Central America and of the northern Andes were uplifted to about their present elevation (Van der Hammen, 1961). Although the Nicaraguan, Panamanian and Colombian portals remained open (upper Miocene-middle Pliocene), numerous volcanic islands existed from the lower Atrato Valley and the Tuira River Basin of eastern Panama to the Nicaraguan portal. They could have been used by Eira’s ancestor to migrate southward. The Cuchillo Bridge of the Uraba region, connecting the Tertiary Western Colombian Andes with the Panamanian islands was probably above sea level during this period. Henceforth, tayras could be another “island hopper” species (Simpson 1950, 1965, 1980). Our results could also be considered as indirect evidence of a Miocene origin of the Isthmus of Panama (Montes et al., 2012, 2015). Indeed, the Isthmus of Panama formation began earlier and seems to be associated with the Northern Andean uplift, around 24 MYA (Farris et al., 2011). Therefore, the tayra could have arrived in South America before other Mustelidae. Koepfli et al., (2008) claimed that genera and species of mustelids found in South America today are largely descended from North American immigrants that arrived as part of the GABI following the rise of the Panamanian isthmus, 3.0-2.5 MYA. Several informational points support the statement of Koepfli et al., (2008). 1-For example, there is the clade of New World otters where Lutra canadensis is sister to Lontra felina, and Lontra longicaudis. The latter two species are found in South America and are estimated to have diverged 2.8–3.4 MYA (95% HPD: 1.6–5.2 MYA) overlapping with the formation of the Panamanian land bridge. 2-The long-tailed weasel, Mustela frenata, ranges from North America to northern South America. In addition, Mustela africana and Mustela felipei are endemic to South America. Fossil evidence clearly indicates that Mustela colonized South America from the north, apparently well after the Panamanian isthmus was in place. 3- Fossils of the current Lyncodon patagonicus, (and a fossil form very related as Lycodon bosei) and Stipanicicia sp (closely related to the extant Galictis cuja) have been registered in the Ensenadean and Bonaerense periods of the Argentinian Pleistocene (Forasiepi et al., 2007). However our results could be ratified by other results provided by the same authors (Koepfli et al., 2008). They found that Pteronura, Galictis and Eira could have a Eurasian origin for each genus with posterior diversification in North

1516

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

America. For example, Pteronura may be related to the extinct genus Satherium from the Pliocene of North America. Additionally, Eira may be related to Trigonictis and Legionarictis, also North American fossils (Tseng et al., 2009). Fossil evidence suggests mustelids colonized the New World across Beringia during different intervals when the land bridge between Eurasia and North America was open. Multiple genera of mustelids migrated into North America during the Late Miocene (around 11.2-5.3 MYA), prior to the first opening of the Bering Strait 5.4– 5.5 MYA, which severed the route across Beringia. Many genera that colonized North America during the Late Miocene or earliest Pliocene became extinct. However, Eira could be one of the surviving genera that began to diversify in North America and also in South America if we accept that they arrived in South America before the complete formation of the Panamanian land bridge. The mitochondrial diversification of the oldest groups of South American tayra occurred 3.7-2.3 MYA. This coincided with the climatic changes that originated from the completion of the Panamanian land bridge (3.1–2.8 MYA; Marshall et al., 1979, 1982; Marshall, 1985, 1988; Webb, 1985, 1997; Coates and Obando, 1996) in the Last Pliocene. Diversification in the tayra occurred close to the Gelasian period (2.5–1.8 MYA), a period characterized by the last stages of a global cooling trend that led to the quaternary ice ages (International Commission on Stratigraphy 2007). Around 2.5 MYA, the Andean forests were transformed into open cold dry savannah (‘paramo’), which could have potentially isolated populations of different species. They could have crossed the Northern Andes coming from Central America. Van der Hammen (1992) demonstrated that the mean temperature in the Colombian Andes was 4 ° C lower than today. He also stated that the rain level descended below the level reported for today (500– 1,000 mm). At 2,500 meters above sea level (masl), the temperature was 10 °C lower than it is today. Tayra’s diversification could have been affected by the rapid uplift that resulted in a significant elevation of the Northern Andes. The mountain range’s height climaxed around 2.7 MYA when the northern Colombian Andes reached its present day elevation (GregoryWodzicki, 2000). This also coincides with the last formation of the Central Andes. All of the Andean chain between Cajamarca and Huancavelica in Peru appeared by volcanism in this period. Much of the mitochondrial diversification process of the typical Pleistocene colonizer haplotypes occurred around 1.5-0.8 MYA. This divergence could have been initiated by the pre-Pastonian glacial period (1.3-0.8 MYA), which had the highest glacial peak of the first Quaternary glacial period (Günz). This glacial period was extremely dry, and there was a great degree of forest fragmentation. This period was a time for haplotype diversification. It was also a time of separation for many carnivores as it was previously determined for the Pampas cat (Cossíos et al. 2009), and for the foxes of the Lycalopex genus (Ruiz-García et al. 2013a). Around 1.3 MYA, the Buenos Aires’s fauna transformed into a typical semi-arid Patagonian fauna, represented by the guanaco, Lestodelphys and Lyncodon. Therefore, the climate was considerably colder and drier than today and could have influenced the mitochondrial fragmentation within the tayra. The strong population expansion detected around 0.4 MYA for the tayra agrees well with an interglacial period (0.39-0.20 MYA, West 1967) characterized by higher temperatures and humidity and forest expansions (Hoxniense in the British Islands, Yarmouth in North America, Holstein in northern Europe and Mindel-Riss interglacial period in central Europe). Future analyses with nuclear markers are needed as well as samples from Central America (especially, southern Mexico, Guatemala, Belize and Honduras), the Pacific areas of Colombia

Mitochondrial Population Genetics Inferences …

1517

and Ecuador, other areas of Central Peru, and the Guyana shield. These markers and additional samples will help us to determine the exact number of subspecies or ESUs (Moritz, 1994). This information is crucial for the development of effective conservation plans for this species.

ACKNOWLEDGMENTS Special thanks to Dr. Diana Álvarez, Dr. Francois Catzeflis, Pablo Escobar-Armel, and Lina Arguello for their help in obtaining samples of tayras throughout Panama, Colombia, Trinidad, French Guiana, Peru, Ecuador, Brazil, Bolivia, Paraguay and Argentina. Thanks also go to the Instituto von Humboldt (Colombia), the Ministry of Environment, Consejo Nacional del Ambiente and the Instituto Nacional de Recursos Naturales in Peru, to the Colección Boliviana de Fauna (Dr. Julieta Vargas), to CITES in Bolivia and to the Ministerio del Ambiente in Coca and Santo Domingo de Tsáchilas (Ecuador) for their role in facilitating the obtainment of the collection permits in Colombia, Peru, Bolivia and Ecuador. Also thanks go to the Panamanian and Argentinian Ministries of Environment for their roles in obtaining permissions in these countries. Additional thanks to the many people of the diverse Indian tribes in Peru (Bora, Ocaina, Shipigo-Comibo, Capanahua, Angoteros, Orejón, Cocama, Kishuarana, and Alamas), Colombia (Jaguas, Ticunas, Huitoto, Cocama, Tucano, Nonuya, Yuri, Yucuna, Curripacos, and Desano), and Ecuador (Kichwa, Huaorani, Shuar, and Achuar) for their help in obtaining tayra samples.

REFERENCES Akaike, H. (1974). A new look at the statistical model identification. IEEE Transactions on Automatic Control, AC, 19, 716–723. Allendorf, F. W., Phelps, S. R. (1981). Use of allelic frequencies to describe population structure. Canadian Journal of Fish and Aquatic Sciences, 38: 1507-1514. Alston, E. R. (1882). Biologia Centrali-Americana: Mammalia. [Central American Biology: Mammalia]. R. H. Porter, London, United Kingdom. Bandelt, H. J, Forster, P., and Rohl, A. (1999) Median-joining networks for inferring intraspecific phylogenies. Molecular Biology and Evolution, 16, 37-48. Baskin, J. A. (1998). Mustelidae. In C. M. Janis, K. M. Scott, and L. L. Jacobs (Eds.), Evolution of Tertiary Mammals of North America Volume 1 (pp. 152-173). Cambridge, England: Cambridge University Press. Baskin, J. A. (2011). A new species of Cernictis (Mammalia, Carnivora, Mustelidae) from the Late Miocene Bidahochi Formation of Arizona, USA. Palaeontologia Electronica, 14, 17. Bryant, H. N, Russell, F. L. S, A. P., and Fitch, W. D. (1993). Phylogenetic relationships within the extant Mustelidae (Carnivora): appraisal of the cladistic status of the Simpsonian subfamilies. Zoological Journal of Linnean Society, 108, 301-334. Cabrera, A. (1957). Catálogo de los mamíferos de América del Sur. [Catalog of mammals of South America]. I (Metatheria, Unguiculata, Carnívora). Revista del Museo Argentino de Ciencias Naturales “Bernardo Rivadavia,” Zoología 4:1-307.

1518

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

Cabrera, A., and Yepes, J. (1960). Mamíferos sudamericanos. Second Ed. [South American mammals. Second Ed.]. Buenos Aires, Argentina: Ediar. Chung, W. K., Steiper, M. E. (2008). Mitochondrial COII introgression into the nuclear genome of Gorilla gorilla. International Journal of Primatology, 29, 1341–1353. Clapperton, C. (1993). Quaternary Geology and Geomorphology of South America. Elsevier, Amsterdam. Coates, A. G., and Obando, J. A. (1996). The geological evolution of the Central American isthmus. In J. B. C. Jackson, A. F. Budd, and A. G. Coates (Eds.), Evolution and Environment in Tropical America (pp. 21-56). Chicago, Illinois: University of Chicago Press. Cossíos, E. D., Lucherini, M., Ruiz-García, M., and Angers B. (2009). Influence of ancient glacial periods on the Andean fauna: the case of the Pampas cat (Leopardus colocolo). BMC Evolutionary Biology, 9, 68-79. Cuarón, A. D., Reid, F., Helgen, K., and González-Maya, J. F. (2016). Eira barbara. The IUCN Red List of Threatened Species 2016: e.T41644A45212151. http://dx.doi.org/ 10.2305/IUCN.UK.2016-1.RLTS.T41644A45212151.en. Downloaded on 05 July 2017. Culver, M., Johnson, W. E., Pecon-Slattery, J. and O’Brien, S. J. (2000). Genomic ancestry of the American puma (Puma concolor). Journal of Heredity, 91, 186-197. Defler, T. R. (1980). Notes on interactions between tayra (Eira barbara) and the white-fronted capuchin (Cebus albifrons). Journal of Mammalogy, 61, 156. Dollfus, O. (1974). La cordillera de los Andes: Presentación de los problemas geomorfológicos. [Presentation of geomorphological problems]. Bulletin de l’Institut Francois d’Etudes Andines, 3, 1-36. Dragoo, J. W., and Honeycutt, R. L. (1997). Systematics of mustelid-like carnivores. Journal of Mammalogy, 78, 426-443. Drummond, A. J., Ho, S. Y. W., Phillips, M. J., and Rambaut, A. (2006). Relaxed phylogenetics and dating with confidence. PLOS Biology, 4(5), e88. Drummond, A. J., Suchard, M. A., Xie, D., and Rambaut, A. (2012). Bayesian phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution, 29, 1969–1973. Eisenberg, J. F. (1989). Mammals of the Neotropics. Volume 1. The Northern Neotropics. University of Chicago Press, USA. Pp. 1-449. Eizirik, E., Bonatto, S. L., Johnson, W. E., Crawshaw Jr. P. G., Vié, J. C., Brousset, D. M., O’Brien, S. J. and Salzano, F. M. (1998). Phylogeographic patterns and evolution of the mitochondrial DNA control region in two Neotropical cats (Mammalia, Felidae). Journal of Molecular Evolution, 47, 613-624. Emmons, L. H., and Freer, F. (1990). Neotropical rainforest mammals: a field guide. University of Chicago Press, Illinois. Excoffier, L., Lischer, H. E. L. (2010). Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Molecular Ecology Resour., 10, 564–567. Farris, D. W., Jaramillo, C., Bayona, G., et al., (2011). Fracturing of the Panamanian Isthmus during initial collision with South America. Geology, 39, 1007–1010. Flynn, J. J., Finarelli, J. A., Zehr, S., Hsu, J., and Nedbal, M. A. (2005). Molecular phylogeny of the Carnivora (Mammalia): assessing the impact of increased sampling on resolving enigmatic relationships. Systematic Biology, 54, 317-337.

Mitochondrial Population Genetics Inferences …

1519

Forasiepi, A., Martinelli, A., and Blanco, J. (2007). Bestiario Fósil. Mamíferos del Pleistoceno de la Argentina [Fossil bestiary. Pleistocene mammals of Argentina] (pp. 1-190) Buenos Aires, Argentina: Editorial Albatros. Fu, Y. X. (1997). Statistical tests of neutrality against population growth, hitchhiking and background selection. Genetics, 147, 915-925. Fu, Y. X., and Li, W. H., 1993. Statistical tests of neutrality of mutations. Genetics, 133, 693709. Fulton, T. L., and Strobeck, C. (2006). Molecular phylogeny of the Arctoidea (Carnivora): effect of missing data on supertree and supermatrix analyses of multiple gene data sets. Molecular Phylogenetics and Evolution, 41, 165-181. Galef, B. G., JR., Mittermeier, R. A., and Bailey, R. C. (1976). Predation by the tayra (Eira barbara). Journal of Mammalogy, 57, 760–761. Galvis, J. (1980). Un arco de islas Terciario en el Occidente colombiano. [An arch of Tertiary islands in the Colombian West]. Geología Colombiana, 11, 7-43. Ginsburg, L. (1999). Order Carnivora. In The Miocene Land Mammals of Europe. Rössner, G. E., and Heissig, K. (Eds.). Verlag Dr. Friedrich Pfeil, München. Pp. 109–148. Ginsburg, L., and Morales, J. (2000). Origin and evolution of the Melinae (Mustelidae, Carnivora, Mammalia). Earth Planet Science, 330, 221-225. González-Maya, J. F., Zárrate-Charry, D., Vela-Vargas, I. M., Jiménez-Alvarado, J. S., and Gómez-Hoyos, D. (2015). Activity patterns of Tayra Eira barbara populations from Costa Rica and Colombia: evidence of seasonal effects. Rev. Biodivers. Neotrop., 5, 96-104. Gregory-Wodzicki, K. M. (2000). Uplift history of the central and northern Andes: a review. Geol. Soc. of Am. Bull., 112, 1091–1105. Hall, E. R. (1981). The mammals of North America. Second Ed. New York, New York: John Wiley and Sons. Hall, E. R., and Dalquest, W. W. (1963). The mammals of Veracruz. University of Kansas Publication Museum of Natural History, 14, 165–362. Hershkovitz, P. (1972). The recent mammals of the Neotropical region: a zoogeographical and ecological review. In A. Keast, F. Erk, and B. Glass (Eds.). Evolution, mammals, and southern continents (pp. 311-431). Albany, New York: State University of New York Press. Hudson, R. R. (2000). A new statistic for detecting genetic differentiation. Genetics, 155, 20112014. Hudson, R. R., Boss, D. D., and Kaplan, N. L. (1992). A statistical test for detecting population subdivision. Molecular Biology and Evolution, 9, 138-151. International Commission on Stratigraphy. (2007). International Stratigraphic Chart. http://www.sratigraphy.org/chus.pdf. Johnson, W. E., and O’Brien, S. J. (1997). Phylogenetic reconstruction of the Felidae using 16S rRNA and NADH-5 mitochondrial genes. Journal of Molecular Evolution, 44 (Suppl 1), S98-S116. Johnson, W. E., Eizirik, E., Pecon-Slattery, J., Murphy, W. J., Antunes, A., Teeling, E., and O’Brien, S. J. (2006). The Late Miocene radiation of the modern Felidae: a genetic assessment. Science, 311, 73–77. Kimura, M. (1980). A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16, 111-120.

1520

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

Kimura, M, (1986). DNA and the neutral theory. Philosophical Transactions of the Royal Society of London, series B, 312: 343-354. Koepfli, K-P., and Wayne, R. K. (1988). Phylogenetic relationships of otters (Carnivora: Mustelidae) based on mitochondrial cytochrome b sequences. Journal of Zoology (London), 246, 401-416. Koepfli, K-P., and Wayne, R. K. (2003). Type-1 STS markers are more informative than cytochrome b in phylogenetic estimation of the Mustelidae (Mammalia: Carnivora). Systematic Biology, 52, 571-593. Koepfli, K. P., Deere, K. A., Slater, G. J., Begg, C., Begg, K., Grassman, L., Lucherini, M., Veron, G., and Wayne, R. K. (2008). Multigene phylogeny of the Mustelidae: Resolving relationships, tempo and biogeographic history of a mammalian adaptive radiation. BMC Evolutionary Biology, 6, 10. Konecny, M. J. (1989). Movement patterns and food habits of four sympatric carnivore species in Belize, Central America. In K. Redford and J. Eisenberg (Eds.), Advances in Neotropical Mammalogy (pp. 243-264). Gainesville, Florida: Sandhill Crane Press. Librado, P., Rozas J. (2009). DnaSP v5: A software for comprehensive analysis of DNA polymorphism data. Bioinformatics, 25, 1451-1452 | doi: 10.1093/bioinformatics/btp187. Lönnberg, E. (1913). Mammals from Ecuador and related forms. Arkiv Zoologi, 16, 1–36. Marshall, L. G. (1985). Geochronology and land-mammal biochronology of the transamerican faunal interchange. In F. G. Stehli and S. D. Webb (Eds.), The Great American Interchange (pp. 49-85). New York, New York: Plenum Press. Marshall, L. G. (1988). Land mammals and the great American interchange. American Science, 76, 380–388. Marshall, L., Butler, R., Drake, R., Curtis, G., and Tedford, R. (1979). Calibration of the Great American Interchange. Science, 204, 272-279. Marshall, L. G., Webb, S. D., Sepkoski Jr., J. J., and Raup, D. M. (1982). Mammalian evolution and the great American interchange. Science, 215, 1351–1357. Montes, C., Bayona, G., Cardona, A., Buchs, D. M., Silva, C. A., Morón, S., Hoyos, N., Ramírez, D. A., Jaramillo, C. A., and Valencia, V. (2012). Arc-continent collision and orocline formation: Closing of the Central American seaway. J. Geophysical Research, 117, B04105, doi:10.1029/2011JB008959. Montes, C., Cardona, A., Jaramillo, C., Pardo, A., Silva, J. C., Valencia, V., Ayala, V. C., PérezAngel, L. C., Rodriguez-Parra, L. A., Ramirez, V., et al., (2015). Middle Miocene closure of the Central American sea way. Science, 348, 226–229. Moritz, C. (1994). Defining evolutionary significant units for conservation. Trends in Ecology and Evolution, 9, 373-375. Morral, N., Bertrantpetit, J., and Estivill,. X (1994). The origin of the major cystic fibrosis mutation (delta F508) in European populations. Nature Genetics, 7, 169-175. Napolitano, C., Sanderson, J., Johnson, W. E., O’Brien, S. J., Rus Hoelzel, A., Freer, R., Dunstone, N., Ritland, K., and Poulin E. (2013). Population Genetics of the felid Leopardus guigna in Southern South America: Identifying intraspecific units for conservation. In Ruiz-García, M and Shostell, J. M. (Eds.), Molecular Population Genetics, Phylogenetics, Evolutionary Biology and Conservation of the Neotropical Carnivores. New York, New York: Nova Science Publishers. Nei, M. (1973). Analysis of gene diversity in subdivided populations. Proc Natl Acad Sci USA, 70, 3321–3323.

Mitochondrial Population Genetics Inferences …

1521

Nylander, J. A. (2004). MrModeltest v2. Evolutionary Biology Center, Uppsala University. Pennington, R. T., Dick, C. W. (2010). Diversification of the Amazonian flora and its relation to key geological and environmental events: a molecular perspective. In: Hoorn C, Wesselingh F (eds). Amazonia, Landscape and Species Evolution: A Look into the Past. Wiley-Blackwell, Oxford. Pp 373-385. Posada, D., Crandall, K. A. (2001). Intraspecific gene genealogies: trees grafting into networks. Trends in Ecology and Evolution, 16, 37–45. Presley, S. J. (2000). Eira barbara. Mammalian Species, 636, 1-6. Qiu, Z. X., Deng, T. and Wang, B. Y. (2004). Early Pleistocene mammalian fauna from Longdan, Dongxiang, Gansu, China. Palaeontologia Sinica Series C, 191, 1–198. Rambaut, A. (2012). FigTree v1.4. http://tree.bio.ed.ac.uk/software/figtree/. Rambaut, A., Drummond, A. J. (2013). TreeAnnotator v1.8.0. http://beast.bio.ed.ac.uk/. Rambaut, A., Suchard, M. A., Xie, W., Drummond, A.J. (2013). Tracer v1.6. http://tree.bio.ed.ac.uk/software/tracer/. Ramos-Onsins, S. E., and Rozas, J. (2002). Statistical properties of new neutrality tests against population growth. Molecular Biology and Evolution, 19, 2092-2100. Ray, C. E., Anderson, E., and Webb, S. D. (1981). The Blancan carnivore Trigonictis (Mammalia: Mustelidae) in the eastern United States. Brimleyana, 5, 1-36. Rogers, A. R., Fraley, A. E., Bamshad, M. J., Watkins, W. S., and Jorde, L. B. (1996). Mitochondrial mismatch analysis is insensitive to the mutational process. Molecular Biology and Evolution, 13, 895-902. Rogers, A. R., and Harpending, H. C. (1992). Population growth makes waves in the distribution of pairwise genetic differences. Molecular Biology and Evolution, 9, 552-569. Ruiz-García, M. (1993). Analysis of the evolution and genetic diversity within and between Balearic and Iberian cat populations. Journal of Heredity, 84, 173-180. Ruiz-García, M. (1994). Genetic profiles from coat genes of natural Balearic cat populations: An Eastern Mediterranean and North-African origin. Genetics Selection and Evolution, 26, 39-64. Ruiz-García, M. (1997). Genetic relationships among some new cat populations sampled in Europe: a spatial autocorrelation analysis. Journal of Genetics, 76, 1-24. Ruiz-García, M. (1999). Genetic structure of different cat populations in Europe and South America at a microgeographic level: Importance of the choice of an adequate sampling level in the accuracy of population genetics interpretations. Genetics and Molecular Biology, 22, 493-505. Ruiz-García, M., Alvarez, D. (2000). Genetic microstructure in two Spanish cat populations I: Genic diversity, gene flow and selection. Genes and Genetics Systems, 75, 269-280. Ruiz-García, M., and Pinedo-Castro, M. (2013). Population genetics and phylogeographic analyses of the jaguarundi (Puma yagouaroundi) by means of three mitochondrial markers: the first molecular population study of this species. In Ruiz-García, M., Shostell, J. (Eds.), Molecular Population Genetics, Phylogenetics, Evolutionary Biology and Conservation of the Neotropical Carnivores. New York, New York: Nova Science Publishers. Pp. 245-288. Ruiz-García, M., Lichilín, N., Jaramillo, M. F. (2013a). Molecular phylogenetics of two Neotropical Carnivores, Potos flavus (Procyonidae) and Eira barbara (Mustelidae): No clear existence of putative morphological subspecies. In Ruiz-García, M., Shostell, J. (Eds.), Molecular Population Genetics, Phylogenetics, Evolutionary Biology and

1522

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

Conservation of the Neotropical Carnivores. New York, New York: Nova Science Publishers. Pp. 37-84. Ruiz-García, M., Rivas-Sánchez, D., and Lichilín-Ortiz, N. (2013b). Phylogenetics relationships among four putative taxa of foxes of the Pseudoalopex genus (Canidae, Carnivora) and molecular population genetics of Ps. culpaeus and Ps. sechurae. In RuizGarcía, M., Shostell, J. (Eds.), Molecular Population Genetics, Phylogenetics, Evolutionary Biology and Conservation of the Neotropical Carnivores. New York, New York: Nova Science Publishers. Pp. 97-128. Ruiz-García, M., Cossíos, D., Lucherini, M., Yáñez, J., Pinedo, M., and Angers, B. (2013c). Population genetics and spatial structure in two Andean cats (the Pampas cat, Leopardus pajeros and the Andean mountain cat, L. jacobita) by means of nuclear and mitochondrial markers and some notes on skull biometrics. In Ruiz-García, M., Shostell, J. (Eds.), Molecular Population Genetics, Phylogenetics, Evolutionary Biology and Conservation of the Neotropical Carnivores. New York, New York: Nova Science Publishers. Pp. 187-246. Ruiz-García, M., Escobar-Armel, P., De Thoisy, B., Martínez-Agüero, M., Pinedo-Castro, M., and Shostell, J. M. (2017a). Biodiversity in the Amazon: origin hypotheses, intrinsic capacity of species colonization, and comparative phylogeography of river otters (Lontra longicaudis and Pteronura brasiliensis, Mustelidae, Carnivora) and pink river dolphin (Inia sp, Iniidae, Cetacea). Journal of Mammalian Evolution, 24, 1-28. DOI 10.1007/s10914-016-9375-4. Ruiz-García, M., Pinedo-Castro, M., Shostell, J. M. (2017b). Mitogenomics of the jaguarundi (Puma yagouaroundi, Felidae, Carnivora): unclear correlation between morphological subspecies and molecular data. PLOS ONE, (in press). Ruiz-García, M., Pinedo-Castro, M., Shostell, J. M. (2017c). Mitogenomics of the margay (Leopardus wiedii, Felidae, Carnivora): some geographic regional clusters but low correspondence with putative morphological subspecies. Journal of Heredity, (in press). Sambrock, J., Fritsch, E., Maniatis, T. (1989). Molecular Cloning: A Laboratory manual. 2nd edition. V1. Cold Spring Harbor Laboratory Press. New York. Sato, J. J., Hosoda, T., Wolsan, M., Tsuchiya, K., Yamamoto, Y., and Suzuki, H. (2003). Phylogenetic relationships and divergence times among mustelids (Mammalia: Carnivora) based on nucleotide sequences of the nuclear interphotoreceptor retinoid binding protein and mitochondrial cytochrome b genes. Zoological Scripta, 20, 243-264. Sato, J. J., Hosoda, T., Wolsan, M., and Suzuki, H. (2004). Molecular phylogeny of arctoids (Mammalia:Carnivora) with emphasis on phylogenetic and taxonomic positions of ferret badgers and skunks. Zoological Scripta, 21, 111-118. Schwarz, G. E. (1978). Estimating the dimension of a model. Annals of Statistics, 6, 461-464. Scott, W. B. (1937). A History of Land Mammals in the Western Hemisphere. New York, New York, Macmillan. Simpson, G. G. (1950). History of the fauna of Latin America. American Scientist, 38,361-389. Simpson, G. G. (1965). The geography of evolution. Collected essays. Philadelphia, Pennsylvania and New York, New York: Chilton Books. Simpson, G. G. (1980). Splendid Isolation: The Curious History of South American Mammals. New Haven, Connecticut: Yale University Press. Slatkin, M. (1985). Rare alleles as indicators of gene flow. Evolution, 39, 53-65. Stamatakis, A. (2006). RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics, 22, 2688– 1243.

Mitochondrial Population Genetics Inferences …

1523

Strobeck, C. (1987). Average number of nucleotide differences in a sample from a single subpopulation: a test for population subdivision. Genetics, 117, 149-153. Sunquist, M. E., Sunquist, F., and Daneke, D. E. (1989). Ecological separation in a Venezuelan llanos carnivore community. In Redford, K., and Eisenberg, J. (Eds.), Advances in Neotropical mammalogy (pp. 197-232). Gainsville, Florida: Sandhill Crane Press. Tajima, F. (1989). Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics, 123, 585-595. Tamura K., Stecher G., Peterson D., Filipski A., and Kumar S. (2013). MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution, 30, 27252729. Tavaré, S. (1986). Some Probabilistic and Statistical Problems in the Analysis of DNA Sequences. Lectures on Mathematics in the Life Sciences, 17, 57–86. Tchaicka, L., Eizirik, E., De Oliveira, T., Cándido, J. F., and Freitas, T. (2006). Phylogeography and population history of the crab-eating fox (Cerdocyon thous). Molecular Ecology, 16, 819-838. Tedford, R. H., Albright, L. B. III., Barnosky, A. D., Ferrusquia-Villafranca, I., Hunt, R. M. Jr, Storer, J. E., Swisher, C. C. III, Voorhies, M. R., Webb, S. D., and Whistler, D. P. (2004). Mammalian biochronology of the Arikareean through Hemphilian interval (Late Oligocene through Early Pliocene epochs. In Woodburne, M. O. (Eds.), Late Cretaceous and Cenozoic mammals of North America (pp. 169-231). New York, New York: Columbia University Press. Trexler, J. C. (1988). Hierarchical organization of genetic variation in the sailfin molly, Poecilia latipinna (Pisces: Poeciliidae). Evolution, 42, 1006–1017. Tseng, Z. J., Wang, X., and Stewart, J. D. (2009). A new immigrant mustelid (Carnivora, Mammalia) from the middle Miocene Temblor Formation of central California. PaleoBios, 29, 13–23. Van der Hammen, T. (1961). The Quaternary climatic changes of northern South America. Annals of the New York Academy of Sciences, 95, 676-683. Van der Hammen, T. (1992). La paleoecología de Suramérica Tropical. Cuarenta años de investigación de la historia del medio ambiente y de la vegetación. [The paleoecology of Tropical South America. Forty years of research into the history of the environment and vegetation]. In Historia, Ecología y Vegetación (pp. 1-411). Bogotá, Colombia: Corporación Colombiana para la Amazonía-Araracuara. Vianna, J. A., Ayerdi, P., Medina-Vogel, G., Mangel, J. C., Zeballos, H., Apaza, M., and Faugeron, S. (2010). Phylogeography of the marine otter (Lontra felina): Historical and contemporary factors determining its distribution. Journal of Heredity, 101, 676–689. Waits, L., Sullivan, J., O’Brien, S. J., and Ward, R. H. (1999). Rapid radiation events in the family Ursidae indicated by likelihood phylogenetic estimations from multiple fragments of mtDNA. Molecular Phylogenetics and Evolution, 13, 82-92. Walsh, P. S., Metzger, D. A., and Higuchi, R. (1991). Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques, 10, 506513. Webb, S. D. (1985). Late Cenozoic mammal dispersals between the Americas. In F. G. Stehli and S. D. Webb (Eds.), The great American biotic interchange. (pp. 357-386). New York, New York: Plenum Press.

1524

Manuel Ruiz-García, Nicolás Lichilín-Ortíz, Yolanda Mejia et al.

Webb, S. D. (1997). The great American faunal interchange. In A. G. Coates (Ed.), Central America: A Natural and Cultural History (pp. 97-122). New Haven, Connecticut: Yale University Press. West, R. G. (1967). The Quaternary of the British Isles. The geologic systems. In Rankama K (Ed.). The Quaternary. Vol 2. Interscience, New York. Pp. 1-87. Wright, S. (1943). Isolation by distance. Genetics, 28, 114-138.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 69

THE PRECISION MEDICINE AND PRECISION PUBLIC HEALTH APPROACHES TO CANCER TREATMENT AND PREVENTION: A CROSS-COMPARISON Stephen M. Modell1,*, Sharon L. R. Kardia2 and Toby Citrin1 1

Department of Health Management and Policy, 2 Department of Epidemiology University of Michigan School of Public Health, Ann Arbor, MI, US

ABSTRACT Like other forms of diagnostics, genetic testing comes with a retinue of costs and benefits. Significant benefits in terms of morbidity and mortality have accrued to individuals tested for more prevalent genetic conditions like cystic fibrosis and sickle cell disease, including persons seen in the emergency room or identified through public health surveillance. These benefits do not mitigate the drawbacks of genetic testing, false and missed diagnoses and sheer cost among them. Both medicine and public health have aimed at means of maximizing genetic test benefits in the interventions that they apply. The President’s Precision Medicine Initiative (PMI) holds promise in that its results could be used to tailor medical treatments to the individual characteristics of patients, “precision” implying a more accurate and precise regimen overall. The National Cancer Institute (NCI) has already launched the NCIMATCH precision medicine trial, which assigns targeted treatments based on the genetic abnormalities in a tumor, regardless of cancer type. Other trials, such as the NCI Pediatric MATCH trial, are yet to happen. The efficacy of cancer treatments also intersects public health concerns. The Evaluation of Genomic Applications in Practice and Prevention (EGAPP) Working Group has evaluated the use of UGT1A1 genotyping to determine the best dose of irinotecan to prevent side effects when treating patients for metastatic colorectal cancer. Analytic validity does not always equate with improved patient

* Corresponding

Author’s Email: [email protected] (Center for Public Health and Community Genomics, University of Michigan School of Public Health, 4628 SPH Tower, 1415 Washington Hts., Ann Arbor, MI 48109-2029; Tel: (734) 615-3141; Fax: (734) 764-1357).

1526

Stephen M. Modell, Sharon L. R. Kardia and Toby Citrin

outcomes, however, thus the public health emphasis on development of a suitable evidence base for precision medical and public health efforts. The public health approach to precision medicine, or “precision public health”, differs from the medical approach in several important ways: (1) population-based with attention to at-risk populations, as opposed to being strictly individualized; (2) focus on primary and secondary prevention, rather than frank disease (tertiary prevention); and (3) prioritizing interventions that have already demonstrated readiness for large-scale implementation, in contrast to the undertaking of novel clinical trials. Precision public health is exemplified in the Centers for Disease Control and Prevention’s emphasis on the implementation of Tier 1 genetic tests that have passed systematic review for analytic and clinical validity and utility – the use of family history for referral for hereditary breast and ovarian cancer genetic testing (BRCA1/2 mutations), and hereditary nonpolyposis colorectal cancer cascade screening (Lynch syndrome MLH1, MSH2, MSH6 mutations). This paper will cross-compare the precision medical approach to cancer based on pharmacogenomic regimens using companion diagnostics, and the public health approach to precision management of hereditary cancer for 3 cancer types – lung, breast, and colorectal. It will describe methods of early detection and consider how lives can be saved through precise management – from predictive testing and cancer monitoring of the at-risk population, to tailored chemoprevention that fits the needs of the individual. In the population context, a cascade screening “multiplier effect” exists in that relatives can also be assessed and followed for mutations identified in the proband. Cost-benefit analyses (T4 translational research) of medical and public health approaches will be closely examined and compared. Points of commonality between the two approaches will also be discussed, since primary/secondary and tertiary disease prevention represent a continuum. These analyses point to the value of allocating resources towards the health of at-risk populations. Questions remain if particular forms of genetic testing are to become “universalized”, and if the needs of all at-risk groups, including racial-ethnic, are to be addressed.

Keywords: lung cancer, breast cancer, colorectal cancer, Lynch syndrome, genetic testing, cascade screening, universal screening, cost-effectiveness, precision medicine, pharmacogenomics, public health, race, ethnicity

FROM THE HUMAN GENOME PROJECT TO THE PRECISION MEDICINE INITIATIVE If the twentieth century is known for its success in mapping the human genome, the twentyfirst century is becoming equally well known for scientists’ attempts at making genetic interventions “precise” – appropriately chosen, and delivered to the right person and physical target within the human body. The Precision Medicine Initiative (PMI), launched by the Obama administration in January 2015 with a $215 million outlay in the President’s 2016 Budget and continuing onward in the current administration, brought medicine closer than ever to the ability to tailor medical regimens to the needs of the individual patient [1]. An article by Francis Collins, Director of the U.S. National Institutes of Health (NIH), and Harold Varmus, former Director of the U.S. National Cancer Institute (NCI), which appeared shortly after the announcement, broke the Initiative into two stages: a near-term focus on cancers, and a longerterm aim to yield new knowledge applicable to the broader range of health and disease [2]. Muin Khoury, Director of the Office of Public Health Genomics at the U.S. Centers for Disease Control and Prevention (CDC-OPHG), and Sandro Galea, Dean of Boston University School

The Precision Medicine and Precision Public Health Approaches …

1527

of Public Health, followed-up with the affirmation that the PMI could, in time, be used to develop, evaluate, and deliver health interventions with greater “precision” for both individuals and populations [3]. The distance between a strictly individualized approach to precision medicine and one that is population-oriented, fitting the right intervention to the right population, is transcended by a common denominator shared by medicine and public health – cost-effectiveness. Translational research spans several distinct territories, from basic genome-based discovery as it yields candidate health applications (e.g., new genetic tests and therapeutic interventions) - T1 translational research, to evaluation of real-world outcomes (e.g., morbidity and mortality, costeffectiveness, and quality-of-life indicators) - T4 translational research [4]. In this piece we take the position that whatever the molecular genetic or behavioral approach used, it must make sense dollar-wise such that the interventions are being mustered in an effective and economical way. Our analysis will show that the criterion of cost-effectiveness naturally shifts the prospect of a national precision medicine effort in the population-oriented direction. Though the two may seem like strange bedfellows, both the pharmacogenomics industry and public health community are in agreement that the PMI must be a sustainable effort, so that the real question becomes, “What direction(s) can the PMI effectively take?”

DEFINITIONS OF PRECISION MEDICINE AND PRECISION PUBLIC HEALTH The definition of a particular medical intervention illustrates both the basic actions to be taken and its scope. Jameson and Longo define “precision medicine” as “treatments targeted to the needs of individual patients on the basis of genetic, biomarker, phenotypic, or psychosocial characteristics that distinguish a given patient from other patients with similar clinical presentations” [5]. Implicit in this definition is the goal of improving clinical outcomes for individual patients, while avoiding unnecessary side-effects that could be incurred by ignoring patients’ individual characteristics. The authors admit that medicine to date has more or less employed such an approach. Hemophilia requires the administration of an appropriate clotting factor, be it factor VIII or factor IX (these days in recombinant form), to stop the bleeding. Clinicians need to undertake a thorough work-up in order to arrive at a precise diagnosis of the hemophilia, which will enable the appropriate therapy to be administered. Choice of antibiotic is another example. For the antibiotic to take hold, the right type of antibiotic must be given for the particular bacterial infection. The latter example suggests that targeted approaches, aimed at particular persons for specific conditions, could actually have population-level applicability, since antibiotics and vaccinations are given on a widespread basis. They are the very opposite of “orphan drugs”, designed to cater to the needs of very rare cases. Shen and Hwang point out that despite the commonality with past precedent, a substantive shift in methodology between the old medicine and the new medicine is occurring [6]. The practice of medicine has so far remained largely “empirical”. Physicians typically rely on a combination of patient and occasionally family medical history, physical examination, and laboratory data to secure a diagnosis and choose a drug. Treatments are based on a provider’s experience with similar patients. Drugs administered are most often “blockbuster” drugs designed to accommodate the “typical” patient. If the wrong analgesic, antibiotic, or

1528

Stephen M. Modell, Sharon L. R. Kardia and Toby Citrin

antiarrhythmic is given, the patient will be weaned off the current drug, and a new one tested until the right drug and dosage are chosen. The idea behind precision medicine is to rely on new biomarkers and genomic tests to “deliver the right treatment to the right patient at the right time” [6]. It is a personally tailored, as opposed to “one size fits all” approach. The fit is “precise” – one person; one drug. Classic pharmacogenomic examples readily demonstrate this novel approach. Warfarin (brand name Coumadin) dosing allows the frequently used anticoagulant to be titrated to the needs of the patient susceptible to clotting events associated with atrial fibrillation and deep vein thrombosis [7]. Two genes are known to be involved in warfarin therapeutic outcomes – CYP2C9, which codes for an enzyme primarily responsible for warfarin metabolism, and VKORC1, which codes for the warfarin drug target. Genotyping can yield information useful to guide a person’s initial warfarin dose and allow the clinician to readily stabilize his or her prothrombin measures, a process which usually takes several weeks. Cost-effectiveness studies of genotype-guided dosing have concluded that considerable potential exists for cost savings, but that it cannot be realized until test costs decrease and the uncertainty concerning effectiveness is reduced. The U.S. Centers for Medicare and Medicaid Services (CMS) has consequently adopted a provisional “coverage with evidence development” approach [7]. A physiologic measure, the ratio of the patient’s prothrombin time to a control or “normal” sample, continues to be the professional standard for warfarin dosing. Since the patient is followed with this measure, its use may be considered a tool in “personalized” or individuallytailored medicine. Imatinib (Gleevec) for chronic myelogenous leukemia (CML) and gastrointestinal stromal tumors is another prime example of the tailoring in drug regimens that may take place. Medical researchers developed this drug over a multi-decade period to inhibit the function of a translocation-related “fusion” gene, BCR-Abl, which produces an abnormal tyrosine kinase that is not properly regulated [8]. In initial trials, all of 31 research participants experienced complete remission. The five year survival rate for CML has increased from 31% (1993) to 59% (2003 – 2009) [9]. The drug is administered to patients who are Ph+ (Philadelphia chromosome positive), with effectiveness monitored by white blood cell and platelet counts. Like warfarin, Gleevec targets a particular type of patient and has a very specific chemical target – the ATP-binding site on a particular kinase – and is a drug that can be closely monitored. Gleevec’s cost is about $3,500 per month, which may evade some patients’ pocketbooks. However, it is covered by Medicare Part D and Medicare Advantage Plans. Both of the above examples describe “personalized medicine” – separating patients into different groups then individually tailoring the treatment to the patient. Though many authors use the two terms interchangeably, Khoury distinguishes “personalized medicine” from “precision medicine” in that the latter inculcates multiple determinants of health, genetics being one rung, thus can absorb the notion of social determinants as easily as it can molecular determinants. The President’s PMI plan is data intensive in a way that would allow the recording of multiple determinants for large numbers of people, ostensibly through a planned million-person cohort: Participants will be involved in the design of the Initiative and will have the opportunity to contribute diverse sources of data – including medical records; profiles of the patient’s genes, metabolites (chemical makeup), and microorganisms in and on the body; environmental and lifestyle data; patient generated information; and personal device and sensor data. [1]

The Precision Medicine and Precision Public Health Approaches …

1529

Collins and Varmus write that the numerous clinical trials stemming from the PMI and its large-scale cohort will require the building of a “cancer knowledge network” to store all the resulting molecular and medical data in digital form and make it readily deliverable to providers and patients [2]. Simonds and Khoury illustrate this idea with the example of a cancer clinical trials and effectiveness research infrastructure developed by the H. Lee Moffitt Cancer Center. The system is part of its personalized cancer care initiative started in 2006 – Total Cancer Care. The program: (1) integrates data from multiple sources (electronic medical records, biospecimen databases, and molecular data); (2) makes resultant information available to patients by providing active feedback about their health and upcoming appointments and expanded electronic health record; and (3) affords data interfaces for researchers and clinicians [10]. It is to be hoped that the streamlining of cancer clinical trials and centralization of incoming data will reduce costs and increase efficiency over standard medical practices. According to Cancer Research U.K., between 2003 and 2007 cancer trials were accompanied by a 75% increase in administrative costs, a figure in need of remedy [11]. Cost-effectiveness and clinical utility will enter into assessments of the PMI. Public health efforts in the U.S. have to date assumed a twin duty – assessment of the cost-effectiveness of clinical programs, at the same time that a vision of precision medicine’s meaning in terms of population health is being formulated. This vision departs from the medical model of precision health in a number of important respects: (1) it is population-based, with attention to at-risk populations, as opposed to being strictly individualized; (2) the focus is on primary and secondary prevention, rather than frank disease (tertiary prevention); and (3) the emphasis is on interventions that have already demonstrated readiness for large-scale implementation, in contrast to the undertaking of novel clinical trials [12]. To glimpse the future, it is helpful to visit recent experience with precision medicine in the cancer arena. This inspection will take our trek from the individuallyfocused domain of clinical medicine to the population-oriented territory of public health. The next section will focus on three major cancer categories of mutual interest to clinical medicine and public health – lung, breast, and colorectal cancer – from the medical pharmacogenomics point of view.

PHARMACOGENOMIC INTERVENTIONS AND COST-EFFECTIVENESS The Precision Medicine Approach to Lung Cancer Lung cancer is the second most common cancer in both men and women, and is the leading cause of cancer-related death in both genders [13, 14]. Of note, the lung cancer incidence rate for black women is roughly equal to that of white women, despite the fact that they smoke fewer cigarettes [13]. The two major forms of lung cancer are non-small cell lung cancer (NSCLC), and small cell lung cancer (SCLC). NSLC comprises ~85% of all lung cancers; SCLC ~10-15% [15]. The 5-year survival rate for NSCLC is 21%, suggesting progress that has been and that is yet to be made [16]. Targeted therapies aimed at cancers harboring very specific genetic alterations are becoming more and more common in oncogenomics. A 2012 review of the role of pharmacogenomics in moving genetic association studies from bench to bedside describes the

1530

Stephen M. Modell, Sharon L. R. Kardia and Toby Citrin

use of EGFR tyrosine kinase inhibitors (TKI) in the treatment of lung cancer and HER2 (tyrosine kinase ERBB2)-directed therapies in the treatment of HER2 (human epidermal growth factor 2)-positive early-stage breast cancer as prime examples of success in the area of cancer pharmacogenomics [17]. A 2016 review of precision medicine approaches in oncology cites ALK (anaplastic lymphoma kinase) fusion oncogene and EGFR (epidermal growth factor receptor (EGFR)) mutations as the main molecular predictive biomarkers supporting NSCLC treatment [15]. Molecular testing for ALK fusion genes has proven valuable. Abbott Molecular already offers a multiplexed assay, the Vysis ALK Break Apart FISH Probe Kit, endorsed by the 2016 National Comprehensive Cancer Network (NCCN) NSCLC practice guidelines [15]. Though ALK fusion gene rearrangements are relatively rare (< 5% of NSCLC cases), clinical responses to targeted inhibitors (e.g., crizotinib) can be quite dramatic [5]. In favor of the precision medicine approach, excluding patients without these mutations can also minimize the exposure of patients to costly and potentially toxic therapies unlikely to benefit them. EML4-ALK is the specific biomarker used in determining patient efficacy for the choice of a TKI agent such as crizotinib in the tertiary or after-the-cancer-has-arisen management of NSCLC [5]. A 2014 cost-effectiveness study on the use of EML4-ALK fusion oncogene testing in first-line crizotinib treatment for patients with advanced NSCLC reveals the complexity inherent in this precision medicine approach [18, 19]. The investigative team found that EML4ALK testing to govern therapeutic decisions improved patient outcomes by an average of 0.011 quality-adjusted life-years (QALYs) while adding extra costs of $2,725 per patient, of which only $60 was attributable to the molecular assay itself. The overall interpretation of the costbenefit calculus changes dramatically, however, when the cost of the companion drug (crizotinib) is considered. The incremental cost-effectiveness ratio is defined as the difference in cost between two alternative interventions, divided by the difference in their effect or impact. The incremental cost effectiveness ratio for administration of the drug itself was $250,632 per QALY gained. The investigators concluded that the regimen is “likely not considered costeffective in the current setting” [19]. This assessment was unaltered when the model was subjected to a sensitivity analysis of alternative costs for the molecular testing. States one reviewer, “Where companion diagnostic precision medicine is considered, these assays are by nature tightly coupled to the cost of the specific associated drug” [18]. Assays for EGFR inhibition may be used when other TKI inhibitors, such as gefitinib and osimertinib, are being considered for NSCLC therapy [15]. The U.S. Food and Drug Administration (FDA) has approved two multiplex assay kits, also NCCN endorsed, for this purpose – the therascreen EGFR RGQ PCR Kit (for use with gefitinib), and the cobas EGFR Mutation Test (for use with osimertinib). A cost-effectiveness analysis performed by an Australian team compared the use of combined multiplex testing and targeted therapy with NSCLC chemotherapy without testing, and thirdly with best supportive care without testing [20]. The combined strategy resulted in an additional 0.009 life-years (LYs) gained, compared to 1.458 LYs gained in the case of each of the other two strategies. The combined strategy resulted in an incremental cost-effectiveness ratio of $485,199 (Australian)/QALY comparing combined and best supportive care strategies, and $489,338 (Australian)/QALY comparing combined and chemotherapy only strategies. Decreasing test and test interpretation costs by half reduced the ratios, but they still remained greater than $200,000 (Australian)/QALY. The authors concluded that multiplex testing and targeted therapy is not cost-effective as a fourthline treatment in metastatic lung cancer when first-line treatments such as chemotherapy without pharmacogenomics testing can be employed.

The Precision Medicine and Precision Public Health Approaches …

1531

Other predictive biomarkers for NSCLC treatment are on the horizon. For example, KRAS mutations can suggest lack of therapeutic efficacy to EGFR targeted therapies. The FDA has cleared KRAS mutation detection assays for use in colorectal cancer, but such assays have not yet been approved for use in NSCLC [15].

The Precision Medicine Approach to Breast Cancer Breast cancer is the most common cancer among American women. It is the second leading cause of cancer death in women, exceeded only by lung cancer [21]. About 85% of breast cancer cases occur in women with no family history of breast cancer. These cases are due to somatic cell mutations which occur as a result of aging, various exposures (such as pre- and postmenopausal hormone therapy), and other life events. Precision medicine efforts for breast cancer due to somatic mutations fall into at least four categories, two of them – endocrine therapy and HER2 therapy – being mainstay treatment categories. HER2-directed therapies, for which trastuzumab (Herceptin) is often used, are one of the two major pharmacogenomics successes in the cancer area cited by Ritchie [17]. Tamoxifen is a major drug of choice in the category of endocrine therapies, itself being a selective estrogen receptor modulator [15]. Herceptin has proven utility in reducing risk for cancer recurrence after surgery for earlystage HER2-positive (HER2+) breast cancer, and improving survival in late-stage (metastatic) HER2+ breast cancer, but it also poses serious side-effects such as heart damage. Herceptin therapy can also cost a sizable amount, up to $50,000 per year [22]. Overexpression of the HER2 gene (HER2+ status) is associated with rapid tumor growth and negative diagnostic and prognostic indicators. A systematic review and meta-analysis performed in Canada compared seven different strategies employing immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) to determine HER2 status, thus appropriateness of using Herceptin [22]. Each strategy utilized an IHC score (0, 1+, 2+, 3+) alone or coupled with FISH confirmation to form this inference. The incremental cost-effectiveness ratio was lowest when cases with an IHC score of 2+ or 3+ (as opposed to 0 or 1+) were confirmed by FISH, which yielded a ratio of $3,351 (Canadian) (minimum) to $12,230 (Canadian) (maximum) per accurately determined case. The cost-effectiveness analysis is favorable given that accurate assessment of HER2 status is capable of reducing the cost of Herceptin therapy by $0.6 million per year, and saving $12 million per year in women who are HER2-, thus can be kept off Herceptin [22]. Estrogen-focused therapies have been a part of standard care for more than thirty years, and have displayed an evolution in policy analysts’ thoughts about the gold standard for precision management [15]. The Evaluation of Genomic Applications in Practice and Prevention (EGAPP) Working Group was launched by the CDC Office of Public Health Genomics in 2004 to conduct systematic, evidence-based reviews of burgeoning genetic tests and other applications of genetic technologies in transition from research to clinical and public health practice. EGAPP has produced two systematic reviews of the use of gene expression profiling to improve therapeutic outcomes in women with breast cancer. EGAPP’s 2009 review examined the validity and utility of three tests – Oncotype DX, MammaPrint, and the H:I (normalized gene expression) ratio [23]. These tests have been designed to go beyond the standard estrogen/progesterone receptor status indicator to predict tumor recurrence risk for women on tamoxifen, for whom alternative therapies might be considered. The EGAPP

1532

Stephen M. Modell, Sharon L. R. Kardia and Toby Citrin

Working Group found adequate evidence from the NSABP B-14 randomized controlled trial to support the association between Oncotype DX recurrence scores and 10-year distant metastases in estrogen receptor positive (ER+) patients, and adequate evidence to support the association between RS score and overall chemotherapy benefit, particularly for patients in the high risk category [23]. Recent publication of interim results for the TAILORx study has shown a further association between recurrence score and 5-year disease-free survival and distant recurrence in patients at low risk [24]. A follow-up systematic review by the EGAPP Working Group published in 2016 confirmed its previous findings but also noted the lack of direct evidence that the use of Oncotype DX improves clinical outcomes [25]. It also highlighted contradictory costeffectiveness results in studies performed in the U.S. (for which $2,000 in cost savings per patient were due to a decrease in post-testing chemotherapy use) and the U.K. (for which an incremental cost-effectiveness ratio of 26,940 £/QALY gained were due to an increase in chemotherapy use) [25]. The U.K. National Institute for Health and Care Excellence (NICE) Diagnostics Advisory Committee concluded that, under the assumption of equal chemotherapy benefit for all Oncotype DX risk categories, the test is not cost-effective at its current pricing level. In the first EGAPP review, data were adequate to support an association between the MammaPrint Index and 5- to 10-year metastasis rates, but the efficacy relative to classical clinical factors was unclear. More conclusive results await the completion of the MINDACT trial. For the H:I ratio test, populations studied were quite heterogeneous, and the test’s commercial offering was based on a single study in women with primary, untreated breast cancer.

The Precision Medicine Approach to Colorectal Cancer Colorectal cancer (CRC) is the third most common cancer in both men and women in the U.S. [26]. It is the third leading cause of cancer deaths when men and women are considered separately, and the second leading cause in both sexes combined. Considerable effort has been placed into targeted therapies and companion diagnostics for CRC. About 70-80% of patients present with resectable localized disease, treated by surgery and often followed by adjuvant therapy [27]. CRC patients with advanced disease may receive first-line chemotherapy, or chemotherapy and radiation before surgery is considered. The EGAPP Working Group published in 2009 a systematic review of one first-line chemotherapeutic agent, irinotecan, which may be accompanied by UGT1A1 genotyping to check for ability to adequately clear the drug [27]. Such genotyping aids decisions to either increase drug dose for more aggressive therapy, or switch to common alternate drugs, bevacizumab or cetuximab, for instance, in individuals with reduced clearance at risk for adverse events. EGAPP had two major findings: (1) unless patients receive a certain threshold dose of irinotecan, the increase in risk for toxicity is not significant, thus testing may not be warranted; and (2) reducing the dose of irinotecan (personalized dosing) to avoid adverse events may lead to more cases of unresponsive tumors than instances of adverse events avoided. It is inconclusive that benefits outweigh harms in the application of a precision approach here. The alternate drugs mentioned above are positioned among the three main classes of targeted therapies approved for metastatic CRC: (1) multikinase inhibitors; (2) angiogenic inhibitors; and (3) anti-EGFR antibodies [15]. Up to 50% of CRC patients respond to anti-

The Precision Medicine and Precision Public Health Approaches …

1533

EGFR therapy, which includes cetuximab [28]. KRAS wild-type status is considered an important factor in achieving a clinical response from this category of therapy [29]. However, 40-60% of patients with wild-type status do not respond to such therapy. Data suggest that BRAF gene status also plays a role in anti-EGFR response, and that the BRAF V600E mutation, present in 5-10% of CRC tumors, can lead to a positive response. To date the FDA has cleared two genetic testing kits, the therascreen KRAS kit from Qiagen, and the cobas KRAS Mutation Test from Roche [15]. The American Society for Clinical Oncology (ASCO) and three other professional organizations released new consensus guidelines in 2015 strongly recommending KRAS mutational testing for patients being considered for anti-EGFR therapy, and that BRAF V600 testing also be considered. Table 1. Pharmacogenomic/Companion diagnostic approach – 3 cancers Condition Non-small cell lung cancer (NSCLC)

HER2+ Breast cancer ER+ Breast cancer Metastatic colorectal cancer

Therapy Tyrosine kinase inhibitors

Biomarkers EML4-ALK

Cost-Effectiveness $255,970/QALY gained

References Djalalov et al. [19]

EGFR

$489,338 (Austr.)/QALY gained $3,351 – 12,230 (Can.) saved per case 26,940 £ (Brit.) cost/QALY gained ambivalent results – reducing toxicity vs. reducing tumor burden $7,500 – 12,400 saved per case

Doble et al. [20]

Herceptin

IHC, FISH

Endocrine

21-gene assay

Topoisomerase 1 inhibitor (TOP1) – irinotecan

UGT1A1 genotyping

Anti-EGFR

KRAS

$180,000/QALY gained

Dendukuri et al. [22] EGAPP [25]; Ward et al. [33] EGAPP [27]

EGAPP [30]; Vijayaraghavan et al. [31] EGAPP [30]; Shiroiwa et al. [32]

The EGAPP Working Group conducted a systematic review of companion diagnostic use of KRAS and BRAF mutation testing in anti-EGFR therapy in 2013 [30]. The systematic review looked at multiple pooled assessments, each consisting of up to seven studies, which together indicated statistically significant increased response rates to cetuximab and other anti-EGFR drugs, reduced risk of disease progression, and enhanced overall survival with KRAS wild-type status. EGAPP cited a cost-effectiveness study of KRAS testing in metastatic CRC patients in the U.S. and Germany [30, 31]. For the U.S. patients, use of KRAS testing to select patients for EGFR inhibitor therapy saved $7,500 to $12,400 per case. A second cited study from Japan displayed an incremental cost-effectiveness ratio for cetuximab with KRAS testing to be $180,000 per QALY gained compared to therapy without testing [32]. Due to this cost, the investigators concluded that the protocol was not cost-effective, even when treatment was limited to patients with wild-type KRAS. Two of three studies looking at BRAF testing found associations similar to the KRAS studies in terms of progression-free and overall survival, but these findings, however, were not contingent on whether or not cetuximab was included in the combination therapy. Thus, while the review supported recommendations for a precision

1534

Stephen M. Modell, Sharon L. R. Kardia and Toby Citrin

approach using KRAS mutation testing, it found insufficient evidence to link BRAF V600E mutation testing with treatment response independent of prognostic association. Table 1 summarizes the cost-effectiveness and descriptive findings for the pharmacogenomics or companion diagnostic precision medicine approach to the three cancers.

TAKING PRECISION MEDICINE BEYOND THE PERSONALIZED LEVEL One argument against the informativeness of the above studies is that they represent a personalized medicine approach, but not a precision medicine approach in its full capacity [3]. The electronic storage of information, which can be multifactorial, including relevant lifestyle, would seem to be crucial to maximizing benefits and minimizing cost. The investigative team looking at the infrastructure characteristics of the Lee Moffit Cancer Center “Total Cancer Care” program also examined six other major healthcare programs engaged in cancer care comparative effectiveness research in genomic and precision medicine [10]. Four of the researched programs – at Duke University, Kaiser Permanente, University of Pennsylvania, and the Fred Hutchinson Cancer Center – had established a complex infrastructure (with data and biospecimen registries and multidisciplinary research teams), were engaged in “knowledge generation” (via randomized controlled trials and observational studies), and had reached the stage of “knowledge synthesis” (horizon scanning, evidence synthesis, and decision modeling). These programs display a depth of information and range of multidisciplinary expertise that is reflective of the type of knowledge synthesis of which the PMI’s million person cohort will be capable. The Duke University and Kaiser Permanente teams noted a number of strategic challenges to the amassing of cancer study data – limited data quality, large variation in genomic methodology used, and poor demonstration of clinical utility for the genomic tests supplying the data [10]. These observations point out challenges that could foreseeably face PMI investigators attempting to collate information from the expansive precision medicine cohort. The Kaiser Permanente group was able to show that in screening for Lynch syndrome, a hereditary form of CRC, microsatellite instability testing (MSI) was preferable compared to immunohistochemical staining (IHC). In the treatment phase, the investigators found that screening for KRAS and BRAF mutations improved the cost-effectiveness of anti-EGFR therapy, but that the cost of the therapy surpassed generally accepted cost-effectiveness thresholds of $100,000/quality-adjusted life-year. These findings allude to the capability of the PMI to develop new data on useful oncogenomic screening, mutational testing, and therapeutic procedures, and to the correspondingly likely possibility that many of the discoveries, while being individually beneficial, could elude effectiveness for the clinical population as a whole. The PMI will no doubt be carried in new directions that have not yet been quantified, however. NCI is engaged a new type of clinical trial called “NCI-MATCH” [34]. In this innovative program, adult cancer patients are assigned to targeted treatments based on the genetic abnormalities in their tumors, regardless of the type of cancer they have. This concept represents the therapeutic end of what has been happening with diagnostics. KRAS and EGFR mutation testing is now occurring for multiple cancer types. Why should cancer therapies be restricted to just one cancer type? New management models may also evolve. The data

The Precision Medicine and Precision Public Health Approaches …

1535

infrastructure supporting precision medicine can and is being used to develop procedural algorithms that combine genetic testing with genetically targeted therapies. These algorithms, if tailored to the lay person, can then be used by both medical providers and patients in collaboration, improving the effectiveness of the prescribed regimen. Shen and Hwang use CYP2C9 (they cite CYP450) testing for warfarin dose performed at home first by nurses then by patients as an example [6]. This linkage of “big” or “rich” data and the development of new, useful algorithms is cited by multiple authors [2, 5, 35]. The issue is whether providers of various types, and consumers, can understand the test results and appreciate the connection to one-size-does-not-fit-all therapeutic management [36]. Authors discussing the translation of big data into usable guidelines and algorithms are not just limiting the payoff to individualized treatment, however. Jameson and Longo, for instance, speak of not just a pharmacogenomic future, but one in which “guideline-based screening”, e.g., colonoscopy, can be targeted on the basis of age and family history [5]. Family health history is one of several tools, including individualized genetic testing and family cascade testing, fueling the public health drive towards precision interventions [37, 38]. The public health approach to precision medicine, or “precision public health”, is highly evidence-based. Precision public health is exemplified in the Centers for Disease Control and Prevention’s emphasis on the implementation of Tier 1 genetic tests that have passed systematic review for analytic and clinical validity and utility – family history-based hereditary breast and ovarian cancer (HBOC) genetic testing (BRCA1/2 mutations in relatives), and hereditary nonpolyposis colorectal cancer genetic testing (Lynch syndrome MLH1, MSH2, MSH6, PMS2, EPCAM mutations) [39]. Indeed, genetic counseling and testing for HBOC are already incorporated into healthcare reform as services not requiring co-pay for individuals deemed at risk by their providers [40]. The PMI promises much more, however, and part of the vision of public health is that precision techniques can be used to direct genetic preventive strategies to those subsets of the population that will derive maximal benefit [41].

PUBLIC HEALTH INTERVENTIONS AND COST-EFFECTIVNESS The Precision Public Health Approach to Lung Cancer It has been remarked that “although personalized treatments can help save the lives of sick people, prevention applies to all” [3]. This comment applies especially to lung cancer, which can be tackled as we have seen individually and after it has manifested, or by using a preventive, population-based approach. Initial genome-wide association studies (GWAS) published by several investigative teams in 2008 were suggestive of lung cancer susceptibility genes being situated on the long arm of chromosome 15 [42]. The studies were all large (3,500 to 14,000 participants) and replicated, yielding strong evidence for an association between SNP variations at 15q24/15q25.1 and lung cancer. Thorgeirsson et al. found a highly significant association (P = 1.5 x 10-8) between a common variant in the nicotinic acetylcholine receptor gene cluster on chromosome 15q24 and smoking frequency, with an odds ratio of 1.31 (1.19 – 1.44, 95% C.I.) between nicotine dependent cases and low quantity smokers plus population controls [43]. Studies by Hung et al. [44] and Amos et al. [45] found odds ratios between 1.21 and 1.77 for associations between the nicotinic acetylcholine receptor regions 15q25 and 15q25.1 and lung

1536

Stephen M. Modell, Sharon L. R. Kardia and Toby Citrin

cancer in ever smokers, the former accounting for 14% (attributable risk) of the lung cancer cases in the first study. The second study examined 2,724 NSCLC cases, the same type of cancer being treated in later stages by pharmacogenomics regimens. More recent GWAS in never-smoking Asian females have pointed out genetic associations independent of smoking status. Case-control studies of never-smoking Asian females funded through the National Institutes of Health [46] and the Mayo Foundation [47] have identified genetic variants in the 3q28 and 13q31.3 regions associated with risk for lung cancer (N = 754 to 7,254 participants). These associations show both statistical significance (P = 10-6 to 10-8) in terms of odds ratios and allelic risk, and biological plausibility (association with the regulation of cell proliferation and division). These two lines of discovery – lung cancer in connection with nicotine dependence and independent of it – could beneficially lead to both personalized smoking-cessation interventions, and to increased screening of people at risk for lung cancer [41]. The difficulty is that the association studies are at the primary research (T1) stage and do not yet imply clinical validity. Precision medicine in public health terms involves targeting groups at risk. Various professional societies have developed guidelines for lung cancer screening, generally beginning at age 55 [48]. The NCCN lung cancer screening guidelines recommend screening individuals age 50-55 years, those who have between 20 and 30 pack-years of exposure, and who exhibit one additional risk factor, such as family history. The relative risk of developing lung cancer is 1.8 if the individual has at least one first-degree relative with lung cancer, and 3.0 given two first-degree relatives with the condition [49]. The positive and negative predictive values for lung cancer appearing in a proband’s first-degree relatives are 89.9% and 99.1%, respectively [50]. In the Utah Family High Risk Program, the cost of taking a family health history varied between $10 and $25 depending upon receipt of follow-up educational interventions [51]. These figures indicate cost-effectiveness for the use of family history in risk assessment for lung cancer. Public health programs are especially concerned with the rights and welfare of underserved groups, an aim that is built into public health codes of ethics [52]. Surprisingly, of the 58,160 lung disease studies published between 1993 and 2013, less than 5% reported the inclusion of minority participants [53]. NIH is presently consulting researchers adept at recruiting underrepresented groups into studies as part of PMI Research Cohort formation. An admixture study of 1812 African Americans performed by the Karmanos Cancer Institute in Detroit, MI demonstrates what can come out of the use of the PMI Cohort. Excess African ancestry was observed on chromosome 3q among ever smokers with NSCLC, a chromosomal region identified by previous studies with mostly persons of European ancestry [54].

The Precision Public Health Approach to Breast Cancer About 10 to 15% of women diagnosed with breast cancer have germline mutations in the BRCA1 or 2 genes. Between 10 and 30% of women under age 60 diagnosed with triple-negative breast cancer (cancer which does not have receptors for estrogen, progesterone, or HER2/neu) display a BRCA1/2 mutation [55]. Ashkenazi Jewish ancestry confers an increased risk, though such mutations are by no means relegated to just one group. Like lung cancer, the public health approach to hereditary breast and ovarian cancer (HBOC) focuses on primary prevention before disease has appeared. Primary prevention can be conducted through a variety of means, several

The Precision Medicine and Precision Public Health Approaches …

1537

of which fit under a public health precision model. A study out of the Cleveland Clinic Genomic Medicine Institute compared two methods for cancer risk assessment – “family history-based risk assessment” and “DTC [Direct-to-Consumer] personal genomic screening,” the latter using a variety of risk alleles [56]. Of 22 high risk females appearing in clinic, family history classified eight individuals as being at risk for breast cancer, but only one of the eight was classified as high-risk through personal genomic screening method. Family history is a quick way of identifying risk, and has value in this instance as it does with lung cancer. Valdez et al. note that the relative risk of developing breast cancer is 1.8 and ovarian cancer 2.9 if the individual has at least one first-degree relative with these conditions [49]. It is 3.0 and 14.7 given two affected first-degree relatives. The positive and negative predictive values for these cancers appearing in a proband’s first-degree relatives are 89.1% and 98.9% for breast cancer, and 76.1% and 99.3% for ovarian cancer [50]. The U.S. Preventive Services Task Force (USPSTF) has conducted evidence reviews of genetic testing for the key mutations involved in HBOC, BRCA1 and 2. It recommends: Primary care providers screen women who have family members with breast, ovarian, tubal, or peritoneal cancer with 1 of several screening tools designed to identify a family history that may be associated with an increased risk for potentially harmful mutations in breast cancer susceptibility genes (BRCA1 or BRCA2). Women with positive screening results should receive genetic counseling and, if indicated after counseling, BRCA testing. [57]

The CDC-OPHG classifies the use of family history of known breast/ovarian cancer with deleterious BRCA mutations as Tier 1 [39]. CDC defines Tier 1 genetic interventions as those supported by clinical practice guidelines based on thorough systematic review. These modalities are ready for implementation not just on the individual but on the level of the at-risk population as well [38]. Family history, however, is part of a train of diagnostic interventions, including genetic counseling and genetic testing. The latter can lead to annual screening via MRI or to surgery. A 2012 cost-effectiveness analysis of BRCA1/2 testing of women >= 35 years at elevated risk of carrying a mutation, considering the eventual use of these MRI and surgery, determined genetic testing to be cost-effective if testing cost were 200 CGG), premutated individuals (55-200 CGG) and intermediate alleles (45-54 CGG). In 1984, Fryns [1] studied a large population of fragile X males, describing a behavioral phenotype of hyperactivity and impaired attention, marked anxiety with poor eye contact, affective liability, aggression, self-injurious behavior (especially the characteristic hand biting), and autistic features reported as repetitive, perseverative and stereotypic behaviors. This basic formulation of the fragile X behavioral phenotype has remained intact to the present day, with substantial confirmation of these basic findings in subsequent studies.

FRAGILE X SYNDROME Fragile X patients suffer maladaptive behaviors and emotional disturbance with an enormous functional impairment; symptoms are a frequent reason for families to seek treatment and can lead to institutionalization in more severe cases.

Autism Disorders Autistic disorder is the most debilitating subgroup of a larger category known as pervasive developmental disorders (American Psychiatric Association) characterized by impairment in social interaction and verbal and non-verbal communication, and restricted, repetitive and stereotypic patterns of behavior, interests and activities. Although there is considerable variability in individual symptoms, core deficits in social communication and restricted and repetitive behaviors are hallmarks of the disorder [2]. FXS is the leading known monogenic

Psychiatric Aspects in Fragile X Syndrome and Related Phenotypes

1897

cause of autism, accounting for approximately 5% of autism cases [reviewed in 3] and autism is one of the most recognized and severe behavioral abnormalities observed in males with FXS [4-8]. In individuals with the full mutation, approximately 30–50% meet full DSM-IV-TR criteria for autism with 60–74% fulfilling criteria for an autism spectrum disorder (ASD) [913]. Over 90% of individuals with FXS display some form of atypical behavior characteristic of autism, including social interaction (e.g., avoidance of eye contact, social withdrawal, and social anxiety) and repetitive and stereotyped behaviors [14]. Co-morbid FXS and autism are indicative of worse developmental outcomes [15-17], and greater impairment in cognition and adaptive behavior skills are more severe aberrant behavior than FXS without autism [18]. It has been suggested that autistic behaviors increase slowly but significantly over time, as do associated social avoidance behaviors [19]. The main dilemma arises when considering the pathogenesis of clinical autism spectrum in patients diagnosed with the FXS. Some authors consider that the clinical autism spectrum in these patients is a consequence of pathophysiological alterations resulting from the mutation of the FMR1 gene, while other authors consider that this clinical autism spectrum in these patients has an etiopathological mechanism similar to idiopathic autism. These different points of view are generated due to the fact that diagnostic criteria for autism spectrum disorders are purely clinical. Likewise, Harris (2011) [20] has proposed a focus on brain-behavior relationships targeting advancement of behavioral phenotyping in neurogenetic disorders precluding the application of DSM-IV diagnostic behavioral criteria to identify disorders such as FXS. He proposed that FXS is a neural model and phenocopy of autism and should not be considered a genetic model for autism. On the other hand, a number of investigators have reported findings indicating highly similar profiles between individuals with FXS and autism versus idiopathic autism and apply categorical or dimensional ratings of autism in FXS [9,16,21-23]. These authors agree with the concept that the autism phenomenon represents a range of behaviors, and perhaps also of other neurologic features [24]. While there is clear consensus regarding the shared phenomenology between FXS and idiopathic autism, there is great debate regarding diagnostic issues. Two of the primary debates on FXS center around questions of whether autism in FXS represents a continuum, with only those most severely affected meeting criteria for autism, and whether autism in FXS is the same as or different from idiopathic autism [9]. Although the literature on the co-morbidity of FXS and autism is extensive, few published studies have longitudinally examined early indicators of autism in infants. Study of the emerging characteristics in FXS is critical for understanding if early features in infants with FXS are associated with later autistic behaviors as reported in idiopathic autism. To date, the studies that have been conducted lend evidence to the fact that indicators of autism are present at as early as 12 months of age in males with FXS, and replicate findings in idiopathic autism that implicate difficulties, with disengagement of attention and shifts in behavior at 6 to 12 months of age in the later development of autism [25-27]. Clearly, brain–behavior relationships in idiopathic autism and FXS are complex, and there is currently insufficient evidence to resolve these debates. In summary, however, despite all the controversies generated in the diagnosis of clinical ASD, at present the FMR1 gene is considered the most common monogenic cause of ASD, and therefore, the molecular diagnosis of FXS should be ruled out in all ASD [28].

1898

E. Mur and M. Milà

Hyperactivity Disorders Attention deficit and hyperactivity (ADHD) is the most common diagnosable condition in FXS patients, with most males meeting formal criteria at some point in their lives. This condition is typically not stable over time in any given individual [1]. Using DSM-V, several of the ADHD symptoms must be present in individuals prior to the age of 12 years, compared to 7 years as the age of onset in DSM-IV. This change is supported by substantial research published since 1994 that found no clinical differences between children identified at 7 years versus later in terms of the course, severity, outcome, or treatment response. DSM-5 includes no exclusion criteria for people with ASD, since symptoms of both disorders co-occur. The higher inattentiveness, restlessness, fidgetiness and impulsivity in ADHD in children with FXS is suggestive of the ADHD inattentive sub-type compared to ADHD in the general population; these features do not necessarily improve with age [29]. The signature of the FXS is strong unsustained attention, but poor capacity to switch between tasks and weaker inhibitory control [reviewed in 30]. Very young children with FXS are often noted to be physically hypoactive, with somewhat impaired attention. Preschool children can display dramatic increases in activity levels, leading to markedly disruptive behavior. As children grow, hyperactivity declines with increasing body mass, while problems with attention continue throughout life. This can be seen as similar to the course of ADHD in the normal population, though the degree of hyperactivity in FXS is impressive. There is also evidence that the attention deficit seen in males with FXS has a specific profile [31], which is distinct from other causes of developmental disorders, suggesting that the attention problems seen in the course of FXS may represent more than nonspecific immaturity. There is evidence that ADHD symptoms in FXS respond to stimulants [32,33].

Mood Disorders There has been considerable controversy regarding the behavior phenotype of FXS and the nature of behavioral and emotional problems associated with it. As described by Backes and colleagues (2000) [34], males with FXS rarely meet formal criteria for a diagnosis of a major mood disorder as defined in DSM-V. Diagnoses such as major depression or bipolar disorder require periods of abnormal mood that are sustained, whereas individuals with FXS typically exhibit labile mood, irritability, self-injurious behavior, and aggressive outbursts of a more fleeting and episodic nature, not meeting the conventional duration criteria. These episodes are typically adaptive, related to environmental stressors and are less frequent in familial or more structured settings. However, affective symptoms can be severe and disruptive, and psychopharmacologic intervention is needed. Selective serotonin reuptake inhibitors are a commonly employed treatment strategy for affective symptoms, along with other antidepressants, anticonvulsants, and atypical antipsychotics in more severe cases [33]. There have been no clinical trials of any size, open or controlled, of antidepressants or anticonvulsants for the treatment of affective symptoms of FXS. Curiously, the study of valproic acid by Torrioli and collaborators (2010) [35] focused exclusively on ADHD symptoms in boys and they considered that this treatment could be considered as an alternative to treating symptoms with stimulants the efficacy of which needs

Psychiatric Aspects in Fragile X Syndrome and Related Phenotypes

1899

to be confirmed by further studies in patients with FXS. Behavioral problems in FXS improve from childhood to young adulthood [36].

Anxiety Disorders Children with neurodevelopmental disorders, such as FXS, have a higher risk of presenting anxiety. Patients with FXS display a broad range of anxiety symptoms, but these symptoms often do not fit into the established categories of major anxiety disorders employed by the DSM. Cordeiro and coworkers (2011) [37] examined the prevalence of anxiety disorders in a FXS population using DSM-IV-TR criteria. They found that 83% of participants (n=97, ages 5.5– 33.3 years) met criteria for any anxiety disorder, and 58% exhibited multiple anxiety disorders. In addition to the high proportion of anxiety disorders in FXS, an important part of individuals with FXS display autistic symptoms as mentioned previously. Symptoms of anxiety and autism overlap and interrelate within FXS, although these disorders have been distinguished through behavioral and physiological profiles. Kaufmann, Budimirovic and colleagues have published a series of papers characterizing anxiety and autism as distinct social interaction disorders in FXS [38-39]. These authors propose that social anxiety emerges from a combination of lower non-verbal abilities and moderate social withdrawal, whereas autism (either alone or in conjunction with social anxiety) is characterized by a more complex constellation of severe social withdrawal and lower adaptive socialization or verbal skills. Negative affect is one of the most commonly studied predictors of problem behaviors in non-clinical [40-41] and clinical [42] populations. Negative affect is composed of several specific dimensions of temperament; including fear, approach, soothability, sadness, anger, discomfort, and motor activity [43] and predicts anxiety in preschool boys with FXS [44]. Multilevel models indicate associations between elevated anxiety and higher fear and sadness, lower soothability, and steeper longitudinal increases in approaches in the FXS population. A minority of males with FXS fulfill formal criteria for the diagnosis of obsessivecompulsive disorder (OCD), while “compulsive symptoms” have been noted in several studies in a large majority of subjects with FXS. In most cases of FXS, individuals exhibit symptoms strongly reminiscent of obsessions and compulsions, but which do not meet the precise psychiatric definitions for these symptoms. Often, pleasure is derived from repetitive and “compulsive” behaviors, in contrast to the ego-dystonic nature of true obsessions and compulsions. Hoarding, counting, and the need for symmetry are all typical symptoms of OCD frequently seen in FXS. Similarly, younger children with FXS meet the criteria for separation anxiety disorder in a small minority of cases [34], while symptoms of separation anxiety, social phobia, panic, and agoraphobia are seen clinically at a much higher rate. The psychiatric drugs currently available can provide significant symptomatic relief of the hyperactivity, anxiety disorders, and affective disturbances often seen in the course of FXS. However, patients with this syndrome may be especially susceptible to the psychiatric side effects of these medications, requiring particular care in their prescription.

1900

E. Mur and M. Milà

PREMUTATION CARRIERS For many years, premutation carriers of the FMR1 gene were considered asymptomatic, but various clinical disorders have been associated in both men and women, being Fragile X tremor –ataxia syndrome (FXTAS) one of the most severe. Individuals with carrier premutation are those that have alleles between 55-200 CGG. Some of the clinical features have been related to the CGG number; in general, more length in the CGG track implies more severe clinical manifestations. There is a growing body of evidence suggesting that FMR1 premutation carriers may have increased vulnerability of presenting psychiatric disorders [45]. However, the presence of neuropsychological and behavioral impairment among FMR1 premutation carriers remains controversial, as these features were initially thought to be associated with the stress of raising children with FXS [reviewed in 46]. Altered neurobehavioral profiles including variation of phenotypes associated with mood and anxiety may be expected among younger premutation carriers. An increased risk of anxiety and mood disorders among premutation carriers has not been established. Some studies have reported a lack of phenotype [47-48], while others have described repeat length associations with psychiatric symptoms [49-50]. Hessl and coworkers (2005)[51] found that the FMR1 transcript level, but not repeat length or Fragile X Mental retardation Protein (FMRP) levels, was significantly associated with increased severity of psychiatric symptoms in males, independently of FXTAS status. These results suggest that premutation carriers may be at risk of presenting emotional morbidity; however, phenotypic differences were subtle and of a small CGG effect size. The largest and most recent study of life-time mood and anxiety in the premutation population was completed by Bourgeois and colleagues (2009) [52]. In this study, the prevalence of anxiety disorders in carriers with and without FXTAS was compared with a very large age-matched national dataset. In terms of all anxiety disorders, only those with FXTAS demonstrated a higher prevalence. Upon separation, this was similarly true for panic disorder, post-traumatic stress disorder and specific phobia. Generalized anxiety disorder and OCD failed to demonstrate any difference between carriers and controls. Only social phobia was found to have higher levels in premutation carriers without FXTAS compared to controls. Chronic anxiety has also been associated with radiological signs on MRI; specifically, the higher the anxiety score the smaller the size of the hippocampus in women with the premutation [53]. Rodriguez-Revenga and collaborators (2008) [54] examined psychiatric and depressive symptoms in 34 FMR1 premutation carrier mothers of children with FXS in comparison with two control groups (39 mothers with a non-FXS intellectual disability child and 39 mothers from the general population). Both groups of mothers with a child with intellectual disability showed greater susceptibility to psychological problems than the control group without a mentally retarded child, but FMR1 premutated mothers evidenced a higher tendency to depression. These results suggest that, despite the stress of caring for a child with mental retardation, the premutation by itself could be responsible for some psychiatric traits. In a screening study of individuals from families with FXS, roughly 14% of boys and 5% of girls with the premutation were found to also have an ASD [10]. Even among those carriers not diagnosed with ASD, related psychological traits are more common among carriers

Psychiatric Aspects in Fragile X Syndrome and Related Phenotypes

1901

compared to controls without the premutation. A recent study examined a broad range of pragmatic language skills as well as related behavioral features of the broad autism phenotype among women with the premutation compared with mothers of children with autism, and mothers of typically developing children with no family history of FXS, autism, or language impairment [55]. In this study, conversational samples from a semistructured videotaped interview were used to assess pragmatic language using the Pragmatic Rating Scale (PRS) [56]. This study replicated previous findings in the autism parent group and also showed that women with the premutation exhibited similarly elevated rates of pragmatic language problems relative to the controls. The presence of broad autism phenotype traits was associated with greater expression of autism symptoms in their children with FXS. Other studies have also found increased rates of both social aloofness [49] and a rigid perfectionism [57] among carrier women. Given its relative rarity in the general population, psychosis has been challenging to study in premutation carriers. Initial linkage analysis failed to show a clear relationship of schizophrenia to the FMR1 gene [58]. Prevalence studies have found the overall rate of psychotic disorders to be low [49]. There have, however, been several case reports of combined psychotic illnesses and the premutation, including schizoaffective disorder [59] and with combined schizophrenia and schizoid personality disorder [60]. Interestingly, as opposed to frank psychotic disorders, multiple studies have found an increased prevalence of schizotypal personality traits in the carrier population [49,61]. Attention regulation difficulties have been proposed to be a problem in people with the premutation. Notably, when compared with their control siblings, premutation carriers had significantly more issues related to attention than their noncarrier siblings [62]. Inattention and impulsivity amongst FMR1 carriers can be problematic through adulthood [63], although hyperactivity was not noted to be increased in prevalence. Dysthymia and bipolar disorder have generally failed to demonstrate significant levels in carriers compared to controls [52].

FRAGILE X ASSOCIATED TREMOR ATAXIA SYNDROME (FXTAS) FXTAS is an X-linked neurodegenerative disorder affecting up to 45.5% of males and 16.5% of females carrying a premutation in the FMR1 gene [64-65]. There is a growing body of literature suggesting that the neuropsychiatric features of FXTAS follow a fronto-subcortical pattern with primary impairments in executive function and increased vulnerability to mood and anxiety disorders [51,53, 66-69] Increased rates of psychiatric symptoms may represent early markers of neurodegenerative diseases such as Parkinsons Disease (PD) [70] and Huntington’s Disease [71], which have also been reported among FMR1 premutation carriers without FXTAS, including obsessivecompulsive symptoms [51], social phobia [72], depression [50], schizotypal features [73] and abnormalities in social cognition [74]. Three studies have examined the psychiatric features of FXTAS: (1) Bacalman et al. (2006) [67]; (2) Adams et al. (2010) [53]; and (3) Hashimoto et al. (2011) [69]. They showed no significant association between FXTAS and different psychiatric diagnoses. The studies compared the prevalence of neuropsychiatric symptoms between individuals with FXTAS and

1902

E. Mur and M. Milà

matched controls with normal FMR1 alleles (cohort 1 and 3), and between asymptomatic FMR1 premutation carriers in cohort 2. Symptoms of depression were significantly elevated among males with FXTAS when measured using the informant-rated NPI in cohort 1; however, self-reported symptoms measured using the SCL-90-R in cohort 3 were comparable to controls. Women with FXTAS (cohort 2) tended to report higher rates of depression than controls with normal FMR1 alleles; however, this difference did not withstand correction for multiple comparisons. Anxiety was significantly elevated among older males with FXTAS compared to controls in cohort 2; however, in cohort 1 the group difference (50% FXTAS group vs. 0% control group) was not significant, possibly due to the small sample size (n=14). Male carriers with FXTAS exhibited elevated rates of anxiety in cohort 3 (Cohen’s d=0.69) and comparable scores in cohort 2. Females with FXTAS (cohort 2) exhibited higher rates of anxiety and obsessivecompulsive symptoms compared to controls with normal FMR1 alleles and asymptomatic FMR1premutation carriers. Males with FXTAS (cohorts 2 and 3) reported significantly higher rates of obsessive compulsive symptoms compared to asymptomatic carriers (Cohen’s d=0.92, cohort 7), but not controls (cohort 2). Symptoms of anxiety among asymptomatic male and female FMR1 premutation carriers were compared to controls with normal alleles in cohort 2 and no group differences were detected. Additional informant-rated behavioral disturbances found to be significantly elevated among males with FXTAS (cohort 1) compared to controls included apathy, irritability, disinhibition, and agitation/aggression (Cohen’s d=3.53) [67]. Increased obsessive-compulsive and depressive symptoms (but not anxiety) were also associated with decreased left amygdala volume among males with FXTAS in cohort 3 (all ps90% 30-50% 60-74%

Affective disorders

22% Females 12% Males 83%

Anxiety

PM without FXTAS

14% Males 5% females 30% Females 14% Males

30% Females 60% Males

References [14] [11-13] [11-12,57] [62]

65%

55.7% 34.2%

[49,62,72]

52%

35-40%

[37,49,72,]

CONCLUSION FMR1 is the first monogenic cause of autism disorder. Approximately 30–50% of FXS meet full DSM-IV-TR criteria for autism, 60–74% fulfilling criteria for an ASD and over 90% of individuals display some form of atypical behavior characteristic of autism. Molecular diagnosis of FXS should be ruled out in all ASD. Increased rates of psychiatric symptoms may represent early markers of neurodegenerative diseases which have been reported among FMR1 premutation carriers with and without FXTAS; including obsessive-compulsive symptoms, social phobia, depression, schizotypal features, and abnormalities in social cognition. Altered neurobehavioral profiles including a variation of phenotypes associated with mood and anxiety may be expected among younger premutation carriers. The trend is to present higher rates of anxiety and mood disorders in premutation carriers, but no study has found significant differences between carriers and the control population.

REFERENCES [1]

Fryns JP. The fragile X syndrome. A study of 83 families. Clin. Genet. 1984;26(6):497– 528.

1904 [2]

[3] [4]

[5]

[6] [7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

E. Mur and M. Milà Tager-Flusberg H, Rogers S, Cooper J, Landa R, Lord C, Paul R, Rice M, Stoel-Gammon C, Wetherby A, Yoder P. Defining spoken language benchmarks and selecting measures of expressive language development for young children with autism spectrum disorders. J Speech Lang Hear Res. 2009 Jun;52(3):643-52. Hagerman RJ, Hall DA, Coffey S, Leehey M, Bourgeois J, Gould J, Zhang L, Seritan A, Berry-Kravis E, Olichney J, Miller JW, Fong AL, Carpenter R, Bodine C, Gane LW, Rainin E, Hagerman H, Hagerman PJ. Treatment of fragile X-associated tremor ataxia syndrome (FXTAS) and related neurological problems. Clin. Interv Aging. 2008;3(2):251-62. Review. Hagerman RJ, JacksonAW III, Levitas A, Rimland B, Barden M, 1986. An analysis of autism in fifty males with the fragile X syndrome. Am. J. Med. Genet 23:359-374. Baumgardner TL, Reiss AL, Freund LS, Abrams MT. Specification of the neurobehavioral phenotype in males with fragile X syndrome. Pediatrics 1995;95(5):744–752. Bailey DB Jr, Mesibov GB, Hatton DD, Clark RD, Roberts JE, Mayhew L. Autistic behavior in young boys with fragile X syndrome. J. Autism Dev. Disord. 1998 Dec;28(6):499-508. Kaufman WE, Reiss AL. Molecular and cellular genetics of fragile X syndrome. Am. J. Med. Genet.1999;88:11-24. Hagerman RJ. The physical and behavioral phenotype. In Hagerman RJ, Hagerman PJ, editors. Fragile X syndrome: Diagnosis, treatment, and research. Baltimore, MD: The Johns Hopkins Univerity Press. 2002;pp 3-109 Kaufmann WE, Cortell R, Kau AS, Bukelis I, Tierney E, Gray RM, Cox C, Capone GT, Stanard P. Autism spectrum disorder in fragile X syndrome: communication, social interaction, and specific behaviors. Am. J. Med. Genet A. 2004 Sep 1;129A(3):225-34. Clifford S, Dissanayake C, Bui QM, Huggins R, Taylor AK, Loesch DZ. Autism spectrum phenotype in males and females with fragile X full mutation and premutation. J. Autism Dev. Disord 2007, 37:738–747. Hall SS, Lightbody AA, Reiss AL. Compulsive, self-injurious, and autistic behavior in children and adolescents with fragile X syndrome. Am. J. Ment. Retard. 2008 Jan;113(1):44-53. Harris SW, Hessl D, Goodlin-Jones B, Ferranti J, Bacalman S, Barbato I, Tassone F, Hagerman PJ, Herman H, Hagerman RJ. Autism profiles of males with fragile X syndrome. Am. J. Ment. Retard. 2008 Nov;113(6):427-38. Bailey DB, Raspa M, Holiday D, Bishop E, Olmsted M. Functional skills of individuals with fragile x syndrome: a lifespan cross-sectional analysis. Am. J. Intellect Dev. Disabil. 2009 Jul;114(4):289-303. Hernandez RN, Feinberg RL, Vaurio R, Passanante NM, Thompson RE, Kaufmann WE. Autism spectrum disorder in fragile X syndrome: a longitudinal evaluation. Am. J. Med. Genet A. 2009 Jun;149A(6):1125-37. Bailey DB Jr, Hatton DD, Mesibov G, Ament N, Skinner M. Early development, temperament, and functional impairment in autism and fragile X syndrome. J. Autism Dev. Disord. 2000 Feb;30(1):49-59. Rogers SJ, Wehner DE, Hagerman R. The behavioral phenotype in fragile X: symptoms of autism in very young children with fragile X syndrome, idiopathic autism, and other developmental disorders. J. Dev. Behav. Pediatr. 2001 Dec;22(6):409-17.

Psychiatric Aspects in Fragile X Syndrome and Related Phenotypes

1905

[16] Kau AS, Tierney E, Bukelis I, Stump MH, Kates WR, Trescher WH, Kaufmann WE. Social behavior profile in young males with fragile X syndrome: characteristics and specificity. Am. J. Med. Genet A. 2004 Apr 1;126A(1):9-17. [17] Hatton DD, Sideris J, Skinner M, Mankowski J, Bailey DB Jr, Roberts J, Mirrett P. Autistic behavior in children with fragile X syndrome: prevalence, stability, and the impact of FMRP. Am. J. Med. Genet A. 2006 Sep 1;140A(17):1804-13. [18] Roberts JE, Weisenfeld LA, Hatton DD, Heath M, Kaufmann WE. Social approach and autistic behavior in children with fragile X syndrome. J. Autism Dev. Disord. 2007 Oct;37(9):1748-60. Epub 2006 Dec 19. [19] Harris JC. Brain and behavior in fragile x syndrome and idiopathic autism. Arch. Gen. Psychiatry. 2011 Mar;68(3):230-1. [20] Bailey DB Jr. Newborn screening for fragile X syndrome. Ment. Retard Dev. Disabil Res. Rev. 2004;10(1):3-10. Review. [21] Lewis P, Abbeduto L, Murphy M, Richmond E, Giles N, Bruno L, Schroeder S. Cognitive, language and social-cognitive skills of individuals with fragile X syndrome with and without autism. J. Intellect Disabil Res. 2006 Jul;50(Pt 7):532-45. [22] Hoeft F, Walter E, Lightbody AA, Hazlett HC, Chang C, Piven J, Reiss AL. Neuroanatomical differences in toddler boys with fragile x syndrome and idiopathic autism. Arch. Gen. Psychiatry. 2011 Mar;68(3):295-305. doi: 10.1001/archgen psychiatry.2010.153. Epub 2010 Nov 1. [23] Lord C, Petkova E, Hus V, Gan W, Lu F, Martin DM, Ousley O, Guy L, Bernier R, Gerdts J, Algermissen M, Whitaker A, Sutcliffe JS, Warren Z, Klin A, Saulnier C, Hanson E, Hundley R, Piggot J, Fombonne E, Steiman M, Miles J, Kanne SM, GoinKochel RP, Peters SU, Cook EH, Guter S, Tjernagel J, Green-Snyder LA, Bishop S, Esler A, Gotham K, Luyster R, Miller F, Olson J, Richler J, Risi S. A multisite study of the clinical diagnosis of different autism spectrum disorders. Arch. Gen. Psychiatry. 2012 Mar;69(3):306-13. Epub 2011 Nov 7. [24] Zwaigenbaum L, Bryson S, Rogers T, Roberts W, Brian J, Szatmari P. Behavioral manifestations of autism in the first year of life. Int. J. Dev. Neurosci. 2005 AprMay;23(2-3):143-52. [25] Baranek GT, Roberts JE, David FJ, Sideris J, Mirrett PL, Hatton DD, Bailey DB Jr. Developmental trajectories and correlates of sensory processing in young boys with fragile X syndrome. Phys. Occup. Ther Pediatr. 2008;28(1):79-98. [26] Roberts TP, Cannon KM, Tavabi K, Blaskey L, Khan SY, Monroe JF, Qasmieh S, Levy SE, Edgar JC. Auditory magnetic mismatch field latency: a biomarker for language impairment in autism. Biol. Psychiatry. 2011 Aug 1;70(3):263-9. Epub 2011 Mar 9. [27] Shen Y, Dies KA, Holm IA, Bridgemohan C, Sobeih MM, Caronna EB, Miller KJ, Frazier JA, Silverstein I, Picker J, Weissman L, Raffalli P, Jeste S, Demmer LA, Peters HK, Brewster SJ, Kowalczyk SJ, Rosen-Sheidley B, McGowan C, Duda AW 3rd, Lincoln SA, Lowe KR, Schonwald A, Robbins M, Hisama F, Wolff R, Becker R, Nasir R, Urion DK, Milunsky JM, Rappaport L, Gusella JF, Walsh CA, Wu BL, Miller DT; Autism Consortium Clinical Genetics/DNA Diagnostics Collaboration. Clinical genetic testing for patients with autism spectrum disorders. Pediatrics. 2010 Apr;125(4):e72735. [28] Turk J, Cornish K. Face recognition and emotion perception in boys with fragile-X syndrome. J. Intellect Disabil. Res. 1998 Dec;42 (Pt 6):490-9.

1906

E. Mur and M. Milà

[29] Cornish KM, Turk J, Wilding J, Sudhalter V, Munir F, Kooy F, Hagerman R. Annotation: Deconstructing the attention deficit in fragile X syndrome: a developmental neuropsychological approach. J. Child Psychol. Psychiatry. 2004 Sep;45(6):1042-53. Review. [30] Munir F, Cornish KM, Wilding J. A neuropsychological profile of attention deficits in young males with fragile X syndrome. Neuropsychologia. 2000;38(9):1261-70. [31] Berry-Kravis E, Potanos K. Psychopharmacology in fragile X syndrome-present and future. Ment. Retard Dev. Disabil Res. Rev. 2004;10(1):42-8. [32] Tsiouris JA, Brown WT. Neuropsychiatric symptoms of fragile X syndrome: pathophysiology and pharmacotherapy. CNS Drugs. 2004;18(11):687-703. [33] Backes M, Genç B, Schreck J, Doerfler W, Lehmkuhl G, von Gontard A. Cognitive and behavioral profile of fragile X boys: correlations to molecular data. Am. J. Med. Genet. 2000 Nov 13;95(2):150-6. [34] Torrioli M, Vernacotola S, Setini C, Bevilacqua F, Martinelli D, Snape M, Hutchison JA, Di Raimo FR, Tabolacci E, Neri G. Treatment with valproic acid ameliorates ADHD symptoms in fragile X syndrome boys. Am. J. Med. Genet A. 2010 Jun;152A(6):1420-7. [35] Einfeld S, Tonge B, Turner G. Longitudinal course of behavioral and emotional problems in fragile X syndrome. Am. J. Med. Genet. 1999 Dec 22;87(5):436-9. [36] Cordeiro L, Ballinger E, Hagerman R, Hessl D. Clinical assessment of DSM-IV anxiety disorders in fragile X syndrome: prevalence and characterization. J. Neurodev Disord. 2011 Mar;3(1):57-67. [37] Budimirovic DB, Bukelis I, Cox C, Gray RM, Tierney E, Kaufmann WE. Autism spectrum disorder in Fragile X syndrome: differential contribution of adaptive socialization and social withdrawal. Am. J. Med. Genet A. 2006 Sep 1;140A(17):181426. [38] Budimirovic DB, Kaufmann WE. What can we learn about autism from studying fragile X syndrome? Dev. Neurosci. 2011;33(5):379-94.. Review. [39] Calkins SD, Blandon AY, Williford AP, Keane SP. Biological, behavioral, and relational levels of resilience in the context of risk for early childhood behavior problems. Dev. Psychopathol. 2007 Summer;19(3):675-700. [40] Lemery KS, Essex MJ, Smider NA. Revealing the relation between temperament and behavior problem symptoms by eliminating measurement confounding: expert ratings and factor analyses. Child Dev. 2002 May-Jun;73(3):867-82. [41] Hutman T, Rozga A, DeLaurentis AD, Barnwell JM, Sugar CA, Sigman M. Response to distress in infants at risk for autism: a prospective longitudinal study. J. Child Psychol. Psychiatry. 2010 Sep;51(9):1010-20. [42] Putnam SP, Stifter CA. Behavioral approach-inhibition in toddlers: prediction from infancy, positive and negative affective components, and relations with behavior problems. Child Dev. 2005 Jan-Feb;76(1):212-26. [43] Tonnsen BL, Malone PS, Hatton DD, Roberts JE. Early negative affect predicts anxiety, not autism, in preschool boys with fragile X syndrome. J. Abnorm Child Psychol. 2013 Feb;41(2):267-80. [44] Hunter JE, Leslie M, Novak G, Hamilton D, Shubeck L, Charen K, Abramowitz A, Epstein MP, Lori A, Binder E, Cubells JF, Sherman SL. Depression and anxiety symptoms among women who carry the FMR1 premutation: impact of raising a child

Psychiatric Aspects in Fragile X Syndrome and Related Phenotypes

[45]

[46]

[47]

[48]

[49]

[50]

[51]

[52]

[53]

[54]

[55] [56] [57]

1907

with fragile X syndrome is moderated by CRHR1 polymorphisms. Am. J. Med. Genet B Neuropsychiatr Genet. 2012. Epub 2012 May 9. Hunter JE, Abramowitz A, Rusin M, Sherman SL. Is there evidence for neuropsychological and neurobehavioral phenotypes among adults without FXTAS who carry the FMR1 premutation? A review of current literature. Genet Med. 2009 Feb;11(2):79-89. Review. Reiss AL, Freund L, Abrams MT, Boehm C, Kazazian H. Neurobehavioral effects of the fragile X premutation in adult women: a controlled study. Am. J. Hum. Genet 1993, 52:884–894. Sobesky WE, Taylor AK, Pennington BF, Bennetto L, Porter D, Riddle J, Hagerman RJ. Molecular/clinical correlations in females with fragile X. Am. J. Med. Genet. 1996 Aug 9;64(2):340-5. Franke P, Leboyer M, Gansicke M, Weiffenbach O, Biancalana V, Cornillet-Lefebre P, Maier W. Genotype-phenotype relationship in female carriers of the premutation and full mutation of FMR-1. Psychiatry Res 1998, 80:113–127. Johnston C, Eliez S, Dyer-Friedman J, Hessl D, Glaser B, Blasey C, Taylor A, Reiss A. Neurobehavioral phenotype in carriers of the fragile X premutation. Am. J. Med. Genet. 2001 Nov 1;103(4):314-9. Hessl D, Tassone F, Loesch DZ, Berry-Kravis E, Leehey MA, Gane LW, Barbato I, Rice C, Gould E, Hall DA, Grigsby J, Wegelin JA, Harris S, Lewin F, Weinberg D, Hagerman PJ, Hagerman RJ. Abnormal elevation of FMR1 mRNA is associated with psychological symptoms in individuals with the fragile X premutation. Am. J. Med. Genet B Neuropsychiatr Genet. 2005 Nov 5;139B(1):115-21. Bourgeois JA, Coffey SM, Rivera SM, Hessl D, Gane LW, Tassone F, Greco C, Finucane B, Nelson L, Berry-Kravis E, Grigsby J, Hagerman PJ, Hagerman RJ. A review of fragile X premutation disorders: Expanding the psychiatric perspective. J. Clin. Psychiatry 2009, 70:852–862. Adams PE, Adams JS, Nguyen DV, Hessl D, Brunberg JA, Tassone F, Zhang W, Koldewyn K, Rivera SM, Grigsby J, Zhang L, Decarli C, Hagerman PJ, Hagerman RJ. Psychological symptoms correlate with reduced hippocampal volume in fragile X premutation carriers. Am. J. Med. Genet B Neuropsychiatr Genet. 2010 Apr 5;153B(3):775-85. Rodriguez-Revenga L, Madrigal I, Alegret M, Santos M, Milà M. Evidence of depressive symptoms in fragile-X syndrome premutated females. Psychiatr Genet. 2008 Aug;18(4):153-5. Losh M, Klusek J, Martin GE, Sideris J, Parlier M, Piven J. Defining genetically meaningful language and personality traits in relatives of individuals with fragile X syndrome and relatives of individuals with autism. Am. J. Med. Genet B 2012, 159B:660– 668. Landa R, Piven J, Wzorek MM, Gayle JO, Chase GA, Folstein SE: Social language use in parents of autistic individuals. Psychol. Med. 1992, 22:245–254 Hessl D, Rivera SM, Reiss AL: The neuroanatomy and neuroendocrinology of fragile X syndrome. Ment. Retard Dev. D R 2004, 10:17–24 Ashworth A, Abusaad I, Walsh C, Nanko S, Murray RM, Asherson P, Collier DA. Linkage analysis of the fragile X gene FMR-1 and schizophrenia: no evidence for linkage

1908

[58] [59]

[60]

[61]

[62]

[63] [64]

[65]

[66]

[67]

[68]

[69]

[70]

[71]

E. Mur and M. Milà but report of a family with schizophrenia and an unstable triplet repeat. Psychiatr Genet 1996, 6:81–86. Al-Semaan Y, Malla AK, Lazosky A: Schizoaffective disorder in a fragile-X carrier. Aust. N Z J. Psychiatry 1999, 33:436–440. Khin NA, Tarleton J, Raghu B, Park SK: Clinical description of an adult male with psychosis who showed FMR1 gene methylation mosaicism. Am. J. Med. Genet 1998, 81:222–224. Thompson NM, Rogeness GA, McClure E, Clayton R, Johnson C: Influence of depression on cognitive functioning in Fragile X females. Psychiatry Res 1996, 64:97– 104. Bailey DB Jr, Raspa M, Olmsted M, Holiday DB. Co-occurring conditions associated with FMR1 gene variations: findings from a national parent survey. Am. J. Med. Genet A. 2008 Aug 15;146A(16):2060-9. Hunter JE, Allen EG, Abramowitz A, Rusin M, Leslie M, Novak G, Sherman SL. No evidence for a difference in neuropsychological profile among carriers and noncarriers of the FMR1 premutation in adults under the age of 50. Am. J. Hum. Genet. 2008, 83:692– 702. Hagerman RJ, Hagerman PJ.Fragile X syndrome: a model of gene-brain-behaviour relationships. Rev. Neurol. 2001 Oct;33 Suppl 1:S51-7. Review. Spanish. Rodriguez-Revenga L, Madrigal I, Pagonabarraga J, Xunclà M, Badenas C, Kulisevsky J, Gomez B, Milà M. Penetrance of FMR1 premutation associated pathologies in fragile X syndrome families. Eur. J. Hum. Genet. 2009 Oct;17(10):1359-62. Hagerman RJ, Leavitt BR, Farzin F, Jacquemont S, Greco CM, Brunberg JA, Tassone F, Hessl D, Harris SW, Zhang L, Jardini T, Gane LW, Ferranti J, Ruiz L, Leehey MA, Grigsby J, Hagerman PJ. Fragile-X-associated tremor/ataxia syndrome (FXTAS) in females with the FMR1 premutation. Am. J. Hum. Genet. 2004 May;74(5):1051-6. Bacalman S, Farzin F, Bourgeois JA, Cogswell J, Goodlin-Jones BL, Gane LW, Grigsby J, Leehey MA, Tassone F, Hagerman RJ. Psychiatric phenotype of the fragile Xassociated tremor/ataxia syndrome (FXTAS) in males: newly described frontosubcortical dementia. J. Clin. Psychiatry. 2006 Jan;67(1):87-94. Bourgeois JA, Cogswell JB, Hessl D, Zhang L, Ono MY, Tassone F, Farzin F, Brunberg JA, Grigsby J, Hagerman RJ. Cognitive, anxiety and mood disorders in the fragile Xassociated tremor/ataxia syndrome. Gen. Hosp. Psychiatry. 2007 Jul-Aug;29(4):349-56. Hashimoto R, Backer KC, Tassone F, Hagerman RJ, Rivera SM. An fMRI study of the prefrontal activity during the performance of a working memory task in premutation carriers of the fragile X mental retardation 1 gene with and without fragile X-associated tremor/ataxia syndrome (FXTAS). J. Psychiatr Res. 2011 Jan;45(1):36-43. Shiba M, Bower JH, Maraganore DM, McDonnell SK, Peterson BJ, Ahlskog JE, Schaid DJ, Rocca WA. Anxiety disorders and depressive disorders preceding Parkinson's disease: a case-control study. Mov. Disord. 2000 Jul;15(4):669-77. Duff K, Paulsen JS, Beglinger LJ, Langbehn DR, Stout JC; Predict-HD Investigators of the Huntington Study Group. Psychiatric symptoms in Huntington's disease before diagnosis: the predict-HD study. Biol. Psychiatry. 2007 Dec 15;62(12):1341-6. Epub 2007 May 3. Bourgeois JA, Seritan AL, Casillas EM, Hessl D, Schneider A, Yang Y, Kaur I, Cogswell JB, Nguyen DV, Hagerman RJ. Lifetime prevalence of mood and anxiety disorders in

Psychiatric Aspects in Fragile X Syndrome and Related Phenotypes

[72] [73]

[74]

[75] [76]

[77]

[78] [79] [80]

1909

fragile X premutation carriers. J. Clin. Psychiatry. 2011 Feb;72(2):175-82. Epub 2010 Aug 24. Sobesky WE, Hull CE, Hagerman RJ. Symptoms of schizotypal personality disorder in fragile X women. J. Am. Acad. Child Adolesc. Psychiatry. 1994 Feb;33(2):247-55. Cornish K, Kogan C, Turk J, Manly T, James N, Mills A, Dalton A. The emerging fragile X premutation phenotype: evidence from the domain of social cognition. Brain Cogn. 2005 Feb;57(1):53-60. Hocking DR, Kogan CS, Cornish KM. Selective spatial processing deficits in an at-risk subgroup of the fragile X premutation. Brain Cogn. 2012 Jun;79(1):39-44. doi: 10.1016/j.bandc.2012.02.005. Mitchell RJ, Holden JJ, Zhang C et al: FMR1 alleles in Tasmania: a screening study of the special educational needs population. Clin. Genet. 2005; 67: 38–46. Crawford DC, Meadows KL, Newman JL et al: Prevalence and phenotype consequence of FRAXA and FRAXE alleles in a large, ethnically diverse, special education-needs population. Am. J. Hum. Genet 1999; 64: 495–507. Patsalis PC, Sismani C, Hettinger JA et al: Frequencies of ‘grey-zone’ and premutationsize FMR1 CGG-repeat alleles in patients with developmental disability in Cyprus and Canada. Am. J. Med. Genet 1999; 84: 195–197. Mornet E, Chateau C, Simon-Bouy B, Serre JL: The intermediate alleles of the fragile X CGG repeat in patients with mental retardation. Clin. Genet 1998; 53: 200–201. Otsuka S, Sakamoto Y, Siomi H et al: Fragile X carrier screening and FMR1 allele distribution in the Japanese population. Brain Dev. 2010; 32: 110–114. Madrigal I, Xunclà M, Tejada MI, Martínez F, Fernández-Carvajal I, Pérez-Jurado LA, Rodriguez-Revenga L, Milà M. Intermediate FMR1 alleles and cognitive and/or behavioural phenotypes. Eur. J. Hum. Genet. 2011 Aug;19(8):921-3.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 91

CLINICAL FEATURES ASSOCIATED WITH FMR1 PREMUTATION CARRIERS M. I. Alvarez-Mora1,2 and L. Rodriguez-Revenga1,2,3,* 1

Centre for Biomedical Network Research of Rare Disease (CIBERER), Barcelona, Spain 2 Biochemistry and Molecular Genetics Department, Hospital Clinic, Barcelona, Spain 3 IDIBAPS (Institut d’Investigacions Biomèdiques August Pi i Sunyer). Barcelona, Spain

ABSTRACT The expansion of the CGG trinucleotide located within the 5’UTR of the FMR1 gene is involved in a growing number of diseases; the most well-established are Fragile X Syndrome (FXS), Fragile X Tremor/Ataxia Syndrome (FXTAS) and Fragile X Primary Ovarian Insufficiency (FXPOI). Whereas full mutation alleles (>200CGGs) are responsible for the FXS, smaller expansions called premutation alleles (55-200CGGs) are associated with FXTAS and FXPOI. Numerous evidence have currently been reported suggesting that premutation alleles give rise to an increased risk for carriers of these alleles in relation to additional medical, psychiatric and cognitive features which occur at a greater frequency than what would be expected for the general population. In this chapter, we review the clinical features including peripheral neuropathy, immune-mediated disorders, migraines and neurocognitive involvement which have been suggested to be associated with premutation alleles. In addition, the current understanding of the pathogenic molecular mechanisms that give rise to the spectrum of FMR1 premutation associated disorders is also reviewed. Although further research is needed in order to shed light on the factors underlying the common incomplete penetrance applicable to all phenotypes associated with the premutation, it is likely that a combination of environmental and genetic factors with differences in intrinsic susceptibility may modulate the appearance and the severity of these disorders.

Keywords: FMR1 premutation, fibromyalgia, thyroid disease, peripheral neuropathy

1912

M. I. Alvarez-Mora and L. Rodriguez-Revenga

INTRODUCTION In the last years, there has been intense interest in identifying and characterizing the Fragile X premutation-associated phenotypes from the perspective not only of basic science but also of public health given its high prevalence affecting 1:250 females and 1:800 males among the general population [1]. Historically, carriers of FMR1 premutation (PM) alleles were considered to be clinically unaffected, since the gene is generally not methylated and these individuals do not present intellectual disabilities (ID). The significance of these alleles was generally thought to be their propensity for expansion to the full mutation range (>200 CGG repeats) during maternal transmission resulting in transcriptional silencing of FMR1 gene, absence of the encoding fragile X mental retardation 1 protein (FMRP) and manifestation of fragile X syndrome (FXS) [2,3]. Although, the features of this expansion are not fully understood, it is currently accepted that they depend on the size of the maternal allele and also on the number of the AGG interruptions within the CGG-repeat track [4]. The AGG interruptions are likely to have stabilizing effects during transmission by decreasing the risk of DNA polymerase slippage during DNA replication [5]. In PM male carriers there is a relative stable transmission, and thus, the risk of expansion to a full mutation is negligible [reviewed in 6]. Despite the belief that PM carriers do not present signs of clinical involvement, prior to the discovery of the gene FMR1 Cronister and collaborators (1991) [7] reported, higher rates of premature ovarian failure (POF) among women heterozygous for X-chromosome fragility. Later, Allinghan-Hawkins and colleagues (1999) [8] established PM alleles as a significant risk factor for POF based on the study of 760 women in which 16% of PM carriers were affected with POF whereas none of the full mutation carriers and just one (0.4%) of the controls presented with POF [8]. Currently, the association between ovarian deficiency and PM female carriers, namely Fragile X-Primary ovarian Insufficiency (FXPOI), is well-established, presenting an incidence of around 20% in these women and estimated at around 1% among the general population. Chapter 2 describes the features of FXPOI. Ten years after, the first description of a neurodegenerative disorder named Fragile X Tremor Ataxia Syndrome (FXTAS) associated to older adults PM carriers was made by Hagerman and colleagues (2001) [9]. This syndrome is characterized by white matter changes and global brain atrophy, presenting with core features of intention tremor and gait ataxia. Details of FXTAS are described in Chapter 3. Over the past 10-15 years, an increasingly broad spectrum of clinical manifestations has been related to individuals who are carriers of PM alleles (Table 1). Domains of clinical involvement seen in some, but not all carriers of PM encompass the presence of medical, emotional and cognitive manifestations which have been widely reported to occur more frequently among PM carriers than in the general population. Some of these features have recently been classified as being ‘definitely related’, ‘probably related’, ‘possibly related’ or ‘not likely related’ to the molecular changes associated with an FMR1 expansion based on clinical and previously reported data [reviewed in 10]. Coffey and collaborators (2008) [11] reported the first evidence of an expanded clinical phenotype of women with the PM. In this study, PM female carriers without core features of FXTAS showed significantly more complaints of chronic muscle pain, persistent paraesthesias in the extremities, and a history of tremor than controls. Furthermore, a significantly greater

Clinical Features Associated with FMR1 Premutation Carriers

1913

presence of medical co-morbidity was detected in females with definite or probable FXTAS, with an increased prevalence of thyroid disease, hypertension, seizures, peripheral neuropathy, fibromyalgia compared with controls [11]. In addition, some of the comorbidites associated with FXTAS beyond central nervous system involvement, specifically peripheral neuropathy [11,12] and neuroendocrine dysfunction [11,13-15] have also been associated with PM carriers without FXTAS. Moreover, there is increasing evidence that young PM carriers present increased rates of neurodevelopmental phenotypes such as attention-deficit hyperactivity disorder (ADHD), autism spectrum disorder (ASD) and seizures [reviewed in 16]. Furthermore, increased rates of psychiatric involvement, particularly depression and anxiety have also been associated with FXTAS among adult PM carriers [reviewed in 17]. Neuropsychiatric aspects are discussed in Chapter 4. Table 1.Clinical manifestations associated with some FMR1 premutation carriers Cohort studied* Immune mediated disorders Fibromyalgia PM females Thyroid disease PM females Irritable bowel syndrome PM females Neurodevelopmental Phenotypes Working memory deficiencies PM males Language dysfluencies PM females Spatiotemporal processing impairment Young-adult PM carriers Arithmetic weaknesses PM females Developmental Delay PM carriers Reproductive features Ovarian Insufficiency (FXPOI) PM females Obstetric and perinatal difficulties PM females Estrogen-deficiency related conditions FXPOI PM females Autonomic dysfunction Impotence FXTAS PM males Hypertension FXTAS PM both Bowel and bladder incontinence FXTAS PM both Neurocognitive and phychiatric Involvement Depression PM females Anxiety disorders PM females Mood disorders PM females Seizures PM male children ASD PM male children ADHD PM females Other clinical manifestations Migraine PM carriers both Peripheral neuropathy PM carriers both

References [11-15] [11,13,15] [15] [27,28] [29] [32] [30,31] [75] [reviewed in 10] [56] [11,67] [18,68]

[69-71] [72] [72,73] [74] [25] [11,76]

CLINICAL FEATURES ASSOCIATED WITH FMR1 PREMUTATION CARRIERS Neuropathy Peripheral neuropathy is characterized by a damaging of peripheral nerves which carry information to and from the brain as well as to and from the spinal cord to the rest of the body.

1914

M. I. Alvarez-Mora and L. Rodriguez-Revenga

Depending on the type of nerve affected it may promote impaired sensation, movement, gland or organ function. The association between neuropathy and FMR1 alleles was first reported in PM carriers with FXTAS [9,18]. Thereafter, Berry-Kravis and collaborators (2007) [12] reported the first evidence that signs of neuropathy on clinical examination are associated with PM carrier status based on neurological examination data from 207 unrelated individuals. Results from this study revealed that the degree of clinical involvement strongly correlated with the CGG repeat length in males since these individuals presented significantly higher mean scores in the neuropathy screening scale score (P=0.0014), the vibration score (P=0.0015), and the reflex score (P=0.0014) than sex-matched controls suggesting that PM male carriers present higher impairment of both distal vibratory sense and reflexes [12]. The lack of significant differences among PM female carriers presumably reflects the broad variation in clinical involvement among carriers as a result of variation in the X-chromosome activation ratio as well as the decreased penetrance of the clinical manifestation due to the protective effect of the second non-mutated X chromosome [12]. Afterwards, Coffey and collaborators (2008) [11] demonstrated that females with PM alleles also presented significantly higher signs of neuropathy based on findings from 128 PM female carriers without FXTAS. In this study it was shown that these women presented a significant rate of numbness and tingling and muscle pain in the extremities, albeit evidence of neuropathy is increased in PM female carriers presenting with FXTAS [11]. It has been suggested that neuropathic symptoms in PM female carriers are manifested together with the emergence of FXTAS disease [reviewed in 10].

Immune-Mediated Disorders Numerous reports support elevated rates of immune-mediated disorders (IMD) in PM female carriers, particularly regarding hypothyroidism and fibromyalgia [11, 13-15]. In contrast, IMDs have not been evidenced among males with the premutation, likely due to the relative rarity of these disorders among the general male population. In a recent study, Winarni and colleagues (2012) [15] examined the relative likelihood of large clinical manifestations among 344 female carriers of PM alleles and 72 controls including autoimmune thyroid disorder, multiple sclerosis, Sjögren syndrome, rheumatoid arthritis, systemic lupus erythematosus, Raynaud’s phenomenon, irritable bowel syndrome and optic neuritis. The results of this study evidenced that among women over 40 years of age 46.54% of PM females without FXTAS experienced one or more of the IMDs surveyed, and the prevalence increased to about 72.73% for those with FXTAS compared to 31.58% for the control group [15]. With respect to FXPOI, both groups of PM females carriers present higher odds ratios of IMDs compared to controls, and similarly, when considering FXTAS symptoms, the odds ratio of IMDs among PM female carriers presenting with FXPOI is about 2.4-fold higher when compared to those without FXPOI. Moreover, these authors found that an autoimmune thyroid disorder was the most common IMD followed by fibromyalgia and irritable bowel syndrome [15]. Increased penetrance for both thyroid disease and fibromyalgia has been broadly reported among PM female carriers [13], although the penetrance of these disorders is highly variable among the general population since it increases with age. For thyroid disease, it has been suggested that the association with PM alleles may be more relevant in older women [10] due to the lack of statistical significance when considering women between 18 and 50 years of age

Clinical Features Associated with FMR1 Premutation Carriers

1915

[19]. Nonetheless, in the general population the penetrance estimated for thyroid disorders is of around 10% [20] and around 2-4% for fibromyalgia whereas it has been estimated to be around 15.9% and 24.4%, respectively, among PM female carriers [13]. Conversely, in 700 unrelated Spanish patients with fibromyalgia the frequency of PM alleles did not significantly differ from the estimated rate in the general population [21]. In contrast, another study found a higher incidence of PM alleles among a Spanish female fibromyalgia cohort. Indeed, the incidence of PM alleles was 1 of 88, being 1 of 250 in females in the general population [22]. These controversial results are likely to be caused by a sample size effect since the data reported by Martorell and colleagues (2012) [22] were based on the screening of 353 females whereas the data presented by Rodriguez-Revenga and coworkers (2013) [21] were based on 700 samples. Nonetheless, it has been shown that the pathophysiology of fibromyalgia involves hyperexcitability of central neurons through several synaptic and neurotransmitter/ neurochemical mechanisms [reviewed in 23] suggesting that it could arise through an alteration of pain neurotransmissor mechanisms among PM female carriers [14]. Finally, it has been recently demonstrated that individual carriers of PM alleles present an immune dysregulation and decreased immune responses when compared with healthy controls [24]. Moreover, it has been found that PM carriers present a reduction in the levels of cytokine production which is negatively associated with CGG repeat length, mainly with IL-12 production [24]. Furthermore, these women have also been shown to present a decrease in the relative levels of the surface marker CD25 in T cells suggesting potential differences in the activation of T-cells that regulate immune response [24].

Migraines Au and collaborators (2013) [25] have recently reported that PM carriers show increased rates in the prevalence of migraines based on physical and medical examination of 315 PM carriers (203 females and 112 males) and 154 controls (83 females and 71 males). Migraine is a neurologic disorder characterized by light and sound sensitivity and pulsatile pain, which is thought to have a polygenic and mutlifactorial etiology. The prevalence of migraine among the general population is estimated around 27.3% in women and 9.7% in men [26], reaching up to 54.2% and 26.79% among female and male PM carriers, respectively, both resulting in statistical significant differences [25]. In addition, this significance was obtained considering both those affected with and also those without FXTAS, adjusted for age. However, the risk of migraine headaches was not correlated with either CGG repeats or FMR1 mRNA expression [25].

Neurocognitive Features The expanded range of clinical involvement associated with PM carriers also includes an alteration of various cognitive domains including executive function, working memory and arithmetic skills which become apparent even in young individuals, with a usually more progressive course in PM individuals than in the general population [reviewed in 10]. However, neurocognitive deficits are reportedly more frequent in male than in female carriers of PM alleles. Results reported by Kogan and collaborators (2008) [27] revealed that the CGG

1916

M. I. Alvarez-Mora and L. Rodriguez-Revenga

expansion confers a significant risk for working memory difficulties based on a controlled study of 40 PM male carriers without manifest symptoms of FXTAS. In addition, Cornish and colleagues (2009) [28] reported neuropsychological measures in PM males regarding core subcomponents of working memory such as verbal memory, visual–spatial memory, and central executive memory revealing that PM males present specific vulnerability in executive control of memory including tasks requiring simultaneous manipulation and storage of new information, regardless of the presence of FXTAS symptoms. These authors revealed an impairment of the central executive working memory among PM male carriers without FXTAS, which was significantly correlated with larger CGG repeat expansions, whereas FXTAS patients demonstrated a more general impairment in terms of phonological working memory in addition to central executive working memory [28]. Moreover, language dysfluencies associated with deficits in organization and planning have been evidenced among PM female carriers [29]. Past research has demonstrated that language dysfluencies are an indicator of executive functioning deficits which are characteristic of other neurodegenerative disorders such as Parkinson and Alzheimer diseases. Regarding arithmetic skills it has been suggested that PM female carriers show weaknesses in mathematical tasks [30] and this has recently been supported by other groups [31]. Furthermore, it has been demonstrated that PM carriers from 19 to 45 years of age show impairment in spatiotemporal processing which may underlie the impairments observed in arithmetic skills among these individuals since the representations of space and time provide the foundation for an understanding of numbers [32]. Although further research is needed, it has been suggested that determining whether cognitive impairments are detectable in PM carriers without FXTAS should be prudent since it may not only be an early indicator of cognitive decline in PM carriers [29] but could also be used as a biomarker of disease progression if these features precede motor impairment [32].

CURRENT UNDERSTANDING OF THE MOLECULAR MECHANISMS UNDERLYING PREMUTATION-ASSOCIATED PATHOLOGIES Premutation-associated phenotypes have been mainly attributed to a pathogenic mechanism involving a gain-of-function toxicity of the expanded FMR1 mRNA, a process entirely distinct from the FMRP deficiency responsible for the FXS phenotype [reviewed in 33]. This observation was based on the restriction of these clinical phenotypes to the premutation range in which the molecular signature is a 2-8 fold increase in the expression of the PM mRNA and, paradoxically, a slight reduction in Fragile X Mental Retardation Protein (FMRP) levels [34]. The mechanisms underlying the increased transcriptional activity of the PM alleles remain unclear, however, it has been reported that these alleles use differential transcriptional start sites leading to different expression compared to non-expanded FMR1 alleles [35]. On other hand, it has also been suggested that the reduction of FMRP in PM carriers may promote an added contribution to the clinical involvement observed in both children and adults related to phenotypes associated with reduced cognition and disturbed behavior [36]. However, the FMRP deficiency cannot be a driving factor in the PM-associated disorders since FXTAS and FXPOI are not experienced by full mutation carriers. Despite wide reports that the levels of FMRP expression are only slightly decreased in patients with FXTAS, most of these

Clinical Features Associated with FMR1 Premutation Carriers

1917

measurements have been performed using lymphocytes or whole blood samples rather than brain tissue, in which changes are likely to be more robust [reviewed in 37]. The efficiency of FMRP translation is associated with the length of the CGG expansion in light of impairment in translation of larger CGG tracks by interference with ribosomal scanning through the 5’UTR, thereby preventing appropriate loading of the expanded FMR1 mRNA into polyribosomal complexes [38-40]. It is currently considered that the dual mechanism of involvement, the excess of PM mRNA expression and the decrease in FMRP translation, is a double hit which may promote phenotypic features of FXS and PM associated disorders [reviewed in 33, 41]. Notwithstanding, the reduction of FMRP synthesis, the phenotype of PM carriers, is different from carriers of full mutation alleles since milder protein deficiency among PM carriers usually leads to mild developmental problems with these individuals having higher IQs and less severe behavioral problems than those with FXS [reviewed in 42]. A FMRP deficit has been correlated with lowered activity of the amygdala among PM male carriers compared to controls on functional magnetic resonance imaging whereas increased levels of expanded mRNA have been strongly associated with obsessive–compulsive symptoms and psychoticism in PM male carriers [43,44]. It has also been described that RNA toxicity leads to the up-regulation of the heat shock proteins Hsp70 and αB-crystallin, which may stimulate immune dysregulation [15]. Regarding migraines, their association with mitochondrial dysfunction is well established. Interestingly, there is evidence pointing to a deregulation of mitochondrial function among PM carriers [45-47], therefore the increased prevalence of migraines in PM carriers may be the result of RNA toxicity leading to mitochondrial deregulation [25]. Likewise, RNA toxicity has also been proposed to shed light on the high rate of thyroid dysfunction among females with the PM by causing a direct effect on the hypothalamic-pituitary-adrenal axis or on the thyroid gland. Additionally, RNA toxicity has also been proposed to promote an autoimmune mechanism or apoptosis in thyroid cells [11]. However, data reported by Cunningham and coworkers (2011) [48] show that the presence of PM alleles promotes migration defects in the neocortex and altered expression of neuronal lineage markers among embryonic PM mice. These results support the hypothesis that the role of the RNA toxicity may be restricted to the initial triggering events since many features of the neuronal and astrocytic cellular phenotype observed in FXTAS patients are already present in the neonatal period, suggesting that the clinical involvement among children carriers of PM alleles may be manifestations of this early, non-degenerative process [reviewed in 33]. The sequestration hypothesis of RNA toxicity was first proposed and established for myotonic dystrophy type 1 caused by an expansion of a CTG repeat in the 3’UTR of DMPK gene [reviewed in 49]. Particularly, in Fragile X PM the model hypothesized that expanded CGG repeats form hairpin loops which are sticky and recruit an excess of specific RNA-binding proteins, resulting in a functional insufficiency of the sequestered proteins and leading to cell dysfunction and death [50]. Although the initial triggering events in these disorders are based on RNA toxicity, this model does not provide evidence regarding cell sickening and death. In this way, there are several candidate downstream pathways, although alterations of both mitochondrial function and calcium regulation are emerging as core mediators of cellular deregulation and dysfunction [reviewed in 31, 39] The increased expression of the expanded FMR1 mRNA is thought to be the main cause of clinical involvement in PM carriers since the FMR1 mRNA and the sequestered proteins form aggregates leading to intranuclear inclusions present in several tissues. Interestingly, the expanded mRNA of FMR1 is detected within the

1918

M. I. Alvarez-Mora and L. Rodriguez-Revenga

inclusion whereas FMRP is not present [51]. Furthermore, proteomic analysis of these inclusions revealed a large number of proteins presented in the aggregates, including the RNA binding protein hnRNP A2/B1, the nuclear envelope protein lamin A/C, the small heat shock protein αB-crystallin [52], the splicing factor Sam68 [53] and part of the microRNA processor complex DGCR8 [50]. Indeed, it has recently been demonstrated that the sequestration of DGCR8 promotes the deregulation of microRNAs biogenesis, suggesting a central role of DGCR8 as an inductor of RNA toxicity by leading to cell dysfunction and cell loss [50]. Intranuclear inclusions, which represent the neuropathological hallmark of FXTAS [52], have been also detected among PM carriers through different cell types including the central and peripheral nervous system and other tissue including the adrenal glands, the testes, pancreas and heart [54-58]. Recently, Hunsaker and colleagues (2011) [58] reported autopsy findings from ten PM carriers with FXTAS in which intranuclear inclusions were detected throughout multiple tissues including the hypothalamic-pituitary-adrenal axis, pineal gland, cardiac conduction system, peripheral nerves and autonomic ganglia, the thyroid gland, the digestive system, the testes and pancreas. The broad distribution of these inclusions suggests that many organ systems may be affected by RNA toxicity. Nevertheless, it is necessary to study the processes underlying inclusion formation in depth to address whether they themselves are toxic or reflect cellular dysfunction [58]. Furthermore, additional mechanisms have been proposed as possible triggering events in the PM-associated disorders, although most evidence support CGG-repeat mediated protein sequestration [reviewed in 33,37]. These mechanisms include a RNA-mediated protein aggregation model whereby the CGGs contained within the FMR1 mRNA might promote a conformational transition in proteins with prion-like domains that may initiate a cascade of protein aggregation similar to what occurs in amyloid plaque formation in Alzheimer’s disease. Moreover, the production of a toxic polyglycine peptide has also been proposed as an alternative toxicity model by a non-AUG-initiated (RAN) translation [59]. In addition, a specific splicing isoform is detected exclusively with transcripts of PM alleles suggesting a possible role of antisense transcripts generated at the FMR1 locus [60]. Otherwise very little attention has been focused on the other end of the spectrum, the socalled “low-normal” numbers of CGG repeats, up to 23 trinucleotide repeats. In this framework, data based on genotype–phenotype correlations have recently been reported suggesting that this range of CGG repeats may have substantial implications for cognitive functioning, cancer, and the odds of having children with neurodevelopmental or neuropsychiatric conditions [61]. Despite these range of CGG number not being associated with altered FMRP synthesis, Chen and co-workers (2003) [62] reported that the efficiency of FMRP translation was based on the number of CGG repeats, conferring the greatest efficiency of protein synthesis to the allele of 30 repeats. Thus, inefficient translation may be related to the clinical manifestations associated with the low numbers of CGG repeats. Likewise, Ramocki and Zoghbi (2008) [63] suggested that imbalances in homeostatic controls of multiple genes including FMR1 may partially promote the appearance of neurodevelopmental and neuropsychiatric disorders. At this point, the difficulty in understanding PM-associated pathologies lies in the inability of prediction of which PM carriers will develop any of these phenotypes. The incomplete penetrance across the phenotypic spectrum is likely to be associated with a combination of genetic and environmental factors which may confer specific vulnerability to PM carriers (Figure 1).

Clinical Features Associated with FMR1 Premutation Carriers

1919

Figure 1. Diagram of the potential players contributing to the clinical involvement associated to PM carriers.

Genetic factors that may contribute to the PM-associated disorders include CGG repeat length, expression levels of the expanded FMR1 mRNA, aberrant translation of the repeat sequence as well as genomic changes in other regions of the genome. Within this framework, specific polymorphisms of the CRHR1 gene have been associated with female clinical involvement (rs7209436), particularly with depression and anxiety mainly as this gene regulates the expression and release of ACTH from the anterior pituitary gland which, in turn, stimulates the release of cortisol from the adrenal cortex [64]. Furthermore, risk factors for other neurodegenerative disorders such as allele ε4 of the APOE gene may also influence the risk of FXTAS as a higher frequency of these alleles has been reported in PM carriers with compared to those without FXTAS [65]. Moreover, it has recently been suggested that

1920

M. I. Alvarez-Mora and L. Rodriguez-Revenga

individuals who are carriers of PM alleles presenting with ID, seizures or ASD are likely to have a second hit since PM carriers show a significant enrichment (P=2.27e-07) of CNVs compared to controls [66]. Furthermore, these authors found an association between the presence of rare CNVs (not detected in 8000 controls) among PM carriers with either autistic traits or neurological involvement, suggesting that they may have a possible role in this phenotypic variability [66]. Regarding environmental factors, it has been suggested that smoking, prolonged surgery with anesthesia, drug and alcohol abuse or the stress of carrying a child with FXS are also puzzling factors which may act as additional determinants for the phenotypic variability among PM individuals [reviewed in 41,42]. Finally, further longitudinal studies are required to determine the context in which any of the PM-associated phenotypes are developed and what protective factors might reduce the risks of more negative outcomes [reviewed in 10].

CONCLUSION Overall, it is currently accepted that PM alleles led to multiple distinct clinical features which are present at a greater frequency among PM carriers than what would be expected in the general population. However, the association of the PM with the phenotypes reviewed in this chapter is less well established than its association with FXTAS and FXPOI. Although further research is needed in order to shed light on the factors underlying the common incomplete penetrance applicable to all phenotypes associated with the PM, a combination of environmental and genetic factors with differences in intrinsic susceptibility likely modulate the appearance and the severity of these disorders.

REFERENCES [1] [2]

[3]

[4] [5]

[6]

Hagerman PJ. The fragile X prevalence paradox. J Med. Genet.. 2008 Aug;45(8):498-9. Erratum in: J. Med. Genet. 2008 Nov;45(11):768. Rousseau F, Heitz D, Biancalana V, Blumenfeld S, Kretz C, Boué J, Tommerup N, Van Der Hagen C, DeLozier-Blanchet C, Croquette MF, et al. Direct diagnosis by DNA analysis of the fragile X syndrome of mental retardation. N. Engl. J. Med. 1991 Dec 12;325(24):1673-81. Nolin SL, Lewis FA 3rd, Ye LL, Houck GE Jr, Glicksman AE, Limprasert P, Li SY, Zhong N, Ashley AE, Feingold E, Sherman SL, Brown WT. Familial transmission of the FMR1 CGG repeat. Am. J. Hum. Genet. 1996 Dec;59(6):1252-61. Yrigollen CM, Tassone F, Durbin-Johnson B, Tassone F. The role of AGG interruptions in the transcription of PM alleles. PLoS One. 2011;6(7):e21728. Gacy AM, Goellner G, Juranić N, Macura S, McMurray CT. Trinucleotide repeats that expand in human disease form hairpin structures in vitro. Cell. 1995 May 19;81(4):53340. Brouwer JR, Willemsen R, Oostra BA. Microsatellite repeat instability and neurological disease. Bioessays. 2009 Jan;31(1):71-83. doi: 10.1002/bies.080122.

Clinical Features Associated with FMR1 Premutation Carriers [7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

1921

Cronister A, Schreiner R, Wittenberger M, Amiri K, Harris K, Hagerman RJ. Heterozygous fragile X female: historical, physical, cognitive, and cytogenetic features. Am. J. Med. Genet. 1991 Feb-Mar;38(2-3):269-74. Allingham-Hawkins DJ, Babul-Hirji R, Chitayat D, Holden JJ, Yang KT, Lee C, Hudson R, Gorwill H, Nolin SL, Glicksman A, Jenkins EC, Brown WT, Howard-Peebles PN, Becchi C, Cummings E, Fallon L, Seitz S, Black SH, Vianna-Morgante AM, Costa SS, Otto PA, Mingroni-Netto RC, Murray A, Webb J, Vieri F, et al. Fragile X premutation is a significant risk factor for premature ovarian failure: the International Collaborative POF in Fragile X study--preliminary data. Am. J. Med. Genet. 1999 Apr 2;83(4):322-5. Hagerman RJ, Leehey M, Heinrichs W, Tassone F, Wilson R, Hills J, Grigsby J, Gage B, Hagerman PJ. Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X. Neurology. 2001 Jul 10;57(1):127-30. Wheeler AC, Bailey DB Jr, Berry-Kravis E, Greenberg J, Losh M, Mailick M, Milà M, Olichney JM, Rodriguez-Revenga L, Sherman S, Smith L, Summers S, Yang JC, Hagerman R. Associated features in females with an PM. J Neurodev Disord. 2014;6(1):30. Review. Coffey SM, Cook K, Tartaglia N, Tassone F, Nguyen DV, Pan R, Bronsky HE, Yuhas J, Borodyanskaya M, Grigsby J, Doerflinger M, Hagerman PJ, Hagerman RJ. Expanded clinical phenotype of women with the PM. Am. J. Med. Genet. A. 2008 Apr 15;146A(8):1009-16. Berry-Kravis E, Goetz CG, Leehey MA, Hagerman RJ, Zhang L, Li L, Nguyen D, Hall DA, Tartaglia N, Cogswell J, Tassone F, Hagerman PJ. Neuropathic features in fragile X premutation carriers. Am. J. Med. Gene.t A. 2007 Jan 1;143A(1):19-26. Rodriguez-Revenga L, Madrigal I, Pagonabarraga J, Xunclà M, Badenas C, Kulisevsky J, Gomez B, Milà M. Penetrance of FMR1 premutation associated pathologies in fragile X syndrome families. Eur. J. Hum. Genet. 2009 Oct;17(10):1359-62. Leehey MA, Legg W, Tassone F, Hagerman R. Fibromyalgia in fragile X mental retardation 1 gene premutation carriers. Rheumatology (Oxford). 2011 Dec;50(12):22336. Winarni TI, Chonchaiya W, Sumekar TA, Ashwood P, Morales GM, Tassone F, Nguyen DV, Faradz SM, Van de Water J, Cook K, Hamlin A, Mu Y, Hagerman PJ, Hagerman RJ. Immune-mediated disorders among women carriers of fragile X premutation alleles. Am. J. Med. Genet. A. 2012 Oct;158A(10):2473-81. Besterman AD, Wilke SA, Mulligan TE, Allison SC, Hagerman R, Seritan AL, Bourgeois JA. Towards an Understanding of Neuropsychiatric Manifestations in Fragile X Premutation Carriers. Future Neurol. 2014 Mar;9(2):227-239. Hunter JE, Abramowitz A, Rusin M, Sherman SL. Is there evidence for neuropsychological and neurobehavioral phenotypes among adults without FXTAS who carry the PM? A review of current literature. Genet Med. 2009 Feb;11(2):79-89. Jacquemont S, Hagerman RJ, Leehey M, Grigsby J, Zhang L, Brunberg JA, Greco C, Des Portes V, Jardini T, Levine R, Berry-Kravis E, Brown WT, Schaeffer S, Kissel J, Tassone F, Hagerman PJ. Fragile X premutation tremor/ataxia syndrome: molecular, clinical, and neuroimaging correlates. Am. J. Hum. Genet. 2003 Apr;72(4):869-78. Hunter JE, Rohr JK, Sherman SL. Co-occurring diagnoses among FMR1 premutation allele carriers. Clin. Genet. 2010 Apr;77(4):374-81.

1922

M. I. Alvarez-Mora and L. Rodriguez-Revenga

[20] Canaris GJ, Manowitz NR, Mayor G, Ridgway EC. The Colorado thyroid disease prevalence study. Arch. Intern Med. 2000 Feb 28;160(4):526-34. [21] Rodriguez-Revenga L, Madrigal I, Blanch-Rubió J, Elurbe DM, Docampo E, Collado A, Vidal J, Carbonell J, Estivill X, Mila M. Screening for the presence of PM alleles in women with fibromyalgia. Gene. 2013 Jan 10;512(2):305-8. [22] Martorell L, Tondo M, Garcia-Fructuoso F, Naudo M, Alegre C, Gamez J, Genovés J, Poo P. Screening for the presence of FMR1 premutation alleles in a Spanish population with fibromyalgia. Clin. Rheumatol. 2012 Nov;31(11):1611-5. [23] Yunus MB. Role of central sensitization in symptoms beyond muscle pain, and the evaluation of a patient with widespread pain. Best Pract. Res. Clin. Rheumatol. 2007 Jun;21(3):481-97. Review. [24] Careaga M, Rose D, Tassone F, Berman RF, Hagerman R, Ashwood P. Immune dysregulation as a cause of autoinflammation in fragile X premutation carriers: link between FMRI CGG repeat number and decreased cytokine responses. PLoS One. 2014 Apr 9;9(4):e94475. [25] Au J, Akins RS, Berkowitz-Sutherland L, Tang HT, Chen Y, Boyd A, Tassone F, Nguyen DV, Hagerman R. Prevalence and risk of migraine headaches in adult fragile X premutation carriers. Clin Genet. 2013 Dec;84(6):546-51. [26] Lipton RB, Stewart WF, Diamond S, Diamond ML, Reed M. Prevalence and burden of migraine in the United States: data from the American Migraine Study II. Headache 2001: 41 (7): 646–657. [27] Kogan CS, Turk J, Hagerman RJ, Cornish KM. Impact of the Fragile X mental retardation 1 (FMR1) gene premutation on neuropsychiatric functioning in adult males without fragile X-associated Tremor/Ataxia syndrome: a controlled study. Am. J. Med. Genet. B Neuropsychiatr Genet. 2008 Sep 5;147B(6):859-72. [28] Cornish KM, Kogan CS, Li L, Turk J, Jacquemont S, Hagerman RJ. Lifespan changes in working memory in fragile X premutation males. Brain Cogn. 2009 Apr;69(3):551-8. [29] Sterling AM, Mailick M, Greenberg J, Warren SF, Brady N. Language dysfluencies in females with the PM. Brain Cogn. 2013 Jun;82(1):84-9. [30] Lachiewicz AM, Dawson DV, Spiridigliozzi GA, McConkie-Rosell A. Arithmetic difficulties in females with the fragile X premutation. Am. J. Med. Genet. A. 2006 Apr 1;140(7):665-72. [31] Semenza C, Bonollo S, Polli R, Busana C, Pignatti R, Iuculano T, Maria Laverda A, Priftis K, Murgia A. Genetics and mathematics: FMR1 premutation female carriers. Neuropsychologia. 2012 Dec;50(14):3757-63 [32] Wong LM, Goodrich-Hunsaker NJ, McLennan Y, Tassone F, Harvey D, Rivera SM, Simon TJ. Young adult male carriers of the fragile X premutation exhibit genetically modulated impairments in visuospatial tasks controlled for psychomotor speed. J. Neurodev Disord. 2012 Nov 13;4(1):26. [33] Hagerman P. Fragile X-associated tremor/ataxia syndrome (FXTAS): pathology and mechanisms. Acta Neuropathol. 2013 Jul;126(1):1-19. [34] Tassone F, Beilina A, Carosi C, Albertosi S, Bagni C, Li L, Glover K, Bentley D, Hagerman PJ. Elevated FMR1 mRNA in premutation carriers is due to increased transcription. RNA. 2007 Apr;13(4):555-62.

Clinical Features Associated with FMR1 Premutation Carriers

1923

[35] Tassone F, De Rubeis S, Carosi C, La Fata G, Serpa G, Raske C, Willemsen R, Hagerman PJ, Bagni C. Differential usage of transcriptional start sites and polyadenylation sites in FMR1 premutation alleles. Nucleic Acids Res. 2011 Aug;39(14):6172-85. [36] Tassone F, Hagerman RJ, Taylor AK, Mills JB, Harris SW, Gane LW, Hagerman PJ (2000) Clinical involvement and protein expression in individuals with the FMR1 premutation. Am. J. Med. Genet. 91(2):144–152 [37] Renoux AJ, Todd PK. Neurodegeneration the RNA way. Prog. Neurobiol. 2012 May;97(2):173-89. [38] Primerano B, Tassone F, Hagerman RJ, Hagerman P, Amaldi F, Bagni C. Reduced FMR1 mRNA translation efficiency in fragile X patients with premutations. RNA. 2002 Dec;8(12):1482-8. [39] Ludwig AL, Raske C, Tassone F, Garcia-Arocena D, Hershey JW, Hagerman PJ. Translation of the FMR1 mRNA is not influenced by AGG interruptions. Nucleic Acids Res. 2009 Nov;37(20):6896-904. [40] Ludwig AL, Hershey JW, Hagerman PJ. Initiation of translation of the FMR1 mRNA Occurs predominantly through 5'-end-dependent ribosomal scanning. J. Mol. Biol. 2011 Mar 18;407(1):21-34. [41] Hagerman R, Hagerman P. Advances in clinical and molecular understanding of the FMR1 premutation and fragile X-associated tremor/ataxia syndrome. Lancet Neurol. 2013 Aug;12(8):786-98. [42] Polussa J, Schneider A, Hagerman R. (2014) Molecular Advances Leading to Treatment Implications for Fragile X Premutation Carriers. Brain Disord Ther 3:2. [43] Hessl D, Tassone F, Loesch DZ, Berry-Kravis E, Leehey MA, Gane LW, Barbato I, Rice C, Gould E, Hall DA, Grigsby J, Wegelin JA, Harris S, Lewin F, Weinberg D, Hagerman PJ, Hagerman RJ. Abnormal elevation of FMR1 mRNA is associated with psychological symptoms in individuals with the fragile X premutation. Am. J. Med. Genet. B Neuropsychiatr Genet. 2005; 139B (1):115–121. [44] Hoem G, Raske CR, Garcia-Arocena D, Tassone F, Sanchez E, Ludwig AL, Iwahashi CK, Kumar M, Yang JE, Hagerman PJ. CGG-repeat length threshold for FMR1 RNA pathogenesis in a cellular model for FXTAS. Hum. Mol. Genet. 2011; 20 (11):2161– 2170. [45] Ross-Inta C, Omanska-Klusek A, Wong S, Barrow C, Garcia-Arocena D, Iwahashi C, Berry-Kravis E, Hagerman RJ, Hagerman PJ, Giulivi C. Evidence of mitochondrial dysfunction in fragile X-associated tremor/ataxia syndrome. Biochem. J. 2010 Aug 1;429(3):545-52. [46] Napoli E, Ross-Inta C, Wong S, Omanska-Klusek A, Barrow C, Iwahashi C, GarciaArocena D, Sakaguchi D, Berry-Kravis E, Hagerman R, Hagerman PJ, Giulivi C. Altered zinc transport disrupts mitochondrial protein processing/import in fragile X-associated tremor/ataxia syndrome. Hum. Mol. Genet. 2011 Aug 1;20(15):3079-92. [47] Mateu-Huertas E, Rodriguez-Revenga L, Alvarez-Mora MI, Madrigal I, Willemsen R, Milà M, Martí E, Estivill X. Blood expression profiles of fragile X premutation carriers identify candidate genes involved in neurodegenerative and infertility phenotypes. Neurobiol. Dis. 2014 May;65:43-54. [48] Cunningham CL, Martínez Cerdeño V, Navarro Porras E, Prakash AN, Angelastro JM, Willemsen R, Hagerman PJ, Pessah IN, Berman RF, Noctor SC. Premutation CGG-

1924

[49] [50]

[51] [52]

[53]

[54]

[55]

[56]

[57] [58]

[59]

[60]

M. I. Alvarez-Mora and L. Rodriguez-Revenga repeat expansion of the Fmr1 gene impairs mouse neocortical development. Hum. Mol. Genet. 2011 Jan 1;20(1):64-79. Todd PK, Paulson HL. RNA-mediated neurodegeneration in repeat expansion disorders. Ann. Neurol. 2010 Mar;67(3):291-300. Review. Sellier C, Freyermuth F, Tabet R, Tran T, He F, Ruffenach F, Alunni V, Moine H, Thibault C, Page A, Tassone F, Willemsen R, Disney MD, Hagerman PJ, Todd PK, Charlet-Berguerand N. Sequestration of DROSHA and DGCR8 by expanded CGG RNA repeats alters microRNA processing in fragile X-associated tremor/ataxia syndrome. Cell Rep. 2013 Mar 28;3(3):869-80. Tassone F, Iwahashi C, Hagerman PJ. FMR1 RNA within the intranuclear inclusions of fragile X-associated tremor/ataxia syndrome (FXTAS). RNA Biol. 2004 Jul;1(2):103-5. Iwahashi CK, Yasui DH, An HJ, Greco CM, Tassone F, Nannen K, Babineau B, Lebrilla CB, Hagerman RJ, Hagerman PJ. Protein composition of the intranuclear inclusions of FXTAS. Brain. 2006 Jan;129(Pt 1):256-71. Sellier C, Rau F, Liu Y, Tassone F, Hukema RK, Gattoni R, Schneider A, Richard S, Willemsen R, Elliott DJ, Hagerman PJ, Charlet-Berguerand N. Sam68 sequestration and partial loss of function are associated with splicing alterations in FXTAS patients. EMBO J. 2010 Apr 7;29(7):1248-61. Louis E, Moskowitz C, Friez M, Amaya M, Vonsattel JP. Parkinsonism, dysautonomia, and intranuclear inclusions in a fragile X carrier: a clinical-pathological study. Mov. Disord. 2006 Mar;21(3):420-5. Greco CM, Berman RF, Martin RM, Tassone F, Schwartz PH, Chang A, Trapp BD, Iwahashi C, Brunberg J, Grigsby J, Hessl D, Becker EJ, Papazian J, Leehey MA, Hagerman RJ, Hagerman PJ. Neuropathology of fragile X-associated tremor/ataxia syndrome (FXTAS). Brain. 2006 Jan;129(Pt 1):243-55. Greco CM, Soontrapornchai K, Wirojanan J, Gould JE, Hagerman PJ, Hagerman RJ. Testicular and pituitary inclusion formation in fragile X associated tremor/ataxia syndrome. J. Urol. 2007 Apr;177(4):1434-7. Gokden M, Al-Hinti JT, Harik SI. Peripheral nervous system pathology in fragile X tremor/ataxia syndrome (FXTAS). Neuropathology. 2009 Jun;29(3):280-4. Hunsaker MR, Greco CM, Spath MA, Smits AP, Navarro CS, Tassone F, Kros JM, Severijnen LA, Berry-Kravis EM, Berman RF, Hagerman PJ, Willemsen R, Hagerman RJ, Hukema RK. Widespread non-central nervous system organ pathology in fragile X premutation carriers with fragile X-associated tremor/ataxia syndrome and CGG knockin mice. Acta Neuropathol. 2011 Oct;122(4):467-79. Todd PK, Oh SY, Krans A, He F, Sellier C, Frazer M, Renoux AJ, Chen KC, Scaglione KM, Basrur V, Elenitoba-Johnson K, Vonsattel JP, Louis ED, Sutton MA, Taylor JP, Mills RE, Charlet-Berguerand N, Paulson HL. CGG repeat-associated translation mediates neurodegeneration in fragile X tremor ataxia syndrome. Neuron. 2013 May 8;78(3):440-55. Ladd PD, Smith LE, Rabaia NA, Moore JM, Georges SA, Hansen RS, Hagerman RJ, Tassone F, Tapscott SJ, Filippova GN. An antisense transcript spanning the CGG repeat region of FMR1 is upregulated in premutation carriers but silenced in full mutation individuals. Hum. Mol. Genet. 2007 Dec 15;16(24):3174-87.

Clinical Features Associated with FMR1 Premutation Carriers

1925

[61] Mailick MR, Hong J, Rathouz P, Baker MW, Greenberg JS, Smith L, Maenner M. Lownormal FMR1 CGG repeat length: phenotypic associations. Front Genet. 2014 Sep 9;5:309. [62] Chen LS, Tassone F, Sahota P, Hagerman PJ. The (CGG)n repeat element within the 5' untranslated region of the FMR1 message provides both positive and negative cis effects on in vivo translation of a downstream reporter. Hum. Mol. Genet. 2003 Dec 1;12(23):3067-74. Epub 2003 Sep 30. [63] Ramocki MB, Zoghbi HY. Failure of neuronal homeostasis results in common neuropsychiatric phenotypes. Nature. 2008 Oct 16;455(7215):912-8. Review. [64] Hunter JE, Leslie M, Novak G, Hamilton D, Shubeck L, Charen K, Abramowitz A, Epstein MP, Lori A, Binder E, Cubells JF, Sherman SL. Depression and anxiety symptoms among women who carry the PM: impact of raising a child with fragile X syndrome is moderated by CRHR1 polymorphisms. Am. J. Med. Genet. B Neuropsychiatr Genet. 2012 Jul;159B(5):549-59. [65] Silva F, Rodriguez-Revenga L, Madrigal I, Alvarez-Mora MI, Oliva R, Milà M. High apolipoprotein E4 allele frequency in FXTAS patients. Genet Med. 2013 Aug;15(8):63942. [66] Lozano R, Hagerman RJ, Duyzend M, Budimirovic DB, Eichler EE, Tassone F. Genomic studies in fragile X premutation carriers. J. Neurodev Disord. 2014;6(1):27. [67] Hamlin A, Liu Y, Nguyen DV, Tassone F, Zhang L, Hagerman RJ. Sleep apnea in fragile X premutation carriers with and without FXTAS. Am. J. Med. Genet. B Neuropsychiatr Genet. 2011;156B (8):923–928. [68] Leehey MA. Fragile X-associated tremor/ataxia syndrome: clinical phenotype, diagnosis, and treatment. J. Investig. Med. 2009 Dec;57(8):830-6. Review. [69] Rodriguez-Revenga L, Madrigal I, Alegret M, Santos M, Milà M. Evidence of depressive symptoms in fragile-X syndrome premutated females. Psychiatr Genet. 2008 Aug;18(4):153-5. [70] Bourgeois JA, Seritan AL, Casillas EM, Hessl D, Schneider A, Yang Y, Kaur I, Cogswell JB, Nguyen DV, Hagerman RJ. Lifetime prevalence of mood and anxiety disorders in fragile X premutation carriers. J. Clin. Psychiatry. 2011 Feb;72(2):175-82. [71] Hunter JE, Leslie M, Novak G, Hamilton D, Shubeck L, Charen K, Abramowitz A, Epstein MP, Lori A, Binder E, Cubells JF, Sherman SL. Depression and anxiety symptoms among women who carry the FMR1 premutation: impact of raising a child with fragile X syndrome is moderated by CRHR1 polymorphisms. Am. J. Med. Genet. B Neuropsychiatr Genet. 2012 Jul;159B(5):549-59. [72] Chonchaiya W, Au J, Schneider A, Hessl D, Harris SW, Laird M, Mu Y, Tassone F, Nguyen DV, Hagerman RJ. Increased prevalence of seizures in boys who were probands with the FMR1 premutation and co-morbid autism spectrum disorder. Hum. Genet. 2012; 131 (4):581–589. [73] Farzin F, Perry H, Hessl D, Loesch D, Cohen J, Bacalman S, Gane L, Tassone F, Hagerman P, Hagerman R. Autism spectrum disorders and attention-deficit/ hyperactivity disorder in boys with the fragile X premutation. J. Dev. Behav. Pediatr. 2006; 27 (2 Suppl):S137–144. [74] Kraan CM, Hocking DR, Georgiou-Karistianis N, Metcalfe SA, Archibald AD, Fielding J, Trollor J, Bradshaw JL, Cohen J, Cornish KM. Impaired response inhibition is associated with self-reported symptoms of depression, anxiety, and ADHD in female

1926

M. I. Alvarez-Mora and L. Rodriguez-Revenga

FMR1 premutation carriers. Am. J. Med. Genet. B Neuropsychiatr Genet. 2014 Jan;165(1):41-51. [75] Bailey DB Jr, Raspa M, Olmsted M, Holiday DB. Co-occurring conditions associated with FMR1 gene variations: findings from a national parent survey. Am. J. Med. Genet. A. 2008; 146A (16): 2060–2069. [76] Hagerman RJ, Coffey SM, Maselli R, Soontarapornchai K, Brunberg JA, Leehey MA, Zhang L, Gane LW, Fenton-Farrell G, Tassone F, Hagerman PJ. Neuropathy as a presenting feature in fragile X-associated tremor/ataxia syndrome. Am. J. Med. Genet. A. 2007 Oct 1;143A(19):2256-60.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 92

GENETIC COUNSELING OF FMR1 I. Madrigal Biochemistry and Molecular Genetics Department, Hospital Clínic and IDIBAPS Centre for Biomedical Research on Rare Diseases (CIBERER), ISCIII, Barcelona, Spain IDIBAPS (Institut d’Investigacions Biomèdiques August Pi i Sunyer), Barcelona, Spain

ABSTRACT Fragile X syndrome is the most common form of inherited intellectual disability, with an estimated incidence of 1 in 4,000 males and 1 in 6,000 females. Each diagnosis of an FMR1 mutation has far reaching clinical and reproductive implications for the extended family. Until now genetic counseling was offered based on the expansion risk in premutation carrier women, but the description of FMR1-associated disorders has increased the complexity of the genetic counseling for FXS families, especially FMR1 premutation carriers. Male individuals carrying full mutated alleles present with intellectual disability while the penetrance is incomplete in females (30-50%). Premutation allele carriers are intellectually unaffected, but several FMR1 premutation-related disorders have been described. The most prevalent are fragile X-associated primary ovarian insufficiency and fragile X-associated tremor/ataxia syndrome, but behavioral features such as impaired executive function, social deficits or anxiety have also been related to several FMR1 premutation carriers. Premutation women have 50% of risk of transmitting a premutation/full mutation allele to their offspring, depending on the CGG expansion repeat and the presence of AGG interruptions. On the contrary, premutation men carriers will only transmit the premutation allele to their daughters. Some issues such as risk assessment for intermediate alleles and the clinical prognosis for females with full mutations still remain challenging. Genetic counselors must have an updated and solid understanding of this genetic condition and the FMR1-associated disorders in order to cover all the counseling aspects of these disorders.

Keywords: FMR1, FXS, premutation alleles, full mutation alleles, genetic counseling, intermediate alles

1928

I. Madrigal

INTRODUCTION The World Health Organization defines Genetic Counseling as the process through which trained genetic counselors inform about the genetic aspects of a particular genetic disease to those who are at an increased risk of developing the disorder or of passing it on to their unborn offspring. A genetic counselor must provide accurate information to the patient and their families about the clinical consequences of the conditions, the inheritance of illnesses and their risks of recurrence, management and/or treatment, quality of life, life expectancy and social aspects. These professionals must then work in a wide variety of fields such as general genetics, prenatal care or family planning. The counseling process consists of two stages: pre and the post-test genetic counseling. In pre-test genetic counseling individuals are informed about the purpose of the test, the clinical consequences of the conditions, including the phenotypic features, inheritance patterns, the reliability and limitations of the test and the possible psychological impacts to the counselees and their relatives. In post-test genetic counseling, after disclosure of the test results, the counselor should focus on the emotional impact on the counselee and the relatives involved. The counselees must be informed about implications to them and their close relatives, including management and/or treatment options, quality of life, life expectancy and available reproductive choices. Counselors must ensure the privacy and confidentiality of the results.

GENETIC COUNSELING IN FMR1-ASSOCIATED DISORDERS Fragile X syndrome (FXS, #300624) is the most common form of inherited intellectual disability (ID), with an estimated incidence of 1 in 4,000 males and 1 in 6,000 females [1]. The molecular basis of this syndrome is mainly the expansion of an unstable CGG repeat in the 5’ untranslated region of the fragile X syndrome gene (FMR1). The polymorphic CGG repeat of the FMR1 gene is distributed in the population in four allelic classes according to repeat length (Table 1). Alleles ranging from 6 to 44 CGG repeats are the most common in the general population and have a stable transmission to the next generation. Alleles within the 45–54 CGG repeat range are called intermediate alleles and most are stable. Individuals carrying intermediate alleles are phenotypically normal. Alleles about 55–200 repeats are called premutation alleles. These alleles are associated with a significant elevation of FMR1 mRNA levels [2-3] and are highly unstable during maternal transmission. Premutation carrier individuals do not present with ID, but they have a risk of developing fragile X-associated tremor/ataxia syndrome (FXTAS), premature ovarian insufficiency (FXPOI) or other psychological symptoms [4-7]. Finally, expansion of the repeat region to more than 200 CGG trinucleotide sequences is called full mutation. FMR1 is an X-linked gene regulated by methylation of the promoter during X inactivation in somatic cells of females. This leads to gene silencing and insufficient synthesis of the FMR1 protein (FMRP). Expansions over 200 CGGs lead to hypermethylation of the CpG island resulting in non-expression of the FMR1 gene and absence of the FMRP. The lack of FMRP is the direct cause of the FXS phenotype [8]. Besides CGG repeat expansions, it has been reported that almost 1% of individuals with FXS have a partial or full deletion, or point mutation of the FMR1 gene [9-12].

Genetic Counseling of FMR1

1929

Until now genetic counseling was offered based on the expansion risk in premutation carrier women, but the description of FMR1-associated disorders has increased the complexity of the genetic counseling for FXS families, particularly to FMR1 premutation carriers. Furthermore, some issues such as risk assessment for intermediate alleles and the clinical prognosis for females with full mutations still remain challenging. Most of the families who first receive a diagnosis of FXS have no prior knowledge of FMR1-premutation disorders, and it is essential that individuals under study receive pre and post genetic counseling, including information about possible outcomes and the implications of carrying full, premutation or intermediate alleles. Genetic counseling of FXS requires attention to a wide range of clinical manifestations including developmental, neurodegenerative, and reproductive symptoms that may vary in age of onset and severity. Counselors must have a solid understanding of this genetic condition, including the trinucleotide repeat instability and the phenotypic variability. Table 1 shows associated FMR1 allele phenotypes. Table 1. FMR1 alleles and associated phenotypes Allele Normal Intermediate Premutation

CGG repeat range 5-44 45-54 55–200

Full Mutation

>200 (methylated)

Phenotype Normal Normal Normal, FXTAS, FXPOI and others ID in 100% males and reduced penetrance in females (30-50%)

ASSESSMENT RISK BASED ON CGGS EXPANSION Normal Range and Intermediate Alleles Alleles ranging from 6 to 44 CGG repeats, the most common in the general population, and most of the intermediate alleles have stable transmission to the next generation. Intermediate alleles may show some instability, including expansion to a full mutation in two generations [13-15].

Premutation Alleles Premutation alleles are highly unstable during maternal transmission and may expand to a higher CGG repeat size or even to a full mutation in only one generation. Even expansion of paternal premutation alleles is possible; the expansion from a premutation allele to a full mutation has only been observed through female meioses. Thus, all the daughters from a premutation male will inherit the premutation allele and will not manifest FXS. Table 2 shows the risk of expansion of the different allele types. The expansion risk of a FMR1 allele depends both on CGG repeat size and the presence of AGG interruptions. In 1994, Eichler et al. suggested that AGGs interspersed within the FMR1 repeat region may be linked to repeat stability and the risk of expansion [16]. In the general population, almost 95% of alleles have

1930

I. Madrigal

one or two AGG interruptions, which the most common allele pattern is two AGGs at positions 10 or 11 and 20 or 21 repeats. In contrast, alleles in FXS families contain no or few AGGs at the 5′ end and they contain long stretches of uninterrupted CGGs at the 3′ end [16,17]. Presumably maternal alleles with no AGG interruptions confer increased risk for unstable transmissions and thus, the inclusion of AGG genotype studies would be of benefit in clinical practice. AGG testing is expected to reassure premutation carriers with AGG interruptions while alerting premutation carriers with alleles without AGG interruptions who would have the highest risk for instability. Table 2. Risk of expansion of FMR1 alleles Allele Normal Intermediate

Premutation

Full Mutation

CGG repeat range 5-44 45-54 55–59 60–69 70–79 80–89 90–99 >100 >200 (methylated)

Risk of expansion to a full mutation for females* 0% 0% 3.70% 5.30% 31.10% 57.80% 80.10% 94–100%

*[68-70].

Full Mutation Alleles Full mutated males never transmit the full mutated allele to their daughters, only an allele in the premutation range. Full mutated females have a 50% of transmission risk of the full mutated allele to their offspring: all male descendants carrying the full mutation allele will be affected while a smaller percentage of women will present the syndrome.

GENETIC COUNSELING BASED ON FMR1 ALLELES Intermediate Alleles Intermediate alleles present a 45–54 CGG repeat range [18] and have a frequency in the general population of 1/35 to 1/57 females [19,20]. Intermediate allele carriers do not manifest ID, FXTAS or FXPOI, although some groups have suggested associations between intermediate alleles and some disorders such as Parkinson’s disease [21], primary ovarian insufficiency [22], and autism and cognitive disabilities [23,24]. However, these findings have not consistently been supported by other studies [25-27]. A frequent concern in FXS screening is the genetic counseling to intermediate allele carriers. Currently, the follow-up of individuals with no AGG interruptions is indicated, despite the low risk of expansion in the next generation.

Genetic Counseling of FMR1

1931

Premutation Alleles Individuals carrying premutation alleles are intellectually unaffected, but in the last decades several premutation-related disorders have been described. Among them the most prevalent are FXPOI and FXTAS [28,29]. In addition, behavioral features such as impaired executive function, social deficits or anxiety have been related to some FMR1 premutation carriers [30]. Premutation alleles contain trinucleotide expansions in the range of 55 to 200 CGG repeats. In Western populations premutation frequencies in females range from 1/151 to 1/259, but there is some evidence of ethnic and racial variability. In Israel, for example, the premutation frequency is around 1/113 and in Taiwan 1/837 [20,31-33]. Some authors state that the different reproductive aptitudes of female premutation carriers and the differences in mean maternal age may contribute to this variation in premutation frequencies [34]. In males the rate ranges from 1/468 to 1/813 [20,35]. Men carrying the premutation allele must mainly be counseled about the risk of FXTAS. This syndrome presents with incomplete penetrance even among premutation carriers with identical CGG-repeat lengths. Approximately 50% of premutation carrier males will develop neurodegenerative symptoms of FXTAS after the age of 50 [36]. The first clinical signs of the syndrome typically appear when patients are in their 50s and 60s, with a mean tremor onset at approximately 60 years and ataxia onset at 62 years [37]. The risk and severity of the disorder appear to be related to the CGG repeat size, with higher risk in larger repeats [38]; nevertheless, a biomarker that predicts the apparition of FXTAS or the protective factors in asymptomatic carriers has still not been identified. Other clinical signs associated with premutation male carriers are neuroendocrine dysfunction, including testosterone deficiency [39], hypertension [40] or bowel and urinary incontinence [41]. Genetic counseling of premutation carrier women must be addressed to the risk for premature ovarian insufficiency, besides the risk for expansion and the FXTAS syndrome. In women, FXTAS is much less common than in men, as many as 16% will develop FXTAS symptoms, it presents a later age of onset and is milder in presentation. The risk for FXPOI in these women increases around 20% with an age of onset before the age of 40 years [28]. Other pathologies associated with females premutation carriers are psychiatric disorders such as depression, anxiety or mood disorders [42-44], migraine [45], immune-mediated disorders, particularly hypothyroidism (15.9%) [36], and fibromyalgia (25%) [7,46,47]. The latter two in particular are even more common among women with FXTAS, with a frequency of 43% and 50%, respectively [7].

Full Mutation Alleles Full mutations are responsible for FXS, a spectrum of clinical features which includes physical, cognitive and behavioral aspects. All males carrying the full mutation will present with mild to severe intellectual disability and exhibit a variety of maladaptive behaviors overlapping those described for autism spectrum disorders [48,49]. On the contrary, only 50%70% of women manifest FXS symptoms, albeit in a milder form than men, and some appear to be completely unaffected or exhibit minor neurobehavioral features [50-52]. Despite a common genetic etiology, the clinical presentation of FXS is variable and this variability is related to residual levels of the FMRP due to the presence of CGG expansion size mosaicism, different

1932

I. Madrigal

methylation levels of the full mutation allele and X-inactivation that leads to a differential pattern of FMRP expression within tissues [51]. On the other hand, there are full mutation carrier males with a standardized IQ score of 70 or higher who are known as high functioning males. In normal males, the 5' CpG island containing the CGG trinucleotide repeat is not methylated, whereas a CGG triplet repeat expans to more than ~200 repeats, this site is methylated and the FMR1 is transcriptionally silenced [53]. Many mildly affected individuals show mosaic methylation at the FMR1 promoter. Regarding their offspring, their daughters will inherit an allele in the premutation range. High functioning males do not present with intellectual disability but recently, FXTAS has been described in a high functioning male [54] and in the case of an unmethylated mosaic (premutation-full mutation) male [55]. The latter suggests that the definition of FXTAS should also include those cases with an expanded allele the size and lack of methylation of which leads to RNA toxicity.

FMR1 Point Mutations/Deletions It has been suggested that patients with a clinical FXS-like phenotype but not carrying the FMR1 gene full mutation should be screened for FMR1 mutations [56,57]. It is estimated that FMR1 point mutations or deletions are responsible for up 1% of FXS cases. Nevertheless, the prevalence of mutations in the FMR1 coding region is still not well known since the standard FXS protocols only comprise the study of the CGG repeats size. These mutations can be de novo or inherited from a carrier mother. A male carrying a point mutation or deletion will always have carrier daughters, who might be affected depending on the X-chromosome inactivation. Carrier females have 50% of risk of transmitting the mutated allele. Within this 50%, all males will be affected and females will be variably affected, depending on the Xinactivation.

REPRODUCTIVE OPTIONS FOR PREMUTATION/FULL MUTATION CARRIERS Individuals at risk for passing on FXS mutations to their offspring have a variety of preand postconception options available. Regardless of the option they choose, women must be advised of any contraindication of these procedures [58]. When offering the reproductive options to a couple at risk, a fertility issue has to be considered since the risk of POF has significant reproductive implications. First of all, the onset of POF is difficult to predict. Secondly, the subtle endocrine perturbations (elevated follicle-stimulating hormone levels) observed in these women decreases the efficiency of ovarian stimulation required for preimplantational diagnosis and finally, there is evidence that premutation carriers may have hormonal changes suggestive of early ovarian aging despite regular menstrual cycles (See Chapter 5).

Genetic Counseling of FMR1

1933

Prenatal Diagnosis for FXS Prenatal diagnosis for FXS is possible using chorionic villi or amniotic fluid cells and it depends on several factors, including the physician performing the procedure and patient preference. When the establishment of the sizing of the expansion is sufficient to determine the genotype, the prenatal diagnosis on chorionic villi allows performing a therapeutic abortion at early stages in the pregnancy. On the contrary, the methylation pattern of a full mutation is established after the 14th week of pregnancy, thus the use of a methylation-sensitive method (i.e Southern Blot) is not suitable for early prenatal diagnosis on DNA from chorionic villi [59]. Moreover, the risk of miscarriage may be lower on amniotic fluid cell sampling. Table 3. Genetic counseling in FMR1 Progenitor allele and gender Normal male Normal female IA carrier male IA carrier female PM carrier male

% expected offspring No risk No risk Females IA range 50% NA range 50% IA range

Offspring outcome Males Normal Normal Normal

Females Normal Normal Normal

Normal

Normal

Females PM range

Normal

50% NA range 50%* PM/ FM*

Normal Normal, FXTAS, and others 100% ID

FM carrier male

females PM range

Normal

FM carrier female

50% NA range 50% FM

Normal 100% ID

PM carrier female

Normal, FXTAS, FXPOI and others Normal Normal, FXTAS, FXPOI and others 30-50% ID Normal, FXTAS, FXPOI and others Normal 30-50% ID

NA: normal allele, IA: intermediate allele; PM: premutation allele; FM: full mutation allele. *percentage varies according to the expansion risk indicated in Table 2.

Prenatal diagnosis should be offered to women with premutation or full mutations, but it is not intended for the pregnant partner of a premutation male carrier. These males, nevertheless, should receive genetic counseling about phenotypic risk to their daughters, who will inherit the premutation allele. Neither is prenatal testing intended for intermediate allele carriers. As indicated before, there are no reports of intermediate alleles expanding to full mutations in a single generation. The risk for a female premutation carrier of transmitting the expansion is 50%, and the risk for the maternal premutation to expand to full mutation is proportional to its size and AGG content. Table 3 summarizes the possible outcomes depending on the carrier state of each parent. The identification of a female fetus with the fragile X full mutation entails a significant challenge for professionals. The probability that a full mutation carrier fetus is affected is around 50-70%, but at present there are no biomarkers to predict this affectation. The diagnosis of a FXS patient requires extending the study to the mother in order to confirm her premutation carrier status.

1934

I. Madrigal

Preimplantational Diagnosis for FXS Preimplantation genetic diagnosis (PGD) is a technique based on the genetic analysis of an embryo obtained through in vitro fecundation. The most common option is to perform the genetic study on a day-3 embryo which is then transferred to the uterus. This approach increases the risk of embryo viability due to the biopsy. Further, the possibility of embryo mosaicism has been described at the cleavage stage and self-correction of aneuploidies between the cleavage and blastocyst stages [60]. Polar body biopsies can be used to avoid any misdiagnosis due to embryo mosaicism, although only maternal genetic information is obtained. The third option is to biopsy trophectoderm cells from blastocysts (5-6 day embryo), which is less invasive and has higher concordance between inner cell mass and trophectoderm cells [61]. PGD has several advantages over prenatal diagnosis. The diagnosis is performed in the embryo, avoiding the parental stress and the emotional trauma of a termination of pregnancy.

Offspring Renouncement and Adoption These two options are drastic and are usually rejected by the couples. Therefore they are currently seldom observed as the first choice option by couples at risk that wish to prevent the birth of an affected child.

Donor Germline Cell Another possible option is egg or sperm donation for female and male mutation carriers, respectively. Based on our experience, around 10% of FXS families chose for a germline cell donation [62]. At present, it is a very good option for premutation carrier females who have been involved in previous prenatal diagnosis and termination of pregnancies. Moreover, given the relatively high prevalence of FXS in the general population, potential gamete donors should be tested for this syndrome.

FMR1 TESTING GUIDELINES Several scientific societies such as the European Molecular genetics Quality Network (EMQN), the American College of Medical Genetics (ACMG), the National Society of genetic Counselors (NSGC) and the American College of Obstetrics and Gynecology (ACOG) have published best practice guidelines for the molecular genetic testing and diagnosis of FXS and other fragile X-associated disorders [18,63-66]. The best practice guidelines for genetic analysis and reporting in FXS, FXPOI, and FXTAS are listed in Table 4. Appropriate FMR1 molecular testing is very important for optimal genetic counseling in the fragile X-associated disorders due to the particular pattern and transmission of the CGG repeat. Although not being endorsed by current guidelines, screening women without known risk factors to FXS is increasingly being offered. In 2005 Musci and Caughey demonstrated the efficacy and cost effectiveness of prenatal population-based fragile X carrier screening [67].

Genetic Counseling of FMR1

1935

Table 4. FMR1 mutation testing recommendations FMR1 mutation testing is recommended for*: Individuals of either sex with intellectual disability, developmental delay or autism Individuals who have a family history of FXS Women with a family history of FMR1-related disorders, including FXPOI Women with reproductive or fertility problems associated with elevated levels of follicle stimulating hormone (FSH) Individuals with late onset tremor or cerebellar ataxia of unknown origin Given the relatively high prevalence of FXS in the general population, potential gamete donors should be tested for this syndrome *Sherman, 2005; ACOG, 20010.

CONCLUSION When first described, FXS was a rare X-linked disease responsible for intellectual disabilities in males and females in a lesser percentage. Research into FMR1 has brought to light the molecular and phenotypic complexity of FMR1-related diseases. The first issue to consider is that a FXS patient will always have a premutation carrier mother who should receive genetic counseling. Premutation carrier females have a 50% risk of transmitting a premutation/full mutated allele to their offspring, unlike carrier males who will only transmit the premutation allele. The expansion risk in females depends on the CGG repeats number and the AGG interruptions. Lastly, premutation carriers are at risk not only of having FXS offspring (females) but also of FXPOI (females), FXTAS and other disorders. The complexity of the issues surrounding genetic testing and the management of FMR1-associated disorders has increased, and investigation related to this gene covers many aspects, including molecular factors, epigenetic factors, emotional issues or targeted pharmaceuticals. As the knowledge regarding disease causing mechanisms evolves, genetic counselors must have an updated and solid understanding of this genetic condition and the FMR1-associated disorders in order to cover all the counseling aspects of these syndromes.

REFERENCES [1]

[2]

[3]

[4]

Hagerman RJ. The physical and behavioural phenotype, in: RJ Hagerman, P Hagerman (Eds.), Fragile-X Syndrome: Diagnosis, Treatment and Research, The Johns Hopkins University Press, Baltimore, 2002, pp. 3–109. Tassone F, Hagerman RJ, Loesch DZ, Lachiewicz A, Taylor AK, Hagerman PJ. Fragile X males with unmethylated, full mutation trinucleo tide repeat expansions have elevated levels of FMR1 messenger RNA. Am. J. Med. Genet. 2000a;94:232–236. Tassone F, Hagerman RJ, Taylor AK, Gane LW, Godfrey TE, Hagerman PJ. Elevated levels of FMR1 mRNA in carrier males: A new mechanism of involvement in the fragileX syndrome. Am. J. Hum. Genet. 2000b;66:6-15. Hagerman RJ, Leehey M, Heinrichs W, Tassone F, Wilson R, Hills J, Grigsby J, Gage B, Hagerman PJ. Intention tremor, parkinsonism, and generalized brain atrophy in male carriers of fragile X. Neurology 2001;57:127-130.

1936 [5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14] [15]

[16]

[17]

[18]

I. Madrigal Jacquemont S, Hagerman RJ, Leehey M, Grigsby J, Zhang L, Brunberg JA, Greco C, Des Portes V, Jardini T, Levine R, Berry-Kravis E, Brown WT, Schaeffer S, Kissel J, Tassone F, Hagerman PJ. Fragile X premutation tremor/ataxia syndrome: molecular, clinical, and neuroimaging correlates. Am. J. Hum. Genet. 2003;72:869-878. Hessl D, Tassone F, Loesch DZ, Berry-Kravis E, Leehey MA, Gane LW, Barbato I, Rice C, Gould E, Hall DA, Grigsby J, Wegelin JA, Harris S, Lewin F, Weinberg D, Hagerman PJ, Hagerman RJ. Abnormal elevation of FMR1 mRNA is associated with psychological symptoms in individuals with the fragile X premutation. Am. J. Med. Genet. B Neuropsychiatr. Genet. 2005;139B:115-21. Coffey SM, Cook K, Tartaglia N, Tassone F, Nguyen DV, Pan R, Bronsky HE, Yuhas J, Borodyanskaya M, Grigsby J, Doerflinger M, Hagerman PJ, Hagerman RJ. Expanded clinical phenotype of women with the FMR1 premutation. Am. J. Med. Genet. A. 2008;146A:1009-16. de Vries BB, Mohkamsing S, van den Ouweland AM, Mol E, Gelsema K, van Rijn M, Tibben A, Halley DJ, Duivenvoorden HJ, Oostra BA, Niermeijer MF. Screening with the FMR1 protein test among mentally retarded males. Hum. Genet. 1998;103:520-522. De Boulle K, Verkerk AJ, Reyniers E, Vits L, Hendrickx J, Van Roy B, Van den Bos F, de Graaff E, Oostra BA, Willems PJ. A point mutation in the FMR-1 gene associated with fragile X mental retardation. Nat. Genet. 1993;3:31–5. Lugenbeel KA, Peier AM, Carson NL, Chudley AE, Nelson DL. Intragenic loss of function mutations demonstrate the primary role of FMR1 in fragile X syndrome. Nat. Genet. 1995;10:483–5. Strom CM, Crossley B, Redman JB, Buller A, Quan F, Peng M, McGinnis M, Fenwick RG Jr, Sun W. Molecular testing for fragile X syndrome: lessons learned from 119,232 tests performed in a clinical laboratory. Genet Med. Off J. Am. Coll. Med. Genet 2007;9:46e51. Handt M, Epplen A, Hoffjan S, Mese K, Epplen JT, Dekomien G. Point mutation frequency in the FMR1 gene as revealed by fragile X syndrome screening. Mol. Cell Probes. 2014 Aug 27. pii: S0890-8508(14)00042-5. doi: 10.1016/j.mcp.2014.08.003. Terracciano A, Pomponi MG, Marino GM, Chiurazzi P, Rinaldi MM, Dobosz M, Neri G. Expansion to full mutation of a FMR1 intermediate allele over two generations. Eur. J. Hum. Genet. 2004;12:333-336. Zuniga A, Juan J, Mila M, Guerrero A. Expansion of an intermediate allele of the FMR1 gene in only two generations. Clin. Genet 2005;68:471–473. Fernandez-Carvajal I, Lopez Posadas B, Pan R, Raske C, Hagerman PJ, Tassone F. Expansion of an FMR1 grey-zone allele to a full mutation in two generations. J. Mol. Diagn 2009;11:306-310. Eichler EE, Holden JJ, Popovich BW, Reiss AL, Snow K, Thibodeau SN, Richards CS, Ward PA, Nelson DL. Length of uninterrupted CGG repeats determines instability in the FMR1 gene. Nat. Genet. 1994;8:88-94. Eichler EE, Macpherson JN, Murray A, Jacobs PA, Chakravarti A, Nelson DL. Haplotype and interspersion analysis of the FMR1 CGG repeat identifies two different mutational pathways for the origin of the fragile X syndrome. Hum. Mol. Genet. 1996;5:319-30. Sherman S, Pletcher BA, Driscoll DA. Fragile X syndrome: diagnostic and carrier testing. Genet Med. 2005;7:584-7.

Genetic Counseling of FMR1

1937

[19] Cronister A, Teicher J, Rohlfs EM, Donnenfeld A, Hallam S. Prevalence and instability of fragile X alleles: implications for offering fragile X prenatal diagnosis. Obstet. Gynecol. 2008;111:596-601. [20] Seltzer MM, Baker MW, Hong J, Maenner M, Greenberg J, Mandel D. Prevalence of CGG expansions of the FMR1 gene in a US population-based sample. American Journal of Medical Genetics Part B 2012;159B:589–597. [21] Loesch DZ, Khaniani MS, Slater HR, Rubio JP, Bui QM, Kotschet K, D'Souza W, Venn A, Kalitsis P, Choo AK, Burgess T, Johnson L, Evans A, Horne M. Small CGG repeat expansion alleles of FMR1 gene are associated with parkinsonism. Clin. Genet. 2009a;76:471-6. [22] Bodega B, Bione S, Dalprà L, Toniolo D, Ornaghi F, Vegetti W, Ginelli E, Marozzi A. Influence of intermediate and uninterrupted FMR1 CGG expansions in premature ovarian failure manifestation. Hum. Reprod. 2006;21:952-7. [23] Aziz M, Stathopulu E, Callias M, Taylor C, Turk J, Oostra B, Willemsen R, Patton M. Clinical features of boys with fragile X premutations and intermediate alleles. Am. J. Med. Genet. B Neuropsychiatr. Genet. 2003;121B:119-27. [24] Loesch DZ, Godler DE, Khaniani M, Gold E, Gehling F, Dissanayake C, Burgess T, Tassone F, Huggins R, Slater H, Choo KH. Linking the FMR1 alleles with small CGG expansions with neurodevelopmental disorders: preliminary data suggest an involvement of epigenetic mechanisms. Am. J. Med. Genet. A. 2009b;149A:2306-10. [25] Ennis S, Murray A, Youings S, Brightwell G, Herrick D, Ring S, Pembrey M, Morton NE, Jacobs PA. An investigation of FRAXA intermediate allele phenotype in a longitudinal sample. Ann. Hum. Genet. 2006;70:170-80. [26] Bennett CE, Conway GS, Macpherson JN, Jacobs PA, Murray A. Intermediate sized CGG repeats are not a common cause of idiopathic premature ovarian failure. Hum. Reprod. 2010;25:1335-8. [27] Madrigal I, Xunclà M, Tejada MI, Martínez F, Fernández-Carvajal I, Pérez-Jurado LA, Rodriguez-Revenga L, Milà M. Intermediate FMR1 alleles and cognitive and/or behavioural phenotypes. Eur. J. Hum. Genet. 2011;19:921-3. [28] Sherman, S. L. Premature ovarian failure in the fragile X syndrome. Am. J. Med. Genet. 2000;97:189–194. [29] Garcia-Arocena, D., Hagerman, P. J.. Advances in understanding the molecular basis of FXTAS. Human Molecular Genetic 2010;19:R83–89. [30] Bailey DB Jr, Raspa M, Olmsted M, Holiday DB. Co-occurring conditions associated with FMR1 gene variations: findings from a national parent survey. Am. J. Med. Genet A. 2008;146A:2060-9. [31] Rousseau, F., Rouillard, P., Khandjian, E. W., & Morgan, K. Prevalence of carriers of premutation-size alleles of the FMR1 gene and implications for the population genetics of the fragile X syndrome. American Journal of Human Genetics 1995;57:1006–1018. [32] Toledano-Alhadef H, Basel-Vanagaite L, Magal N, Davidov B, Ehrlich S, Drasinover V, Taub E, Halpern GJ, Ginott N, Shohat M. Fragile-X carrier screening and the prevalence of premutation and full-mutation carriers in Israel. American Journal of Human Genetics 2001;69:352–360. [33] Tzeng, C. C., Tsai, L. P., Hwu, W. L., Lin, S. J., Chao, M. C., Jong, Y. J., Chu, S. Y., Chao, W. C., and Lu, C. L. Prevalence of the FMR1 mutation in Taiwan assessed by

1938

[34] [35]

[36]

[37]

[38]

[39]

[40]

[41] [42] [43]

[44]

[45]

[46] [47]

[48]

I. Madrigal large-scale screening of newborn boys and analysis of DXS548-FRAXAC1 haplotype. Am. J. Med. Genet. 2005;133A:37–43. Genereux DP, Laird CD. Why do fragile X carrier frequencies differ between Asian and non-Asian populations? Genes Genet. Syst. 2013;88:211-24. Dombrowski C, Lévesque S, Morel ML, Rouillard P, Morgan K, Rousseau F. Premutation and intermediate-size FMR1 alleles in 10572 males from the general population: loss of an AGG interruption is a late event in the generation of fragile X syndrome alleles. Human Molecular Genetics 2002;11:371–378. Rodriguez-Revenga L, Madrigal I, Pagonabarraga J, Xunclà M, Badenas C, Kulisevsky J, Gomez B, Milà M. Penetrance of FMR1 premutation associated pathologies in fragile X syndrome families. Eur. J. Hum. Genet. 2009;17:1359-62. Leehey MA, Berry-Kravis E, Min SJ, Hall DA, Rice CD, Zhang L, Grigsby J, Greco CM, Reynolds A, Lara R, Cogswell J, Jacquemont S, Hessl DR, Tassone F, Hagerman R, Hagerman PJ. Progression of tremor and ataxia in male carriers of the FMR1 premutation. Mov. Disord. 2007;22:203-6. Leehey MA, Berry-Kravis E, Goetz CG, Zhang L, Hall DA, Li L, Rice CD, Lara R, Cogswell J, Reynolds A, Gane L, Jacquemont S, Tassone F, Grigsby J, Hagerman RJ, Hagerman PJ. FMR1 CGG repeat length predicts motor dysfunction in premutation carriers. Neurology. 2008;70:1397-402. Greco CM, Soontrapornchai K, Wirojanan J, Gould JE, Hagerman PJ, Hagerman RJ. Testicular and pituitary inclusion formation in fragile X associated tremor/ataxia syndrome. J. Urol. 2007;177:1434-7. Hamlin AA, Sukharev D, Campos L, Mu Y, Tassone F, Hessl D, Nguyen DV, Loesch D, Hagerman RJ. Hypertension in FMR1 premutation males with and without fragile Xassociated tremor/ataxia syndrome (FXTAS). Am. J. Med. Genet. A. 2012;158A:1304-9. Hagerman PJ, Hagerman RJ. Fragile X-associated tremor/ataxia syndrome--an older face of the fragile X gene. Nat. Clin. Pract. Neurol. 2007;3:107-12. Rodriguez-Revenga L, Madrigal I, Alegret M, Santos M, Milà M. Evidence of depressive symptoms in fragile-X syndrome premutated females. Psychiatr Genet. 2008;18:153-5. Bourgeois JA, Seritan AL, Casillas EM, Hessl D, Schneider A, Yang Y, Kaur I, Cogswell JB, Nguyen DV, Hagerman RJ. Lifetime prevalence of mood and anxiety disorders in fragile X premutation carriers. J. Clin. Psychiatry. 2011;72:175-82. Hunter JE, Sherman S, Grigsby J, Kogan C, Cornish K. Capturing the fragile X premutation phenotypes: a collaborative effort across multiple cohorts. Neuropsychology. 2012;26:156-64. Au J, Akins RS, Berkowitz-Sutherland L, Tang HT, Chen Y, Boyd A, Tassone F, Nguyen DV, Hagerman R. Prevalence and risk of migraine headaches in adult fragile X premutation carriers. Clin. Genet. 2013;84:546-51. Leehey MA, Legg W, Tassone F, Hagerman R. Fibromyalgia in fragile X mental retardation 1 gene premutation carriers. Rheumatology (Oxford). 2011;50:2233-6. Rodriguez-Revenga L, Madrigal I, Blanch-Rubió J, Elurbe DM, Docampo E, Collado A, Vidal J, Carbonell J, Estivill X, Mila M. Screening for the presence of FMR1 premutation alleles in women with fibromyalgia. Gene. 2013;512:305-8. Farzin F, Perry H, Hessl D, Loesch D, Cohen J, Bacalman S, Gane L, Tassone F, Hagerman P, Hagerman R. Autism spectrum disorders and attention-deficit/hyperactivity

Genetic Counseling of FMR1

[49] [50]

[51]

[52] [53]

[54]

[55]

[56] [57] [58] [59]

[60]

[61]

[62]

[63]

1939

disorder in boys with the fragile X premutation. J. Dev. Behav. Pediatr. 2006;27:S13744. Boyle L, Kaufmann WE. The behavioral phenotype of FMR1 mutations. Am. J. Med. Genet. C. Semin. Med. Genet. 2010 Nov 15;154C:469-76. Cronister A, Schreiner R, Wittenberger M, Amiri K, Harris K, Hagerman RJ. Heterozygous fragile X female: historical, physical, cognitive, and cytogenetic features. Am. J. Med. Genet. 1991;38:269-74. de Vries BB, Jansen CC, Duits AA, Verheij C, Willemsen R, van Hemel JO, van den Ouweland AM, Niermeijer MF, Oostra BA, Halley DJ. Variable FMR1 gene methylation of large expansions leads to variable phenotype in three males from one fragile X family. J. Med. Genet. 1996;33:1007-10. Keysor CS, Mazzocco MM. A developmental approach to understanding Fragile X syndrome in females. Microsc. Res. Tech. 2002;57:179-86. Hornstra I.K., Nelson D.L., Warren S.T., Yang T.P. High resolution methylation analysis of the FMR-1 gene trinucleotide repeat region in Fragile X syndrome. Hum. Mol. Genet. 1993;2:1659-1665 Loesch DZ, Sherwell S, Kinsella G, Tassone F, Taylor A, Amor D, Sung S, Evans A. Fragile X-associated tremor/ataxia phenotype in a male carrier of unmethylated full mutation in the FMR1 gene. Clin. Genet. 2012;82:88-92 Santa María L, Pugin A, Alliende MA, Aliaga S, Curotto B, Aravena T, Tang HT, Mendoza-Morales G, Hagerman R, Tassone F. FXTAS in an unmethylated mosaic male with fragile X syndrome from Chile. Clin. Genet. 2014;86:378-82 Grønskov K, Brøndum-Nielsen K, Dedic A, Hjalgrim H. A nonsense mutation in FMR1 causing fragile X syndrome. Eur. J. Hum. Genet. 2011;19:489e91. Myrick LK, Nakamoto-Kinoshita M, Lindor NM, Kirmani S, Cheng X, Warren ST. Fragile X syndrome due to a missense mutation. Eur. J. Hum. Genet. 2014;22:1185-9. Mor YS, Schenker JG. Ovarian Hyperstimulation Syndrome and Thrombotic Events. Am. J. Reprod. Immunol. 2014 Aug 22. doi: 10.1111/aji.12310. Devys D, Biancalana V, Rousseau F, Boue J, Mandel JL, Oberle I. Analysis of full fragile X mutations in fetal tissues and monozygotic twins indicate that abnormal methylation and somatic heterogeneity are established early in development. Am. J. Med. Genet 1992;43:208–216. Frumkin T,MalcovM, Yaron Y, Ben-Yosef D. Elucidating the origin of chromosomal aberrations in IVF embryos by preimplantation genetic analysis. Mol. Cell Endocrinol. 2008;282:112–9. Capalbo A, Wright G, Themaat L, Elliott T, Rienzi L, Nagy ZP. FISH reanalysis of inner cell mass and trophectoderm samples of previously array-CGH screened blastocysts reveals high accuracy of diagnosis and no sign of mosaicism or preferential allocation. Hum. Reprod. 2013;28:2298-307. Xunclà M, Badenas C, Domínguez M, Rodríguez-Revenga L, Madrigal I, Jiménez L, Soler A, Borrell A, Sánchez A, Milà M. Fragile X syndrome prenatal diagnosis: parental attitudes and reproductive responses. Reprod. Biomed. Online. 2010;21:560-5. Kronquist KE, Sherman SL, Spector EB. Clinical significance of tri-nucleotide repeats in Fragile X testing: a clarification of American College of Medical Genetics guidelines. Genet Med. 2008;10:845-7.

1940

I. Madrigal

[64] American College of Obstetricians and Gynecologists Committee on Genetics. ACOG Committee Opinion No. 469: Carrier screening for fragile X syndrome. Obstet. Gynecol. 2010;116:1008-10. [65] Finucane B, Abrams L, Cronister A, Archibald AD, Bennett RL, McConkie-Rosell A. Genetic counseling and testing for FMR1 gene mutations: practice guidelines of the national society of genetic counselors. J. Genet Couns. 2012;21:752-60. [66] Biancalana V, Glaeser D, McQuaid S, Steinbach P. EMQN best practice guidelines for the molecular genetic testing and reporting of fragile X syndrome and other fragile Xassociated disorders. Eur. J. Hum. Genet. 2014 Sep 17. doi: 10.1038/ejhg.2014.185 [67] Musci TJ, Caughey AB. Cost-effectiveness analysis of prenatal population-based fragile X carrier screening. Am. J. Obstet. Gynecol. 2005;192:1905-12. [68] Nolin SL, Brown WT, Glicksman A, Houck GE Jr, Gargano AD, Sullivan A, Biancalana V, Bröndum-Nielsen K, Hjalgrim H, Holinski-Feder E, Kooy F, Longshore J, Macpherson J, Mandel JL, Matthijs G, Rousseau F, Steinbach P, Väisänen ML, von Koskull H, Sherman SL. Expansion of the fragile X CGG repeat in females with premutation or intermediate alleles. Am. J. Hum. Genet. 2003;72:454-64. [69] Rifé M, Badenas C, Quintó L, Puigoriol E, Tazón B, Rodriguez-Revenga L, Jiménez L, Sánchez A, Milà M. Analysis of CGG variation through 642 meioses in Fragile X families. Mol. Hum. Reprod. 2004;10:773-6. [70] Lévesque S, Dombrowski C, Morel ML, Rehel R, Côté JS, Bussières J, Morgan K, Rousseau F. Screening and instability of FMR1 alleles in a prospective sample of 24,449 mother-newborn pairs from the general population. Clin. Genet. 2009;76:511-23.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 93

TREATMENT OF FRAGILE X SPECTRUM: FXS, FXTAS AND FXPOI F. J. Ramos1 and M. P. Ribate2 1

Unidad de Genética-Pediatría, GCV-CIBERER, Hospital Clínico Universitario “Lozano Blesa”, Facultad de Medicina, Universidad de Zaragoza, Spain 2 Facultad de Ciencias de la Salud, Universidad San Jorge, Zaragoza, Spain

ABSTRACT Fragile X Spectrum includes three different clinical conditions Fragile X Syndrome (FXS), Fragile X-Associated Tremor and Ataxia (FXTAS), and Fragile X-Associated Premature Ovarian Insufficiency (FXPOI). Treatment of FXS is mainly symptomatic and it is addressed to improve or make disappear some of the more dyscapacitating symptoms like hyperactivity, deficit attention disorder and behavioral problems of language anomalies. Clinical trials are in course focusing on new discovered therapeutical targets (i.e., mGluR). Treatment of FXTAS and FXPOI are also mainly symptomatic and should be individually prescribed and modified depending on the clinical evolution.

INTRODUCTION Fragile X spectrum includes Fragile X Syndrome (FXS), Fragile X-Associated Tremor Ataxia Syndrome (FXTAS) and Fragile X-Associated Premature ovarian Insufficiency (FXPOI). All three conditions are associated with the CGG trinucleotide expansion in the FMR1 gene on the X chromosome: FXS with more than 200 CGGs (full mutation) and FXTAS and FXPOI with 50 to 200 CGGs (premutation). Patients with FXS and FXTAS are mostly males, although females can also be affected. All three conditions are treated symptomatically, combining pharmacological and non-pharmacological therapies directed at alleviate the main disabling symptoms present in each condition.

1942

F. J. Ramos and M. P. Ribate

FRAGILE X SYNDROME Fragile X syndrome (FXS) is the most common inherited cause of intellectual disability that affects approximately 1 in 4,000 males and 1 in 8,000 females. Its genetic cause was identified in 1991 and consisted of the expansion of the number of CGG trinucleotide repeats at the FMR1 gene, located on the distal region of the long arm of chromosome X. The normal gene has less than 55 CGGs but when it has more than 55 CGGs it tends to expand when transmitted by the mother to the next generation. Individuals who have between 55- 200 CGGs (premutation) are considered carriers, and those with more than 200 CGGs (full mutation) and have a hypermethylated gene are affected. This methylation leads to the silencing of the FMR1 gene and the subsequent absence, partial or complete, of the FMRP (Fragile X Mental Retardation Protein), considered as the ultimate cause of FXS [1]. The vast majority of FXS males with the full mutation develop intellectual disabilities, which occurs in only 25% of females due to the presence of a normal X chromosome that produces FMRP. However, most females with FXS have learning disabilities and/or emotional and behavior problems [2]. The clinical presentation of FXS is highly variable. In addition to intellectual disability, affected patients have neurodevelopmental problems such as attention deficit hyperactivity disorder, disruptive behavior or autism spectrum disorders. The physical characteristics of FXS include dysmorphic facial features (long face, large and prominent ears and prominent chin), and macroorchidism after puberty [3].

The FMRP Protein and the Synapse FMRP is expressed ubiquitously in many tissues, predominantly in brain neurons. There it binds to different nuclear mRNAs, including the FMR1 gene mRNA, repressing the translation of the target mRNA to postsynaptic dendritic spines, where its activity is important for synaptic plasticity during transport. Dendritic spines are specialized and rapidly changing protrusions in the neurons whose creation and elimination are essential for learning and memory processing [4]. Microscopic analysis of brain samples of patients with FXS and Fmr1 knockout mice revealed no gross morphological abnormalities; however, in certain areas of the brain there are spindly dendritic spines, which are interpreted as immaturity and affect adversely the synaptic plasticity [5]. The discovery of a morphological spine phenotype indicates a possible defect in synaptic plasticity in FXS that could result in the intellectual disability phenotype. Whether the abnormal spine morphology is a cause or a consequence of altered signal transmission is currently unknown [6].

The Glutamate Receptor (mGluR) Hypothesis In the brain, there are two main types of neurotransmitter receptors in the synaptic membrane: metabotropic receptors and ionotropic receptors. Metabotropic receptors (mGluRs) have eight different subtypes (mGluR1-8) which in turn are divided into three groups (I, II and III) according to sequence similarities and pharmacological properties. Group I includes mGluR1 and mGluR5 receptors which activates the Gq protein coupled and phospholipase C.

Treatment of Fragile X Spectrum

1943

Group II receptors (mGluR2 and mGluR3) and Group III (mGluR4, mGluR6, and Glu7 Glu8) are coupled to the proteins Gi / Go by inhibiting adenylate cyclase. Ionotropic receptors are ligand-gated ion channels in which the incorporation of a specific ligand induces a conformational change leading to opening of the receiver [7]. The opened receiver allows ion flow across the cell membrane by changing the excitability of the neuron. The main dependent neuronal glutamate ionotropic receptors are: AMPA (isoxazolepropionic amino-3-hydroxy-5methyl-4-acid), NMDA (N-methyl-D-aspartic acid), and kainate receptors, whose activation produces a fast excitatory neurotransmission [8]. The mechanisms of long-term potentiation (LTP) and long-term depression (LTD) are the most important regulatory mechanisms of neuronal synaptic plasticity, defined as long-lasting changes in synaptic strength accompanied by abnormalities in the size and morphology of dendritic spines. The mechanism of strengthening of LTP produces a connection between presynaptic and postsynaptic neurons. The LTD mechanism is opposite to that of LTP and results in the weakening of synapses, mainly due to a reduction of glutamate-gated ionotropic AMPA-alpha in the postsynaptic membrane [9]. The ‘theory of glutamate receptor (mGluR)’, first published in 2004, tried to explain many aspects of clinical symptoms present in patients with FXS and in the Fmr1-KO mouse, including a higher density and immaturity of dendritic spines compared to normal individuals/mice. This theory stated that internalization of the AMPA receptor is excessive in FXS and likely caused by stimulation of group I mGluRs (mGluR1 and mGluR5). Such stimulation would induce local mRNA translation, resulting in the synthesis of new protein that triggers the internalization of the AMPA receptor, essential for the long-term plasticity of dendritic spines. FMR1 mRNA is also present in the postsynaptic compartment and FMRP is synthesized locally after mGluR activation [10]. On the other hand, FMRP seems to negatively regulate the translation of proteins that are important for the internalization of the AMPA receptor. The exact mechanism by which the FMRP local translation represses mRNA remains unknown. Moreover, phosphorylation and dephosphorylation of FMRP seems play a crucial role in the signaling cascade induced by stimulation of mGluR5 receptors, which stimulate local protein synthesis at the synapses [11]. Since the formulation of the mGluR theory, clinical researchers in FXS have sought the support of the pharmaceutical industry to collaborate in identifying therapeutic strategies aimed at mGluR5 in order to at least partially reverse some of the symptoms of FXS. The MPEP (2-methyl-6-(phenylethynyl)-pyridine), a negative modulator of mGluR5, can, in vitro, counter the excess of activity of the receptor and rescue the loss of AMPA receptors after the loss of FMRP. In FXS animal models, researches have got the pharmacological rescue of audiogenic seizures, behavioral phenotypes and alterations in dendritic spines by using several negative modulators of mGluR5. MGluR theory has focused research into the basic mechanisms underlying FXS, prompting the search for new therapeutic strategies [12].

The GABA Hypothesis Besides the mGluR´s hypothesis, researches have suggested that the signaling receptor gamma-aminobutyric acid (GABA) is altered in patients with FXS. GABA is the major inhibitory neurotransmitter in the central nervous system (CNS) and, as such, plays a key role in the modulation of neuronal activity in the brain. GABA mediates its action through two

1944

F. J. Ramos and M. P. Ribate

distinct systems, the ionotropic GABA-A and the metabotropic GABA-B receptors [13]. Many patients with FXS have epilepsy and sleep disorders, conditions associated with the signaling pathway of the GABA receptor. Interestingly, the mRNA encoding GABA-A receptor subunits are targets of FMRP. The Fmr1-KO mice have decreased levels of mRNA and protein in various subunits of GABA-A receptor compared to normal animals [14]. These studies support a model in which the FMRP mRNA would regulate the stability of the GABA-A receptor subunits, preventing its degradation by joining these mRNAs in vivo. In addition to GABA-A receptors, GABA-B receptors could also be related to FXS, therefore turning into another potential therapeutic target. The GABA-B receptor agonists inhibit the presynaptic release of glutamate and the postsynaptic signaling cascade downstream of mGluR5 [15]. All those studies have demonstrated a dysfunction in the mRNA and protein expression of several subunits of GABA receptors, mechanisms that would be likely involved in the occurrence of the FXS phenotype.

THERAPEUTIC APPROACHES IN FXS Currently, the treatment of patients with FXS is mainly symptomatic. The two most commonly used medications are stimulants used to improve attention and hyperactivity, and selective inhibitors of serotonin reuptake to reduce the risk of aggression associated with anxiety. FXS patients are not only treated with pharmacological agents, but also benefit from behavioral therapies for improving emotional and language problems. As already demonstrated in the mouse FXS behavior improves with an enriched environment and therefore this therapy might also be beneficial to humans [16]. Current therapeutic strategies, both pharmacological and non-pharmacological, are aimed at improving the symptoms but do not improve cognitive function. In recent years, new strategies have been developed for therapeutic interventions in FXS based on the theories of mGluR and GABA receptors. Several clinical trials using new designed drugs were initiated to correct the abnormal activity of the mGluR and GABA pathways in FXS [6]. Unfortunately, some of them have been recently discontinued due to the lack of demonstrable improvement.

MGluR5 Inhibitors The fenobam is a potent and selective antagonist of mGluR5 and was the first negative mGluR5 modulator tested in patients with FXS. To test whether it had significant effect on the FXS phenotype, fenobam was administered as a single oral dose to twelve affected patients (six males and six females) that the pre-pulse flicker noise (PPI -Pre-Pulse inhibition was measured inhibition of Acoustic Startle-) before and after drug administration. Generally, patients with FXS show decreased PPI compared to healthy control individuals. Six of the twelve patients with FXS showed improvement after treatment with PPI fenobam, with no significant adverse effects observed [17]. Although results were promising, it was difficult to draw definitive conclusions because of the lack of a controlled study with placebo, the fact that the patients received only a single dose

Treatment of Fragile X Spectrum

1945

of fenobam, and the low number of participants enrolled. Other inhibitors are the AFQ056 mGluR5, from Novartis; the STX107, developed by Merck and whose license was issued to Seaside Therapeutics, and the RO4917523, from Hoffman-La Roche [6]. Despite of the results of a preliminary clinical trial with AFQ056 (Mavoglurant) in which certain cognitive aspects improved in FXS patients with complete methylation of the FMR1 gene [18], the trial was discontinued by Novartis last April after results of phase IIb/III failed to show demonstrable improvement. Last month, Roche discontinued its trial as well because of negative phase II clinical results.

GABA-A Agonists GABA-A receptor agonists are currently used as anticonvulsants, antidepressants or anxiolytics. Benzodiazepines, which enhance the function of the GABA receptor, are the bestknown drugs of this group. Although their anxiolytic effects are useful in patients with FXS have unwanted side effects such as sedation or ataxia, and treatment discontinuation may cause withdrawal symptoms [6]. Besides the selective agonists of GABA-A receptor, neuroactive steroids that allosterically modulate them may be also effective, for example ganaxolone, which has a favorable safety profile and may be useful in patients with FXS [19]. The use of inhibitors of GABA-A receptors in patients with FXS is likely to be effective in reducing symptoms such as seizures or sleep disorders.

GABA-B Agonists Arbaclofen (STX209), a drug proven effective and safe for gastroesophageal reflux disease (GERD), has been used to treat autism spectrum disorders (ASD) in several studies. In an animal model of FXS, arbaclofen demonstrated a reversal of behavioral, neurological, and neuropathological features associated with the disease. Results from one double-blind, placebocontrolled study that treated children and adults with FXS have been promising, with signs of improvement in social function, especially in the most severely socially impaired individuals. Two studies, one open-label and one double-blind, placebo-controlled, were also conducted in children, adolescents, and young adults with ASD showing improvements in socialization [20, 21]. Approximately 13-18% of patients with FXS have seizures. The GABA-B and mGluR5 receptors are thought to be involved in the occurrence of audiogenic seizures in Fmr1-KO mice. Treatment of these mice with racemic baclofen reduced the incidence of seizures. Another positive effect of GABA-B receptor agonists could be the reduction of anxiety in patients with FXS. Treatment of Fmr1-KO mice with a GABA-B receptors agonist can inhibit audiogenic seizures, supporting the idea that GABA-B receptors are involved in the etiology of FXS [6].

1946

F. J. Ramos and M. P. Ribate

AMPA Agonists The increased internalization of AMPA receptors in neurons of Fmr1-KO mice plays a major role in altering the transmission of signals. CX516 is an ampakine which acts as a positive allosteric AMPA receptor modulator. This compound binds to the AMPA receptor-channel complex and induces a slower deactivation of the receptor, which results in a longer opening time, in a slower disappearance of the excitatory postsynaptic potential, and ultimately to an increased hippocampal LTP, compared to baseline state before administering the drug. Thus, CX516 enhances AMPA receptors after glutamate-mediated synaptic. CX516 has been tested in phase II, randomized, double-blind, placebo-controlled safety for four weeks in adult patients with FXS. Unfortunately no significant or cognitive measures and improvement in behavior were observed. This could be due to the use of low doses, to the CX516 short half-life in humans or, finally, to insufficient time of treatment. In the study, there were only minimal side effects and no serious adverse effects were observed [22]. Theoretically, treatments targeting AMPA receptors could improve behavior in FXS, although the beneficial effects of ampakines have yet to be convincingly demonstrated.

NMDA Receptor Antagonists Memantine is a non-competitive antagonist of NMDA receptors that can slow the progression of Alzheimer's disease and has been tested to treat Pervasive Developmental Disorders (PDD). In the presence of low levels of synaptic glutamate, binding of memantine blocks NMDA receptors, which are unblocked when glutamate levels increase. Besides excessive signaling through mGluR5 is linked to an increased AMPA receptor internalization and to the dysregulation of NMDA receptor activity [23]. Therefore, memantine may have positive effects on behavioral problems of patients with FXS. A clinical trial of memantine in six patients with FXS who had a comorbid diagnosis of PDD has been reported. Therapeutic effects were determined by the clinical evaluation of the “Clinical Global Impressions-Improvement” (CGI-I) scale during the time of treatment. The results did not show any significant improvement, although in four of the six patients certain signs of improvement were observed. Furthermore, the study was not a randomized placebocontrolled trial and, therefore, it was difficult to draw valid conclusions [24]. The NMDA receptor may be a target for pharmacological treatment of SXF because some brain regions of the Fmr1-KO mice showed impaired NMDA-dependent LTP. However, there is no convincing evidence that NMDA receptor antagonists have demonstrable beneficial effects on behavior [6].

Additional Treatments Lithium has been used for many years as a mood stabilizer. Most studies that have linked lithium with FXS have focused on the path of GSK3. Lithium inhibits the activity of GSK-3b, which in turn inhibits the phosphorylation of microtubule-associated protein 1B (MAP1B). The MAP1B is one of the major targets of the mRNA to which it binds and translationally regulates FMRP. In 2008, a clinical trial with open-label lithium was published in FXS patients; although

Treatment of Fragile X Spectrum

1947

the test was not randomized and placebo controlled, lithium appears that produced beneficial effects as decreased responses of aggression, abnormal vocalization improvement of self-harm and anxiety [25]. In conclusion, lithium appears to have beneficial effects on behavior and some cognitive functions but further research, such as long-term placebo-controlled studies are needed to check the effects of lithium in patients with FXS. Minocycline is a tetracycline analog which can inhibit matrix metalloproteinase-9 (MMP9) and reduce inflammation in the CNS. MMP-9 is an extracellular endopeptidase which breaks down the extracellular matrix proteins acting on synaptogenesis and morphology of dendritic spines. Minocycline is thought to act on the mGluR pathway and it has been tested in clinical trials to treat various neurological disorders (stroke, multiple sclerosis and autism). It has also been shown to have beneficial effects on the maturation of dendritic spines in cultured hippocampal neurons of Fmr1-KO mice [26]. A clinical trial of open-label studied the effects of minocycline in 50 patients with FXS was recently completed. The results were an improvement in language and behavior [27]. Acamprosate (calcium acetyl-homotaurine) is a commercially available drug used for the maintenance of abstinence from alcohol. This compound appears to have several mechanism of action: antagonist of mGluR5, weak antagonist of NMDA receptors and agonist of GABAA receptors. Although the mechanism of action of acamprosate is not fully understood, a small clinical trial was conducted in three patients with FXS to evaluate the response to treatment with acamprosate using the CGI-I scale. After a minimum of 16 weeks of treatment, all three patients improved. Surprisingly, they also showed improvement in language skills. Two subjects experienced nausea. Although these results appear promising, this trial was not placebo-controlled and the number of participants was too small to draw definitive conclusions [28]. Aripiprazole, an atypical antipsychotic that was approved in the USA for the treatment of children and adolescents with autism, has also been tested in patients with FXS. The effect of aripiprazole in patients with FXS was assessed by the CGI-I and ABC-I scales. All subjects who completed the study showed significant improvement in irritable behavior [29]. However, the study was not placebo-controlled and therefore the findings were difficult to interpret. Oxidative stress has been implicated in some psychiatric disorders, including autism. Studies in animal models suggested that in FXS there is an increased sensitivity to oxidative stress, which may alter neuronal and glial function. Indirect evidence was obtained by preclinical treatments of FXS performed using antioxidants. Indeed, chronic alpha-tocopherol treatment normalized free radical production and oxidative stress in the brain of FXS mice, in which it improved many of the behavioral and learning deficits of these mice, such as exploratory behaviors, habituation abnormalities, anxiety responses and contextual fear conditioning [30]. Recently, a phase II randomized, placebo-controlled trial was protocol was designed for children and adolescents with FXS [31]. Chronic melatonin treatment of FXS mice normalized the glutathione levels and prevented lipid peroxidation in the brain and testes of the mice. Moreover, melatonin improved some abnormal behaviors observed in FXS mice such as context-dependent exploratory and anxiety behaviors and learning abnormalities [32]. In a 4-week double-blind, placebo-controlled study with melatonin in 12 children with FXS, ASD or both, results showed a favorable effect (longer) in night sleep duration [33].

1948

F. J. Ramos and M. P. Ribate

Final Remarks FXS patients are treated with medications to alleviate the symptoms of the disease and/or the behavior problems such as hyperactivity or anxiety. Attempts to discover new drugs for the treatment of patients with FXS are becoming more promising with time due to improved understanding of the molecular mechanisms involved in the pathogenesis of the syndrome. Preliminary trials of new drugs in KO-mice models will be essential before they can be used in clinical trials in humans, although this does not guarantee their success. To date, several clinical trials have been carried out with promising preliminary results. Nevertheless, others had to be discontinued due to lack of positive results. Hopefully, more trials are currently being conducted or designed with improvements such as randomized double-blind methodology, sufficient number of patients and the use of outcome objective measurements to determine the therapeutic efficacy of the drug. For this, most clinical trials used one or more classic psychological questionnaires, however, the measurements of improvement were based on the likely subjective assessments made by relatives, caregivers and teachers. To ensure objectivity, it is important to develop reliable and objective outcome measurements (i.e.: questionnaires, scales or tests) to determine the true efficacy of the new drug [34]. Fortunately, and despite of some recent disappointing results, a number of clinicaltherapeutic trials for FXS and/or ASD are currently in course or being designed. It is remarkable that in less than 25 years since the discovery of the genetic defect that causes FXS, targeted therapeutic strategies have been already developed, with more or less success, to treat some of the most disabling symptoms of affected individuals. Although curative treatment seems to be far yet, it is likely that in the near future more effective symptomatic treatments will be available for FXS, especially for individuals with ASD. If expectations are met, they will significantly improve their quality of life and of their families.

FRAGILE X-ASSOCIATED TREMOR-ATAXIA SYNDROME (FXTAS) Fragile X-Associated Tremor-Ataxia Syndrome (FXTAS) is a progressive neurological disease that affects mainly males over 50 who carry a premutation allele (55-200 CGG repeats) in the fragile X gene FMR1. Affected individuals usually have intention tremor, ataxia, signs of parkinsonism, cognitive progressive decline and peripheral neuropathy. Besides, ancillary findings include autonomic dysfunction and psychiatric symptoms such as anxiety, depression and disinhibition [35]. As in FXS, there is no curative treatment for FXTAS, although there are a number of symptomatic therapies that can improve the clinical manifestations in affected individuals. Moreover, there is enough evidence regarding the efficacy of various medications for treatment of other diseases (i.e., Alzheimer diseases) that have important clinical overlap with FXTAS. The most common therapeutic interventions for FXTAS are listed in Table 1, which includes symptom-based treatments [36]. The drugs are used, basically, to alleviate symptoms related to tremor, equilibrium coordination, parkinsonism, sleep problems, anxiety, mood alterations, memory problems and pain.

Treatment of Fragile X Spectrum

1949

FRAGILE X-ASSOCIATED PRIMARY OVARY INSUFFICIENCY (FXPOI) Primary ovarian insufficiency or premature ovarian failure (POI/POF) is one of the causes of female infertility. POI consists in cessation of menstrual periods, increased levels of FSH and diminished levels of estrogens, all before the age of 40. POI occurs in about 1% of women between 30 to 40 years of age. Fertility of women with POI is severely diminished, but unlike menopause, POI may be accompanied with spontaneous ovarian activity and natural pregnancies [37]. The major causes of POI include autoimmunity, genetic and environmental factors. Among the most common genetic conditions that produce POI is Fragile X premutation, which is present in all female carriers. Treatment of POI includes hormone replacement therapy to reduce complications due to impaired endocrine function of ovaries, and fertility preservation therapies that include ovarian cortex, oocyte and embryo cryopreservation, oocyte or embryo donation and adoption in women without any ovarian function [38]. Recent research findings in animals and humans showed that neonatal and adult ovaries have some oogonial stem cells (OSCs) that can stably proliferate for months and produce mature oocytes in vitro. Studies on the isolation of OSCs form ovaries of aged animals and production of mature normal oocytes in ovaries of young adult animals lead to the recognition of the of importance of OSC niche and intraovarian environment on their differentiation to mature, normal oocytes. Therefore, cases of POI that result from defects in ovarian niche and its incapacity to support differentiation and growth of oocytes and also ovarian aging may be reversible in future [39]. These results have offered the opportunity for the application of OSCs as a target for POI therapy, restoration of ovarian function and, subsequently, restoration of normal fertility. However, clinical utility of these cells for treatment requires more evidence to confirm their safety, especially the effects from epigenetic changes during in vitro culture, and manipulation of produced oocytes and also resultant offspring. Table1. Symptom-based treatments for patients with FXTAS Symptoms Tremor Ataxia Parkinsonism Cognitive deficits and dementia Psychiatric problems Autonomic dysfunction Pain *

Treatment/Therapy Primidone, beta-blockers, benzodiazepines Amantadine and physical therapy Carbidopa/levodopa, pramipexole and eldepryl Donepezil, rivastigmine, galantamine, memantine Sertraline, citalopram, escitalopram, duloxetine, mirtazapine, venlafaxine and aripiprazole Bladder incontinency: Tricyclic antidepressants, muscarinic receptor antagonists, cytoscopy with injection of Botox Swallowing difficulties: pyridostigmine bromide Antidepressants, antiepileptics, topical analgesics, gabapentin and/or pregabalin

Modified from Capelli et al., (2010). [36]

1950

F. J. Ramos and M. P. Ribate

CONCLUSION There is no curative treatment for Fragile X Syndrome. Symptomatic paliative therapies include behavioral and cognitive interventions, speech therapy, occupational and physical therapy, as well as pharmacological treatments. All of them intended to improve intellectual abilities, familial interactions and social integration. Pharmacological treatments should be individualized depending on the age and the intellectual-cognitive level of the affected individual. Treatment for Fragile X-Associated Tremor and Ataxia is also symptomatic, and include physical therapy, psychological and/or psychiatric interventions, and pharmacological treatments. Fragile X Carrier females with Premature Ovarian Insufficiency should be treated by the appropriate specialists. Hormone replacement and fertility preservation therapies are the two main issues that should be addressed.

REFERENCES [1]

Oostra, B. A. and Willemsen, R. FMR1: A gene with three faces. Biochim Biophys Acta 2009, 1790, 467-477. [2] Garber, K. B., Visootsak, J., Warren, S. T. Fragile X Syndrome. Eur J Hum Genet 2008, 16, 666-672. [3] Brown W. T. Clinical aspects of the Fragile X Syndrome. In: Denman R. B. Ed. Modeling Fragile X Syndrome: Results and Problems in Cell Differentiation nº 54. Berlin: Springer-Verlag; 2012; pp. 273-279. [4] Kim, M., Bellini, M., Ceman, S. Fragile X mental retardation protein FMRP binds mRNAs in the nucleus. Mol Cell Biol 2009, 29, 214-228. [5] Irwin, S. A., Patel, B., Idupulapati, M., Harris, J. B., Crisostomo, R. A., Larsen, B. P., Kooy, F., Willems, P. J., Cras, P., Kozlowski, P. B., Swain, R. A., Weiler, I. J., Greenough, W. T. Abnormal dendritic spine characteristics in the temporal and visual cortices of patients with fragile-X syndrome: A quantitative examination. Am. J Med Genet 2001, 98, 161-167. [6] Levenga, J., de Vrij, F. M. S., Oostra, B. A., Willemsen, R. Potential therapeutic interventions for Fragile X síndrome. Trends Mol Med 2010, 16, 516-527. [7] Gross, C., Berry-Kravis, E. M., Bassell, G. J. Therapeutic Strategies in Fragile X Syndrome: Dysregulated mGluR Signaling and Beyond. Neuropsychopharmacology 2011, 37, 178-195. [8] Ferraguti, F., Crepaldi, L., Nicoletti, F. Metabotropic glutamate 1 receptor: Current concepts and perspectives. Pharmacol Rev 2008, 60, 536-581. [9] Collingridge, G. L., Peineau, S., Howland, J. G., Wang, Y. T. Long-term depression n the CNS. Nat Rev Neurosci 2010, 11, 459-473. [10] Bear, M. F., Huber, K. M., Warren S. T. The mGluR theory of fragile X mental retardation. Trends Neurosci 2004, 27, 370-377. [11] Ceman, S., O´Donnell, W. T., Reed, M., Patton, S., Pohl, J., Warren, S. T. Phosphorylation influences the translation state of FMRP-associated polyribosomes. Hum Mol Genet 2003, 12, 32295-32305.

Treatment of Fragile X Spectrum

1951

[12] Nakamoto, M., Nalavadi, V., Epstein, M. P., Narayanan, U., Bassell, G. J., Warren, S. T. Fragile X mental retardation protein deficiency leads to excessive mGluR5-dependent internalization of AMPA receptors. Proc Natl Acad Sci USA 2007, 104, 15537-15542. [13] D’Hulst, C. and Kooy, R. F. The GABA(A) receptor: A novel target for treatment of fragile X? Trends Neurosci 2007, 30, 425-431. [14] Selby, L., Zhank, C., Sun, Q. Q. Major defects in neocortical GABAergic inhibitory circuits in mice lacking the fragile X mental retardation protein. Neurosci Lett 2007, 412, 227-232. [15] Tu, H., Rondard, P., Xu, C., Bertaso, F., Cao, F., Zhang, X., Pin, J. P., Liu, J. Dominant role of GABAB2 and Gbetagamma for GABAB receptor-mediated-ERK1/2/CREB pathway in cerebellar neurons. Cell Signal 2007, 19, 1996-2002. [16] Meredith, R. M., Holmgren, C. D., Weidum, M., Burnashev, N., Mansvelder, H. D. Increased threshold for spike-timing-dependent plasticity is caused by unreliable calcium signaling in mice lacking fragile X gene FMR1. Neuron 2007, 54, 627-638. [17] Hessl, D., Berry-Kravis, E., Cordeiro, L., Yuhas, J., Ornitz, E. M., Campbell, A., Chruscinski, E., Hervey, C., Long, J. M., Hagerman, R. J. Prepulse inhibition in fragile X syndrome: feasibility, reliability, and implications for treatment. Am J Med Genet B Neuropsychiatr Genet 2009, 150B, 545-553. [18] Jacquemont, S., Curie, A., des Portes, V., Torrioli, M. G., Berry-Kravis, E., Hagerman, R. J., Ramos, F. J., Cornish, K., He, Y., Paulding, C., Neri, G., Chen, F., Hadjikhani, N., Martinet, D., Meyer, J., Beckmann, J. S., Delange, K., Brun, A., Bussy, G., Gasparini, F., Hilse, T., Floesser, A., Branson, J., Bilbe, G., Johns, D., Gomez-Mancilla, B. Epigenetic modification of the FMR1 gene in Fragile X Syndrome is associated with differential response to the mGluR5 antagonist AFQ056. Sci Transl Med 2011; 3:64ra1. [19] Cornish, K., Turk, J., Hagerman, R. The fragile X continuum: New advances and perspectives. J Intellect Disabil Res 2008, 52, 469-482. [20] Cryan, J. F. and Kaupmann, K. Don’t worry ‘B’ happy! A role for GABA(B) receptors in anxiety and depression. Trends Pharmacol Sci 2005, 26, 36-43. [21] Erickson, C. A., Veenstra-Vanderweele, J. M., Melmed, R. D., McCracken, J. T., Ginsberg, L. D., Sikich, L., Scahill, L., Cherubini, M., Zarevics, P., Walton-Bowen, K., Carpenter, R. L., Bear, M. F., Wang, P. P., King, B. H. STX209 (arbaclofen) for autism spectrum disorders: An 8-week open-label study. J Autism Dev Disord 2014, 44, 958964. [22] Berry-Kravis, E., Krause, S. E., Block, S. S., Guter, S., Wuu, J., Leurgans, S., Decle, P., Potanos, K., Cook, E., Salt, J., Maino, D., Weinberg, D., Lara, R., Jardini, T., Cogswell, J., Johnson, S. A.; Hagerman, R. Effect of CX516, an AMPA-modulating compound, on cognition and behavior in fragile X syndrome: a controlled trial. J Child Adolesc Psychopharmacol 2006, 16, 525-540. [23] Shang, Y., Wang, H., Mercaldo, V., Li, X., Chen, T., Zhuo, M. Fragile X mental retardation protein is required for chemically-induced long-term potentiation of the hippocampus in adult mice. J Neurochem 2009, 111, 635-646. [24] Erickson, C. A., Mullett, J. E., McDougle, C. J. Open-label memantine in fragile X syndrome. J Autism Dev Disord 2009, 39, 1629-1635. [25] Berry-Kravis, E., Sumis, A., Hervey, C., Nelson, M., Porges, S. W., Weng, N., Weiler, I. J., Greenough, W. T. Open-label treatment trial of lithium to target the underlying defect in fragile X syndrome. J Dev Behav Pediatr 2008, 29, 293-302.

1952

F. J. Ramos and M. P. Ribate

[26] Bilousova, T. V., Dansie, L., Ngo, M., Aye, J., Charles, J. R., Ethell, D. W., Ethell, I. M. Minocycline promotes dendritic spine maturation and improves behavioural performance in the fragile X mouse model. J Med Genet 2009, 46, 94-102. [27] Utari, A., Chonchaiya, W., Rivera, S. M., Schneider, A., Hagerman, R. J., Faradz, S. M., Ethell, I. M., Nguyen, D. V. Side effects of minocycline treatment in patients with fragile X syndrome and exploration of outcome measures. Am. J Intellect Dev Disabil 2010, 115, 433-443. [28] Erickson, C. A., Mullett, J. E., McDougle, D. J. Brief report: Acamprosate in fragile X syndrome. J Autism Dev Disord 2010, 40, 1412-1416. [29] Erickson, C. A., Stigler, K. A., Wink, L. K., Mullett, J. E., Kohn, A., Posey, D. J., McDougle, C. J. A prospective open-label study of aripiprazole in fragile X syndrome. Psychopharmacology (Berl). 2011, 216, 85-90. [30] De Diego-Otero, Y., Romero-Zerbo, Y., El Bekay, R., Decara, J., Sánchez, L., Rodriguez-de-Fonseca, F., del Arco-Herrera, I. Alpha-tocopherol protect against oxidative stress in the fragile X knockout mouse: An experimental therapeutic approach for the Fmr1 deficiency. Neuropsycopharmacology 2009, 34, 1011-1026. [31] De Diego-Otero, Y., Calvo-Medina, R., Quintero-Navarro, C., Sánchez-Salido, L., García-Guirado, F., Del Arco-Herrera, I., Fernández-Carvajal, I., Ferrando-Lucas, T., Caballero-Andaluz, R., Pérez-Costillas, L. A combination of ascorbic acid and αtocopherol to test the effectiveness and safety in the fragile X syndrome: study protocol for a phase II, randomized, placebo-controlled trial. Trials 2014, 15, 345-360. [32] Romero-Zerbo, Y., Decara, J., el Bekay, R., Sanchez-Salido, L., Del Arco-Herrera, I., de Fonseca, F. R., de Diego-Otero, Y. Protective effects of melatonin against oxidative stress in Fmr1 knockout mice: a therapeutic research model for the fragile X syndrome. J Pineal Res 2009, 46, 224-234. [33] Wirojanan, J., Jacquemont, S., Diaz, R., Bacalman, S., Anders, T. F., Hagerman, R. J., Goodlin-Jones, B. L. The efficacy of melatonin for sleep problems in children with autism, fragile X syndrome, or autism and fragile X syndrome. J Clin Sleep Med 2009, 5, 145-150. [34] Berry-Kravis, E., Hessl, D., Abbeduto, L., Reiss, A. L., Beckel-Mitchener, A., Urv, T. K. and Outcome Measurements Working Groups. Outcome measures for clinical trials in Fragile X Syndrome. J Dev Behav Pediatr 2013, 34, 508-522. [35] Hagerman, R. J., Hall, D. A., Coffey, S., Leehey, M., Burgeois, J., Gould, J., Zhank, L., Seritan, A., Berry-Kravis, E., Olichney, J., Miller, J. W., Fong, A. L., Carpenter, R., Bodine, C., Gane, L. W., Rainin, E., Hagerman, H., Hagerman, P. J. Treatment of fragile X-associated tremor ataxia syndrome (FXTAS) and related neurological problems. Clin Intervention Aging 2008, 3, 251-262. [36] Capelli, L. P., Rodrigues-Gonçalves, M. R., Leite, C. C., Barbosa, E. R., Nitrini, R., Vianna-Morgante, A. M. The fragile X-associated tremor and ataxia syndrome (FXTAS). Arq Neuropsiquiatr, 2010, 68, 791-798. [37] Sadeghi, M. R. New hopes for the treatment of Primary Ovarian Insufficiency/ Premature Ovarian Failure. J Reprod Infertil 2013, 14, 1-2. [38] Blumenfeld, Z. Fertility treatment in women with premature ovarian failure. Expert Rev Obstet Gynecol 2011, 6, 321-330.

Treatment of Fragile X Spectrum

1953

[39] White, Y. A., Woods, D. C., Takai, Y., Ishihara, O., Seki, H., Tilly, J. L. Oocyte formation by mitotically active germ cells purified from ovaries of reproductive-age women. Nat Med 2010, 18, 413-421.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 94

PRIVACY AND PROGRESS IN WHOLE GENOME SEQUENCING Presidential Commission for the Study of Bioethical Issues EXECUTIVE SUMMARY Over the course of less than a decade, whole genome sequencing has progressed from being one of our nation’s boldest scientific aspirations to becoming a readily available technique for determining the complete sequence of an individual’s deoxyribonucleic acid (DNA)—that person’s unique genetic blueprint. With this tremendous advance comes the accumulation of vast quantities of whole genome sequence data and complex questions of how—across a multitude of clinical, research, and social environments—to protect the privacy of those whose genomes have been sequenced. Collections of whole genome sequence data have already been key to important medical breakthroughs, and they hold enormous promise to advance clinical care and general health moving forward. To realize this promise of great public good ethically, individual interests in privacy must be respected and secured. Large-scale collections of genomic data raise serious concerns for the individuals participating. One of the greatest of these concerns centers around privacy: whether and how personal, sensitive, or intimate knowledge and use of that knowledge about an individual can be limited or restricted (by means that include guarantees of confidentiality, anonymity, or secure data protection). Because whole genome sequence data provide important insights into the medical and related life prospects of individuals as well as their relatives— who most likely did not consent to the sequencing procedure—these privacy concerns extend beyond those of the individual participating in whole genome sequencing. These concerns are compounded by the fact that whole genome sequence data gathered now may well reveal important information, entirely unanticipated and unplanned for, only after years of scientific progress. Another privacy concern associated with whole genome sequencing is the potential for unauthorized access to and misuse of information. For example, in many states someone could  This

is an edited, reformatted and augmented version of the Presidential Commission for the Study of Bioethical Issues, dated October 2012.

1956

Presidential Commission for the Study of Bioethical Issues

legally pick up a discarded coffee cup and send a saliva sample to a commercial sequencing entity in an attempt to discover an individual’s predisposition to neurodegenerative disease. The information might then be misused, for example, by a contentious spouse as evidence of unfitness to parent in a custody case. Or, the information might be publicized by a malicious stranger or acquaintance without the individual’s knowledge or consent in a social networking space, which could adversely affect that individual’s chance of finding a spouse, achieving standing in a community, or pursuing a desired career path. Realizing the promise of whole genome sequencing requires widespread public participation and individual willingness to share genomic data and relevant medical information. This, in turn, requires public trust that any whole genome sequence data shared by individuals with clinicians and researchers will be adequately protected. Current U.S. governance and oversight of genetic and genomic data, however, do not fully protect individuals from the risks associated with sharing their whole genome sequence data and information. In particular, a great degree of variation exists in what protections states afford to their citizens regarding the collection and use of genetic data. Only about half of the states, for example, offer protections against surreptitious commercial genetic testing. Currently, the majority of the benefits anticipated from whole genome sequencing research will accrue to society, while associated risks fall to the individuals sharing their data. This report focuses on reconciling the enormous public benefits anticipated from whole genome sequencing research with the potential risks to privacy of individuals, and the protections that must be foremost in our minds as we focus our policies to facilitate such privacy and progress.

Basic Ethical Principles for Assessing Whole Genome Sequencing Laws and regulations cannot do all of the work necessary to provide sufficient privacy protections for whole genome sequence data. The Commission has been mindful of how the five ethical principles set out in its first report, New Directions: The Ethics of Synthetic Biology and Emerging Technologies, apply to the ethics of whole genome sequencing. These principles—which f low from the ideal of respect for persons—are public beneficence, responsible stewardship, intellectual freedom and responsibility, democratic deliberation, and justice and fairness. This report, Privacy and Progress in Whole Genome Sequencing, enlists these principles along with those set forth in the Belmont Report (a landmark statement of ethics for research involving human participants). Privacy and Progress focuses on recommendations aimed at pursuing and securing the public benefits anticipated from whole genome sequencing while minimizing the potential privacy risks to individuals. These principles suggest ethically important and practically useful guidelines for whole genome sequencing. Chief among these is the principle of respect for persons, which requires strong baseline protections for privacy and security of data, while public beneficence requires facilitating ample opportunities for data sharing and access to data by clinicians, researchers, and other authorized users. Respect for persons further requires that any collection and sharing of individual data be based on a robust process of informed consent. Responsible stewardship calls for oversight and management of whole genome sequence information by funders, managers, professional organizations, and others. The principle of intellectual freedom and responsibility provides further support for pursuing whole genome sequencing and seeking models for broad data sharing by promoting regulatory parsimony. Democratic deliberation

Privacy and Progress in Whole Genome Sequencing

1957

urges all parties to consider changes to policies and practices in light of the evolving science and its implications for enduring ethical values. Finally, justice and fairness requires that we seek to channel the benefits of whole genome sequencing to all who can potentially benefit, and to ensure that the risks are not disproportionately borne by any subset of the population, including vulnerable or marginalized groups.

Recommendations Currently we are in a period of intense transition with respect to integrating whole genome sequencing into clinical care, as well as facilitating access to and use of whole genome sequence data for research purposes. Moreover, the challenges we face today are not precisely the same challenges we will face in one, five, or ten years, as genomic technologies continue to develop and mature. Due to the rapid development of technology, we need to craft policies that are flexible and agile enough to ensure that we do not constrain our ability to adapt to evolving technology and social norms related to privacy and access. Recognizing that ethical obligations reach beyond what is legally enforceable, the Commission examines both the relevant ethical principles and the relevant legal requirements to offer guidance as to what (ethically) ought to be done and what (legally) must be done. This is the foundation on which the Commission builds its Privacy and Progress recommendations.

Strong Baseline Protections while Promoting Data Access and Sharing Presently, many national and state policies are in place to guard personally identifiable health information and records of participation in research. These policies should apply to all handlers of the data, from those who collect the data, to researchers who use them, to thirdparty storage and analysis providers (e.g., hosts of cloud computing services). Privacy protections should guard against unauthorized access to, and illegitimate uses of, whole genome sequence data and information while allowing for authorized users of these data to advance individual and public health. Recommendation 1.1. Funders of whole genome sequencing research; managers of research, clinical, and commercial databases; and policy makers should maintain or establish clear policies defining acceptable access to and permissible uses of whole genome sequence data. These policies should promote opportunities for models of data sharing by individuals who want to share their whole genome sequence data with clinicians, researchers, or others. Strong baseline privacy protections require a spectrum of policies starting with data handling through the protection of persons from future disadvantage and discrimination arising from misuse of their whole genome sequence data. It is critical, however, to ensure that privacy regulations allow individuals to share their own whole genome sequence data with clinicians, researchers, and others in ways that they choose.

1958

Presidential Commission for the Study of Bioethical Issues

Recommendation 1.2. The Commission urges federal and state governments to ensure a consistent floor of privacy protections covering whole genome sequence data regardless of how they were obtained. These policies should protect individual privacy by prohibiting unauthorized whole genome sequencing without the consent of the individual from whom the sample came. Treating like data alike is crucial to ensuring consistent protections for whole genome sequence information across the United States. Although states should enact genomic policies that are most relevant and important to their constituents, bringing such protections to a minimum standard that addresses privacy—while still allowing individuals to share their own data—would provide just and fair protections regardless of where one happens to reside. Data Security and Access to Databases Data privacy requires data security. Data security requires ethical responsibility and accountability from all those who handle whole genome sequence data. It must further be supported by policies and infrastructure to protect safe sharing of data.

Recommendation 2.1. Funders of whole genome sequencing research; managers of research, clinical, and commercial databases; and policy makers should ensure the security of whole genome sequence data. All persons who work with whole genome sequence data, whether in clinical or research settings, public or private, must be: 1) guided by professional ethical standards related to the privacy and confidentiality of whole genome sequence data and not intentionally, recklessly, or negligently access or misuse these data; and 2) held accountable to state and federal laws and regulations that require specific remedial or penal measures in the case of lapses in whole genome sequence data security, such as breaches due to the loss of portable data storage devices or hacking. Many observe that absolute privacy is not possible in this, or many other realms. The greater potential for harm is not by virtue of authorized others knowing about one’s whole genome make-up, but rather through the misuse of data that have been legally accessed. Recommendation 2.2. Funders of whole genome sequencing research; managers of research, clinical, and commercial databases; and policy makers must outline to donors or suppliers of specimens acceptable access to and permissible use of identifiable whole genome sequence data. Accessible whole genome sequence data should be stripped of traditional identifiers whenever possible to inhibit recognition or re-identification. Only in exceptional circumstances should entities such as law enforcement or defense and security have access to biospecimens or whole genome sequence data for non health-related purposes without consent. The consent process should communicate limits on access to and use of genomic data to those having their whole genome sequenced in clinical care, research, and consumer-initiated contexts. These policies should apply to the original recipient of the data as well as to all parties who work with the data, from those who collect the sample or data through third-party storage and analysis service providers. Those who work with whole genome sequence data should remain current on regulations regarding data privacy and security.

Privacy and Progress in Whole Genome Sequencing

1959

Recommendation 2.3. Relevant federal agencies should continue to invest in initiatives to ensure that thirdparty entrustment of whole genome sequence data, particularly when these data are interpreted to generate health-related information, complies with relevant regulatory schemes such as the Health Insurance Portability and Accountability Act and other data privacy and security requirements. Best practices for keeping data secure should be shared across the industry to create a solid foundation of knowledge upon which to maximize public trust. Whole genome sequence data not stripped of traditional identifiers are considered “protected health information” and are covered under the Health Insurance Portability and Accountability Act’s Privacy, Security, and Enforcement Rules and the federal Common Rule for protecting human research participants. The same regulations, policies, and ethical guidelines that protect such health information should also be in place to govern the sharing of whole genome sequence data with third-party storage and analysis service providers. Public and the private sector parties should share their lessons learned to promote efficiency and avoid duplicating efforts. Consent Not unique to whole genome sequencing, a well-developed, understandable, informed consent process is essential to ethical clinical care and research. To educate patients and participants thoroughly about the potential risks associated with whole genome sequencing, the consent process must include information about what whole genome sequencing is; how data will be analyzed, stored, and shared; the types of results the patient and participant can expect to receive, if relevant; and the likelihood that the implications of some of these results might currently be unknown, but could be discovered in the future. Respect for persons requires obtaining fully informed consent at the outset of diagnostic testing or research.

Recommendation 3.1. Researchers and clinicians should evaluate and adopt robust and workable consent processes that allow research participants, patients, and others to understand who has access to their whole genome sequences and other data generated in the course of research, clinical, or commercial sequencing, and to know how these data might be used in the future. Consent processes should ascertain participant or patient preferences at the time the samples are obtained. Recommendation 3.2. The federal Office for Human Research Protections or a designated central organizing federal agency should establish clear and consistent guidelines for informed consent forms for research conducted by those under the purview of the Common Rule that involves whole genome sequencing. Informed consent forms should: 1) briefly describe whole genome sequencing and analysis; 2) state how the data will be used in the present study, and state, to the extent feasible, how the data might be used in the future; 3) explain the extent to which the individual will have control over future data use; 4) define benefits, potential risks, and state that there might be unknown future risks; and 5) state what data and information, if any, might be returned to the individual.

1960

Presidential Commission for the Study of Bioethical Issues

Each Common Rule agency has its own enforcement authorities to protect research participants. All agencies should work together as they develop clear and consistent guidelines for their informed consent forms. Clinical consent documents for whole genome sequencing will have to address a number of issues specific to whole genome sequencing: an explanation of the science, whether whole genome sequence data collected for clinical applications will be made available for research purposes, and what types of results will be produced through whole genome sequencing. For example, an important unsettled issue is the ethics of reporting incidental findings to individuals— that is, information gleaned from whole genome sequencing research or clinical practice that was not its intended or expected object.

Recommendation 3.3. Researchers, clinicians, and commercial whole genome sequencing entities must make individuals aware that incidental findings are likely to be discovered in the course of whole genome sequencing. The consent process should convey whether these findings will be communicated, the scope of communicated findings, and to whom the findings will be communicated. Recommendation 3.4. Funders of whole genome sequencing research should support studies to evaluate proposed frameworks for offering return of incidental findings and other research results derived from whole genome sequencing. Funders should also investigate the related preferences and expectations of the individuals contributing samples and data to genomic research and undergoing whole genome sequencing in clinical care, research, or commercial contexts. Individuals undergoing whole genome sequencing in research, clinical, and commercial contexts must be provided with sufficient information in informed consent documents to understand what incidental findings are, and to know if they will or will not be notified of incidental findings discovered as a result of whole genome sequencing. Facilitating Progress in Whole Genome Sequencing Currently, large amounts of patient data are being collected in the health care setting, stripped of traditional identifiers, analyzed, and fed into research that might one day improve clinical care. This “learning health system” model both translates advances in health services research into clinical applications and collects data during clinical care to facilitate further advances in research. Learning health system advocates and others support standardized electronic health record systems and infrastructure to facilitate health information exchange so that data can be easily aggregated and studied. Integrating whole genome sequence data into health records in the learning health system model can provide researchers with more data to perform genome-wide analyses, which in turn can advance clinical care.

Recommendation 4.1. Funders of whole genome sequencing research, relevant clinical entities, and the commercial sector should facilitate explicit exchange of information between genomic researchers and clinicians, while maintaining robust data protection safeguards, so that whole genome sequence and health data can be shared to advance genomic medicine.

Privacy and Progress in Whole Genome Sequencing

1961

Current sequencing technologies and those in development are diverse and evolving, and standardization is a substantial challenge. Ongoing efforts are critical to achieving standards for ensuring the reliability of whole genome sequencing results, and facilitating the exchange and use of these data.

Recommendation 4.2. Policy makers should promote opportunities for the public to benefit from whole genome sequencing research. Further, policy makers and the research community should promote opportunities for the exploration of alternative models of the relationship between researchers and research participants, including participatory models that promote collaborative relationships. Respect for persons implies not only respecting individual privacy, but also respecting research participants as autonomous persons who might choose to share their own data. Public beneficence is advanced by giving researchers access to plentiful data from which they can work to advance health care. Regulatory parsimony recommends only as much oversight as is truly necessary and effective in ensuring an adequate degree of privacy, justice and fairness, and security and safety while pursuing the public benefits of whole genome sequencing. Therefore, existing privacy protections and those being contemplated should be parsimonious and not impose high barriers to data sharing. While the Commission supports the intellectual freedom this access will encourage, clinicians and researchers must also act responsibly to earn public trust for the research enterprise. Public Benefit Thousands of citizens have participated in whole genome sequencing research personally, and all citizens help to support government investment in whole genome sequencing through their general participation in and support of our political system. Therefore, all citizens should have the opportunity to benefit from medical advances that result from whole genome sequencing. Special caution should be taken on the part of researchers to ensure that their participants accurately reflect as much as possible the rich diversity of our population. Different groups have genomic variants at different frequencies within their populations, and sufficiently diverse data must be collected so that advances arising from whole genome sequencing can be used for the benefit of all groups.

Recommendation 5.1. The Commission encourages the federal government to facilitate access to the numerous scientific advances generated through its investments in whole genome sequencing to the broadest group of persons possible to ensure that all persons who could benefit from these developments have the opportunity to do so. Government investment in genomic research has resulted in public benefit through improved health care and in economic return on investment. The principle of justice and fairness requires that the benefits and risks of whole genome sequencing be distributed equitably across society. Research funded with taxpayer contributions should benefit all members of society. To these ends, researchers should be vigilant about including individuals from all sectors of society in their studies, so that research findings can be translated widely into improved clinical care. The federal government should follow through on its investment

1962

Presidential Commission for the Study of Bioethical Issues

in research and assure that the discoveries of whole genome sequencing are integrated with clinical care to benefit the health of all.

INTRODUCTION The Potential of Whole Genome Sequencing In 1996, Retta Beery gave birth to apparently healthy twins Alexis and Noah.1 It soon became clear, however, that something was wrong; the twins cried nonstop and had developmental problems. Over the next two years, Retta and her husband Joe endured the physical, emotional, and financial costs of visiting numerous specialists, putting their young twins through countless tests, and having their children undergo surgery. None of these steps provided results or solutions. In 1998, the twins were diagnosed with cerebral palsy and a related course of treatment was outlined. Although the treatment yielded some symptomatic improvement, Retta felt that the diagnosis was incorrect. In 2002, the Beerys were starting to look at wheelchairs and feeding tubes when Retta, after four years of research, stumbled upon an article on DOPAresponsive dystonia (also known as Segawa’s dystonia) and suspected that this was the disease that the twins had. The Beerys contacted a specialist, and after a physiological test the twins were diagnosed with Segawa’s dystonia. They began a new course of treatment to increase brain dopamine, which yielded a dramatic improvement in their health. In 2009, Alexis developed breathing problems and was forced again to endure multiple emergency room visits and a battery of tests and visits to specialists. In August 2010, the Beerys went to Baylor College of Medicine for diagnostic whole genome sequencing. By November, Alexis’s and Noah’s whole genomes had been sequenced. Their data were compared to other whole genome sequences in databases, such as the Baylor Human Genome Sequencing Center’s database, to reveal what was unique about the Beery twins’ genomes. Clinicians now had answers for the family. The geneticists had uncovered an extremely rare and only recently recognized genetic cause of DOPA-responsive dystonia producing a deficiency of not only dopamine but also serotonin production in the brain. Armed with this new information, the Beerys returned to their neurologist, who amended the treatment regimen for Alexis and Noah with an over-the-counter supplement. Within a month, Alexis’s breathing problems disappeared. As a result of that final piece of the puzzle—the information provided by whole genome sequencing—Alexis is able to breathe normally and can now even compete in sports. Both children have a definitive diagnosis, and are expected to live long, healthy lives.

THE CHALLENGE OF PRIVACY Victoria Grove’s sisters struggled with a difficult genetic diagnosis: alpha-1 antitrypsin deficiency. The genetic illness meant that her sisters’ bodies did not make enough of a protein that protected their lungs and liver from damage, which could lead to emphysema and liver disease.

Privacy and Progress in Whole Genome Sequencing

1963

Victoria wanted to help them, and in 2004 agreed to enroll in a research study of families with alpha-1 antitrypsin deficiency. “I just knew I didn’t have it, so I signed up for the study.” But the tests came back positive—Victoria had the same genetic mutation as her sisters. She did not yet have any symptoms, and wanted to keep her test results private, so she did not tell her doctor. In 2005, Victoria got tested again to confirm the research study results. She used a private company and had the results sent directly to her. Victoria’s second test came back positive, and she chose again not to send the results to her doctor, fearing that the information would be included in her medical record. Victoria worried that this information could lead her insurance company to drop her coverage or charge her higher rates. Victoria kept her genetic results private for nearly three years. The pivotal moment came when Victoria felt she was coming down with a bout of pneumonia but could not convince the nurse practitioner who saw her to order the X-ray necessary to prescribe antibiotics. Victoria went home without antibiotics, her condition worsened, and she called back a few days later. The nurse asked Victoria to come in again, but Victoria told them she could not drive across town in the snowstorm that had immobilized the city. She could, however, get to a pharmacy near her house if the office called in the antibiotics. The nurse on the phone insisted this was not possible. “My emotions just took hold and I cried ‘I have alpha-1 and I need that antibiotic,’” Victoria said. “At that point the cat was out of the bag.” Today Victoria gets regular treatments for her condition. She recognizes that fear kept her from providing her clinicians with crucial information. Still, she can’t convince either her brother or her son to get tested for alpha-1. Victoria says both men are aware that there is federal protection from discrimination in employment and health insurance, but fear that these laws will not provide sufficient protection. Her son already has to buy his own health insurance; he does not want any information in his medical record that could jeopardize his job or his access to health insurance. “I can imagine in a job situation, it’s expensive to take on someone if they’re ill. And you can always get rid of people for other reasons. I assume that’s going on.” Whole genome sequencing offers great promise of medical advances that could benefit all of society, but this promise is tempered by the concerns of individual privacy. This tension between medical progress and the risks to privacy from whole genome sequencing is the subject of this report. To use whole genome sequencing to discover the changes in deoxyribonucleic acid (DNA) that underlie disease, scientists and clinicians must have access to whole genome sequence data from many individuals (for the definitions of scientific terms used in this report, see Appendix I: Glossary of Key Terms). Continued advances therefore depend on large numbers of individuals who are willing to share their whole genome sequence data for research purposes. Further, scientists are better able to make connections between variations in whole genome sequence data and specific diseases when additional health and demographic information accompanies these data. But this additional information might make it easier to identify an individual and discover his or her private health information.2 Thus, while society stands to benefit from advances in improved medical treatment and diagnosis from whole genome sequencing, the privacy risks associated with sharing whole genome sequence data fall predominantly on the individuals themselves. Whole genome sequencing is a technique that determines the complete sequence of DNA in an individual’s cells (See Figure 1. For more information regarding the science of whole

1964

Presidential Commission for the Study of Bioethical Issues

genome sequencing, see Appendix II: Genetic and Genomic Background Information). Whole genome sequencing reveals the genetic blueprint for a person, generating information on every gene in the nucleus of one’s cells. Each person’s DNA is unique, and changes in DNA can lead to disease. The ability to link variations in DNA with health and disease outcomes, a process still in its infancy, holds promise for substantial public benefit.3 These benefits have the potential to alter the way we treat cancer, heart disease, diabetes, Alzheimer’s disease, schizophrenia, and countless other illnesses. The Commission believes that the ethical principles and recommendations in this report should not be limited to whole genome sequencing. Whole genome sequencing is the focus of this report because of its current promise to advance health. The ideas in this report, however, apply broadly to all studies using large-scale genetic and genomic data and information, including whole exome sequencing, genome-wide SNP analysis, and other large-scale genomic studies. The tools used to decipher and study whole genomes are evolving rapidly, and it is not clear what additional technologies will emerge in the near future. What is clear is that all current genetic and genomic research can be measured against the ethical principles and recommendations described in this report, and the Commission is optimistic that its recommendations will specifically accommodate future advances in large-scale sequencing and analysis.

Figure 1. The Structure of DNA.

Privacy and Progress in Whole Genome Sequencing

1965

TERMINOLOGY Whole genome sequencing: determining the order of nucleotide bases—As, Cs, Gs, and Ts—in an organism’s entire DNA sequence Whole genome sequence data: the file of As, Cs, Gs, and Ts that results from whole genome sequencing Whole genome sequence information: facts derived from whole genome sequence data, such as predisposition to disease Genomics: the study of all the DNA (the genome) in an individual, and how parts of the genome interact with each other and the environment Genetic test: a discrete test that examines a specific genetic location or a single gene, such as the test for Huntington’s disease Genotyping: analyzing a handful to thousands of discrete variants across the genome (i.e., more than a discrete genetic test, but less than whole genome sequencing) For additional terminology, please see Appendix I: Glossary of Key Terms and Appendix II: Genetic and Genomic Background Information.

Current clinical uses of DNA information are limited mostly to specific genetic tests. If clinicians suspect a particular disease with a known genetic cause, such as Huntington’s disease, they can order a genetic test looking at one specific gene among the more than 20,000 genes in the human genome. These test sex a mine only a few of the whole genome’s three billion pairs of building blocks. The price of sequencing a whole genome is dropping rapidly, however, and soon it will be less expensive to sequence an entire genome than to perform a few individual genetic tests. Once this happens, whole genomes might be sequenced in lieu of discrete genetic tests, and such information can be stored in a patient’s medical records. Then, if a clinician would like to find out something about a patient’s DNA in the future, he or she could examine the whole genome sequence data already stored in that patient’s record. For example, a patient’s response to a particular dose of warfarin, a drug that helps prevent blood clotting, is partly dependent on his or her genetic makeup. A clinician with access to a patient’s whole genome sequence can use it to identify drug sensitivity and reduce the time required to achieve the optimal dosage.4 The sheer amount of information contained in our genomes is what makes whole genome sequence data different from other medical information. Our whole genome sequence data can reveal predispositions to diabetes, cancer, or psychiatric conditions. The data can also reveal variations in DNA that are not yet understood. For example, an apparently healthy individual could be missing a small piece of DNA. The person seems healthy, but will that variant cause a problem in the future? Over 20,000 individual human genes have been identified. A major recent advance by the National Institute of Health’s (NIH) Encyclopedia of DNA Elements (ENCODE) project greatly enhanced our knowledge of the function of the genome through a flurry of scientific publications, finding that 80 percent of the genome has a “biochemical function.”5 For years,

1966

Presidential Commission for the Study of Bioethical Issues

that number had stood at 10 percent.6 Eric Lander, president of the Broad Institute, compared the results of the Human Genome Project, which sequenced the first full human genome, to a picture of the Earth from space, and compared the ENCODE project to Google Maps. The ENCODE Project is a major step toward demonstrating the function of the whole genome sequence that was determined in the Human Genome Project, much like Google Maps can refine a snapshot of the Earth by showing traffic, alternate routes, and the location of landmarks.7 The function of 20 percent of the non-coding regions—regions of DNA that do not contain specific instructions for making proteins—is still unknown, but these regions might have functions that are yet to be determined. Unlike genetic testing—which looks at the specific parts of the genome to reveal a variant at a specific location of a single gene indicating a particular disease—whole genome sequencing reveals an individual’s entire genome, including all variants within the genome. These variants are changes in the DNA sequence and range in size from small changes like a single base pair change, to larger changes such as a deletion of a portion of the DNA strand. As more information about our genomes becomes available, variants that might be revealed by whole genome sequencing include: specific known disease variants; variants of unknown significance (e.g., an unknown variant in the region that increases risk for heart disease); nonmedical genetic traits, including hair and eye color; carrier status variants, including variants that do not cause disease in the individual but could be passed on, such as mutations for hemophilia or cystic fibrosis; susceptibility genes, such as those that slightly increase susceptibility to diabetes, heart disease, or some cancers; and genes for conditions with late onset that will not affect an individual until much later in life, such as Alzheimer’s disease and Huntington’s disease.8 Only a small number of the genetic variants that whole genome sequencing might reveal have yet been studied enough to substantiate their connection to disease.9 “And so having the genome may be not incredibly powerful right now, but it opens the door to outrageous rates of discovery, which I’m pretty certain are going to happen over the next five to ten years.” Leonard D’Avolio, Associate Center Director for Biomedical Informatics, Massachusetts Veterans Epidemiology Research and Information Center, Department of Veterans Affairs, Instructor, Harvard Medical School. (2012). Genomic Privacy, Data Access, and Health IT. Presentation to PCSBI, May 17, 2012. Retrieved from http:// bioethics.gov/cms/node/713.

Whole genome sequencing also raises many potential concerns for individuals. One might shoulder the burden of knowing medical in format ion regarding future adverse health conditions for which there is currently no treatment. Whole genome sequencing raises concerns about our privacy as well. Just as patients would not want to give anyone access to their medical record, many people might not want others to have access to their whole genome sequence data and information. With unauthorized access comes concerns about misuse of information. For example, someone could pick up a discarded coffee cup and send a sample of saliva—which contains DNA—from the rim of the cup to a commercial sequencing entity in an attempt to discover an individual’s predisposition to neurodegenerative disease. The information might then be misused by publicizing it in a social networking space, which could derail that

Privacy and Progress in Whole Genome Sequencing

1967

individual’s chance of finding a spouse, achieving standing in a community, or pursuing a certain career path. To yield medically useful information, an individual’s genomic sequence data needs to be coupled with clinical information about disease and compared to other genomic sequence data. Further, genomic research is complex because each person’s DNA naturally has thousands of variants, and the vast majority of these variants do not cause disease. The research and clinical power of whole genome sequencing lies in being able to compare a large number of whole genome sequence data sets that are linked with relevant health and disease states. This type of study allows researchers to identify sequence variations and associations between whole genome sequence variations and disease. For this reason, scientists need whole genome sequence data to be linked to clinical, laboratory, and socio-demographic data. This linking can be done by entering only relevant information (e.g., disease state or symptoms) and excluding personally identifiable information, such as an individual’s name or address; but without access to relevant medical data, links between whole genome sequence variations and disease could not be identified. Recent technological advances have facilitated storing and sharing of whole genome sequence data. Whole genome sequence data and associated health information can now be stored in genomic databases and biorepositories that contain digital information and physical samples, respectively, from large numbers of persons. By using these resources, researchers will have the volume of data they need to advance medical understanding for the public good through genomics. However, this data storage and sharing raises its own questions: How does one securely store these huge data files? Who should have access to these data files? How can these data be used productively, and how might they be misused? What constitutes “misuse”? What should the penalties be for misusing these data? The summation of all these issues—the unknowns, privacy, consent, data security, and data storage involved in whole genome sequencing—will require careful and sustained ethical attention. This report delves into two crucial questions: What information about an individual’s whole genome should remain private, and when should it remain private? The Commission explores how, when, and why genomic information should remain subject to clear rules of confidentiality, secrecy, information security, decisional autonomy, and freedom from unwanted intrusion out of respect for individuals. Without trust in the confidentiality and security of the data, individuals could be less likely to participate in research. Conversely, with well-founded trust that their sense of privacy will be honored, individuals are treated with the respect to which they are entitled and might be more likely to contribute to the research enterprise that promises important public benefits. This report therefore aims to pursue and secure the public benefit anticipated from whole genome sequencing while minimizing the potential privacy risks to individuals. The recommendations draw upon the principles that flow from the ideal of respect for persons, and are set forth in the Belmont Report, a landmark statement of ethics for research involving human participants, and those outlined in the Commission’s first report New Directions: The Ethics of Synthetic Biology and Emerging Technologies.10

1968

Presidential Commission for the Study of Bioethical Issues

The Promise of Whole Genome Sequencing Whole genome sequencing can help researchers and clinicians better understand the unique qualities of a disease, and, especially when combined with other information, might help select treatment methods.11 Researchers already have been able to help clinicians aid some children born with rare birth defects by sequencing and analyzing their whole genomes to diagnose and treat their illnesses.12 Researchers are also teaming up with clinicians in using whole genome sequence data to advance personalized medicine, including predicting an individual’s risk for a heart attack or determining the best dosage of medication for an individual.13 Researchers recently determined a fetal whole genome sequence using a blood sample from the mother, an innovation that could soon reach the clinic.14 And this is only the beginning of the whole genome sequencing era, which has the potential to revolutionize medicine. In 2000, the cost of sequencing a single human genome was estimated to be 2.5 billion dollars; it is anticipated that this cost will soon be $1,000. As the cost falls, whole genome sequencing will be increasingly integrated into clinical care. Clinicians can—and many will— incorporate whole genome sequence information into the clinic to promote the practice of personalized medicine.15 Nevertheless, little has been written about the ethical concerns of integrating whole genome sequencing into the clinical context, which is particularly problematic given the speed with which this could occur.16 The Commission therefore presents its recommendations mindful of the changing uses and implications of whole genome sequencing. Although this report focuses on issues related to privacy and sharing of whole genome sequence data, the Commission recognizes that another important unsettled issue is the ethics of reporting incidental findings to individuals—that is, information gleaned from whole genome sequencing research or clinical practice that was not its intended or expected object. The Commission plans to take up the issue of incidental findings in the future.

Privacy Concerns At age 13, Brian Hurley learned from an ophthalmologist that he had retinitis pigmentosa and that at some unknown point in his life he would go blind. During high school, Brian learned about careers in law and thought this was something he could do well, regardless of eyesight. When he started law school, however, he realized he did not like it. Brian needed to find something he could do and wanted to do—not just something a blind person was considered capable of doing. Brian felt tremendous pressure to resolve his career path before he lost his vision: “In the beginning of a career, you try to figure out what you are good at and hopefully enjoy, but I was more concerned about could I do it well when blind.” Brian spent hours online searching for careers that might work, and successful blind professionals that he could use as role models. “It was like having a time bomb inside of me,” Brian said. After college, Brian experienced a steady decline in his peripheral vision. At age 27, Brian stopped driving. During this time, Brian’s actual symptoms did not match the decline of his emotional state. Brian said he was so panicked that it took the joy out of his last few years before becoming legally blind. “If you took my mental condition, I might as well have been blind already.”

Privacy and Progress in Whole Genome Sequencing

1969

Then, at 33, Brian lost the majority of his eyesight. “The irony is, anticipation was much worse than the actual loss. It was a relief to stop worrying when the loss would occur.” Today, at 39, and relieved of the anticipation, he enjoys his current role as a Public Affairs Program Director. Brian refuses to let his vision loss be an obstacle to his professional and personal goals. Brian recently learned of the eyeGENE® program at the National Institutes of Health. He wants to help with eye research—specifically research related to retinitis pigmentosa. He knows research is important and wants to contribute his data to help others. He does not, however, want his whole genome sequenced in the course of participating in research. Before enrolling in the eyeGENE® program, Brian spent three days with a lighted magnifier and 20 pages of consent forms to ensure that researchers would not sequence his entire genome and that they will not divulge findings about other diseases to him. Having lived with one time bomb, Brian understands its collateral damage. He never wants to carry that burden again. In his situation, Brian feels that having less information is better. With regard to whole genome sequence data, privacy concerns are more complex than a simple decision about whether to undergo whole genome sequencing and, if so, whether the data should be included with an individual’s medical record. Individuals might have good reason for wanting to share particular parts of their genomic data—such as for the purposes of research— but might also want to limit the extent to which others can access these data. The prevention of unauthorized use or disclosure of medical information about specific individuals has long been a serious ethical concern. Whole genome sequencing dramatically raises the privacy stakes because it necessarily involves examining and sharing large amounts of biological and medical information that is not only inherently unique to a single person but also has implications for blood relatives. Genomic information is inherited and determines traits like hair and eye color. Unlike a decision to share our hair or eye color, which does not reveal anything about our relatives that is not observable, a decision to learn about our own genomic makeup might inadvertently tell us something about our relatives or tell them something about their own genomic makeup that they did not already know and perhaps do not want to know. More than other medical information, such as X-rays, our genomes reveal something both objectively more comprehensive and subjectively (to many minds) more fundamental about who we are, where we came from, and the health twists and turns that life might have in store for us. The fact that whole genome sequence information is uniquely connected to our conceptions of self is what could cause the inappropriate disclosure or misuse of this information to be so harmful. In theory, whole genome sequence information could be used to deny financial backing or loan approval, educational opportunities, sports eligibility, military accession, or adoption eligibility.17 Disclosing genomic information could affect the opportunities available to individuals, subject them to social stigma, and cause psychological harm. The full extent of what whole genome sequencing can reveal is unknown, but we k now that having one’s whole genome sequenced today could reveal genetic variants that increase the risk for certain conditions such as Alzheimer’s disease, which many people either do not want to know about themselves or others to know about them.

1970

Presidential Commission for the Study of Bioethical Issues

“[H]arm is not the act…of distributing data. Harm comes from actions that are taken once the data have been distributed.” John Wilbanks, Founder, Consent to Research; Senior Fellow, Kauffman Foundation; Research Fellow, Lybba. (2012). Privacy II – Control, Access and Human Genome Sequence Data. Presentation to PCSBI, February 2, 2012. Retrieved from http://bioethics. gov/cms/node/659.

It is understandable, therefore, that whole genome sequencing heightens concerns about how unauthorized disclosure can threaten one’s individual privacy. But determining what privacy requires in the whole genome context is not straightforward. In the legal context, privacy is multidimensional and includes physical, informational, decisional, proprietary, associational, and intellectual aspects.18 While there is no consensus definition of privacy, in this report we consider privacy to be a general concept that includes confidentiality, secrecy, anonymity, data protection, data security, fair information practices, decisional autonomy, and freedom from unwanted intrusion.19 Whole genome sequencing calls for serious consideration of each of these components and their related ethical concerns. It also is important to recognize at the outset that, in some significant respects, parts of our genomic information are not and cannot be wholly private. When we routinely provide a blood sample in a clinical exam, decide to submit a DNA sample to be used in research, or unintentionally leave behind traces of DNA on a coffee cup that we discard in a public waste bin, we are providing some other individuals the opportunity to learn something about us. While doing everything possible to prevent any use of whole genome sequence data certainly would provide strong privacy protection, it would fail to allow the anticipated public benefit that is to be achieved by sharing whole genome sequence data and advancing science. Because preventing all whole genome sequence data sharing would stifle potentially life-saving and life-enhancing medical progress, we must focus on how best to protect confidentiality of data, ensure security of information from unauthorized access and uses, preserve decisional autonomy as to possible uses, and guarantee the freedom of individuals from unwanted and unwarranted intrusion.

Policy and Governance “If you sequence people’s exomes you’re going to find stuff,” said Gholson Lyon, a physician and researcher previously at the University of Utah, now at Cold Spring Harbor Laboratory. As part of his research, Dr. Lyon worked with a family in Ogden, Utah. Over two generations, four boys had died from an unknown disease with a distinct combination of symptoms—an aged appearance, facial abnormalities, and developmental delay. Dr. Lyon sought to identify the genetic cause of this disease, and collected blood samples from 12 family members who had signed consent forms. The family members understood these forms to mean that they would have access to their results. Dr. Lyon conducted exon capture and sequencing of the X chromosome—a process that analyzes specific regions of the X chromosome and is a less expensive alternative to whole genome sequencing—to analyze the blood samples. Dr. Lyon and his colleagues identified a genetic mutation, and named the disease Ogden Syndrome after the family’s hometown.

Privacy and Progress in Whole Genome Sequencing

1971

After Dr. Lyon and his team identified the genetic basis of Ogden Syndrome, one of the family members contacted him. This young mother of one daughter had submitted a blood sample for Dr. Lyon’s research. She had not been pregnant at the time, but was now four months pregnant with her second child. She knew that she was carrying a boy and wanted to know if she was a carrier of the mutation. She wanted to be able to mentally and emotionally prepare herself and her family. By reexamining his research data, Dr. Lyon was able to see that the expectant mother was a carrier of Ogden Syndrome. This meant that her son had a 50 percent chance of being born with the disease. Dr. Lyon could not, however, legally share this important information with the family because he had conducted the original sequencing in a research laboratory that had not satisfied federally mandated standards designed to ensure the accuracy of clinical genetic results. Instead, Dr. Lyon worked to have the mutation validated at a laboratory that satisfied those federal standards; this involved overcoming substantial bureaucratic hurdles and other obstacles that held up the process. During this time, the baby boy was born and died of Ogden Syndrome at four months of age. While knowing the results would not have changed the outcome, Dr. Lyon feels he should have been able to do more for the family. Dr. Lyon has become an outspoken advocate for conducting whole genome sequencing in laboratories that satisfy the federal standards so that researchers can return results to participants, if appropriate. Dr. Lyon wants clear guidance for laboratories conducting genetic research and clear language in consent forms that clarifies the results that participants should expect to have returned from the researchers. Realizing the promise of whole genome sequencing requires widespread public participation and individual willingness to share genomic data and relevant medical information. This requires public trust that any whole genome sequence data shared by individuals with researchers and clinicians will be adequately protected. Individuals must trust that their whole genome sequence data will not be either intentionally or inadvertently disclosed or misused. Current U.S. governance and oversight of genetic and genomic data, however, do not fully protect individuals from the risks associated with sharing their whole genome sequence data and information. The Genetic Information Nondiscrimination Act of 2008 (GINA) is the leading federal protection of genetic information, but it offers only prohibition of genetic discrimination in health insurance and employment. GINA does not regulate access, security, and disclosure of genetic or whole genome sequence information across all potential users, nor does it protect against discrimination in other contexts. U.S. state laws on genetic information vary greatly in their protections of individuals, and they also fail to provide uniform privacy protections. In an era in which whole genome sequence data are increasingly stored and shared using biorepositories and databases, there is little to no systematic oversight of these systems.

Ethical Principles Laws and regulations cannot do all of the work necessary to provide sufficient privacy protections for whole genome sequence data. Individuals who obtain their whole genome sequence data also have a responsibility to thoughtfully consider to what extent they ought to

1972

Presidential Commission for the Study of Bioethical Issues

act to protect their own privacy beyond current legal protection when considering whether to share their data and information publicly. In its previous reports, the Commission established an ethical framework for considering the implications of scientific advances, including emerging technologies, that can be applied in similar situations. That framework outlines principles developed to apply particularly to emerging biotechnologies that do not directly involve human therapy or human experimentation. These guiding principles are 1) public beneficence, 2) responsible stewardship, 3) intellectual freedom and responsibility, 4) democratic deliberation, and 5) justice and fairness. As biomedical science has evolved over time, the lines between clinical care, human research, and research not involving human participants have become blurred. The principles developed by this Commission, which flow from the concept of respect for persons, are described in detail in New Directions: The Ethics of Synthetic Biology and Emerging Technologies, and also apply when considering the ethics of whole genome sequencing.20 As applied to the science of whole genome sequencing, these principles, along with the principle of respect for persons, guide us to focus on pursuing public benefit while minimizing both personal and public risk.

Respect for Persons Respect for persons provides a strong, enduring, and widely accepted foundation for this report’s recommendations for protecting individual privacy in the pursuit of public benefit. As set forth in the Belmont Report, respect for persons requires one to give great “weight to autonomous persons’ considered opinions and choices while refraining from obstructing their actions unless they are clearly detrimental to others.”21 The Belmont Report recognizes that not all persons can act as autonomous agents, and makes clear that there are special responsibilities to those who cannot. Public Beneficence Public beneficence asks us to pursue and secure public benefits and minimize personal and public harm. It encompasses society’s duty to promote activities that have great potential to improve the public’s well-being.22 Public beneficence also supports scientific enterprises that benefit society by increasing economic opportunities. Responsible Stewardship Responsible stewardship calls upon governments and societies to proceed prudently in promoting scientific advancement by taking into account the interests and needs of those who are not in a position to represent themselves such as children, the mentally ill, future generations, or individuals that may be unaware of risks. Responsible stewardship expresses a shared obligation to act in ways that demonstrate respect for such individuals. Emerging technologies present particularly profound challenges for responsible stewardship because our understanding of their potential benefits and risks is incomplete and uncertain.23 This makes it all the more important that we take great care not to make choices that have a substantial chance of causing irreversible harm to current or future generations.

Privacy and Progress in Whole Genome Sequencing

1973

Intellectual Freedom and Responsibility Intellectual freedom grants scientists, acting responsibly, the right to use their creative abilities to advance science and the public good. Sustained and dedicated creative intellectual exploration produces much of our scientific and technological progress. Intellectual responsibility, the complementary part of this principle, calls upon scientists to adhere to the ideals of research; to avoid harm to others; and to abide by all applicable policies, rules, and regulations. Institutions, policies, and practices of a free society—along with the many citizens who support them—collectively provide the means for scientists to do their work, and the culture that recognizes and upholds intellectual freedom. As a result, scientists bear profound collective responsibility to society.24 The Commission endorses the principle of regulatory parsimony, which encourages fostering an achievable balance of intellectual freedom and responsibility. Regulatory parsimony calls for “only as much oversight as is truly necessary to ensure justice, fairness, security, and safety while pursing the public good.”25 In this spirit, policy makers are obligated to avoid restrictive rules that offer few benefits and hinder progress in science, medicine, and health care.26 Democratic Deliberation Democratic deliberation is an approach to collaborative decision making that embraces respectful debate of opposing views and active participation by citizens. Democratic deliberation warrants engaging the public and fostering dialogue among the scientific community, policy makers, and persons concerned with the issues raised by scientific progress.27 The principle of democratic deliberation acknowledges that while decisions must eventually be reached, those decisions need not (and often should not) be unalterable, particularly when subsequent developments warrant additional examination. It is in the spirit of democratic deliberation that the Commission was created, has undertaken its work in publicly open meetings, and offered all of its reports to the President and members of the public. Justice and Fairness The principle of justice and fairness relates to the distribution of benefits and burdens across society. A commitment to justice and fairness is a commitment to ensuring that the unavoidable burdens of technological advances do not fall disproportionately on any particular individual or group, and that the benefits are widely and equitably distributed.28 The principle of justice and fairness counsels that the numerous scientific advances stemming from investments in science and medicine should be made accessible to the broadest possible number of persons, consistent with the ability to advance science and medicine for the true benefit of the public.

The Commission’s Process In concert with the principle of democratic deliberation, the Commission invited experts from the public and private sectors to inform their deliberations. Over the course of four public meetings, speakers addressed issues of privacy, consent, data security, access to whole genome sequence data, views of the patient advocacy community, and relevant philosophical topics (for

1974

Presidential Commission for the Study of Bioethical Issues

a complete list of Commission speakers, see Appendix III: Guest Presenters to the Commission Regarding Privacy and Whole Genome Sequencing). The Commission also posed a data call to the 18 Common Rule departments and agencies, asking them to identify relevant statutes, agency regulations, guidance documents, and policies that govern privacy and access to genetic information generally and whole genome sequence data specifically.29 Finally, a Request for Information was published in the Federal Register that elicited many thoughtful comments from individuals and professional societies.30 The Commission identified the field of whole genome sequencing as an important topic for consideration because this rapidly advancing technology raises many ethical issues that have not been fully addressed. After careful consideration of where it could make the greatest contribution at the present time, the Commission chose to focus on privacy rather than address ethical issues that are currently under consideration or have been addressed by other high-level groups or federal agencies, including commercial genetic testing and other important and controversial topics relevant to whole genome sequencing.31 In focusing on the potential risks to individuals’ privacy, the Commission also recognizes the anticipated societal benefit of the scientific and medical applications of advances in whole genome sequencing. Reconciling these goals means addressing the competing concerns of ensuring confidentiality of whole genome sequence data, granting access to and use of these data, and empowering participants who want to share their data without weakening privacy protections for others. The Commission reviewed rules and regulations already in place that protect privacy and prevent discrimination based on genetic information (currently there are no state or federal laws explicitly addressing whole genome sequence data), and heard testimony about the technological security systems used to protect whole genome sequence data. The Commission heard from experts about the ways whole genome sequencing is being, and will continue to be, integrated into clinical care. In addition, the Commission heard from the patient advocacy communities who expressed their wishes for more participatory models of research.

About This Report With its guiding principles in mind, the Commission sought to reconcile the anticipated societal benefit of the scientific and medical applications of advances in whole genome sequencing with the potential risks to individuals’ privacy. Recognizing that our ethical obligations reach beyond what is legally enforceable, the Commission examined both the relevant ethical principles and the relevant legal requirements to offer guidance as to what (ethically) ought to be done and what (legally) must be done.32 This is the foundation upon which the Commission builds its recommendations, which apply to both the public and private sectors. Accordingly, Section 1 deploys and applies the relevant ethical principles. Section 2 summarizes the legal framework governing whole genome sequencing and the legal protections provided for persons who decide to share their whole genome sequence data. Finally, Section 3 offers recommendations and guidelines that are aimed at reconciling the existing tension between minimizing risks to individuals and maximizing the anticipated future societal benefits of whole genome sequencing. The Commission intends that any changes resulting from these recommendations be prospective and not apply retrospectively to specimens already collected or stored in the research or clinical setting.

Privacy and Progress in Whole Genome Sequencing

1975

WORK OF PREVIOUS COMMISSIONS Previous bioethics commissions have issued reports on topics related to genetics. In 1982, the President’s Commission for the Study of Ethical Problems in Medicine and Biomedical and Behavioral Research published a report, Splicing Life, which addressed the ethical and social implications of genetic engineering (http://bioethics.georgetown.edu/ documents/pcemr/ splicinglife.pdf). In 1983, the same commission issued a report on the ethical, social, and legal implications of genetic screening, counseling, and education programs, titled Screening and Counseling for Genetic Conditions (http://bioethics. georgetown.edu/pcbe/reports/past_ commissions/ geneticscreening.pdf). Genetic issues were not revisited until the National Bioethics Advisory Commission (NBAC) discussed the issue of human cloning in 1997, in its report Cloning Human Beings (http://bioethics.georgetown.edu/nbac/pubs/ cloning1/cloning.pdf). In 1999, NBAC issued Research Involving Human Biological Materials: Ethical Issues and Policy Guidance, which focused on research involving human biological materials (http://bioethics. georgetown. edu/nbac/hbm.pdf). In 2002, the President’s Council on Bioethics took up the issue of human cloning in its report, Human Cloning and Human Dignity: An Ethical Inquiry (http://bioethics. georgetown.edu/pcbe/reports/ cloningreport/pcbe_cloning_report.pdf). The Council also published The Changing Moral Focus of Newborn Screening, which sought to establish ethical principles to guide newborn genetic screening (http://bioethics. georgetown.edu/pcbe/reports/ newborn_ screening/Newborn Screening for the web.pdf).

SECTION 1. ETHICAL PRINCIPLES Whole genome sequencing offers the promise of tremendous public benefit, and is expected to change substantially our ability to assess risk, diagnose, and treat disease. Achieving this public benefit requires that researchers have access to large amounts of whole genome sequence data and associated medical information to assess correlations between underlying genomic variants and expressed disease. While many of the potential benefits arising from whole genome sequencing will accrue to the broader public, the risks associated with collecting and sharing whole genome sequence data will be borne disproportionately by the individuals whose data are being shared. Because whole genome sequencing begins with obtaining a sample from an individual, to reconcile anticipated public benefits with potential individual harms the Commission begins with the principle of respect for persons. Respect for persons is among the most enduring and widely accepted foundation s for protecting individual privacy in the pursuit of public benefit, and it is well formulated in the Belmont Report, a declaration of ethical principles regarding research involving human participants.33 Since biomedical science has evolved significantly since the Belmont Report’s publication in 1979 from clinically focused research to research for public benefit, the Commission also applies five additional ethical principles which flow from the principle of respect for persons—as outlined in New Directions: The Ethics of Synthetic Biology and Emerging Technologies—to the field of whole genome sequencing.34 These five principles—public beneficence, responsible stewardship, intellectual freedom and responsibility, democratic deliberation, and justice and fairness—apply well not only to

1976

Presidential Commission for the Study of Bioethical Issues

emerging biotechnologies, but also to scientific advancement and innovation generally. The Commission’s five principles are thus a useful supplement to the Belmont principles for the purpose of assessing the ethics of whole genome sequencing. “The state of technology is that data acquisition is now… relatively inexpensive, and while the free access to genetic data has many positive benefits, we need to represent, of course, the tension of that with all of the other personal privacy issues...” Richard Gibbs, Wofford Cain Professor, Department of Molecular and Human Genetics; Director, Human Genome Sequencing Center, Baylor College of Medicine. (2012). Ethics and Practice of Whole Genome Sequencing in the Clinic. Presentation to PCSBI, February 2, 2012. Retrieved from http://bioethics. gov/cms/node/658.

In the case of whole genome sequencing, as is true for many emerging medical technologies, there are tensions between some of these principles. Two of the principles— public beneficence and intellectual freedom and responsibility— support the continued pursuit of whole genome sequencing research because of the promise of intellectual gains and substantial public benefit. Simultaneously, other principles—respect for persons, responsible stewardship, and justice and fairness—counsel the adoption of protections to minimize the privacy risks that could befall individuals. Drawing upon the process of democratic deliberation, the Commission sought to reconcile the potentially conflicting practical implications of these principles. It did so by taking into account various paths to the anticipated promise of this rapidly advancing technology, while respecting the ethical concerns of the increasing numbers of individuals facing the prospect of whole genome sequencing: concerns, for example, about confidentiality, information security, decisional autonomy, and freedom from unwanted intrusion into personal lives.

The Public Benefit of Whole Genome Sequencing Scientists predict that whole genome sequencing research will foster better understanding of the genetic factors that contribute to human health and diseases including cancer, heart disease, diabetes, and neuropsychiatric conditions, as well as many rare diseases. Further, whole genome sequencing is expected to usher in an era of personalized medicine, providing information that might allow clinicians to tailor treatments or manage the health of individuals based on their genomic profile. The Commission’s recommendations regarding the continued pursuit of whole genome sequencing to advance medical science are based primarily on the principles of public beneficence and intellectual freedom and responsibility. Public beneficence gives rise to a societal and governmental duty to promote individual activities and institutional practices, such as scientific and biomedical research, that have great potential to improve the public’s wellbeing.35 Public beneficence also supports scientific enterprises that advance the common good by increasing economic opportunities, a criterion that whole genome sequencing satisfies.36 The U.S. government invested billions of dollars in the Human Genome Project—a collaborative research project with the ambitious goal of sequencing the entire human genome. This

Privacy and Progress in Whole Genome Sequencing

1977

investment has since generated $244 billion in personal income and $796 billion in overall economic impact.37 In 2010 alone, the human genome sequencing projects and associated research and industry activity directly and indirectly generated over 300,000 jobs and brought in tax revenue of $3.7 billion. While not unique to whole genome sequencing, increased economic productivity is often a positive by-product, consistent with public beneficence, of scientific and medical progress. Intellectual freedom grants scientists—acting responsibly—the right to use their creative abilities to advance science. Creative, sustained, and dedicated intellectual exploration is an essential aspect of scientific, technological, and clinical progress. At the same time, it serves to expand our general understanding of the world. However, both public beneficence and intellectual responsibility, the complement to intellectual freedom, caution against pressing forward with whole genome sequencing without regard to negative consequences. The principle of public beneficence requires both that public benefits be secured and that public harms be minimized. Likewise, intellectual responsibility calls upon all researchers and clinicians—including their staff and the institutions that support them—to adhere to the ideals of research, one component of which is avoidance of harm to others.38 Pursuing whole genome sequencing without considering potential harms would violate the clear and compelling mandates of public beneficence and intellectual responsibility.

Privacy Concerns Raised by Whole Genome Sequencing Respect for persons includes respect for the dignity and privacy of individuals. As a result, respect for privacy assumes special salience in discussions about ethics and genetics. Because whole genome sequence data provide important insights into the medical and related life prospects of individuals as well as their relatives (who most often did not consent to the sequencing procedure), whole genome sequencing poses real privacy concerns. These concerns are compounded by the fact that whole genome sequence data gathered now might reveal important information, entirely unanticipated and unplanned for, as science progresses. The potential power of the information contained in whole genome sequencing substantially raises the privacy stakes of medical information. “Public trust is fundamental to the ongoing support of these activities and to participant willingness to actually contribute to the research. And without the participant willingness to contribute to the research, we will not move forward at all.” Laura Lyman Rodriguez, Director of Office of Policy, Communications and Education, National Human Genome Research Institute. (2012). Presentation to PCSBI, August 1. Retrieved from http://bioethics.gov/cms/node/749.

Privacy and the Law Concerns about privacy are not new; worries about the proper boundaries between self, others, and government extend as far back in recorded human history as ancient Greece and Rome.39 The central role of privacy in U.S. culture and ethics is reflected in the tone of its laws. The word “privacy” does not appear in the U.S. Constitution. However, as American courts and scholars have observed, the Bill of Rights implicitly recognizes the value of privacy and

1978

Presidential Commission for the Study of Bioethical Issues

rights of privacy through provisions guaranteeing: 1) freedom of speech, freedom of religious, political and personal association, and related forms of anonymity (First Amendment); 2) freedom from government appropriation of one’s home (Third Amendment); 3) freedom from unreasonable search and seizure of one’s body and property (Fourth Amendment); 4) freedom from compulsory self-incrimination (Fifth Amendment); 5) freedom from cruel and unusual punishment, including unnecessarily extreme deprivations of privacy (Eight Amendment); and 6) other personal freedoms (Ninth Amendment). In addition to the Bill of Rights, the Supreme Court and state courts have marshaled the due process clause and language of “liberty” of the Fourteenth Amendment to strike down laws interfering with autonomous medical, marital, sexual, and family decision making. “With advancing technologies it’s increasingly hard to keep secret our genetic information. There’s more data-sharing... but that doesn’t mean that we don’t have privacy interests here, it just means that we may need more explicit protections of those interests.” Sonia Suter, Law Professor at George Washington University. (2012). Presentation to PCSBI, August 1. Retrieved from http://bioethics.gov/cms/ node/748.

A number of U.S. states have explicit privacy protection provisions in their constitutions that apply to privacy violations by state and, in some cases, private entities. The common law of some states includes a breach of confidentiality tort. Most states recognize one or more right to privacy torts, first proposed in the 1890 article “The Right to Privacy” by Samuel Warren and Louis Brandeis. This seminal article persuasively argued that courts should recognize a “right to be let alone” against unwanted intrusion and publicity.40 Today personal injury suits can be brought alleging intrusion upon seclusion; publication of private facts; publication placing one in a false light; and appropriation of name, likeness, or identity. The United States takes a sectoral approach to regulating privacy, which means that the United States specifically regulates privacy concerns in particular settings as they arise. In the past four decades, in response to pervasive new technologies and related business practices, state and federal authorities have enacted many statutes and agency rules protecting the privacy of data related to health, education, finances, taxes, the federal census, video rentals, liedetection, motor vehicle records, library records, and electronic and telephonic communications. This sectoral approach means that a number of areas that have no specific laws currently do not receive even baseline privacy protections. By contrast, Europe regulates privacy comprehensively, providing privacy protections that are consistent across different types of data or information.41

The Meanings of Privacy Privacy and associated terms, including confidentiality, anonymity, choice, and data protection, refer to related concepts. Discussions about ethics and whole genome sequencing sometimes inappropriately use these terms interchangeably. To enable clear ethical analysis in this report, we provide basic definitions of the family of privacy terms applicable to our work and map their relationships. Scholars differ in their precise definitions of the terms we use, but the language we present in this report is consistent with a general consensus view. The following definitions are meant to show how the Commission uses these terms and to help

Privacy and Progress in Whole Genome Sequencing

1979

guide future discussions regarding ethics and genetics. They should not be taken as formal arguments for precise definitions. Restricted Access The term privacy is used here (and in many ethical and legal contexts) broadly to mean states of affairs by virtue of which the accessibility of persons, personal information, or personal property is limited or restricted. What is valued as “personal,” “sensitive,” or “intimate” may be restricted by virtue of, for example, spatial distances, physical barriers, electronic passwords, social norms, or customs. In the United States and other developed societies, health information is widely considered personal, sensitive, or intimate, and genetic information especially so. The term informational privacy refers generically to restricted access to information or data. “Confidentiality,” “anonymity,” and “data protection” are specific ways to protect informational privacy in the broad sense, with special relevance in clinical and health research settings. Confidentiality is used to denote restricting access to information or data to groups of specifically authorized recipients. In the medical context, health information is often limited by custom to close family and friends and by law to health practitioners, insurers, and professional researchers. Patients and research participants may even choose to keep health conditions secret from intimate kin by deliberately concealing the information. Confidentiality is closely connected with trusting relationships. One can share private information with another person on the understanding that he or she can be trusted to keep that information secret (i.e., will not divulge it to others). Patients entrust clinicians with medical information provided that they have a “need to know,” and understanding that the clinician will keep the information confidential. In the context of whole genome sequencing, data must be kept confidential; databases must be secure and information must not be divulged to unauthorized users. Anonymity is used to denote restrictions on access to personally identifiable information pertaining to individuals or groups, achieved through intentionally disguising or removing identifiers. A health record can be made more anonymous, for example, by removing a patient’s name, address, or social security number. Data protection refers to measures designed to thwart deliberate or accidental disclosures of confidential or anonymous information. Health data that are electronically stored or transmitted can be protected with computer passwords and encryption. Health care providers employ technology to protect data, but ethical norms and business practices can also protect data from unauthorized access, use, and disclosure. Autonomy The term “privacy” has a second distinct use in ethics and law. Privacy is a rough synonym of autonomy with respect to self-regarding conduct and intimate relationships. Here, privacy denotes the absence of substantial government or other outside interference with individuals’ decisions and choices. In traditional bioethics, the “privacy” at issue in euthanasia, birth control, and consent to research is this second understanding of privacy, which involves the ability to make autonomous decisions. We note that there are other uses of “privacy,” some health-related, that do not play a major role in this report. Seeking greater precision and focus, privacy scholars and the courts commonly qualify the term “privacy” using descriptive adjectives. Indeed, they commonly

1980

Presidential Commission for the Study of Bioethical Issues

speak of informational privacy in relationship to the collection, use, and sharing of information or data. They speak of physical privacy in relation to observing, concealing, and touching the human body, such as entering hospital rooms or respecting patient modesty. They refer to spatial, geographical, and locational privacy in relation to GPS and beeper technologies. They speak of associational privacy in relation to affiliation with like-minded people. They recognize decisional privacy in relation to independent decision-making. Less commonly, privacy scholars and the courts distinguish proprietary privacy in relation to repositories of personal identity and genetic ownership claims. And finally, they identify intellectual privacy in relation to interests in freedom of thought, conscience, and the right to read and access knowledge. There is ample debate and disagreement about the value of particular privacies and the basis for laws and policies promoting or regulating each type of privacy. In this report, the Commission focuses on informational and decisional privacy as they pertain to whole genome sequencing. We use the term “privacy” in reference to both limited access to genetic information and data, and to the absence of interference with decisions about the collection, use, and sharing of genetic information. A person whose whole genome is sequenced might have both decisional privacy concerns (about who is permitted to decide whether whole genome sequencing data are shared) and informational privacy concerns about whether such data will be shared in confidence, securely, or in de-identified form. Although the precise contours and content of privacy have changed substantially over time, with shifts in culture as well as technology, intense and widespread human interest in the protection of privacy is abiding, not only in the United States, but also around the world. Privacy protections promote a set of highly prized values. Although modern technology can facilitate unobserved and uninvited intrusions into homes, for example, what individuals choose to do in such a domain is generally valued as a matter of “privacy” and deemed legitimately “private,” unless that behavior violates particularly weighty ethical or legal limits. That is, there are constraints on what behavior can be considered legitimately private. In the inclusive understanding of what falls under the privacy umbrella we adopt here, what individuals choose to do at home is presumptively confidential, anonymous, intimate, secure, free from unwanted intrusion, and/or subject to decisional autonomy.42 Concern for privacy values (while additionally a means of enabling privacy at home and other vital privacies) also incorporates the increasingly elusive ideal of control over the flow of information regarding oneself, again subject to broad ethical and legal limits.43

The Value of Medical Privacy The Commission agrees that respect for patient and participant privacy can greatly benefit individuals and the general public. Under the principle of respect for persons, and for the sake of public beneficence and justice and fairness, those who collect, use, or share health data should employ practices that include confidentiality, anonymity, and informed consent to shelter clinical patients and research participants from the unwanted glare and control of others. It is important to ensure that respect for patient and participant privacy not be compromised, not only in clinical care and research, but also in the publication or archiving of medical lectures, scholarly articles, and personal papers. Medical privacy remains an important ethical principle, despite the recognition that many people voluntarily share their health information or data, including genetic information and data, and despite the practical reality that modern institutional practices presuppose that a great deal of sensitive health information can and will be lawfully shared among providers, insurers, researchers, and the government.

Privacy and Progress in Whole Genome Sequencing

1981

Medical privacy has many varieties of recognized public value. First, medical privacy encourages individuals to seek medical care. Individuals will be more inclined to pursue medical attention if they believe they can do so on a confidential basis. Practicing confidentiality assures that, in most cases, a patient can choose when to disclose an illness, condition, or genetic status. Confidentiality and anonymity enable individuals to exercise constitutionally protected liberties of autonomous medical decision-making by safeguarding information they do not choose to share because it is embarrassing or would expose them to discrimination or disapprobation. “It just seemed safer to keep it to myself…I didn’t know what somebody would do with that information in the future…and I was very concerned about it.” Victoria Grove, introductory vignette, referring to her decision to keep secret her positive genetic test for alpha-1 antitrypsin deficiency.

Second, medical privacy encourages frank disclosures in clinical and research settings. Individuals seeking care can be open and honest if they can trust that facts reported to or uncovered by clinicians or researchers will not be broadcast to the world at large. People are often embarrassed by symptoms, histories, and prospects of illness. Individuals concerned about discrimination, shame, or stigma have an interest in controlling the flow of information about their health. Some patients and participants believe they own personal information about themselves, especially genetic information, and should be able to control its release. Third, if individuals believe they can decide whether to share data, information, and biospecimens under conditions of confidentiality, anonymity, and informed consent, they might be more likely to participate in research. In the context of health research, ethics committees and institutional review boards properly require researchers to protect the privacy of research participants and their medical records. Obligations of privacy may require the use of coded information rather than names or “de-identification” procedures such as data aggregation. Some have argued that researchers must publish genomic data in ways that obscure the identities of whole families. Even statistical use of individuals’ health data has raised privacy concerns, as some have argued that for cultural or social reasons individuals might have an ethical interest in the uses of data sets without personal identifiers that include data about them.44 Fourth, alleviating the concerns about exposure and discrimination that keep patients away from clinicians enhances confidentiality, which can further the goals of health care cost savings by ensuring that patients seek early medical care rather than waiting until their conditions worsen and require more dramatic medical intervention.45 The Commission recognizes that privacy, like most values, has ethical as well as practical limits. It is not an absolute public good. Certain diseases, conditions, and prescriptions must be reported to government to protect public health and safety. Health care providers and responsible adults are ethically obligated to report evidence of child neglect and abuse uncovered in treatment. Mental health providers have an ethical duty to warn police or potential victims of the credibly violent intentions of patients with mental illness. Situations arise in which medical confidentiality cannot be preserved because the media has a right to publish information or legal authorities have the authority to subpoena information for use in legal proceedings and investigations. Members of the military and civil servants serving in war zones may be also required to undergo mandatory genetic biobanking or testing for varied purposes.

1982

Presidential Commission for the Study of Bioethical Issues

Privacy in Whole Genome Sequencing Currently, whole genome sequencing involves generating, storing, sharing, and analyzing large amounts of data. Although members of the public express general comfort with the idea of sharing genomic data in biorepositories, privacy ranks among participants’ highest concerns.46 Data also show that for many, privacy concerns are an important obstacle to participation in large cohort studies.47 Although 60 percent of people surveyed said they would participate in a study that involved storing data in biorepositories, 91 percent of those potential research participants would be concerned about privacy.48 Additional data indicate that although a large majority of survey participants trust clinicians and researchers, they are concerned that results of genetic tests could end up in the wrong hands and be used against them.49 Most of the people interviewed following enrollment in one sequencing study indicated that their primary concern was that they be informed if there was a possibility that their data would be shared with other researchers and that it was important they maintain some control over who could have access to their genomic data. The participants wanted insurance companies and employers to be excluded from access to these data, but were comfortable with data sharing within the research community.50 Informational and decisional privacy concerns about the unauthorized disclosure or misuse of whole genome sequence data are not only common and intensely important in the minds of potential research participants, they are also objectively linked to the potential for serious harms from such disclosure and misuse. Potential harms include the risk of lost opportunities in employment, long-term health care, disability and life insurance, loan approvals, education, sports eligibility, military accession, and adoption eligibility.51 In areas that are far less amenable to any legal protection or recourse, individuals could find themselves facing social stigma from disclosure of sensitive genomic information, and subsequent disruption of their home, family, and community life.52 Risks that are more internal to, and variable among, individuals include being subject to psychological harms upon learning information that can be difficult to bear, including that one has a predisposition to a disease such as cancer or Alzheimer’s disease. Because whole genome sequence information directly implicates relatives, psychological harms often are not limited to the person whose genome is voluntarily being sequenced and publicly disclosed. Even individuals who learn that they do not carry a harmful variant may experience “survivor’s guilt” if another family member is affected.53 To date, the number of documented cases of discrimination on the basis of genetic test results is small.54 This might be due to the relatively few conditions for which there are currently definitive genetic tests, coupled with the expense and difficulty of conducting these tests. As a result, genetic information is rarely available to third parties. Another reason for the small number of reported cases, now and potentially in the future, might be the difficulty of uncovering and documenting discriminatory use of data.55 It is also possible that such discrimination might not occur, either because there are other more definitive bases on which to make insurance or employment decisions, or because all individuals have some form of disease predispositions. Regardless, legitimate concerns remain about the potential for differential treatment of individuals based on their genomic information, even if legally prohibited discrimination rarely occurs. If individuals lack assurances against misuse of their genomic information, their privacy concerns might motivate them to not share their whole genome sequence data, which could harm the research enterprise that generates life-saving discoveries.

Privacy and Progress in Whole Genome Sequencing

1983

Privacy and the Ethical Principles A robust set of ethical principles—respect for persons, responsible stewardship, and justice and fairness—supports the adoption of norms to minimize the privacy risks that could befall individuals while enabling research and clinical care for public benefit to continue. Respect for persons requires one to give great “weight to autonomous persons’ considered opinions and choices while refraining from obstructing their actions unless they are clearly detrimental to others.”56 Exercising autonomy includes self-determination, which requires that persons be allowed to make “important decisions about one’s life for oneself and according to one’s own values or conception of a good life.”57 Respect for persons highlights an individual’s autonomy and recognizes that we should respect individuals’ ability to decide for themselves what they value, and how and when to act on those values. For example, an autonomous person should be able to decide whether to undergo a medical procedure based on personal considerations of risks, benefits, costs, and cultural and religious views. Forcing an individual to undergo a procedure, even for their medical benefit, would violate that person’s autonomy and would fail to demonstrate respect for the individual as a person. Respect for persons also encompasses respect for the individual’s dignity and privacy. Therefore, violation of an individual’s privacy, such as the misuse or unauthorized disclosure of whole genome sequencing data, demonstrates a violation of the principle of respect for persons. Governments and societies that exercise responsible stewardship accept a duty to proceed prudently in promoting scientific advancement and emerging technologies. They recognize a shared duty to act in ways that demonstrate concern for all those who might be affected, and especially for those who are not in a position to represent themselves (e.g., children, the disenfranchised, vulnerable populations, and future generations). Rapidly advancing technologies such as whole genome sequencing present profound challenges for responsible stewardship because our understanding of the potential benefits and risks is largely incomplete and uncertain.58 This makes it important that governments and societies take great care not to make decisions that have a substantial chance of causing irreversible harm to current or future generations, and especially those who have little or no say over such decisions. Responsible stewardship advises against decisions that are entirely precautionary (no action without complete certainty of security) or entirely proactionary (no limitations on science). Heeding the principle of responsible stewardship therefore neither thwarts the development of new scientific enterprises nor lets science advance unchecked on the fallible assumption that it is safe. The principle of justice and fairness is, in important part, a commitment to ensuring that the unavoidable burdens of technological advances do not fall disproportionately on any individual or group, and that the benefits are widely distributed.59 The principle of justice and fairness encompasses the idea of fair distribution in that it demands society ensure that risks not be disproportionately borne by any particular group and strive for “the broadest distribution of beneficial technologies.”60 As such, the principle of justice and fairness entails protection for those who decide to share their whole genome sequence data to reduce the chances that they will be harmed by unauthorized disclosure or misuse. These three principles, taken together, suggest that individuals are entitled to privacy protections that prevent undue and disproportionate burden. But these protections are not absolute. Prohibiting all gathering and sharing of whole genome sequence data would protect privacy absolutely, but still would fail to adequately respect persons. A total prohibition prevents individuals from choosing to participate in whole genome sequence research, even if they consider themselves adequately protected; it also fails to take into account individuals’

1984

Presidential Commission for the Study of Bioethical Issues

other interests, such as an interest in excellent medical care. Respect for persons demands respect both for individuals’ privacy and for their interest in benefitting themselves and others from medical advances. The Commission emphasizes that there is extremely good reason for individuals to choose to share information in a context where there is adequate protection for individual privacy: whole genome sequencing has the potential to be of substantial public benefit. The ability to share information is the sort of important decision that is central to autonomous action, which respect for persons commits us to recognize. Respect for persons supports giving persons the opportunity to share their whole genome sequence information for scientific advancement, subject to strong baseline privacy protections. At the same time, individuals have a responsibility to safeguard their privacy as well as that of others, by giving thoughtful consideration to how sharing their whole genome sequencing data in a public forum might expose them to unwanted incursions upon their privacy and that of their immediate relatives. To be indifferent to the implications of disclosure of sensitive data and information about one’s self is to act irresponsibly. That being said, it can be good and virtuous to share sensitive data about oneself in appropriate circumstances, for example, for the good of public health research or public education. To determine what baseline privacy protections should be, we need to distinguish between access to, use of, and possession of whole genome sequence data. To possess whole genome sequence data is to have a copy of the data file and, therefore, to have access to it at any time. Having access to data implies the ability to manipulate and work with the data files. It is possible to access data that one does not possess; a researcher might be allowed to access data files in a secure database to address research questions without keeping a copy of the data. One can have access to data even if one does not (and either ethically or legally cannot) use it, as when whole genome sequence data are stored on a server available to download, but one does not download them. The use of data refers to seeking answers to questions by analyzing the data. A researcher could use data in a protected database without having either access to or possession of the data by submitting a query to the database manager and then receiving the results of the query from the database manager. In these ways, it is possible to allow researchers to work with whole genome sequencing data through access to or use of the data while maintaining the security of the data themselves and protecting the privacy of the individuals who contributed to the database. The confidentiality of information or data about persons can be maintained through a number of means designed to prevent unauthorized access to the data: these means are collectively called informational security or data security. Examples of data security mechanisms include legal limitations, locked drawers, and computer firewalls. Presentations to this Commission indicated that whole genome sequence data could be used without actually possessing it: that is, technologies already are being developed to allow researchers to have limited computational access to select whole genome sequence data sets without physically transferring possession of all data files in the set.61 The researcher would be able to use the data for analysis, but would not maintain possession of the data. This means that possession of genomic information is neither necessary nor sufficient for its use. As with control of information, the use of information (including misuse and unauthorized use) in some cases will be of greater ethical salience than either access or possession.

Privacy and Progress in Whole Genome Sequencing

1985

Reconciling Competing Ethical Claims The principles of public beneficence and intellectual freedom and responsibility support continued pursuit of whole genome sequencing to advance scientific understanding and medical progress. But these principles have components that suggest such pursuits should not be unrestrained. The positive argument for restraint is founded upon the principles of respect for persons, responsible stewardship, and justice and fairness, which together require implementing privacy protections and minimizing the chance of harm to individuals. But these principles do not suggest that privacy protections should erect absolute barriers to voluntary data sharing. In moving forward with whole genome sequencing, respect for persons requires informing individuals about the foreseeable consequences of their decision to share their genomic data, including who has access to their whole genome sequence data and how these data might be used in the future. Respect for persons also counsels individuals who collect samples to determine patient and research participant preferences at the time samples are obtained so that they can choose whether to participate, or whether feasible limits on the use of their whole genome sequence data can be agreed upon. Providing individuals who are choosing whether to share whole genome sequence data with the information necessary to make a fully informed decision about the potential consequences—including who can access the data and how the data will be used—allows individuals to make an autonomous decision. The principle of respect for persons applies to all whole genome sequence data regardless of whether they were obtained in a research or a clinical context. The Commission’s principle of regulatory parsimony calls for “only as much oversight as is truly necessary to ensure justice, fairness, security, and safety while pursing the public good.”62 Regulatory oversight is appropriate in certain contexts—for example, disallowing certain types of research or permitting other types of research only when certain conditions are met. But some aspects of research—including data security protections for whole genome sequence data—remain outside most regulatory frameworks. For otherwise unregulated aspects of research, informed consent is one mechanism by which individuals can protect their own privacy. By informing individuals about the potential risks and benefits of participation in whole genome sequencing, along with information about the security protections in place, individuals can autonomously choose whether to provide a biological sample for use in whole genome sequencing research. In this way, informed consent is one means of reconciling the public good that can come from whole genome sequencing with the potential harms to individual privacy. NEWBORN SCREENING In the case of Beleno v. Texas Department of State Health Services parents sued, claiming that the Texas Department of State Health Services collected and stored newborn blood samples, subsequently making them available for research purposes, without seeking parental consent. The parents argued that the lack of proper consent was a violation of privacy. The out-of-court settlement that was reached resulted in the destruction of 4 million similar specimens that had been collected without parental consent.

1986

Presidential Commission for the Study of Bioethical Issues

Sources: Beleno v. Lakey, No. SA-09CA-188-FB (W.D. Tex. Sept. 17, 2009).; and Aaronson, B. (2010, December 8). Lawsuit alleges DSHS sold baby DNA samples. The Texas Tribune, TribBlog. Available at: http://www.texastribune. org/texas-state-agencies/departmentof-statehealth-services/lawsuitalleges-dshs-sold-baby-dna-samples/.

The Commission is also mindful of democratic deliberation, an approach to collaborative decision-making that embraces respectful debate of opposing views and active participation by citizens. Democratic deliberation warrants engaging the public and fostering dialogue among the scientific community, policy makers, and those concerned with the issues raised by whole genome sequencing.63 In this spirit, the Commission sought input from a broad range of voices, including members of the patient advocacy community calling for more participatory models of research and from researchers who feared further administrative burden. The principle of democratic deliberation acknowledges that while decisions (e.g., recommendations, policies, and guidance documents) must be reached in a timely manner, those decisions need not—and generally should not—be unalterable, particularly when relevant new information emerges. Modern societies change rapidly, especially in the domain of science and technology, and decisions in changing realms are best considered provisional rather than permanent. Researchers and clinicians must be particularly mindful of the deliberative value of provisionality, of being tentative or temporary, as whole genome sequencing moves from the realm of research and enters the broader clinical context.64 The transition is already raising new challenges, and the policies that were once created with the assumption that the research realm is clearly and cleanly separated from clinical contexts may no longer be either sustainable or desirable due to the reciprocal relationship that has developed between them. Clinical samples, stripped of identifiers and transferred to genomic databanks and biorepositories for broader use by researchers, contribute to the common good by making possible research that could not be done without large numbers of samples from which to generate data. Subsequently, medical benefits developed as a result of such research will be available to the broader population including the persons from whom the deidentified clinical samples were taken.

Conclusion The Belmont principles and the principles articulated by this Commission suggest ethically important and practically useful guidelines for whole genome sequencing. Chief among these is that the principle of respect for persons requires strong baseline protections for privacy and security of data, while public beneficence requires facilitating ample opportunities for data sharing and access to data by clinicians, researchers, and other authorized users. Respect for persons further requires that any collection and sharing of an individual’s data be based on a robust process of informed consent. The principle of responsible stewardship calls for oversight and management of whole genome sequence information by funders, managers, professional organizations, and others. The principle of intellectual freedom and responsibility provides further support for pursuing whole genome sequencing and seeking models for broad data sharing by promoting regulatory parsimony. Democratic deliberation is the foundation of the process that gave rise to this document, and others like it, and will continue to be the foundation moving forward. Democratic deliberation urges all parties to consider changes to policies and practices in light of the evolving science and its implications for enduring ethical values.

Privacy and Progress in Whole Genome Sequencing

1987

Finally, the principle of justice and fairness requires that we seek to channel the benefits of whole genome sequencing to all who may potentially benefit, and ensure that the risks are not disproportionately borne by any particularly vulnerable or marginalized group.

SECTION 2. POLICY AND GOVERNANCE This section describes current policy and legal protections of genetic information and the ways in which genome sequence data are shared in the United States. There is no comprehensive federal law that protects genetic privacy. The Genetic Information Nondiscrimination Act (GINA) prohibits discrimination by employers and health insurers based on the results of genetic tests, but does not provide privacy protections. In addition, GINA does not address the complexity of large-scale genomic data. Many states have laws governing genetic information and some of these laws provide privacy protections, but the laws vary greatly from state to state. As a result, our laws lack the specificity required to encourage participation and secure public benefits from this emerging science, while still ensuring the protection of privacy. To gain the most benefit from recent innovations in whole genome sequencing, researchers need as much data as possible, derived from broad public participation in whole genome sequencing research. Widespread participation will be achieved only if participants trust the research enterprise and are comfortable that their privacy interests are protected. Currently, the patchwork of state and federal laws does not provide uniform protection of genomic data privacy. Protecting privacy interests of individuals requires a spectrum of conditions to be in place, including ethical and trustworthy behavior by researchers and clinicians, sufficient security of information technology, and policies and laws that hold violators accountable.

Privacy Concerns about Genetic and Whole Genome Sequence Data For as long as the nature of genetics and heritability has been understood, there have been concerns about misuse. During most of the 20th century, erroneous notions about genetics led to eugenic policies based on the idea that genetic “inferiority” should be eliminated. Since the launch of the Human Genome Project in 1990, scientific knowledge about genetic information has grown exponentially, especially in identifying genetic variations that cause disease. This new information has resulted in a heightened concern about privacy, and the implications of others knowing an individual’s genetic information. To draw meaningful conclusions and answer broad research questions, researchers aggregate and share whole genome sequence data from large numbers of individuals. To garner widespread participation in research and maintain trust in the enterprise, users and holders of whole genome sequence data must guide themselves according to at least three facets of privacy and confidentiality. The first facet, the individual, requires fostering ethical behavioral norms for researchers and clinicians. Participants, patients, and consumers must be assured that those who have contact with identifiable data intend to use them in an ethical manner—namely, only for those uses for which the participant, patient, or consumer has given consent. Many individuals trust researchers and medical professionals to consider their needs along with the

1988

Presidential Commission for the Study of Bioethical Issues

greater good, despite substantial privacy concerns. A 2010 study of research participants’ views on genomic research indicated that, while individuals expressed concerns about privacy and data security, they also understood the value of sharing whole genome sequence information. Overall, concerns about privacy did not outweigh their sense of the importance of sharing genomic data in the interest of a larger social good.65 The second facet of privacy protection is information technology. Participants and patients must be assured that their data are secure. A 2006 survey queried the public’s wariness about health information technology systems and found that 80 percent of survey participants were concerned about identity theft and fraud, 77 percent about health information being used for marketing purposes, and 55 percent about health information being misused by insurers or employers.66 These concerns highlight the need for secure information technology systems tailored to sensitive biomedical information, including whole genome sequence data and information. These concerns build upon the need for fundamental trust in the ethical behavior of data users and in the security of the systems that store these data—participants and patients should be assured that they can rely on their consent to allow identified data to be used for certain purposes and not for others. The third facet of privacy protection is policy. Policy-level protection requires that systems be in place to provide clear institution-level expectations of training and preparation to handle whole genome sequencing data and information, to ensure an atmosphere of trust and an expectation of security, and to provide recourse should individual and information technology privacy protections fail. While rapid advancement of genomic science in the past decade has led to vast potential for valuable research and societal benefits through medical advances, privacy and confidentiality concerns persist. Without reliable protection from potential harms, perceived and real fears of privacy violation and discrimination could cause individuals to balk at sharing their whole genome sequence data, thus stifling scientific progress.

Current Sharing of Specimens and Whole Genome Sequence Data The past few years have seen the rise of sharing whole genome sequence data through biorepositories (facilities that store large numbers of physical biospecimens containing genetic material and associated data and information that researchers can access) and databases. Biorepositories are categorized generally into four groups: disease-specific (e.g., cancer databases); longitudinal population studies (e.g., the United Kingdom biorepository); isolated populations (e.g., the Faroe Islands); or twin registries, used to distinguish between genetic and non-genetic bases for disease.67 Biorepositories often have different missions and different governance structures and must reconcile the rights of individuals with potential societal benefit accordingly. Other organizations, such as academic institutions, government agencies, and private not-for-prof it entities, store data in databases—repositories that do not contain physical biospecimens, but rather electronic versions of genome sequence files. For many purposes, it is no longer necessary to maintain actual stored DNA from an individual once the genome sequence data have been collected, because it is easier to share electronic data files than physical specimens. Despite these differences, biorepositories and their associated databases share some commonalities. The collection of specimens and data and subsequent storage in biorepositories

Privacy and Progress in Whole Genome Sequencing

1989

and databases give rise to risks that might include minor harm to the donor in obtaining the biospecimen (such as bruising upon blood withdrawal); nonphysical harms such as discrimination, stigmatization, and untoward psychological impact upon discovering unwelcome information; group harms, like those incurred by the Havasupai; and ethical harms that arise when individuals are not treated with respect and dignity.68 Various laws and regulations govern the ways that these data currently are collected, shared, and used in the United States and around the world.

U.S. Federal Agency Activity In order to inform this report, the Commission sought information about human whole genome sequencing research sponsored by the 18 U.S. Common Rule agencies, and related privacy protections of the data generated in the research they sponsor (see Table 1). The Commission supplemented these responses with publicly available information.69 Twelve of the responding agencies stated that they do not conduct research involving human genomics, have not advocated formally for policy changes, and do not anticipate policy changes related to genomics.70 Table 1. Human genomics research in federal common rule agencies

Department/Agency Agency for International Development (USAID) Central Intelligence Agency (CIA) Consumer Product Safety Commission (CPSC) Department of Agriculture (USDA) Department of Commerce (DOC) Department of Defense (DOD) Department of Education (ED) Department of Energy (DOE) Department of Health and Human Services (HHS) Department of Homeland Security (DHS) Department of Housing and Urban Development (HUD) Department of Justice (DOJ) Department of Transportation (DOT) Department of Veteran Affairs (VA) Environmental Protection Agency (EPA) National Aeronautics and Space Administration (NASA) National Science Foundation (NSF) Social Security Administration (SSA)

Conducts/ Sponsors Research Involving Human Genomics No No No No No Yes No No Yes Yes No Yes Yes Yes No No No No

Anticipates Proposing New Policies No No No Yes No Yes No No Yes No No No No As needed No As needed No No

Six agencies—the Department of Homeland Security (DHS), the Department of Defense (DOD), the Department of Justice (DOJ), the Department of Health and Human Services (HHS), the Department of Veterans Affairs (VA), and the Department of Transportation (DOT)—currently sponsor genetic and/or genomic studies, and five maintain or support biorepositories and databases.71 The confidentiality, privacy, and security of samples and data stored by federal agencies are governed by a baseline of laws and regulations, including the

1990

Presidential Commission for the Study of Bioethical Issues

Health Information Technology for Economic and Clinical Health (HITECH) Act, the EGovernment Act, the Federal Information Security Management Act, the Health Insurance Portability and Accountability Act (HIPAA), the Privacy Act, and the Policy for Privacy Act Implementation and Breach Notification.72 Several agencies have additional mission or function-specific policies that govern the entities they fund that perform whole genome sequencing studies. DOD uses large-scale genomic data in the DNA Dog Tag program, a mandatory program that has collected and stored blood and tissue samples from every member of the Armed Forces since 1991. The program does not give service members the opportunity to opt out of this collection. DNA is extracted from the samples only if needed to assist in identifying human remains. Specimens stored in the repository are not used for any other purpose unless approved by the Assistant Secretary of Defense for Health Affairs. DOD has several policies for protecting and securing genetic information that address disclosure, medical records, and information systems.73 DOD expects to increase the use of whole genome sequencing for forensic applications related to human remains identification.74 Agencies within HHS routinely use or sponsor whole genome sequencing. The confidentiality and security of samples and data used by HHS are covered both by HHS-wide and agency-specific policies, laws, and regulations.75 For example, one HHS agency, the Centers for Disease Control and Prevention coordinates efforts to conduct whole genome sequencing of residual dried blood spots archived by states after newborn screening with parental consent.76 The Centers for Disease Control and Prevention also collects DNA specimens for its National Health and Nutrition Examination Survey, and the confidentiality of identifiable information collected is protected under the Public Health Service Act.77 Another HHS agency, the National Institutes of Health (NIH), devotes resources to studying the influence of genetic factors on human health and illness. NIH has established a number of genetic data repositories, most notably the database of Genotypes and Phenotypes (dbGaP).78 dbGaP stores various types of genetic information, including whole genome sequence data. Access to data stored in dbGaP is two-tiered: open access, which grants the public access to information about study design and aggregate phenotypic information; and controlled access, which grants researchers access to information including de-identified genotypes and phenotypes of individual study participants.79 Researchers who seek controlled access must submit formal research requests that are reviewed and approved by NIH Data Access Committees.80 NIH has implemented policies and procedures to which every researcher with access to dbGaP must adhere to protect the privacy and confidentiality of genetic and, specifically, whole genome sequence data.81 The Combined DNA Index System (CODIS) is a DNA database funded by the Federal Bureau of Investigation (FBI), a Department of Justice agency. CODIS consists of DNA profiles from the Convicted Offender Index, the Forensic Index, the Arrestee Index, the Missing or Unidentified Persons Index, and the Missing Persons Reference Index. The National DNA Index contains almost 11 million offender profiles.82 CODIS does not contain personally identifiable information, nor does it contain whole genome sequence data. To further protect the data in CODIS, access to computers containing CODIS software is limited to authorized users approved by the FBI. Unauthorized disclosure of DNA data in the National DNA database is subject to a criminal penalty.83 DHS uses genetic data, but not whole genome sequence data, in several ways. DHS collects DNA from individuals who are arrested, facing charges, or convicted of federal or military

Privacy and Progress in Whole Genome Sequencing

1991

crimes. DHS also collects DNA from non-U.S. citizens who are detained under the authority of the United States. U.S. Citizen and Immigration Services can require genetic testing to establish familial relationships to determine immigration or refugee status. Finally, DHS is piloting a program for overseas refugees who request asylum for family members; refugees can be asked to voluntarily undergo familial relationship testing using a portable DNA testing device. DHS does not generally maintain or have access to the genetic information it collects from individuals; it sends DNA samples to the Department of Justice for processing and entry into CODIS.84 VA has active research and clinical genomics programs. In 2012, VA launched the Million Veteran Program, which aims to collect one million biospecimens from veterans to explore the role of genes in health and disease.85 VA treats genomic data as personally identifiable medical information protected under HIPA A, although it stores the biospecimens securely and without other traditional identifiers such as name. VA has applied for a Certificate of Confidentiality from NIH, and has several additional departmental policies to protect the privacy of identifiable medical information.86 The Million Veteran Program database is accessible only to authorized researchers for projects that have been approved by appropriate VA oversight committees.87 The Federal Aviation Administration, a Department of Transportation agency, is researching human factors related to aviation safety from a gene expression viewpoint (gene expression is the process by which genes are translated into proteins).88 Specifically, the Federal Aviation Administration is researching how alcohol use, fatigue, and cosmic radiation change gene expression and is correlating changes in gene expression to human performance to improve aviation safety. The Federal Aviation Administration’s intent is to have unique sets of molecular markers for these factors that are generally applicable across the broad human genetic spectrum with a high degree of specificity. Genetic data collected by the Department of Transportation are subject to a number of federal data security policies. INTERNATIONAL BIOREPOSITORIES While the United States has many publicly funded biorepositories of limited size, a number of countries have implemented or attempted to implement population-wide biorepositories. In the United Kingdom, for example, a half million volunteers are being recruited to donate genetic material to be linked to medical records in a biobank. The biobank will obtain informed consent from its participants and will allow for withdrawal from the database. Participants can request: 1) complete withdrawal and destruction of existing samples, 2) discontinued participation but continued use of existing data, or 3) no further contact, but continued use of existing data. Source: UK Biobank [website]. Retrieved from http://www.ukbiobank.ac.uk/.

Commercial Genetic Testing Companies Over the past few years, accessibility and availability of commercial genetic testing and genotyping has greatly expanded. Companies like 23andMe, Navigenics, and Ancestry DNA provide an array of services including paternity testing, testing for predisposition to certain diseases and traits, genealogy and ancestry information, pharmacogenomics (the influence of genomic factors on drug response), and even private forensic tests to establish profiles of suspects not included in the federal CODIS database.89 Most commercial genetic testing

1992

Presidential Commission for the Study of Bioethical Issues

companies currently do not conduct whole genome sequencing. Instead, they analyze hundreds of thousands of single-nucleotide polymorphisms (SNPs) or discrete variants throughout the genome, which they describe as “genotyping.”90 Commercial genetic testing companies often conduct research that uses biospecimens submitted by their customers. Most recently, 23andMe patented one of their research discoveries, “polymorphisms associated with Parkinson’s disease.”91 Commercial entities face issues of data maintenance and storage similar to those of government-sponsored biorepositories and databases. They collect and analyze genetic and genotypic data and maintain electronic databases of consumer data. In addition, many commercial genetic testing companies have a research arm that conducts research on consumer data in biorepositories. Currently, there are no overarching federal or industry guidelines indicating how commercial genetic testing companies should operate, what privacy controls they should implement, or what limits they should put on the use of genetic data and information. Like government-sponsored biorepositories and databases, they can protect consumers by developing systems to promote ethical and trustworthy behavior of employees, strengthening the security of information technology systems, and developing company policies that hold violators accountable.

Privacy Regulations Individuals who share their genomic information, like those who share any medical data, accept risks to their privacy and confidentiality should the data be improperly shared or used. Rather than a broad framework that provides general privacy protections, the United States has developed a patchwork of subject-specific regulations to protect the privacy of different types of information.92 This system of subject-specific regulations includes, for example, regulations that protect census data, financial information, medical records, and video rental records, but does not include regulations that protect personally identifiable information that is not financial or medical, including name, address, occupation, affiliations, or internet activity.93 As a matter of respect for persons as well as justice and fairness, a government can institute laws and regulations that help mitigate risks to individuals who share whole genome sequence data, and it can protect individuals from unwillingly or unwittingly sharing their whole genome sequence data. But it cannot eliminate all privacy risks while still effectively encouraging scientific, economic, and social progress. Just as the Commission strongly supports effective protections of privacy, it also emphasizes that sharing whole genome sequence data for the sake of medical research holds great potential for public benefit. The principle of public beneficence strongly encourages this sharing in a setting that provides adequate protections of privacy.

U.S. Privacy Regulations The collection and protection of personally identifiable information is not new. The United States has collected personally identifiable information through the census and the tax systems since its early history. The government has recognized the importance of keeping this information secure and has implemented protections to ensure the privacy and security of these data.94 Privacy laws and regulations permit but regulate cross-agency matching of collected data, and establish precedent that personal data shared by an individual for one specific purpose

Privacy and Progress in Whole Genome Sequencing

1993

should not be used to other ends, such as law enforcement or judicial proceedings, without their consent. In addition, traditional identifying information often is removed from the data files.95 The United States has made several sectoral legislative attempts to regulate the privacy and security of personal data. These laws include the Fair Credit Reporting Act; the Privacy Act of 1974; the Confidentiality of Alcohol and Drug Abuse Act; the Family Educational Rights and Privacy Act of 1974; the Electronic Communications Privacy Act of 1986; the Video Privacy Act of 1988; the Children’s Online Privacy Protection Act of 1998; and the Gramm-LeachBliley Act of 1999, also known as the Financial Services Modernization Act (requiring financial institutions to protect consumer privacy).96 The laws cited above generally comport with “fair information practice” principles and practices first set forth in the Department of Health, Education, and Welfare (the precursor of HHS and the Department of Education) report, “Records, Computers and the Rights of Citizens.”97 The practices include the following principles: 1) there must be no personal data record-keeping systems whose very existence is secret; 2) individuals must be able to find out what personal information about them is in a record and how it is used; 3) individuals must be able to prevent information obtained for one purpose from being used for other purposes without consent; 4) individuals must be able to correct or amend a record of identifiable information; and 5) any organization creating, maintaining, using, or disseminating records of identifiable personal data must assure the reliability of the data for their intended use and must take reasonable precautions to prevent misuse of the data.98 HIPA A, enacted in 1996, is the federal law most relevant to medical privacy.99 Pursuant to the authority of Title II, HIPA A sets forth policies, procedures, and guidelines for maintaining the privacy and security of personally identifiable health information.

Figure 2. U.S. Federal Privacy Laws.

1994

Presidential Commission for the Study of Bioethical Issues

The HIPA A-mandated Privacy Rule was finalized in 2005. The Privacy Rule defines the circumstances in which an individual’s protected health information—including any identifiable in format ion — may be used or disclosed by a covered entity.100 A covered entity is a health plan, a health care clearinghouse, or a health care provider that transmits any health information in electronic form.101 Under HIPA A, health information is not “identifiable” if there is “no reasonable basis to believe that the information can be used to identify an individual” or if it is stripped of the HIPAA identifiers.102 An individual’s privacy rights under the Privacy Rule survive death.103 While it is clear that genetic information is health information under HIPA A, HHS has stated that it is only covered by the Privacy Rule to the extent that it meets the definition of protected health information.104 HHS has not clarified whether genetic or genomic information on its own is protected health information—that is, whether it falls under one of the HIPAA identifiers, such as “biometric identifier” or “any other unique identifying number, characteristic, or code.”105 IDENTIFYING INFORMATION UNDER HIPAA Names Address Dates Phone numbers Fax numbers Email addresses Social security numbers Medical record numbers Health plan beneficiary numbers Account numbers Certificate/license numbers Vehicle identifiers Device identifiers and serial numbers Web URLs Internet protocol (IP) addresses Biometric identifiers, including finger and voice prints Full face photographic images and any comparable images Any other unique identifying number, characteristic, or code (with certain exceptions)

A covered entity must disclose an individual’s protected health information to him or her when specifically requested, and to HHS in the event of a compliance investigation or enforcement action.106 A covered entity may disclose protected health information without consent in specifically enumerated circumstances, including for purposes related to treatment, payment, public health, and health care operations. A covered entity that discloses protected health information, however, must try to disclose only the minimum necessary to achieve its purpose.107 There are no restrictions on the use or disclosure of de-identified health information, which is information that neither identifies nor provides a reasonable basis with which to identify an individual.108

Privacy and Progress in Whole Genome Sequencing

1995

HITECH updated and revised HIPAA to extend slightly its privacy protections. HITECH adds business associates of covered entities to the list of those who can be subject to liability for disclosure of protected health information. It also strengthens the accounting requirements for the protection of health information, and imposes new notification requirements for covered entities to comply with when a breach has occurred.109 The Office of the National Coordinator for Health Information Technology was created in 2004 through an Executive Order, and legislatively mandated in the HITECH Act. Its mission is to coordinate nationwide efforts to implement and use the most advanced health information technology and the electronic exchange of health information.110 While the requirements of HIPAA and HITECH apply only to “covered entities,” most academic institutions and federal agencies are required to follow the rules set forth for human research under the Common Rule. The Common Rule is a federal regulation governing human research in the United States that requires federally funded scientific research to be subjected to independent review by an institutional review board (IRB), have equitable subject selection, use procedures consistent with sound research design, minimize risks to participants, and obtain informed consent. Informed consent by participants must generally include, among other things, a description of the procedures in the research plan, an explanation of the risks and benefits to the participant, a description of the extent to which confidentiality of records will be maintained, and an explanation of the right to withdraw from the study.111 Currently, whole genome sequence data obtained in the clinical context can be stripped of traditional identifiers and used for research purposes without IRB review or additional consent. This is because whole genome sequence data, when stripped of traditional identifiers (such as name or address), are not considered readily identifiable under the Common Rule.112 The logic behind this is that while whole genome sequence data are unique to an individual, without a key that matches particular data to an identity, one could not readily ascertain which person the whole genome identifies. Similarly, while fingerprints are considered identifiable for law enforcement purposes, a fingerprint with no personal identifying information cannot point to whom that fingerprint belongs. In other words, a fingerprint does not have a name or address encoded directly in it. To discover the suspect’s identity, one must link the print to a database containing both traditional personal identifiers and fingerprints in order to know which person to arrest. Only research that uses data where the identity of the subject is, or may readily be, determined is considered human research under the Common Rule. Research using data stripped of traditional identifiers is not considered human research and therefore does not trigger Common Rule protections such as IRB review or consent. Research using whole genome sequence data that have not been stripped of traditional identifiers (e.g., readily identifiable information) is considered human research. Accordingly, this research is governed by the Common Rule, meaning that IRB approval and informed consent must be obtained or waived by an IRB before the research can occur. HHS recently published an Advanced Notice of Proposed Rulemaking (ANPRM), entitled Human Subjects Research Protections: Enhancing Protections for Research Subjects and Reducing Burden, Delay, and Ambiguity for Investigators, and collected comments on whether some types of genomic data should be considered identifiable. This ANPRM acknowledges that “there is an increasing belief that what constitutes ‘identifiable’ and ‘de-identified’ data is fluid” and that evolving technologies and the increasing accessibility of data could allow deidentified data to become re-identified.113 It also highlights the concern that “advances that have come in genetic and information technologies” might “make complete de-identification of

1996

Presidential Commission for the Study of Bioethical Issues

biospecimens impossible and re-identification of sensitive health data easier.”114 This is an ongoing discussion. A change to the Common Rule pertaining to identifiability could impact the collection and subsequent use of whole genome sequence data.

International Approaches to Regulating Genetic Information The United States is not the only country deciding how best to prevent the misuse of genetic information. No international models yet exist regarding the misuse of and specific protections for whole genome sequence data. Some countries have enacted general privacy laws that encompass personal health information; patient rights’ acts that regulate, among other things, informed consent and confidentiality of medical information; and legislation that specifically regulates genetic information and genetic research. These laws differ from U.S. law, which is focused on prohibiting discrimination resulting from disclosure of genetic information rather than ensuring privacy of genetic information. Many countries and foreign bodies have broad laws that regulate the use of personal information.115 Some of these, such as the European Union’s Data Protection Directive, offer special protection for more sensitive data, including personal health information.116 These privacy laws are far reaching—covering private and public institutions and many types of data—and are often overseen by data commissions or commissioners.117 In addition to these general data protection laws, many countries also have enacted patient rights’ laws that prohibit discrimination and require confidentiality of patients’ health information. These laws often require informed consent for disclosure of personal health information.118 Some of these laws, like those in the United States, also require that patients have access to their own medical records.119 In recent years, some countries have enacted laws specifically regulating genetic information and research. For example, Chile enacted a law in 2006 regulating genetic research that prohibits discrimination on the basis of genetic heritage and requires informed consent for research, confidentiality of genetic information, and anonymization of genetic data.120 Some of these laws allow genetic testing only for individual health reasons or scientific research.121

Legal Protections of Genetic and Whole Genome Sequence Data In light of mounting concerns about genetic privacy at the onset of the Human Genome Project, the U.S. Congress adopted legislation protecting against genetic discrimination. In 2008, Congress passed GINA, which aims to prevent genetic discrimination in the health insurance market (Title I) and in employment decisions such as hiring, firing, job assignments, and promotions (Title II).122 GINA does not protect against discrimination in the context of life insurance, disability insurance, or long-term care insurance. GINA’s protections apply to asymptomatic individuals, not those who have “manifested disease.”123 Nor does it prescribe rules for genetic research.124 GINA also expanded HIPA A privacy protections by applying prohibitions against genetic discrimination to all health insurers.125

Privacy and Progress in Whole Genome Sequencing

1997

“There is certainly more room for legislation about privacy… the Genetic Information Nondiscrimination Act…is only a start. There are many more protections that the patient community would like that are not present in GINA.” Greg Biggers, Council Member, Genetic Alliance; Chief Executive Officer, Genomera. (2012). Genomic Privacy, Data Access, and Health IT. Presentation to PCSBI, May 17, 2012. Retrieved from http://bioethics.gov/cms/node/713.

Under Title I of GINA, all health insurers are barred from: 1) using genetic information to determine coverage, eligibility, or premiums; 2) requesting or requiring genetic testing or genetic information for underwriting decisions; and 3) obtaining genetic information for underwriting purposes.126 Additionally, insurers may not, on the basis of genetic information, impose a preexisting condition exclusion.127 GINA extended HIPAA protections to cover persons purchasing individual, rather than group, health insurance policies.128 GINA substantially expanded protections from genetic discrimination in employment. Under Title II of GINA, an employer with more than 15 employees cannot use an individual’s genetic information when making employment decisions such as hiring, firing, job assignments, and promotions, nor can an employer request, require, or purchase genetic information about an individual employee or family member. Although GINA prohibits specific types of misuse of genetic information by health insurers and employers, it does not address the use of or access to genetic data. In other words, GINA is an anti-discrimination law; it does not provide comprehensive privacy protections. GINA provides a uniform federal law as a floor of protections against genetic discrimination, but also allows for state laws that provide additional safeguards.129 Slightly fewer than half of all U.S. states have laws providing additional protection against discrimination in aspects of life, long-term care, or disability insurance not present in GINA.130 About half of the U.S. states have policies governing genetic privacy. There is a great degree of variation, however, in what protections states afford their citizens regarding the collection and use of genetic data and, similar to the federal level, none have specific prohibitions for whole genome sequence data. Some states protect against the improper collection of genetic material without consent.131 Others protect against the improper disclosure of genetic information (and several of these states’ laws do not specify to whom the disclosure is prohibited, whether to the donor or another party).132 Still others protect against improper retention of genetic information without consent.133 The result of the variation in state laws is that there is no standard or comprehensive approach to the protection of genetic information in the United States, and the level of protection afforded to an individual’s genetic information differs widely from state to state (for more information regarding the diversity of state law genetic protections, see Table 2 and Appendix IV: U.S. State Genetic Laws). The U.S. Supreme Court has not established a constitutional right to informational privacy applicable to whole genome sequence data. Although the Supreme Court has addressed privacy rights of biomedical information in the context of the Fourth and Fourteenth Amendments, there is no case law addressing informational privacy in the context of whole genome sequencing.134 Legal protections might be afforded if individuals have state property rights over their biospecimens, though courts have generally favored scientists over individuals from whom the specimen was taken.135 The most famous case is Moore v. Regents of the University of

1998

Presidential Commission for the Study of Bioethical Issues

California in which the Supreme Court of California held that individuals are entitled to informed consent, but do not maintain property or privacy rights over cells after they have been removed from their body.136 Table 2. Examples of State Genetic Privacy Laws State Arizona AZ Rev. Stat. §122801-4, §20-448.02; 21 Oklahoma Okl. St. § 1175 Hawaii HRS §§ 431:10A-118 Missouri § 375.1309 R.S.Mo. Rhode Island R.I. Gen. Laws §27-1852, 52.3, §27-19-44, 44.1, §27-20-39. 39.1, §27-41-53, 53.1 Vermont V.T. Stat. Ann. tit. 18, §9331 to 9335 Wyoming Wyo. Stat. Ann. §14-2701 to 710 Michigan Mich. Comp. Laws §§ 333.17020, 333.17520

Protections Requires informed consent for genetic testing performed by health care providers, but does not address whether a non-health care provider may collect or analyze genetic material. Provides privacy protections for genetic information obtained from newborns, but does not provide similar protections for adult genetic data. Prohibits disclosure of genetic information by insurers, but does not specify the same for health care providers, nor does it protect against unwanted analysis of genetic material. Prohibits the disclosure of genetic information by persons who hold such information “in the course of business,” but does not address persons who have obtained it for any other reason. Prohibits the unauthorized disclosure of genetic information by insurance companies, but does not prohibit unauthorized disclosure by anyone else who may have access to genetic information.

Prohibits people from performing genetic tests without consent and from disclosing the results of genetic tests without consent, but does not regulate the unauthorized obtaining or retention of genetic information. Prohibits the disclosure of genetic tests for paternity without consent, but does not address any other kinds of genetic tests. Prohibits the performing of a genetic test by a health care provider without consent, but does not address performance of genetic tests by any other party, and does not prohibit unauthorized obtaining, retaining, or disclosure of genetic tests by any party.

State contract law also may provide legal protection if an individual has signed an informed consent document. In the context of genetic databases, researchers and participants can contractually determine who can access or use the data and on what terms, and the penalties for misusing protected information.

Conclusion There is considerable concern in modern society about unauthorized or unintended disclosures of genetic information. While GINA prohibits genetic discrimination in the health insurance and employment contexts, it does not regulate use, access, security, or disclosure of genetic data, and does not specifically address whole genome sequence data or information. State-based privacy laws, consent forms, and IRBs collectively create a patchwork of privacy protections, but they neither comprehensively nor consistently protect the whole genome sequence data of individuals. In an era in which genomic data increasingly are stored and shared using biorepositories and genetic databases, there is little to no systematic oversight of these facilities.

Privacy and Progress in Whole Genome Sequencing

1999

To address the complex privacy and data security issues that arise in this arena, we need each of three robust facets of privacy and confidentiality protections of whole genome sequence data: individual researchers and clinicians; information technology systems; and laws, regulations, and institutional policies. Protection of personally identifiable data requires attention at all three broad facets of responsibilities. Individuals who collect, handle, store, and use data must recognize the ethical imperative of protecting the privacy of persons from whom they collect data. The information technology systems should be designed to protect persons by prohibiting the unauthorized access and release (intentional or unintentional) of identifiable data and protecting databases from intrusion. Laws and policies must protect persons from negative consequences of disclosure of information (e.g., discrimination) as well as enforce accountability and consequences for unauthorized access or disclosure. It is clear that laws and regulations cannot do all of the work necessary to provide sufficient privacy protections for whole genome sequence data. Together with laws and regulations preventing misuse of data, individuals who receive such data have professional ethical obligations to protect the data that go beyond the limitations of the legal protections. Moreover, given how rapidly whole genome sequence technology is changing, it is in some ways preferable to adopt professional guidelines and policies rather than enact additional laws, since professional guidelines and policies are updated far more easily.137 Guidelines and policies also might help those affected consider more deeply the privacy considerations at issue rather than focusing entirely on compliance with the letter of the law.138

SECTION 3. ANALYSIS AND RECOMMENDATIONS For this report on whole genome sequencing, the Commission has been mindful of the five ethical principles set out in its first report, as described in detail in Section 1. These principles for assessing emerging biotechnologies are public beneficence, responsible stewardship, intellectual freedom and responsibility, democratic deliberation, and justice and fairness. The Commission’s principles complement and build upon the Belmont principles of respect for persons, beneficence, and justice. The Commission drew on both sets of principles to develop recommendations that facilitate responsible development of, access to, and use of whole genome sequencing. The Commission focused on the principle of respect for persons by seeking to minimize risks to individuals willing to share their whole genome sequence data. Although individual benefits of whole genome sequencing are emerging, they are more elusive than predicted a decade ago. Many of the benefits anticipated from advances in whole genome sequence research will accrue to society generally through, for example, improved diagnosis and public health resulting from efficient medical treatment. Related privacy risks, however, primarily fall to individuals willing to share their genomic information. Risks might also fall to blood relatives of these individuals who carry similar genomic variants, thereby raising the stakes of privacy concerns in whole genome sequencing compared with most other types of research. Strong privacy protections enable individuals to determine autonomously their preferred level of data and information sharing. When individuals have control and can govern sharing of their data at a level with which they are comfortable, they are more likely to have trust in the research or clinical enterprise, and are more likely to participate and share data, benefiting

2000

Presidential Commission for the Study of Bioethical Issues

society generally. These privacy interests are served by robust informed consent, data security provisions, and systematic oversight. With the above in mind, the Commission identified the following areas for ethical analysis:     

Standards that allow individuals, if they wish, to access and share their whole genome sequence data and information; Security of whole genome sequence data and information and standards of access to and use of whole genome sequence databases; Informed consent to whole genome sequencing in the contexts of clinical care and research; Oversight of collection, storage, access, and use of whole genome sequence data and information; and Distribution of benefits from medical advances resulting from whole genome sequencing.

The recommendations presented in this section apply to individuals and entities that have an interest in, and work with, whole genome sequence data and information, both in the public and private sectors. Whole genome sequence data collected in the clinical setting are indistinguishable from whole genome sequence data collected in the course of research, and data increasingly move back and forth between the clinical and research settings. Ethical principles providing guidance in this area are based on a shared morality. While the implementation of recommendations that follow might be different depending on the entity involved in the collection, storage, access, and use of whole genome sequence data, the ethical issues at stake are the same. The Commission’s recommendations are also based on the fact that whole genome sequence data are inherently unique, meaning there is only one person in the world with that specific sequence. If the identity of the donor is not apparent to the user of the data, that individual is not readily identifiable. However, whole genome sequence data are often most useful when linked with information about physical characteristics, environmental factors, and medical records. These additional pieces of information, in turn, might make whole genome sequence data readily identifiable. The Commission sees promise in the application of information technology to the field of whole genome sequencing. Information technology is able to tailor access to data with a degree of specificity not possible with traditional medical records, potentially making all types of whole genome sequence data more secure. Uses of whole genome sequence data are rapidly evolving, and some of these uses do not fit easily into the current regulatory framework. The Commission, therefore, has crafted its recommendations to call attention to areas where it believes that current laws, regulations, and policies need to be reconsidered to honor applicable ethical principles and ensure that whole genome sequencing is most effectively used to the benefit of society and its individuals.

Strong Baseline Protections While Promoting Data Access and Sharing Whole genome sequencing increasingly is being incorporated into clinical care and research. Presently, numerous national and state policies are in place to guard personally

Privacy and Progress in Whole Genome Sequencing

2001

identifiable health information and records of participation in research.139 These policies should apply to all handlers of the data, from those who collect the data, to researchers, to third-party storage and analysis providers.140 Privacy protection is an essential component of oversight of the use of whole genome sequencing in research and clinical care. Privacy protections should guard against unauthorized access to, and illegitimate uses of, data and information while allowing for authorized users of these data to advance public health. For both ethical and practical purposes, it is important to carefully distinguish between access to, use of, and possession of whole genome sequence data. Access means being able to come in contact with the information, whether physically or electronically. It would be impossible to limit physical access to all sources of whole genome sequence data. We leave behind specimens containing our DNA in myriad public places—by discarding a coffee cup, for example—that could be used to perform whole genome sequencing. (It is more feasible of course to protect electronic access to whole genome sequence data in biorepositories and databases.) While individuals might have abandoned these genomic samples to public access, they nonetheless have a strong interest in whether the data they contain are collected and how they are used. On the other hand, sometimes persons might have authorized access to whole genome sequence data but misuse the information (e.g., by sharing information with a reporter). In certain cases, others simply have no right to know certain things about other people, no matter what they do with the information.141 Unauthorized access to data is not necessarily a problem in and of itself— despite having access to information, one can choose to not use it, and thereby not produce any harm. Misuse of information can therefore be more ethically significant than unauthorized access. Laws and regulations can prohibit unauthorized parties from accessing or misusing whole genome sequence data, but it is impossible to guarantee that this will not occur. Laws and regulations can, however, provide deterrents to inappropriate access or misuse (such as fines), and compensation for the individuals whose data have been inappropriately accessed or misused. Presentations to the Commission also indicated that authorized individuals can use data without having actual possession of those data.142 Technologies are being developed that allow “computational” access to data sets, which allow access and use without the user possessing the data set. In computational access, the data are possessed by a central party, but others can remotely perform analyses (i.e., use) of the data. AN EXAMPLE OF COMPUTATIONAL ACCESS Google, a major internet search engine, has collected data from its customers’ internet activity. Google views these data as a commercial asset and does not share possession of them. However, Google tools, such as Google Correlate and Google Trends, allow users to query Google’s collected data. A user can search for “stapler” to ascertain whether stapler and staple sales correlate, but users receive only the answer to their question (not access to the data mined by Google yielding the result). By using computational access, Google can give users access to answers, but not access to the data. Source: Google. (n.d.). Google Trends. Retrieved from http://www.google.com/ trends/.

2002

Presidential Commission for the Study of Bioethical Issues

Developments in the science of whole genome sequencing, which are progressing quickly, will require ongoing ethical consideration and democratic deliberation. Individuals and groups have differing sensibilities toward the privacy and publicity of whole genome sequence data, which might be relevant to distinguishing between acceptable and unacceptable uses of data. Perceived misuses of whole genome sequence data vary between cultures and individuals. For example, some individuals might be open to having a secondary researcher use his or her whole genome sequence data for an ancestry study. Members of the Havasupai tribe, on the other hand, strongly disapproved of their samples being used in ancestry studies, because these studies contradicted their traditional origin beliefs.143 Some parents do not object to using Guthrie card newborn blood screening spots in future research without consent. Notable lawsuits in Minnesota and Texas, however, have indicated that some parents feel otherwise.144 Requiring consent for future uses of readily identifiable whole genome sequence data, and encouraging consent for future uses of any data, are important to appropriate use. However, it is difficult to consent to all specific future uses in rapidly advancing scientific technology. While privacy and confidentiality remain imperatives for protecting whole genome sequence data, it is also important to recognize that the American public, generally speaking, has become more open about communicating their health information. The development of online resources and communities reflects a shift in societal notions of what data should remain private (regardless of whether individuals would want to make it public). People now freely share information that was once considered inherently private or not suitable to be shared with a broad audience. The arrival of whole genome sequencing in health care has coincided with an era of greater openness about diseases that used to carry social stigma, such as HIV/AIDS, cancer, and mental health conditions. Many patients may choose to publicly share their stories, although others might not for privacy reasons. Social attitudes about privacy are changing. There have been shifts not only in what information is considered private but also in how entities can realistically be expected to protect that privacy. Technological advances can trigger the creation of new privacy policies, such as the National Institutes of Health’s (NIH) updated genome-wide association study policies.145 While policy makers continue to focus on genetic non-discrimination policies that protect those whose privacy has been compromised, they have also begun to focus on data security policies that protect the data in the first place.146 Finally, informed consent practices increasingly acknowledge that absolute privacy cannot be guaranteed.147 Policies likely will evolve as notions of privacy continue to change. Future policies need to be flexible so that they can adapt to such advances in data security and information technology.

Recommendation 1.1. Funders of whole genome sequencing research; managers of research, clinical, and commercial databases; and policy makers should maintain or establish clear policies defining acceptable access to and permissible uses of whole genome sequence data. These policies should promote opportunities for models of data sharing by individuals who want to share their whole genome sequence data with clinicians, researchers, or others. Strong baseline privacy protections require a spectrum of policies starting with data handling through the protection of persons from future disadvantage and discrimination arising from misuse of their whole genome sequence data. It is critical, however, to ensure that privacy regulations allow individuals to share their own whole genome sequence data with clinicians, researchers, and others in ways that they choose.

Privacy and Progress in Whole Genome Sequencing

2003

Policy makers should also revisit efforts to strengthen protections against, and sanctions for, discrimination by treating the Genetic Information Nondiscrimination Act as a floor, not a ceiling, of protection. For example, because GINA does not cover symptomatic persons or address discrimination in life, disability, or long-term care insurance, persons with genetic diseases and predispositions are vulnerable to discrimination.148 Advances in information technology should be pursued that promote appropriate use of whole genome sequence data while safe-guarding access to data files. For example, computational models that limit access to data files without preventing researchers’ ability to analyze these data can be a valuable tool to protect privacy. DATA PROTECTIONS THAT MOVE WITH THE DATA The President’s Council of Advisors on Science and Technology advocates a “tagged data element approach [that] allows for a sophisticated, fine-grained model of implementing strong privacy controls (including honoring patient-controlled privacy preferences where applicable) and strong security protection.” This approach encourages privacy protections to move with the data across institutions, as opposed to changing protections based on the handler. Source: President’s Council of Advisors on Science and Technology. (2010, December). Report to the President Realizing the Full Potential of Health Information Technology to Improve Health care for Americans: The Path Forward, p. 52. Retrieved from http://www.whitehouse.gov/ sites/default/ files/microsites/ostp/pcast-health-itreport.pdf.

Last, policies regarding access to and use of data should take into consideration varying cultural, ethnic, and racial views about what might or might not constitute a misuse of data.149 Currently, about half of the U.S. states have laws or regulations governing genetic privacy that outline illegitimate uses of these data. However, there is tremendous variation in these laws. In some instances, it is difficult to determine whether a state prohibits surreptitious testing of genetic material from an unwilling donor because of unclear language in the statutes. Some states prohibit unauthorized acquisition or analysis of genetic information, while others prohibit only unauthorized disclosure (and it is often unclear to whom disclosure is prohibited). Some laws at the state level encompass all genetic information, while others address only healthrelated information, or information obtained or used in particular settings (e.g., employment or insurance discrimination).150 Therefore, whether genetic testing or whole genome sequencing without the consent of the donor is prohibited can depend on a combination of factors: who conducts the test, to whom the DNA belongs, what the test attempts to determine, how the results will be used, and in what state the testing takes place.151 Moreover, no states have laws or regulations specific to whole genome sequence data; some states have laws that include the words “DNA” and “genetic,” although it is unclear whether these laws might be interpreted to cover whole genome sequence data and information. Some of the topics specified in existing genetic laws could be used for whole genome sequencing laws as well. Types of regulations that would translate effectively into genomic protections include those regarding: 

Defining restrictions on what information can be stored in a biorepository, biobank, or genomic research database;

2004 



Presidential Commission for the Study of Bioethical Issues Sharing of whole genome sequencing data, and if clinical data are shared with researchers, what type of information can be shared (e.g., stripped of traditional identifiers or not), and penalties for violations; and Using whole genome sequence information for life, disability, or long-term care insurance.

When individuals are asked about their concerns with respect to online health information, most focus on illegitimate uses of the data. They also cite discrimination, such as unauthorized use by insurers or employers, or use of their data for marketing purposes.152 However, the existing patchwork of state protections—with some states having no laws and the others having an inconsistent potpourri of legal prohibitions—does not protect all individuals from unauthorized uses. These uneven protections might also affect the development of trust in contexts where individuals are asked to share their whole genome sequence data for the public benefit in the course of research, clinical care, or commerce. Like all medical information, whole genome sequencing data should be ensured baseline privacy protections in all jurisdictions.

Recommendation 1.2. The Commission urges federal and state governments to ensure a consistent floor of privacy protections covering whole genome sequence data regardless of how they were obtained. These policies should protect individual privacy by prohibiting unauthorized whole genome sequencing without the consent of the person from whom the sample came. Currently federal and state laws protect data dependent on who collected them (i.e., a clinician, researcher, or consumer). Although a whole genome sequenced in the clinic is the same as a whole genome sequenced during research, data collected in the course of clinical care are governed by the Health Insurance Portability and Accountability Act, while data collected in the course of research are governed by the federal Common Rule for human research. The exact same data are treated differently depending on who collected the sample. Clinical data are collected to benefit the patient, while research data are collected to advance science and health care generally. However, the blurring of clinical and research lines, particularly in the field of whole genome sequencing, compels reconsideration of the differences between how clinical and research data are protected. In addition, while the requirement for consent to whole genome sequencing is regulated in the clinical and research contexts (depending, to some extent, on whether or not traditional identifiers—such as name, address, or social security number—are attached to the sample), commercial genetic testing has opened a new loophole in privacy protections. One can now pick up a discarded coffee cup and send a saliva sample to a genetic testing company.153 The potential consequences of unauthorized surreptitious testing could be profound (e.g., revealing disease risks to sway the disposition of a custody battle).154 There are, of course, exceptions to this need for consent, such as use for legitimate law enforcement purposes. The Commission therefore recommends the prohibition of “unauthorized” whole genome sequencing—a term intended to carve out an exception for legitimate law enforcement. Data protections should be tied to the nature of the data, not who collects them. Widely shared norms of justice and fairness dictate that similar kinds of data should be treated in similar ways, no matter in which state or health facility they are sequenced. If protections are inherent to the data, they should follow the data and dictate appropriate use. For example, meta-data

Privacy and Progress in Whole Genome Sequencing

2005

tags could be used to encode the level of security protections required for the data file and elements of consent (e.g., these data can/cannot be used in reproductive research). Using this approach, data will receive appropriately consistent use protections throughout their life span. More consistency in state protections of genetic and genomic data could also enhance privacy. Treating like data alike is crucial to ensuring consistent protections for whole genome sequence information across the United States. Although states should enact genomic policies that are most relevant and important to their constituents, bringing such protections to a minimum standard that addresses privacy—while still allowing individuals to share their own data—would provide just and fair protections regardless of where one happens to reside. Because the options for implementation of such protections are unclear, the Commission recommends that experts in federal law, state law, policy, and privacy be brought together to engage in further democratic deliberation regarding acceptable access to and permissible use of whole genome sequence data. The Commission will consider following up with stakeholders regarding: 1) suggested requirements to ensure a floor of protection of whole genome sequence data and data sharing in all states; and 2) the practical steps necessary to accomplish this goal, such as federal, state, or non-regulatory interventions.

Data Security and Access to Databases Respect for persons requires honoring data privacy. Data privacy requires data security. Data security requires ethical responsibility and accountability from all those who handle whole genome sequence data and information. It must further be supported by policies and infrastructure to protect safe sharing of data. Authorized users must have access to whole genome sequence databases to conduct research and make advances that will contribute to improved medical diagnostics and treatment for all. Security should allow only authorized individuals to access these data. However, breaches of unsecured protected health information have been publicized in the past, and can cause patients and research participants to doubt the security of their data. Unsecured health information can be accessed by unauthorized persons through means such as the loss or theft of unencrypted information on data storage devices, hacking of network servers, unauthorized disclosure, or improper disposal of paper records.155 In a recent case, the unencrypted health information of over 800 patients was inadvertently embedded in PowerPoint presentations that were posted online.156 In light of the possibility of data security breaches, it is important to address misuse of whole genome sequence data rather than wholly relying on preventing unauthorized access to these data. “Technology can help save privacy, it can change your thinking, whether [it is] with respect to setting norms, [or] whether [it is] with respect to changing the way you set up the platform so that the platform can do more [computational] analysis… versus sharing the data around.” Latanya Sweeney, Visiting Professor and Scholar, Computer Science Director, Data Privacy Lab, Harvard University. (2012). How Technology is Changing Views of Privacy. Presentation to PCSBI, August 1, 2012. Retrieved from http://bioethics. gov/cms/node/748.

2006

Presidential Commission for the Study of Bioethical Issues

When told of data hacking, some assume that the transition of private information to an electronic format makes it less safe. Quite the opposite might be true. In many respects, advances in information technology can be used to strengthen data security. For example, electronic files bear marks of who accessed them and when, allowing for more fine-tuned file tracking than is possible with paper records that may be surreptitiously accessed without a trace. In addition, current technology allows data files to be analyzed without the need to export the data files to other networks, that is, computational access can be allowed without data transfer. Even when individuals are willing to share their readily identifiable data and information for use in research, they might not want copies of their information saved on computers around the world. Access to and sharing of data files do not have to be one and the same. The Commission supports ongoing exploration and development of a set of best practice models that separate possession of, access to, and use of data.157

Recommendation 2.1. Funders of whole genome sequencing research; managers of research, clinical, and commercial databases; and policy makers should ensure the security of whole genome sequence data. All persons who work with whole genome sequence data, whether in clinical or research settings, public or private, must be: 1) guided by professional ethical standards related to the privacy and confidentiality of whole genome sequence data and not intentionally, recklessly, or negligently access or misuse these data; and 2) held accountable to state and federal laws and regulations that require specific remedial or penal measures in the case of lapses in whole genome sequence data security, such as breaches due to the loss of portable data storage devices or hacking. Absolute privacy, many observe, is not possible in this as in many other realms. The greater potential for harm is not by virtue of authorized others knowing about one’s whole genome make-up, but rather through the misuse of data that have been legally accessed.158 For example, a clinician with a celebrity client would have legally authorized access to their client’s whole genome sequence data for purposes of providing clinical care, but could not then sell that information to a tabloid. Researchers, clinicians, and others authorized to access whole genome sequence data should be guided by professional ethical standards so that they do not intentionally or inadvertently misuse these data. In the event that data are mishandled or lost, those responsible should be aware of federal and state policies that require specific remedial actions, such as the requirement under the Health Information Technology for Economic and Clinical Health Act Breach Notification Rule to report breaches to the Department of Health and Human Services within the required number of days.159 Those persons authorized to access whole genome sequence data should take part in regular training sessions to remain current on regulations governing whole genome sequence data privacy and security. Public and private entities have different policies governing access to whole genome sequence databases by those seeking to use data for purposes other than that for which they were originally collected. Some policies create absolute prohibitions on releasing data to outside parties and associated penalties for violation, and some are more flexible, relying on the discretion of the person who holds the data.160 Certificates of Confidentiality, for example, permit but do not require investigators to refuse access to research data by law enforcement officials and others.161 The use of Certificates of Confidentiality however, is limited; one study found that only 114 (0.04 percent) of 27,000 funded studies secured such a certificate.162

Privacy and Progress in Whole Genome Sequencing

2007

Although empirical data on the use and effectiveness of these forms of privacy protection are not robust, scholars have questioned the strength of these protections, how well understood these protections are, and how they affect research participation.163 Besides researchers, parties who might be interested in accessing information already compiled in whole genome sequence databases and biorepositories include law enforcement officials and marketing agencies. While commercial advertising can be a valuable tool in educating at-risk populations, this technique is often viewed as invasive when used as a way to sell products, for example, to selectively market a statin to someone with a genomic predisposition to high cholesterol.164 In order to establish and maintain trust between members of the general public, clinicians, and the scientific research community, strong whole genome sequence data protections must be in place to secure data. Further, these limits on access must be communicated to those giving consent to have their whole genome sequenced in clinical, research, or consumer-initiated settings. Obtaining a whole genome sequence data file by itself yields information about, but does not definitively identify, a specific individual. The individual still has “practical obscurity,” as his or her identity is not readily ascertainable from the data. Practical obscurity means that simply because information is accessible, does not mean it is easily available or interpretable, and that those who want to find specific information must expend a lot of effort to do so. While some experts might be able to determine an individual’s hair color or specific cancer risk from whole genome sequence data (a file of 6 billion As, Cs, Gs, and Ts), these data are not interpretable by the vast majority of individuals. In addition, even if we know that a whole genome sequence is from one individual, we cannot know which of the over 7 billion people on Earth that person is without a key linking the whole genome sequence information with a single person or their close relative. Therefore, while whole genome sequence data are uniquely identifiable, they are not currently readily identifiable. Traditional identifiers have been stripped from samples or data in the clinical and research setting to mitigate the possibility of risks to the individual from whom the samples came. Removing traditional identifiers from samples and data can allow for research on samples previously collected for different purposes, deter users from illegitimately identifying individuals, and minimize the risk that users might recognize individuals and use this information subconsciously in their daily life.

Recommendation 2.2. Funders of whole genome sequencing research; managers of research, clinical, and commercial databases; and policy makers must outline to donors or suppliers of specimens acceptable access to and permissible use of identifiable whole genome sequence data. Accessible whole genome sequence data should be stripped of traditional identifiers whenever possible to inhibit recognition or re-identification. Only in exceptional circumstances should entities such as law enforcement or defense and security have access to biospecimens or whole genome sequence data for non health-related purposes without consent. The consent process should communicate limits on access and use to those having their whole genome sequenced in clinical care, research, and consumer-initiated contexts. These policies should apply to the original recipient of the data, as well as to all parties who work with the data, from those who collect the sample or data to third-party storage and analysis service providers.

2008

Presidential Commission for the Study of Bioethical Issues

An existing policy that could serve as a model is the Agency for Healthcare Research and Quality’s confidentiality statute.165 This statute was put in place to foster participation in research and provides a respected form of statutory protection for all identifiable data submitted to the Agency for Healthcare Research and Quality for research. The statute covers AHRQ, its grantees, and contractors. The statute also defines strict penalties for individuals who use these data for non-consented purposes. Whole genome sequencing and related analyses generate enormous data sets. As of March 2012, the 1000 Genomes Project contained the sequence data of 1,700 people. The project database contained 200 terabytes of data, or the equivalent of 30,000 standard DVDs. This data set is a tremendous resource for biomedical researchers. At the same time, these data might not be useful to medical scientists and researchers without the computing power required to work with such a large data set. Exploring options for making these data available to qualified researchers is critical so that innovation and research are not slowed simply because researchers’ computer networks cannot store these large data files. “The explosion of biomedical data has already significantly advanced our understanding of health and disease. Now we want to find new and better ways to make the most of these data to speed discovery, innovation, and improvements in the nation’s health and economy.” NIH Director Francis S. Collins, M.D., Ph.D., in a press release announcing the movement of the 1000 Genomes Project data set to the Amazon Web Services cloud. Retrieved from http://www.nih.gov/ news/health/mar2012/nhgri-29.htm.

The question of how best to handle large data sets has gained attention throughout the government. The federal Office of Science and Technology Policy recently announced a “Big Data Research and Development Initiative,” with the goal of “improving our ability to extract knowledge and insights from large and complex collections of digital data.”166 Six federal departments and agencies are part of the initiative. This initiative includes NIH, which recently made its 1000 Genomes Project public data set available on the Amazon Web Services cloud. NIH now expects that researchers can access and analyze the data at a fraction of the cost it would take to establish the computing capacity at their own institution.167 Making whole genome sequence data accessible to researchers and clinicians is a promising step toward advancing medicine for the betterment of society. Moving data to thirdparty storage and analysis service providers, however, complicates the protection of individual data. When data are moved to third parties, an expanded range of data handlers and administrators have access to the data. Currently, a wide range of federal regulations govern the conduct of entities that handle protected health information.168

Recommendation 2.3. Relevant federal agencies should continue to invest in initiatives to ensure that thirdparty entrustment of whole genome sequence data, particularly when these data are interpreted to generate health-related information, complies with relevant regulatory schemes such as the Health Insurance Portability and Accountability Act and other data privacy and security requirements. Best practices for keeping data secure should be shared across the industry to create a solid foundation of knowledge upon which to maximize public trust.

Privacy and Progress in Whole Genome Sequencing

2009

Whole genome sequence data not stripped of traditional identifiers are considered “protected health information” and are covered under the HIPAA Privacy, Security, and Enforcement Rules and the Common Rule. The same regulations, policies, and ethical guidelines that protect such health information should also be in place to govern the sharing of whole genome sequence data with third-party storage and analysis service providers (those otherwise not considered covered health entities under HIPA A). Entities within the public and private sectors have developed a range of practices for protecting privacy. For example, the National Institute of Standards and Technology, the Office of the National Coordinator for Health Information Technology, and the Office for Human Research Protections are developing policies concerning access to and use of data by third parties. The National Institute of Standards and Technology recently released guidance on “Security and Privacy in Public Cloud Computing” and the Office of the National Coordinator for Health Information Technology worked to strengthen protections of identifiable health information handled by third parties.169 Also, the Office for Human Research Protections issued guidance on research with coded private information or biological specimens.170 Parties from the public and the private sectors should share their lessons learned to promote efficiency and avoid duplicating efforts. Because of the expansive potential of information technology, special attention should be paid to those practices that leverage information technology to protect privacy. In order for the public to benefit as much as possible, best practices across the industry should be shared to ensure the privacy and security of whole genome sequence data and best gain the trust of those who have their whole genome sequenced in research, clinical, and consumer-initiated contexts. These best practices should include encrypting stored data and storing data without traditional identifiers when possible. Even when data are being accessed and used with informed consent, persons who access the data should be responsible and accountable for protecting the privacy of individuals and the confidentiality of the data. Respect for persons requires that these and other privacy protections do not become a competitive advantage for certain parties but rather serve, in both appearance and reality, as a reliable standard of individual protection.

Consent Although not unique to whole genome sequencing, a well-developed, understandable, informed consent process is essential to ethical clinical care and research. Conveying the complexities of whole genome sequencing to an individual, however, is likely more difficult than for the average diagnostic test. To make the issue more complex still, informed consent documents are often overly legalistic and written at a reading level beyond the capacity of the average research participant.171 Studies have demonstrated varying levels of comprehension of consent documents, including reports of persons signing consent forms who are later either unable to recall whether they signed a consent form or describe to what they had consented.172 To educate participants thoroughly about the potential risks associated with whole genome sequencing, the consent process must include in format ion about what whole genome sequencing is; how data will be analyzed, stored, and shared; the types of results the patient or participant can expect to receive, if relevant; and the likelihood that implications of some of these results might currently be unknown, but could be discovered in the future. As per usual consent protocol, permission to perform whole genome sequencing for a person who cannot

2010

Presidential Commission for the Study of Bioethical Issues

consent for him or herself should be obtained from an informed, legally authorized representative. “How does consent change when a person lacks genetic health literacy, [or] when the health condition does not yet exist, but is a future probability, and some of those may be non-treatable conditions? When a health condition does not have implications for you, but it does for your offspring, what are the terms of consent there, especially if your offspring have different views about what they want to know about genetics, and then lastly, for these incidental findings versus disease specific testing..? I’ll just leave you with those questions, as the first of many that you will engage.” Daniel Masys, Affiliate Professor, Biomedical and Health Informatics, University of Washington School of Medicine. (2012). Ethics and Practice of Whole Genome Sequencing in the Clinic. Presentation to PCSBI, February 2, 2012. Retrieved from http://bioethics.gov/cms/node/658.

Consent documents differ between research and clinical care. Research informed consent documents are often long and contain n elements such as a summary of the research, future uses of data, the option to opt out, potential risks of participation, conditions of compensation in case of injury, and potential benefits to the individual. Clinical consent documents contain some of the same elements but generally are shorter than, and not as detailed as, research consent forms. In fact, oral consent might be sufficient for low-risk clinical procedures. The reason clinical consent is less comprehensive is because clinical procedures are done for the direct benefit of the patient and thus pose less of a risk of conflicting interests. More substantive clinical written consent is required, however, for higher-risk procedures, such as those expected to produce pain, require anesthesia, or have a significant risk of complications. In the research world, public opinion polls have found that individuals believe that being asked for consent throughout the course of research with their specimens or data would make them feel “respected and involved.”173 Informed consent involves an autonomous decision to participate in research that results from a communication process between researchers and prospective research participants that describes the research and explains the risks and benefits associated with enrolling in the study. Respect for persons dictates that individual consent should be well-informed and honored, regardless of a person’s specific privacy preferences. Clinical written consent documents for whole genome sequencing need not be as detailed as research consent documents, but these documents should still adequately explain whole genome sequencing and its potential impact upon privacy interests. A clinician should not frame whole genome sequencing as “just another type of blood test.” Consent procedures for clinical whole genome sequencing should build on those consent procedures already in place for discrete genetic tests. In the clinical context, as in research, individuals being asked to consent to whole genome sequencing should understand the volume of data and information to be generated, as well as the risks, benefits, and implications of the results of whole genome sequencing. The Common Rule states that data and specimens collected in the clinic, when stripped of traditional identifiers, can be used in research without consent. Because consent requirements differ in clinical and research settings, researchers could theoretically seek out data and specimens collected in the clinic to bypass the more involved research consent requirements.

Privacy and Progress in Whole Genome Sequencing

2011

While it is acceptable to use clinical data and specimens in research, the Commission does not condone researchers circumventing Institutional Review Board approval by seeking out clinical data and specimens for use in research when they could not otherwise obtain IRB approval. Whole genome sequencing involving minors raises additional ethical quandaries even when permission is properly obtained from an informed, legally authorized representative. First, federal privacy laws inconsistently define the age of consent—for the most part, the age of consent is 18 years old in the United States, yet in health care for certain contexts (e.g., mental health, contraception, or substance use), state laws allow consent by minors as young as age 14.174 Second, the potential future risks raised by the current unknowns of whole genome sequencing are compounded in children who will see advancement in the science during their lifetime. While the function of all genes is not currently known, researchers will continue to determine the function of more genes, and could feel compelled to re-contact these children, as adults, with results that they are not prepared to receive or do not want. Third, whole genome sequence data obtained from a minor already could have been widely shared before the minor reached an age at which they could determine preferred data sharing limits themselves, thereby decreasing their autonomy. Whole genome sequencing in children, therefore, raises a number of unique issues with regard to fully informed decision making.175 Some commentators are concerned that participants enrolled in research that requires especially large data sets, and who are given too much control over their data, will stifle the production of public benefits, such as improvements in clinical care, comparative effectiveness research, and epidemiological studies.176 If individuals can choose not to participate in certain types of studies, the amount of data available to clinicians and researchers upon which to base their conclusions will be limited to some extent. A range of consent frameworks are available that offer participants varying levels of control over their data. Most of these frameworks fall into four categories: 1) broad; 2) narrow; 3) tiered; and 4) participant-centric or dynamic approaches. Under broad consent, individuals are given the option to opt in or opt out of general, and often yet to be determined, future uses of their data. Narrow consent usually states that data will be used only by the research team carrying out a specific study or for a specific treatment in the clinic. Tiered consent processes allow individuals to specify acceptable and unacceptable uses of their sample and data at the outset of research. “We also, as a research community, need to get used to the fact that there are patient-driven research objectives now and [patients] are coming together to do [research].” Laura Lyman Rodriguez, Director, Office of Policy, Communications, and Education, National Human Genome Research Institute. (2012). Protection of Private and Public Genomic Databases. Presentation to PCSBI, August 1, 2012. Retrieved from http:// bioethics.gov/cms/node/749.

Other consent models use computer-based participant-centered consent processes, which generally give participants freedom to determine their specific data sharing preferences up front, with some allowing participants to monitor and modify their preferences on an ongoing basis through a computer interface.177 One prototype that has been implemented by a group called Consent to Research allows users to “attach” consent to the data they donate, and any researcher who can accommodate the provisions of that consent can use those data.178 Alternatively, as databases become more technologically flexible, those donating biospecimens

2012

Presidential Commission for the Study of Bioethical Issues

can express preferences at the outset about permissible and impermissible uses that can be respected by future users of whole genome sequence data. Further, sample donors could electronically update their consent to encompass proposed new studies, with minimal hassle to the donor or the researcher. These models, however, can only be used by participants who have computer and internet access. Some data have been collected on participant views of consent forms for biorepository research. Biorepository specimens and data files can be collected in clinical or research settings, and include (among other things) medical waste, newborn blood spot cards, and biopsy specimens. In one pair of studies, when asked about an opt out consent process, over 90 percent of participants agreed or strongly agreed that “DNA biobank research is fine as long as people can choose not to have their DNA included.”179 Another study found that, despite privacy concerns, 60 percent of individuals surveyed would participate in a genetic biorepository, 48 percent of whom would prefer broad consent, while 42 percent would prefer project-specific consent with re-consent for each project.180 These studies indicate that the majority of individuals enrolled in research are willing to share their data when asked, and the limited data available suggest that individuals vary widely across this spectrum of preferred form of consent.181 More research is needed, however, including on minority and marginalized populations where research participation is not as high. The Common Rule, which governs most human research in the United States, requires that research consent be informed. Consent may be waived in some circumstances, and research with samples or data that are not readily identifiable is not considered human research (and thus does not fall under the Common Rule). Blanket authorization for all future uses of identifiable data, known and unknown, at the outset of a research study cannot legally satisfy the current requirements for informed research consent. However, the Common Rule Advanced Notice of Proposed Rulemaking (ANPRM) proposes a broad consent requirement that would give participants the opportunity to say “yes” or “no” to all future research uses of their data and specimens at the outset of research.182 The ANPRM also proposes that individuals could designate special categories of research in which they would not want their samples included, for example, reproductive research. By giving individuals the option to not participate in research to which they object, these individuals are respected as persons. Moreover, the option to not participate in a set of specific categories of research that one finds objectionable might actually encourage broader participation in research. Broad consent at the outset of research might be a more practical solution than re-consent, or obtaining informed consent from every donor for a new use. Re-consent is difficult or, in some cases, impossible, as individuals frequently change residences, clinicians, phone numbers, and email addresses. Researchers also maintain that obtaining consent for each future study is burdensome and could hinder research.183

Recommendation 3.1. Researchers and clinicians should evaluate and adopt robust and workable consent processes that allow research participants, patients, and others to understand who has access to their whole genome sequences and other data generated in the course of research, clinical, or commercial sequencing, and to know how these data might be used in the future. Consent processes should ascertain participant or patient preferences at the time the samples are obtained.

Privacy and Progress in Whole Genome Sequencing

2013

Respect for persons requires obtaining fully informed consent at the outset of treatment or research. The informed consent process should cover the current proposed use of individuals’ data, convey who might have access to their data, and explain potential future uses of these data, as well as what research results and incidental findings, if any, will be returned to the patients or participants. Some patients might be surprised to discover that their whole genome sequence data obtained in the clinic could be used for research in the future without additional consent. With the blurring of the line between clinical care and research, data may be shared back and forth to improve clinical diagnosis and treatment.184 Patients in the clinic should thus be explicitly informed that their whole genome sequence data could be used in research. When possible, individuals should be given the option to withhold their data from certain types of future research to avoid inadvertent complicity with research goals to which they are opposed. The Commission acknowledges the complexity of integrating individual options into the research enterprise, but if a framework is in place that accommodates identifying specific participant preferences at the time of enrolling in research, such as proposed in the ANPRM, these preferences should be honored.185 As long as consent processes are equivalently effective in informing individuals about what they are consenting to, and as long as they do not unduly shape or undermine individuals’ ability to make genuinely voluntary choices, there is no philosophical or ethical imperative to use one kind of consent process over another. In cases where the public stands to benefit from an activity and the research consent is fully informed and consistent with the ability to make autonomous choices, it might be advantageous to use consent processes that make it easier for individuals to participate—but most definitely not “trick” them into participating—at higher rates. In other words, the most important issue in consent is not the type, but rather that the consent is properly informed and consistent with voluntary choice. Opt in consent policies assume that the default is not to go forward with some proposal, such as to consent to whole genome sequencing; the individual must actively consent to the proposal in order for anything to happen. Opt out consent means that, in the absence of a refusal, the default is participation, which tends to encourage higher rates of participation, a result particularly supportive of the public value of scientific and medical research that is otherwise ethically and legally sound. BIOVU: AN OPT OUT DATABASE Vanderbilt’s BioVU database, which has collected DNA samples from almost 150,000 individuals, is an opt out database. Unless patients check a box indicating that they do not want their DNA in the BioVU database, their samples are included. In this way, BioVU is able economically to collect a large number of samples. To protect the data in its database, the samples are coded before being entered in the database. The computer system can match the DNA with information in medical records, but researchers working with the data do not know to whom the data belong. Data are stripped of identifiers before being shared with secondary researchers. Vanderbilt University Medical Center. (2012). Vanderbilt BioVU. Retrieved from http://www. vanderbilthealth.com/main/25443.

2014

Presidential Commission for the Study of Bioethical Issues

Organ donation policies in Europe provide an example of opt out consent procedures. Austria, France, Hungary, Poland, and Portugal have opt out organ donation polices and all have organ donation consent rates above 99 percent.186 The United States, on the other hand, uses an opt in system. Polls show that about 90 percent of Americans support organ donation, but only about 44 percent of people in the United States opt in to be organ donors.187 This indicates that where Americans’ values dispose them in favor of consent to organ donation, the often cumbersome and anxiety-inducing procedures of an opt in policy make them reconsider, passively resist, or fail to follow through with the extra steps (like filling out extra forms) required to opt in.188 With some exceptions, federally funded research studies are required by law to obtain informed consent from all individuals enrolled in research or from their legally authorized representative.189 The informed consent document is one component of the informed consent process. Current federal regulation requires that informed consent documents include, among other things, a description of the procedures in the research plan, an explanation of the risks and benefits to the participant, a description of the extent to which confidentiality of records will be maintained, and an explanation of the right to withdraw from the study. By regulation, research participants can withdraw from research to which they consented at any time for any reason. However, complete destruction of whole genome sequence data is likely impossible. Although physical biospecimens and data files stored by the primary researchers can and will be destroyed at the time of withdrawal according to guidelines laid out in consent documents, the destruction of distributed copies of associated data files may not be feasible as distributed genome sequence data files can be stored on local computers or network servers. Therefore, those conducting whole genome sequencing research might not be able to promise complete withdrawal from a study.

Recommendation 3.2. The federal Office for Human Research Protections or a designated central organizing federal agency should establish clear and consistent guidelines for informed consent forms for research conducted by those under the purview of the Common Rule that involves whole genome sequencing. Informed consent forms should: 1) briefly describe whole genome sequencing and analysis; 2) state how the data will be used in the present study, and state, to the extent feasible, how the data might be used in the future; 3) explain the extent to which the individual will have control over future data use; 4) define benefits, potential risks, and state that there might be unknown future risks; and 5) state what data and information, if any, might be returned to the individual. Each government agency has its own enforcement authorities to protect research participants. For example, the Office for Human Research Protections has jurisdiction over human research conducted or supported by HHS, the Central Intelligence Agency has a Human Subject Research Panel, and the Department of Veterans Affairs uses a combination of Research Compliance Officers and its Office of Research Oversight. All these agencies should work together as each agency develops clear and consistent guidelines for their informed consent forms, enabling an individual to make a fully informed decision to participate in research. Looking forward, clinical consent documents for whole genome sequencing will have to address a number of issues specific to whole genome sequencing: an explanation of the science, what types of results will be produced through whole genome sequencing, and whether whole

Privacy and Progress in Whole Genome Sequencing

2015

genome sequence data collected for clinical applications will be made available for research purposes. Further, whole genome sequence data can provide information about many conditions, not just the condition under study. Acknowledging this, informed consent documents for studies involving whole genome sequencing should include which (if any) research results and incidental findings will be returned to individuals.190 “Now, on the other side of the ledger…are the findings… which the patient is not expecting…which are going to have a dramatic impact of known consequence to them, and then the set of things for which there is much less certain impact.” Richard Gibbs, Wofford Cain Professor, Department of Molecular and Human Genetics; Director, Human Genome Sequencing Center, Baylor College of Medicine. (2012). Ethics and Practice of Whole Genome Sequencing in the Clinic. Presentation to PCSBI, February 2, 2012. Retrieved from http:// bioethics.gov/cms/node/658.

In whole genome sequencing, many individuals might want, and even expect, access to data or results.191 From the perspective of many individuals, the inability to receive or access their data denies them a fundamentally important sense of control over information about their own genomic makeup. While some individuals wish to share their data broadly for the advancement of science, others want control over their data to maintain their privacy, control information shared with intimate relations, or protect their right not to know results that might be discovered during whole genome sequencing. Individuals who seek return of data or results often feel that if someone else knows something unique about them, such as their risk for a particular disease, they ought to know it as well.192 On the other hand, some experts have said that although participant or patient preferences should be considered in the return of results, individual preferences are not a sufficient reason for agreeing to return results because of the importance of ensuring that the results are accurately communicated to individuals. These experts argue that the decision of whether to return incidental findings and other data should be in the hands of those who can more fully understand the broad implications of returning those findings, and what needs to accompany the return of raw results. They call for criteria to be developed, for example, by return of results committees.193 There are, of course, reasons within our current research systems for not returning research results to individuals enrolled in research studies as well. First, by current law, only sequencing results from Clinical Laboratory Improvement Amendments (CLIA) compliant laboratories may be returned to individuals.194 This requirement came about in the 1980s as a result of stories in the media that raised concerns about the quality of laboratory results, especially the return of false-negative Pap smear results.195 This attention catalyzed the passage of CLIA in 1988, designed to improve quality and consistency in clinical laboratory testing. CLIA made it illegal to return to patients clinical results generated in a non-CLIA-certified laboratory.196 Currently, most research is not conducted in CLIA-certified laboratories, including those laboratories performing whole genome sequencing.197 In addition, researchers leading projects that are producing whole genome sequence data might not be qualified or trained to return sensitive, potentially devastating results directly to individuals, nor are grants usually structured to hire someone with the appropriate qualifications to do so.

2016

Presidential Commission for the Study of Bioethical Issues

Ethical analysis of whether and how individual research results and incidental findings should be returned is ongoing, and these questions are currently the subject of wide-ranging debate.198 Many agree that participants should have the option to opt out of receiving research results and data from a study. There is less consensus on what should be done in cases where individuals want to receive incidental research results and data but, for example, researchers or clinicians did not themselves collect the information, are not trained in interpreting incidental results, did not perform the sequencing in a CLIA-approved lab, or have no prior knowledge of or relationship to the individual to appropriately convey the results. Alternatively, in some cases, investigators might feel personally obligated to provide research results that could be clinically meaningful.199 One example that illustrates this dilemma is the Alzheimer’s risk associated with certain variants of the ApoE gene. Individuals who carry the ApoE4 variant have a higher risk of developing Alzheimer’s disease, but not everyone with this variant will develop Alzheimer’s disease. Suppose that whole genome sequencing is being performed on a young adult for a breast cancer research study he or she is involved in, and the ApoE4 variant is discovered. Should this finding be returned? The finding is not clinically actionable—meaning that there is not an effective treatment or cure—and it is not certain that individuals with the ApoE4 variant will develop Alzheimer’s disease. Some argue that the only acceptable reason to return an incidental finding is that the finding is clinically relevant and actionable, and the ApoE4 variant’s association with Alzheimer’s disease fails to cleanly meet these criteria.200 Others argue that it should be completely up to the individual whose whole genome is sequenced to make this decision.201 A number of frameworks for return of research results and incidental findings have recently been proposed by broadly constituted groups. A recent consensus paper authored by academic researchers, legal scholars, and patient advocates determined that researchers should offer to return individual research results that 1) are analytically valid; 2) are in compliance with CLIA; 3) the patient has consented to receiving; 4) are clinically actionable; and 5) present an “established and substantial risk of a serious health condition.”202 Another framework proposes grouping incidental findings into three “bins” including: “clinically actionable,” “clinically valid but not directly actionable,” (subdivided into low-, medium-, or high-risk incidental information groups), and “unknown or no clinical significance.”203 The bin into which the data fall in this model, in combination with other variants, determines if the result should be reported to the participant in a clinical context. Models also exist that are more finely tuned and consider multiple variables, such as participant preference (what results the participant does and does not want to know), significance of the result (analytic validity of the test and possibility for medical intervention), and communicability (literacy of the participant and clarity of the message).204 In contrast to these fine-tuned, multivariable return of results frameworks, many representatives of the patient advocacy community propose the wholesale return of whole genome sequence data to individuals. They argue that although universities or companies provide a service by performing whole genome sequencing, the individuals who supplied the samples should retain the right to control the use of the data, access to the data, and be able to share the data with whomever they choose (such as with researchers conducting other studies related to conditions affecting the individuals or the individuals’ families).205 There is a difference however between the return of “data” and “information” in the context of whole genome sequencing. Some have suggested that regardless of whether meaningful

Privacy and Progress in Whole Genome Sequencing

2017

information (that is, analyzed data interpreted by experts) is made available, raw data might be valuable to individuals. Currently, the Food and Drug Administration is debating the classification of these data in the context of commercial genetic testing. If companies are returning results with clinical or medical significance, commercial genetic services might be subject to regulatory requirements; but if they are simply returning unanalyzed whole genome sequence data files, regulatory requirements might not apply.206 For example, the commercial genetic test company Lumigenix does not interpret medically relevant genetic variants in-house. Rather, it provides customers with raw whole genome sequence data, inviting the consumer to use free genome analysis software to discover and interpret clinically relevant information on their own.207 This is a mere sampling of the many complex and detailed issues that need to be addressed before reaching a comprehensive set of actionable recommendations about whether and when incidental findings from whole genome sequencing can and should be returned to individuals with their fully informed consent.

Recommendation 3.3. Researchers, clinicians, and commercial whole genome sequencing entities must make individuals aware that incidental findings are likely to be discovered in the course of whole genome sequencing. The consent process should convey whether these findings will be communicated, the scope of communicated findings, and to whom the findings will be communicated. Recommendation 3.4. Funders of whole genome sequencing research should support studies to evaluate proposed frameworks for offering return of incidental findings and other research results derived from whole genome sequencing. Funders should also support research to investigate the related preferences and expectations of the individuals contributing samples and data to genomic research and undergoing whole genome sequencing in clinical care, research, or commercial contexts. Individuals undergoing whole genome sequencing in research, clinical, and commercial contexts must be provided with sufficient information in informed consent documents to understand what incidental findings are, and to know whether they will be notified of incidental findings discovered as a result of whole genome sequencing.208 Users of whole genome sequence data should continue supporting research into the management of incidental findings and individual research results obtained in both CLIA and nonCLIA-certified laboratories. Previous research has generated many models and guidelines for returning incidental findings and other results obtained in clinical and basic research. In order to take the next step of translating these models into best practices for the return of results, additional data must be collected to inform the deliberations. In particular, research should be expanded to collect empirical data on participant, patient, researcher, and clinician opinions of each model, and the consequences and costs of implementing each model. These studies should examine the motivations of patients and participants enrolled in research, undergoing genome sequencing in the clinical context, or engaging in commercial whole genome sequencing to obtain their research results. Respect for patient and participant values is essential to guide the development of these tools ethically.

2018

Presidential Commission for the Study of Bioethical Issues

Facilitating Progress in Whole Genome Sequencing Current protections for research participants emerged from a series of lapses in research ethics uncovered in the 1960s and 1970s in which clinicians and scientists conducted research without the fully informed consent or even knowledge of the research participants.209 One outcome of this history was the drawing of a bright line between clinical care and research. But this distinction is no longer so clear. Currently, large amounts of patient data are being collected in the health care setting, stripped of traditional identifiers, analyzed, and fed into research that might one day improve clinical care. This learning health system model both translates advances in health services research into clinical applications and collects data during clinical care to facilitate further advances in research.210 With patient data increasingly being transitioned to electronic medical records, persons engaged in this type of research can also more easily access data to aggregate and analyze.211 Advocates of the learning health system model advocate encouraging intellectual freedom through clinical research and engaging in regulatory parsimony.212 Large amounts of data are essential for researchers to make correlations between genomic variants and disease states. Learning health system advocates and others call for standardized electronic health record systems and infrastructure to facilitate health information exchange so that data can be easily aggregated and studied.213 Integrating whole genome sequence data into health records within the learning health system model can provide researchers with more data to perform genomewide analyses, which in turn can advance clinical care. Several Institute of Medicine (IOM) working groups have supported these goals, outlining the desirability of establishing a universal health information technology system and learning environment that engages health care providers and patients. The IOM reports recommend that such a system include both genomic and clinical information, increased interoperability of medical records systems, and reduced barriers to data sharing.214 The President’s Council of Advisors on Science and Technology identified the lack of sharing electronic health records—with patients, with a patient’s health care providers at other organizations, with public health agencies, and with researchers—as a barrier to improved health care.215

Recommendation 4.1. Funders of whole genome sequencing research, relevant clinical entities, and the commercial sector should facilitate explicit exchange of information between genomic researchers and clinicians, while maintaining robust data protection safeguards, so that whole genome sequence and health data can be shared to advance genomic medicine. Performing all whole genome sequencing in CLIA-approved laboratories would remove one of the barriers to data sharing. It would help ensure that whole genome sequencing generates high-quality data that clinicians and researchers can use to draw clinically relevant conclusions. It would also ensure that individuals who obtain their whole genome sequence data could share them more confidently in patient-driven research initiatives, producing more meaningful data. That said, current sequencing technologies and those in development are diverse and evolving, and standardization is a substantial challenge. Ongoing efforts, such as those by the Standardization of Clinical Testing working group are critical to achieving standards for ensuring the reliability of whole genome sequencing results, and facilitating the exchange and use of these data.216

Privacy and Progress in Whole Genome Sequencing

2019

In order for all persons to benefit from whole genome sequencing research, diverse populations must be involved in research. Consequently, it is incumbent upon the research community to earn and maintain the trust of individuals from a wide range of diverse populations across society. This trust is particularly important in minority and marginalized populations where levels of trust in the medical and research communities have been historically low. To encourage such trust, some scholars and advocates have proposed alternative models for the interactions between researchers and individuals enrolled in research that attempt to increase transparency and shift the balance of control between these two parties.217 As opposed to the traditional research model, in which there is usually little contact between the researcher and the individual enrolled in research beyond initial sample contribution, participant-centric initiatives put research participants at the center of the decision making, and are based on principles of respect and empowerment.218 The federal government has shown a n interest in giving patients a better understanding of disease, treatment, and care options through its establishment of the Patient-Centered Outcomes Research Institute.219 The challenges we face today in whole genome sequencing are not (or only partially overlap with) the challenges we will face in the coming years as technologies continue to develop and mature. For example, one current concern is the integration of data into electronic medical records; in 20 years or less, society might have to decide if every newborn should have their whole genome sequenced and added to their electronic medical record. Due to rapid technological developments, today’s policies must be crafted specifically enough to be actionable and targeted to address our current concerns, yet agile enough to ensure that we do not constrain our ability to adapt to evolving technology, research, and social norms related to privacy and sharing.220

Recommendation 4.2. Policy makers should promote opportunities for the public to benefit from whole genome sequencing research. Further, policy makers and the research community should promote opportunities for the exploration of alternative models of the relationship between researchers and research participants, including participatory models that promote collaborative relationships. Respect for persons implies not only respecting individual privacy, but also respecting research participants as autonomous persons who might choose to share their own data. Public beneficence is advanced by giving researchers access to plentiful data from which they can work to advance health care. Regulatory parsimony recommends only as much oversight as is truly necessary and effective in ensuring an adequate degree of privacy, justice and fairness, and security and safety while pursuing the public benefits of whole genome sequencing. Therefore, existing privacy protections and those being contemplated should be parsimonious and not impose high barriers to data sharing.221 While the Commission supports the intellectual freedom this access will encourage, clinicians and researchers must also act responsibly to earn public trust for the research enterprise.

2020

Presidential Commission for the Study of Bioethical Issues

Public Benefit The federal government has made a substantial investment in genetics research, including whole genome sequencing, and the benefit of this investment has been realized in two major ways. First, disease diagnosis and treatment have been advanced, and the functions of many genes have been and will continue to be discovered, which will further improve clinical care in the coming years. Incorporating knowledge gained through advances in whole genome sequencing into the clinic could improve diagnosis and treatment of diseases that have brought turmoil and tragedy into the lives of individuals and their families. We have already begun to see some benefits resulting from these advances; for example, genetic variants that can lead to adverse drug reactions have been identified. In the future, as the genetic variations that underlie common diseases are discovered, clinicians will, in some instances, be able to detect predispositions to disease before those diseases occur, and begin treatment or recommend lifestyle changes before a patient exhibits symptoms. Second, an indirect economic benefit has been realized. The U.S. government invested $3.8 billion in the Human Genome Project; it is estimated that this investment generated $244 billion in personal income and $796 billion in overall economic impact.222 These health and economic gains not only benefit the public through improved health care but also through increased economic opportunities. Thousands of citizens have participated in whole genome sequencing research personally, and all citizens help support government investment in whole genome sequencing through their participation in and support of our political system. Therefore, all citizens should have the opportunity to benefit from medical advances that result from whole genome sequencing. Special caution should be taken on the part of researchers to ensure that their participants reflect as much as possible the rich diversity of our population. Different groups have genomic variants at different frequencies within their populations, and sufficiently diverse data must be collected so that advances arising from whole genome sequencing can be used for the benefit of all groups.223

Recommendation 5.1. The Commission encourages the federal government to facilitate access to the numerous scientific advances generated through its investments in whole genome sequencing to the broadest group of persons possible to ensure that all persons who could benefit from these developments have the opportunity to do so. Government investment in genomic research has resulted in public benefit through improved health care and in economic return on investment. The principle of justice and fairness requires that the benefits and risks of whole genome sequencing be distributed across society. Research funded with taxpayer contributions should benefit all members of society. To these ends, researchers should be vigilant about including individuals from all sectors of society in their studies, so that research findings can be translated widely into clinical care. The federal government should follow through on its investment in research and assure that the discoveries of whole genome sequencing are integrated with clinical care that can be accessed by all.

Privacy and Progress in Whole Genome Sequencing

2021

APPENDIX I: GLOSSARY OF KEY TERMS Allele: a form of a gene at a particular location on a chromosome. Biorepository: a stored collection of physical biological samples (e.g., blood or tissue) and associated data (e.g., medical information and policies). Sometimes called a biobank. Carrier: an individual who has one normal and one mutated version of a gene. Chromosome: X-shaped structure made of tightly wrapped DNA in the nucleus of the cell that carries genes from one generation to the next. Humans have 46 chromosomes (in 23 pairs). Clinical utility: an assessment of the risks and benefits associated with a clinical test and the likelihood that the test will result in improved patient outcome. Clinical validity: the degree to which a genetic test can predict clinical status, as measured by the strength of the association between the genotype and phenotype. Copy number variations (CNVs): DNA mutations that occur when large sections of DNA are inserted or deleted during cell division. Database: an organized collection of data or information (e.g., whole genome sequence data files and information). Deoxyribonucleic acid (DNA): the molecule that contains the instructions to develop and direct the biological and chemical activities of a living organism. DNA Sequencing: the process that identifies the order of the nucleotide bases in a strand of DNA. Exome Sequencing: DNA sequencing of only the parts of the genome that make proteins (exons). Exon: a stretch of DNA, part of a gene, that codes for a protein. Gene: a piece of DNA that contains the information required for making a product that will have a biological function. A full set of genes is called a genome. Gene-environment interaction: the environmental factors that can influence a gene’s expression and the resulting phenotype. Genetic test: a discrete test that examines a specific genetic location or a single gene, such as the test for Huntington’s disease. Genetic variation: differences in alleles of allele frequency between or among individuals or populations. Genomics: the study of all the DNA (the genome) in an individual, and how parts of the genome interact with each other and the environment. Genome: the full set of genes in an individual. Humans have about 20,000 to 25,000 genes in their genome. Genome-wide association study (GWAS): compares large amounts of genetic data from individuals with and without a specific condition to identify DNA variants that correlate with diseases. Genotype: the genetic make-up of an individual. Genotype/phenotype correlation: the association between a certain mutation (genotype) and the resulting physical characteristic (phenotype). Genotyping: analyzing discrete variants, from a handful to thousands, across the genome (i.e., more than a discrete genetic test, but less than whole genome sequencing).

2022

Presidential Commission for the Study of Bioethical Issues

Guthrie Card: piece of paper used to capture and store a few drops of blood collected from a newborn. DNA from the dried blood spot is then used to test for a range of genetic conditions and infections. Heterozygous: when the genes or alleles on the two chromosomes are different. Homozygous: when the genes or alleles on each of the two chromosomes are the same. Incidental finding: a finding discovered in the course of clinical care or research concerning a participant that is beyond the aims of the clinical test or research but has potential health importance. Individual research result: a finding discovered in the course of clinical care or research concerning a research participant that relates to the aims of the clinical test or research and has potential health importance. Intron: part of a gene present between exons that does not directly code for a protein. Locus: the location of a gene on a chromosome. Mutation: a change in the DNA sequence. Mutations can arise from mistakes during cell division or from an outside source (e.g., radiation from the sun). Nucleotide bases: the four chemical units that compose DNA. The bases are adenine (A), thymine (T), guanine (G), and cytosine (C). A always pairs with T on the opposite strand of DNA, and C always pairs with G. One A-T or G-C pair is called a base pair. Phenotype: the expression of an individual’s genotype. An individual’s phenotype consists of their physical characteristics. Public health utility: the likelihood that a clinical test will reduce disease burden and/or result in improved patient outcome in the population. Single nucleotide polymorphisms (or SNPs): variations in the genome that involve single base pairs. Structural variants: the insertion, deletion, duplication, translocation (the movement of DNA from one location to another on the same or another chromosome), or inversion (flipping over) of long DNA segments (greater than about 1,000 base pairs in length). Whole genome sequence data: the file of As, Cs, Gs, and Ts produced as a result of whole genome sequencing. Whole genome sequence information: facts derived from whole genome sequencing data, such as predisposition to disease. Whole genome sequencing: determining the order of nucleotide bases— As, Cs, Gs, and Ts— in an organism’s entire DNA sequence.

APPENDIX II: GENETIC AND GENOMIC BACKGROUND INFORMATION Understanding Basic Genetic Architecture Deoxyribonucleic acid (DNA) is the molecule that contains the instructions to develop and direct the biological and chemical activities of nearly all living organisms. DNA is a twisting pair of strands, called a double helix, made of four basic building blocks, or nucleotide bases. These bases are abbreviated A, T, C, and G. The As, Cs, Gs, and Ts are linked together in long strands. The A on one strand will link to at T on the other strand of the double helix, bringing

Privacy and Progress in Whole Genome Sequencing

2023

the two strands together at each point along the DNA strand, like rungs on a ladder. A always binds with T, and C always binds to G. One A-T or G-C pair is called a nucleotide base pair. If the DNA in a single human cell was stretched out, it would be about six feet long. If all the DNA in a human body was stretched out, it would reach almost 70 times from the earth to the sun and back.224 In order to fit this much DNA into cells, the long strands of DNA have to be stored compactly. In the cell, DNA is nearly always wrapped tightly into X-shaped structures called chromosomes, which prevent the long strands of DNA from tangling or being damaged. Chromosomes pass DNA from one generation to the next. MENDELIAN GENETICS Gregor Mendel, a 19th Century European monk, discovered the mechanism for trait inheritance in plants and animals. Mendel studied traits in peas, including flower color, stem length, seed shape, and seed color. Through selective pollination, he was able to observe how traits were expressed when two plants produced seed. He found that organisms have two copies of every inheritance “unit” (now called genes): one from each parent.

Chromosomes are located in the nucleus of a cell (a sub-compartment of the cell that stores DNA). Chromosomes are usually found in pairs, with one member of each pair coming from the individual’s genetic mother and the other from the genetic father (See Figure 3). Humans have 46 chromosomes, in 23 pairs. Of the 46 chromosomes, two are sex chromosomes (X and Y) that determine if an individual is male or female. In addition to the 22 pairs of chromosomes that all humans have, females inherit one X chromosome from each parent, making their 23rd pair XX, while a male inherits an X chromosome from his mother and a Y chromosome from his father, making his 23rd pair XY. A complete set of DNA, or a full set of 46 chromosomes in a human, is called his or her genome. In humans, the genome is made up of approximately 3 billion nucleotide base pairs (A-T and G-C pairs). Nearly every cell in the human body contains a complete copy of the genome. WHY IT IS GOOD TO HAVE TWO COPIES OF EACH CHROMOSOME Having two copies of each gene ensures that if one gene on one chromosome of a pair is damaged, the gene on the other chromosome of the pair might not be damaged. In most cases, having only one functional copy of a gene is sufficient for normal function. This could be compared to having two kidneys: if one kidney is damaged, the healthy one can function well enough so that the individual can lead a relatively normal life.

Genes are specific regions of DNA on chromosomes. Genes are the basic physical unit of inheritance, and are passed from parents to their children. There are approximately 20,00025,000 genes distributed over the 46 chromosomes. Together, these genes make up the blueprint for the body and how it functions. The location of a gene on a chromosome is called the locus, which is much like an address. For example, a gene can be found on chromosome 16 (e.g., the name of the street), on a particular end of the chromosome (e.g., the North or South end of a street), at a particular location (e.g., the house number).

2024

Presidential Commission for the Study of Bioethical Issues

Figure 3. The 23 pairs of human chromosomes.

Almost all genes come in pairs with one copy (or allele) from each parent. While the alleles might or might not be identical, the genes are the same (just like we all have ears, but our ears do not all look exactly alike). Every person has the same number of genes, although they might have different alleles from one another; that is, every person has the genes for cystic fibrosis (CFTR) and breast cancer (BRCA1/2), but most of us do not have disease-causing mutations in these genes. In order to go from the blueprint in the genes to a functioning human, information in DNA is turned into proteins. Genes contain the instructions for making proteins that make up the human body. Examples of proteins include collagen, which is a major component of our hair and skin; and enzymes, a special type of protein, some of which break down the food we eat. If the DNA coding for a protein is mutated, it could result in that protein not functioning. For example, if the enzyme that breaks down lactose (a protein found in milk) is not assembled properly, it cannot break down lactose effectively and an individual is said to be lactose intolerant. Not every single part of our DNA contains the instructions for making a protein, only certain parts of genes make proteins. These regions are called exons. The function of the regions of DNA that do not code for proteins, called introns, is unknown. Introns were once called “junk” DNA, but scientists are learning that introns are likely essential for the rest of the gene to function properly.

Privacy and Progress in Whole Genome Sequencing

2025

GENE-ENVIRONMENT INTERACTIONS Cystic Fibrosis is a recessive genetic disorder, which means that a child must inherit a mutated copy of the CFTR gene from each parent to have the disease. While the genetic cause is clear, the severity of disease is linked to environmental factors such as exposure to second hand smoke, stress, and poor nutrition. Smoke in particular has been shown to interact with the CFTR gene and a secondary gene as well, worsening lung function in the patient. Source: Collaco, J.M., et al. (2008). Interactions between secondhand smoke and genes that affect cystic fibrosis lung disease. Journal of the American Medical Association, 299(4), 417-424.

The term genotype refers to an individual’s collection of genes or to the two alleles inherited for a particular gene. The expression of the genotype, through making proteins, contributes to the individual’s outward characteristics, called their phenotype. The association between a certain mutation or mutations (genotype) and the resulting physical characteristics (phenotype) is called the genotype/phenotype correlation. This association is at the core of genetic testing and research. Gene-environment interaction refers to how environmental factors modify the expression of a gene and, therefore, the trait, or phenotype. Some phenotypic traits are strongly influenced by genes, while others are more strongly influenced by the environment. Most traits are influenced by one or more genes interacting in complex ways with the environment.

Genetic Variation A mutation is a change in a DNA sequence (see Figure 4). Mutations can come from mistakes that happen when DNA is copied during cell division, exposure to chemicals or harmful radiation (like UV rays from the sun), or infection with certain viruses. Some mutations occur in the cells of an individual’s body and are not passed on to offspring, such as DNA damage in the skin caused by sunburn. Other mutations occur in the eggs and sperm and can be passed on to offspring, such as a mutation in the gene for sickle cell anemia. The term genetic variation refers to differences in alleles and other genetic changes between or among individuals. Genetic variation can also refer to how often those differences in alleles occur between or among populations. Humans have about 99.9 percent our genetic information in common, but there is considerable genetic variation. The differences in our genomes can explain why we are diverse as individuals or populations in appearance, predisposition to specific diseases, and adaptation to our environment. Understanding genetic variation is at the heart of understanding the role of genetics in disease. Genetic variations involving only a single nucleotide base (an A, C, G, or T building block) are referred to as single nucleotide polymorphisms, or SNPs (pronounced “snips”). Most people have thousands of SNPs in their genomes, but they often occur in the parts of DNA that do not make proteins, so they do not cause disease. When SNPs occur within a gene, they might cause disease by affecting the gene’s function. Researchers have found SNPs that might help predict how an individual responds to certain drugs, their susceptibility to environmental factors such as toxins, and their risk of developing particular diseases. SNPs have been used extensively to study diseases that are passed from one generation to the next in families.

2026

Presidential Commission for the Study of Bioethical Issues

Figure 4. Types of Genetic Variations.

Genetic variation can also involve much longer stretches of DNA. Structural variants involve the insertion, deletion, duplication, translocation (the movement of DNA from one location to a not her on the same or another chromosome), or inversion (flipping over) of long DNA segments (greater than about 1,000 base pairs in length). One type of structural variation is a copy number variant. Copy number variations (CNVs) can occur when large sections of DNA are inserted or deleted during cell division. Scientists are trying to understand how copy number variation contributes to health and disease. Each person carries roughly 100 copy number variants, but many do not appear to have a disease linkage. SICKLE CELL ANEMIA Sickle cell anemia is caused by a SNP in the gene for hemoglobin, a protein in red blood cells that is responsible for carrying oxygen. If the hemoglobin gene is mutated on both alleles, an individual will have sickle cell disease, which leads to a shortened life span. If an individual has one normal hemoglobin allele and one mutated allele, however, they will not have sickle cell disease (because they also have one functional allele) and they will have some protection against malaria. Sickle cell disease is most common in populations who live in malaria-prone regions of the world, because carrying this mutation is actually protective against malaria. Source: CDC. (n.d.). Protective Effect of Sickle Cell Trait Against Malaria Associated Mortality and Morbidity. Retrieved from http://www.cdc.gov/ malaria/about/biology/sickle_cell.html.

Privacy and Progress in Whole Genome Sequencing

2027

How Genetic Variants Translate into Disease Today, clinical genetic testing is used in individuals with a family history of disease; in other words, the tests are limited to those who are considered at risk of carrying known genetic variants that are linked to a particular disease. However, some clinical studies are evaluating the use of whole genome sequencing in regular clinical practice.225 In addition, individuals can try to bypass the traditional health care system and use the services of companies that offer consumers SNP analysis, whole exome sequencing, and more. Very few genetic variants are directly linked to a specific disease, however some examples include cystic fibrosis, sickle cell anemia, and Huntington’s disease. Targeted genetic tests have been developed for many of these diseases. Many other diseases are suspected to have a genetic component, but scientists have not determined which genetic variants might cause them. For example, heart disease could be caused by genetic mutations, but it is certainly not a simple case of one mutation in one gene. The genetic component of heart disease could be many mutations throughout the genome that interact with the environment to cause heart disease. Whole genome sequencing could reveal complex interactions between genes and disease, where a particular mutation on a certain gene, in conjunction with another mutation on another gene, or several other mutations on other genes, come together to cause disease. Some of the genetic variants discovered during whole genome sequencing will have clear links to disease, but the majority will be unknown. Based on how they translate to disease, genetic variants can fall into six categories: 







 

Variants of unknown significance: An example of this might be when a piece of DNA has been cut out of one location on a chromosome and inserted into another location on the chromosome. The fact that the DNA is different is clear, but what that difference means, or how it will relate to disease, is unclear. Nonmedical genetic markers: These are genes that code for things such as eye color. If there were a mutation in one of these genes, it would not be something that would require medical treatment. Carrier status: An individual is a carrier of a variant if they have one normal and one mutated version of a gene. Most often, the individual is not affected by the disease, but they can pass the gene on to their children. An example is sickle cell disease, where individuals with one mutated version of the gene and one normal version of the gene do not have the full-blown disease themselves. Susceptibility genes: These are genes that make it more likely, but not certain, that an individual will develop a particular disease, i.e., they are “susceptible” to it. An individual might carry genes that make them susceptible to diabetes, but with proper diet and exercise, they will not necessarily develop diabetes. Late onset genetic conditions: Late onset conditions present later in life. Examples are Alzheimer’s disease, Huntington’s disease, and some degenerative eye diseases. Medical conditions found by current prenatal genetic tests: These are conditions that, if an individual has one or two copies of the gene, they will have the disease, and the disease will affect their health and quality of life throughout their life span. An example is phenylketonuria. Individuals with phenylketonuria cannot break down a particular amino acid and must follow a diet that is low in that amino acid.

2028

Presidential Commission for the Study of Bioethical Issues

Sequencing Strategies DNA sequencing is the process of determining the exact order of the bases (nucleotides) in a strand of DNA. Since base pairing is predictable (A always pairs with T; G always pairs with C), knowing the sequence on one strand automatically reveals the sequence on the other strand. Sequencing technology has rapidly advanced in recent years, allowing scientists to make discoveries about the regulation, variability, and evolution of the human genome.226 A consequence of decreasing cost and increasing accessibility of sequencing technologies is the increasing use of whole genome sequencing. Whole genome sequencing is the process of sequencing all the DNA in an organism, in contrast to testing for only a handful of known mutations or sequencing a particular gene. Whole genome sequencing reads more than 95 percent of the genome, compared to SNP genotyping, which typically covers less than 0.1 percent of the genome. That said, knowing one person’s complete DNA sequence does not necessarily provide useful clinical information, because each person’s DNA is different from the DNA of others at millions of places. One goal of whole genome sequencing research is to create a reference catalog of all common and rare genetic variants in human populations so that the relationship between variants and disease can be studied. By comparing one person’s whole genome sequence with other whole genome sequences, reference sequences, and associated health information, one can find places in the genome where, for example, a group of people with the same DNA mutation at the same locus all have the same disease. Comparisons like this will hopefully lead to meaningful associations and ultimately guide clinical and personal health decisions. Exome sequencing might be an efficient alternative to whole genome sequencing in some cases. Exome sequencing selectively sequences only the part of the genome that make proteins (exons). An estimated 85 percent of disease-causing mutations are found in the exome.227 Therefore, sequencing only the exons, which make up about 1 percent of the genome, should be faster and less expensive than sequencing the entire genome, and is likely to identify most disease-causing mutations. Increasingly, exome sequencing is being used in clinical diagnostic testing. However, now that 80 percent of the genome has been found to have “biochemical function,” with non-coding regions of the genome influencing the activity of genes that are spatially distant, exome sequencing that does not find an answer could be complemented by targeted sequencing of non-coding regions. A genome-wide association study (GWAS) is a method that has been used heavily in recent years to identify links between specific genetic variations and specific diseases. The method involves studying the genomes of many people with and without a disease of interest and searching for genetic markers (e.g., SNPs) that can be used to predict the presence of a disease. GWASs alone cannot specify which genes cause disease; however, by looking at hundreds of thousands of SNPs, researchers can identify mutations that are more frequent in people with the disease than without. These mutations are therefore considered “associated” with the disease. Disease-associated SNPs are used as markers or pointers to the region of the genome where a disease-causing mutation is likely to be found. The Challenges of Analyzing Whole Genome Sequence Data and Identifying Disease Associations The primary goal of whole genome sequencing research is to describe the relationship between genotype (genetic variants) and phenotype (physical characteristics, including

Privacy and Progress in Whole Genome Sequencing

2029

disease). Whole genome sequence data alone will not provide a complete understanding of disease. The data must be linked to phenotypic data, such as medical records. Environmental data will also be needed to fully understand gene-environment interactions. A challenge of whole genome sequencing research is the hard-to-detect relationship between genetic variant and phenotypic trait, such as disease risk. To interpret an individual’s disease risk, one must have reliable information about every validated genetic disease to use as a standard of comparison. Currently, there is no central, publicly available repository of all variants found to be associated with a clinically relevant trait or disease. Refinements must also be made to take into account the genomic diversity of the human population. While no “private” variants have been found only in one population and not in others, many variants occur at different frequencies in different populations (for example, a particular SNP might be common in one population and rare in another). Studying genetic variation across populations can provide some, but not all, clues to the causes of health disparities.228 Finally, even if a specific mutation is linked to a disease, the expression of that gene and environmental interactions can result in different phenotypic effects in different people. In other words, one person carrying a particular mutation might develop the disease and another person with the same mutation might not, or that person might exhibit the disease in a more or less severe form. Further, a single mutation in one gene rarely leads to the particular phenotype of an individual. The current clinical value of whole genome sequencing for linking genomic variants to disease remains challenging because of the many gene-gene and gene-environment interactions. Thus, the field continues to work toward establishing the clinical validity (future disease positive and negative predictive value stratified by exposure), clinical utility (targeted interventions to reduce disease risk among persons with the profile) and public health utility (comparing reduction of disease burden in the population based on genomic analysis) of whole genome sequence data.

APPENDIX III: GUEST PRESENTERS TO THE COMMISSION REGARDING PRIVACY AND WHOLE GENOME SEQUENCING George Annas, J.D., M.P.H. Chair, Health Law, Bioethics & Human Rights; William Fairfield Warren Distinguished Professor, Boston University School of Public Health

Richard Gibbs, Ph.D. Wofford Cain Professor, Department of Molecular and Human Genetics; Director, Human Genome Sequencing Center, Baylor College of Medicine

Retta Beery Mother of twins who benefitted from diagnosis made possible by whole genome sequencing

Jane Kaye, D.Phil., L.L.B. Director, Centre for Law, Health and Emerging Technologies (HeLEX),Oxford University

2030

Presidential Commission for the Study of Bioethical Issues

Greg Biggers Council Member, Genetic Alliance; Chief Executive Officer, Genomera Ken Chahine, Ph.D., J.D. Senior Vice President and General Manager, Ancestry DNA, LLC Ellen Wright Clayton, J.D., M.D. Craig-Weaver Professor of Pediatrics; Professor of Law and Director, Center for Biomedical Ethics and Society, Vanderbilt University Leonard D’Avolio, Ph.D. Associate Center Director for Biomedical Informatics, Massachusetts Veterans Epidemiology Research and Information Center (MAVERIC), Department of Veterans Affairs; Instructor, Harvard Medical School James P. Evans, M.D., Ph.D. Clinical Professor and Bryson Distinguished Professor of Genetics and Medicine, Department of Genetics, University of North Carolina School of Medicine Madison Powers, J.D., D.Phil. Professor, Department of Philosophy; Senior Research Scholar, Kennedy Institute of Ethics, Georgetown University Laura Lyman Rodriguez, Ph.D. Director, Office of Policy, Communications, and Education, National Human Genome Research Institute, National Institutes of Health Mark A. Rothstein, J.D. Herbert F. Boehl Chair of Law and Medicine, University of Louisville School of Medicine

Bartha Knoppers, Ph.D. Director, Centre of Genomics and Policy; Canada Research Chair in Law and Medicine, McGill University Daniel Masys, M.D. Affiliate Professor, Biomedical and Health Informatics, University of Washington School of Medicine Amy McGuire, J.D., Ph.D. Associate Professor of Medicine and Medical Ethics; Associate Director of Research, Center for Medical Ethics and Health Policy, Baylor College of Medicine Melissa Mourges, J.D. Assistant District Attorney; Chief, Forensic Sciences/Cold Case Unit, New York County District Attorney’s Office Pilar Ossorio, Ph.D., J.D. Associate Professor of Law and Bioethics, University of Wisconsin-Madison Erik Parens, Ph.D. Senior Research Scholar, The Hastings Center Latanya Sweeney, Ph.D. Visiting Professor and Scholar, Computer Science; Director, Data Privacy Lab, Harvard University John Wilbanks Founder, Consent to Research; Senior Fellow, Kauffman Foundation; Research Fellow, Lybba Susan Wolf, J.D. McKnight Presidential Professor of Law, Medicine & Public Policy; Faegre & Benson Professor of Law; Professor of Medicine; Faculty Member, Center for Bioethics, University of Minnesota

Privacy and Progress in Whole Genome Sequencing Sonia Suter, M.S., J.D. Professor of Law, George Washington University

APPENDIX IV: U. S. STATE GENETIC LAWS*

* Map

and table current as of March 2012.

2031

Consent required to DISCLOSE genetic information

AL AK

X

X

X

AZ AR CA

CO

CT DC DE

16 Del. Code Ann.§§ 1201 through 1208 Fla. Stat. § 760.40 (2010) G.A. Code Ann. §§ 3354-1 through 33-54-8 (2011) Haw. Rev. Stat. §§ 431:10A-118 (2010)

FL GA HI ID IL IN IA KS KY LA ME MD MA MI MN MS MO MT

X

X

X

X

Mo. Rev. Stat. §375.1309 (2011)

ordinary course of business ordinary course of business ordinary course of business/ insurance

X

X

X

X

X

X

X

X

X

healthcare provider or insurance company no law on point no law on point comprehensive law

X X

X

X X

comprehensive law insurance

X

insurance

X

no law on point comprehensive law

La. Rev. Stat. Ann. § 22:1023, 40:1299.6 (2011) 22 Me. Rev. Stat. Ann. § 1711-C (2011)

X

no law on point comprehensive law

X

§ 225 Ill. Comp. Stat. 135/90, § 410 ILCS 513/1 through 513/91 (2011) Ind. Code Ann. § 1639-5-2 (LexisNexis 2011)

Mass. Ann. Laws ch. 111, § 70G (2010) Mich. Comp. Laws §§ 333.17020, 333.17520 (2011) Minn. Stat. § 13.386 (2010)

X

Application/ context limited to

Consent required to OBTAIN genetic information Consent required to RETAIN genetic information

Alaska Stat. §§ 18.13.010 through 18.13.100 (2011) Ariz. Rev. Stat. §§ 1-602, 12-2801 through 12-2804, & 20-448-02 (2011) Ark. Code. Ann. §§ 1643-1101, 2035-101 through 20-35-103 (2010) Cal. Civ. Code §§ 56.17, 56.265 (West 2010); Cal Ins Code 10123.35, 10148 through 10149.1 (2010) Colo. Rev. Stat. §§ 10-3-1104.6 & 103-1104.7 (2010)

Citation

Consent required to PERFORM genetic tests

Presidential Commission for the Study of Bioethical Issues

State

2032

X

insurance

X

no law on point no law on point no law on point insurance

X

X X

X

X

X X

X

X

X X

healthcare providers no law on point healthcare providers healthcare providers government entity no law on point ordinary course of business no law on point

NE

Neb. Rev. Stat. § 71551 (2010)

X

NV

Nev. Rev. Stat. Ann. §§ 629.141 through 629.201 (2010) N.H. Rev. Stat. Ann. 141-H:1 through 141H:6 (2010) N.J. Stat. Ann. §§ 10:5-44 through 10:5-49 (2011) N.M. Stat. Ann. §§ 24-21-1 through 2421-7 (2010) N.Y. Civ. Rights Law § 79-l (2011)

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X

X X

X X

X

NH

NJ NM

NY NC ND OH OK OR PA RI

SC SD TN TX UT VT VA WA

WV WI WY

21 Okla. Stat. § 1175 Or. Rev. Stat. §192.531 to 192.549 (SB 618) R.I. Gen. Laws §27-1852, 52.3, §2719-44, 44.1, §27-20-39. 39.1, §27-4153, 53.1 S.C. Code Ann. §3893-10 to §38-9390; S.C. Code Ann. § 16-1-10 S.D. Codified Laws §34-14-14 to -24

X

X

X X

X

insurance comprehensive law no law on point insurance

X

X

V.T. Stat. Ann. tit. 18, §9331 to 9335

X

X X X

X X

X

comprehensive law comprehensive law

X

Tex. Ins. Code Ann. §546.001 et squ.

Wis. Stat. §942.07 Wyo. Stat. Ann. §14-2701 to 710

healthcare providers comprehensive law comprehensive law

comprehensive law no law on point no law on point no law on point newborns comprehensive law no law on point insurance

X

V.A. Code Ann. §38.2508.4 Wash. Rev. Code §70.02.05 through 70.02.90; RCW 49.44.180

2033 Application/ context limited to

Consent required to DISCLOSE genetic information

Consent required to RETAIN genetic information

Consent required to OBTAIN genetic information

Consent required to PERFORM genetic tests

Citation

State

Privacy and Progress in Whole Genome Sequencing

X X

no law on point comprehensive law insurance healthcare providers no law on point employment perform: comprehensive prohibition; disclose: paternity law

2034

Presidential Commission for the Study of Bioethical Issues

End Notes 1

The individuals mentioned in these vignettes have given their permission to have their names included. For more detail, please see Section 2: Policy and Governance-Privacy Regulations. 3 The Genomics and Personalized Medicine Act of 2006 (S. 3822, 109th Cong. [2006]; subsequently reintroduced in the Senate in 2007 and in the House of Representatives in 2008 and 2010) encouraged accelerating genetics and genomics research and translating knowledge gained into clinical and public health applications. The proposed bill stated that “pharmaco-genetics has the potential to dramatically increase the efficacy and safety of drugs and reduce health care costs, and is fundamental to the practice of genome-based personalized medicine.” The Act identified several drugs that are more or less effective in people with particular genetic profiles, including the cancer drug Gleevac, the breast cancer drug Herceptin, and the acute lymphoblastic leukemia drug 6mercaptopurine. All four bills were referred to committee and were not enacted. 4 American Medical Association (AMA). (2007). Personalized Health Care Report 2008: Warfarin and Genetic Testing. Retrieved from http://www.ama-assn.org/ama1/pub/upload/ mm/464/warfarin-brochure.pdf. 5 Kolata, G. (2012, September 5). Bits of mystery DNA, far from ‘junk,’ play crucial role. New York Times, p. A1. Retrieved from http://www.nytimes.com/2012/09/06/science/far-from-junk-dna-dark-matter-proves-crucial-tohealth.html?_r=2&hp; Young, E. (2012, September). ENCODE: The rough guide to the human genome. Discover Magazine. Retrieved from http://blogs.discovermagazine.com/notrocketscience/2012/09/05/encodethe-rough-guide-to-the-human-genome/. 6 McGuire, A.L., and J.R. Lupski. (2010). Personal genome research: What should the participant be told? Trends in Genetics, 26(5), 199-201. 7 Kolata, G., op cit. 8 Donley, G., Hull, S.C., and B.E. Berkman. (2012). Prenatal whole genome sequencing: Just because we can, should we? Hastings Center Report, 42(4), 28-40. 9 Cirulli, E.T., and D.B. Goldstein. (2010). Uncovering the roles of rare variants in common disease through wholegenome sequencing. Nature Reviews Genetics, 11, 415-425. 10 The National Commission for the Protection of Human Subjects of Biomedical and Behavioral Research. (1978). The Belmont Report: Ethical Principles and Guidelines for the Protection of Human Subjects of Research. Washington, DC: Department of Health, Education, and Welfare, DHEW Publication OS 78-0012. Retrieved from http://www.hhs.gov/ohrp/ human-subjects/guidance/belmont.html; PCSBI. (2010, December). New Directions: The Ethics of Synthetic Biology and Emerging Technologies. Washington, DC: PCSBI. 11 Pokorska-Bocci, A. (2010). Early examples of clinical use of whole-genome sequencing. Retrieved from http:// www.phgfoundation.org/news/5708/. 12 Beery, R., Mother of twins who benefitted from improved diagnosis gained by whole genome sequencing. (2012). The Beery Family Whole Genome Sequencing Success. Presentation to the Presidential Commission for the Study of Bioethical Issues (PCSBI), February 2, 2012. Retrieved from http://bioethics.gov/cms/ node/658. 13 Topol, E. (2012). The Creative Destruction of Medicine: How the Digital Revolution Will Create Better Health Care. New York: Basic Books. 14 Fan, H.C., et al. (2012). Non-invasive prenatal measurement of the fetal genome. Nature, 487, 320-324; Motluk, A. (2012). Fetal genome deduced from parental DNA, Nature News, doi:10.1038. 15 Topol, E., op cit. 16 Donley, G., et al., op cit. 17 Geller, L.N., et al. (1996). Individual, family, and societal dimensions of genetic discrimination: A case study analysis. Science and Engineering Ethics, 2(1), 71-88; NOVA. (2012). Cracking Your Genetic Code, 46:30 et seq. Retrieved from http://video.pbs.org/ video/2215641935; Suter, S., Professor of Law, George Washington University. (2012). How Technology is Changing Views of Privacy. Presentation to PCSBI, August 1, 2012. Retrieved from http://bioethics.gov/cms/node/748. 18 Allen, A.L. (2011). Privacy Law and Society, 2nd ed. St. Paul, MN: Thomson Reuters. 19 Ibid; DeCew, J. (2012). Privacy. In E.N. Zalta (ed.), The Stanford Encyclopedia of Philosophy (Fall 2012 Edition). Stanford, CA: The Metaphysics Research Lab, Stanford University. Retrieved from http://plato. stanford.edu/archives/fall2012/entries/privacy/. 20 PCSBI. (2010, December). New Directions: The Ethics of Synthetic Biology and Emerging Technologies. Washington, DC: PCSBI. 21 National Commission for the Protection of Human Subjects of Biomedical and Behavioral Research. (1979). The Belmont Report: Ethical Principles and Guidelines for the Protection of Human Subjects of Research. Washington, DC: Department of Health, Education, and Welfare, DHEW Publication OS 78-0012. Retrieved from http://www.hhs.gov/ohrp/ humansubjects/guidance/belmont.html. 22 PCSBI. (2010, December). New Directions: The Ethics of Synthetic Biology and Emerging Technologies. Washington, DC: PCSBI, pp. 24-25, 113. 23 Ibid, pp. 25-27, 123-127. 24 Ibid, pp. 27-28, 141-145. 2

Privacy and Progress in Whole Genome Sequencing 25

2035

Ibid. Ibid. 27 Ibid, pp. 28-30, 151. 28 Ibid, pp. 30-31, 161-163. 29 The Commission reached out to the heads of the 18 federal agencies and departments that have adopted the federal Common Rule for protecting human research participants. They are: Department of Agriculture; Department of Commerce; Department of Defense; Department of Education; Department of Energy; Department of Health and Human Services; Department of Homeland Security; Department of Housing and Urban Development; Department of Justice; Department of Transportation; Department of Veterans Affairs; Agency for International Development; Consumer Product Safety Commission; Environmental Protection Agency; National Aeronautics and Space Administration; National Science Foundation; Social Security Administration; and the Central Intelligence Agency. 30 Request for Comments on Issues of Privacy and Access With Regard to Human Genome Sequence Data, 77 Fed. Reg. 18, 247 (March 27, 2012). 31 For example, the American College of Medical Genetics and Genomics is taking the lead in considering which results ought to be returned. A number of federal agencies have looked into direct-to-consumer testing, including the Secretary’s Advisory Committee on Genetic Testing in its report “Enhancing the Oversight of Genetic Tests: Recommendations of the SACGT” (http://oba.od.nih.gov/oba/sacgt/reports/oversight_ report.pdf); its successor, the Secretary’s Advisory Committee on Genetics, Health, and Society in its report “U.S. System of Oversight of Genetic Testing: A Response to the Charge of the Secretary of Health and Human Services” (http://oba.od.nih.gov/oba/sacghs/reports/sacghs_oversight _report.pdf); and by the Government Accountability Office first in its 2006 report “Nutrigenetic Testing: Tests Purchased from Four Web Sites Mislead Consumers” (http://www.gao.gov/new.items/d06977t.pdf) and in its 2010 report “Misleading Test Results Are Further Complicated by Deceptive Marketing and Other Questionable Practices” (http://www.gao.gov/products/GAO10-847T). The Food and Drug Administration has also considered the issue of direct-to-consumer testing, but has not yet published any formal recommendations. And the American Heart Association recently published a report entitled “Genetics and cardiovascular disease: a policy statement from the American Heart Association” that discussed gene patenting and insurance coverage of genetic tests (Ashley, E.A. et al. (2012). Genetics and cardiovascular disease: A policy statement from the American Heart Association. Circulation, 126). 32 Gutmann, A., Chair, PCSBI. (2012). How Technology is Changing Views of Privacy. Addressing PCSBI, August 1, 2012. Retrieved from http://bioethics.gov/cms/node/748. 33 National Commission, op cit. 34 PCSBI, (2010, December), op cit. 35 Ibid, pp. 24-25, 113. 36 The distribution of both scientific knowledge and subsequently of economic opportunity in the field of genome sequencing has been debated within the legal system. In a recent example, Myriad Genetics attempted to patent the BRCA1 and BRCA2 genes, which are associated with breast and ovarian cancer. Myriad Genetics’ actions were contested by the American Civil Liberties Union, which argued that they were in violation of the First Amendment. In August 2012, a U.S. federal appeals court ruled that the company has the right to patent the two genes, stating that the patents would encourage innovation, but simultaneously denied the company’s attempt to patent methods comparing or analyzing DNA sequences. Reuters. (2012, August 16). Court reaffirms right of myriad genetics to patent genes. New York Times. Retrieved from http://www.nytimes. com/2012/08/17/ business/court-reaffirms-right-of-myriad-genetics-to-patent-genes.html?_r=1. 37 Battelle. (n.d.). $3.8 billion investment in Human Genome Project drove $796 billion in economic impact creating 310,000 jobs and launching the genomic revolution. Retrieved from http://www.battelle.org/media/ news/2011/05/11/$3.8-billion-investment-in-human-genome-project-drove-$796-billion-in-economicimpactcreating-310-000-jobs-and-launching-the-genomic-revolution. 38 PCSBI, (2010, December), op cit. 39 Aristotle, Politics, (Benjamin Jowett trans., Dover first ed. 2000) (350 B.C.); DeCew, J.W. (1997). In Pursuit of Privacy. Ithaca, NY: Cornell Press, p.10. 40 Warren, S.D., and L.D. Brandeis. (1890), The Right to Privacy, 4 Harv. L. Rev. 5. 41 Lowrance, W. (2012). Privacy, Confidentiality, and Health Research. New York: Cambridge University Press, p. 40-47. 42 Allen, A.L. (1997). Genetic privacy: Emerging concepts and values. In M. Rothstein (Ed.), Genetic Secrets: Protecting Privacy and Confidentiality in the Genetic Era (pp. 31-59). New Haven, CT: Yale University Press; Allen, A.L. (1999). Coercing Privacy, 40 Wm. & Mary L. Rev. 723 (1999); DeCew, J.W. (2004). Privacy and policy for genetic research. Ethics and Information Technology, 6, 5-14; Farahany, N.A. (2012). Searching Secrets, 160 U. Penn. L. Rev. 1239, 1255. 43 Fried, C. (1970). An Anatomy of Values. Cambridge: Harvard University Press; Moore v. Regents of the Univ. of Cal., 51 Cal. 3d 120 (Cal. 1990); Rachels, J. (1975). Why privacy is important. Philosophy & Public Affairs, 4(4), 323-333. 44 Newcombe, H.B. (1994). Cohorts and privacy. Cancer Causes and Control, 5(3), 287-291. 26

2036 45

Presidential Commission for the Study of Bioethical Issues

Allen, A.L. (2009). Confidentiality: An expectation in healthcare. In Ravitsky, V., Fiester, A., and A.L. Caplan (Eds.), The Penn Center Guide to Bioethics. (pp.127-135). New York: Springer Publishing Co. 46 Goldstein, M., Associate Professor, Department of Health Policy, School of Public Health and Health Services, George Washington University, and McGraw, D., Director, Health Privacy Project, Center for Democracy and Technology. (2012). Comments submitted to PCSBI, May 25, 2012; Health Privacy Project. (2007). Health Privacy Stories. Retrieved from https://www.cdt.org/healthprivacy/20080311stories.pdf. 47 Williams, S., et al. (2009). The Genetic Town Hall: Public Opinion About Research on Genes, Environment, and Health. Washington, DC: Genetics and Public Policy Center. Retrieved from http://www.dnapolicy.org/pub. reports.php?action=detail&report_id=27. 48 Kaufman, D.J., et al. (2009). Public opinion about the importance of privacy in biobank research. The American Journal of Human Genetics, 85(5), 643-654. 49 Genetics and Public Policy Center. (2007, April 24). U.S. Public Opinion on Uses of Genetic Information and Genetic Discrimination. Retrieved from http://www.dnapolicy.org/ resources/GINAPublic_Opinion_ Genetic_Information_Discrimination.pdf. 50 McGuire, A.L., et al. (2008). DNA data sharing: Research participants’ perspectives. Genetics in Medicine, 10(1), 46-53. 51 For a survey of self-reported genetic discrimination, see Geller, L.N., et al. (1996). Individual, family, and societal dimensions of genetic discrimination: A case study analysis. Science and Engineering Ethics, 2(1), 71-88; NOVA. (2012, March 28). Cracking Your Genetic Code, 46:30 et seq. Retrieved from http://video.pbs.org/ video/2215641935 (Discussing potential harms from whole genome sequencing at birth). 52 Powers, M., Professor, Department of Philosophy, Senior Research Scholar, Kennedy Institute of Ethics, Georgetown University. (2012). Theory and Practice of a Right to Privacy. Presentation to PCSBI, May 17, 2012. Retrieved from http://bioethics.gov/cms/node/712. 53 Andrews, L.B. (2001). Future Perfect. New York: Columbia University Press. 54 For example in EEOC v. Burlington Northern and Santa Fe Railway, the Federal District Court for the Northern District of Iowa addressed the scope of protection from genetic discrimination under the Americans with Disabilities Act. In this case, the railway required that employees who complained of carpal tunnel syndrome undergo genetic testing for a genetic predisposition. No. C01-4013 (N.D. Iowa Feb. 9, 2001). 55 Sweeney, L., Visiting Professor and Scholar, Computer Science; Director, Data Privacy Lab, Harvard University. (2012). How Technology is Changing Views of Privacy. Presentation to PCSBI, August 1, 2012. Retrieved from http://bioethics.gov/cms/node/748. 56 The Belmont Report recognizes that not all persons can act as autonomous agents, and makes clear that there are special responsibilities to those who cannot. National Commission for the Protection of Human Subjects of Biomedical and Behavioral Research. (1979). The Belmont Report: Ethical Principles and Guidelines for the Protection of Human Subjects of Research. Washington, DC: Department of Health, Education, and Welfare, DHEW Publication OS 78-0012. Retrieved from http://www.hhs.gov/ohrp/humansubjects/guidance/ belmont.html. 57 Brock, D. (1999). A critique of three objections to physician-assisted suicide. Ethics, 109(3), 523-524. 58 PCSBI. (2010, December). New Directions: The Ethics of Synthetic Biology and Emerging Technologies. Washington, DC: PCSBI. 59 Ibid. 60 Ibid, p. 31. 61 Sweeney, L., Visiting Professor and Scholar, Computer Science, Director, Data Privacy Lab, Harvard University. (2012). How Technology is Changing Views of Privacy. Presentation to PCSBI, August 1, 2012. Retrieved from http://bioethics.gov/cms/node/748. 62 PCSBI, (2010, December), op cit, p.5. 63 Ibid. 64 Gutmann, A., and D. Thompson. (1996). Democracy and Disagreement. Cambridge, MA: Harvard University Press. 65 Trinidad, S.B., et al. (2010). Genomic research and wide data sharing: Views of prospective participants. Genetics in Medicine, 12(8), 486-495. 66 Lake Research Partners and American Viewpoint. (2006). National Survey on Electronic Personal Health Records, conducted by the Markle Foundation. Retrieved from http://www.markle.org/sites/default/files/ research_doc_120706.pdf. 67 Gottweis, H., and K. Zatloukal. (2007). Biorepository governance: Trends and perspectives. Pathobiology, 74(4), 206-211. 68 In the early 1990s, researchers obtained consent from the Havasupai Indian tribe to collect samples and conduct research on a genetic link to diabetes. The University of Arizona conducted the initial research, and later used the samples from the Havasupai to perform unrelated studies, including genetic and medical records analysis of inbreeding, schizophrenia, migration history, and genealogy. The Havasupai sued the University, alleging that it misused their genetic information, and that it conducted research for which it never obtained informed consent. The lawsuit resulted in a large settlement and destruction of the samples. Eriksson, S., and G. Helgesson. (2005).

Privacy and Progress in Whole Genome Sequencing

2037

Potential harms, anonymization, and the right to withdraw consent to biobank research. European Journal of Human Genetics, 13(9), 1071-1076; Harmon, A. (2010, April 21). Indian tribe wins fight to limit research of its DNA. New York Times. Retrieved from http://www.nytimes.com/2010/04/22/us/22dna. html?pagewanted=all. 69 The Common Rule is a federal regulation regarding human subject research, adopted by 18 federal agencies; see footnote 29. 70 Those agencies are: 1) USAID; 2) CIA; 3) CPSC; 4) USDA; 5) DOC; 6) DOE; 7) ED; 8) EPA; 9) HUD; 10) NASA; 11) NSF; and 12) SSA. SSA does receive genetic information that it considers personally identifiable information and deals with the information accordingly. 71 USDA indicated that its Agricultural Research Service expects to conduct human research programs in the future that may include more extensive use of whole genome analysis or sequencing. 72 Chief Information Officer, Office of Information Services, Centers for Medicare & Medicaid Services. (2007). Policy for Privacy Act Implementation & Breach Notification. Retrieved from https://www.cms.gov/ SystemLifecycleFramework/downloads/privacypolicy.pdf; E-Government Act, 116 Stat. 2899 (2002); Federal Information Security Management Act (FIMSA), 116 Stat. 2899 (2002); Health Information Technology for Economic and Clinical Health (HITECH), 123 Stat. 115 (2009); Health Insurance Portability and Accountability Act (HIPAA), 110 Stat. 1936 (1996); Policy for Privacy Act Implementation and Breach Notification, 5 U.S.C.§ 552a. 73 DOD. (2002). DOD Directive 6025.18, Privacy of Individually Identifiable Health Information in DOD Health Care Programs. December 19, 2002. Retrieved from http://biotech.law.lsu.edu/blaw/dodd/corres/ html/602518.htm; DOD Regulation, DOD Directive 8580.02-R. (2007). DOD Health Information Security Regulation; DOD Regulation, DOD Directive 5400.11-R. (2007). Department of Defense Privacy Program. 74 Letter from Earl C. Wyatt, Deputy Assistant Secretary of Defense, and Rapid Fielding, DOD to Amy Gutmann, Chair, PCSBI. (April 27, 2012). 75 HITECH, Key provisions codified at 42 U.S.C. §§17931 et seq.; HIPAA, Key provisions codified at 42 U.S.C. §§ 1320d et seq.; FISMA, Key provisions codified at 44 U.S.C. §§ 3541 et seq. and 40 U.S.C. § 11331; Confidential Information Protection and Statistical Efficiency Act (CIPSEA), 44 U.S.C. § 3501 note, see also the OMB Implementation Guidance on CIPSEA, 72 Fed. Reg. § 33361 (2007); AHRQ general provisions, 42 U.S.C. § 299c-3(c); SAMHSA General Provisions, 42 U.S.C. § 290aa(n); Privacy Act of 1974, 5 U.S.C. § 552a; Confidentiality of information from health statistics and other activities, 42 U.S.C. § 242m(d). 76 Letter from Kathleen Sebelius, Secretary, HHS to Amy Gutmann, Chair, PCSBI. (May 16, 2012). 77 The Public Health Service Act, 42 U.S.C. §242m, part 301(d). 78 Letter from Kathleen Sebelius, Secretary, HHS to Amy Gutmann, Chair, PCSBI. (May 16, 2012). 79 Ibid. 80 Ibid. 81 NIH. (2007). NIH Policy for Sharing of Data Obtained in NIH Supported or Conducted Genome-Wide Association Studies (GWAS). Retrieved from http://grants.nih.gov/grants/ guide/notice-files/NOT-OD-07088.html; See updated data access policy at http://gwas.nih. gov/pdf/Data Sharing Policy Modifications.pdf. 82 Federal Bureau of Investigation (FBI). (2012, June). CODIS-NDIS Statistics [web post]. Retrieved from http://www.fbi.gov/about-us/lab/codis/ndis-statistics. 83 FBI. (n.d.). Frequently Asked Questions (FAQs) on the CODIS Program and the National DNA Index System [web post]. Retrieved from http://www.fbi.gov/about-us/lab/codis/ codis-and-ndis-fact-sheet/. 84 Collection and Use of DNA Identification Information from Certain Federal Offenders Act, 42 U.S.C. § 14135a; Collection of DNA Samples, 28 C.F.R. §28.12. 85 VA. (2011). The Million Veteran Program: VA’s Genomics Game-Changer Launches Nationwide [Press Release]. Retrieved from http://www.va.gov/opa/pressrel/pressrelease. cfm?id=2090. 86 VA has departmental policies, including the Notice of Privacy Handbook Practice 1605.04 and Determining Service Connection for Congenital, Developmental, or Hereditary Disorders. See Letter from Robert A. Petzel, Under Secretary for Health, VA to Amy Gutmann, Chair, PCSBI. (May 1, 2012). 87 VA. (2011). The Million Veteran Program: VA’s Genomics Game-Changer Launches Nationwide [Press Release]. Retrieved from http://www.va.gov/opa/pressrel/pressrelease. cfm?id=2090. 88 Letter from Judith S. Kaleta, Deputy General Counsel, DOT to Amy Gutmann, Chair, PCSBI. (August 1, 2012). 89 Bregman-Eschet, Y. (2006). Genetic Databases And Biobanks: Who Controls Our Genetic Privacy? 23 Santa Clara Computer & High Tech. L.J. 1. 90 23andMe. (2012, April 10). What is the difference between genotyping and sequencing? [Frequently Asked Questions web post]. Retrieved from https://customercare.23andme.com/ entries/21262606. 91 US Patent Number 8,187,811 (filed Nov. 30, 2010). 92 Lowrance, W. (2012). Privacy, Confidentiality, and Health Research. New York: Cambridge University Press, p. 48. 93 See e.g., Farahany, N.A. (2012).Searching Secrets, 160 U. Penn. L. Rev. 1277-83 (2012). 94 Confidentiality and Disclosure of Returns and Return Information, 26 U.S.C. § 6103(d) et. seq. 95 See e.g., Census Confidentiality Statute of 1954, 13 U.S.C. §9 (1954); HIPAA Privacy Rule, 45 C.F.R. § 164.514.

2038 96

Presidential Commission for the Study of Bioethical Issues

Fair Credit Reporting Act, 15 U.S.C. § 1681 et seq.; Privacy Act of 1974, 5 U.S.C. § 552a; HHS. (2004). The Confidentiality of Alcohol And Drug Abuse Patient Records Regulation and the HIPAA Privacy Rule: Implications for Alcohol and Substance Abuse Programs. June. Retrieved from http://www.nj.gov/ humanservices/das/information/SAMHSA-Pt2-HIPAA.pdf; Family Educational Rights and Privacy Act of 1974, 20 U.S.C. § 1232g; Electronic Communications Privacy Act of 1986, 18 U.S.C. § 2510-22; Video Privacy Act of 1988, 18 U.S.C. § 2710; Children’s Online Privacy Protection Act of 1998, 15 U.S.C. §§ 6501–6506; and Gramm-Leach-Bliley Act, Pub. L. 106-102, 113 Stat. 1338. 97 Department of Health, Education, and Welfare (DHEW). (1973). Records, Computers and the Rights of Citizens: Report of the Secretary’s Advisory Committee on Automated Personal Data Systems. Retrieved from http://aspe.hhs.gov/datacncl/1973privacy/ tocprefacemembers.htm. The Electronic Communications Privacy Act of 1986 is not a fair information statute, but rather a set of rules regulating government and other access to the many modes of communications used in daily life. 98 DHEW. (1973). Records, Computers and the Rights of Citizens: Report of the Secretary’s Advisory Committee on Automated Personal Data Systems. Retrieved from http://aspe. hhs.gov/datacncl/1973privacy/ tocprefacemembers.htm. 99 HIPAA, Pub. L. 104-191, 110 Stat. 1936, enacted August 21, 1996. 100 HIPAA Privacy Rule, 45 C.F.R. § 164.501. 101 HIPAA Privacy Rule, 45 C.F.R. § 160, 164. 102 HIPAA Privacy Rule, 45 C.F.R. § 164.514. 103 On the other hand, deceased individuals are not considered “human subjects” under, and are therefore not covered by, the Common Rule. 45 C.F.R. § 46.102(f). 104 HIPAA Administrative Simplification: Standards for Privacy of Individually Identifiable Health Information, Proposed Rule, 74 Fed. Reg. 51698 (Oct. 7, 2009). 105 Institute of Medicine (IOM). (2009). Beyond the HIPAA Privacy Rule: Enhancing Privacy, Improving Health Through Research. Washington, DC: National Academies Press. 106 HIPAA Privacy Rule, 45 C.F.R. § 164.502. 107 HIPAA Privacy Rule, 45 C.F.R. § 164.502(b). 108 HIPAA Privacy Rule, 45 C.F.R. § 164.502. 109 HITECH, 42 U.S.C. § 300jj. 110 The Office of the National Coordinator for Health Information Technology [web post]. (n.d.). Retrieved from http://healthit.hhs.gov/portal/server.pt/community/healthit_hhs_gov__onc/ 1200. 111 Protection of Human Subjects, 45 C.F.R. § 46. 112 Office for Human Research Protections (OHRP). (2008). OHRP Guidance on Research Involving Coded Private Information or Biological Specimens. October 16. Retrieved from http://www.hhs.gov/ohrp/policy/ cdebiol.html. 113 Human Subject Research Protections: Enhancing Protections for Research Subjects and Reducing Burden, Delay, and Ambiguity for Investigators, 76 Fed. Reg. 44512, 44524. 114 Ibid. 115 See e.g., The Personal Information Protection and Electronic Documents Act, S.C. 2000, c. 5 (Canada, 2000); The Personal Data Act (523/1999) (Finland, 1999); The Federal Data Protection Act, BDSG 2003 (Germany, 2003); Act on the Protection and Processing of Personal Data, No. 77/2000 (Iceland, 2000); Personal Data Protection Code, Legisl. Ital. 196 (Italy, 2003); Data Protection Act, Cap. 440 (Malta, 2001); Personal Data Protection Act, 95/46/EC (Netherlands, 2001); Privacy Act, Public Act 1993 No 28 (New Zealand, 1993). 116 European Union, Directive 95/46/EC (1995). 117 See e.g., The Personal Information Protection and Electronic Documents Act, S.C. 2000, c. 5 (Canada, 2000); European Union, Directive 95/46/EC (1995). 118 See e.g., Patient Rights’ Act, Law No. 482 (Denmark, 1998); Patients’ Rights Act, No. 63 (Norway, 1999). 119 See e.g., Law on the Rights of Patients, (Belgium, 2002); Act on the Status and Rights of Patients, No.785/1992 (Finland, 1992); Patient’s Rights Act (Romania, 1996). 120 Law No. 20120 on scientific research on human beings, the human genome, and the prohibition of cloning (Chile, 2007); see also, Human Genome Research Act, RT I 2000, 104, 685 (Estonia, 2000); Rights of Users of Genetic Services Act (France, 2004); Law 14/2007 on Biomedical Research (Spain, 2007); Human Genetic Examination Act (Germany, 2009); Genetic Information Law, 5761-2000 (Israel, 2000). 121 See e.g., Law on the Rights of Patients, No. 283-IIS (Georgia, 2000); Human Genetic Examination Act (Germany, 2009). 122 Genetic Information Nondiscrimination Act (GINA), 122 Stat. 881-922 (2008). 123 Kang, P.B. (2011). Presymptomatic and early symptomatic genetic testing. Neurogenetics, 2, 343-6. 124 Kostecka, B.E. (2009). GINA Will Protect You, Just Not From Death: The Genetic Information Nondiscrimination Act and Its Failure to Include Life Insurance within Its Protections, 34 Seton Hall Legis. J. 93 (2009). 125 HIPAA, 29 U.S.C. §§1181-82, 42 U.S.C. §§300gg-41. 126 GINA, 122 Stat. 881-922 (2008). 127 Ibid.

Privacy and Progress in Whole Genome Sequencing

2039

Rothstein, M.A. (n.d.). GINA’s beauty is only skin deep. Genewatch. Retrieved from http:// www.councilforresponsiblegenetics.org/GeneWatch/GeneWatchPage.aspx?pageId=184. 129 Kostecka, op cit. 130 See Appendix IV: State Law Tables. Also see Genome Statute and Legislation Database. (2010). Retrieved from http://www.genome.gov/PolicyEthics/LegDatabase/pubsearch.cfm 131 See e.g., Del. Code Ann. §§ 12.2.1220 to 12.2.1227. 132 See e.g., Ariz. Rev. Stat. Ann. §12-2801-4, §20-448.02. 133 See e.g., Colo. Rev. Stat. 10-3-1104.7. 134 Whalen v. Roe 429 U.S. 589 (1977); Sorrell v. IMS Health Inc., 131 S. Ct. 2653 (2011). 135 For a discussion on how Courts have generally disfavored a property-rights analysis in identifying information, see Farahany, op cit. 136 Moore v. Regents of the Univ. of Cal., 51 Cal. 3d 120 (Cal. 1990). 137 Rodriguez, L.L., Director, Office of Policy, Communications, and Education, National Human Genome Research Institute, NIH. (2012). Presentation to PCSBI, August 1, 2012. Retrieved from http://bioethics.gov/ cms/node/749. 138 Knoppers, B., Director, Centre of Genomics and Policy, Canada Research Chair in Law and Medicine, McGill University. (2012). Presentation to PCSBI, August 1, 2012. Retrieved from http://bioethics.gov/cms/node/740. 139 HITECH, Pub. L. 111-5, 123 Stat. 115 (2009); E-Government Act, Pub. L. 107-347, 116 Stat. 2899 (2002); HIPAA, Pub. L. 104-191, 110 Stat. 1936 (1996); Privacy Act, 5 U.S.C. § 552a; GINA, Pub. L. No. 110-233, 122 Stat. 881 (2008); PCSBI. (2012). Analysis of Responses to Common Rule Agency Data Call; See Appendix IV: U.S. State Genetic Laws. 140 An example of a third-party storage and analysis provider is cloud computing services, which include web-based systems of virtual servers. 141 Rachels, J. (1975). Why privacy is important. Philosophy & Public Affairs, 4(4), 323-333. 142 Sweeney, L.S., Visiting Professor and Scholar, Computer Science; Director, Data Privacy Lab, Harvard University. (2012). How technology is changing views of privacy. Presentation to PCSBI, August 1, 2012. Retrieved from http://bioethics.gov/cms/node/748. 143 Harmon, A. (2010, April 21). Indian tribe wins fight to limit research of its DNA. New York Times. Retrieved from http://www.nytimes.com/2010/04/22/us/22dna.html?pagewanted=all. 144 Bearder v. State, 788 N.W.2d 144 (2010); Settlement Agreement and Release, Beleno v. Tex. Dept. of State Health Servs., No. SA-09-CA-188-FB (W.D. Tex. 2009). Document obtained from plaintiffs’ attorney, Jim Harrington, at the Texas Civil Rights Project. 145 NIH. (2008). Policy for Sharing of Data Obtained in NIH Supported or Conducted Genome-Wide Association Studies (GWAS). Retrieved from http://grants.nih.gov/grants/guide/ notice-files/NOT-OD-07088.html. 146 GINA, Pub. L. No. 110-233, 122 Stat. 881 (2008). 147 Baruch, S., and K. Hudson. (2008). Civilian and military genetics: Nondiscrimination policy in a postGINA world. American Journal of Human Genetics, 83, 435-444; Greenbaum, D., et al. (2011). Genomics and privacy: Implications of the new reality of closed data for the field. PLoS Computational Biology, 7(12), e1002278; Hayden, E.C. (2012). A broken contract. Nature, 486, 312-314. 148 The Affordable Care Act of 2010 helps mitigate concerns about obtaining insurance with its prohibition on discriminating against individuals with pre-existing conditions. 149 Sweeney, L.S., Visiting Professor and Scholar, Computer Science Director, Data Privacy Lab, Harvard University. (2012). How Technology is Changing Views of Privacy. Presentation to PCSBI, August 1, 2012. Retrieved from http://bioethics.gov/cms/node/748. 150 Genetics and Public Policy Center. (2009, January 21). State laws pertaining to surreptitious DNA testing. Retrieved from http://www.dnapolicy.org/resources/State_law_summaries_ final_all_states.pdf. 151 Genomics Law Report. (2010). Surreptitious genetic testing: WikiLeaks highlights gap in genetic privacy law. Retrieved from http://www.genomicslawreport.com/index.php/ 2010/12/09/surreptitious-genetic-testingwikileaks-highlights-gap-in-genetic-privacy-law/. 152 Lake Research Partners and American Viewpoint. (2006). National Survey on Electronic Personal Health Records, conducted by the Markle Foundation. Retrieved from http://www.markle.org/sites/default/files/ research_doc_120706.pdf. 153 Aldhous, P., and M. Reilly. (2009). Special investigation: How my genome was hacked. New Scientist. Retrieved from http://www.newscientist.com/article/mg20127013.800-special-investigation-how-my-genome-washacked.html?page=1. 154 Green, R.C., and G.J. Annas. (2008). The genetic privacy of presidential candidates. New England Journal of Medicine, 359(21), 2192-2193. 155 HHS Health Information Privacy, HIPAA Breach Notification Rule, Breaches Affecting 500 or More Individuals. Retrieved from http://www.hhs.gov/ocr/privacy/hipaa/administrative/ breachnotificationrule/ breachtool.html. 156 Memorial Sloan-Kettering Cancer Center. (2012, June 15). Privacy Alert. Retrieved from http://www.mskcc.org/public-notices/privacy-alert. 128

2040 157

Presidential Commission for the Study of Bioethical Issues

Sweeney, L.S., Visiting Professor and Scholar, Computer Science Director, Data Privacy Lab, Harvard University. (2012). How Technology is Changing Views of Privacy. Presentation to PCSBI, August 1, 2012. Retrieved from http://bioethics.gov/cms/node/748. 158 Terry, S.F., and P.F. Terry. (2001). A consumer perspective on informed consent and third party issues. Journal of Continuing Education in the Health Professions, 21, 256-264. 159 HHS Health Information Privacy, HIPAA Breach Notification Rule, Breaches Affecting 500 or More Individuals. Retrieved from http://www.hhs.gov/ocr/privacy/hipaa/administrative/ breachnotificationrule/ breachtool.html. 160 Dissemination of Information (AHRQ), 42 USC §299C-3; General Provisions Respecting Effectiveness, Efficiency, and Quality of Health Services (CDC), 42 USC §242M; Justice System Improvement Administrative Provisions, 42 USCS § 3789g. Confidentiality of Information; The Public Health and Welfare Act, 42 U.S.C. § 46. 161 NIH. (2002). Notice NOT-OD-02-037, NIH Announces Statement on Certificates of Confidentiality. March 15. Retrieved from http://grants.nih.gov/grants/guide/notice-files/NOT-OD-02-037.html. 162 Cooper, Z.N., Nelson, R.M., and L.F. Ross. (2004). Certificates of confidentiality in research: Rationale and usage. Genetic Testing, 8(2), 214-220. This study sampled three NIH institutes: The National Human Genome Research Institute (NHGRI); the National Heart, Lung, and Blood Institute (NHLBI); and the National Institute of Neurological Disorders and Stroke (NINDS). 163 Angrist, M. (2010). Urge overkill: Protecting deidentified human subjects at what price? Health Privacy in Research, 10(9), 17-18; Catania, J.A., et al. (2007). Research participants’ perceptions of the certificate of confidentiality’s assurances and limitations. Journal of Empirical Research on Human Research Ethics, 2(4), 53-59; Cooper, Z.N., Nelson, R.M., and L.F. Ross. (2004). Certificates of confidentiality in research: Rationale and usage. Genetic Testing, 8(2), 214-220; Hudson, K., and S. Devaney. (2008). Novel forensic technique highlights need for greater privacy protection for research participants [News release]. Retrieved from http://www.dnapolicy.org/news.release.php?action=detail& pressrelease_id=104; Lo, B., and M. Barnes. (2011). Protecting research participants while reducing regulatory burdens. Journal of the American Medical Association, 306(20), 2260-2261; Wolf, L.E., and J. Zandecki. (2006). Sleeping better at night: Investigators’ experiences with certificates of confidentiality. IRB, 28(6), 1-7. 164 Liang, B.A., and T. Mackey. (2011). Reforming direct-to-consumer advertising. Nature Biotechnology, 29(5), 397400. 165 Dissemination of Information (AHRQ), 42 USC §299c-3(c). The confidentiality statute that is part of AHRQ’s authorizing legislation, grounded in judicially recognized public policies intended to foster participation in and the conduct of research, provides a respected form of federal statutory protection for all identifiable data submitted to the Agency, its grantees and contractors, for research purposes and permits no disclosures or uses of it, other than those consented to by the suppliers of the data or by the research subjects. Memorandum from Susan Greene Merewitz, Senior Attorney, AHRQ to Nancy Foster, Coordinator for Quality Activities, AHRQ. (April 16, 2001). Statutory Confidentiality Protection of Research Data. Retrieved from http://www.ahrq.gov/fund/datamemo.htm. 166 Office of Science and Technology Policy (OSTP). (2012, March 29). Obama administration unveils “Big Data” initiative: Announces $200 million in new R&D investments [Press release]. Retrieved from http://www.whitehouse.gov/sites/default/files/microsites/ostp/big _data_press_release_final_2.pdf. 167 National Human Genome Research Institute (NHGRI). (2012). 1000 Genomes Project data available on Amazon Cloud [Press release]. Retrieved from http://www.nih.gov/news/ health/mar2012/nhgri-29.htm. 168 Breach Notification for Unsecured Protected Health Information, 74 Fed. Reg. 42,740 (Aug. 24, 2009) (codified at 45 C.F.R. §§ 160, 164); Health Breach Notification Rule; Final Rule, 74 Fed. Reg. 42,962 (Aug. 25, 2009) (codified at 16 C.F.R. § 318); HIPAA Administrative Simplification: Enforcement; Final Rule, 71Fed. Reg. 8,390 (Feb. 16, 2006) (codified at 45 C.F.R. §§ 160, 164); Standards for Privacy of Individually Identifiable Health Information; Final Rule, 65 Fed. Reg. 82,462 (Dec. 28, 2000) (codified at 45 C.F.R. §§ 160, 164); Health Insurance Reform: Security Standards; Final Rule, 68 Fed. Reg. 8,334 (Feb. 20, 2003) (codified at 45 C.F.R. §§ 160, 162, and 164). 169 HHS. (2010). HHS Strengthens Health Information Privacy and Security through New Rules [Press Release]. Retrieved from http://www.hhs.gov/news/press/2010pres/07/20100708c. html; National Institutes for Standards and Technology (NIST). (2012). Guidelines on Security and Privacy in Public Cloud Computing. Retrieved from http://csrc.nist.gov/publications/nistpubs/800-144/SP800-144.pdf. 170 OHRP. (2008). Guidance on Research Involving Coded Private Information or Biological Specimens. October 16. Retrieved from http://www.hhs.gov/ohrp/policy/cdebiol.html. 171 Paasche-Orlow, M.K., Taylor, H.A., and F.L. Brancati. (2003). Readability standards for informed-consent forms as compared to actual readability. New England Journal of Medicine, 348(8), 721-726. 172 PRIM&R. (McGuire, A.L.) (2012). Data sharing in genomic research: Participant attitudes and ethical issues. [Webinar]. 173 Kaufman, D.J., et al. (2009). Public opinion about the importance of privacy in biobank research. American Journal of Human Genetics, 85, 643-654.

Privacy and Progress in Whole Genome Sequencing

2041

The Family Educational Rights and Privacy Act (FERPA), 20 U.S.C. § 1232g; 34 C.F.R. § 99; Children’s Online Privacy Protection Act of 1998, 18 U.S.C. §§ 6501-6506; Parent Initiated Alternatives Act of 2005, HB10582005-06 (Washington); Hickey, K. (2007). Minors’ rights in medical decision making. Journal of Nursing Administration Health Care Law, Ethics, and Regulation, 9(3), 100-104. 175 AMA. (1996). AMA Code of Medical Ethics, Opinion 2.138: Genetic testing of children. Retrieved from http://www.ama-assn.org/ama/pub/physician-resources/medical-ethics/code-medical-ethics/opinion2138. page; American Academy of Pediatrics. (2001). Ethical issues with genetic testing in pediatrics. Pediatrics, 107(6), 1451-1455; Donley, G., Hull, S.C., and B.E. Berkman. (2012). Prenatal Whole Genome Sequencing: Just Because We Can, Should We? Hastings Center Report, 42(4), 28-40. 176 Gostin, L.O. (2009). Privacy: Rethinking health information technology and informed consent. In M. Crowley (Ed.), Connecting American Values with Health Reform. Garrison, NY: The Hastings Center, pp. 15-17. 177 Kaye, J., et al. (2012). From patients to partners: Participant-centric initiatives in biomedical research. Nature Reviews Genetics, 13(5), 371-376; Nietfeld, J.J., Sugarman, J., and J.E. Litton. (2011). The Bio-PIN: A concept to improve biobanking. Nature Reviews Cancer, 11, 303-308; Time to open up. (2012). Nature, 486, 293. 178 Consent to Research (n.d.). About Us. Retrieved from http://weconsent.us/about. 179 Brothers, K.B., Morrison, D.R., and E.W. Clayton. (2011). Two large-scale surveys on community attitudes toward an opt-out biobank. American Journal of Medical Genetics, Part A, 155, 2982-2990. 180 Kaufman, D.J., et al. (2009). Public opinion about the importance of privacy in biobank research. American Journal of Human Genetics, 85, 643-654. 181 Valle-Mansilla, J.I., Ruiz-Canela, M., and D.P. Sulmasy. (2010). Patients’ attitudes to informed consent for genomic research with donated samples. Cancer Investigation, 28(7), 726-734. 182 Human Subjects Research Protections: Enhancing Protections for Research Subjects and Reducing Burden, Delay, and Ambiguity for Investigators, 76 Fed. Reg. 143, 44,513 (July 26, 2011). 183 Colditz, G.A. (2009). Constraints on data sharing: Experience from the Nurses’ Health Study. Epidemiology, 20(2), 169-171. 184 One potential result of this sharing of data between physicians and researchers is the publication of findings in academic journals. In the interest of making data sharing an element of the scholarly publication process, some journals require that, if public repositories have been established for a particular type of data (including whole genome sequence data), all data from which results were drawn should be deposited in open access databases before publication. 185 Knoppers, B., Director, Centre of Genomics and Policy, Canada Research Chair in Law and Medicine, McGill University. (2012). Consent and Return of Findings. Presentation to PCSBI, August 1, 2012. Retrieved from http://bioethics.gov/cms/node/740. 186 Johnson, E.J., and D. Goldstein. (2003). Do defaults save lives? Science, 302, 1338-1339. 187 Donate Life America. (2012). 2012 National Donor Designation Report Card Released [Press Release]. Retrieved from http://donatelife.net/2012-national-donor-designation-report-card-released/; Goldman, R. (2012, May 2). States see instant spike in organ donors following Facebook push. ABC News. Retrieved from http://abcnews.go.com/Health/states-instant-spike-organ-donors-facebook-push/story?id=16255979. 188 Sunstein, C.R., and R.H. Thaler. (2003). Libertarian paternalism is not an oxymoron. University of Chicago Law Review. Retrieved from http://www.law.uchicago.edu/ files/files/185.crs_.paternalism.pdf; Thaler, R.H., and C.R. Sunstein. (2008). Nudge: Improving Decisions About Health, Wealth, and Happiness. New Haven, CT: Yale University Press. 189 Human Subjects Research Protections: Enhancing Protections for Research Subjects and Reducing Burden, Delay, and Ambiguity for Investigators, 76 Fed. Reg. 143, 44,513 (July 26, 2011). 190 McGuire, A.L., and L.M. Beskow. (2010). Informed consent in genomics and genetic research. Annual Review of Genomics and Human Genetics, 11, 361-381. 191 Bollinger, J.M., et al. (2012). Public preferences regarding the return of individual genetic research results: Findings from a qualitative focus group study. Genetics in Medicine, 14(4), 451-457; Murphy, J., et al. (2008). Public expectations for return of results from large-cohort genetic research. American Journal of Bioethics, 8(11), 36-34; Terry, S.F., and P.F. Terry. (2011). Power to the people: Participant ownership of clinical trial data. Science Translational Medicine, 3(69), 1-3. 192 Murphy, J., et al. (2008). Public expectations for return of results from large-cohort genetic research. American Journal of Bioethics, 8(11), 36-43. 193 Maschke, K.J. (2012). Returning genetic research results: Considerations for existing no-return and future biobanks. Minnesota Journal of Law, Science, and Technology, 13(2), 559-573. 194 Clinical Laboratory Improvement Amendments of 1988 (CLIA), 42 U.S.C. § 263a (2006). 195 Sharp, S.E., and B.L. Elder. (2004). Competency assessment in the clinical microbiology laboratory. Clinical Microbiology Review, 17(3), 681-694. 196 CLIA, 42 U.S.C. § 263a (2006). 197 Hudson, K., et al. (2006). Oversight of U.S. genetic testing laboratories. Nature Biotechnology, 24(9), 10831091; Ledbetter, D.H., and W.A. Faucett. (2008). Issues in genetic testing for ultra-rare diseases: Background and introduction. Genetics in Medicine, 10(5), 309-313. 174

2042 198

Presidential Commission for the Study of Bioethical Issues

Wolf, S.M. (2012). The past, present, and future of the debate over return of research results and incidental findings. Genetics in Medicine, 14(4), 355-357. 199 Green, R., et al. (2012). Exploring concordance and discordance for return of incidental findings from clinical sequencing. Genetics in Medicine, 14(4), 1-6. 200 GARNET. (2012). GARNET Statement on Incidental Findings and Potentially Clinically Relevant Genetic Results. May 18. Retrieved from https://www.garnetstudy.org/sites/ www/content/files/subcom/if/GARNET_ RORstatement_final.pdf. 201 Kohane, I.S., et al. (2007). Reestablishing the researcher-patient compact. Science, 316, 836-837. 202 Wolf, S.M., et al. (2012). Managing incidental findings and research results in genomic research involving biobanks and archived data sets. Genetics in Medicine, 14(4), 361-384. 203 Berg, J.S., Khoury, M.J., and J.P. Evans. (2011). Deploying whole genome sequencing in clinical practice and public health: Meeting the challenge one bin at a time. Genetics in Medicine, 13(6), 499-504. 204 Kohane, I.S., and P.L. Taylor. (2010). Multidimensional results reporting to participants in genomic studies: Getting it right. Science Translational Medicine, 2(37), 1-4. 205 Angrist, M. (2011). You never call, you never write: Why return of ‘omic’ results to research participants is both a good idea and a moral imperative. Personalized Medicine, 8(6), 651-657; Kohane, I.S., et al. (2007), op cit.; Terry, S., and R. Cook-Deegan. (2012, June 8). Your genome belongs to you. Health Affairs Blog. Retrieved from http://healthaffairs.org/ blog/2012/06/08/your-genome-belongs-to-you/; Time to open up. (2012). Nature, 486, 293. 206 Genomics Law Report. (2011, March 11). The FDA and DTC genetic testing: Setting the record straight. Retrieved from http://www.genomicslawreport.com/index.php/2011/03/11/ the-fda-and-dtc-genetic-testing-setting-therecord-straight/. 207 Vorhaus, D., MacArthur, D., and L. Jostins. (2011, June 16). DTC genetic testing and the FDA: Is there an end in sight on regulatory uncertainty? [Blog]. Retrieved from http://www.genomesunzipped.org/2011/06/ dtc-genetictesting-and-the-fda-is-there-an-end-in-sight-to-the-regulatory-uncertainty.php#more-3681. 208 The Commission plans to look into incidental findings in a future report. 209 Beecher, H.K. (1966). Ethics and clinical research. New England Journal of Medicine, 274(24), 1354-1360; Jones, J.H. (1993) Bad Blood: The Tuskegee Syphilis Experiment. New York: The Free Press; Advisory Committee on Human Radiation Experiments (ACHRE). (1996). Final Report of the Advisory Committee on Human Radiation Experiments. New York: Oxford University Press. 210 Friedman, C.P., Wong, A.K., and D. Blumenthal. (2010). Achieving a nationwide learning health system. Science Translational Medicine, 2(57), 1-3. 211 IOM. (2007). The Learning Health Care System: Workshop Summary (IOM Roundtable on Evidence-Based Medicine). Washington, DC: The National Academies Press. 212 Kass, N., Faden, R., and S. Tunis. (2012). Addressing low-risk comparative effectiveness research in proposed changes to U.S. federal regulations governing research. Journal of the American Medical Association, 307(15), 1589-1590. 213 Friedman, C.P., op cit. 214 IOM. (2011). Integrating Large-scale Genomic Information into Clinical Practice: Workshop Summary. Washington, DC: National Academies Press; IOM. (2012). Digital Data Priorities for Continuous Learning in Health and Health Care: An Institute of Medicine Workshop. National Academies Press: Washington, DC; IOM. (2011). Digital Infrastructure for the Learning Health System: The Foundation for Continuous Improvement in Health and Health Care. Washington, DC: National Academies Press; Nass, S.J., Levit, L.A., and L.O. Gostin. (2009). Beyond the HIPAA Privacy Rule: Enhancing Privacy, Improving Health Through Research. Washington, DC: National Academies Press. 215 President’s Council of Advisors on Science and Technology. (2010). Report to the President Realizing the Full Potential of Health Information Technology to Improve Health Care for Americans: The Path Forward. Retrieved from http://www.whitehouse.gov/sites/default/ files/microsites/ostp/pcast-health-it-report.pdf. 216 CDC. (2012). Next generation sequencing: Standardization of clinical testing (Nex-StoCT) working group. Retrieved from http://www.cdc.gov/osels/lspppo/Genetic_Testing_Quality _Practices/Nex-StoCT.html. 217 Kaye, J., Director of the Centre for Law, Health and Emerging Technologies, Oxford University. (2012). Privacy II – Control, Access and Human Genome Sequence Data. Presentation to PCSBI, February 2, 2012. Retrieved from http://bioethics.gov/cms/node/ 659. 218 Kaye, J., et al. (2012). From patients to partners: Participant-centric initiatives in biomedical research. Nature Reviews, 13, 371-376. 219 The Patient-Centered Outcomes Research Institute (PCORI). (2012). Retrieved from http://www.pcori.org/. 220 Wetterstrand, K.A. (n.d.). DNA Sequencing Costs: Data from the NHGRI Large-Scale Genome Sequencing Program Retrieved from www.genome.gov/sequencingcosts. 221 Brothers K.B., Morrison D.R., and E.W. Clayton. (2011). Two large-scale surveys on community attitudes toward an opt-out biobank. American Journal of Medical Genetics Part A, 155, 2982-2990; Human Subjects Research Protections: Enhancing Protections for Research Subjects and Reducing Burden, Delay, and Ambiguity for

Privacy and Progress in Whole Genome Sequencing

2043

Investigators, 76 Fed. Reg. 143, 44,513 (July 26, 2011); Kaye, J., et al., op cit; HITECH, Pub. L. 111-5, 123 Stat. 115 (2009). 222 Battelle. (n.d.). $3.8 billion investment in Human Genome Project drove $796 billion in economic impact creating 310,000 jobs and launching the genomic revolution. Retrieved from http://www.battelle.org/media/ news/2011/05/11/$3.8-billion-investment-in-human-genome-project-drove-$796-billion-in-economicimpactcreating-310-000-jobs-and-launching-the-genomic-revolution. 223 Bustamante, D.D., Burchard, E.G., and F.M. De la Vega. (2011). Genomics for the world. Nature, 475, 163-165. 224 Length of a human DNA molecule. In The Physics Factbook. Elert, G. (Ed.). Retrieved from http:// hypertextbook.com/facts/1998/StevenChen.shtml. 225 NIH. (2012). Clinical sequencing exploratory research coordinating center (U01). RFA-HG-12-008. Retrieved from http://grants.nih.gov/grants/guide/rfa-files/RFA-HG-12-008.html. 226 Gimelbrant, A., et al. (2007). Widespread monoallelic expression on human autosomes. Science, 318(5853), 11361140; Mardis, E.R. (2011). A decade’s perspective on DNA sequencing technology. Nature, 470, 198-203; Lander, E. (2011). Initial impact of the sequencing of the human genome. Nature, 470, 187-197; Mason, C.E., and E. Onull. (2012). Faster sequencers, larger datasets, new challenges. Genome Biology, 13, 314. 227 Choia, M., et al. (2010). Genetic diagnosis by whole exome capture and massively parallel DNA sequencing. PNAS, 106, 19096-19101; Ng, S.B., et al. (2009). Targeted capture and massively parallel sequencing of 12 human exomes. Nature, 461, 272-276. 228 Ramos, E., and C. Rotimi. (2009). The A’s, G’s, C’s, and T’s of health disparities. BMC Medical Genomics, 2, 29.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 95

GENETIC TESTING: SCIENTIFIC BACKGROUND FOR POLICYMAKERS Amanda K. Sarata ABSTRACT Congress has considered, at various points in time, numerous pieces of legislation that relate to genetic and genomic technology and testing. These include bills addressing genetic discrimination in health insurance and employment; personalized medicine; the patenting of genetic material; and the quality of clinical laboratory tests, including genetic tests. The focus on these issues signals the growing importance of the public policy issues surrounding the clinical and public health implications of new genetic technology. As genetic technologies proliferate and are increasingly used to guide clinical treatment, these public policy issues are likely to continue to garner considerable attention. Understanding the basic scientific concepts underlying genetics and genetic testing may help facilitate the development of more effective public policy in this area. Most diseases have a genetic component. Some diseases, such as Huntington’s Disease, are caused by a specific gene. Other diseases, such as heart disease and cancer, are caused by a complex combination of genetic and environmental factors. For this reason, the public health burden of genetic disease is substantial, as is its clinical significance. Experts note that society has recently entered a transition period in which specific genetic knowledge is becoming critical to the delivery of effective health care for everyone. Therefore, the value of and role for genetic testing in clinical medicine is likely to increase significantly in the future.

INTRODUCTION Virtually all disease has a genetic component.1 The term “genetic disease” has traditionally been used to refer to rare monogenic (caused by a single gene) inherited disease, for example,  This is an edited, reformatted and augmented version of a Congressional Research Service publication, CRS Report

for Congress RL33832, prepared for Members and Committees of Congress, from www.crs.gov, dated December 19, 2011.

2046

Amanda K. Sarata

cystic fibrosis. However, we now know that many common complex human diseases, including common chronic conditions such as cancer, heart disease, and diabetes, are influenced by several genetic and environmental factors.2 For this reason, they could all be said to be “genetic diseases.” Considering this broader definition of genetic disease, the public health burden of genetic disease can be seen to be substantial. In addition, an individual patient’s genetic makeup, and the genetic make-up of his disease, will help guide clinical decision making. Experts note that “(w)e have recently entered a transition period in which specific genetic knowledge is becoming critical to the delivery of effective health care for everyone.”3 This sentiment is still broadly shared, despite the fact that the translation to practice has perhaps been slower than anticipated due to the lack of a comprehensive evidence base to inform clinical validity and utility determinations for many genomic technologies. Experts in the field note that, “[d]espite dramatic advances in the molecular pathogenesis of disease, translation of basic biomedical research into safe and effective clinical applications remains a slow, expensive, and failureprone endeavor.”4 Over time, as translational obstacles are addressed, the value of and role for genetic testing in clinical medicine is likely to increase significantly. As the role of genetics in clinical medicine and public health continues to grow, so too will the importance of public policy issues raised by genetic technologies. Science is beginning to unlock the complex nature of the interaction between genes and the environment in common disease, and their respective contributions to the disease process. The information provided by the Human Genome Project is helping scientists and clinicians to identify common genetic variation that contributes to disease, primarily through genome-wide association studies (GWAS).5 However, researchers have identified a significant translational gap between genetic discoveries and application in clinical and public health practice and note that “the pace of implementation of genome-based applications in health care and population health has been slow.”6 Efforts are underway to close this gap and expedite translation into practice, specifically the recent development of the NIH-CDC collaborative Genomic Applications in Practice and Prevention Network.7 Experts note that the moderate effect of many common variants, uncovered by GWAS, has helped to underscore the multifactorial etiology of complex disease, and that substantially greater research efforts will be required to detect “missing” genetic influences.8 GWAS efforts have identified 1,100 well-validated genetic risk factors for common disease; however, the potential for many of these factors to serve as drug targets is unknown.9 In addition, research conducted utilizing large population databases that collect health, genetic, and environmental information about entire populations will likely provide more information about the genetic and environmental underpinnings of common diseases. Many countries have established such databases, including Iceland, the United Kingdom, and Estonia. The knowledge of the potential relevance of genetic information to the clinical management of nearly all patients coupled with the lack of complete information about the genetic and environmental factors underlying disease creates a challenging climate for public policymaking. In many cases, the results of genetic testing may be used to guide clinical management of patients, and a particularly prominent role is anticipated in the realm of preventive medicine.10 For example, more frequent screening may be recommended for individuals at increased risk of certain diseases by virtue of their genetic make-up, such as colorectal and breast cancer. In some cases, prophylactic surgery may even be indicated. Decisions about courses of treatment and dosing may also be guided by genetic testing, as might reproductive decisions (both clinical and personal). However, many diseases with an identified molecular cause do not have any

Genetic Testing: Scientific Background for Policymakers

2047

treatment available; specifically, therapies exist only for approximately 200 of the more than 4,000 conditions with a known molecular cause.11 In these cases, the benefits of genetic testing lie largely in the information they provide an individual about his or her risk of future disease or current disease status. The value of genetic information in these cases is personal to individuals, who may choose to utilize this information to help guide medical and other life decisions for themselves and their families. The information can affect decisions about reproduction; the types or amount of health, life, or disability insurance to purchase; or career and education choices. As genetic research continues to advance rapidly, it will often be the case that genetic testing may be able to provide information about the probability of a health outcome without an accompanying treatment option. This situation again creates unique public policy challenges, for example, in terms of decisions about the coverage of genetic testing services and education about the value of testing. Policymakers may need to balance concerns about the potential use and misuse of genetic information, as well as issues of genetic exceptionalism12 and genetic determinism13, with the potential of genetics and genetic technology to improve care delivery, for example by personalizing medical care and treatment of disease. In addition, policymakers face decisions about the extent of federal oversight and regulation of genetic tests, patients’ safety, and innovation in this area. Finally, the need for and degree of federal support for research to develop a comprehensive evidence base to facilitate the integration of genetic testing into clinical practice (for example, to support coverage decisions by health insurers) may be debated. This report will summarize basic scientific concepts in genetics and will provide an overview of genetic tests, their main characteristics, and the key policy issues they raise.

FUNDAMENTAL CONCEPTS IN GENETICS The following section explains key concepts in genetics that are essential for understanding genetic testing and issues associated with testing that are of interest to Congress.

Cells Contain Chromosomes Humans have 23 pairs of chromosomes in the nucleus of most cells in their bodies. These include 22 pairs of autosomal chromosomes (numbered 1 through 22) and one pair of sex chromosomes (X and Y). One copy of each autosomal chromosome is inherited from the mother and from the father, and each parent contributes one sex chromosome. Many syndromes involving abnormal human development result from abnormal numbers of chromosomes (such as Down Syndrome). Other diseases, such as leukemia, can be caused by breaks in or rearrangements of chromosome pieces.

Chromosomes Contain DNA Chromosomes are composed of deoxyribonucleic acid (DNA) and protein. DNA is comprised of complex chemical substances called bases. Strands made up of combinations of

2048

Amanda K. Sarata

the four bases (adenine (A), guanine (G), cytosine (C) and thymine (T)) twist together to form a double helix (like a spiral staircase). Chromosomes contain almost 3 billion base pairs of DNA that code for about 20,000-25,000 genes (this is a current estimate, although it may change and has changed several times since the publication of the human genome sequence).14

DNA Codes for Protein Proteins are fundamental components of all living cells. They include enzymes, structural elements, and hormones. Each protein is made up of a specific sequence of amino acids. This sequence of amino acids is determined by the specific order of bases in a section of DNA. A gene is the section of DNA which contains the sequence which corresponds to a specific protein. Changes to the DNA sequence, called mutations, can change the amino acid sequence. Thus, variations in DNA sequence can manifest as variations in the protein which may affect the function of the protein. This may result in, or contribute to the development of, a genetic disease.

Genotype Influences Phenotype Though most of the genome is very similar between individuals, there can be significant variation in physical appearance or function between individuals. In other words, although we share most of the genetic material we have, we can see that there are significant differences in our physical appearance (height, weight, eye color, etc.). Humans inherit one copy (or allele) of most genes from each parent. The specific alleles that are present on a chromosome pair constitute a person’s genotype. The actual observable, or measurable, physical trait is known as the phenotype. For example, having two brown-eye color alleles would be an example of a genotype and having brown eyes would be the phenotype. Many complex factors affect how a genotype (DNA) translates to a phenotype (observable trait) in ways that are not yet clear for many traits or conditions. Study of a person’s genotype may determine if a person has a mutation associated with a disease, but only observation of the phenotype can determine if that person actually has physical characteristics or symptoms of the disease. Generally, the risk of developing a disease caused by a single mutation can be more easily predicted than the risk of developing a complex disease caused by multiple mutations in multiple genes and environmental factors. Complex diseases, such as heart disease, cancer, immune disorders, or mental illness, for example, have both inherited and environmental components that are very difficult to separate. Thus, it can be difficult to determine whether an individual will develop symptoms, how severe the symptoms may be, or when they may appear.

GENETIC TESTS What Is a Genetic Test? Scientifically, a genetic test may be defined as:

Genetic Testing: Scientific Background for Policymakers

2049

an analysis performed on human DNA, RNA, genes, and/or chromosomes to detect heritable or acquired genotypes, mutations, phenotypes, or karyotypes that cause or are likely to cause a specific disease or condition. A genetic test also is the analysis of human proteins and certain metabolites, which are predominantly used to detect heritable or acquired genotypes, mutations, or phenotypes.15

Once the sequence of a gene is known, looking for specific changes is relatively straightforward using the modern techniques of molecular biology. In fact, these methods have become so advanced that hundreds or thousands of genetic variations can be detected simultaneously using a technology called a microarray.16

Policy Issues The way genetic test is defined can be very important to the development of geneticsrelated public policy. For example, the above scientific definition is very broad, including both predictive and diagnostic tests and analyses on a broad range of material (nucleic acid, protein, and metabolites), but this may not be the best way to achieve certain policy goals. It may sometimes be desirable to limit the definition only to predictive, and not diagnostic, genetic testing because often, predictive tests raise public policy concerns that diagnostic tests do not (see “What Are the Different Types of Genetic Tests?”). In other cases, it may be desirable to limit the definition to only analysis of specific material, such as DNA, RNA, and chromosomes, but not metabolites or proteins, for example, to help avoid capturing certain types of tests, such as some newborn screening tests, in the scope of a proposed law. Policies extending protection against discrimination may aim to be as broad as possible, whereas policies addressing the stringency of oversight of genetic tests may aim to be more limited (to predictive or probabilistic tests only, or to those for conditions with no treatment, for example).

How Many Genetic Tests are Available? As of December 2011, genetic tests are available for 2,492 diseases. Of those tests, 2,238 are available for clinical diagnosis, while 254 are available for research only.17 The majority of these tests are for single-gene rare diseases.

What Are the Different Types of Genetic Tests? Most clinical genetic tests are for rare disorders, but increasingly, tests are becoming available to determine susceptibility to common, complex diseases and to predict response to medication. With respect to health-related tests (i.e., excluding tests used for forensic purposes, such as “DNA fingerprinting”), there are two general types of genetic testing: diagnostic and predictive. Genetic tests can be utilized to identify the presence or absence of a disease (diagnostic). Predictive genetic tests can be used to predict if an individual will definitely get a disease in the future (presymptomatic) or to predict the risk of an individual getting a disease in the future (predispositional). For example, testing for mutations in the BRCA1 and/or BRCA2 genes provides probabilistic information about how likely an individual is to develop

2050

Amanda K. Sarata

breast cancer in his or her lifetime (predispositional). The genetic test for Huntington’s Disease provides genetic information that is predictive in that it allows a physician to predict with certainty whether an individual will develop the disease, but does not allow the physician to determine when the onset of symptoms will actually occur (presymptomatic). In both of these examples, the individual does not have the clinical disease at the time of genetic testing, as they would with diagnostic genetic testing. Within this broader framework of diagnostic and predictive genetic tests, several distinct types of genetic testing can be considered. Reproductive genetic testing can identify carriers of genetic disorders, establish prenatal diagnoses or prognoses, or identify genetic variation in embryos before they are used in in vitro fertilization. Reproductive genetic testing, such as prenatal testing, may be either diagnostic or predictive in nature. Newborn screening is a type of genetic testing that identifies newborns with certain metabolic or inherited conditions (although not all newborn screening tests are genetic tests). Traditionally, most newborn screening has been diagnostic, but some states have chosen to add certain predictive genetic testing to their newborn screening panels (for example, Maryland includes testing for cystic fibrosis).18 Finally, pharmacogenomic testing, or testing to determine a patient’s likely response to a medication, may be considered either diagnostic or predictive, depending on the context in which it is being utilized (i.e., before administration of a medication to determine potential effectiveness, dosing levels, or potential adverse interactions or events vs. after administration and manifestation of a clinical event, for use in determining the basis of the specific event or outcome in the particular patient).

Policy Issues Generally, predictive genetic testing (both presymptomatic and predispositional), rather than diagnostic testing, raises more complex ethical, legal, and social issues. For example, issues surrounding insurance coverage and reimbursement for this type of test, especially if no treatment is available, are more complex than with diagnostic genetic testing. A private insurer may feel that paying for a test that predicts the onset of a disease with no treatment is not costeffective. Even more complicated are cases where the test only shows an increased probability of getting a disease. Another issue is the oversight of genetic tests. Decisions about the need for oversight of genetic testing may be based on whether the information they provide is probabilistic rather than diagnostic, and whether a treatment is available. Additionally, stronger regulation of direct-to consumer marketing of genetic tests, or direct access testing,19 may be desirable in cases where a test is probabilistic rather than diagnostic. Finally, issues of genetic discrimination may be different with predictive testing than they are with diagnostic testing. Genetic discrimination may be defined as differential treatment in either health insurance coverage or employment based upon an individual’s genotype. Discriminatory action based on the possibility of something happening in the future, or even the certainty of it happening in the future, might raise more concern than would action taken based upon diagnostic information. With probabilistic genetic information (generated by predictive testing, see above), the health outcome at issue may never manifest, or if it is certain to, may not manifest for decades into the future. An individual’s concern about the privacy of her genetic information may also be different if the information is probabilistic. For example, an individual who tests positive for being at increased risk of developing breast cancer in the future might believe unfavorable insurance or employment decisions based on this information

Genetic Testing: Scientific Background for Policymakers

2051

in the present (when she does not have breast cancer) would be unfair. If this were in fact her belief, this individual may have heightened concern with keeping this information private from health insurers or employers.

The Genetic Test Result Genetic tests can provide information about both inherited genetic variations, that is, the individual’s genes that were inherited from their mother and father, as well as about acquired genetic variations, such as those that cause some tumors. Acquired variations are not inherited, but rather are acquired in DNA due to replication errors or exposure to mutagenic chemicals and radiation (e.g., UV rays). In contrast with most other medical tests, genetic tests can be performed on material from a body, and may continue to provide information after the individual has died, as a result of the stability of the DNA molecule. DNA-based testing of inherited genetic variations differs from other medical testing in several ways. These test results can have exceptionally long-range predictive powers over the lifespan of an individual; can predict disease or increased risk for disease in the absence of clinical signs or symptoms; can reveal the sharing of genetic variants within families at precise and calculable rates; and, at least theoretically, have the potential to generate a unique identifier profile for individuals. Genetic changes to inherited genes can be acquired throughout a person’s life (acquired genetic variation). Tests that are performed for acquired genetic variations that occur with a disease have implications only for individuals with the disease, and not family members. Tests for acquired genetic variations are also usually diagnostic rather than predictive, since these tests are generally performed after the presentation of symptoms. Pharmacogenomic testing may be used to determine both acquired genetic variations in disease tissue (i.e., acquired variations in a tumor) or may be used to determine inherited variations in an individual’s drug metabolizing enzymes. For example, with respect to determining acquired genetic variations in disease tissue, a tumor may have acquired genetic variations that render the tumor susceptible or resistant to chemotherapy. With respect to inherited genetic variation in drug metabolizing enzymes, an individual may, for example, be found to be a slow metabolizer of a certain type of drug (e.g., statins) and this information can be used to guide both drug choice and dosing.

Policy Issues In some cases, people feel differently about their genetic information than they do about other medical information, a sentiment embodied by the concept of genetic exceptionalism. This viewpoint may be based on actual differences between genetic testing and other medical testing, but also may be based on personal belief that genetic information is powerful and different than other medical information. For example, genetic information about an individual may reveal things about family members, and therefore decisions by an individual to share her own genetic information can potentially also affect her family. Partially as a result of these considerations, the 110th Congress passed the Genetic Information Nondiscrimination Act of 2008 (P.L. 110-233), and many states, beginning in the early 1990s, enacted laws addressing genetic discrimination in health insurance, employment, and life insurance. Whether genetic

2052

Amanda K. Sarata

information is in fact different from other medical information and whether it deserves special protection are important public policy issues.20 Pharmacogenomic testing is important because it will help provide the foundation for personalized medicine. Personalized medicine is healthcare based on individualized diagnosis and treatment for each patient determined by information at the genomic level. Many public policy issues are associated with personalized medicine. For example, there is some uncertainty currently as to how health insurers will assess and choose to cover pharmacogenomic testing as it becomes available. In addition, there are issues surrounding the regulation of pharmacogenomic testing and the encouragement of the co-development of drugs and diagnostic genetic tests (companion diagnostics). Companion diagnostics guide the use of the drug in a given individual.

Characteristics of Genetic Tests Genetic tests function in two environments: the laboratory and the clinic. Genetic tests are evaluated based primarily on three characteristics: analytical validity, clinical validity, and clinical utility.

Analytical Validity Analytical validity is defined as the ability of a test to detect or measure the analyte it is intended to detect or measure.21 This characteristic is critical for all clinical laboratory testing, not only genetic testing, as it provides information about the ability of the test to perform reliably at its most basic level. This characteristic is relevant to how well a test performs in a laboratory. Clinical Validity The clinical validity of a genetic test is its ability to accurately diagnose or predict the risk of a particular clinical outcome. A genetic test’s clinical validity relies on an established connection between the DNA variant being tested for and a specific health outcome. Clinical validity is a measure of how well a test performs in a clinical rather than laboratory setting. Many measures are used to assess clinical validity, but the two of key importance are clinical sensitivity and positive predictive value. Genetic tests can be either diagnostic or predictive and, therefore, the measures used to assess the clinical validity of a genetic test must take this into consideration. For the purposes of a genetic test, positive predictive value can be defined as the probability that a person with a positive test result (i.e., the DNA variant tested for is present) either has or will develop the disease the test is designed to detect. Positive predictive value is the test measure most commonly used by physicians to gauge the usefulness of a test to clinical management of patients. Determining the positive predictive value of a predictive genetic test may be difficult because there are many different DNA variants and environmental modifiers that may affect the development of a disease. In other words, a DNA variant may have a known association with a specific health outcome, but it may not always be causal. Clinical sensitivity may be defined as the probability that people who have, or will develop a disease, are detected by the test.

Genetic Testing: Scientific Background for Policymakers

2053

Clinical Utility Clinical utility takes into account the impact and usefulness of the test results to the individual and family and primarily considers the implications that the test results have for health outcomes (for example, is treatment or preventive care available for the disease). It also includes the utility of the test more broadly for society, and can encompass considerations of the psychological, social, and economic consequences of testing. Policy Issues These three above-mentioned characteristics of genetic tests, or analytic validity, clinical validity, and clinical utility, have important ties to public policy issues. For example, although the analytical validity of genetic tests is regulated by the Centers for Medicare and Medicaid Services (CMS) through the Clinical Laboratory Improvement Amendments (CLIA) of 1988 (P.L. 100- 578), the clinical validity of the majority of genetic tests is not regulated at all. This has raised concerns about direct-to-consumer marketing of genetic tests where the connection between a DNA variant and a clinical outcome has not been clearly established. Marketing of such tests to consumers directly may mislead consumers into believing that the advice given them based on the results of such tests could improve their health status or outcomes when in fact there is no scientific basis underlying such an assertion. This issue was the subject of a July 2006 hearing by the Senate Special Committee on Aging. In addition, clinical utility and clinical validity both figure prominently into coverage decisions by payers, but a lack of data often hinders coverage decisions, potentially leaving patients without coverage for these tests.

Coverage by Health Insurers Health insurers are playing an increasingly large role in determining the availability of genetic tests by deciding which tests they will pay for as part of their covered benefit packages. Many aspects of genetic tests, including their clinical validity and utility, may complicate the coverage decision-making process for insurers. While insurers require that, where applicable, a test be approved by the Food and Drug Administration (FDA), they also want evidence that it is “medically necessary;” that is, evidence demonstrating that a test will affect a patient’s health outcome in a positive way. This additional requirement of evidence of improved health outcomes underscores the importance of patient participation in long-term research in genetic medicine. Particularly for genetic tests, data on health outcomes may take a very long time to collect.

Policy Issues Decisions by insurers to cover new genetic tests have a significant impact on the utilization of such tests and their eventual integration into the health care system. The integration of personalized medicine into the health care system will be significantly affected by coverage decisions. Although insurers are beginning to cover pharmacogenomic tests and treatments, the high cost of such tests and treatments often means that insurers require stringent evidence that they will improve health outcomes. As mentioned previously, this evidence is often lacking. In addition, coverage of many genetic tests and services, which may be considered preventive in some cases, might be affected by the passage of the Patient Protection and

2054

Amanda K. Sarata

Affordable Care Act of 2010 (ACA, P.L. 111-148). The ACA requires private health insurers, Medicare, and Medicaid to cover clinical preventive services (as specified in the law) and outlines cost-sharing requirements in some cases for these services.22 However, the ACA provisions in some cases tie coverage of clinical preventive services to determinations by the U.S. Preventive Services Task Force (USPSTF, located in the Agency for Healthcare Research and Quality), and these determinations are based on the quality of the evidence available to support a given clinical preventive service. For this reason, coverage of genetic tests and services (that are determined to be preventive clinical services) might be negatively affected by a lack of high-quality evidence to support their use.

Regulation of Genetic Tests by the Federal Government Genetic tests are regulated by the Food and Drug Administration (FDA) and CMS, through CLIA. FDA regulates genetic tests that are manufactured by industry and sold for clinical diagnostic use. These test kits usually come prepackaged with all of the reagents and instructions that a laboratory needs to perform the test and are considered to be products by the FDA. FDA requires manufacturers of the kits to ensure that the test detects what the manufacturer says it will, in the intended patient population. With respect to the characteristics of a genetic test, this process requires manufacturers to prove that their test is clinically valid. Depending on the perceived risk associated with the intended use promoted by the manufacturer, the manufacturer must determine that the genetic test is safe and effective, or that it is substantially equivalent to something that is already on the market that has the same intended use. Most genetic tests, however, are performed not with test kits, but rather as laboratory testing services (referred to as either laboratory-developed or “homebrew” tests), meaning that clinical laboratories themselves perform the test in-house and make most or all of the reagents used in the tests. Laboratory-developed tests (LDTs) are not currently regulated by the FDA in the way that test kits are and, therefore, the clinical validity of the majority of genetic tests is not regulated. The FDA does regulate certain components used in LDTs, known as Analyte Specific Reagents (ASRs), but only if the ASR is commercially available. If the ASR is made in-house by a laboratory performing the LDT, the test is not regulated at all by the FDA. This type of test is sometimes referred to informally as a “homebrew-homebrew” test. Any clinical laboratory test that is performed with results returned to the patient must be performed in a CLIA-certified laboratory. CLIA is primarily administered by CMS in conjunction with the Centers for Disease Control and Prevention (CDC) and the FDA.23 FDA determines the category of complexity of the test so the laboratories know which requirements of CLIA they must follow. As previously noted, CLIA regulates the analytical validity of a clinical laboratory test only. It generally establishes requirements for laboratory processes, such as personnel training and quality control or quality assurance programs. CLIA requires laboratories to prove that their tests work properly, to maintain the appropriate documentation, and to show that tests are interpreted by laboratory professionals with the appropriate training. However, CLIA does not require that tests made by laboratories undergo any review by an outside agency to see if they work properly. Supporters of the CLIA regulatory process argue that regulation of the testing process gives the laboratories optimal flexibility to modify tests

Genetic Testing: Scientific Background for Policymakers

2055

as new information becomes available. Critics argue that CLIA does not go far enough to assure the accuracy of genetic tests since it only addresses analytical validity and not clinical validity.

End Notes Collins, F.S. and V.A. McCusick. (2001) “Implications of the Human Genome Project for Medical Science.” Journal of the American Medical Association 285:540-544. 2 Manolio, T.A. et al. (2009) “Finding the missing heritability of complex diseases.” Nature 461(8): 747-753. 3 Guttmacher, A.E. and F.S. Collins. (2002) “Genomic Medicine - A Primer.” New England Journal of Medicine 347(19): 1512-1520. 4 Collins F.S. (2011) “Reengineering Translational Science: The Time Is Right.” Sci Transl Med. 3(90):90cm17. 5 Genome-wide association studies are defined by the National Human Genome Research Institute as “...an approach used in genetics research to associate specific genetic variations with particular diseases. The method involves scanning the genomes from many different people and looking for genetic markers that can be used to predict the presence of a disease.” http://www.genome.gov/glossary/index.cfm?id=91 6 Khoury M.J. et al. (2009) “The Genomic Applications in Practice and Prevention Network.” Genetics in Medicine 11(7): 488-494. 7 For more information about the Genomic Applications in Practice and Prevention Network, see http://www.cdc.gov/ genomics/translation/GAPPNet/index.htm. 8 See note 2 at page 751. 9 Collins F.S. (2011) “Reengineering Translational Science: The Time Is Right.” Sci Transl Med. 3(90):90cm17. 10 Collins F.S. (2010) “Opportunities for Research and NIH.” Science 327: 36-37. 11 Collins F.S. (2011) “Reengineering Translational Science: The Time Is Right.” Sci Transl Med. 3(90):90cm17. 12 Genetic exceptionalism is the concept that genetic information is inherently unique, should receive special consideration, and should be treated differently from other medical information. For more information about genetic exceptionalism in public policy, see CRS Report RL34376, Genetic Exceptionalism: Genetic Information and Public Policy, by Amanda K. Sarata. 13 Genetic determinism is the concept that our genes are our destiny and that they solely determine our behavioral and physical characteristics. This concept has mostly fallen out of favor as the substantial role of the environment in determining characteristics has been recognized. 14 National Research Council, Reaping the Benefits of Genomic and Proteomic Research: Intellectual Property Rights, Innovation, and Public Health. Washington, DC: National Academies Press (2006); p. 19. The National Human Genome Research Institute at the National Institutes of Health reports that the estimated number of human genes is closer to 25,000. See http://www.genome.gov/11508982. 15 Report of the Secretary’s Advisory Committee on Genetic Testing (SACGT), “Enhancing the Oversight of Genetic Tests: Recommendations of the SACGT,” July 2000, at http://oba.od. nih.gov/oba/sacgt/ reports/ oversight_report.pdf. 16 Microarray technology is defined as “...a developing technology used to study the expression of many genes at once. It involves placing thousands of gene sequences in known locations on a glass slide called a gene chip. A sample containing DNA or RNA is placed in contact with the gene chip. Complementary base pairing between the sample and the gene sequences on the chip produces light that is measured. Areas on the chip producing light identify genes that are expressed in the sample.” See http://ghr.nlm.nih.gov/glossary= micro arraytechnology. 17 See http://www.genetests.org for information on disease reviews, an international directory of genetic testing laboratories, an international directory of genetics and prenatal diagnosis clinics, and a glossary of medical genetics terms. 18 Newborn Screening Home, Maryland Department of Health and Mental Hygiene. http://dhmh. maryland.gov/labs/ html/nbs.html. 19 For more information about direct-to-consumer genetic testing, see http://ghr.nlm.nih.gov/handbook/testing/ directtoconsumer. 20 For more information about characteristics of genetic information that may be viewed as unique and public perspectives on the differences between genetic and other medical information, see CRS Report RL34376, Genetic Exceptionalism: Genetic Information and Public Policy, by Amanda K. Sarata. 21 An analyte is defined as a substance or chemical constituent undergoing analysis. 1

2056 22

Amanda K. Sarata

For more information about requirements relating to the coverage of clinical preventive services under the ACA, see CRS Report R41278, Public Health, Workforce, Quality, and Related Provisions in PPACA: Summary and Timeline, coordinated by C. Stephen Redhead and Erin D. Williams. 23 See http://www.cms.hhs.gov/CLIA/.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 96

EVOLUTION OF HUMAN GENOME ANALYSIS: IMPACT ON DISEASES DIAGNOSIS AND MOLECULAR DIAGNOSTIC LABS Julie Gauthier1,*, Isabelle Thiffault1, Virginie Dormoy-Raclet1 and Guy A. Rouleau1,2 1

Medical Biological Unit, Molecular Diagnostic Laboratory, Sainte-Justine University Hospital Center, Montreal, QC, Canada 2 Montreal Neurological Institute and Hospital, Montréal (Québec), Canada

ABSTRACT The advent of massively parallel sequencing has changed the interrogation process of the human genome and now provides a high resolution and global view of the genome which is beyond research applications. Together with powerful bioinformatics tools, these next generation sequencing technologies have revolutionized fundamental research and have important consequences for clinically actionable tests, diagnosis and treatment of rare diseases and cancers. Today, molecular testing is commonly used to confirm clinical diagnosis of specific diseases; it requires that a clinician specify the gene or mutation to test and, in return, will receive information only about this sequence. Despite relative successes, a large number of patients receive no accurate diagnosis, even after many expensive molecular investigations. A clear paradigm shift has taken place in the health network with the introduction of the exome sequencing in molecular diagnostic lab. In this chapter, the impact of the implementation of high throughput sequencing technologies on molecular diagnosis and on the practice of medicine, with an emphasis in paediatrics, is reviewed. We compared well-established genetic tests, using examples from our molecular diagnostic lab, to the recent exome sequencing applications. The genetic tests can fall into three main categories: 1) Mendelian Single Gene Disorder tests that include targeted mutation and targeted gene approaches 2) Genetic Disease Panels which are composed of a few to a dozen genes and 3) Exome or Genome approaches, which interrogate either the * Corresponding

Author’s Email: [email protected].

2058

Julie Gauthier, Isabelle Thiffault, Virginie Dormoy-Raclet et al.

entire coding sequences of the 22,333 human genes or the entire human genome. For each of these categories, advantages and limitations are discussed. We devoted a section on the future of molecular diagnosis and discuss which tests will subsist and which one may be soon abandoned. Massively parallel sequencing is transforming the molecular diagnostic field: it offers personalized genetic tests and generates new ethical challenges. Important questions like incidental findings and possible forms of discrimination are addressed. Finally, we conclude with a section on the future directions surrounding the application of these multimodal molecular approaches in general and their putative applications in neonatal intensive care units.

1. INCREASED HUMAN GENOME KNOWLEDGE THROUGH PROGRESS IN SEQUENCING TECHNOLOGY Sequencing the DNA of an organism is feasible since 1977 when the "dideoxy" chaintermination method for sequencing DNA molecules was introduced by Frederick Sanger and colleagues [1]. This technique allows for the sequencing of a single DNA fragment up to 1000 base pairs long. The original method used radiolabeled dNTP and the reading was done manually. Sanger sequencing has been the basis of several major gene discoveries transforming the field of molecular biology. For example, before DNA sequencing, proteins were sequenced directly, this is a laborious technique. Now, this is easily accomplished by sequencing a cDNA and translating the DNA sequence into the amino acid sequence of the protein. In the early 1990s, DNA sequencing was automated using a 4-channel capillary approach (basically the current Life Technologies ABI 3730 system) and ddNTP labeled with different color fluorescent dyes which allow fast DNA sequencing, with hundreds of fragments simultaneously. These sequencing systems were the first generation of sequencing technologies. Their high-throughput yield allows a single lab to sequence millions of base pairs, compared to thousands before their introduction. Commonly called the Sanger method, this sequencing technique is the gold standard in research and clinical diagnostic laboratories for genetic testing. This advance in technology led to science’s greatest achievement, the Human Genome Project. This project aimed to determine the sequence of the 3 billion nucleotide base pairs that constitute the human genome and to identify all 22,333 genes [2] in human DNA [3]. This 13-year project gave rise to the first draft of the human genome sequence in 2001. Decoding the human genome has opened unprecedented new avenues in research and increased our understanding of human health. Information from the human genome sequence enables us to understand how the genetic information drives the development and function of the human body. More importantly, the Human Genome Project accelerated the exploration of genetic variations predisposing to disease and thus revolutionizes medical practice and biological research. Since then, the availability of genomic information (gene and chromosome structure, polymorphisms, disease causing mutations, etc.), has continuously increased. Sanger sequencing helped the discovery of new genetic mechanisms. For example, by sequencing more than 400 synaptic genes in affected probands with sporadic schizophrenia or autism (that is, with no history of psychiatric disorders in the parents or the extended family), we and others have observed a significant excess of potentially deleterious de novo mutations in affected individuals [4]. A similar observation was done in intellectual disability cases [5].

Evolution of Human Genome Analysis

2059

The most recent DNA sequencing development is the advent of massively parallel sequencing platforms leading to the “next generation sequencing” technologies. The development of ultra-high throughput sequencing technologies pushed forward at an unprecedented speed the identification of DNA variations associated with diseases. Ultrasequencing platforms can be combined with microarray technologies to capture and amplify the functional genome that encodes proteins, also known as the "exome", or to capture more comprehensively a subset of related genes. As technology progressed, next-generation DNA sequencing techniques have improved significantly and are now much faster, and to some extent less expensive than Sanger sequencing. What took over 10 years like the Human Genome Project can now be done in less than a month. It’s now feasible to decode multiple human genomes at once. All of these progresses gave birth to larger scale genetics. A remarkable increase of genetic and genomic data occurred in the last decade notably through the introduction of microarrays and next-generation sequencing. In fact, human genome array-comparative genomic hybridization and SNP arrays were developed to detect genetic aberrations or copy number variants (CNVs) at a higher resolution than traditional karyotyping. Comparative genomic hybridization, also called array CGH, is now currently used in diagnostic labs to identify small chromosomal deletions and duplicated regions. For example, conventional karyotyping has a resolution of 5-10 million bases compare to 100 000 for arrayCGH. Therefore, submicroscopic chromosomal alterations can now be detected. These technological progresses lead researchers to major discoveries in the understanding of genetic mechanisms of different neuropsychiatric conditions such as intellectual disabilities, autism and schizophrenia. De Vries et al. used array based comparative genomic hybridization (array CGH) to study 100 patients with unexplained intellectual disability. They were able to detect a potential causative chromosomal anomaly in 10% of their patients which represents a diagnostic yield of at least twice as high as that of conventional method [7]. In addition to the identification of the causative genetic factors implicated in pediatric and childhood complex disorders, microarrays initiated the discovery of new genetic mechanisms for a number of complex disorders, namely autism, intellectual disability and schizophrenia. Using these technologies, studies have highlighted the involvement of rare (2,500 being rare) have been characterized at the molecular level, and for over 3,500 of these the genetic causes are still unknown. Some genetic conditions are related to a single gene (e.g., cystic fibrosis), but most genetic diseases are characterized by a great heterogeneity, each of which can be caused by mutations in one of several genes (Intellectual disability > 300 genes, Deafness > 60 genes, Mitochondrial diseases >300 genes). The current molecular diagnosis of clinical phenotypic heterogeneity in genetic conditions is laborious and expensive because it involves the sequential analysis of several genes.

2060

Julie Gauthier, Isabelle Thiffault, Virginie Dormoy-Raclet et al.

2. THE GENETIC DIAGNOSIS: A MULTI TECHNICAL APPROACH FOR NEURODEVELOPMENTAL AND METABOLIC DISORDERS The advance of modern genomics has changed the health economic decisions concerning genetic screening, with costs- per-megabase for DNA sequencing falling at a faster rate than predicted. Although individually rare, Mendelian diseases collectively account for a significant percentage of infant mortality and pediatric hospitalizations [10]. The speed with which genomics is becoming clinically relevant and the increasing power of the new sequencing technologies led to its rapid implementation in clinical settings. Assuming that new technology automatically translates into improved patient care is idealistic. The ability to amplify DNA by polymerase chain reaction (PCR) has revolutionized our ability to test for genetic mutations. Many different assay systems are based on PCR for analyzing the amplified DNA or RNA. These techniques are sensitive, reliable and can be performed easily on different material: blood, skin or muscle biopsies, tumour, foetus, and even single cells from blastomeres and polar bodies. The aims of adapting new PCR-based strategies in clinical settings are improving the accuracy, speeding up the diagnosis, the time-consuming and costing without decreasing the sensitivity or specificity. Understanding the type of mutations, the incidence of de novo mutations or genetic rearrangements is essential to accurately select the best molecular technique for the detection of carrier in pre-natal diagnosis. Techniques involving PCR-based amplification are successfully used for mutation screening in the majority of diseases. It can be combined for the detection of the presence or absence of restriction sites, electrophoretic mobility shift or sizing analysis, as in single strand conformation polymorphism (SSCP) or in denaturing gradient gel electrophoresis (DGGE). Computer‐assisted highly sensitive mutation detection is also performed, for the above techniques, by means of fluorescent PCR for allelic specific discrimination. Recent advances in the development of quantitative real-time PCR (qPCR)-based diagnostic tools allow detection and quantification of gene or exon dosage. An alternative procedure to mutation‐directed protocols for complex genetic mutations is the use of fluorescent multiplex PCR. Indirect diagnosis performed by the use of polymorphic microsatellite markers, allowing identification of the pathogenic haplotype instead of the mutation [11, 12] as for instance in some spinal muscular atrophy or Duchenne muscular dystrophy families. For diseases involving a heterogeneous spectrum of identified mutations, such as cystic fibrosis, autosomal non-syndromic intellectual disability (SYNGAP1) or Rett Syndrome (MECP2), the development of a mutation‐based strategy is not practical and sequencing of the entire coding sequence is recommended to facilitate mutation detection. Multiplex ligation-dependent probe amplification (MLPA) is a variation of the multiplex polymerase chain reaction that permits multiple targets (exons) to be amplified with only a single primer pair [13]. Specific fluorescent probes consist of two unique oligonucleotides which recognise adjacent target sites on the DNA and each amplicon generates a fluorescent peak which can be detected by a capillary sequencer. Comparing the peak pattern obtained on a given sample with those obtained on various control samples, allow the relative quantity of each target to be determined. This technique is commonly used to detect chromosomal anomalies in cell and tissue samples, [14] detection of gene copy number [13], detection of duplications and deletions in disease-related genes such as DMD, MECP2, BRCA1, BRCA2, etc. It has replaced the need to use of southern blot in many diseases [15-17].

Evolution of Human Genome Analysis

2061

Expansion repeat disorders such as of the glutamine codon (CAG) in spinocerebellar ataxias, or the trinucleotide repeat in non-coding regions, as the CGG in Fragile-X syndrome, the GAA in Friedreich ataxia or the CTG in myotonic dystrophy type I, are a special type of mutation. The unstable dynamic nature of those mutations requires the use of a multimodal approach [18]. Molecular tests for the diagnosis and carrier detection often combine PCR for the repeat expansion and triplet repeat primed PCR (TP-PCR) analysis of genomic DNA, as well as southern blot. The detection rate of the screening test, as well as the frequency of the mutation in the study population and the technical limitations of the procedure, will determine the usefulness of a positive or negative result. Preimplantation testing provides a paradigm for the ease of use of PCR-based testing, yet also underscores the problems encountered with genetic screening because of the multitude of possible mutations and the possible misinterpretation of results [12]. Molecular diagnostic testing is currently available for only a certain number of disorders and with the increasing number of new genes associated to human diseases, it is becoming more and more challenging to provide cost effective molecular testing [10]. Preconception screening, together with genetic counselling of carriers, has resulted in remarkable declines in the incidence of several severe recessive diseases in populations at risk [19, 20]. However, extensive preconception screening and molecular diagnostic testing has been limited to targeted population or family history–directed individual and is still impractical for many disorders [20].

2.1. Mendelian Single Gene Disorders: At the Mutation or Gene Level Single-gene disorders have a straight forward inheritance pattern, and the genetic causes can be traced to changes in specific individual genes. A particular disorder may be rare; however, as a group of disease-causing genes, single-gene disorders are responsible for a significant percentage of pediatric diseases [21]. About 1% of the approximately 4 million annual live births in the United States will have a single gene disorder that requires intensive clinical investigation, specific medical treatment and hospitalization [22, 23]. Based on the location of the relevant genes, single-gene traits can be divided into autosomal or sex-linked inheritance. Autosomal inheritance, depending on whether one or two mutant alleles are required to cause the disease phenotype, can be classified as autosomal dominant or autosomal recessive. Each of these single gene disorders, called Mendelian traits or diseases, are relatively uncommon. The frequency often varies with ethnic background, with each ethnic group having one or more Mendelian traits in higher frequency when compared to the other ethnic groups. For example, cystic fibrosis has a frequency of about one in 2,000 births in Americans descended from western European Caucasians [10] but is much rarer in African-Americans descent while sickle cell anemia has a frequency of about 1/600 births in African-American, but is rare in Caucasians [24]. Just to name a few, Mediterranean descent have a high frequency of thalassemia [25]; Eastern European Jews have a high frequency of Tay-Sachs disease [26, 27]; French Canadians from Quebec have a high frequency of tyrosinemia [28], all when compared to other ethnic groups. It has been estimated, regardless of the ethnicity, that each healthy individual is carrying between 1 and 8 mutations which, if found in the homozygous state would result in the expression of a Mendelian recessive disease [10]. Since each human genome has 22,333 genes it is unlikely that any two unrelated individuals would be carrying

2062

Julie Gauthier, Isabelle Thiffault, Virginie Dormoy-Raclet et al.

the same mutations, even if they are from the same ethnic background. This explains why most Mendelian diseases are rare, affecting about 1/10,000 to 1/100,000 live births [21, 29]. In Quebec, the distribution of Mendelian diseases is due to local founder effects caused by the stratification of the contemporary French Canadian gene pool. The migration of a small number of French individuals from France to Quebec created a founder effect. Subsequent inland migrations have created smaller regional founder effects [30, 31]. The limited size of the population favoured genetic drift, and the social context encouraged endogamy, only few unions were reported between French Canadians with English and other immigrants [31]. The French-Canadian population of Quebec, currently about 6 million people, descends from about 7,798 immigrant founders who arrived in Quebec between 1608 and 1759 [31]. Recent studies showed that the Quebec population structure through the analysis of the genetic contribution of the first French settlers can be partitioned in eight regions, and they contributed to over 90% of gene pools in seven out of those eight regions [32]. This particular local genetic effect highlights the importance of considering the geographic origin of samples in the design of genetic testing in Quebec [33]. The conditions under which the peopling of Quebec was made, have favoured changes in the frequency of certain alleles in comparison with the French original population. As a result, certain genetic diseases are specific or more prevalent to the Quebec population. The prevalence and distribution of genetic diseases in Quebec is an essential factor to consider in clinical practice and particularly in differential diagnostic to prioritize molecular investigations [20]. This founder effect has impacted our molecular diagnostic testing system and is still a key factor when developing new diagnostic test for a genetic disease. The prevalence of the disease and the nature of the mutations found in the Quebec population need to be taken into account. The performance of the test depends on how well it accounts for the particularities of the disease in the French Canadians but more specifically depending on the regional founder effect [31]. The current changes in the immigration and the increased admixture is bringing new challenges in the differential diagnosis and amelioration of our molecular genetic testing system. Over thirty Mendelian diseases have a high prevalence in the Quebec population [31, 34, 35]. Before the advances in sequencing technologies, it was believed that some of the disease were almost exclusive to the French Canadians, as autosomal recessive spastic ataxia of Charlevoix-Saguenay (ARSACS; MIM 270550), hereditary motor and sensory neuropathy with agenesis of the corpus callosum (ACCPN; MIM 218000) or French-Canadian-type Leigh syndrome (MIM 220111) [36-38]. Taking ARSACS as an example, after extensive resequencing of the responsible gene, SACS, it became evident that ARSACS was not limited to Quebec, and more than 100 different pathogenic mutations have now been identified worldwide [39, 40]. ARSACS is believed to be underdiagnosed in patients with atypical phenotypes and recent data on exome sequencing suggest a presumably high frequency of allele carriers around the world [39-42]. Admixture has more and more impact on the genetic characteristics of disease in French Canadians. Other ethnic groups have deep roots in the province. Many immigrant communities that are established mainly in and near Montreal now account for over 15% of the Quebec population. First Nations groups in Quebec have specific genetic diseases with three autosomal recessive conditions that have been well documented: Cree leukoencephalopathy [MIM 603896], Cree encephalitis [MIM 608505], North American Indian Childhood Cirrhosis [MIM 604901]. In Cree communities, the carrier frequency of Cree leukoencephalopathy is estimated at 1/10, 1/30 for Cree encephalitis and, 9/100 for the North American Indian Childhood

Evolution of Human Genome Analysis

2063

Cirrhosis [43, 44]. However, universal screening is currently offered only in the neonatal period for phenylketonuria, tyrosinaemia type I, medium-chain acyl-coenzyme A dehydrogenase deficiency [MCAD] and congenital hypothyroidism in addition to selected inborn errors of metabolism by urine screening [45, 46]. Effective targeted carrier-screening programs are provided in some specific communities but are often limited to individuals with a family history of recessive diseases. For public health, the genetic structure of Quebec presents major challenge for genetic screening but brings also opportunities for gene identification studies, clinical genetics research and practice. In the next section, we will discuss our experience over time with the implementation of effective targeted genetic testing and carrier-screening programs.

2.1.1. Targeted Mutations The French-Canadian population of Quebec evolved as a mosaic of layered founder effects which has stimulated the development and feasibility of population-based carrier screening for at-risk individuals. For most of the Mendelian diseases in Quebec, the mutant founder alleles are characteristic and often unique. Usually one or two founder mutations account for 90% of French-Canadian alleles, depending on the region. However, founder mutations panels do exist for some disorders in Quebec such as for familial hypercholesterolemia, hereditary breast cancer, etc. A good example of a mutant founder allele in Quebec is the Cree encephalitis, a severe early-onset progressive neurological disorder in an inbred Canadian Aboriginal community [MIM 608505]. The symptoms appear within the first few weeks of life and children usually die in infancy or early childhood. The main neurological symptoms are acquired microcephaly, mental retardation, cerebral atrophy with white matter changes, cerebral calcification, and chronic cerebrospinal fluid lymphocytosis. Cree encephalitis shows phenotypic overlap with Aicardi-Goutières syndrome with elevated levels of IFN-a in cerebrospinal fluid [47, 48]. The gene responsible, named TREX1 (3-prime repair exonuclease 1, MIM 606609), has only one coding exon and is located on 3p21.31. The mutation causing Cree encephalitis is the p.Arg164Ter (c.490C>T) [49]. The molecular genetic diagnosis consists of determining the presence or absence of p.Arg164Ter in symptomatic patients. CREE encephalitis is among the leading causes of death of Cree infants. Cree carrier rates of this mutation are estimated to be 2-3 individual out of twenty meaning that about one in 300 births will be affected. In 2006, a genetic screening program was developed and managed by the Cree Health Board to identify carriers of the mutation p.Arg164Ter in the TREX1 gene. A second autosomal recessive condition is included in the Cree population genetic screening, Cree leukoencephalopathy [MIM 603896]. All patients are homozygous for the mutation p.Glu584Ala in the translation-initiation factor EIF2B5 gene causing childhood ataxia with central hypomyelination and vanishing white matter disease [CACH/VWM] [50]. Both tests are performed in our molecular diagnostic laboratory at CHU Sainte-Justine. To date, >500 individuals have been tested. Pregnant woman and teenagers in High School are the targeted population for this genetic test. In fact, the rate of teenage pregnancy is very high in Cree population (23% among those aged 45 known genes), spinocerebellar ataxia (> 15 known genes) and mitochondrial disease (> 300 known genes). The exploration of these assumptions was simply prohibitive as proposed by the clinical genetic testing targeted 20 genes and would have cost > $ 40,000. Exome sequencing, with a cost of ~$ 7000 rapidly led to the causative mutation/gene. The major hurdle of exome sequencing is the missing or suboptimal exons coverage mainly due to high GC content. One good example is the aortopathies characterized by aortic dilation, which can lead to life threatening aneurysms and/or dissections. An early diagnosis is critical,

2068

Julie Gauthier, Isabelle Thiffault, Virginie Dormoy-Raclet et al.

since timely initiation of pharmacological treatment can slow dilation and prophylactic surgery can prevent aortic dissection or rupture. Mortality rate is 20% for aortic dissections. Mutations in twelve different genes (for a total of 360 exons) are known to be responsible for these diseases. The commercial kit of exome capture SureSelect from Agilent is missing (or suboptimal) 11% exons of these genes. Fortunately, these weaknesses will be overcome with promised technological update.

3. THE FUTURE OF MOLECULAR DIAGNOSTIC LAB: WHAT WILL BE KEPT AND WHAT WILL BOT Routine DNA-based diagnostic sequencing for neurodevelopmental or metabolic disorders currently targets well-defined genes or sets of genes that address very specific clinical questions. Today, available services vary greatly depending on the diagnostic laboratory, including Sanger sequencing of complete genes harboring mutations with known, welldescribed clinical phenotypes or multi-gene testing panels or next-generation sequencing-based disease/phenotype panels. Test ordering depends on the ability of a physician to apply a differential diagnosis; it follows a paradigm where a patient with phenotype A will have a mutation in a known gene causing phenotype A, which will be sequenced. Today’s reality is that several genes are known to cause almost any particular phenotype, so gene panels can be used to sequence multiple genes simultaneously, or in a linear approach where the most commonly mutated genes are sequenced first, and if a negative result is obtained, the remainder are sequenced. The recent advances of next-generation sequencing enable the laboratory to simultaneously sequence a large number of genes at a significantly decreasing cost per gene. This raises multiple questions - is there a point at which additional sequencing diminishes the clinical utility of the resulting data? Is the proliferation of DNA testing panels enabled by nextgeneration sequencing beneficial for clinical diagnostics? What will be kept and what will be dropped? This type of linear strategy is generally very satisfying for the diagnosing clinician as each test in specific population, for example in micro founder effect of Cree subpopulation or Saguenay, has a known value for diagnostic purpose. It also utilizes a focused approach, which tends to prioritize the most common gene involved in a certain phenotype. The genetics field is still young, but the actual genes and associated casual mutations are often incrementally discovered. Newly discovered genes are reported weekly, but it is generally difficult to systematically add them to a laboratory test menu. The diagnostic value from a single, wellcharacterized gene is relatively high since it is easier to interpret and it minimizes the likelihood that a variant of unknown significance will be discovered [64]. Howeer, if a gene is reported only for a few cases, the diagnostic test may not be offered. Offering genetic testing for rare orphan disease has a high relative cost of test development and a low diagnostic yield [41, 63, 64]. As described in the previous section, some specific mutation panels will remains for at-risk population until the cost of next-generation sequencing decreases further. In addition, tripletrepeat diseases because of the unstable dynamic nature of those mutations will continue to require the use of a multimodal approach.

Evolution of Human Genome Analysis

2069

Next-generation sequencing is really moving the field of towards comprehensive gene panels. Expanded comprehensive diagnostic gene panels have several advantages. First of all, the design of an expanded diagnostic panel is quite straightforward and begins by identifying all of the genes involved in the disease(s) being targeted. Adding genes to the list is simple and does not requir additional cost, unless enrichment is needed [63]. More comprehensive gene panel tests will simplify test ordering by consolidating all candidate genes into a single diagnostic test. By taking a more comprehensive approach, the sensitivity of the test increases and the rate of molecular under diagnosis decreases by including genes with low-frequency. It will also allow the identificaiton of in the causative gene in patients with an atypical phenotypic presentation. Moreover, with the advent of next-generation sequencing, an expanded neurodevelopmental and metabolic molecular diagnostic sequencing panel becomes economically feasible, allowing diagnosis of extremely rare orphan disease in one genetic test. Next-generation sequencing introduces some interpretative challenges which are not new to diagnostic testing, but the scale of incidental findings or number of variants of unknown significance will be far greater than any previous test. Sanger sequencing typically identifies three categories of mutations: known non-pathogenic or benign polymorphisms; known pathogenic mutations; and variants of unknown significance. Variants identified as known pathogenic mutations are straightforward to interpret as in most cases, there are clearly indicated for clinical action [76]. With time, and better variant databases, the experience gained using next-generation sequencing testing panels will provide more data to improve variant interpretation and, over time, reduce the total number of variants of unknown significance encountered during next-generation sequencing diagnostic test[76]. The molecular clinical approach should focus on immediate clinical benefit of next-generation sequencing, such as the ability to offer comprehensive gene panels, to provide a first-pass diagnostic yield, and to limit gene list to genes of known diagnostic value [64]. This will aid the interpretation of the data set in a way that the healthcare provider will be able to understand and utilize.

4. THE NON-TARGETED GENETIC STRATEGY GENERATES NEW ETHICAL CHALLENGES Particular emphasis has been placed in recent years on the identification of rare disease genes due to the availability of new genomic sequencing technologies. As seen earlier, these technologies greatly facilitate the search for causative disease mutations since they allow the analysis of the 22,333 genes at once in a short period of time for a reasonable cost. As a result, more genetic mechanisms involved in rare diseases are known, and a portion of these findings are already translated into diagnostic tools. Indeed, the clinical sequencing (referring to exome or genome sequencing) is rapidly being integrated into the practice of medicine. Although technically feasible and proven to be successful [77, 78], several challenges remain surrounding the use of clinical sequencing. Nonetheless molecular diagnosis using genomic and genetic methods such as microarray CGH, exome and genome sequencing have in common several ethical, legal and social concerns with other methods of medical investigation. Because of the unprecedentedly large amount of information generated by these comprehensive tests on an individual, the concerns (e.g., content of the consent form), incidental findings, returning results to the patient, etc. are amplified.

2070

Julie Gauthier, Isabelle Thiffault, Virginie Dormoy-Raclet et al.

4.1. Consent Form Consent forms need to be adapted to the new generation of sequencing clinical test. The main addition to the current medical consent form is the extent to which the patients would have control/access to the whole data (exome/genome), what results might be returned to the patient and what are the potential risks. The consent form should also inform the patient about the possible risk of discovering unwanted findings (unrelated to the original medical investigation). For instance, the exome analysis may reveal that the patient is likely to get a serious and untreatable disease.

4.2. Data Storage and Sharing Next-generation sequencing technologies generate terabytes of data, and storing this amount of data will constitute a challenge in itself but also raised ethical issues. The genetic information of individual genome that is derived from the clinical sequencing is an accessible and robust “login” into a patient identity. It can give information on the patient’s relatives, ethnic groups, and more. The Wellcome Trust and the National Institute of Health, two respective Institutions whose mission is to operate open access genetic and genomic databases for the benefits of researchers and patients, now restricted and controlled their web database access. They even formed specific committees to oversee the circulation of the data included in their databases. This was effective following the conclusion from the study of Homer and colleagues in 2008 demonstrating that genome-wide association derived data is sufficient to reidentify an individual that have participated in a study [79]. They concluded that anonymizing data was unsatisfactory to protect the confidentiality of research participants. Because the understanding, diagnosed and treatment of complex diseases such as cancer or pediatric disorders required comparison of genetic information from several hundreds and often thousands of individuals, genetic data sharing is critical for research and molecular diagnosis. To further illustrate the significance of protecting information derived from whole genome sequencing of individual, the Presidential Commission for the Study of Bioethical Issues published a 150-page report, on the Privacy and progress in the era of whole genome sequencing. They concluded “to realize the enormous promise that whole genome sequencing holds for advancing clinical care and the greater public good, individual interests in privacy must be respected and secured. As the scientific community works to bring the cost of whole genome sequencing down from millions per test to less than the cost of many standard diagnostic tests today, the Commission recognizes that whole genome sequencing and its increased use in research and the clinic could yield major advances in health care. However it could also raise ethical dilemmas. The Commission offers a dozen timely proactive recommendations that will help craft policies that are flexible enough to ensure progress and responsive enough to protect privacy.” Finally, researchers and policy-makers need to find methods to protect individuals’ genomic data while still being able to share information.

Evolution of Human Genome Analysis

2071

4.3. Incidental Findings As mentioned in earlier sections, clinical exome and genome sequencing present several advantages for clinical practice and for the patient. The main advantage discussed is the nondiscrimination on the selection of candidate’s genes that will be analyzed. However, these methods can yield incidental medical information not related to the principal medical target. For instance, the genome of a child investigated for a rare form of deafness can lead to the discovery of a known mutation leading to a late onset neurodegenerative disorder. In addition, the patient can be found to be carrier of a recessive lethal disease. These “secondary” findings have been the subject of many discussions and recently the American College of Medical Genetics and Genomics whose mission is to improve health through medical genetics released it’s highly anticipated “Recommendations on Incidental Findings in Clinical Exome and Genome Sequencing”. In addition to fortuitous findings, whole genome sequencing raises great social concerns that still need to be resolved, such as possible forms of discrimination. Efforts have been made to overcome this phenomenon since the Genetic Information Nondiscrimination Act was signed in the USA in 2008 to protect individuals from improper use of genetics information with regard to health insurance and employment [69]. Emerging discoveries of susceptibility genes and gene variants associated with major neurological or psychiatric disorders are likely to challenge the existing ethical guidelines. It is up to researchers, health professionals and experts in the Ethical, Economic, Environmental, Legal, and Social aspects of genomics [GE3LS] to manage this growing scientific knowledge in a way that prioritizes protection of research participants and improves patient care.

CONCLUSION AND FUTURE The successful use of whole-genome and exome sequencing for diagnosis has been amply confirmed by numerous studies. Whether targeted gene, gene panel approaches and exome sequencing will be entirely replaced by whole-genome sequencing is still unknown. Compared to traditional methods, it is now well accepted that exome sequencing has fewer false positives, and a greater sensitivity due to the higher coverage achieved when focusing only on a small fraction of the genome. Exome and whole-genome sequencing allow the discovery of point mutations and small deletion. With advanced bioinformatics tool it is now feasible to detect larger insertions and deletions (CNVs), currently detected using the microarrays technologies. We think that these “cytogenetic” methods, including karyotyping and molecular diagnosis, will merge. We also think that the current modalities of next-generation sequencing will eventually be replaced by genome sequencing. Recently, Saunders and colleague showed the feasibility of using whole-genome sequencing in neonatal intensive care units to screen for genetic disease diagnosis [77]. They described a 50-hour delay in the diagnosis of genetic disorders using whole genome sequencing. Some challenges will subsist: mosaicism, balanced translocation and complex diseases (unknown mode of transmission). However, an important challenge in using whole-genome sequencing will be the interpretation of the data linking a genetic variation to the disease/phenotype and all ethical issues around it.

2072

Julie Gauthier, Isabelle Thiffault, Virginie Dormoy-Raclet et al.

The rapid development of sequencing is now positively impacting prenatal diagnosis. Since the discovery of cell-free fetal nucleic acids circulating in the blood of pregnant women, [80] combined with next-generation DNA sequencing technologies, it is now possible to do early, noninvasive prenatal genetic testing [81]. Clinical applications of these methods already include fetal sex determination and blood group typing [82]. Ongoing research is currently evaluating the use of this approach for noninvasive detection of trisomies [83]. Other uses being explored are the detection of single-gene disorders, chromosomal abnormalities and inheritance of parental polymorphisms across the whole fetal genome. Use of preimplantation genetic diagnosis and preimplantation genetic screening using nextgeneration sequencing can provide blastocyst preimplantation genetic diagnosis (PGD) results with high level of consistency with established diagnostic methods. Furthermore, single-gene disorder screening by next-generation sequencing could be performed in parallel with qPCRbased comprehensive chromosome screening or array SNP-CGH. Several studies showed that next-generation sequencing could serve as an essential PGD tools for further development of this important and emerging field [84]. Next-generation sequencing data provides a unique opportunity to evaluate multiple genomic loci and multiple samples on one experiment (e.g foetus can be tested in parallel with the parents). Next-generation sequencing might also be useful for simultaneous evaluation of aneuploidy, single-gene disorders, and translocations from the same biopsy without the need for multiple technological platforms [85]. Clearly, the fertility field has seen intensive efforts to significantly improve and validate better state-of-theart in vitro fecundation techniques. Martin J. et al. suggested that IVF techniques coupled with deep comprehensive diagnosis/screening methods using NGS should result in high implantation and live birth rates [85]. Nevertheless, there is always room for improvements; it is important to be prudent, recognize the limits of sequence depth necessary to maintain accuracy, and variation in sequencing depth across different genomic loci that is critical to its clinical application in PGD. We expect that whole-genome sequencing will allow the identification of genetic variants that will determine an individual’s risk for developing diseases, including neurological or psychiatric disorders. In fact, the continuing reduction in sequencing costs may lead to replacement of most of the other currently used approaches.

ACKNOWLEDGMENTS We are very grateful for the support of our Institution. We wish to thank our colleagues, Mélanie Lafleur, Françoise Couture, Sylvie Filiatrault, Josée Gauthier, Janique Ladouceur, Caroline Deschaînes, Marie-Josée Lassonde, Julie Ménard, Li Fan and Marie-Lyne Darveau for their technical and administrative work in the Molecular Diagnostic Lab. We also acknowledge the work/input of our collaborative clinicians: Drs. Jacques Michaud, Grant Mitchell, Jean-François Soucy, Dorothée Dal Soglio, Luc Oligny, George-Etienne Rivard and Sonia Cellot for their help in the discovery, development and for working in close collaboration to improve the use of genetics and genomic knowledge and tools in today’s medicine.

Evolution of Human Genome Analysis

2073

REFERENCES [1] [2] [3] [4] [5]

[6] [7]

[8] [9] [10] [11]

[12]

[13] [14]

[15]

[16]

[17] [18]

Sanger, F., S. Nicklen, and A.R. Coulson, DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A, 1977. 74(12): p. 5463-7. Pruitt, K.D., et al., NCBI Reference Sequences: current status, policy and new initiatives. Nucleic Acids Res, 2009. 37(Database issue): p. D32-6. The Human Genome Project. http://genomics.energy.gov., 1999. Awadalla, P., et al., Direct measure of the de novo mutation rate in autism and schizophrenia cohorts. Am J Hum Genet, 2010. 87(3): p. 316-24. Hamdan, F.F., et al., Excess of de novo deleterious mutations in genes associated with glutamatergic systems in nonsyndromic intellectual disability. Am J Hum Genet, 2011. 88(3): p. 306-16. Griswold, A.J., et al., Evaluation of Copy Number Variations Reveals Novel Candidate Genes in Autism Spectrum Disorder Associated Pathways. Hum Mol Genet, 2012. Elia, J., et al., Genome-wide copy number variation study associates metabotropic glutamate receptor gene networks with attention deficit hyperactivity disorder. Nat Genet, 2012. 44(1): p. 78-84. Pfundt, R. and J.A. Veltman, Structural genomic variation in intellectual disability. Methods Mol Biol, 2012. 838: p. 77-95. Malhotra, D., et al., High frequencies of de novo CNVs in bipolar disorder and schizophrenia. Neuron, 2011. 72(6): p. 951-63. Kingsmore, S., Comprehensive carrier screening and molecular diagnostic testing for recessive childhood diseases. PLoS Curr, 2012: p. e4f9877ab8ffa9. Dreesen, J.C., et al., Multiplex PCR of polymorphic markers flanking the CFTR gene; a general approach for preimplantation genetic diagnosis of cystic fibrosis. Mol Hum Reprod, 2000. 6(5): p. 391-6. Moutou, C., N. Gardes, and S. Viville, Multiplex PCR combining deltaF508 mutation and intragenic microsatellites of the CFTR gene for pre-implantation genetic diagnosis (PGD) of cystic fibrosis. Eur J Hum Genet, 2002. 10(4): p. 231-8. Schouten, J.P., et al., Relative quantification of 40 nucleic acid sequences by multiplex ligation-dependent probe amplification. Nucleic Acids Res, 2002. 30(12): p. e57. Hochstenbach, R., et al., Rapid detection of chromosomal aneuploidies in uncultured amniocytes by multiplex ligation-dependent probe amplification (MLPA). Prenat Diagn, 2005. 25(11): p. 1032-9. Marzese, D.M., et al., Detection of deletions and duplications in the Duchenne muscular dystrophy gene by the molecular method MLPA in the first Argentine affected families. Genet Mol Res, 2008. 7(1): p. 223-33. Engert, S., et al., MLPA screening in the BRCA1 gene from 1,506 German hereditary breast cancer cases: novel deletions, frequent involvement of exon 17, and occurrence in single early-onset cases. Hum Mutat, 2008. 29(7): p. 948-58. Makrythanasis, P., et al., De novo duplication of MECP2 in a girl with mental retardation and no obvious dysmorphic features. Clin Genet, 2010. 78(2): p. 175-80. Thompson, T., Genetics in Medicine. 7th ed, ed. S. Elsevier. 2007, Philadelphia: Elsevier. 567.

2074

Julie Gauthier, Isabelle Thiffault, Virginie Dormoy-Raclet et al.

[19] Andermann, A., I. Blancquaert, and V. Dery, Genetic screening: a conceptual framework for programmes and policy-making. J Health Serv Res Policy, 2010. 15(2): p. 90-7. [20] Laberge, A.M., et al., Population history and its impact on medical genetics in Quebec. Clin Genet, 2005. 68(4): p. 287-301. [21] Rodelsperger, C., et al., Identity-by-descent filtering of exome sequence data for diseasegene identification in autosomal recessive disorders. Bioinformatics, 2011. 27(6): p. 82936. [22] Yu, J.H., et al., Self-guided management of exome and whole-genome sequencing results: changing the results return model. Genet Med, 2013. [23] Jamal, S.M., et al., Practices and policies of clinical exome sequencing providers: analysis and implications. Am J Med Genet A, 2013. 161A(5): p. 935-50. [24] Section on Hematology/Oncology Committee on, G. and P. American Academy of, Health supervision for children with sickle cell disease. Pediatrics, 2002. 109(3): p. 52635. [25] Atanasovska, B., et al., Efficient detection of Mediterranean beta-thalassemia mutations by multiplex single-nucleotide primer extension. PLoS One, 2012. 7(10): p. e48167. [26] Natowicz, M.R. and E.M. Prence, Heterozygote screening for Tay-Sachs disease: past successes and future challenges. Curr Opin Pediatr, 1996. 8(6): p. 625-9. [27] Rozenberg, R. and V. Pereira Lda, The frequency of Tay-Sachs disease causing mutations in the Brazilian Jewish population justifies a carrier screening program. Sao Paulo Med J, 2001. 119(4): p. 146-9. [28] Bergeron, P., C. Laberge, and A. Grenier, Hereditary tyrosinemia in the province of Quebec: prevalence at birth and geographic distribution. Clin Genet, 1974. 5(2): p. 15762. [29] Guillevin, L., [The national plan for orphan rare diseases: nearly 10 years on]. Rev Neurol (Paris), 2013. 169 Suppl 1: p. S9-11. [30] Bouchard, G., C. Laberge, and C.R. Scriver, [Demographic reproduction and genetic transmission in the north-east of the province of Quebec (18th-20th centuries)]. Eur J Popul, 1988. 4(1): p. 39-67. [31] Laberge, A.M., [Prevalence and distribution of genetic diseases in Quebec: impact of the past on the present]. Med Sci (Paris), 2007. 23(11): p. 997-1001. [32] Roy-Gagnon, M.H., et al., Genomic and genealogical investigation of the French Canadian founder population structure. Hum Genet, 2011. 129(5): p. 521-31. [33] Bherer, C., et al., Admixed ancestry and stratification of Quebec regional populations. Am J Phys Anthropol, 2011. 144(3): p. 432-41. [34] Scriver, C.R., et al., Feasibility of chemical screening of urine for neuroblastoma case finding in infancy in Quebec. CMAJ, 1987. 136(9): p. 952-6. [35] Scriver, C.R., Human genetics: lessons from Quebec populations. Annu Rev Genomics Hum Genet, 2001. 2: p. 69-101. [36] Engert, J.C., et al., ARSACS, a spastic ataxia common in northeastern Quebec, is caused by mutations in a new gene encoding an 11.5-kb ORF. Nat Genet, 2000. 24(2): p. 1205. [37] Debray, F.G., et al., LRPPRC mutations cause a phenotypically distinct form of Leigh syndrome with cytochrome c oxidase deficiency. J Med Genet, 2011. 48(3): p. 183-9.

Evolution of Human Genome Analysis

2075

[38] Howard, H.C., et al., The K-Cl cotransporter KCC3 is mutant in a severe peripheral neuropathy associated with agenesis of the corpus callosum. Nat Genet, 2002. 32(3): p. 384-92. [39] Thiffault, I., et al., Diversity of ARSACS mutations in French-Canadians. Can J Neurol Sci, 2013. 40(1): p. 61-6. [40] Synofzik, M., et al., Autosomal recessive spastic ataxia of Charlevoix Saguenay (ARSACS): expanding the genetic, clinical and imaging spectrum. Orphanet J Rare Dis, 2013. 8: p. 41. [41] Chen, Z., et al., Using next-generation sequencing as a genetic diagnostic tool in rare autosomal recessive neurologic Mendelian disorders. Neurobiol Aging, 2013. [42] Tzoulis C, J.S., Haukanes BI, Boman H, Knappskog PM, et al., Novel SACS Mutations Identified by Whole Exome Sequencing in a Norwegian Family with Autosomal Recessive Spastic Ataxia of Charlevoix-Saguenay. PLoS One, 2013. 8(6): p. e66145. [43] Black, D.N., et al., Leukoencephalopathy among native Indian infants in northern Quebec and Manitoba. Ann Neurol, 1988. 24(4): p. 490-6. [44] Drouin, E., et al., North American Indian cirrhosis in children: a review of 30 cases. J Pediatr Gastroenterol Nutr, 2000. 31(4): p. 395-404. [45] Laberge, C., et al., [The genetic medicine network in Quebec: An integrated program for diagnosis, counseling and treatment of hereditary metabolic diseases]. Union Med Can, 1975. 104(3): p. 428-32. [46] Grenier, A. and C. Laberge, [Detection of hereditary metabolic diseases in Quebec]. Union Med Can, 1974. 103(3): p. 453-6. [47] Crow, Y.J., et al., Cree encephalitis is allelic with Aicardi-Goutieres syndrome: implications for the pathogenesis of disorders of interferon alpha metabolism. J Med Genet, 2003. 40(3): p. 183-7. [48] Black, D.N., et al., Encephalitis among Cree children in northern Quebec. Ann Neurol, 1988. 24(4): p. 483-9. [49] Crow, Y.J., et al., Mutations in the gene encoding the 3'-5' DNA exonuclease TREX1 cause Aicardi-Goutieres syndrome at the AGS1 locus. Nat Genet, 2006. 38(8): p. 91720. [50] Fogli, A., et al., Cree leukoencephalopathy and CACH/VWM disease are allelic at the EIF2B5 locus. Ann Neurol, 2002. 52(4): p. 506-10. [51] Bouchard JP, R.A., Melancon SB, Mathieu J, Michaud J., Autosomal recessive spastic ataxia (Charlevoix– Saguenay). Handbook of ataxia disorders, Klockgether T, New York: Marcel Dekker, 2000: 311–324., 2000. [52] Vermeer, S., et al., ARSACS in the Dutch population: a frequent cause of early-onset cerebellar ataxia. Neurogenetics, 2008. 9(3): p. 207-14. [53] Breckpot, J., et al., A novel genomic disorder: a deletion of the SACS gene leading to spastic ataxia of Charlevoix-Saguenay. Eur J Hum Genet, 2008. 16(9): p. 1050-4. [54] Amir, R.E., et al., Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet, 1999. 23(2): p. 185-8. [55] Curtis, A.R., et al., X chromosome linkage studies in familial Rett syndrome. Hum Genet, 1993. 90(5): p. 551-5. [56] Schanen, N.C., et al., A new Rett syndrome family consistent with X-linked inheritance expands the X chromosome exclusion map. Am J Hum Genet, 1997. 61(3): p. 634-41.

2076

Julie Gauthier, Isabelle Thiffault, Virginie Dormoy-Raclet et al.

[57] Wan, M., et al., Rett syndrome and beyond: recurrent spontaneous and familial MECP2 mutations at CpG hotspots. Am J Hum Genet, 1999. 65(6): p. 1520-9. [58] Hamdan, F.F., et al., Mutations in SYNGAP1 in autosomal nonsyndromic mental retardation. N Engl J Med, 2009. 360(6): p. 599-605. [59] Saudubray, J.M., F. Sedel, and J.H. Walter, Clinical approach to treatable inborn metabolic diseases: an introduction. J Inherit Metab Dis, 2006. 29(2-3): p. 261-74. [60] Saudubray, J.M., Neurometabolic disorders. J Inherit Metab Dis, 2009. 32(5): p. 595-6. [61] Fernandes, J.S., J.M.; van den Berghe, G.; Walter, J.H., Inborn Metabolic Diseases: Diagnosis and Treatments. 4th ed, ed. Springer. 2006: Springer. [62] Applegarth, D.A., J.R. Toone, and R.B. Lowry, Incidence of inborn errors of metabolism in British Columbia, 1969-1996. Pediatrics, 2000. 105(1): p. e10. [63] Ku, C.S., et al., Exome sequencing: dual role as a discovery and diagnostic tool. Ann Neurol, 2012. 71(1): p. 5-14. [64] Klee, E.W., N.L. Hoppman-Chaney, and M.J. Ferber, Expanding DNA diagnostic panel testing: is more better? Expert Rev Mol Diagn, 2011. 11(7): p. 703-9. [65] Levenson, D., The tricky matter of secondary genomic findings: ACMG plans to issue recommendations. Am J Med Genet A, 2012. 158A(7): p. ix-x. [66] Lee, J.A. and J.R. Lupski, Genomic rearrangements and gene copy-number alterations as a cause of nervous system disorders. Neuron, 2006. 52(1): p. 103-21. [67] Kusenda, M. and J. Sebat, The role of rare structural variants in the genetics of autism spectrum disorders. Cytogenet Genome Res, 2008. 123(1-4): p. 36-43. [68] Guilmatre, A., et al., Recurrent rearrangements in synaptic and neurodevelopmental genes and shared biologic pathways in schizophrenia, autism, and mental retardation. Arch Gen Psychiatry, 2009. 66(9): p. 947-56. [69] Cantor, R.M. and D.H. Geschwind, Schizophrenia: genome, interrupted. Neuron, 2008. 58(2): p. 165-7. [70] Williams, C.A., et al., Angelman syndrome: mimicking conditions and phenotypes. Am J Med Genet, 2001. 101(1): p. 59-64. [71] Marschik, P.B., et al., Changing the perspective on early development of Rett syndrome. Res Dev Disabil, 2013. 34(4): p. 1236-9. [72] Neul, J.L., The relationship of Rett syndrome and MECP2 disorders to autism. Dialogues Clin Neurosci, 2012. 14(3): p. 253-62. [73] Maortua, H., et al., CDKL5 gene status in female patients with epilepsy and Rett-like features: two new mutations in the catalytic domain. BMC Med Genet, 2012. 13: p. 68. [74] Novara, F., et al., MEF2C deletions and mutations versus duplications: A clinical comparison. Eur J Med Genet, 2013. 56(5): p. 260-5. [75] Guerrini, R. and E. Parrini, Epilepsy in Rett syndrome, and CDKL5- and FOXG1-generelated encephalopathies. Epilepsia, 2012. 53(12): p. 2067-78. [76] Richards, C.S., et al., ACMG recommendations for standards for interpretation and reporting of sequence variations: Revisions 2007. Genet Med, 2008. 10(4): p. 294-300. [77] Saunders, C.J., et al., Rapid whole-genome sequencing for genetic disease diagnosis in neonatal intensive care units. Sci Transl Med, 2012. 4(154): p. 154ra135. [78] de Ligt, J., et al., Diagnostic exome sequencing in persons with severe intellectual disability. N Engl J Med, 2012. 367(20): p. 1921-9.

Evolution of Human Genome Analysis

2077

[79] Homer, N., et al., Resolving individuals contributing trace amounts of DNA to highly complex mixtures using high-density SNP genotyping microarrays. PLoS Genet, 2008. 4(8): p. e1000167. [80] Lo, Y.M., et al., Presence of fetal DNA in maternal plasma and serum. Lancet, 1997. 350(9076): p. 485-7. [81] Sayres, L.C. and M.K. Cho, Cell-free fetal nucleic acid testing: a review of the technology and its applications. Obstet Gynecol Surv, 2011. 66(7): p. 431-42. [82] Lo, Y.M., et al., Prenatal diagnosis of fetal RhD status by molecular analysis of maternal plasma. N Engl J Med, 1998. 339(24): p. 1734-8. [83] Chiu, R.W., et al., Non-invasive prenatal assessment of trisomy 21 by multiplexed maternal plasma DNA sequencing: large scale validity study. BMJ, 2011. 342: p. c7401. [84] Treff, N.R., et al., Evaluation of targeted next-generation sequencing-based preimplantation genetic diagnosis of monogenic disease. Fertil Steril, 2013. 99(5): p. 1377-1384 e6. [85] Martin, J., et al., The impact of next-generation sequencing technology on preimplantation genetic diagnosis and screening. Fertil Steril, 2013. 99(4): p. 1054-61 e3.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 97

IMPROVEMENTS IN HSV-1- DERIVED AMPLICON VECTORS FOR GENE TRANSFER Matias E. Melendez1,2,*, Alejandra I. Aguirre3,*, Maria V. Baez3, Carlos A. Bueno1,4, Anna Salvetti5, Diana A. Jerusalinsky≠,*,3 and Alberto L. Epstein†,*,1,5 1

Centre de Génétique et de Physiologie Moléculaire et Cellulaire, CNRS UMR5534, Université Claude Bernard Lyon 1, Villeurbanne, France 2 Molecular Oncology Research Center, Barretos Cancer Hospital, SP, Brazil 3 Instituto de Biología Celular y Neurociencia "Prof. Eduardo De Robertis", CONICET-UBA, Facultad de Medicina, Universidad de Buenos Aires, (1121) Ciudad de Buenos Aires, Argentina 4 Laboratorio de Virología, Departamento de Química Biológica, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Argentina 5 Centre International de Recherche en Infectiologie (CIRI) INSERM U1111 – CNRS UMR5308 Université Lyon 1, Lyon, France

ABSTRACT Viral vectors engineered to carry transgenic sequences can be delivered into discrete tissues or anatomical structures to express specific transgenes into the transduced cells. Therefore, they are useful tools to produce specific, transient and localized knockout, knockdown, ectopic expression or overexpression of a gene, leading to the possibility of analyzing both in vitro and in vivo molecular basis of relevant functions. Replicationincompetent helper-dependent amplicon vectors, derived from herpes simplex virus type* Equivalent

contribution to this work. Corresponding Author’s Email: [email protected] (CIRI INSERM U1111 – CNRS UMR5308. Université Lyon 1, ENS de Lyon. 46 Allée d'Italie. 69364 LYON cedex 07, France). ≠ Corresponding Author’s Email: [email protected] (IBCN - School Medicine. University of Buenos Aires. 2155 Paraguay Street, 3rd floor. (1121) City of Bs. As., Argentina). †

2080

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

1 (HSV-1) are devoid of viral genes. Thus, these vectors have great advantages as tools for in vitro and in vivo gene transfer and, in particular (i) minimal toxicity or induction of adaptive immune responses, and (ii) large transgene capacity, being able to carry up to 150 kbp of foreign DNA. In addition, these vectors have (iii) widespread cellular tropism: amplicons can experimentally infect several cell types, either quiescent or not, though naturally HSV-1 infects mainly neurons and epithelial cells, and (iv) absence of insertional mutagenesis, since the viral genome does not integrate into the host cell genome. These vectors have been used both on basic and applied research, and they have revealed as most suitable tools to study complex functions involving the nervous system, such as anxiety, sexual behavior, learning and memory. In addition, amplicon vectors are being used for the development of new experimental gene therapy approaches, both for inherited and acquired diseases affecting the nervous system, including neuro-degenerative diseases. Although several technological improvements have been achieved in the last decade, some difficulties regarding these appealing vectors remain still unresolved, such as the inability to generate large amounts of high-titer fully helper-free vectors and the fact that expression from the transgenic sequence delivered by the vectors is generally unstable, often leading to a complete silencing of expression after a few weeks. To overcome these obstacles and to improve these vectors, we have recently modified (a) the amplicon genome, in order to fully delete bacterial sequences and (b) developed novel complementing cell lines, in order to improve helper-free vector production and to render amplicon stocks compatible with clinical trials. In this review article we briefly review data supporting the potential of HSV1-based amplicon vector model for gene delivery in primary cultures of neural cells and into the brain of living animals.

Keywords: HSV-1-derived vectors, Amplicons, nervous system, neurodegenerative disorders, cancer, vaccines, experimental gene therapy

HSV-1 BACKGROUND HSV-1 Epidemiology and Clinical Features HSV-1 is one of the most common human pathogens, infecting 40–80% of people worldwide. Primary, productive infections of HSV-1 typically occur in regions of the orofacial mucosa, causing a mild gingivo-stomatitis. The virus particles produced during this primary infection enter the peripheral sensory neurons, where the virus genome often remains into a latent for the lifetime of the host. Reactivation, occurring generally following stress, usually leads to recurrent lesions in the vicinity of the primary infected area and are typically limited to cold sores of the mouth. Although recrudescent herpes may affect any site along the involved sensory division of the fifth cranial nerve, the most frequent location is the muco-cutaneous junction of the lips [1]. Classic lesions are characterized by virally induced epithelial damage and go through different clinical stages. Initially, a transient cluster of micro-vesicles appears at the site of recrudescence and breaks open to form irregular, superficial erosions that crust over and heal without scarring over a period of 1–2 weeks. Shedding of the virus is often present for several days after resolution of clinical signs and symptoms [1]. HSV-1 infection can also cause ocular herpes and, much more infrequently, it can cause encephalitis. In neonates and in immune-depressed individuals HSV-1 can cause severe disseminated infection with neurological impairment and high mortality [2].

Amplicon Vectors for Gene Transfer

2081

HSV-1 Virion Structure The architecture of this enveloped double-stranded DNA virus, of 220 nm in diameter, is highly complex [3]. The mature HSV-1 virion (Fig. 1) consists of the following four components: • • •

•

A core of double-stranded (ds) DNA An icosadeltahedral capsid The tegument, which is a layer of proteins located between the envelope and the underlying capsid; these proteins play a critical role in virion morphogenesis, and they also help the virus to take the control of the expression machinery of the cell very early following infection A lipid envelope from cellular origin, where viral glycoproteins and other membrane proteins are embedded, several of which are involved in receptor-mediated cellular entry.

Figure 1. HSV-1 Virion.

HSV-1 Genome The linear 152-kbp dsDNA virus genome (Fig. 2) is densely packaged within the capsid cavity [4] and is devoid of histone proteins at this stage [5]. This genome is arranged as long (UL) and short (US) unique segments, of 126 and 26 kbp, respectively. The UL and US segments are flanked by repeated sequences, designated ab, b’a’ a’c’ and ca (or TRL, IRL, IRS and TRS, for Terminal Repeat L, Internal Repeat L, Internal Repeat S and Terminal repeat S) [6]. The HSV-1 genome, which is 68% G+C rich, has been fully sequenced [7-9]. At least eighty-four viral genes are encoded, and these may be divided into essential and non-essential genes, according to whether their expression is necessary or not for viral growth in permissive cultured cells. HSV-1 genes do not contain intron sequences, with the exception of those encoding ICP0, ICP22, ICP47, UL15 and LAT. Nonessential genes often encode functions that

2082

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

are important for specific virus-host interaction in vivo, such as immune evasion, replication in non-dividing cells or shutdown of host protein synthesis. Approximately half of the viral genes have been shown to be dispensable for replication of the virus in cultured cells, and thus, these genes could be replaced by exogenous genetic material, which has been the premise for the development of HSV-1-based vectors for gene therapy [10]. In contrast, most genes involved in virus entry, DNA replication, capsid assembly and DNA packaging are essential.

Figure 2. HSV-1 genome.

The HSV-1 genome contains two cis-acting sequences that are essential for virus multiplication: the viral DNA replication origins and the cleavage/packaging signals. HSV-1 harbors three lytic origins of replication, with two located within the repeated segments surrounding US (oriS) and one in the UL segment (oriL) [11]. Mutant viruses lacking either oriL or both copies of oriS are replication competent, suggesting that all origins are functionally competent [6]. The oriS is located within the shared promoter regulatory region between the divergently transcribed immediate-early genes ICP4 and ICP22/ICP47, whereas oriL lies in the regulatory region between two divergently transcribed early genes that are essential for viral DNA replication: the major DNA-binding protein and the HSV-1 DNA polymerase [12]. The cleavage/packaging signals of the HSV-1 genome are located within the a sequences, generally found in tandem repeats at both ends of the genome, as well as at the L/S junction [13, 14]. In different HSV-1 strains, the a sequence ranges from 250 to 500 bp. An approximately 200-bp fragment (Uc-DR1-Ub) spanning the junction between tandem a sequences has been shown to contain all the essential cis-acting sequences necessary for DNA cleavage and packaging [15]. The specific signals for DNA cleavage and packaging, termed pac1 and pac2, are located within the Ub and Uc regions, respectively [14-16].

HSV-1-DERIVED VECTORS The improvement of methods for efficient delivery of genetic material in mammalian cells has been a major objective of molecular and cellular biology, gene therapy and vaccine development during the last 30 years and is still a subject of increasing interest. Viral-derived

Amplicon Vectors for Gene Transfer

2083

vectors are the most promising gene transfer tools as viruses have naturally evolved as molecular carriers to specific tissues. As already quoted, HSV-1 is a naturally epithelialneurotropic virus, highly adapted to the nervous system environment of the host organism, and neurons and glia are thus the most common target cells for HSV-1-derived vectors. Coding more than 80 genes, HSV-1 is a complex virus, which can be engineered to exquisitely design viral vectors for fundamental research and gene therapy of neurological disorders. In general terms, HSV-1 possesses several features that make it especially interesting as a vector: •

• • •

• • •

Although essentially neurotropic, under experimental conditions HSV-1 has a broad host cell range, due to the fact that its cellular receptors are widely distributed. In addition, HSV-1 infects and replicates in cells from different mammals, easily allowing preclinical evaluation. It can infect dividing and non-dividing cells. It generally causes nonthreatening diseases. It has a very large transgene capacity, allowing to deliver multiple or large transgenes (approximately half of the genome is nonessential in cultured cells and can be deleted without compromising viral replication, allowing to lodge considerable amounts of transgenic DNA). Moreover, HSV-1-derived amplicon vectors are devoid of almost the totality of their genome (i.e., 152-kbp DNA), which can therefore be replaced by exogenous DNA. Safe replication-defective HSV-1 vectors may be prepared to high titers. The ability to establish a latent state in neurons may be very useful for stable longterm expression of therapeutic transgenes. HSV-1 genome does not integrate into host chromosomes, remaining episomal and reducing the risk of insertional mutagenesis.

To exploit the versatility of HSV-1 for gene transfer, three types of HSV-1-based vectors have been developed: (i) attenuated replication-competent vectors, (ii) replication-defective recombinant vectors, and (iii) amplicon vectors. Attenuated replication-competent HSV-1 vectors can replicate only in certain cell types and tissues in vivo due to deletion of non-essential viral genes. Such vectors have been typically used for the development of tumor therapies, and are usually referred to as oncolytic HSV-1 vectors. However, other uses of attenuated vectors are possible, for example to deliver genes to the peripheral sensory ganglia following infection at peripheral tissues. Replication-defective recombinant HSV-1 vectors are devoid of one or more viral genes that are essential for lytic replication (such as the immediate early genes ICP4 and ICP27), but they can retain their ability to establish latency [17, 18]. The production of these vectors requires complementing cell lines expressing the deleted viral genes. This type of vectors can be used as genetic vaccines or for gene therapy of neurological disorders. Lastly, Spaete and Frenkel [19] reported the natural generation of fully defective HSV-1 genomes, in which almost all the transacting virus genes were absent. These defective genomes were formed mainly by repeats of the two non-coding HSV-1 sequences, i.e., the origins of DNA replication and the cleavage/packaging signals. Moreover, they have showed that these defective genomes could be replicated and packaged into particles in the presence of a helper virus that supplied all the virus functions in trans, thus demonstrating that the origins of virus replication and the cleavage/packaging signals were the only two cis-acting sequences required for replication and packaging of a defective virus genome. These cis-acting sequences from the

2084

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

HSV-1 genome were then incorporated into a standard bacterial plasmid, which they have termed the amplicon plasmid [19], and they demonstrated that the amplicon plasmid could also be replicated and packaged into viral particles in the presence of a helper system, thus generating what they have termed amplicon vectors. This chapter will be devoted to the biology and applications of this very appealing type of vectors.

Amplicon Vectors A conventional HSV-1 amplicon plasmid consists of (i) a plasmid backbone harboring a bacterial origin of DNA replication and an antibiotic resistance gene for propagation in bacteria, (ii) an HSV-1 origin of DNA replication (generally oriS), (iii) an HSV-1 cleavage/packaging sequence (pac or a), (iv) a transcription unit expressing a reporter gene, generally encoding the green fluorescence protein (GFP), which is useful for identifying the amplicon-infected cells and to facilitate the titration of amplicon stocks, and (v), a multiple cloning site (MCS) for introducing the transgene(s) of interest (Fig. 3). This basic structure of amplicon plasmids has remained almost unchanged from the beginning [19].

Figure 3. Structure of a typical amplicon plasmid.

Heterologous transcription units, either alone or in combination, can be cloned into amplicon plasmids using conventional molecular cloning techniques; the resulting construct is then packaged into viral particles to be then used for transduction of cells or tissues. From the structural point of view, amplicon vectors are virus particles structurally and immunological identical to wild-type HSV-1 particles, but bearing, instead of the virus genome, a concatemeric form of DNA amplified in a head-to-tail arrangement, which derives from the amplicon plasmid (Fig. 4). Amplicon vectors have been used both on basic and applied research, and they have revealed as most suitable tools to study complex functions involving the nervous system, such as anxiety, sexual behaviour, learning and memory. In addition, amplicon vectors are being used for the development of new experimental gene therapy approaches (both for inherited and acquired diseases affecting the nervous system, including neurodegenerative diseases) [20-23],

Amplicon Vectors for Gene Transfer

2085

vaccine development [24, 25], hybrid viral vectors (such as adeno-associated and lentivirus viruses) [26, 27], human artificial chromosome technologies [28, 29] and basic research. It is not possible to fully describe these applications in the short extent of this manuscript. For a more detailed description of amplicon vector applications, please refer to Cuchet et al. (2007) [30], Epstein (2009) [31],Fraefel (2007) [32], Manservigi et al. (2011) [33] and de Silva and Bowers (2009) [10].

Figure 4. Concatemeric amplicon DNA replication.

Amplicon Vector Properties The amplicon system has several properties that make it a reliable and efficient method for gene transfer. 1. The two HSV-1 elements required to support replication and packaging into virions, i.e., the oriS and a sequences, are smaller than 1-kbp. Since the HSV-1 particle can package up to 153-kbp, this means that the amplicon particle has the potential to accommodate very large fragments of foreign DNA, including multiple and/or large transgenes or large cell type-specific regulatory sequences. This is the most remarkable feature of amplicon vectors, as there is no other available viral vector system displaying the capacity to deliver such a large amount of foreign DNA (150-kbp) to the nuclear environment of mammalian cells. 2. Depending on the size of the amplicon plasmid, several copies of the transgene can be packaged into a single vector particle [34], thereby increasing the transgene dose per infected cell. This happens because the amplicon genome is replicated via a monodirectional rolling circle-like mechanism, therefore generating long concatemers composed of tandem repeats of the amplicon plasmid, and because each HSV-1 amplicon particle always cleaves and packages a 150-kbp DNA molecule, which represents the HSV-1 particle packaging capacity [35].

2086

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

3. The HSV amplicon is not an ‘alive’ virus but an inert particle, bearing an inherently safe in vivo profile. Although amplicon genomes carry no virus genes and consequently do not induce synthesis of viral proteins, the approximately 40 different HSV-1 structural proteins that shape the HSV-1 virion (which are the same in the amplicon virion) are delivered into the cell during infection and can trigger cell signaling and cellular responses, probably having a transient impact on cell homeostasis and cellular gene expression. Nevertheless, these proteins soon disappear and the cells can resume their normal functions, including the ability to divide and to respond to physiological stimuli. Furthermore, the absence of viral genes in the amplicon genome strongly reduces the risk of reactivation, complementation or recombination with latent or resident HSV-1 genomes. 4. As already quoted, after primary HSV-1 infection of epithelial cells, the virus particles can enter sensory nerve endings and the capsid is moved via retrograde axonal transport to the neuronal cell bodies of the sensory ganglia, where the virus genome may establish a latent infection. Most of these mechanisms are certainly reproduced by amplicon vectors, since the mature amplicon particle is identical to that of the helper HSV-1 and they will thus behave as normal virion particles. However, it is not yet clear if the amplicon genome can establish a latency-like long-term expression in sensory neurons. 5. Once packaged into viral particles, the amplicon vector retains the ability to infect numerous cell types, and its genome is maintained in an episomal state within the nucleus of the infected cell. Due to the absence of viral gene expression, the amplicon is replication-defective, and its episomal existence results in stable maintenance in post-mitotic cells, but leads to unequal segregation in mitotically active cells. Since it does not integrate into the host cell genome, the conventional amplicon does not lead to insertional mutagenesis, thus increasing its safety profile as a gene therapy vector.

Amplicon Production Systems Production of amplicon vectors involves the coordinated action of more than 50 viral proteins, required to allow replication and packaging of the amplicon plasmid into fully infectious virus particles. Amplicon plasmids are therefore dependent on helper HSV-1 virus proteins, and the genes encoding these proteins could in principle be supplied by a helper HSV1, or by HSV-1 viral DNA. The most important limitation for the use of amplicons in gene therapy trials is the difficulty to produce large, high-titer stocks of vector particles free of helper virus contamination. At present, there are two major methods used for producing amplicon vectors with low or even without HSV-1-helper-contamination (Fig. 5): one is based on transfection of the amplicon plasmid with HSV-1 helper genome (either as bacterial artificial chromosome (BAC) or as cosmid-based packaging systems), and the other, is based on transfection of the amplicon plasmid in cells expressing Cre recombinase, followed by infection using a defective helper HSV-1 carrying loxP sequences surrounding the packaging signals. Helper DNA-Based Packaging Methods DNA-based packaging methods for amplicon production are carried out by co-transfecting amplicon plasmids with HSV-1 genomes lacking their packaging signals. This system, initially derived from a set of five overlapping cosmids, each one carrying a large fragment of the virus

Amplicon Vectors for Gene Transfer

2087

genome, which allows the reconstitution of a full virus genome by homologous recombination, in cells co-transfected with the full cosmid set [36]. By deleting the a sequences from the two cosmids carrying them, this system generates a virus genome that is able to express all the required transacting functions but which cannot itself be packaged into HSV-1 particles. The co-transfection of amplicon plasmids with the modified set of cosmids allows therefore the production amplicon vectors. Using this system, however, amplicons are produced in relative low amounts (105-106 TU/mL) [37], and the vector stocks can be barely contaminated with helper virus particles.

Figure 5. Amplicon production systems. (A) DNA-based packaging system: Vero ICP27-expressing cells are co-transfected with the amplicon plasmid, the fBACΔpac BAC (which carries a nonpackageable HSV-1 genome) and an ICP27-expressing plasmid, and amplicon vectors are harvested from cells 2 or 3 days post-transfection. (B) Helper virus-based packaging system: Vero ICP4expressing cells are transfected with an amplicon plasmid and super-infected with the HSV-1 LaLΔJ helper virus. At two days post-infection, the mixed population of viral particles (amplicons and helper particles) is used to infect ICP4/Cre recombinase-expressing cells. After 2 days, amplicon vectors, only barely contaminated with defective helper particles, are harvested from infected cells.

This approach was later simplified and significantly improved by cloning the entire HSV1 genome, only devoid of a signals, into a bacterial artificial chromosome (BAC), thus generating a BAC-HSV-1) [38, 39]. In the last version of this system, the gene encoding the essential ICP27 protein was further deleted from the BAC-HSV-1 genome, which was then increased in size by adding non-coding DNA to further reduce the probability of being packed into newly assembled HSV-1 particles [39, 40]. The ICP27 protein is supplied in trans, both by a plasmid and by complementing cell lines expressing this protein (Fig. 5A). This system gave rise to the production of entirely helper-free amplicon stocks for the first time. Vector

2088

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

titers obtained from helper virus-free amplicon packaging can range from 107 to 108 TU/ml, but the total amount of particles is somewhat limited by the fact that vector stocks produced in this way cannot be serially passaged. Helper Virus-Based Packaging Methods Historically, the first method to produce amplicon stocks was based in the transfection of cells with the amplicon plasmid, followed by super-infection with a helper HSV-1 virus, to supply in trans the necessary viral functions. One advantage of this system was that the vector/helper stock thus produced could be serially passaged, to produce as many amplicon particles as required. Although this method allows to produce large amounts of amplicon vectors, its major limitation is that it leads to a mixed population of particles, highly contaminated with HSV-1 helper particles, which induces strong cytotoxicity and immune responses upon infection of target cells or organisms, thus impeding their use in gene therapy and even in many fundamental studies. Due to the identical physical properties of both amplicon and HSV-1 helper virus particles, a selective purification of amplicon particles by physical treatment is not feasible. Therefore, different strategies have been successively developed in order to reduce the toxicity of the helper-contaminated amplicon stocks, firstly by modifying the helper virus genome in order to limit its toxicity, and secondly, by limiting the production of contaminant particles. The first approach to improve this virus-based method was the use of a thermosensitive HSV-1 as helper [41]. Subsequently, defective helper HSV-1 viruses, carrying deletions in immediate early genes encoding one essential protein [42-45] were developed. However, and despite obtaining relatively high titers, these amplicon stocks were still contaminated with large amounts of defective HSV-1 helper particles, resulting in significant cytotoxicity and inflammation. LaL and LaLJ HSV-1 Helper System More recently, an attractive approach to produce amplicon vectors using the helper virusbased system, was developed to avoid or to limit helper genome packaging while producing high amounts of amplicon stocks. This system is based on the deletion of a sequences from the HSV-1 helper genomes by a Cre/loxP-based site-specific recombination, in order to abolish their packaging in the cells that are producing the amplicon vectors. The first of these helper systems, named HSV-1 LaL (for lox-a-lox) helper, carried a unique and ectopic a sequence flanked by two parallel loxP sites, located in the gC locus [46, 47]. This virus is therefore Cresensitive and cannot, in principle, be packaged in Cre-expressing cells due to deletion of the floxed a sequence. Nevertheless, some helper genomes could escape the action of the Cre recombinase, allowing the production of some helper particles, which are replicationcompetent and able to spread. To further improve this helper system, the two genes surrounding the a sequence, encoding the virulence factor ICP34.5 and the essential protein ICP4, were deleted from the LaL genome, generating the LaL∆J helper virus [48]. Although the amplicon stocks prepared with this helper, in a cell line trans-complementing both Cre and ICP4 proteins (Fig. 5B) still contain a very small amount of contaminating helper particles, the replication-incompetent LaLJ helper cannot spread upon infection of target cells or tissues. Use of the HSV-1 LaL∆J helper virus generally results in the production of large stocks of amplicon vectors with titers often

Amplicon Vectors for Gene Transfer

2089

exceeding 2x108 TU/mL, and only barely contaminated (about 1.0%) with defective, nonpathogenic helper particles. Nevertheless, the presence of contaminating helper virus, even at very low levels, could still be a limitation for the use of amplicon stocks in some gene therapy applications. Therefore, the approaches to produce amplicon vectors should still be improved in order to produce high amounts of high-titer of entirely non-toxic amplicon stocks. Further Improvements of Amplicon Vectors Technology Although several technological improvements for amplicon vectors production have been thus developed in the last decade, several difficulties remain still unresolved. These include: (i) cytopathic effects and immune responses induced by gene expression from potential helper virus contaminants; (ii) potential reversion of helper virus contaminants to the wild type HSV phenotype; (iii) potential interactions with residing HSV-1, eventually leading to complementation, reactivation and recombination; (iv) the inability of the vector genome to be maintained in proliferating cells; (v) the presence of bacterial DNA sequences, which can lead to inflammatory responses and to the silencing of transgene expression, and (vi) the already quoted inability to generate large amounts of high-titer vectors fully free of contaminant helper particles. To overcome some of these obstacles and to improve these vectors, we have recently introduced two modifications to the amplicon vector production system, corresponding to: (i) the amplicon genome, in order to fully delete bacterial sequences and (ii) the nature of the complementing cell lines where the amplicons are produced, in order to improve helper-free vector production. We briefly describe in the following paragraphs our ongoing program to improve the amplicon methodology. Elimination of Bacterial DNA from the Amplicon Genome It is known that the presence of bacterial sequences in transduced plasmids can induce silencing of the transgene cassette, as well as innate and inflammatory reactions. In addition, bacterial sequences are outlaw in gene therapy protocols. In the case of amplicons, it was recently demonstrated that the presence of bacterial sequences in the amplicon plasmid (and thus, also present in the amplicon vector genome) cause inflammatory responses and rapid transgene silencing, by forming inactive chromatin [49]. In this regard, it has been shown that infection with amplicon vectors lacking bacterial sequences (minicircle amplicon vectors) induced approximately 20-fold higher transgene expression due to transcriptional enhancement [49]. In addition, nude mice injected with minicircle amplicon vectors exhibited 10-fold higher luciferase expression than mice injected with conventional amplicons, detectable up to at least 28 days post-infection [49]. Elimination of these bacterial DNA sequences from the amplicon genome is therefore critical if the vectors will be used in gene therapy. Our efforts to eliminate bacterial DNA from the amplicon genome are based on the modification of the amplicon plasmid. We have recently generated a new amplicon plasmid, named pOPNE (Fig. 6), which possesses a typical plasmidic backbone with a bacterial origin of DNA replication (E. coli ori) and an antibiotic resistance gene (AmpR). This plasmid also contains an amplicon cassette surrounded by two loxP (L) sites in parallel orientation. As usual, the amplicon cassette carries one HSV-1 oriS and one pac (or a) signal. Note that the oriS sequence is linked to the HSV-1 IE4/5 promoter (IE4/5), very close to one of the loxP sites. pOPNE also contains a Neomycin/Kanamycin resistance gene (Neo) bordered by two FRT sites (F). This FRT-bordered cassette will serve as an acceptor locus for the introduction of transgenes through FRT-flipase site-specific recombination. Finally, the amplicon cassette also

2090

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

possesses a promoterless EGFP (enhanced-GFP) reporter gene, juxtaposed to the second loxP site. Preliminary results (not shown here), indicate that when the pOPNE plasmid is transfected in Cre recombinase-expressing cell lines, the amplicon plasmid recombines at the loxP sites, thereby producing two molecules: one minicircle carrying the bacterial sequences present in the plasmid backbone (residual DNA) and a second minicircle carrying the complete amplicon module devoid of bacterial sequences (Fig. 7). In addition, the Cre recombinase-mediated deletion of the bacterial sequences brought the IE4/5 promoter upstream the promoterlessEGFP open reading frame (ORF), therefore leading to EGFP transcription. Following infection of these cells with helper HSV-1, the amplicon genome was then encapsidated into HSV-1 particles. These particles expressed EGFP upon infecting target cells, therefore demonstrating that they have lost the bacterial sequences between the promoter and the EGFP ORF. These vectors are therefore appropriate for further used in gene transfer approaches. We are currently investigating the biological properties of these bacterial DNA-free amplicon vectors.

Figure 6. Structure of pOPNE amplicon plasmid. ori: bacterial origin of DNA replication; AmpR: Ampicillin resistance gene; L: loxP sites; oriS: HSV-1 origin of DNA replication; pac: HSV-1 cleavage/packaging-encapsidation sequence; IE4/5: HSV-1 IE4/5 promoter; F_Neo_F: Neomycin resistance gene bordered by two FRT sites (F); and EGFP: EGFP reporter gene, without promoter.

Figure 7. Cre recombinase-mediated cleavage and dissociation of pOPNE plasmid. Upon Cre recombinase expression, the amplicon plasmid pOPNE is dissociated into two DNA molecules: one carries the residual bacterial DNA and another carries the amplicon sequences devoid of bacterial DNA.

Amplicon Vectors for Gene Transfer

2091

Modification of the Complementing Cell Lines

VCre4 Cell Line As already quoted, when using HSV-1 LaLΔJ as helper virus, the helper particles are eliminated through a Cre/loxP-based site-specific recombination event that requires thus the expression of Cre-recombinase in the infected cells, in addition to the expression of the essential protein ICP4, whose gene is absent in this helper system. Previous cell lines expressing simultaneously ICP4 and Cre recombinase, that were used for the production of amplicon stocks with HSV-1 LaLΔJ helper, were derived from TE-671 cells (human rhabdomyosarcoma cells, ATCC CRL 8805) [46]. As these cells are cancer-derived cell lines, they cannot be used to produce vectors for gene therapy. In contrast, Vero and Vero-derived cell lines are approved for gene therapy approaches by the Food and Drug Administration (FDA - U.S. Department of Health and Human Services) [50]. Therefore, we have recently constructed another cell line, derived from Vero cells, which we named VCre4. These cells express Cre recombinase under the control of the HCMV promoter and the 10.4-kbp ICP4 locus including its own promoter (HSV-1 bases 126,764131,731). Preliminary results have shown that VCre4 cells produce higher levels of amplicon vector stocks than the previous system and these stocks contains lower than 1% of contaminant defective helper particles (data not shown here). Therefore, not only VCre4 cells provide a better packaging cell system but, in addition, the creation of this novel Vero-based cell line, brings amplicon vector technology closer to gene therapy protocols and represents a promising approach to treat neurodegenerative diseases.

AMPLICON VECTORS AND CANCER In this section we present a very brief summary about some past and recent applications of HSV-1 derived vectors to cancer research and experimental therapy. HSV-1-amplicon vectors have been tested for treatment of different experimental tumours, both in brain and in other organs and tissues, exploiting its inherent absence of toxicity and ability to infect many different cell types. Since these vectors can efficiently deliver transgenes to cancer cells, but they are diluted during successive cell divisions, most studies have used acute approaches by delivering pro-drug activating enzymes, cytotoxic proteins, apoptosisinducing factors, fusogenic proteins and small interfering RNAs (siRNAs) for growth factor receptors. In addition, several studies have targeted amplicon vector entry or expression in order to improve treatment efficacy and selectivity. Targeting tumour cells using HSV-1 vectors is a complicated issue as the process involves multiple interactions of viral envelope glycoproteins and cellular host surface proteins. In order to improve the selectivity of amplicon vectors tropism for tumour cells, such as glioma cells, the heparan sulfate-binding domain of glycoprotein C (gC) has been replaced with a human glioma-specific peptide sequence (MG11). Preferential homing of these virions in glioma cells was confirmed in a xenograft glioma mouse model, following intravascular delivery [51]. Another important issue is the inefficient distribution of vector particles in vivo, which may limit their therapeutic potential in patients with gliomas and, in this context, it has been recently

2092

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

demonstrated that vector-mediated gene expression in gliomas was strongly dependent on vector application-injection pressure and injection time [52]. In order to improve efficiency and safety of cancer gene therapies, efforts have been made at specifically targeting proliferating cells in glioma models. The HSV-1 immediate-early gene ICP0 possesses E3-ubiquitin ligase activity [53] and it can induce the degradation of centromeric proteins [54]. Amplicons expressing the HSV-1 ICP0 were used to infect human glioblastoma Gli36 cells and well-established models of non-dividing cells, such as primary cultures of either rat cardiomyocytes or brain cells. ICP0 induced a strong cytostatic effect and significant cell death in Gli36 cells. In contrast, neither cell death nor any evidence of ICP0induced toxicity was evident in both primary cultures of non-cycling cells. These observations suggest that ICP0 has gene therapy potential and would be the first member of a new family of cytostatic proteins that could be used to treat cancer [55]. A different approach used amplicons expressing siRNA in order to mediate posttranscriptional silencing of molecules involved in the pathogenesis of cancer or connected with the radiation resistance of tumour cells. Infected human glioblastoma cells with knockdown for the epidermal growth factor receptor (EGFR) expression displayed growth inhibition, both in culture and in athymic mice [56]. Besides, the combination of vector-mediated silencing of Rad51 expression (which is a key component of the homologous recombination repair of DNA double-strand breaks) and treatment with ionizing radiation, resulted in a pronounced reduction of human glioma cells survival in culture and in a significant decrease in tumour size in athymic mice [57]. Another tested strategy was to target tumour cells via transcriptional control of therapeutic genes. Ho and co-workers constructed a glioma-specific and cell cycle-regulated amplicon carrying the GFAP enhancer/promoter element, plus a cell cycle specific regulatory element from the cyclin A promoter [58]. Transgenic activity was mediated in a cell type-specific and cell cycle-dependent manner, both in vitro and in vivo in glioma-bearing animals [59]. Antitumour efficacy of this vector system was assessed using the pro-apoptotic proteins Fas ligand (FasL) and the Fas-associated death domain (FADD), inducing cell death in proliferating primary human glioma cells derived from patients, and resulting in prolonged survival of mice bearing orthotopic gliomas [60]. The authors pointed out that these vectors are stable, elicit minimal immune response and are not significantly hampered by hemotherapy or irradiation in vivo [58]. To achieve schwannomas regression without injury to associated neurons, it was generated an HSV-1 amplicon vector, in which the apoptosis-inducing enzyme caspase-1 (ICE), was placed under the Schwann cell-specific P0 promoter. Following direct intra-tumoral injection of the P0-ICE amplicon vector in an experimental xenograft mouse model (tumours were formed by subcutaneous injection of an immortalized human schwannoma cell line into one or both flanks of immunodeficient mice), there was a marked regression of schwannoma tumours. Injection of the same amplicon vector into the sciatic nerve produced no apparent injury to the associated dorsal root ganglia neurons or myelinated nerve fibers. Hence, the P0-ICE amplicon vector provides a potential means of ‘knifeless resection’ of schwannoma tumours by injection of the vector into the tumour, with low risk of damage to associated nerve fibers [61].

Amplicon Vectors for Gene Transfer

2093

AMPLICON VECTORS AND VACCINES In this section we present a brief summary about some applications of HSV-1 derived vectors as potential vaccines. Wild-type HSV-1 is a potent immunogen that can elicit both host innate and adaptive immune responses [62], though is also able to evade host immunity due to immuno-modulatory gene products such as the ICP47 protein [63]. The biological characteristics of HSV-1 amplicons that make them an attractive candidate for vaccine delivery applications are: its safety profile, the lack of expression of viral immuno-evasive genes, large insert capacity and ability to infect a wide range of cells, including antigen-presenting cells. So far, immunization studies involving amplicons have been essentially directed against viral pathogens and neurological disease factors. Virus-like particles (VLPs) are promising vaccine candidates, because they represent viral antigens in the authentic conformation of the virus particles and are, therefore, readily recognized by the immune system. As VLPs do not contain genetic material, they are safer than attenuated virus vaccines. In a first study, HSV-1 amplicon vectors were constructed to coexpress the rotavirus (RV) structural genes VP2, VP6, and VP7, and were used as platforms to launch the production of RV-like particles (RVLPs) in vector-infected mammalian cells. HSV-1 amplicon vectors launching the production of heterologous rotavirus-like particles were able to induce rotavirus-specific immune response in mice [25]. In a second study, amplicons expressing Foot-and-mouth disease (FMD) virus antigens were used to generate a genetic vaccine prototype, based in the in situ generation of FMD-VLPs [64]. Amplicons have been also used to express antigens and elicit immune responses in the context of veterinary diseases. In particular, specific serum antibody responses were detected in mice inoculated with amplicon vectors that expressed the glycoprotein D (gD) of bovine herpesvirus [24]. Most studies focused on immunization against HIV. Hocknell and collegues showed that a single inoculation of 1x106 transducing units of amplicons expressing the HIV-1 envelope glycoprotein (gp120), was able to elicit strong, antigen-specific and long-lasting (≤ 5 months) cellular and humoral responses in mice [65]. Subsequent studies demonstrated that a combined heterologous prime-boost immunization approach using naked plasmid DNA prime and amplicon boost expressing the gp120 antigen could enhance by 15- to 20-fold the amplicon induced memory T-cell responses [66]. Gorantla and co-workers used non-obese diabetic/severe combined immunodeficient mice repopulated with human peripheral blood lymphocytes, as in vivo model for HIV immunization [67]. Injecting autologous dendritic cells transduced ex vivo with a gp120-expressing amplicon into these mice, resulted in primary HIV1-specific humoral and cellular immune responses. The same authors demonstrated that there also was a partial protection against infectious HIV-1 challenge in the immunized mice [67]. Lastly, in an attempt to optimize amplicons for HIV vaccine delivery, Santos and collaborators showed that amplicons expressing the HIV-1 gag gene driven by two different HCMV hybrid promoters (HCMV/long-terminal repeat or HCMV/woodchuck post-regulatory element), elicited the strongest immune response in mice [68]. Other studies have explored the potential of amplicons in immunotherapy for prion disorders. Bowers and collaborators described the construction of amplicons expressing domains of PrP C fused to tetanus toxin Fragment C as adjuvant, as a base for prion disorders

2094

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

immunotherapy [69]. Vaccination generated significant levels of prion protein (PrP)-specific antibodies in mice, but none of the constructions was able to alter disease progression. Since amplicons can elicit strong antigen-specific immune responses to viral or mammalian proteins, they might be used in prophylactic vaccination against pathogens or neurodegenerative diseases. However, due to the high prevalence of HSV infection within the human population, one major concern about their use as vaccines is the possible impact of preexisting antiviral immunity on vaccine efficiency. This question remains controversial. Some studies using replication-defective HSV-1 showed strong immune responses even in the presence of anti-HSV immunity [65, 70]. In contrast, another study with a replication-defective HSV-1, showed a substantial reduction in immune responses in animals previously vaccinated against HSV-1 [71].

AMPLICON VECTORS AND BEHAVIOUR Amplicon vectors have been delivered into distinct brain regions to investigate complex aspects of the normal functioning of the central nervous system (CNS). Amplicon vectors designed to modify protein expression may carry sequences that allow overexpression or knockdown of an endogenous protein, or expression of an exogenous protein (e.g., dominantnegative mutants) relevant for CNS functions, like proteins directly involved in neurotransmission and in neuron signaling. A comprehensive review on the use of amplicons vectors to study behaviour can be found in Jerusalinsky and co-workers (2012) [20]. Different challenges to find causal relationships between neuronal molecular mechanisms and learning and memory processing, have been solved by the use of amplicon vectors. These vectors were used, for example, to investigate the involvement of NMDA glutamate receptor (NMDAR) in learning and memory. Amplicons carrying sequences in either sense or antisense orientations of the GluN1 subunit gene, in addition to EGFP as the reporter gene, were used to investigate the participation of hippocampal NMDAR by modifying the expression of that essential GluN1 subunit in the rat CNS. The ability to modify endogenous levels of GluN1 was first tested in vitro in primary cultures of neurons from rat embryo cerebral cortex [72, 73] and then assessed in vivo. Adult rats inoculated into the dorsal hippocampus with vectors expressing GluN1 antisense performed significantly worse than control rats in an inhibitory avoidance of a footshock task, and did not show habituation (decreased exploratory behaviour) by repeated exposure to an open field. Immunohistochemistry in serial brain slices from these animals, showed that the transduced cells represented approximately 6–7% of hippocampal pyramidal neurons in CA1 region and just about less than 1% of granule cells in the dentate gyrus, indicating that the knockdown of a single gene in a small number of those neurons significantly impaired memory [74]. Amplicon vectors expressing a constitutively active catalytic domain of the protein kinase C (PKC) β-II were used to transduce rat hippocampal dentate granule neurons. Activation of PKC pathways in a small percentage of these neurons was sufficient to enhance rat auditory discrimination reversal learning, suggesting an hippocampal auditory mediated learning in the rat [75]. Amplicon vectors have been used to elucidate the role of the alpha-amino-3-hydroxy-5methyl-4-isoxazole-propionic acid receptor/channel (AMPAR) in learning and memory

Amplicon Vectors for Gene Transfer

2095

processes. Most endogenous AMPARs contain the GluR2 subunit and both inward and outward currents can pass through equally well. In contrast, AMPARs lacking GluR2 exhibit a profound inward rectification, what means that minimal outward current could pass through these channels when the cell depolarizes Thus, incorporation of recombinant AMPARs into synapses can be monitored functionally [76]. To study the AMPARs trafficking in associative fear conditioning learning, Rumpel and co-workers injected amplicon vectors expressing recombinant AMPARs subunits into the rat basolateral amygdala [77]. An amplicon vector encoding GluR1 subunit fused with GFP was used to express homomeric AMPARs, which display greater inward rectification than endogenous AMPARs, allowing electrophysiological detection of synapses undergoing plasticity by incorporation of recombinant GluR1-AMPARs. Another amplicon vector encoded the carboxyl cytoplasmic tail of GluR1 subunit fused with GFP, expressing a protein that acts as a dominant-negative construct to prevent synaptic incorporation of endogenous GluR1-receptors, and thereby blocks several forms of synaptic plasticity in vitro and in vivo. A third vector driving expression of GFP only, was used as control of infection. Using these vectors, they showed that fear conditioning drives AMPARs into the synapse of a large fraction of post-synaptic neurons in the basolateral amygdala, and that blocking GluR1-receptor trafficking in a few (~10 to 20%) neurons undergoing plasticity, was sufficient to impair memories depending on this structure [77]. The cyclic adenosine monophosphate (cAMP) response element-binding protein (CREB) plays an important role in learning and memory processes [78]. It was shown that changes in CREB function could influence the probability of individual lateral amygdala neurons to be recruited into a fear memory trace, suggesting a competitive model underlying memory formation. In such a model, eligible neurons are selected to participate in a memory trace as a function of their relative CREB activity in learning [79]. In this regard, several investigators have manipulated the function of CREB using amplicons vectors. An amplicon encoding wtCREB was used to show that increasing CREB in the auditory thalamus enhanced memory and generalization of auditory conditioned fear, indicating that CREB-mediated plasticity in the thalamus plays a role in this cognitive process [80]. Using an amplicon vector encoding a dominant-negative mutant form of CREB (mCREB), Brightwell and collaborators demonstrated that hippocampal overexpression of mCREB can block long-term – though not short-term – memory for a socially transmitted food preference, therefore involving hippocampal CREB function in this type of memory [81]. They later showed that rats trained to make a consistent turning response in a water version of the plus maze, required CREB function in the dorsolateral striatum to form a long-term memory of the response strategy, and showed that it is independent on CREB function in the dorsal hippocampus [82]. Using a model of protracted social isolation in adult rats, Barrot et al. observed an increase in anxiety-like behaviour and in both the latency of the onset of sexual behaviour and the latency to ejaculate [83]. Then, in transgenic cAMP response element (CRE)-LacZ reporter mice, which express βgal under control of CREs, they showed that protracted social isolation also reduced CREdependent transcription within the nucleus accumbens. This decrease in CRE-dependent transcription was mimicked in non-isolated animals by amplicon-based gene transfer of a dominant-negative mutant of CREB into the nucleus accumbens. In these animals, the local inhibition of CREB activity increased anxiety-like behaviour and delayed initiation of sexual behaviour, with no effect observed on the ejaculation parameters. In isolated animals, restoring CREB activity in the nucleus accumbens using amplicon vectors to overexpress wt-CREB, rescued the anxiety phenotype as well as the deficit in the latency to initiate sexual behaviour.

2096

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

This study suggests a role for the nucleus accumbens in anxiety responses and in specific aspects of sexual behaviour, and provides novel insights into the molecular mechanisms by which social interactions affect brain plasticity and behaviour [83]. Interestingly, Liu and co-workers recently reported that an amplicon expressing siRNA for the γ-Aminobutyric acid A (GABA-A) receptor α2 subunit, infused into the central nucleus of the amygdala of alcohol-preferring rats, (i) caused profound and selective reduction of binge drinking associated with inhibition of α2 subunit expression, (ii) decreased GABA-A receptor density and (iii) inhibited Toll-like receptor 4 (TLR4) expression [84]. Furthermore, infusion of an amplicon expressing TLR4 siRNA into the central amygdala also inhibited binge drinking, but did not cause such changes when infused into the ventral pallidum. On the other hand, binge drinking was effectively inhibited by an amplicon expressing GABA-A receptor α1 subunit siRNA, infused into the ventral pallidum, showing that TLR4 contributes to binge drinking downstream to α2 subunit in the central amygdala, but not in the ventral pallidum, underscoring the relevance of TLR4 in specific neuroanatomical sites. Those data indicate that GABA-A α2-regulated TLR4 expression in the central amygdala contributes to binge drinking and may be a key for early neuroadaptation in excessive drinking [84].

AMPLICON VECTORS AND NEURODEGENERATIVE DISEASES Ataxias Ataxias are a group of specific degenerative diseases of the nervous system characterized by the loss of movement coordination. Hereditary ataxias could be recessive or dominant. Nowadays, no treatment can effectively stop progression of ataxias. The most prevalent form of hereditary ataxia is the Frederich’s ataxia (FA) [85], where neurological symptoms result from neurodegeneration in the dorsal root ganglia (DRG), with loss of large sensory neurons and posterior columns, followed by degeneration in the spinocerebellar and corticospinal tracts of the spinal cord. This disease is caused by a mutation in the first intron of the frataxin gene (frda wt) which causes a large GAA repeat expansions (frda mut) and, in consequence, leads to a decrease in the level of the mitochondrial protein, frataxin. Lim and collaborators generated a conditional frataxin transgenic mouse with the frda wt gene floxed (loxP-frda); then, they injected an amplicon vector carrying the CRE recombinase transgene into the brainstem of this transgenic loxP-frda mouse [86]. CRE expression causes the homologous recombination of loxP sites and the loss of frda, leading to a decrease in frataxin expression. These mice developed behavioral deficits after 4 weeks, resembling FA. In an attempt to generate a treatment for FA, the authors injected a second amplicon vector, bearing the cDNA of frda wt. These mice exhibit behavioral recovery as early as 4 weeks after the second vector injection [86]. Taking advantage of the large capacity of amplicon vectors, Gomez-Sebastian and collaborators used amplicons to deliver a 135-kb insert containing the entire frda wt human genomic locus, including long upstream and downstream regulatory sequences (~80-kb), to fibroblasts extracted from FA patients (which expressed low levels of frataxin) [87]. Synthesis of frataxin in these frda wt-transduced FA-deficient cells was confirmed by

Amplicon Vectors for Gene Transfer

2097

immunofluorescence [87]. The fibroblasts of FA patients have been shown to exhibit biochemical deficits, including increased sensitivity to oxidative stress. Functional complementation studies demonstrated restoration of the wild type cellular phenotype in the frda wt-transduced cells, in response to H2O2 treatment (a classical stressor) [87]. To investigate the persistence of the transgene expression, the same group injected into the adult mouse cerebellum an iBAC-HSV-1-based vector, carrying the 135-kb frda wt genomic DNA locus [88]. As reporter, the authors constructed another vector, but with the E. coli lacZ gene inserted at the ATG start codon (iBAC-frda-lacZ). Direct intracranial injection of this vector into the adult mouse cerebellum resulted in a large number of cells expressing lacZ; this expression was driven by the frda wt locus and persisted for at least 75 days. In contrast, synthesis of GFP expressed from the same vector, but driven by the HSV-1 IE4/5 promoter, was strong but transient. This study demonstrated for the first time, a sustained transgene expression in vivo, by amplicon delivery of a very long genomic DNA locus. All together these results suggest the potential of the HSV-1 derived-FRDA vectors for gene therapy of FA. Ataxia-telangiectasia is an autosomal recessive neurodegenerative disorder due to mutations in the A-T gene (AT). This gene is, in the AT wt form, a kinase responsible for recognizing and correcting errors in current DNA duplication before cell division. Several mutations led to an AT-mutated: (ATM) protein with different degrees of activity, generating a pleiotropic phenotype characterized by cerebellar degeneration, immunodeficiency, cancer predisposition, increased radiation sensitivity and premature aging, according to the residual kinase activity of the expressed ATM protein [89]. As the AT cDNA is too large (~9-kb) for most of the currently used vectors, it was difficult to rescue the phenotype of cells expressing ATM. Therefore, Cortes and co-workers used an amplicon vector codifying the AT cDNA, to express a non-mutated form of AT in human fibroblasts which express ATM [90]. The AT wt protein expression was confirmed by western blot and immunofluorescence. AT kinase function was tested by in vitro phosphorylation of p53; the in vivo functionality of AT was assessed by counting the accumulation of G2/M cells after ionizing radiation [90]. In a further study, the same group constructed an amplicon encoding both the EGFP and a human FLAG-tagged-AT protein; this vector was inoculated in the cerebellum of AT–/– mice. The number and phenotype of infected cells were assessed by EGFP fluorescence and infection of thousands of cells at the inoculated cerebellum, including Purkinje cells, was confirmed. FLAG-tagged-AT expression was demonstrated at transcriptional (qRT-PCR, in situ hybridization) as well as at translational (immunoprecipitation of the full-length human protein) levels, 3 days post-inoculation [91]. In an attempt to achieve stable gene replacement, the same group generated an HSV/adenoassociated virus (AAV)-hybrid amplicon, carrying the expression cassette for the AT and EGFP cDNAs, flanked by AAV inverted terminal repeats (ITRs). In the presence of the AAV Rep proteins (proteins codified by AAV genome, required for AAV chromosome integration), this hybrid vector mediated a site-specific integration of the transgenic sequences into the AAV1 site of chromosome 19. To test functional activity of this AT vector, Cortes et al. exposed AT infected cells to ionizing radiation; then, AT activity was assessed by specific immunofluorescence using antibodies against the phosphorylated form of AT (pAT, activated form). An increase in pAT was observed only in AT-AAV/HSV infected cells and not in cells infected with a control vector [92]. These results showed that this AT HSV/AAV hybrid amplicon was able to integrate into the AAVS1 site and to achieve functional expression of human AT cDNA in vivo, in a mouse model of ATM.

2098

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

Alzheimer Disease One of the most studied neurodegenerative diseases is Alzheimer’s disease (AD). In this pathology, the peptide known as amyloid beta (Aβ) acts as a neurotoxin that produces neurodegeneration. More precisely, a recently enunciated hypothesis states that soluble oligomers of Aβ peptide (named ADDLs: Aβ-derived diffusible ligands) bind to neurons, mainly at the post-synaptic side, and that this binding would be responsible for triggering toxic effects that ultimately lead to neuronal death [93, 94]. Aβ peptide is generated by degradation of the Amyloid Precursor Protein (APP). Under physiological conditions, APP is first cleaved by α-secretase and subsequently cleaved by γsecretase, resulting in a non-amyloidogenic soluble peptide. However, under certain abnormal conditions or by blocking the normal degradation pathway, APP is cleaved by the β-secretase BACE-1 (instead of α-secretase) and then by the γ-secretase, generating amyloidogenic peptides 1-40 and 1-42, (of 40 and 42 amino acids respectively, being Aβ1-42 more amyloidogenic than Aβ1-40) [95]. Aβ initially aggregates in soluble oligomers of 2–14 monomers (ADDLs), which can bind to the post-synaptic densities; then, as the concentration rises up, they further aggregate into fibrils in the extracellular space and then form the typical amyloid plaques [94, 96-100]. Two studies have described the use of amplicons for “Aβ vaccination” in mice as a possible therapeutic strategy for AD, aimed at preventing Aβ fibrillogenesis and/or to enhance removal of parenchymal amyloid deposits. In the first study, transgenic Tg2576 mice, which overexpress APP with the Swedish mutation that results in enhanced generation and extracellular deposition of the Aβ1–42 peptide, were injected with amplicons expressing either Aβ 1-42 (HSVAβ) or Aβ 1-42 fused to the molecular adjuvant tetanus toxin Fragment C (HSVAβ/TtxFC). Peripheral administration of both “vaccines” augmented humoral responses to Aβ and reduced CNS Aβ deposition in this model of AD. However, HSVAβ vaccination was found to be toxic, since it induced expression of pro-inflammatory transcripts within the mouse hippocampus [101]. Another amplicon vector -HSV(IE)Aβ(CMV)IL-4-, was constructed to co-delivered Aβ 142 and interleukin 4 (IL-4), a cytokine that promotes the generation of Th2 like T-cell responses. Triple transgenic AD (3XTg-AD) mice, which progressively develop both amyloid and neurofibrillary tangle pathology, were vaccinated with that vector or with a set of control amplicon vectors (one encoding Aβ1–42 but not IL-4, and one “empty” vector without Aβ1– 42 or IL-4 transgenes). Prevention of AD-related amyloid and tau pathology progression were significantly more important in HSV(IE)Aβ(CMV)IL-4 treated mice than in control groups. Furthermore, the expression of Th2-related Aβ-specific antibodies appeared to improve learning and memory in the Barnes Maze spatial memory paradigm [102]. Therefore, these results underlined the potential of amplicons for Aβ immune-therapy of AD [103]. Neurodegenerative pathologies as AD or Parkinson’s disease (PD), as well as some forms of depression, have been associated to dysfunction of receptor-neurotransmitter systems. Lglutamate is the major excitatory neurotransmitter in the CNS. Therefore, glutamate receptors represent an attractive molecular target in the treatment of neurodegenerative diseases and also in epilepsy, schizophrenia and ischemia. There is recent evidence showing that the transmembrane protein APP appears capable of interacting with NMDAR [104, 105]. These ionotropic receptors are tetramers made of two GluN1 subunits and different GluN2 (A-D), and/or GluN3 (A-B) subunits, with GluN1 being

Amplicon Vectors for Gene Transfer

2099

essential for receptor assembly [106-108]. Nowadays, association of NMDAR with several neuropathologies has been continuously growing up. Thus, the generation of novel tools that modify expression and composition of NMDARs should help to understand both the normal functioning (as reported above in “Amplicon vectors and behaviour” section) and the physiopathology of these receptors. It was proposed that ADDLs binds to NMDAR or to postsynaptic complexes containing it, acting as gain of function ligands [93, 94, 109]. By targeting such post-synaptic complexes, ADDLs activate a cascade of signals that lead to an increase in intracellular reactive oxygen species (ROS) [93]. Decker and colleagues have demonstrated that blockade of GluN1 expression through the infection of primary cultured neurons with amplicon vectors encoding an anti-GluN1 antisense RNA, inhibited ADDLs binding to synapses [109]. In the same study, they showed that there was a great reduction in ADDLinstigated ROS formation in GluN1 knockdown neurons [109]. In addition, it has recently been reported that different regulatory GluN2 subunits would also be involved in the binding of ADDLs to synaptic sites [110, 111]. Liu and colleagues have suggested that increasing the activity of GluN2A and/or reducing that of GluN2B, may alter or reduce the expression of cytotoxic effects mediated by ADDLs in neuronal cultures [110]. On the other hand, Balducci and colleagues showed that there was an alteration in the trafficking of GluN2A and GluN2B subunits in mutant mice expressing an amyloidogenic human form of APP [111]. However, more precise studies on the possible specific interaction between different subunits of the NMDAR and the Aβ peptide, both in normal and pathological conditions, is necessary to further clarify the specific site for ADDLs binding. It should be taken into account that the decrease in GluN1, which is essential for assembly and for the membrane allocation of the receptor, would lead to a decrease of all the NMDAR subunits at the synaptic surface [112]. The genes for microtubule-associated protein tau (MAPT) and α-synuclein (SNCA) play central roles in neurodegenerative disorders. Peruzzi and colleagues have recently generated amplicon-based iBAC-vectors carrying either the 143-kb MAPT or the 135-kb SNCA loci [113]. They have used these vectors to study regulation of gene expression of both MAPT and SNCA, showing functional complementation between them in cultured neurons and in organotypic brain slices. Infected neurons were able to express functional genes under physiological regulation, including the generation of multiple splice variants. In particular, multiple MAPT transcripts were expressed under strict developmental and cell type-specific control. Primary cultures from Mapt(–/–) embryos had been shown to be resistant to Aβ peptide-induced toxicity, suggesting that the tau protein might be mediating the neurotoxicity of Aβ. To test the functionality of the MAPT transgene, the authors examined whether the responsiveness to Aβ peptide could be restored in the Mapt(–/–) neurons and in organotypic brain slices. In both preparations from Mapt(–/–) mice infected with the vector bearing the MAPT transgene, the tau protein was expressed as detected by ELISA and immunocytochemistry, and the sensitivity of Mapt(–/–) neurons to Aβ peptide was restored [113]. As stated by the authors, the faithful retention of gene expression and phenotypic complementation by this system provides a novel and powerful approach to analyze neurological disease genes.

Parkinson Disease Parkinson's disease (PD) is the second most common neurodegenerative disorder. A typical feature of this disease is the progressive loss of dopaminergic neurons in the substantia nigra

2100

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

and a decrease in the level of dopaminergic inputs to the striatum [114]. PD is clinically characterized by akinesia or bradykinesia, rigidity and tremor that are directly related to dopaminergic striatal loss [115]. Several studies have used amplicons in experimental settings of PD. During and co-workers were the first to report the use of amplicons to deliver human tyrosine hydroxylase (TH) into the partially denervated striatum of 6-hydrodopamine-lesioned rats, used as a model of PD [116]. Efficient behavioral and biochemical recovery has persisted for one year after gene transfer. In an attempt to improve that vector, Sun and collaborators developed another vector able to co-express two enzymes involved in the synthesis of L-DOPA: TH and the aromatic amino acid decarboxylase (AADC), under a modified neurofilament gene promoter that supports longterm expression in forebrain neurons [117]. This improved vector was injected in the right striatum of adult rats where PD-like symptoms had been previously induced by injection of 6OHDA in the substantia nigra. Histologic analyses demonstrated neuronal-specific coexpression of TH and AADC from 4 days to 7 months after gene transfer. In these rats, vector injection was able to correct in about 80% the apomorphine-induced rotational behaviour present in this 6-OHDA rat model of PD [117]. Later on, in a series of elegant studies, Sun and co-workers further compared the activities of tissue-specific promoters to drive gene expression, particularly the promoters of TH, the neurofilament and the vesicular glutamate transport 1 (VGLUT1) [22, 118-122]. Taking advantage of the large transgene capacity of HSV derived vectors, they developed two vectors: one that co-express the three dopamine biosynthetic enzymes (TH, GTP CH I, and AADC, a 3-genes-vector) and another carrying all the three dopamine biosynthetic enzymes and the vesicular monoamine transporter (TH, GTP CH I, AADC, and VMAT-2, a 4-genes-vector). The authors compared the effects of both vectors. The 4-genes-vector supported higher levels of correction of apomorphine-induced rotational behaviour than did the 3-genes-vector, and this correction was maintained for 6 months. Proximal to the injection sites, the 4-genes-vector, but not the 3-genes-vector, supported extracellular levels of dopamine and dihydroxyphenylacetic acid (DOPAC) similar to those observed in normal rats, and only the 4-genes-vector supported significant K+dependent release of dopamine [118]. The effect of amplicon-mediated transduction of the dominant-negative fibroblast growth factor (FGF) receptor-1 mutant protein (FGFR1(TK-)) into the rat substantia nigra, was evaluated in vivo as a possible strategy to mimic the reduced FGF signaling already documented to occur in PD. Following intra-nigral delivery of the FGFR1(TK-) amplicon, the number of substantia nigra neurons expressing TH was significantly reduced, leading to the conclusion that reduced FGF signaling in the substantia nigra of Parkinsonian patients could play a role in the impaired dopaminergic transmission in PD [123]. In a further study, the same group analyzed the effect of ex vivo transduction of mesencephalic reaggregates with the antiapoptotic protein bcl-2, on grafted dopamine neuron survival. Using an amplicon expressing bcl-2 under the control of the TH promoter (HSV-TH9bcl-2) to transduce mesencephalic reaggregates, it was shown that, in spite of the high efficiency of the infection (since many cells were effectively transduced), amplicon-mediated overexpression of bcl-2 did not lead to an increase in grafted TH-immune-reactive neuron number [124]. Mitochondrial alterations are detected in most neurodegenerative disorders and may contribute to the dysfunction and demise of neurons. Rotenone or 1-methyl-4-phenyl-1,2,3,6tetrahydropyridina (MPTP) inhibit the mitochondrial complex I, causing death of dopaminergic neurons in the substantia nigra, thus providing an acute model of PD. It has been recently

Amplicon Vectors for Gene Transfer

2101

demonstrated that mitochondrial hexokinase II promotes neuronal survival in rotenone treated cells, and that this enzyme acts downstream of glycogen synthase kinase-3 (GSK-3), which is considered to be a critical factor in regulating neuronal cell survival and death [125]. More recently, the same group generated amplicons expressing hexokinase II; overexpression of this protein in the substantia nigra of mice subsequently administered with rotenone or MPTP, prevented neuronal cell death induced by both drugs and reduced the associated motor deficits. These results provide the first proof that hexokinase II could protect against dopaminergic neurodegeneration in vivo, and suggest that increase of hexokinase II expression could represent a promising approach to treat PD [126].

Narcolepsy Narcolepsy is a neurodegenerative sleep disorder that is linked to the loss of neurons containing the neuropeptide orexin (also known as hypocretin). Liu and collaborators inoculated an amplicon vector expressing pre-pro-orexin into the lateral hypothalamus of orexin knockout mice and showed that exogenous expression of orexin significantly improved sleeping in these animals [127].

AMPLICON VECTORS AND NERVOUS SYSTEM DAMAGE Ischemia Apoptosis plays a critical role in many neurological diseases, including stroke. To study the protective role of the antiapoptotic factor bcl-2 in ischemia, an amplicon vector encoding bcl-2 (HSVbcl-2) was infused in rat cerebral cortex 24 hours prior to ischemia induction. Expression of bcl-2 was confirmed by immunohistochemistry in animals injected with the HSVbcl2 expression vector. Tissue viability significantly increased at the injection site in HSVbcl2, but not in animals injected with a similar vector expressing E. coli LacZ (HSVLacZ) [128]. Later, HSVbcl-2 was used to inject gerbils unilaterally into the CA1 region of the hippocampus, 24 hours prior to induce transient global ischemia [129]. Results showed that the local increase in bcl-2 expression using the HSVbcl-2 vector, may protect CA1 pyramidal cells from the delayed neuronal death caused by transient global ischemia, and that this happened only in the HSVbcl-2 injected hemisphere. In the same line, other group generated another bcl2 expressing amplicon that was used to infect hippocampal cell cultures. Bcl-2 expressing vectors enhanced neuron survival after exposure to adriamycin, glutamate and hypoglycemia. Furthermore, dichlorofluorescein measurements indicated that there was a significant reduction in the accumulation of oxygen radicals associated with these insults [130]. Improved neuron survival could be attributed to the fact that the bcl-2 blocks nuclear Apoptosis-inducing factor (AIF) translocation [131]. In an experimental therapeutic approach, Lawrence and collaborators injected rats with this Bcl-2 expressing vector after ischemia induction, then leading to a reduction in neuronal loss [132]. Furthermore, they showed that there is a time window (30 minutes to 4 hours after reperfusion) where the injection was effective [132]. In accordance with these results, amplicon vectors expressing the inducible heat shock protein (hsp) 72 can also attenuate cerebral ischemic injury when introduced into the rat striatum, even during post-

2102

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

ischemia [133]. Furthermore, amplicons expressing hsp72 also protected neurons of CA1 hippocampal region from ischemia, and this protection would be mediated, at least in part, by increased expression of bcl-2 [134].

Neurotoxicity Increases in cytoplasmic Ca2+ concentration can lead to neurotoxicity and neuronal death. The increase of Ca2+ could be induced by neurological trauma associated with aging and some neurological diseases. To prevent neurotoxic effects of cytoplasmic Ca2+ increases, an amplicon vector that expresses the calcium-binding protein calbindin D28K (calbindin D28KHSV) was used to infect neurons, both in vitro and in vivo [135, 136]. Cultured neurons infected with this vector responded to hypoglycemia and glutamatergic insults with decreased cytoplasmic [Ca2+] measured by microfluorometry and increased neuron survival relative to controls [135]. Furthermore, in vivo injection of calbindin D28KHSV vector in the hippocampal dentate gyrus increases neuronal survival after application of the antimetabolite 3-acetylpyridine, and increases transynaptic neuronal survival in area CA3 following kainic acid neurotoxicity [136]. Reactive oxygen species (ROS) and oxidative stress damage plays an important role in neuronal death. Amplicon vectors expressing different antioxidant enzymes were used to counteract oxidative damages. The cDNA of catalase and glutathione peroxidase, two enzymes involved in hydrogen peroxide degradation, were subcloned into amplicon vectors. These vectors were shown to decrease neurotoxicity induced by different agents in primary cultures of hippocampus or cerebral cortex cells [137]. A further study using amplicons to express the antioxidant enzyme Cu–Zn–SOD, showed that these vectors were able to protect hippocampal neurons through the induction of glutathione peroxidase expression, though only in the case of neurons treated with sodium cyanide. The authors pointed out that the effect of the amplicons actually worsens the toxic effects of kainic acid, another classical ROS inducer, raising a cautionary note concerning gene therapy against oxidative damage [138]. Amplicons expressing glutamic acid decarboxylase (GAD67) were shown to protect non-differentiated cortical neurons from glutamate toxicity mediated by oxidative stress [139]. It was reported that the HIV glycoprotein of 120kDa (HIV-gp120) could be neurotoxic at certain doses and that the hsp70, hsp25 or hsp90 overexpression would protect neurons from HIV-gp120 effect. Therefore, Lim and collaborators overexpressed hsp70 with a HSVamplicon vector in cultured hippocampal neurons; in this way, they demonstrated that hsp70 overexpression protected cultured hippocampal neurons from HIV-gp120 neurotoxicity [140]. Hipoglycemia could result in an insult for neurons. With amplicons expressing the rat brain glucose transporter (GT), it was shown that these vectors: (i) can maintain neuronal metabolism and reduce the extent of neurons loss in cultures, after a period of hypoglycemia [141]; (ii) protected cultured hippocampal, spinal cord and septal neurons against various necrotic insults, including hypoglycemia, glutamate and 3-nitropropionic acid [142]; and (iii) can enhance glucose uptake in adult rat hippocampus and in hippocampal cultures [143].

Amplicon Vectors for Gene Transfer

2103

Neurotrophins Neurotrophins are a family of growth factors that play important roles in the development and maintenance of the nervous system. The human brain-derived neurotrophic factor (BDNF) is one of the most important neurotrophins. The knowledge about the complex function of BDNF in mammalian nervous system is continuously expanding; it plays a key role as mediator of activity-induced long term potentiation (LTP) in the hippocampus, as well as in behaviour and memory [144]; BDNF has been implicated in neurodegenerative diseases [145], motor diseases [146] and fragile X syndrome [147]. This neurotrophin participates in maturation and function of mammalian auditory neurons. For this reason, amplicon vectors expressing BDNF were used to evaluate the feasibility of gene therapy of deafness. First, Geschwind and collaborators used an amplicon vector bearing a BDNF cDNA and E. coli β-galactosidase (HSVbdnflac), to evaluate the expression and biological activity in established cell lines and explant cultures, prepared from spiral ganglia of the murine ear [148]. Using two BDNFresponsive cell lines, PC12trkB and MG87trkB, they demonstrated efficient secretion of biologically active BDNF [148]. Also, the transduction of explanted spiral ganglia with HSVbdnflac, elicited a robust neuritic process outgrowth, that is comparable to the effect of exogenously added BDNF [148]. Later on, the amplicon vector expressing BDNF was used in mice to infect damaged spiral ganglion. Four weeks post-infection, stable production of BDNF was observed; and it supported the survival of auditory neurons by preventing their loss due to trophic factor deprivation-induced apoptosis [149]. In addition, the use of amplicons expressing BDNF promoted neuronal survival up to the same maximal level seen by adding exogenous BDNF, in a model of avian cochlear neuron cultures [150]. Other neurotrophins were implicated in the proper function of the auditory system. Amplicons expressing neurotrophin3 (NT-3) were also used in murine cochlear explants model. After infection, the cochlear explants were exposed to cisplatin to induce destruction of hair cells and neurons in the auditory system. This toxicity, defined as ototoxicity, is a major dose-limiting side effect of cisplatin chemotherapy for cancer patients. Amplicon-mediated NT-3 transduction was shown to attenuate the ototoxic action of cisplatin, demonstrating the potency of NT-3 in protecting spiral ganglion neurons from degeneration [151]. Moreover, aged mouse injected in the peripheral auditory system with amplicon vectors expressing NT-3, showed significantly more spiral ganglion surviving neurons (SGNs) and lower incidence of cisplatin-induced apoptosis or necrosis, than those injected with a control vector [152]. Therefore, this approach seemed to be a promising treatment for prevention of chemical-induced hearing disorders and potentially for hearing degeneration due to normal aging. Amplicon vectors were used to compare BDNF ability with that of the glial-derived neurotrophic factor (GDNF) to protect nigrostriatal neurons in a rat model of PD. According to this study, GDNF was significantly more effective than BDNF for both correcting behavioral deficits and protecting nigrostriatal dopaminergic neurons. The expression of both neurotrophic factors from the same vector was not more effective than expressing GDNF only [153]. In a further study addressing the effect of this trophic factor, it was shown that intracerebral administration of amplicon vectors expressing GDNF, following prior occlusion of the middle cerebral artery, displayed neuroprotection in ischemic injury. Treated animals showed reduced motor deficits and, after 1 month, there was a reduction in tissue loss, in glial fibrillary acidic protein (GFAP) and in caspase-3 immunostaining [154].

2104

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

In neonatal rats, the combined delivery of NT-3 and the GluN2D subunit of the NMDA receptor, that was possible thanks to the large capacity of amplicon vectors, was used to strengthen monosynaptic connections in contused cords and to induce the appearance of weak but functional multi-synaptic connections, in double hemi-sected cords. On the other hand, the expression of either NT-3 or GluN2D alone failed to induce appearance of synaptic responses through the hemi-sected region of newborn rats [155]. More recently, the same group has treated adult rats with the following agents: (i) anti-Nogo-A antibodies to neutralize the growthinhibitor Nogo-A; (ii) NT-3 via engineered fibroblasts, to promote neuron survival and plasticity; and (iii) the GluN2D subunit via an HSV-1 amplicon vector, to elevate NMDA receptor function by reversing its Mg2+ blockade, thereby enhancing synaptic plasticity and promoting the effects of NT-3 [156]. The combined treatment resulted in slightly better motor function in the absence of adverse effects (i.e., pain), suggesting that this novel combined treatment may help to improve function of the damaged spinal cord [156].

Neuropathic Pain Neuropathic pain is a chronic form of pain that results from an injury to the nervous system. It could be due to multiple causes, like alcoholism, chemotherapy, diabetes, facial nerve problems among others. Amplicon vectors expressing proenkephalin (pHSV-hPPE-lacZ, SHPZ), were used to investigate the antinociceptive effect of leuenkephalin (a product of proekephalin proccesing). The amplicons were injected into the ventral periaqueductal grey [157] or into the cortex of rats [21]. Both studies showed that the injection of SHPZ, but not of a control vector only expressing the reporter gene lacZ, attenuated neuropathic pain and reduced induced hypersensitivity in rats [21, 157].

ACKNOWLEDGMENTS ALE and DAJ would like to thank the French CNRS and the Argentinean CONICET institutions for supporting the International Associated Laboratory (LIA) DEVENIR. Part of this work was supported by Association Française contre les Myopathies (AFM). MEM PhD studies were supported by AFM. CAB participation in this work was supported by the French Embassy in Argentine with a “Bernardo Houssay” postdoctoral position.

REFERENCES [1] [2] [3]

Fatahzadeh, M. and R.A. Schwartz, Human herpes simplex labialis. Clin Exp Dermatol, 2007. 32(6): p. 625-30. Kelly, B.J., et al., Functional roles of the tegument proteins of herpes simplex virus type 1. Virus Res, 2009. 145(2): p. 173-86. Grunewald, K. and M. Cyrklaff, Structure of complex viruses and virus-infected cells by electron cryo tomography. Curr Opin Microbiol, 2006. 9(4): p. 437-42.

Amplicon Vectors for Gene Transfer [4] [5] [6] [7] [8] [9] [10] [11]

[12]

[13] [14] [15]

[16]

[17]

[18] [19] [20]

[21]

[22]

2105

Zhou, Z.H., et al., Visualization of tegument-capsid interactions and DNA in intact herpes simplex virus type 1 virions. J Virol, 1999. 73(4): p. 3210-8. Oh, J. and N.W. Fraser, Temporal association of the herpes simplex virus genome with histone proteins during a lytic infection. J Virol, 2008. 82(7): p. 3530-7. Bataille, D. and A.L. Epstein, Herpes simplex virus type 1 replication and recombination. Biochimie, 1995. 77(10): p. 787-95. McGeoch, D.J., et al., The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1. J Gen Virol, 1988. 69 (Pt 7): p. 1531-74. McGeoch, D.J., et al., Complete DNA sequence of the short repeat region in the genome of herpes simplex virus type 1. Nucleic Acids Res, 1986. 14(4): p. 1727-45. McGeoch, D.J., et al., Sequence determination and genetic content of the short unique region in the genome of herpes simplex virus type 1. J Mol Biol, 1985. 181(1): p. 1-13. de Silva, S. and W.J. Bowers, Herpes Virus Amplicon Vectors. Viruses, 2009. 1(3): p. 594-629. Vlazny, D.A. and N. Frenkel, Replication of herpes simplex virus DNA: localization of replication recognition signals within defective virus genomes. Proc Natl Acad Sci U S A, 1981. 78(2): p. 742-6. Hardwicke, M.A. and P.A. Schaffer, Cloning and characterization of herpes simplex virus type 1 oriL: comparison of replication and protein-DNA complex formation by oriL and oriS. J Virol, 1995. 69(3): p. 1377-88. Davison, A.J. and N.M. Wilkie, Nucleotide sequences of the joint between the L and S segments of herpes simplex virus types 1 and 2. J Gen Virol, 1981. 55(Pt 2): p. 315-31. Deiss, L.P., J. Chou, and N. Frenkel, Functional domains within the a sequence involved in the cleavage-packaging of herpes simplex virus DNA. J Virol, 1986. 59(3): p. 605-18. Nasseri, M. and E.S. Mocarski, The cleavage recognition signal is contained within sequences surrounding an a-a junction in herpes simplex virus DNA. Virology, 1988. 167(1): p. 25-30. McVoy, M.A., et al., Sequences within the herpesvirus-conserved pac1 and pac2 motifs are required for cleavage and packaging of the murine cytomegalovirus genome. J Virol, 1998. 72(1): p. 48-56. DeLuca, N.A., A.M. McCarthy, and P.A. Schaffer, Isolation and characterization of deletion mutants of herpes simplex virus type 1 in the gene encoding immediate-early regulatory protein ICP4. J Virol, 1985. 56(2): p. 558-70. Ozuer, A., et al., Evaluation of infection parameters in the production of replicationdefective HSV-1 viral vectors. Biotechnol Prog, 2002. 18(3): p. 476-82. Spaete, R.R. and N. Frenkel, The herpes simplex virus amplicon: a new eucaryotic defective-virus cloning-amplifying vector. Cell, 1982. 30(1): p. 295-304. Jerusalinsky, D., M.V. Baez, and A.L. Epstein, Herpes simplex virus type 1-based amplicon vectors for fundamental research in neurosciences and gene therapy of neurological diseases. J Physiol Paris, 2012. 106(1-2): p. 2-11. Zou, W., et al., Intrathecal herpes simplex virus type 1 amplicon vector-mediated human proenkephalin reduces chronic constriction injury-induced neuropathic pain in rats. Mol Med Rep, 2011. 4(3): p. 529-33. Zhang, G.R. and A.I. Geller, A helper virus-free HSV-1 vector containing the vesicular glutamate transporter-1 promoter supports expression preferentially in VGLUT1containing glutamatergic neurons. Brain Res, 2010. 1331: p. 12-9.

2106

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

[23] Marconi, P., R. Manservigi, and A.L. Epstein, HSV-1-derived helper-independent defective vectors, replicating vectors and amplicon vectors, for the treatment of brain diseases. Curr Opin Drug Discov Devel, 2010. 13(2): p. 169-83. [24] Blanc, A.M., et al., Induction of humoral responses to BHV-1 glycoprotein D expressed by HSV-1 amplicon vectors. J Vet Sci, 2012. 13(1): p. 59-65. [25] Laimbacher, A.S., et al., HSV-1 amplicon vectors launch the production of heterologous rotavirus-like particles and induce rotavirus-specific immune responses in mice. Mol Ther, 2012. 20(9): p. 1810-20. [26] Saydam, O., D.L. Glauser, and C. Fraefel, Construction and packaging of herpes simplex virus/adeno-associated virus (HSV/AAV) Hybrid amplicon vectors. Cold Spring Harb Protoc, 2012. 2012(3): p. 352-6. [27] de Oliveira, A.P. and C. Fraefel, Herpes simplex virus type 1/adeno-associated virus hybrid vectors. Open Virol J, 2010. 4: p. 109-22. [28] Mandegar, M.A., et al., Functional human artificial chromosomes are generated and stably maintained in human embryonic stem cells. Hum Mol Genet, 2011. 20(15): p. 2905-13. [29] Moralli, D., et al., A novel human artificial chromosome gene expression system using herpes simplex virus type 1 vectors. EMBO Rep, 2006. 7(9): p. 911-8. [30] Cuchet, D., et al., HSV-1 amplicon vectors: a promising and versatile tool for gene delivery. Expert Opin Biol Ther, 2007. 7(7): p. 975-95. [31] Epstein, A.L., HSV-1-derived amplicon vectors: recent technological improvements and remaining difficulties--a review. Mem Inst Oswaldo Cruz, 2009. 104(3): p. 399-410. [32] Fraefel, C., Gene delivery using helper virus-free HSV-1 amplicon vectors. Curr Protoc Neurosci, 2007. Chapter 4: p. Unit 4 14. [33] Manservigi, R., R. Argnani, and P. Marconi, HSV Recombinant Vectors for Gene Therapy. Open Virol J. 4: p. 123-56. [34] Kwong, A.D. and N. Frenkel, Herpes simplex virus amplicon: effect of size on replication of constructed defective genomes containing eucaryotic DNA sequences. J Virol, 1984. 51(3): p. 595-603. [35] Boehmer, P.E. and I.R. Lehman, Herpes simplex virus DNA replication. Annu Rev Biochem, 1997. 66: p. 347-84. [36] Cunningham, C. and A.J. Davison, A cosmid-based system for constructing mutants of herpes simplex virus type 1. Virology, 1993. 197(1): p. 116-24. [37] Fraefel, C., et al., Helper virus-free transfer of herpes simplex virus type 1 plasmid vectors into neural cells. J Virol, 1996. 70(10): p. 7190-7. [38] Heister, T.G., et al., Construction of HSV-1 BACs and their use for packaging of HSV1-based amplicon vectors. Methods Mol Biol, 2004. 256: p. 241-56. [39] Saeki, Y., X.O. Breakefield, and E.A. Chiocca, Improved HSV-1 amplicon packaging system using ICP27-deleted, oversized HSV-1 BAC DNA. Methods Mol Med, 2003. 76: p. 51-60. [40] Saeki, Y., et al., Improved helper virus-free packaging system for HSV amplicon vectors using an ICP27-deleted, oversized HSV-1 DNA in a bacterial artificial chromosome. Mol Ther, 2001. 3(4): p. 591-601. [41] Geller, A.I., A new method to propagate defective HSV-1 vectors. Nucleic Acids Res, 1988. 16(12): p. 5690.

Amplicon Vectors for Gene Transfer

2107

[42] Geller, A.I., et al., An efficient deletion mutant packaging system for defective herpes simplex virus vectors: potential applications to human gene therapy and neuronal physiology. Proc Natl Acad Sci U S A, 1990. 87(22): p. 8950-4. [43] Lim, F., et al., Generation of high-titer defective HSV-1 vectors using an IE 2 deletion mutant and quantitative study of expression in cultured cortical cells. Biotechniques, 1996. 20(3): p. 460-9. [44] Pechan, P.A., et al., A novel 'piggyback' packaging system for herpes simplex virus amplicon vectors. Hum Gene Ther, 1996. 7(16): p. 2003-13. [45] Zhang, X., et al., An efficient selection system for packaging herpes simplex virus amplicons. J Gen Virol, 1998. 79 (Pt 1): p. 125-31. [46] Logvinoff, C. and A.L. Epstein, Genetic engineering of herpes simplex virus and vector genomes carrying loxP sites in cells expressing Cre recombinase. Virology, 2000. 267(1): p. 102-10. [47] Logvinoff, C. and A.L. Epstein, Intracellular Cre-mediated deletion of the unique packaging signal carried by a herpes simplex virus type 1 recombinant and its relationship to the cleavage-packaging process. J Virol, 2000. 74(18): p. 8402-12. [48] Zaupa, C., V. Revol-Guyot, and A.L. Epstein, Improved packaging system for generation of high-level noncytotoxic HSV-1 amplicon vectors using Cre-loxP site-specific recombination to delete the packaging signals of defective helper genomes. Hum Gene Ther, 2003. 14(11): p. 1049-63. [49] Suzuki, M., K. Kasai, and Y. Saeki, Plasmid DNA sequences present in conventional herpes simplex virus amplicon vectors cause rapid transgene silencing by forming inactive chromatin. J Virol, 2006. 80(7): p. 3293-300. [50] Content and Review of Chemistry, Manufacturing, and Control (CMC) Information for Human Gene Therapy Investigational New Drug Applications (INDs). U.S. Department of Health and Human Services / Food and Drug Administration, 2008. [51] Ho, I.A., et al., Targeting human glioma cells using HSV-1 amplicon peptide display vector. Gene Ther, 2010. 17(2): p. 250-60. [52] Kaestle, C., et al., Imaging herpes simplex virus type 1 amplicon vector-mediated gene expression in human glioma spheroids. Mol Imaging, 2011. 10(3): p. 197-205. [53] Boutell, C., et al., Reciprocal activities between herpes simplex virus type 1 regulatory protein ICP0, a ubiquitin E3 ligase, and ubiquitin-specific protease USP7. J Virol, 2005. 79(19): p. 12342-54. [54] Lomonte, P., K.F. Sullivan, and R.D. Everett, Degradation of nucleosome-associated centromeric histone H3-like protein CENP-A induced by herpes simplex virus type 1 protein ICP0. J Biol Chem, 2001. 276(8): p. 5829-35. [55] Cuchet, D., et al., Characterization of antiproliferative and cytotoxic properties of the HSV-1 immediate-early ICPo protein. J Gene Med, 2005. 7(9): p. 1187-99. [56] Saydam, O., et al., Herpes simplex virus 1 amplicon vector-mediated siRNA targeting epidermal growth factor receptor inhibits growth of human glioma cells in vivo. Mol Ther, 2005. 12(5): p. 803-12. [57] Saydam, O., et al., HSV-1 amplicon-mediated post-transcriptional inhibition of Rad51 sensitizes human glioma cells to ionizing radiation. Gene Ther, 2007. 14(15): p. 114351. [58] Ho, I.A., K.M. Hui, and P.Y. Lam, Targeting proliferating tumor cells via the transcriptional control of therapeutic genes. Cancer Gene Ther, 2006. 13(1): p. 44-52.

2108

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

[59] Ho, I.A., K.M. Hui, and P.Y. Lam, Glioma-specific and cell cycle-regulated herpes simplex virus type 1 amplicon viral vector. Hum Gene Ther, 2004. 15(5): p. 495-508. [60] Ho, I.A., W.H. Ng, and P.Y. Lam, FasL and FADD delivery by a glioma-specific and cell cycle-dependent HSV-1 amplicon virus enhanced apoptosis in primary human brain tumors. Mol Cancer, 2010. 9: p. 270. [61] Prabhakar, S., et al., Imaging and therapy of experimental schwannomas using HSV amplicon vector-encoding apoptotic protein under Schwann cell promoter. Cancer Gene Ther, 2010. 17(4): p. 266-74. [62] Whitley, R.J. and B. Roizman, Herpes simplex virus infections. Lancet, 2001. 357(9267): p. 1513-8. [63] York, I.A., et al., A cytosolic herpes simplex virus protein inhibits antigen presentation to CD8+ T lymphocytes. Cell, 1994. 77(4): p. 525-35. [64] D'Antuono, A., et al., HSV-1 amplicon vectors that direct the in situ production of footand-mouth disease virus antigens in mammalian cells can be used for genetic immunization. Vaccine, 2010. 28(46): p. 7363-72. [65] Hocknell, P.K., et al., Expression of human immunodeficiency virus type 1 gp120 from herpes simplex virus type 1-derived amplicons results in potent, specific, and durable cellular and humoral immune responses. J Virol, 2002. 76(11): p. 5565-80. [66] Wang, X., et al., Cellular immune responses to helper-free HSV-1 amplicon particles encoding HIV-1 gp120 are enhanced by DNA priming. Vaccine, 2003. 21(19-20): p. 2288-97. [67] Gorantla, S., et al., Human dendritic cells transduced with herpes simplex virus amplicons encoding human immunodeficiency virus type 1 (HIV-1) gp120 elicit adaptive immune responses from human cells engrafted into NOD/SCID mice and confer partial protection against HIV-1 challenge. J Virol, 2005. 79(4): p. 2124-32. [68] Santos, K., et al., Effect of promoter strength on protein expression and immunogenicity of an HSV-1 amplicon vector encoding HIV-1 Gag. Vaccine, 2007. 25(9): p. 1634-46. [69] Tyler, C.M., et al., HSV amplicons: neuro applications. Curr Gene Ther, 2006. 6(3): p. 337-50. [70] Brockman, M.A. and D.M. Knipe, Herpes simplex virus vectors elicit durable immune responses in the presence of preexisting host immunity. J Virol, 2002. 76(8): p. 3678-87. [71] Lauterbach, H., et al., Reduced immune responses after vaccination with a recombinant herpes simplex virus type 1 vector in the presence of antiviral immunity. J Gen Virol, 2005. 86(Pt 9): p. 2401-10. [72] Adrover, M.F., et al., Hippocampal infection with HSV-1-derived vectors expressing an NMDAR1 antisense modifies behavior. Genes Brain Behav, 2003. 2(2): p. 103-13. [73] Cheli, V.T., et al., Gene transfer of NMDAR1 subunit sequences to the rat CNS using herpes simplex virus vectors interfered with habituation. Cell Mol Neurobiol, 2002. 22(3): p. 303-14. [74] Cheli, V., et al., Knocking-down the NMDAR1 subunit in a limited amount of neurons in the rat hippocampus impairs learning. J Neurochem, 2006. 97 Suppl 1: p. 68-73. [75] Neill, J.C., et al., Enhanced auditory reversal learning by genetic activation of protein kinase C in small groups of rat hippocampal neurons. Brain Res Mol Brain Res, 2001. 93(2): p. 127-36. [76] Malinow, R. and R.C. Malenka, AMPA receptor trafficking and synaptic plasticity. Annu Rev Neurosci, 2002. 25: p. 103-26.

Amplicon Vectors for Gene Transfer

2109

[77] Rumpel, S., et al., Postsynaptic receptor trafficking underlying a form of associative learning. Science, 2005. 308(5718): p. 83-8. [78] Kandel, E.R., The molecular biology of memory storage: a dialogue between genes and synapses. Science, 2001. 294(5544): p. 1030-8. [79] Han, J.H., et al., Neuronal competition and selection during memory formation. Science, 2007. 316(5823): p. 457-60. [80] Han, J.H., et al., Increasing CREB in the auditory thalamus enhances memory and generalization of auditory conditioned fear. Learn Mem, 2008. 15(6): p. 443-53. [81] Brightwell, J.J., et al., Hippocampal overexpression of mutant creb blocks long-term, but not short-term memory for a socially transmitted food preference. Learn Mem, 2005. 12(1): p. 12-7. [82] Brightwell, J.J., et al., Transfection of mutant CREB in the striatum, but not the hippocampus, impairs long-term memory for response learning. Neurobiol Learn Mem, 2008. 89(1): p. 27-35. [83] Barrot, M., et al., Regulation of anxiety and initiation of sexual behavior by CREB in the nucleus accumbens. Proc Natl Acad Sci U S A, 2005. 102(23): p. 8357-62. [84] Liu, J., et al., Binge alcohol drinking is associated with GABAA alpha2-regulated Tolllike receptor 4 (TLR4) expression in the central amygdala. Proc Natl Acad Sci U S A, 2011. 108(11): p. 4465-70. [85] Cossee, M., et al., Evolution of the Friedreich's ataxia trinucleotide repeat expansion: founder effect and premutations. Proc Natl Acad Sci U S A, 1997. 94(14): p. 7452-7. [86] Lim, F., et al., Functional recovery in a Friedreich's ataxia mouse model by frataxin gene transfer using an HSV-1 amplicon vector. Mol Ther, 2007. 15(6): p. 1072-8. [87] Gomez-Sebastian, S., et al., Infectious delivery and expression of a 135 kb human FRDA genomic DNA locus complements Friedreich's ataxia deficiency in human cells. Mol Ther, 2007. 15(2): p. 248-54. [88] Gimenez-Cassina, A., et al., Infectious delivery and long-term persistence of transgene expression in the brain by a 135-kb iBAC-FXN genomic DNA expression vector. Gene Ther, 2011. 18(10): p. 1015-9. [89] Verhagen, M.M., et al., Presence of ATM protein and residual kinase activity correlates with the phenotype in ataxia-telangiectasia: a genotype-phenotype study. Hum Mutat, 2012. 33(3): p. 561-71. [90] Cortes, M.L., et al., HSV-1 amplicon vector-mediated expression of ATM cDNA and correction of the ataxia-telangiectasia cellular phenotype. Gene Ther, 2003. 10(16): p. 1321-7. [91] Cortes, M.L., et al., Expression of human ATM cDNA in Atm-deficient mouse brain mediated by HSV-1 amplicon vector. Neuroscience, 2006. 141(3): p. 1247-56. [92] Cortes, M.L., et al., Targeted integration of functional human ATM cDNA into genome mediated by HSV/AAV hybrid amplicon vector. Mol Ther, 2008. 16(1): p. 81-8. [93] De Felice, F.G., et al., Abeta oligomers induce neuronal oxidative stress through an Nmethyl-D-aspartate receptor-dependent mechanism that is blocked by the Alzheimer drug memantine. J Biol Chem, 2007. 282(15): p. 11590-601. [94] Shankar, G.M., et al., Natural oligomers of the Alzheimer amyloid-beta protein induce reversible synapse loss by modulating an NMDA-type glutamate receptor-dependent signaling pathway. J Neurosci, 2007. 27(11): p. 2866-75.

2110

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

[95] Thinakaran, G. and E.H. Koo, Amyloid precursor protein trafficking, processing, and function. J Biol Chem, 2008. 283(44): p. 29615-9. [96] Shankar, G.M., et al., Amyloid-beta protein dimers isolated directly from Alzheimer's brains impair synaptic plasticity and memory. Nat Med, 2008. 14(8): p. 837-42. [97] Haass, C. and D.J. Selkoe, Soluble protein oligomers in neurodegeneration: lessons from the Alzheimer's amyloid beta-peptide. Nat Rev Mol Cell Biol, 2007. 8(2): p. 101-12. [98] Klein, W.L., Synaptic targeting by A beta oligomers (ADDLS) as a basis for memory loss in early Alzheimer's disease. Alzheimers Dement, 2006. 2(1): p. 43-55. [99] Lesne, S., et al., A specific amyloid-beta protein assembly in the brain impairs memory. Nature, 2006. 440(7082): p. 352-7. [100] Roselli, F., et al., Soluble beta-amyloid1-40 induces NMDA-dependent degradation of postsynaptic density-95 at glutamatergic synapses. J Neurosci, 2005. 25(48): p. 1106170. [101] Bowers, W.J., et al., HSV amplicon-mediated Abeta vaccination in Tg2576 mice: differential antigen-specific immune responses. Neurobiol Aging, 2005. 26(4): p. 393407. [102] Barnes, C.A., Memory deficits associated with senescence: a neurophysiological and behavioral study in the rat. J Comp Physiol Psychol, 1979. 93(1): p. 74-104. [103] Frazer, M.E., et al., Reduced pathology and improved behavioral performance in Alzheimer's disease mice vaccinated with HSV amplicons expressing amyloid-beta and interleukin-4. Mol Ther, 2008. 16(5): p. 845-53. [104] Cousins, S.L., et al., Amyloid precursor protein 695 associates with assembled NR2Aand NR2B-containing NMDA receptors to result in the enhancement of their cell surface delivery. J Neurochem, 2009. 111(6): p. 1501-13. [105] Hoey, S.E., R.J. Williams, and M.S. Perkinton, Synaptic NMDA receptor activation stimulates alpha-secretase amyloid precursor protein processing and inhibits amyloidbeta production. J Neurosci, 2009. 29(14): p. 4442-60. [106] Mori, H. and M. Mishina, Structure and function of the NMDA receptor channel. Neuropharmacology, 1995. 34(10): p. 1219-37. [107] Monyer, H., et al., Developmental and regional expression in the rat brain and functional properties of four NMDA receptors. Neuron, 1994. 12(3): p. 529-40. [108] Moriyoshi, K., et al., Molecular cloning and characterization of the rat NMDA receptor. Nature, 1991. 354(6348): p. 31-7. [109] Decker, H., et al., N-methyl-D-aspartate receptors are required for synaptic targeting of Alzheimer's toxic amyloid-beta peptide oligomers. J Neurochem, 2010. 115(6): p. 15209. [110] Liu, J., et al., Amyloid-beta induces caspase-dependent loss of PSD-95 and synaptophysin through NMDA receptors. J Alzheimers Dis, 2010. 22(2): p. 541-56. [111] Balducci, C., et al., Cognitive deficits associated with alteration of synaptic metaplasticity precede plaque deposition in AbetaPP23 transgenic mice. J Alzheimers Dis, 2010. 21(4): p. 1367-81. [112] Paoletti, P., Molecular basis of NMDA receptor functional diversity. Eur J Neurosci, 2011. 33(8): p. 1351-65. [113] Peruzzi, P.P., et al., Physiological transgene regulation and functional complementation of a neurological disease gene deficiency in neurons. Mol Ther, 2009. 17(9): p. 1517-26.

Amplicon Vectors for Gene Transfer

2111

[114] Hornykiewicz, O., Basic research on dopamine in Parkinson's disease and the discovery of the nigrostriatal dopamine pathway: the view of an eyewitness. Neurodegener Dis, 2008. 5(3-4): p. 114-7. [115] Rodriguez-Oroz, M.C., et al., Initial clinical manifestations of Parkinson's disease: features and pathophysiological mechanisms. Lancet Neurol, 2009. 8(12): p. 1128-39. [116] During, M.J., et al., Long-term behavioral recovery in parkinsonian rats by an HSV vector expressing tyrosine hydroxylase. Science, 1994. 266(5189): p. 1399-403. [117] Sun, M., et al., Correction of a rat model of Parkinson's disease by coexpression of tyrosine hydroxylase and aromatic amino acid decarboxylase from a helper virus-free herpes simplex virus type 1 vector. Hum Gene Ther, 2003. 14(5): p. 415-24. [118] Sun, M., et al., Coexpression of tyrosine hydroxylase, GTP cyclohydrolase I, aromatic amino acid decarboxylase, and vesicular monoamine transporter 2 from a helper virusfree herpes simplex virus type 1 vector supports high-level, long-term biochemical and behavioral correction of a rat model of Parkinson's disease. Hum Gene Ther, 2004. 15(12): p. 1177-96. [119] Zhang, G.R., et al., The vesicular glutamate transporter-1 upstream promoter and first intron each support glutamatergic-specific expression in rat postrhinal cortex. Brain Res, 2011. 1377: p. 1-12. [120] Zhang, G.R., et al., A tyrosine hydroxylase-neurofilament chimeric promoter enhances long-term expression in rat forebrain neurons from helper virus-free HSV-1 vectors. Brain Res Mol Brain Res, 2000. 84(1-2): p. 17-31. [121] Cao, H., et al., Enhanced nigrostriatal neuron-specific, long-term expression by using neural-specific promoters in combination with targeted gene transfer by modified helper virus-free HSV-1 vector particles. BMC Neurosci, 2008. 9: p. 37. [122] Gao, Q., et al., Isolation of an enhancer from the rat tyrosine hydroxylase promoter that supports long-term, neuronal-specific expression from a neurofilament promoter, in a helper virus-free HSV-1 vector system. Brain Res, 2007. 1130(1): p. 1-16. [123] Corso, T.D., et al., Transfection of tyrosine kinase deleted FGF receptor-1 into rat brain substantia nigra reduces the number of tyrosine hydroxylase expressing neurons and decreases concentration levels of striatal dopamine. Brain Res Mol Brain Res, 2005. 139(2): p. 361-6. [124] Sortwell, C.E., et al., Effects of ex vivo transduction of mesencephalic reaggregates with bcl-2 on grafted dopamine neuron survival. Brain Res, 2007. 1134(1): p. 33-44. [125] Gimenez-Cassina, A., et al., Mitochondrial hexokinase II promotes neuronal survival and acts downstream of glycogen synthase kinase-3. J Biol Chem, 2009. 284(5): p. 300111. [126] Corona, J.C., et al., Hexokinase II gene transfer protects against neurodegeneration in the rotenone and MPTP mouse models of Parkinson's disease. J Neurosci Res, 2010. 88(9): p. 1943-50. [127] Liu, M., et al., Orexin (hypocretin) gene transfer diminishes narcoleptic sleep behavior in mice. Eur J Neurosci, 2008. 28(7): p. 1382-93. [128] Linnik, M.D., et al., Expression of bcl-2 from a defective herpes simplex virus-1 vector limits neuronal death in focal cerebral ischemia. Stroke, 1995. 26(9): p. 1670-4; discussion 1675.

2112

Matias E. Melendez, Alejandra I. Aguirre, Maria V. Baez et al.

[129] Antonawich, F.J., H.J. Federoff, and J.N. Davis, BCL-2 transduction, using a herpes simplex virus amplicon, protects hippocampal neurons from transient global ischemia. Exp Neurol, 1999. 156(1): p. 130-7. [130] Lawrence, M.S., et al., Overexpression of Bcl-2 with herpes simplex virus vectors protects CNS neurons against neurological insults in vitro and in vivo. J Neurosci, 1996. 16(2): p. 486-96. [131] Zhao, H., et al., Bcl-2 transfection via herpes simplex virus blocks apoptosis-inducing factor translocation after focal ischemia in the rat. J Cereb Blood Flow Metab, 2004. 24(6): p. 681-92. [132] Lawrence, M.S., et al., Herpes simplex viral vectors expressing Bcl-2 are neuroprotective when delivered after a stroke. J Cereb Blood Flow Metab, 1997. 17(7): p. 740-4. [133] Hoehn, B., et al., Overexpression of HSP72 after induction of experimental stroke protects neurons from ischemic damage. J Cereb Blood Flow Metab, 2001. 21(11): p. 1303-9. [134] Kelly, S., et al., Gene transfer of HSP72 protects cornu ammonis 1 region of the hippocampus neurons from global ischemia: influence of Bcl-2. Ann Neurol, 2002. 52(2): p. 160-7. [135] Meier, T.J., et al., Gene transfer of calbindin D28k cDNA via herpes simplex virus amplicon vector decreases cytoplasmic calcium ion response and enhances neuronal survival following glutamatergic challenge but not following cyanide. J Neurochem, 1998. 71(3): p. 1013-23. [136] Phillips, R.G., et al., Calbindin D28K gene transfer via herpes simplex virus amplicon vector decreases hippocampal damage in vivo following neurotoxic insults. J Neurochem, 1999. 73(3): p. 1200-5. [137] Wang, H., et al., Over-expression of antioxidant enzymes protects cultured hippocampal and cortical neurons from necrotic insults. J Neurochem, 2003. 87(6): p. 1527-34. [138] Zemlyak, I., et al., Gene therapy in the nervous system with superoxide dismutase. Brain Res, 2006. 1088(1): p. 12-8. [139] Lamigeon, C., et al., Enhancement of neuronal protection from oxidative stress by glutamic acid decarboxylase delivery with a defective herpes simplex virus vector. Exp Neurol, 2003. 184(1): p. 381-92. [140] Lim, M.C., S.M. Brooke, and R.M. Sapolsky, gp120 neurotoxicity fails to induce heat shock defenses, while the over expression of hsp70 protects against gp120. Brain Res Bull, 2003. 61(2): p. 183-8. [141] Lawrence, M.S., et al., Herpes simplex virus vectors overexpressing the glucose transporter gene protect against seizure-induced neuron loss. Proc Natl Acad Sci U S A, 1995. 92(16): p. 7247-51. [142] Ho, D.Y., et al., Defective herpes simplex virus vectors expressing the rat brain glucose transporter protect cultured neurons from necrotic insults. J Neurochem, 1995. 65(2): p. 842-50. [143] Ho, D.Y., E.S. Mocarski, and R.M. Sapolsky, Altering central nervous system physiology with a defective herpes simplex virus vector expressing the glucose transporter gene. Proc Natl Acad Sci U S A, 1993. 90(8): p. 3655-9. [144] Cowansage, K.K., J.E. LeDoux, and M.H. Monfils, Brain-derived neurotrophic factor: a dynamic gatekeeper of neural plasticity. Curr Mol Pharmacol, 2010. 3(1): p. 12-29.

Amplicon Vectors for Gene Transfer

2113

[145] Gupta, V.K., et al., TrkB Receptor Signaling: Implications in Neurodegenerative, Psychiatric and Proliferative Disorders. Int J Mol Sci, 2013. 14(5): p. 10122-42. [146] He, Y.Y., et al., Role of BDNF in Central Motor Structures and Motor Diseases. Mol Neurobiol, 2013. [147] Castren, M. and E. Castren, BDNF in fragile X syndrome. Neuropharmacology, 2013. [148] Geschwind, M.D., et al., Defective HSV-1 vector expressing BDNF in auditory ganglia elicits neurite outgrowth: model for treatment of neuron loss following cochlear degeneration. Hum Gene Ther, 1996. 7(2): p. 173-82. [149] Staecker, H., et al., Brain-derived neurotrophic factor gene therapy prevents spiral ganglion degeneration after hair cell loss. Otolaryngol Head Neck Surg, 1998. 119(1): p. 7-13. [150] Garrido, J.J., et al., Defining responsiveness of avian cochlear neurons to brain-derived neurotrophic factor and nerve growth factor by HSV-1-mediated gene transfer. J Neurochem, 1998. 70(6): p. 2336-46. [151] Chen, X., et al., HSV amplicon-mediated neurotrophin-3 expression protects murine spiral ganglion neurons from cisplatin-induced damage. Mol Ther, 2001. 3(6): p. 95863. [152] Bowers, W.J., et al., Neurotrophin-3 transduction attenuates cisplatin spiral ganglion neuron ototoxicity in the cochlea. Mol Ther, 2002. 6(1): p. 12-8. [153] Sun, M., et al., Comparison of the capability of GDNF, BDNF, or both, to protect nigrostriatal neurons in a rat model of Parkinson's disease. Brain Res, 2005. 1052(2): p. 119-29. [154] Harvey, B.K., et al., HSV amplicon delivery of glial cell line-derived neurotrophic factor is neuroprotective against ischemic injury. Exp Neurol, 2003. 183(1): p. 47-55. [155] Arvanian, V.L., et al., Combined delivery of neurotrophin-3 and NMDA receptors 2D subunit strengthens synaptic transmission in contused and staggered double hemisected spinal cord of neonatal rat. Exp Neurol, 2006. 197(2): p. 347-52. [156] Schnell, L., et al., Combined delivery of Nogo-A antibody, neurotrophin-3 and the NMDA-NR2d subunit establishes a functional 'detour' in the hemisected spinal cord. Eur J Neurosci, 2011. 34(8): p. 1256-67. [157] Zou, W., et al., Microinjection of HSV-1 amplicon vector-mediated human proenkephalin into the periaqueductal grey attenuates neuropathic pain in rats. Int J Neurosci, 2012. 122(4): p. 189-94.

Reviewed by Dr. Roberto Manservigi, PhD E-mail: [email protected] Address: Università di Ferrara Dipartimento di Scienze della Vita e Biotecnologie Via Luigi Borsari 46 44100 – Ferrara Italia

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 98

ADVANCES IN VIRAL GENOME RESEARCH OF PAPILLOMAVIRUSES A. C. Freitas, A. L. S. Jesus, A. P. D. Gurgel and M. A. R. Silva Department of Genetics, Federal University of Pernambuco, Brazil

ABSTRACT Papillomaviruses (PVs) infect the epithelium of amniotes, where they can cause tumours or persist asymptomatically. PVs are classified in the Papillomaviridae family, that contains 29 genera of PVsisolated from humans (120 types), non-human mammals, birds and reptiles (69 types). PVs have circular double-stranded DNA genomes approximately 8 kb in size and typically contain eight genes. Studies aiming the identification of PVs genomes use techniques such as PCR with consensus primers, rolling circle amplification and metagenomic methods. Advances in papillomaviral genome research have allowed the knowledge of PVs diversity and evolution of the poorly known PVs genera types, revealing that there is still a limited understanding of PVs diversity. Particularly, recent studies in Bovine Papillomavirus (BPV) have shown the identification of novel BPV types and several putative new virus types in cattle. This chapter will show new contributions in PVs genome studies.

Keywords: Papillomavirus, molecular techniques, viral metagenomics

INTRODUCTION Papillomavirus (PVs) is a group of viruses that induce warts (or papillomas) in a variety of animals. The PVs are widespread in nature and have been recognized primarily in higher vertebrates. Viruses have been characterized from humans, cattle, rabbits, horses, dogs, sheep, elk, deer, nonhuman primates, the harvest mouse, and the multimammate mouse (Mastomysnatalensis) [1]. Some PVs also have malignant potential for animals and people. A

2116

A. C. Freitas, A. L. S. Jesus, A. P. D. Gurgel et al.

number of Human Papillomaviruses (HPVs) have been implicated as the etiologic agents for cervical cancer and other epithelial tumors. PVs are small, nonenveloped, icosahedral DNA viruses that replicate in the nucleus of squamous epithelial cells. The virions consist of a single molecule of double-stranded circular DNA about 8,000 bp in size, contained within a spherical capsid coat, composed of 72 capsomers. The genome of the PVs can be divided, in general, into three major regions: early, late, and a long control region (LCR or noncoding region [NCR])[2]. The late region of the viral genome is expressed only in differentiated layers of warts and other productive lesions, while the early region express both in warts and transformed cells [2,3]. The products of the early region encode viral regulatory proteins, including those viral proteins that are necessary for initiating viral DNA replication and transformation of the host cell [4]. The late region of PVs genomes lies downstream of the early region and encodes L1 and L2 ORFs for translation of a major (L1) and a minor (L2) capsid protein. The LCR region has no protein-coding function, but bears the origin of replication as well as multiple transcription factor binding sites that are important in regulation of RNA polymerase II-initiated transcription from viral early as well as late promoters [5]. PVs have often been classified primarily accordingly to the host species they infect and the sites or diseases with which they are associated. DNA sequencing of many PVs genomes has led their phylogenetic organization, according to the comparative homology of the L1 ORF [6]. The L1 gene is useful for classification and construction of phylogenetic trees, as it is reasonably well conserved and can be aligned for all known PVs [7]. These similarities are consistent with the conclusion that PVs have accompanied their host species during evolution and have evolved with them [8]. Although all PVs share similar genetic organization, the L1 DNA sequence identity is just above 40% between the most divergent genomes. PVs were designated as a distinct family, Papillomaviridae, in the 7th Report of the ICTV [9]. De Villiers et al. [6] described the topology of phylogenetic trees based on the nucleotide sequence comparisons and biologically distinguishing features (host species, target tissues, pathogenicity, and genome organization) that determine the classification of PVs on the level of genera. A nomenclature of these genera based on the Greek alphabet was introduced and has rapidly become accepted and widely used by the ICTV and community of PVs researchers. Sixteen groups of PVs or individual PVs fulfilled the criterion of genera, and the Greek alphabet from the letters alpha to pi was employed to create their nomenclature. The last official classification of PVs genera ended with the genus Pi-PVs. The description of 13 new PVs genera however, exhausts the Greek alphabet. In order to create a system that continues with the Greek alphabet, it was proposed the use of the Greek alphabet a second time, employing the prefix “dyo”, (i.e., Greek “a second time”) [7]. Within a given genus, the L1 DNA of all members shares more than 60% identity. A viral type with a species has 71 to 89% identity with other types within the species. Within a type can exist subtypes, which share 90 to 98% identity, and variants, which have more than 98% identity [7]. Viruses can be identified by a wide range of techniques. Traditional methods include electron microscopy, cell culture, inoculation studies and serology [10]. Whereas many of the viruses known today were first identified by these techniques, the methods have limitations. For these viruses, the molecular-based techniques provide sensitive and rapid means of virus detection and identification [11].

Advances in Viral Genome Research of Papillomaviruses

2117

One such approach uses sequence information from known types to identify related but undiscovered types through cross-hybridization. Another advance has involved PCR amplification of the viral genome. Such PCR-based methods comprise conventional PCR, degenerate PCR, sequence-independent PCR, and rolling circle amplification (RCA). Technological advances have also resulted in the development of metagenomics, the cultureindependent study of the collective set of microbial populations in a sample by analyzing the sample’s nucleotide sequence content [10]. In the next sections, it will be presented the main strategies for the identification of new types and variants of PVs and a particular broach about the recent advances in the Bovine Papillomavirus (BPV) research.

STRATEGIES USED TO IDENTIFY PAPILLOMAVIRUS GENOMES Since PVs life cycle requires keratinocyte differentiation, there are no conventional cell lines that allow the growth these viruses [12]. Moreover, PVs could not be transmitted to laboratory animals [13]. Hence, molecular methods have been widely used to discover and characterize the genome of new PVs as well as for diagnostics of PVs that are clinically relevant [14–37]. Among these, molecular methods such as polymerase chain reaction (PCR), hybridization, and metagenomic methodologies have been frequently used in order to detect human [14– 29,31–33,35–40] and animal PVs [41–43] (Figure 1). In this section, we will discuss about several methods to identify and characterize PVs genome. Various molecular methods, such as PCR have been used to detect specific viruses or viral families. PCR can be used to detect a few copies of a particular nucleic acid, and the viral load in a sample can be quantified with real-time PCR [44]. Although many of the PCR assays investigate the presence of a specific virus, assays have been developed to detect several viruses simultaneously. The most used molecular method to study PVs through its genome is the PCR. This methodology has been widely used to detect a broad range of PVs types in human and animals. PCR-based method has been routinely used due to high sensitivity (PCR-based method can be used to detect a few copies of PVs DNA and viral load samples) and specificity [45–48]. In addition, multiple-primed rolling circle amplification (RCA) technique, hybridization, and metagenomic methods have became a convenient tool for molecular biological research on PVs [10]. Thus, the development of molecular techniques reflected advances in knowledge of PVs genomes. Particularly, viral metagenomics have provided a powerful technology to investigate the viral flora of healthy and sick human and animals [49]. By applying these methodologies to PVs studies, it is possible to gain a better understanding in the etiology of PVs, as well as deepen the knowledge into the PVs and others virus circulating in nature, such as PVs in flies, ticks, fomites and body fluids. Also, it may provide a better understanding of the complex interaction between virus and host.

2118

A. C. Freitas, A. L. S. Jesus, A. P. D. Gurgel et al.

PCR-Based Methods Nowadays, there are several molecular assays that use PCR methods for investigate PVs. These methodologies essentially differ in the PVs gene segment amplified and in the number of primers used. For clinical studies of PVs prevalence, the most frequently used primer sets are MY9/MY11, FAP59/64, and PGMY9/ PGMY11. These consensus primer sets were designed to amplify a partial sequence of highly conserved PVs L1 gene. Also, these primers are made with the use of degenerate nucleotides that increase the range of PVs detection, however, may lower its sensitivity [50]. The MY9/MY11 primer set is the most commonly method to detect HPV infection in cervical samples [51]. These primers amplify approximately 450 base pair (bp) fragments and they allow amplification of 47 HPV DNA types. The PGMY09/PGMY11 primer set is an extended version of MY09/11 primer set, which permits to increase the sensitivity to detect HPV types [52]. Alternatively, the association of fixed nucleotide primers, such as GP5+/GP6+, with degenerate nucleotide primers may be employed to increase the sensitivity to HPV. An alternative PCR approach using primers FAP59/64 also amplify a broad spectrum of HPV types. As well as the MY09/11 primer set, the FAP59/64 primers have degenerate nucleotides and were designed to amplify a partial sequence of highly conserved PVs L1 gene [53]. The primers FAP59/64 allow the detection of 46 HPV types. Apart from HPV, FAP59/64 and MY09/11 can be used to identify a broad range of animal PVs DNA. For instance, Ogawa et al. [22] showed that MY09/11 primers allow to detect BPV1 and BPV3. Moreover, the primers FAP59/64 can detect 13 BPV types [27,28] as well as, possible putative new BPV types [22]. Furthermore, the use of FAP59/64 primers allowed to identify PVs in chimpanzees, gorillas, macaques, monkeys, lemurs, cows and elks [54]. More recently, real-time PCR has been used to detect PVs as well as viral load assessment. This method is based on the release of fluorescence at each amplification cycle, which is directly proportional to the amount of amplicon generated. With regard to Human PVs, studies have showed that real-time PCR can be used to quantify viral load, detection and genotyping in cervical lesion or cervical cancer [55–58]. Moreover, real-time PCR has been used to detect and quantify viral load of animal PV types, such as BPV1, BPV2, BPV12 [17,59–62]. Apart from the clinical importance, the use of PCR-based methods and direct sequencing allowed to demonstrate the genetic diversity within PVs. This genetic diversity of PVs DNA can occur due to synonymous and nonsynonymous mutations [35,36,63], insertions [64] and recombination [65]. These changes can alter the structure and the function of proteins and, consequently, their biological activity [66–69]. For instance, several studies have been demonstrated that variants of HPV16, HPV18, HPV31, HPV33, HPV58 and other HPV types are related to persistent infection, progression and oncogenicity [66,67,69–71]. Moreover, studies that used PCR-based method allowed demonstrating that the genetic diversity within HPV16 and HPV18 DNA co-evolved with the three major human phylogenetic branches: African, Caucasian and Asian. Therefore, the PCR-based method is an important approach used in clinical as well as evolutionary studies with regard PVs. Although PCR-based methods have high sensitivity and specificity, this methodology presents some disadvantages, such as the necessity of specific primer to detect PVs and short amplified fragments. In contrast, multiple primed RCA method has been used to detect new PVs. The rolling circle sequence-independent amplification technique makes use of the property of circular DNA molecules such as plasmids or viral genomes replicating through a

Advances in Viral Genome Research of Papillomaviruses

2119

rolling circle mechanism. Briefly, the RCA method is a DNA synthesis reaction that uses the phi29 DNA polymerase to amplify circular DNA molecules [72]. The uses of random hexamers primers, which bind at multiple locations on a circular DNA template, allow the amplification of circular DNA without requiring prior knowledge of the sequence. Recently, several studies showed the detection of new PVs using the RCA method. Although technically more demanding than other methods of sequence-independent amplification, the RCA approach has facilitated the identification of a novel PVs. For instance, the use of RCA allowed to identify 20 new HPV types in the Betapapillomavirus genus, 47 in Gammapapillomavirus genus, and 7 new HPV types in Alphapapillomavirus genus [13]. Similarly, RCA allowed to identify new animal PVs, such as the Canine Papillomavirus (CPV) [73,74], Feline Papillomavirus (FdPV) [75], Equine Papillomavirus (EcPV) [76], Mouse Papillomavirus (MusPV) [77], Bovine Papillomavirus (BPV) [78], Bettongiapenicillata Papillomavirus (BpPV) [79], Cervuselaphus Papillomavirus (CePV)[80] and M. fascicularis Papillomavirus type 1 (MfPV-1)[81].

Metagenomic Methods As previously mentioned, several microorganisms cannot be cultivated, and therefore, some may go unnoticed and unstudied. Molecular methods widely employed such as PCR have the limitation of being used to detect specific viruses or viral families. However, metagenomics is a more general approach to study the genetic composition of uncultured samples [82]. Viral metagenomics investigates the complete genetic viral population in the sample studied [83]. These studies have also contributed to knowledge of undiscovered or low studied PVs due to its presence in no conventional sites. In the first assays of metagenomics, the products of the amplification technologies have usually been cloned into bacteria to create libraries. Then, these cloned products were characterized by Sanger sequencing to identify any potential viruses. However, this process is quite laborious, and due to a combination of the high background of contaminating host nucleic acid and the occasionally low levels of virus, a vast number of clones may have to be sequenced before a viral sequence is identified [49].One of these techniques, the DNase-SISPA assays includes sequence-independent amplification, cloning and sequencing of amplified viral nucleic fragments followed by in silico searches for sequence similarities to known viruses. This method requires a prior digestion of non-pathogen specific nucleic acid before viral DNA/RNA. DNase-SISPA technique have been widely used for identifying known and unknown viruses [84–86], including PVs [33]. Other independent platforms were introduced for sequencing with no need for traditional cloning after amplification and yield several hundred thousand sequence reads in one run. These techniques have different sequencing principles but all have high throughput (relative to Sanger sequencing) in common and are often referred to as next-generation sequencing or high throughput sequencing [87, 88]. For metagenomic studies, 454 sequencing is often used, mainly due to the longer read length, which makes de novo assembly easier. Next-generation sequencing (NGS)-based metagenomic have allowed the identification of several PVs, including new PVs. Hence, the use of sequencing technologies such as the 454 sequencing platform and high throughput sequencing (metagenomic sequencing and analysis) has permitted to identify new PVs in several biological samples. With regard to Human PVs,

2120

A. C. Freitas, A. L. S. Jesus, A. P. D. Gurgel et al.

the use of metagenomic method identified the genomes of HPV116 in rectal swab [89] and nine putative HPV in cutaneous lesions skin [90]. Moreover, the use of this methodology seems to be important to identify PVs infection in HPV-negative samples [91] as well as sites of less common infections [92]. With regard to animal PVs, the metagenomic method allowed to identify BPV10 in teat wart of cattle [33], PVs in mosquitoes [42], a novel Miniopterusschreibersii Papillomavirus type 1 (MscPV1) and Rousettusaegyptiacus Papillomavirus type 1(RaP1) in bats [38, 93] and Tornovirus 1 (STTV1) in sea turtle [42].

Metagenomicbased

Human and Animal PVs PCR-based

DNA Sequencing

Figure 1. Current methodologies used to detect Human and Animal PVs.

A MODEL FOR RESEARCH IN PAPILLOMAVIRUS: ADVANCES IN BOVINE PAPILLOMAVIRUS KNOWLEDGE Among PVs, BPV have a major role in veterinary medicine. They can cause benign and malignant lesions in cattle and are associated with horse, zebra, buffalo, yaks, giraffes, tapirs and bison lesions [17, 26, 40, 94, 95]. BPV has been widely distributed in cattle worldwide [96]. There are reports of the presence of BPV in the Americas [28], Europe [97], Asia [98], Oceania [99] and Africa [26]. BPV is considered the etiological agent of Bovine Papillomatosis and cancers of the bladder and upper gastrointestinal tract in its natural host. Although there is no global survey on the economic impact of BPV, the numbers about world cattle population that exceeded 1 billion head of cattle reflect the importance of studying BPV. Developing countries like India, Brazil and China have the largest cattle population in the world, whereas USA, Brazil and China are the largest beef producer, respectively [100]. Cutaneous papillomas are responsible for significant economic damages to farmers due to the retarded growth of the animals, loss of weight caused by the reduction in food consumption and decrease in milk production [101,102]. Since lesions are commonly found in young animals whose immune system is still developing, its appearance is an important observation for calves because of the morbidity and mortality and high costs of treatment [103].

Advances in Viral Genome Research of Papillomaviruses

2121

The presence of mucosal papillomas or tumors may progress to cancer, and the upper gastrointestinal tract and the urinary bladder are the most common locations for the development of BPV-associated carcinomas [104]. The highest economic damages caused by BPV are found in cattle from tropical and subtropical regions due to the large presence of bracken fern and its consequent chronic ingestion by the animals [104]. To date, 13 BPV types have been identified and classified into three genera: Deltapapillomavirus (BPV1, 2 and 13), Epsilonpapillomavirus (BPV5 and 8) and Xipapillomavirus (BPV3, 4, 6, 9, 10, 11 and 12). One BPV type is still unclassified (BPV7) [78]. All BPV types characterized so far are associated with different histopathological lesions. Xipapillomaviruses are pure epitheliotropic (causing true papillomas), Deltapapillomaviruses induce fibropapillomas and Epsilonpapillomaviruses can cause both types of lesions [105]. Members of Deltapapillomavirus genus are also associated with infections in non-epithelial sites such as blood and semen [27,106]. Besides the importance of BPV in veterinary medicine, BPV has been also largely investigated as animal model to better understand the transforming activity of PVs. BPV attracted the interest of molecular biologists since it was the first PVs able to induce transformation in cultured non-epithelial cells; furthermore its genome was the first among PVs to be completely sequenced [107]. Despite its importance, the understanding of BPV diversity is limited, probably underestimated. In contrast with HPV that presents more than 150 described HPV genomes, less than 70 non-human PVs species have been isolated and sequenced so far. However, the numbers of studies have attempted to assess the diversity and characterization of BPV genome has increased in recent years. Beyond 13 BPVs described, about 30 new putative types were isolated from various geographical regions in countries such as Brazil, Japan and Sweden. For example, BPV7, 8, 9 and 10 were designated from putative BPV types BAPV6, 2, BPV type I and BPV type II, respectively [14, 22, 54, 98, 108–111]. These studies usually employ the PCR technique with consensus primers, and as commonly these studies describe new putative types and subtypes of BPV, it is believed that there may be an underestimation of the identification of BPV types [112]. BPV are also classified into subtypes and variants, which are useful to the knowledge of biology and diversification of PVs. The differences found in nucleotide sequences of variants of PVs could be responsible for changes in the oncogenic potential, cellular location, host immune response, function of PVs proteins (affecting pathogenesis), or binding capacity of a transcription factor [5, 35, 113, 114]. A few studies related to BPV genetic variability were done. The majority of these studies were associated with equine sarcoid, aiming at understanding differences between the disease in bovine and equine [109,115]. The improvement of molecular techniques for detection of HPV allowed the discovery of these various putative new BPV types, besides the discovery of frequent multiple infections in cattle caused by various BPV types in a single skin lesion [28, 97, 116]. BPV DNA is detected by a variety of PCR-based techniques. These PCRs are based frequently on the detection of one or two BPV types using degenerated or type-specific primers. Genotyping is performed either by real-time detection [33] or by sequence analysis [117] or restriction fragment length polymorphism (RFLP) analyses [18] of the generated PCR fragments. Usually the discovery of putative new types, subtypes and variant are made in works that employs consensus primers capable of identifying potentially more than two BPV types [22]. This methodology has suggested the existence of numerous yet uncharacterized BPV types in cattle herds from diverse geographical regions. Beyond the use of consensus primers designed for HPV, such as

2122

A. C. Freitas, A. L. S. Jesus, A. P. D. Gurgel et al.

FAP59/FAP64 and MY09/MY11 successful in identifying cutaneous and mucosal PVs types, respectively [118,119], other consensus primers designed exclusively for L1 of BPV have been used [98]. There are reports indicating that consensus primers sometimes fail to diagnose a Papillomavirus infection because of sequence differences between consensus primers and putative PV types [54].Beyond the use of these primers, the multiple-primed RCA technique has been applied to amplify whole genomes of PVs [120,121] and also BPV [111] and became a convenient tool for molecular biological research on PVs. Also, in cattle other sequenceindependent amplification techniques like DNase-SISPA have been use for characterizing genome of BPV. Due to this plasticity, BPV genomes and BPV-like genome has been detected in several sites and hosts [27, 27, 96, 122], and metagenomic methods are very suitable for samples like plasma, serum, soft tissues, respiratory secretions, cerebrospinal fluid, urine, faeces and filterable environmental [83, 86]. Therefore, these new methods seem to be very suitable for BPV studies. The advances in knowledge of BPV genomes and putative new genomes have been reflected by the development of molecular techniques and enabled new strategies of studies with the purpose of prevention and treatment of Papillomaviruses in cattle and other animals.

REFERENCES [1]

Howley PM: Papillomaviruses and Their Replication. In: Knipe, D.M., Howley, P.M. (Eds.), Fields Virology, vol. 2. Lippinicott, Williams & Wilkins, pp. 3634–3687. [2] Zheng Z-M, Baker CC: Papillomavirus genome structure, expression, and posttranscriptional regulation. Front Biosci. J. Virtual Libr. 2006;11:2286–2302. [3] Jia R, Zheng Z-M: Regulation of Bovine Papillomavirus type 1 gene expression by RNA processing. Front Biosci. J. Virtual Libr. 2009 [4] Campo MS. Bovine Papillomavirus: old system, new lessons? In: Campo MS (ed) Papillomavirus research: from natural history to vaccine and beyond. Caister Academic Press, (2006) Wymondham. [5] Bernard H-U: Gene expression of genital Human Papillomaviruses and considerations on potential antiviral approaches. Antivir. Ther. 2002;7:219–237. [6] De Villiers E-M, Fauquet C, Broker TR, Bernard H-U, zur Hausen H: Classification of Papillomaviruses. Virology 2004 20;324:17–27. [7] Bernard H-U, Burk RD, Chen Z, van Doorslaer K, Hausen H zur, de Villiers E-M: Classification of Papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic amendments. Virology 2010 25;401:70–79. [8] Bernard H-U, Calleja-Macias IE, Dunn ST: Genome variation of Human Papillomavirus types: phylogenetic and medical implications. Int. J. Cancer J. Int. Cancer 2006 1;118:1071–1076. [9] Van Regenmortel M, International, Fauquet C: Virus Taxonomy: Classification and Nomenclature of Viruses: Seventh Report of the International Committee on Taxonomy of Viruses. Academic Press, 2000. [10] Bexfield N, Kellam P: Metagenomics and the molecular identification of novel viruses. Vet. J. Lond. Engl. 2011;190:191–198.

Advances in Viral Genome Research of Papillomaviruses

2123

[11] Belak S, Thoren P, LeBlanc N, Viljoen G: Advances in viral disease diagnostic and molecular epidemiological technologies. Expert Rev. Mol. Diagn. 2009;9:367–381. [12] Geimanen J, Isok-Paas H, Pipitch R, Salk K, Laos T, Orav M, et al.: Development of a cellular assay system to study the genome replication of high- and low-risk mucosal and cutaneous Human Papillomaviruses. J. Virol. 2011 1;85:3315–3329. [13] De Villiers E-M: Cross-roads in the classification of Papillomaviruses. Virology DOI: 10.1016/j.virol.2013.04.023 [14] Maeda Y, Shibahara T, Wada Y, Kadota K, Kanno T, Uchida I, et al.: An outbreak of teat papillomatosis in cattle caused by Bovine Papillomavirus (BPV) type 6 and unclassified BPVs. Vet. Microbiol. 2007;121:242–248. [15] Xi LF, Demers GW, Koutsky LA, Kiviat NB, Kuypers J, Watts DH, et al.: Analysis of Human Papillomavirus Type 16 Variants Indicates Establishment of Persistent Infection. J. Infect. Dis. 1995;172:747–755. [16] Wu Y, Chen Y, Li L, Yu G, He Y, Zhang Y: Analysis of mutations in the E6/E7 oncogenes and L1 gene of Human Papillomavirus 16 cervical cancer isolates from China. J. Gen. Virol. 2006;87:1181 –1188. [17] Bogaert L, Martens A, Kast WM, Van Marck E, De Cock H: Bovine Papillomavirus DNA can be detected in keratinocytes of equine sarcoid tumors. Vet. Microbiol. 2010 15;146:269–275. [18] Carr EA, Théon AP, Madewell BR, Griffey SM, Hitchcock ME: Bovine Papillomavirus DNA in neoplastic and nonneoplastic tissues obtained from horses with and without sarcoids in the western United States. Am. J. Vet. Res. 2001;62:741–744. [19] Stocco dos Santos RC, Lindsey CJ, Ferraz OP, Pinto JR, Mirandola RS, Benesi FJ, et al.: Bovine Papillomavirus transmission and chromosomal aberrations: an experimental model. J. Gen. Virol. 1998;79:2127 –2135. [20] Wosiacki SR, Claus MP, Alfieri AF, Alfieri AA: Bovine Papillomavirus type 2 detection in the urinary bladder of cattle with chronic enzootic haematuria. Memórias Inst. Oswaldo Cruz 2006;101:635–638. [21] Borzacchiello G, Ambrosio V, Roperto S, Poggiali F, Tsirimonakis E, Venuti A, et al.: Bovine Papillomavirus type 4 in oesophageal papillomas of cattle from the south of Italy. J. Comp. Pathol. 2003;128:203–206. [22] Ogawa T, Tomita Y, Okada M, Shinozaki K, Kubonoya H, Kaiho I, et al.: Broadspectrum detection of Papillomaviruses in bovine teat papillomas and healthy teat skin. J. Gen. Virol. 2004;85:2191 –2197. [23] Van Dyk E, Bosman AM, van Wilpe E, Williams JH, Bengis RG, van Heerden J, et al.: Detection and characterisation of Papillomavirus in skin lesions of giraffe and sable antelope in South Africa. J. S. Afr. Vet. Assoc. 2011;82:80–85. [24] Gnanamony M, Peedicayil A, Subhashini J, Ram TS, Rajasekar A, Gravitt P, et al.: Detection and quantitation of HPV 16 and 18 in plasma of Indian women with cervical cancer. Gynecol. Oncol. 2010;116:447–451. [25] Ho C-M, Yang S-S, Chien T-Y, Huang S-H, Jeng C-J, Chang S-F: Detection and quantitation of Human Papillomavirus type 16, 18 and 52 DNA in the peripheral blood of cervical cancer patients. Gynecol. Oncol. 2005;99:615–621. [26] Van Dyk E, Oosthuizen MC, Bosman A-M, Nel PJ, Zimmerman D, Venter EH: Detection of Bovine Papillomavirus DNA in sarcoid-affected and healthy free-roaming zebra (Equus zebra) populations in South Africa. J. Virol. Methods 2009;158:141–151.

2124

A. C. Freitas, A. L. S. Jesus, A. P. D. Gurgel et al.

[27] Silva MAR, Pontes NE, Da Silva KMG, Guerra MMP, Freitas AC: Detection of Bovine Papillomavirus type 2 DNA in commercial frozen semen of bulls (Bos taurus). Anim. Reprod. Sci. 2011;129:146–151. [28] Carvalho CCR, Batista MVA, Silva MAR, Balbino VQ, Freitas AC: Detection of Bovine Papillomavirus types, co-Infection and a putative new BPV11 subtype in cattle. Transbound. Emerg. Dis. 2012 Jan 9; DOI: 10.1111/j.1865-1682.2011.01296.x [29] Leishangthem GD: Detection of Bovine Papillomaviruses in cutaneous warts/papillomas in cattle. Indian J. Vet. Pathol. 32:15–20. [30] Shen Z-Y, Hu S-P, Lu L-C, Tang C-Z, Kuang Z-S, Zhong S-P, et al.: Detection of Human Papillomavirus in esophageal carcinoma. J. Med. Virol. 2002;68:412–416. [31] Baldez da Silva MFPT, Chagas BS, Guimaraes V, Katz LMC, Felix PM, Miranda PM, et al.: HPV31 and HPV33 incidence in cervical samples from women in Recife, Brazil. Genet. Mol. Res. 2009;8:1437–1443. [32] Badaracco G, Venuti A, Morello R, Muller A, Marcante ML: Human Papillomavirus in head and neck carcinomas: prevalence, physical status and relationship with clinical/pathological parameters. Anticancer Res. 2000;20:1301–1305. [33] Rai GK, Saxena M, Singh V, Somvanshi R, Sharma B: Identification of Bovine Papillomavirus 10 in teat warts of cattle by DNase-SISPA. Vet. Microbiol. 2011;147:416–419. [34] Finan RR, Tamim H, Almawi WY: Identification of Chlamydia trachomatis DNA in Human Papillomavirus (HPV) positive women with normal and abnormal cytology. Arch. Gynecol. Obstet. 2002;266:168–171. [35] Chagas BS, Batista MVA, Guimaraes V, Balbino VQ, Crovella S, Freitas AC: New variants of E6 and E7 oncogenes of Human Papillomavirus type 31 identified in Northeastern Brazil. Gynecol. Oncol. 2011;123:284–288. [36] Chagas BS, Batista MV de A, Crovella S, Gurgel APAD, Silva Neto J da C, Serra IGSS, et al.: Novel E6 and E7 oncogenes variants of Human Papillomavirus type 31 in Brazilian women with abnormal cervical cytology. Infect. Genet. Evol. 2013;16C:13–18. [37] Watts KJ, Thompson CH, Cossart YE, Rose BR: Sequence variation and physical state of Human Papillomavirus type 16 cervical cancer isolates from Australia and New Caledonia. Int. J. Cancer J. Int. Cancer 2002;97:868–874. [38] Tse H, Tsang AKL, Tsoi H-W, Leung ASP, Ho C-C, Lau SKP, et al.: Identification of a novel bat Papillomavirus by metagenomics. Plos One 2012;7:e43986. [39] Ge X, Li Y, Yang X, Zhang H, Zhou P, Zhang Y, et al.: Metagenomic analysis of Viruses from the bat fecal samples reveals many novel viruses in insectivorous bats in China. J. Virol. 2012; DOI: 10.1128/JVI.06671-11. [40] Pangty K, Singh S, Goswami R, Saikumar G, Somvanshi R: Detection of BPV-1 and -2 and Quantification of BPV-1 by Real-Time PCR in Cutaneous Warts in Cattle and Buffaloes. Transbound. Emerg. Dis. 2010;57:185–196. [41] Christian L, Claude F, Mathias A, Jessica G, Elisabeth V, Kurt T: Novel snake Papillomavirus does not cluster with other non-mammalian papillomaviruses. Virol. J. 2011;8:4362011. [42] Ng TFF, Manire C, Borrowman K, Langer T, Ehrhart L, Breitbart M: Discovery of a novel single-stranded DNA virus from a sea turtle fibropapilloma by using viral metagenomics. J. Virol. 2009;83:2500–2509.

Advances in Viral Genome Research of Papillomaviruses

2125

[43] Herbst LH, Lenz J, Van Doorslaer K, Chen Z, Stacy BA, Wellehan Jr. JFX, et al.: Genomic characterization of two novel reptilian Papillomaviruses, Chelonia mydas Papillomavirus 1 and Caretta caretta Papillomavirus 1. Virology 2009;383:131–135. [44] Mackay IM, Arden KE, Nitsche A: Real-time PCR in virology. Nucleic. Acids Res. 2002;30:1292–1305. [45] Gravitt PE, Peyton C, Wheeler C, Apple R, Higuchi R, Shah KV: Reproducibility of HPV 16 and HPV 18 viral load quantitation using TaqMan real-time PCR assays. J. Virol. Methods 2003;112:23–33. [46] Hesselink AT, Meijer CJLM, Poljak M, Berkhof J, Kemenade FJ van, Salm ML van der, et al.: Clinical validation of the Abbott RealTime High Risk (HR) HPV assay according to the guidelines for HPV DNA test requirements for cervical screening. J. Clin. Microbiol. 2013; DOI: 10.1128/JCM.00633-13 [47] Nagao S, Yoshinouchi M, Miyagi Y, Hongo A, Kodama J, Itoh S, et al.: Rapid and sensitive detection of physical status of Human Papillomavirus type 16 DNA by quantitative real-time PCR. J. Clin. Microbiol. 2002;40:863–867. [48] Peitsaro P, Johansson B, Syrjänen S: Integrated Human Papillomavirus type 16 is frequently found in cervical cancer precursors as demonstrated by a novel quantitative real-time PCR technique. J. Clin. Microbiol. 2002;40:886–891. [49] Blomström A-L: Applications of viral metagenomics in the veterinary field. 2010. [50] Qu W, Jiang G, Cruz Y, Chang CJ, Ho GY, Klein RS, et al.: PCR detection of Human Papillomavirus: comparison between MY09/MY11 and GP5+/GP6+ primer systems. J. Clin. Microbiol. 1997;35:1304–1310. [51] Resnick RM, Cornelissen MTE, Wright DK, Eichinger GH, Fox HS, Schegget J ter, et al.: Detection and typing of Human Papillomavirus in archival cervical cancer specimens by DNA amplification with consensus primers. J. Natl. Cancer Inst. 1990;82:1477– 1484. [52] Gravitt PE, Peyton CL, Alessi TQ, Wheeler CM, Coutlée F, Hildesheim A, et al.: Improved Amplification of Genital Human Papillomaviruses. J. Clin. Microbiol. 2000;38:357–361. [53] Forslund O: Genetic diversity of cutaneous human papillomaviruses. J. Gen. Virol. 2007;88:2662–2669. [54] Antonsson A, Hansson BG: Healthy skin of many animal species harbors Papillomaviruses which are closely related to their human counterparts. J. Virol. 2002;76:12537–12542. [55] Liao Y, Zhou Y, Guo Q, Xie X, Luo E, Li J, et al.: Simultaneous detection, genotyping, and quantification of Human Papillomaviruses by multicolor real-Time PCR and melting curve analysis. J. Clin. Microbiol. 2013;51:429–435. [56] Seaman WT, Andrews E, Couch M, Kojic EM, Cu-Uvin S, Palefsky J, et al.: Detection and quantitation of HPV in genital and oral tissues and fluids by real time PCR. Virol. J. 2010;7:194. [57] Iftner T, Germ L, Swoyer R, Kjaer SK, Breugelmans JG, Munk C, et al.: Study comparing Human Papillomavirus (HPV) real-time multiplex PCR and hybrid capture II INNO-LiPA v2 HPV genotyping PCR Assays. J. Clin. Microbiol. 2009;47:2106–2113. [58] Micalessi MI, Boulet GA, Vorsters A, De Wit K, Jannes G, Mijs W, et al.: A real-time PCR approach based on SPF10 primers and the INNO-LiPA HPV genotyping extra assay

2126

[59]

[60] [61]

[62]

[63] [64]

[65]

[66]

[67]

[68]

[69]

[70]

[71]

[72] [73]

A. C. Freitas, A. L. S. Jesus, A. P. D. Gurgel et al. for the detection and typing of Human Papillomavirus. J. Virol. Methods 2013;187:166– 171. Pathania S, Dhama K, Saikumar G, Shahi S, Somvanshi R: Detection and quantification of Bovine Papillomavirus type 2 (BPV-2) by real-time PCR in urine and urinary bladder lesions in enzootic bovine haematuria (EBH)-affected cows. Transbound. Emerg. Dis. 2012;59:79–84. Dong J, Zhu W, Goto Y, Haga T: Initial detection of a circular genome deletion in a naturally Bovine Papillomavirus-infected sample. J. Vet. Med. Sci. 2013;75:179–182. Haralambus R, Burgstaller J, Klukowska-Rötzler J, Steinborn R, Buchinger S, Gerber V, et al.: Intralesional Bovine Papillomavirus DNA loads reflect severity of equine sarcoid disease. Equine Vet. J. 2010;42:327–331. Roperto S, Russo V, Ozkul A, Sepici-Dincel A, Maiolino P, Borzacchiello G, et al.: Bovine Papillomavirus type 2 infects the urinary bladder of water buffalo (Bubalus bubalis) and plays a crucial role in bubaline urothelial carcinogenesis. J. Gen. Virol. 2012;94:403–408. De Freitas AC, Gurgel APAD, Chagas BS, Coimbra EC, do Amaral CMM: Susceptibility to cervical cancer: An overview. Gynecol. Oncol. 2012;126:304–311. Campitelli M, Jeannot E, Peter M, Lappartient E, Saada S, de la Rochefordiere A, et al.: Human Papillomavirus mutational insertion: specific marker of circulating tumor DNA in cervical cancer patients. Plos One 2012;7:e43393. Robles-Sikisaka R, Rivera R, Nollens HH, St Leger J, Durden WN, Stolen M, et al.: Evidence of recombination and positive selection in cetacean Papillomaviruses. Virology 2012;427:189–197. Yamada T, Manos MM, Peto J, Greer CE, Munoz N, Bosch FX, et al.: Human Papillomavirus type 16 sequence variation in cervical cancers: a worldwide perspective. J. Virol. 1997;71:2463–2472. Londesborough P, Ho L, Terry G, Cuzick J, Wheeler C, Singer A: Human Papillomavirus genotype as a predictor of persistence and development of high-grade lesions in women with minor cervical abnormalities. Int. J. Cancer J. Int. Cancer 1996;69:364–368. Zehbe I, Lichtig H, Westerback A, Lambert PF, Tommasino M, Sherman L: Rare Human Papillomavirus 16 E6 variants reveal significant oncogenic potential. Mol. Cancer 2011;10:77. Schiffman M, Rodriguez AC, Chen Z, Wacholder S, Herrero R, Hildesheim A, et al.: A Population-Based prospective study of carcinogenic Human Papillomavirus variant lineages, viral persistence, and cervical neoplasia. Cancer Res. 2010;70:3159 –3169. Cento V, Rahmatalla N, Ciccozzi M, Perno CF, Ciotti M: Intratype variations of HPV 31 and 58 in Italian women with abnormal cervical cytology. J. Med. Virol. 2011;83:1752–1761. Raiol T, Wyant PS, de Amorim RMS, Cerqueira DM, Milanezi N von G, Brigido M de M, et al.: Genetic variability and phylogeny of the high-risk HPV-31, -33, -35, -52, and -58 in central Brazil. J. Med. Virol. 2009;81:685–692. Johne R, Müller H, Rector A, van Ranst M, Stevens H: Rolling-circle amplification of viral DNA genomes using phi29 polymerase. Trends Microbiol. 2009;17:205–211. Lange CE, Tobler K, Lehner A, Vetsch E, Favrot C: A case of a canine pigmented plaque associated with the presence of a Xipapillomavirus. Vet. Dermatol. 2012;23:76–e19.

Advances in Viral Genome Research of Papillomaviruses

2127

[74] Lange CE, Ackermann M, Favrot C, Tobler K: Entire Genomic Sequence of Novel Canine Papillomavirus Type 13. J. Virol. 2012;86:10226–10227. [75] Lange CE, Tobler K, Markau T, Alhaidari Z, Bornand V, Stöckli R, et al.: Sequence and classification of FdPV2, a Papillomavirus isolated from feline Bowenoid in situ carcinomas. Vet. Microbiol. 2009;137:60–65. [76] Scase T, Brandt S, Kainzbauer C, Sykora S, Bijmholt S, Hughes K, et al.: Equus caballus Papillomavirus-2 (EcPV-2): An infectious cause for equine genital cancer? Equine Vet. J. 2010;42:738–745. [77] Joh J, Jenson AB, King W, Proctor M, Ingle A, Sundberg JP, et al.: Genomic analysis of the first laboratory-mouse Papillomavirus. J. Gen. Virol. 2011;92:692–698. [78] Lunardi M, Alfieri AA, Otonel RAA, de Alcântara BK, Rodrigues WB, de Miranda AB, et al.: Genetic characterization of a novel Bovine Papillomavirus member of the Deltapapillomavirus genus. Vet. Microbiol. 2013;162:207–213. [79] Bennett MD, Reiss A, Stevens H, Heylen E, Ranst MV, Wayne A, et al.: The first complete Papillomavirus genome characterized from a marsupial host: a novel isolate from Bettongia penicillata. J. Virol. 2010;84:5448–5453. [80] Scagliarini A, Gallina L, Battilani M, Turrini F, Savini F, Lavazza A, et al.: Cervus elaphus Papillomavirus (CePV1): New insights on viral evolution in deer. Vet. Microbiol. DOI: 10.1016/j.vetmic.2013.03.012 [81] Joh J, Hopper K, Doorslaer KV, Sundberg JP, Jenson AB, Ghim S-J: Macaca fascicularis Papillomavirus type 1: a non-human primate Betapapillomavirus causing rapidly progressive hand and foot papillomatosis. J. Gen. Virol. 2009;90:987–994. [82] Handelsman J: Metagenomics: Application of Genomics to Uncultured Microorganisms. Microbiol. Mol. Biol. Rev. 2004;68:669–685. [83] Delwart EL: Viral metagenomics. Rev. Med. Virol. 2007;17:115–131. [84] Allander T, Emerson SU, Engle RE, Purcell RH, Bukh J: A virus discovery method incorporating DNase treatment and its application to the identification of two Bovine Parvovirus species. Proc. Natl. Acad. Sci. USA 2001;98:11609–11614. [85] Breitbart M, Rohwer F: Method for discovering novel DNA viruses in blood using viral particle selection and shotgun sequencing. BioTechniques 2005;39:729–736. [86] Ambrose HE, Clewley JP: Virus discovery by sequence-independent genome amplification. Rev. Med. Virol. 2006;16:365–383. [87] Kircher M, Kelso J: High-throughput DNA sequencing-concepts and limitations. Bioessays 2010;32:524–536. [88] Shendure J, Ji H: Next-generation DNA sequencing. Nat. Biotechnol. 2008;26:1135– 1145. [89] Li L, Barry P, Yeh E, Glaser C, Schnurr D, Delwart E: Identification of a novel Human Gammapapillomavirus species. J. Gen. Virol. 2009;90:2413–2417. [90] Ekström J, Bzhalava D, Svenback D, Forslund O, Dillner J: High throughput sequencing reveals diversity of Human Papillomaviruses in cutaneous lesions. Int. J. Cancer J. Int. Cancer 2011;129:2643–2650. [91] Johansson H, Bzhalava D, Ekström J, Hultin E, Dillner J, Forslund O: Metagenomic sequencing of “HPV-negative” condylomas detects novel putative HPV types. Virology 2013;440:1–7.

2128

A. C. Freitas, A. L. S. Jesus, A. P. D. Gurgel et al.

[92] Mokili JL, Dutilh BE, Lim YW, Schneider BS, Taylor T, Haynes MR, et al.: Identification of a novel Human Papillomavirus by metagenomic analysis of samples from patients with febrile respiratory illness. Plos One 2013;8:e58404. [93] Baker KS, Leggett RM, Bexfield NH, Alston M, Daly G, Todd S, et al.: Metagenomic study of the viruses of African straw-coloured fruit bats: Detection of a chiropteran poxvirus and isolation of a novel adenovirus. Virology 2013;441:95–106. [94] Löhr CV, Juan-Sallés C, Rosas-Rosas A, García AP, Garner MM, Teifke JP: Sarcoids in Captive zebras (Equs burcheli II): Assocation with Bovine Papillomavirus type I infection. J. Zoo Wildl. Med.;36:74–81. [95] Silvestre O, Borzacchiello G, Nava D, Iovane G, Russo V, Vecchio D, et al.: Bovine Papillomavirus Type 1 DNA and E5 Oncoprotein Expression in Water Buffalo Fibropapillomas. Vet. Pathol. Online 2009;46:636 –641. [96] Freitas AC: Recent insights into Bovine Papillomavirus. Afr. J. Microbiol. Res. 2011;5. DOI: 10.5897/AJMRX11.020 [97] Schmitt M, Fiedler V, Müller M: Prevalence of BPV genotypes in a German cowshed determined by a novel multiplex BPV genotyping assay. J. Virol. Methods 2010;170:67– 72. [98] Hatama S, Ishihara R, Ueda Y, Kanno T, Uchida I: Detection of a novel Bovine Papillomavirus type 11 (BPV-11) using Xipapillomavirus consensus polymerase chain reaction primers. Arch. Virol. 2011;156:1281–1285. [99] Munday JS, Knight CG: Amplification of feline sarcoid-associated Papillomavirus DNA sequences from bovine skin. Vet. Dermatol. 2010;21:341–344. [100] Lowe M, Gereffi G. A value chain analysis of the U.S. beef and dairy industries. Report prepared for Environmental Defense Fund. 2009. [101] Meyers SA, Read WK: Squamous cell carcinoma of the vulva in a cow. J. Am. Vet. Med. Assoc. 1990;196:1644–1646. [102] Scott DW, Anderson WI. Bovine cutaneous neoplasms: literature review and retrospective analysis of 62 cases (1968 to 1990). Comp. Cont. Educ. Pract. Vet. 1992; 14:10. [103] Wellenberg GJ, van der Poel WHM, Van Oirschot JT: Viral infections and bovine mastitis: a review. Vet. Microbiol. 2002;88:27–45. [104] Hatama S. Cutaneous papillomatosis in cattle. J. Disaster Res. 2012. [105] Freitas ACF, Gurgel APAD, Chagas BS, Balbino VQ, Batista MVA. Genetic diversity of human and animal Papillomaviruses. In: Julian A, Cervantes Amaya, Miguel MFJ (Org.). Genetic Diversity: New Research. Hauppauge, NY: Nova Science Publishers, Inc., 2012. [106] Silva MAR, Silva KMG, Jesus ALS, Barros LO, Corteggio A, Altamura G, et al.: The presence and gene expression of Bovine Papillomavirus in the peripheral blood and semen of healthy horses. Transbound Emerg. Dis 2012; DOI: 10.1111/tbed.12036 [107] Chen EY, Howley PM, Levinson AD, Seeburg PH: The primary structure and genetic organization of the Bovine Papillomavirus type 1 genome. Nature 1982;299:529–534. [108] Tomita Y, Literak I, Ogawa T, Jin Z, Shirasawa H: Complete genomes and phylogenetic positions of Bovine Papillomavirus type 8 and a variant type from a European bison. Virus Genes. 2007;35:243–249.

Advances in Viral Genome Research of Papillomaviruses

2129

[109] Claus MP, Lunardi M, Alfieri AF, Ferracin LM, Fungaro MHP, Alfieri AA: Identification of unreported putative new Bovine Papillomavirus types in Brazilian cattle herds. Vet. Microbiol. 2008;132:396–401. [110] Hatama S, Nobumoto K, Kanno T: Genomic and phylogenetic analysis of two novel Bovine Papillomaviruses, BPV-9 and BPV-10. J. Gen. Virol. 2008;89:158 –163. [111] Zhu W, Dong J, Shimizu E, Hatama S, Kadota K, Goto Y, et al.: Characterization of novel Bovine Papillomavirus type 12 (BPV-12) causing epithelial papilloma. Arch. Virol. 2012;157:85–91. [112] Silva MAR, Batista MVA, Pontes NE, Santos EUD, Coutinho LCA, Castro RS, et al.: Comparison of two PCR strategies for the detection of Bovine Papillomavirus. J. Virol. Methods 2013;192:55–58. [113] Sichero L, Villa LL: Epidemiological and functional implications of molecular variants of Human Papillomavirus. Braz. J. Med. Biol. Res. 2006;39:707–717. [114] Chambers G, Ellsmore VA, O’Brien PM, Reid SWJ, Love S, Campo MS, et al.: Sequence variants of Bovine Papillomavirus E5 detected in equine sarcoids. Virus Res. 2003;96:141–145. [115] Jarrett WFH, McNeil PE, Grimshaw WTR, Selman IE, McIntyre WIM: High incidence area of cattle cancer with a possible interaction between an environmental carcinogen and a papilloma virus. Nature 1978;274:215–217. [116] Batista MVA, Silva MAR, Pontes NE, Reis MC, Corteggio A, Castro RS, et al.: Molecular epidemiology of bovine papillomatosis and the identification of a putative new virus type in Brazilian cattle. Vet. J. 2013; DOI: 10.1016/j.tvjl.2013.01.019 [117] Brandt S, Haralambus R, Schoster A, Kirnbauer R, Stanek C: Peripheral blood mononuclear cells represent a reservoir of Bovine Papillomavirus DNA in sarcoidaffected equines. J. Gen. Virol. 2008;89:1390 –1395. [118] Forslund O, Antonsson A, Nordin P, Stenquist B, Hansson BG: A broad range of Human Papillomavirus types detected with a general PCR method suitable for analysis of cutaneous tumours and normal skin. J. Gen. Virol. 1999;80 (Pt 9):2437–2443. [119] Manos MM, Ting Y, Wright DK, Lewis AJ, Broker TR, Wolinsky SM. The use of polymerase chain reaction amplification for the detection of genital Human Papillomaviruses. Mol. Diagn. Human 19897:209–214. [120] Rector A, Bossart GD, Ghim S-J, Sundberg JP, Jenson AB, Van Ranst M: Characterization of a novel close-to-root Papillomavirus from a Florida manatee by using multiply primed rolling-circle amplification: Trichechus manatus latirostris Papillomavirus Type 1. J. Virol. 2004;78:12698–12702. [121] Rector A, Tachezy R, Van Doorslaer K, MacNamara T, Burk RD, Sundberg JP, et al.: Isolation and cloning of a Papillomavirus from a North American porcupine by using multiply primed rolling-circle amplification: the Erethizon dorsatum Papillomavirus type 1. Virology 2005;331:449–456. [122] Lindsey CL, Almeida ME, Vicari CF, Carvalho C, Yaguiu A, Freitas AC, et al.: Bovine Papillomavirus DNA in milk, blood, urine, semen, and spermatozoa of bovine papillomavirus-infected animals. Genet. Mol. Res. 2009;8:310–318.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 99

SYNTHETIC SYNTHESIS OF VIRAL GENOMES Monique R. Eller1, Roberto S. Dias2, Rafael L. Salgado3, Cynthia C. da Silva4 and Sérgio O. De Paula2, 1

Department of Food Technology, Laboratory of Molecular Immunovirology, Department of General Biology, 3 Department of Biochemistry and Molecular Biology, 4 Department of Microbiology, Federal University of Viçosa, Av. PH Rolfs, s/n, Campus da UFV, Viçosa, Minas Gerais, Brazil 2

ABSTRACT Viral particles are important tools in Molecular Biology, acting as carriers of genetic material, immunogenic antigens, adjuvants, or even directly combating antibiotic-resistant microorganisms and their biofilms in hospital and industrial environments. However, the efficient use of these particles requires extensive knowledge about their characteristics and components, including those involved in their regulatory mechanisms of genome transcription and protein synthesis. The exploration of this knowledge becomes a challenge especially for scientists analyzing the virions in their natural environment, due to their interactions with the complex and diverse types of biological systems, which directly influence the regulation of the infective cycles. Thus, knowledge about viral genes, their function, organization, and modulation, beyond the comprehension of the viral components as parts of complex systems, consist of the main hurdles for the controlled and predictable handling and use of these particles. For this, the technology of Synthetic Synthesis of viral genomes is distinguished from traditional genetic engineering through the use of modularity and standardization to construct proof-of-principle systems and allow generalized circuits designs to be applied to different scenarios. This new technology is made possible thanks to advances in many areas of science, from the use of restriction enzymes until the development of techniques of genomic synthesis and sequencing, like the 454 Roche, Illumina, and SOLiD systems. This technology is becoming increasingly a multidisciplinary tool used in the investigations about these complex systems, as well in the engineering of new particles for the optimization of diverse viral functions and 

Corresponding Author’s Email: [email protected] (Tel.: +55 31 3899-2589; Fax: +55 31 3899-2549).

2132

Monique R. Eller, Roberto S. Dias, Rafael L. Salgado et al.

alterations in their infectivity and affinity, or even in the development of completely new organisms and features without the need for a template. Nevertheless, advances in this technology are still limited by the lack of dynamic techniques for monitoring biological systems and efficient and standardized circuits. Here, we summarize the major characteristics of viral genomes, their organization and gene modulation, and highlight the main aspects of Synthetic Biology applied to viral genomes, as its main techniques and applications.

INTRODUCTION Viruses are infective particles essential for the balance of ecosystems and are directly related to the evolutionary processes throughout the history of life on Earth. Therefore, the study of viral genomes attracts the interest from various areas of science, since the elucidation of the genomic sequences, its function, organization and modulation are sources of important discoveries about the evolution of species and may help to explain the biological behavior of the more complex living organisms. In addition, knowledge and handling of these genomes along with techniques of molecular biology have allowed these particles be used as vectors or gene recombination agents, as antimicrobials agents helping to control microbial contamination in industries and hospitals, or still used in the production of vaccines for the control of various pathogens, for the detection of micro-organisms, among others. For example, Lu and Collins demonstrate that an engineered bacteriophage was able to enhance the killing of antibioticresistant and biofilm-former bacteria, and act as a strong adjuvant for other bactericidal antibiotics (T K Lu & J J Collins 2007). Viral genomes are extremely variable in size and structure of genes, but patterns can be observed along the evolutionary studies, especially among closely related viruses. The techniques for sequencing these genomes are already a practice and economic reality, allowing the study of genes, their function and modulation for handling these genomes can be accomplished in a rational and predictable way. Accordingly, the chemical synthesis of genes has been gradually made possible, but yet is not a reality in terms of genomes, and biological techniques are still necessary for the union of synthetically synthesized chains of nucleotides. The scientific community’s interest in this issue is so meaningful that in 2012 was created a journal exclusive for this theme in which researchers could report the successful cases in the study and manipulation of viral genomes. In this chapter we discuss about the main elements of the viral genomes, as well as modern techniques for sequencing and manipulating these genomes, concluding with an approach about the concepts of synthetic biology and examples of success in the synthesis of synthetic viral genomes reported throughout the world.

ESSENTIAL ELEMENTS OF VIRAL GENOMES Essential Genes In the cells and viral particles, the constancy of genetic networks form biological networks, which act synergistically to perform various metabolic functions (Figure 1) (Riccione et al.

Synthetic Synthesis of Viral Genomes

2133

2012). Thus, a major goal of Cellular Biology is to understand how these complex networks culminate in the observed cellular behaviors. One of the most used method to assess a gene function or genetic network is based on the isolation of mutants unable to complete a particular pathway. The mutations in the viral genomes can interfere with a range of properties of these particles such as infectivity, the type of lysis plaque formed by them, their host range, or the physicochemical properties of the particles. However, the production of lethal mutations generates unviable virions, thus making them undetectable. Strategies based on synthetic biology to study genetic circuits or viral motifs gene can be a solution to this problem. Thus, to obtain more complex circuitry is necessary to know which genes confer essential characteristics to each organism, which has led to a large number of studies devoted to this subject (Little 2010).

Figure 1. The more complex circuits have various integrated routes. Synthetic biology allows reconstructing parts of these circuits with different purposes, such as the study of these genes, the production of metabolites and control of cell populations (adapted from Riccione et al. 2012).

Viruses have high genetic diversity, ranging from extremely simple genomes, such as that of porcine circovirus, which has a circular genome of only 1.7 nucleotides and three Open Reading Frames (ORFs) (Figure 2), till extremely large genomes, such that of mimivirus, which genome codes for more than 900 ORFs (Abrescia et al. 2012). There is not a universally conserved gene among all viruses. However, some genes that encode proteins required for replication and particle formation are present in all members in a group (Dolja & Koonin 2011). Although there is similarity between sequences of the viral genomes analyzed until now, surprisingly the vast majority of sequences of viruses present in ocean has low similarity to known viral sequences, finding greater similarity to bacterial genes, some involved in the main processes of the cellular metabolism. Two not mutually exclusive hypotheses could explain this issue, one based in the contamination of samples with bacterial DNA, raising the possibility of fails in that protocols of metagenomic analysis, and the other in the fact that our current knowledge on viral genomes is not representative of the current virome which makes oceans the main viromes on the planet (Kristensen et al. 2010).

Figure 2. (Continued).

Figure 2. Genomes with different degrees of complexity. A) PCV genome, the simplest viral genome known, composed of essential genes for replication (ORF1), virion assembly (ORF2) and host apoptosis (ORF3). B) UFV-P2 genome, with intermediate complexity and at least two transcription modules of replication and virion assembly and release. C) mimivirus genome presenting high complexity, possessing 1.2 Mb and more than 900 genes (Raoult et al. 2004).

2136

Monique R. Eller, Roberto S. Dias, Rafael L. Salgado et al.

Due to the great diversity of viral genomes and the distinct genetic needs between different viruses, there are no genes that are essential to all of them. However, two proteins are considered the minimum requirements for the existence of a viral particle - the viral capsid protein and - the viral polymerase. Although the genes encoding these proteins are highly variable among different groups, its existence is almost unanimous among known viral genomes. The other genes present in the viral genomes are components of transcription modules that vary between different virus groups and depend on the particle structure and their mechanism of infection/replication. Next are cited groups of some viruses and their basic replication machinery. 1. Bacteriophages as well as plasmids, can be considered genetic elements, motile or not, present in prokaryotic cells. Once internalized, the genomes of these viruses are called prophages or replicons, and replicate intracellularly by the "replicon model" using key regulatory elements that interact with an origin of replication (Ori). The replication of linear viral genomes composed of dsDNA seems to be simple, despite its unidirectional mechanism of initiation, which leads to the loss of a portion of the genome in each replication cycle. Evolutionary studies showed that phages found at least four different mechanisms to address this issue: 1 - The Bacillus subtilis phage Φ29 proteins uses specific proteins as portable primers, which remain covalently attached to the ends of the viral genome; 2 - The Escherichia coli phage T7 possess direct repeats at the terminal ends of its genome, which are regenerated by the processing of its concatamers by enzymes called terminases during the packing of monomeric genomes, 3 – The Escherichia coli phage N15 regenerates the ends of its linear double-stranded DNA by the action of the specialized enzyme protelomerase, similarly to what happens for eukaryotic genomes by the enzyme telomerase, 4 - linear genomes of some phages are circularized after its injection into the host, while others are integrated into the host chromosome in the form of prophage. 2. The porcine circovirus (PCV) are small, icosahedral viruses with approximately 17 nm in diameter and composed of a circular ssDNA genome. Replication of the genome of PCV-1 is made by rolling circle (RCR) mechanism, which is widely used by phages, plasmids, animal viruses and phytoviruses (Cheung 2012). The PCV have two opposing ORFs from the Ori region. The ORF1 is transcribed and processed, giving rise to the Rep proteins (Rep and Rep ‘) related to viral replication. ORF2 is present in the complementary strand and is responsible for the synthesis of the viral capsid protein (Cheung 2012). The ORF3 was recently characterized as a non-structural protein, not essential for replication in cell cultures, and with a major role in the induction of apoptosis by activating the initiation of the via of caspase 8 and caspase 3in the host (Liu et al. 2005). 3. Viruses of the Flaviviridae family have linear genomes consisting of single stranded RNA (ssRNA) with positive polarity, what means that it can be transcribed immediately after its entry into the host cell. These genomes are transcribed as a single polyprotein, which is cleaved generating the viral structural and non-structural proteins. Among these is the NS5 protein, a RNA-dependent RNA polymerase (RdRp), which is essential for the phage genome replication, since natural animal cells do not possess this enzyme. A second element essential to the replication of these viruses is the sequences for cyclization, present in the terminal ends of their genomes.

Synthetic Synthesis of Viral Genomes

2137

Recent studies show that the RdRp binds to the clamp formed after genome circularization and initiates its replication by synthesizing the negative strand RNA, which is the replicative intermediate of flaviviruses (Malet et al. 2008). 4. Until the discovery of mimiviruses, the concept of viruses was based on the filtration of solutions in membranes with 500 nm pores. However, mimivirus have a diameter of about 750 nm, beyond fibrils, which made this definition improper. Although little is known about the different stages of mimiviruses infection, it is known that their 981 genes characterize them as the first known viruses with complex genomes similar to other intracellular bacterial parasites. In addition, these viruses were the first in which components of the system of protein synthesis were observed, such as amino-acyl tRNA synthetases (Claverie & Abergel 2010). In addition to size and complexity of its genome, the mimivirus are characterized by a high gene density (90.5%), with something like 1262 ORFs, and of these 298 have function assigned to several central functions of cellular metabolism, ranging from the amino acid metabolism and transport, translation and post-translational modifications.

Organization and Modulation of Viral Genomes The evolution of the viral particles led to the mobile interchangeable elements, known as modules, which carry specific biological functions. Thereby, viruses found ways to adapt their genomes to different niches through the combination of different modules. A detailed comparison of two genomes from phages belonging to different niches may shows similarities in genetic organization, although containing alternating regions of high and low sequence similarity (Botstein 1980). The high degree of conservation in the ordering of functional genes into transcriptional modules is evident, allowing the inference of functional proteins by comparing the gene sequences using bioinformatics (Veesler & Cambillau 2011). Furthermore, the homology in the organization of modules in phages from different families enables the establishment of hybrids between them. The genetic modules have two basic characteristics: the efficient conducting of their biological functions and their ability to permute among genomes. Both features define the frequency at which each module is inserted (or lost) in a genome, and this decision is mainly related to the functional compatibility of a module with a variety of combinations with the other essential modules present in the genome of an organism. Thus, the presence/absence of specific viral modules in the genomes may be also indicative of the phylogenetic distance of viral hosts. Lawrence and coworkers proposed that the prophages and phage genomes could be described as an assembly of several genetic modules, which tend to remain associated independently of the recombinant nature of their genomes (Lawrence et al. 2002). Therefore, these modules can been classified according to the functions of their inner genes, as occurs in the modules of adsorption, replication, regulation, recombination, capsid, basal plate, proteins forming contractile tails, proteins forming long non-contractile tails, tail fibers, lysis, integration, excision and pathogenesis (Toussaint et al. 2007; Lima-Mendez et al. 2011). The classification of viruses can be performed by the analysis of evolutionarily conserved modules (ECM). Some ECMs appear to be specific to certain types of phages, host groups, or type of infective cycle. For example, the ECM17 is composed of two sub-modules, the first of integration/regulation, which are real markers for integrative phages, and the replicative module

2138

Monique R. Eller, Roberto S. Dias, Rafael L. Salgado et al.

found in Gram-positive-infecting phages (Pellegrini et al. 1999; Lima-Mendez et al. 2011). Recently, a software was developed based on this type of classification and was named Phage Classification Tool Set - PHACTS, which uses genomic analysis to predict the infective cycle of different phages (McNair et al. 2012).

METHODOLOGIES FOR GENOMIC MANIPULATION The term Synthetic Biology was first described in 1910, by Leduc, S. (Stéphane Leduc 1910). This technology has enabled the development of cells and biological devices with features molded according to a number of different interests. This has led to a demand for more dynamic, simple, and cost effective new technologies of DNA synthesis and sequencing (T K Lu & J J Collins 2007).

Genomic Sequencing The first regulatory circuits were discovered over 40 years and consisted of a feedback inhibitors of amino acidic biosynthetic pathways (Westerhoff & Palsson 2004). The discovery, production and commercial viability of restriction enzymes, and the standardization of techniques as molecular cloning constituted major advances in the 70s, allowing the emergence of technologies such as Genetic Engineering and Biotechnology. Already in the 1980s some of the fundamental experimental approaches of Molecular Biology were developed and improved, and in the mid 90’s the first automated DNA sequencers were glimpsed, leading the genetic sequencing to the genomic scale. The automation, miniaturization and multiplexing of multiple trials led to the generation of additional types of "omic" data, such as metabolomics, proteomics, and genomics (Westerhoff & Palsson 2004; Hunkapiller et al. 1991; Rowen et al. 1997; Uetz et al. 2000). The first methodology for sequencing DNA was the chemical method of Sanger, in which labeled modified nucleotides are used for reading the template DNA during amplification. The Human Genome Project was performed by a variation of this method, the shotgun sequencing, in which the DNA is mechanically or enzymatically broken and the fragments generated are cloned and individually sequenced. After obtaining individual sequences, these are then overlapped for the assembly of the entire genome. The new sequencing methodologies known as next generation sequencing (NGS) are based on this principle, performing random reads throughout the genome and assembling the fragments generated by overlapping (J. Zhang et al. 2011). However, the number of bases that can be continuously read by NGS methods is very small when compared to Sanger, what is the major limitation of these methods since they generate a very large amount of data, making their processing difficult and time-consuming. Some of these new platforms are described below: 1. Roche GS-FLX 454 – It was as the first commercial sequencing platform, introduced in 2004, and has as main advantage the generation of the larger fragments among the NGS platforms. The key process is based on mixing the reactants for amplification in an emulsion. Inside the micelles, the amplification is performed in DNA-binding

Synthetic Synthesis of Viral Genomes

2139

beads. In this platform, the DNA is read through pyrosequencing, in which light is emitted and recorded when each nucleotide is incorporated by the polymerase during the fragment amplification. 2. Illumina - It was the second platform to be commercialized and is currently the most used due to its lower costs. This platform is also based on the sequencing by synthesis, in which DNA fragments are attached to fixed supports via adapters (oligo-primed). These oligo-adapters are also used to amplify the free end of the DNA fragment, thus generating clusters of identical fragments. The amplifications using terminators nucleotides labeled generate signals that are interpreted and give rise to the sequence of each fragment. 3. SOLiD - This platform is based on sequencing by ligation, in which the templates are attached to microspheres in emulsions and combined with universal sequencing primer, the enzyme ligase, and fluorescent probes. Sequencing occurs by hybridization of such fluorescent probes with the target fragment through several steps using different combinations of universal primers. In the last two years new genetic sequencing platforms were presented and called third generation sequencing. One of them is based on changes in electric current generated by the passage of DNA in nanopores, with an ability to read million bases per hour. A second method is based on the variation of electrical conductance of a solution, which occurs due to the polymerase addition of nucleotides to the chain of nucleic acids, presenting processivity about 22 nucleotides per second (Y. S. Chen et al. 2013; Radford et al. 2012; Eisenstein 2012).

Genetic Manipulations The mutations in the phage genomes may be obtained from the use of physical agents such as ultraviolet light, chemical mutagens, or by recombinant DNA technology. These techniques allow changing specifically or randomly the sequences of nucleotides that compose the viral genomes, thus generating particles with different characteristics in relation to the wild ones. For example, the technique of DNA shuffling allows the random recombination of fragments between homologous genes, thereby generating a series of particles with different versions of a particular gene. On the other hand, error prone PCR is a technique of inducing errors during amplification of a specific gene, generating directed punctual mutations. Homologous recombination has also been used for deleting genes or obtaining recombinant phages. The technology known as recombineering allows the introduction of in vivo changes, such as knock outs, deletions, insertions, or point mutations, in a genome. Yu and coworkers reported the development of a transformation system of Escherichia coli genome by inserting the recombination system of the phage λ (Exo and Beta) in the recombination system RecBCD (Marinelli et al. 2012; Yu et al. 2000). The chemical synthesis of nucleotide sequences led to a race of biotechnology companies for more efficient ways to synthesize genetic material with increasing amounts of nucleotides, making it possible to sell affordable gene sequences. Currently, it is possible to a researcher to purchase gene sequences as large as 10,000 base pairs with a delivery time of about a month! The high-throughput DNA syntesis technology provides to researchers a new and important tool. However, the big question still lies in correctly performing the biological question to be

2140

Monique R. Eller, Roberto S. Dias, Rafael L. Salgado et al.

answered by this tool, which can be facilitated by detailed study and mathematical modeling of the known genetic circuits. The chemical modification of nucleotides and the generation and study of isolated circuits offer a way to study independently the influence of circuits in natural pathways without disturbing the other components of the metabolism. Some of these circuits have been used in useful tasks, such as control of cell populations, decision making for biosensors, genetic timer for fermentation processes, and image processing. More recently these circuits have been used to solve medical and industrial solutions such as for the development of bacteria capable of invading cancer cells, for the dispersion of bacterial biofilms by engineered phages, as well as for the production of precursors of anti-malarial drugs for the generation of synthetic microbial routes. However, in such cases, engineered organisms have a single modified gene circuit, which does not include the potential offered by synthetic biology, so showing a discrepancy between the simplicity of these genetic circuits and the promise of assembly of these circuits in complex genetic networks (T K Lu et al. 2009). Although there are no limitations on the number of new circuits to be built, the number of interoperable and well-characterized parts hampers the development of more complex biological systems, thus creating a constant need to expand the set of available tools. This limits our ability to build truly modular circuits and highlights the need for an accurate characterization of the interactions between the different components of these systems so that negative interactions are minimized (T K Lu et al. 2009).

SYNTHESIS OF NEW VIRAL GENOMES The beginning of the study and synthesis of genetic circuits evolved the manipulation of the genetic material of most organisms by a series of restriction enzymes, recombination and amplification reactions, and the expression of heterologous proteins in foreign systems. While these techniques are now used routinely in laboratories around the world, the need for templates for genetic manipulation and the high complexity of the regulatory system of the host led to the need to synthesize de novo genomes, from which it would be possible to predict the interactions between different genetic components. Thus, the chemical synthesis of long polymer chains of nucleotides and the construction and maintenance of DNA libraries have favored the emergence of this new way of creating and manipulating entirely new biological systems. The synthesis and manipulation of genes for their insertion or deletion in the genomes is already a strategy routinely used in different fields of science, for example, in elucidating metabolic pathways, in discovering gene function, or to genetic improvement. However, the synthesis of new genomes without templates has been done only since the last decade, and the increasing knowledge on the functions of regulatory sequences have contributed to the synthesis of larger and more complex genomes, with increasingly predictable and rational designs. An example was the synthesis de novo of a bacterial genome in 2010 (Gibson et al. 2010). While the synthesis of genes considered natural and proximal regulatory aspects, the genomic synthesis should consider the different regulatory elements contained in the entire genome, the interactions between them, and the products of the different genes. This is only possible from a consolidated knowledge about the viral genomes, its function and modulation.

Synthetic Synthesis of Viral Genomes

2141

Genetic Circuits Synthetic biology integrates the techniques of molecular biology to the principles of engineering, computer sciences, and mathematical models. From this integration, it is possible to design and construct genetic circuits that enable living cells to perform new functions. The term genetic circuitry has been widely used to refer to well-defined sequences of genetic material that, together, perform specific functions when transcribed. This concept is directly related to the rational construction of genomes with predefined characteristics. A large number of genetic circuits have been developed, most of them switches, oscillators, digital logic gates, filters, modular and interoperable memory devices, counters, sensors and protein scaffolds (Timothy K Lu 2010). By using these circuits is possible to predict, at least partially, the features and biological modulations of synthetic viral particles, which can be manipulated to present characteristics desirable in relation to the functions for which they are used. In the future, researchers envision that, by analogy to electronic circuits, it will be possible to generate viral particles programmable from the generic combination of genetic circuits which, when combined, generate an predictable phenotype (Ferber 2004). For this, it is necessary to develop well-defined stages of construction, monitoring and debugging and setting of these circuits.

Monitoring the Expression of Genetic Elements Practices methodologies of large-scale monitoring of the expression of circuits are essential for the development of efficient networks and for obtaining reliable and reproducible results. These techniques are mainly based on the detection of reporter elements - molecules whose concentration is proportional to the expression of the target gene, as mRNAs and proteins. there are many methods based on this concept, but the optimal methodology for monitoring gene circuits, although it is dependent on the circuit involved, may generate strong signals with low noise, present specificity, low cost, non-invasiveness, multiplexability, and, if possible, generate dynamic real-time signals (Timothy K Lu 2010). It is possible to monitor a circuit for analyzing the total protein content of an organism without the need for a reporter element. However, this method is nonspecific and often non- accepted for the quantitative determination of expression, and thus does not significantly contribute to the understanding of these circuits. Thus, some macromolecules are frequently used as reference detectors agents. Initial studies relied on the determination of the promoter activity by the simple fusion of the promoter plus the gene of interest with a particular reporter gene. These systems are very effective and used in a number of systems, although the scientists still search for alternatives that are less invasive, cheaper and applicable to a larger number of systems.

Colorimetric Assays The colorimetric assays for monitoring protein expression consist of simple but inaccurate techniques. These assays are based mainly on the co-expression of the gene of interest with an auxiliary gene encoding a colored product, or an enzyme capable of generating products detectable in visible light and therefore measurable. For example, one of the first systems used for reporter gene expression was based on colorimetric assays involving the enzyme βgalactosidase (β-gal) encoded by the gene lacZ in the lac operon in Escherichia coli. Cleavage

2142

Monique R. Eller, Roberto S. Dias, Rafael L. Salgado et al.

of galactosidic substrates by this enzyme generates colored products whose concentration can be measured in a spectrophotometer and is proportional to the amount of enzyme. Thus, the expression of the genes of interest under the promoter of the lac operon can be tracked by monitoring the expression of the β-gal gene. Advantages of this method include its simplicity and low cost, in addition to the vast knowledge about the parameters that could influence the results. Among the main disadvantages are sharing of a promoter, low precision and low reproducibility.

Green Fluorescent Protein (GFP) The production and detection of fluorescent proteins is already a practical and well characterized technology for sensing and monitoring protein expression of genetic circuits. Furthermore, this technology is not specific and can be applied to a variety of circuits. The cloning of the GFP gene from jellyfish (Aequorea victoria) in heterologous systems allows monitoring of its expression via the emission of green fluorescence by the protein after excitation by blue or UV light. For this, scientists couple the gene coding for this protein to the gene of interest using an expression systems and, thus, are able to quantify it and even to locate it in various systems. However, because it is a protein, intrinsic and extrinsic factors involved in its stability, conformation and interactions with various components of the cell may interfere with the accuracy of the methodology. The main advantage of using this protein is the possibility of in vivo and in real time monitoring, without the need for extraction steps or destruction of the particle. Luminescence The systems for monitoring protein expression via luminescence emission are based on exothermic reactions that emit luminescence. The main example is undoubtedly those that uses the enzyme luciferase expressed by the luc gene, cloned from the genome of firefly (Photinus pyralis). This enzyme catalyzes the oxidation of luciferin in the presence of ATP, Mg2+ and O2, generating a light signal that is proportional to the amount of the enzyme. Systems based on luminescence present high sensitivity, speed and are relatively inexpensive. However, in the same way using GFPs, the results depend on the efficiency of the maintenance of the enzymatic activity by stabilizing the system conditions. Specifically, these system also present a great sensitivity to variations in ATP concentrations, which can make their use unfeasible in some cases. Aptamers Aptamers are fragments of macromolecules, specially nucleic acids, that are capable of specifically recognizing and detecting proteins. However, their in vivo use has not been widely applied to the monitoring of genetic circuits because the algorithms that could safely predict the binding affinity between aptamers and the proteins of interest would be extremely specific and therefore not viable, since they are not applied to different cases. However, alternatives that use these molecules also can be developed for detection of proteins in several different systems.

Synthetic Synthesis of Viral Genomes

2143

Detection of Cellular mRNAs The amplification of the mRNA for quantitation of the expression of certain genes constitutes a simple and well-characterized technique for monitoring the expression of genes contained in genetic circuits and governed by different modulators. However, besides not being an accurate picture of the protein content of the host, thus excluding the translational stages, techniques for detecting nucleic acids require the extraction of this material and consequently the destruction of the cells analyzed. This is therefore an invasive technique and impractical for real time analyses. The detection of RNAs by fluorescent proteic probes can be an alternative to these issues, but requires that the RNA of interest are modified so that it can specifically bind to the probe.

Debugging The number of genetic circuits that have presented unexpected results is still very high. This is due to our still limited knowledge about the different parameters involving biological circuits for the synthesis of viral genomes, and the interactions between the components of these circuits and the machinery of the host. In addition, living organisms do not respond linearly according to its components due to the co-operability between molecules, which makes even more challenging to develop predictive mathematical models for these systems. The debugging of genetic circuits involves the detailed characterization of these systems, all available nodes, modifications by trial and error to characterize the interactions between the molecules involved, and specific modeling.

EXAMPLES OF PROJECTS ON SYNTHETIC GENOMES 1. Bacterial gene circuits: In 2004, the group of researchers leaded by Hideki Kobayashi and colleagues engineered genetic circuits coupled to the cellular machinery of an E. coli strain. For this, they inserted plasmids containing a gene essential for biofilm formation under the control of a repressor regulated by RecA protein, which is responsible for mediating the SOS response. The circuit designed was capable of responding to biological signals (damage to genomic DNA) in a predictable and programmable way, so that cells formed biofilm when stimulated. With this, the researchers showed that the genetic circuits can be used to program bacterial cells, through coupling these circuits to the interactions networks of the cell itself (Kobayashi et al. 2004). 2. Synthetic viral genomes: Aiming the degradation of bacterial biofilms, American researchers engineered the genome of bacteriophage T7, an E. coli-specific phage, in which they inserted the gene for the enzyme dispersin B, which is able to reduce biofilms of different species of bacteria. The gene was inserted under the control of the T7phi10 promoter, so that the enzyme was expressed during infection of the phage and thus released after bacterial lysis. The engineered phage was about two orders of magnitude more efficient in degrading the biofilm matrix as compared to the wild phage (T K Lu & J J Collins 2007).

2144

Monique R. Eller, Roberto S. Dias, Rafael L. Salgado et al.

3. Synthetic viral genomes: using tools of synthetic biology, Paul R. Jaschke and colleagues recently published a study aiming establish methods enabling the synthesis, assembly, and recovery of a bacteriophage genome via yeast. They used the bacteriophage øX174 given its small circular genome with 5386 nucleotides that codes 11 gene products with overlapping open reading frames. The researchers questioned whether this overlap was essential or might be eliminated. For this, they synthesized a 6302 nucleotide synthetic genome separating all ORFs and their regions of translational control. The synthesis of the synthetic genome was performed by a combination of two different strategies: chemical synthesis and PCR amplification. For the synthetic genome was reduced to the exact size of the wild genome, the F gene, which encodes the coat protein, was truncated. The researchers were able to recover infective virions containing the truncated and decompressed genome from replication cycles in E. coli expressing the F gene under an inducible promoter. These results indicate that the overlap of genes in the genome of this phage is probably just a tool for genome compaction to facilitate its packaging into the viral particles, but is not necessary for the virions viability (Jaschke et al. 2012).

PROSPECTS Although gene manipulation and processing of viral genomes are already routinely used in laboratories for the modification of viral characteristics, the development of entirely new synthetic genomes without the use of templates and considering the genetic circuits as an unit for assembly of genomes, comprises a new theme and is still relatively obscure. The hurdles to predict and forecast the synergistic behavior of these circuits lead to security issues that must be answered before this method becomes popular. This only will be possible from the knowledge on the interactions between the different components of this circuit, and the monitoring and debugging of the already created circuits in order to increase the existing mathematical models and algorithms to optimize the predictability of these systems. Even so, the creation of entirely new viral genomes is considered one of the most promising technologies for the development of new methods of genetic transfer and recombination, for the generation of new more specific and efficient antimicrobials, for the planning of new vaccines and specific antiviral drugs with lower side effects, and also for the detection of microorganisms in various industrial and hospital environments, where strict control of the microbial population is essential.

CONFLICT OF INTEREST None of the authors of this paper has a financial or personal relationship with other people or organizations that could inappropriately influence or bias the content of this chapter.

Synthetic Synthesis of Viral Genomes

2145

ACKNOWLEDGMENT This work was supported by Brazilian funding agencies CNPq and FAPEMIG.

REFERENCES Abrescia, N. G. et al. (2012). Structure unifies the viral universe. Annual review of biochemistry, 81, 795–822. Available at: http://www.ncbi.nlm. nih.gov/pubmed/ 22482909. Botstein, D. (1980). A theory of modular evolution for bacteriophages. Annals of the New York Academy of Sciences, 354, 484–490. Available at: http://www.ncbi.nlm.nih.gov/ pubmed/6452848. Chen, Y. S. et al. (2013). DNA sequencing using electrical conductance measurements of a DNA polymerase. Nature nanotechnology. Available at: http://www.ncbi.nlm.nih.gov/ pubmed/23644569. Cheung, A. K. (2012). Porcine circovirus: transcription and DNA replication. Virus research, 164(1-2), 46–53. Available at: http://www.ncbi.nlm. nih.gov/pubmed/22036834. Claverie, J. M. & Abergel, C. (2010). Mimivirus: the emerging paradox of quasi-autonomous viruses. Trends in genetics : TIG, 26(10), 431–437. Available at: http://www.ncbi.nlm. nih.gov/pubmed/20696492. Dolja, V. V & Koonin, E. V. (2011). Common origins and host-dependent diversity of plant and animal viromes. Current opinion in virology, 1(5), 322–331. Available at: http://www.ncbi.nlm.nih.gov/pubmed/ 22408703. Eisenstein, M. (2012). Oxford Nanopore announcement sets sequencing sector abuzz. Nature biotechnology, 30(4), 295–296. Available at: http://www.ncbi.nlm.nih.gov/pubmed/ 22491260. Ferber, D. (2004). Synthetic biology. Microbes made to order. Science (New York, N.Y.), 303(5655), 158–61. Available at: http://www.ncbi.nlm.nih. gov/pubmed/14715986 [Accessed March 11, 2013]. Gibson, D. G. et al. (2010). Creation of a bacterial cell controlled by a chemically synthesized genome. Science (New York, N.Y.), 329(5987), 52–6. Available at: http://www.ncbi.nlm. nih.gov/pubmed/20488990 [Accessed February 27, 2013]. Hunkapiller, T. et al. (1991). Large-scale and automated DNA sequence determination. Science, 254(5028), 59–67. Available at: http://www.ncbi. nlm.nih.gov/pubmed/1925562. Jaschke, P. R. et al. (2012). A fully decompressed synthetic bacteriophage øX174 genome assembled and archived in yeast. Virology, 434(2), 278–84. Available at: http://www.ncbi.nlm.nih.gov/pubmed/23079106 [Accessed May 15, 2013]. Kobayashi, H. et al. (2004). Programmable cells: interfacing natural and engineered gene networks. Proceedings of the National Academy of Sciences of the United States of America, 101(22), 8414–9. Available at: http://www.pubmedcentral.nih.gov/article render.fcgi?artid=420408&tool=pmcentrez&rendertype=abstract [Accessed March 18, 2013].

2146

Monique R. Eller, Roberto S. Dias, Rafael L. Salgado et al.

Kristensen, D. M. et al. (2010). New dimensions of the virus world discovered through metagenomics. Trends in microbiology, 18(1), 11–19. Available at: http://www.ncbi.nlm. nih.gov/pubmed/19942437. Lawrence, J. G., Hatfull, G. F. & Hendrix, R. W. (2002). Imbroglios of viral taxonomy: genetic exchange and failings of phenetic approaches. Journal of bacteriology, 184(17), 4891– 4905. Available at: http://www.ncbi.nlm. nih.gov/pubmed/12169615. Lima-Mendez, G., Toussaint, A. & Leplae, R. (2011). A modular view of the bacteriophage genomic space: identification of host and lifestyle marker modules. Research in microbiology, 162(8), 737–746. Available at: http://www.ncbi.nlm.nih.gov/pubmed/ 21767638. Little, J. W. (2010). Evolution of complex gene regulatory circuits by addition of refinements. Current biology : CB, 20(17), R724–34. Available at: http://www.ncbi.nlm.nih.gov/ pubmed/20833317. Liu, J., Chen, I. & Kwang, J. (2005). Characterization of a previously unidentified viral protein in porcine circovirus type 2-infected cells and its role in virus-induced apoptosis. Journal of virology, 79(13), 8262–74. Available at: http://www.pubmedcentral.nih.gov/ articlerender.fcgi?artid= 1143760&tool=pmcentrez&rendertype=abstract [Accessed May 17, 2013]. Lu, T. K. & Collins, J. J. (2007). Dispersing biofilms with engineered enzymatic bacteriophage. Proceedings of the National Academy of Sciences of the United States of America, 104(27), 11197–11202. Available at: http://www.ncbi.nlm.nih.gov/pubmed/ 17592147. Lu, T. K., Khalil, A. S. & Collins, J. J. (2009). Next-generation synthetic gene networks. Nature biotechnology, 27(12), 1139–1150. Available at: http://www.ncbi.nlm.nih.gov/ pubmed/20010597. Lu, Timothy K. (2010). Engineering scalable biological systems. Bioengineered bugs, 1(6), 378–84. Available at: http://www. pubmedcentral.nih.gov/articlerender.fcgi?artid= 3056087&tool=pmcentrez&rendertype=abstract [Accessed April 3, 2013]. Malet, H. et al. (2008). The flavivirus polymerase as a target for drug discovery. Antiviral research, 80(1), 23–35. Available at: http://www. ncbi.nlm.nih.gov/pubmed/18611413. Marinelli, L. J., Hatfull, G. F. & Piuri, M. (2012). Recombineering: A powerful tool for modification of bacteriophage genomes. Bacteriophage, 2(1), 5–14. Available at: http://www.ncbi.nlm.nih.gov/pubmed/22666652. McNair, K., Bailey, B. A. & Edwards, R. A. (2012). PHACTS, a computational approach to classifying the lifestyle of phages. Bioinformatics, 28(5), 614–618. Available at: http://www.ncbi.nlm.nih. gov/pubmed/22238260. Pellegrini, M. et al. (1999). Assigning protein functions by comparative genome analysis: protein phylogenetic profiles. Proceedings of the National Academy of Sciences of the United States of America, 96(8), 4285–4288. Available at: http://www.ncbi.nlm.nih.gov/ pubmed/10200254. Raoult, D. et al. (2004). The 1.2-Mb Genome Sequence of Mimivirus. Science, 306, 1344-1350. Available at: http://www.ncbi.nlm.nih.gov/pubmed/ 15486256 [Accessed May 24, 2013]. Radford, A. D. et al. (2012). Application of next-generation sequencing technologies in virology. The Journal of general virology, 93(Pt 9), 1853–1868. Available at: http://www.ncbi.nlm.nih.gov/pubmed/22647373.

Synthetic Synthesis of Viral Genomes

2147

Riccione, K. A. et al. (2012). A synthetic biology approach to understanding cellular information processing. ACS synthetic biology, 1(9), 389–402. Available at: http://www.ncbi.nlm.nih.gov/pubmed/23411668 [Accessed March 7, 2013]. Rowen, L., Mahairas, G. & Hood, L. (1997). Sequencing the human genome. Science, 278(5338), 605–607. Available at: http://www.ncbi.nlm.nih.gov/ pubmed/9381170. Stéphane Leduc (1910). Théorie Physico-Chimique de la Vie et Générations Spontanées, [Physico-Chemical Theory of Life and Spontaneous Generations]. 1st ed. A. Poinat Editer, ed., Paris. Toussaint, A., Lima-Mendez, G. & Leplae, R. (2007). PhiGO, a phage ontology associated with the ACLAME database. Research in microbiology, 158(7), 567–571. Available at: http://www.ncbi.nlm.nih. gov/pubmed/17614261. Uetz, P. et al. (2000). A comprehensive analysis of protein-protein interactions in Saccharomyces cerevisiae. Nature, 403(6770), 623–627. Available at: http://www.ncbi. nlm.nih.gov/pubmed/10688190. Veesler, D. & Cambillau, C. (2011). A common evolutionary origin for tailed-bacteriophage functional modules and bacterial machineries. Microbiology and molecular biology reviews : MMBR, 75(3), 423–33, first page of table of contents. Available at: http://www.ncbi.nlm.nih.gov/pubmed/21885679. Westerhoff, H. V. & Palsson, B. O. (2004). The evolution of molecular biology into systems biology. Nature biotechnology, 22(10), 1249–1252. Available at: http://www.ncbi.nlm. nih.gov/pubmed/15470464. Yu, D. et al. (2000). An efficient recombination system for chromosome engineering in Escherichia coli. Proceedings of the National Academy of Sciences of the United States of America, 97(11), 5978–5983. Available at: http://www.ncbi.nlm.nih.gov/pubmed/ 10811905. Zhang, J. et al. (2011). The impact of next-generation sequencing on genomics. Journal of genetics and genomics = Yi chuan xue bao, 38(3), 95–109. Available at: http://www. pubmedcentral.nih.gov/articlerender. fcgi?artid=3076108&tool=pmcentrez&rendertype= abstract [Accessed February 28, 2013].

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 100

NOVEL BIOINFORMATICS METHOD TO ANALYZE MORE THAN 10,000 INFLUENZA VIRUS STRAINS EASILY AT ONCE: BATCH-LEARNING SELF ORGANIZING MAP (BLSOM) Yuki Iwasaki1,2, Toshimichi Ikemura1, Kennosuke Wada1, Yoshiko Wada1,3 and Takashi Abe1,4, 1

Nagahama Institute of Bio-Science and Technology, Research Fellow of the Japan Society for the Promotion of Science, 3 Shiga University of Medical Science, Shiga, Japan 4 Niigata University, Niigata, Japan

2

ABSTRACT With increase of microbial and viral genome sequence data obtained from highthroughput DNA sequencers, novel tools are needed for comprehensive analyses of the big sequences data. An unsupervised neural network algorithm, Self-Organizing Map (SOM), is an effective tool for clustering and visualizing high-dimensional complex data on a single map. We previously modified the conventional SOM for genome informatics on the basis of batch-learning SOM (BLSOM), by making the learning process and resulting map independent of the order of data input. Influenza virus is one of zoonotic viruses and shows clear host tropism. Important issues for bioinformatics studies of influenza viruses are prediction of genomic sequence changes in the near future and surveillance of potentially hazardous strains. To characterize sequence changes of influenza virus genomes after invasion into humans from other animal hosts and to study molecular evolutionary processes of their host adaptation, we have constructed BLSOMs for oligonucleotide, codon, amino-acid, and peptide compositions in all genome sequences of influenza A and B viruses and found clear host-dependent clustering (self-organization) of the sequences. Viruses isolated from humans and birds differ in mononucleotide composition from each other. In addition, host-dependent oligonucleotide and peptide compositions that 

Corresponding Author’s Email: [email protected].

2150

Yuki Iwasaki, Toshimichi Ikemura, Kennosuke Wada et al.

cannot be explained with the host-dependent mononucleotide composition are revealed by these BLSOMs. Retrospective time-dependent directional changes of oligonucleotide compositions, which are visualized for human strains on BLSOMs, can provide predictive information about sequence changes of the newly invaded viruses from other animal sources. Basing on this host-dependent oligonucleotide composition, we have proposed a strategy for prediction of directional changes of virus sequences and for surveillance of potentially hazardous strains when introduced into human populations from nonhuman sources. Millions of genomic sequences from infectious microbes and viruses will become available in the near future because of their medical importance, and BLSOM can characterize such big data easily and support efficient knowledge discovery.

INTRODUCTION Due to the revolutionized advancement of decoding the genome sequences, their data have been growing into supermassive “big data” in the International DNA Data Banks, and therefore, large-scale data mining have become vital. The more the available information becomes larger, the more the rightfulness of the proposed model will become verifiable as long as the model is appropriate. At the same time, because of massive amounts of data available, analyzing only a limited part of the data should lead to an image of “the authors may have made convenient stories by extracting useful data for them”, especially when a novel discovery is publicized. It should be important to have a stance “all data belonging to a certain category have to be analyzed, even if the amount of the data is very large”. Therefore, in the post-genome era, the research that gets the picture of the whole will become increasingly important and the present chapter introduces a bioinformatics method suitable for this type of a large-scale analysis. In more detail, we introduce the studies to unveil the species-specific characteristics in the genome sequences by using “BLSOM” developed by our group [1, 2]. This BLSOM for oligonucleotide composition has been developed for genome informatics, on the basis of SOM (Self-Organization Map) originally established by Kohonen and his colleagues [3, 4]. Because BLSOM can analyze millions of sequences simultaneously, almost all known genome sequences have been clustered and analyzable on a single map [5]. GC% has been used for a long period as a fundamental parameter for phylogenetic classification of microbial genomes, including viral genomes, but the GC% is apparently too simple a parameter to differentiate a wide variety of microbial genomes. Oligonucleotide composition, on the other hand, can be used to distinguish the species even with the same GC%, because the oligonucleotide composition varies significantly among the genomes and is called ‘genome signature’ [6]. Previously, we have constructed BLSOMs for di-, tri-, or tetranucleotide composition in all genomic fragments (e.g., 10, 50 and 100 kb) derived from a wide range of prokaryotic and eukaryotic species and found that, without giving any information of species, most of the fragment sequence have been separated (self-organized) according to species [1, 2, 5]. Epidemics of influenza viruses have been frequently repeated among various animal species including birds and swine besides human. Given that the strains derived from nonhuman sources are also capable of infecting humans, it should be impossible to eradicate influenza viruses from the planet. Influenza virus has developed into a pandemic among humans at least four times (in 1918, 1957, 1968 and 2009), causing considerable damages.

Novel Bioinformatics Method …

2151

Virus requires many host factors (e.g., nucleotide, amino acid and tRNA pools and host proteins) when it grows; therefore, it inescapably depends on new host factors when causing a new infection to humans from other animal species. In such cases, the genome sequence of the virus will change to fit the new cellular environments including various host factors. If this view is correct, influenza viruses are likely to modify some part of the characteristics of their genome sequences depending on host, during epidemics in a new host. In other words, it enables us to predict, at least in part, the direction of sequence changes in the newly invaded virus, if we can properly find out the host-dependent characteristics of viral genome sequences. In this chapter we introduce examples of analysis on the host-dependent characteristics of influenza virus genome sequences, which is a key to conduct forecasting their sequence changes after changing hosts. In the previous study, we have attempted BLSOM analyses on viral genome sequences all available in that time [7]. Here, we introduce the BLSOM analysis, which includes the newly accumulated sequences and examine whether the directional changes proposed in the previous paper is actually observed in the sequences obtained after our previous paper. This type of confirmatory studies should be important to verify a novel bioinformatics method.

MATERIALS AND METHODS Viral Genome Sequences A total of 856,730 virus sequences analyzed in Figure 1 were obtained from the NCBI and a total of 12,370 influenza A and B virus strains analyzed in Figure 2 were obtained from the NCBI Influenza Virus Resource (http://www. ncbi.nlm.nih.gov/genomes/FLU/) [8].

Batch-Learning Self-Organizing Map (BLSOM) SOM is an unsupervised neural network algorithm that implements a characteristic nonlinear projection from the high-dimensional space of input data onto a two-dimensional plane [3, 4]. We modified the conventional SOM for genome informatics to make the learning process and resulting map independent of the order of data input on a basis of Batch-Learning SOM: BLSOM [1, 2, 9]. The initial weight vectors were defined by principal component analysis instead of random values. BLSOM learning for oligonucleotide composition was conducted as described previously [1,2]. BLSOM learning for synonymous codon usage and visualization of diagnostic codons for the category separation were conducted as described by Kanaya et al. [9]. BLSOM program was obtained from UNTROD, Inc. ([email protected]). Oligonucleotide composition is normalized for the sequence length and the normalized composition is used for BLSOM calculation. Mono-, di- or tri-amino acid composition in eight genes of influenza virus strains is calculated, and those of eight genes are summed up for each strain. The composition normalized with a total length is used for BLSOM calculation.

2152

Yuki Iwasaki, Toshimichi Ikemura, Kennosuke Wada et al.

RESULT Oligonucleotide BLSOM for All Virus Genome Sequences To explain the clustering powers of BLSOM for a large number of genome sequences from a wide variety of viruses, we have initially constructed BLSOM for di- and trinucleotide composition in all viral genome sequences currently available (ca. 860,000 sequences), which have been classified into 67 phylogenic families (Figure 1). Lattice points that contain sequences from one phylogenetic family are indicated in color, and those that include sequences from more than one family are indicated in black. A major portion is colored, which shows that a major portion of sequences is classified (self-organized) according to phylogenic family; 95 and 98% of viral sequences are located in colored lattice points on di- and tri-BLSOMs, respectively. Notably, no information in regard to phylotype has been given during the BLSOM calculation. It should also be mentioned that approximately one million sequences are analyzed simultaneously on one plane.

Figure 1. Oligonucleotide-BLSOMs for virus genome sequences. BLSOM has been constructed for dior trinucleotide composition (Di or Tri) in 856,730 viral genome sequences. Lattice points that include sequences from more than one phylogenetic family are indicated in black, and those containing sequences from a single phylotype are indicated in a color representing the phylotype: Arteriviridae (■), Bunyaviridae (■), Coronaviridae (■), Flaviviridae (■), Geminiviridae (■), Hepadnaviridae (■), Herpesviridae (■), Orthomyxoviridae (■), Paramyxoviridae (■), Picornaviridae (■), Potyviridae (■), Reoviridae (■), Retroviridae (■), Rhabdoviridae (■) and others (various colors not specified here).

Oligonucleotide BLSOM for Influenza Virus Genomes Over ten thousand genome sequences of influenza A and B virus strains are registered in the International Nucleotide Sequence Databases, even when we concern strains for which all eight segments have been sequenced. We have next constructed a tetranucleotide BLSOM for all influenza A or B strains registered in Influenza Virus Resource [8] in NCBI (Figure 2); for di- and trinucleotide BLSOMs, refer to our previous paper [7]. Because the direct target of natural selection is a virion containing a full set of eight genome segments, tetranucleotide frequencies in the eight segments are summed up for each strain and BLSOM is constructed with the summed frequency after normalization of a total nucleotide length of individual strains; this is because the length of genome sequences compiled by the Influenza Virus Resource differs slightly between strains (Figure 2). The present genome-level analysis should provide valuable information for characterizing individual strains, which may not be obtained by a

Novel Bioinformatics Method …

2153

gene-level analysis, primarily conducted with sequence homology searches used in phylogenetic tree analyses.

Figure 2. Tetranucleotide-BLSOM for influenza A and B virus genome sequences. (A) Tetranucleotide BLSOM (Tetra) has been constructed for 12,370 strains of influenza A and B virus strains. Lattice points containing sequences from strains isolated from more than one host are indicated in black, and those containing sequences from one host are indicated in a color: avian, red; human, green; swine, blue; equine, yellow; bat, grey; and influenza B strain, light blue. (B) Human subtype. On the tetraBLSOM presented in (A), each human virus subtype is specified in a color: H1N1, light blue; H1N1/09, dark green; H3N2, blue; H5N1, red; H7 and H9, pink; and other human subtype, green. (C) Occurrence levels of tetranucleotides, which are diagnostic for host-dependent clustering, are indicated with different levels of two colors: pink (high), green (low), and achromatic (intermediate) as described by Abe et al. [1].

Lattice points containing virus strains isolated from one host species are indicated in a color representing the host and those containing strains isolated from more than one host are in black. Though only oligonucleotide frequencies have been given during the BLSOM calculation, viral sequences are clustered (self-organized) according to host. Viruses are inevitably dependent on many host factors for their growth (e.g., pools of nucleotides, amino acids and tRNAs) and at the same time have to escape from antiviral host mechanisms such as antibodies, cytotoxic T cells, interferons, and RNA interferences [10-13]. Host-dependent clustering of viral sequences visualized on BLSOM should reflect this host dependency in their growth. In Figure 2B (Human Subtype), lattice points that contain human influenza A viruses of one subtype on the tetra-BLSOM (Figure 2A) are specified with one color representing the subtype. Among the 12,000 viral strains analyzed, approximately 3,000 strains correspond to the new pandemic H1N1 strain (H1N1/09) (dark green in Figure 2B), which has started its pandemics among humans around since April 2009. Although its origin is derived from avian strains, it has been infected to human via swine after genome segment reassortments. Interestingly, on BLSOM, they are located apart from seasonal human H1N1 or H3N2 strains (light blue or dark blue in Figure 2B) and surrounded by avian and swine territories (red and blue in Figure 2A and blank in Figure 2B). It can be possible that these H1N1/09 strains have not yet been best suited to growth under human cellular environments. We next investigate human virus subtypes other than the H1N1/09 (Figure 2B). Human seasonal H1N1 and H3N2 are clearly separated from each other; light and dark blue in Figure 2B. In addition, in contrast to H1N1/09 (dark green), human H5N1 strains (red in Figure 2B and mainly black in Figure 2A) are rather scattered within the avian territory (red in Figure 2A

2154

Yuki Iwasaki, Toshimichi Ikemura, Kennosuke Wada et al.

and blank in Figure 2B). This should show that the human H5N1 strains have jumped to humans but are not able to spread from human to human [12], and therefore, they have characteristics of avian viruses. These human H5N1 strains are more separated from the swine and human territories than H1N1/09 strains, and this difference may relate to their infection power in the human and swine populations. In the case of influenza B strains (light blue in Figure 2A and blank in Figure 2B), which have repeatedly caused epidemics only among humans, they form a territory more distant from the avian territory than that of human seasonal strains. This characteristic of influenza B strains will be discussed later.

Diagnostic Tetranucleotides Responsible for Host-Dependent Separation BLSOM provides a powerful ability to visualize diagnostic oligonucleotides responsible for the category-dependent clustering (the host-dependent clustering in this case). In order to study the oligonucleotides that may relate to host adaptation, we next identify diagnostic oligonucleotides for host-dependent separation on the tetranucleotide BLSOM. Six examples of diagnostic tetranucleotides for the host- dependent separation are presented in Figure 2C. A clear tendency is apparent; A- and U-rich oligonucleotides are more favored in humans than in avians (e.g., AUUA and AUUU); G- and C-rich oligonucleotides were more favored in avians than in humans (e.g., GAGG). This GC% effect was previously reported by Rabadan et al. [14]. However, GGCC and GGGG, which are composed only of G and/or C, are more favored in humans than in avians, and UCUU, a tetranucleotide rich in U, is preferred mainly in the avian territory. When we concern about interaction of viral RNAs (vRNAs and mRNAs) with various host factors (e.g., host proteins), oligonucleotide compositions, rather than the mononucleotide composition, will become important, because their interactions with host proteins primarily depend on oligonucleotide sequences in their sequences. This should also be true in considering escape processes from host antiviral mechanisms. To wrap up, oligonucleotide-BLSOM analyses of influenza viruses should provide valuable information of their host adaptation mechanisms (e.g., interactions of viral RNAs with host factors), which will become important for medical and pharmaceutical studies.

Chronological Changes Visualized for Human Viruses In Figure 3, we next explain chronological changes of human seasonal strains using the same tetranucleotide BLSOM; only the lattice points containing human strains are shown as done in Figure 2B. In addition, the territory of human seasonal H1N1 (except for H1N1/09) and H3N2 strains in the following period is separately displayed in brown and blue; H1N1 and/or H3N2 strains isolated in 1930-1957, 1968-1974, 1975-1989, 1990-1999, 2000-2005, and 2006-2012 are displayed in brown and blue, respectively, in the respective panel. The seasonal strains isolated in 1930-1957 and 1968-1974 (i.e., the beginning of the epidemic of H1N1 and H3N2, respectively) are seen near avian and/or swine strains (red and blue in Figure 2A and blank in Figure 3), which have been estimated as their origin. Human seasonal strains are seen moving away from the avian and/or swine territory since 1930 (for H1N1) and 1968 (for H3N2), indicating the directional change of their oligonucleotide composition after

Novel Bioinformatics Method …

2155

invasion into the human population. Therefore, at least from a specific point of view, genome sequence changes in the invader virus appear to be predictable, especially in an early stage of epidemics cycles. This has been found for H1N1/09 strains in our previous paper [7] even during the first one year, because of the high mutation rate and short generation time of influenza A viruses [12, 15]. To wrap up, BLSOM can visualize any categories of strains, in which experimental and medical groups will be interested, and therefore, has a power to visualize evolutionary histories of influenza viruses after invasion into new hosts. Influenza B has caused repetitive epidemics only among humans and can be considered as it has already been well adapted to human cellular environments. In order to examine numerically whether the tetranucleotide composition of human seasonal A strains are approaching that of Influenza B with time, we have calculated Euclidean distance between the average composition in influenza B strains and that in H1N1 or H3N2 strains isolated in each year (Figure 4A). Euclidean distance shows the distance in the multidimensional scale (256 dimension for tetranucleotide composition); the distance between the strains that own an identical oligonucleotide composition is 0 and, as the difference in the oligonucleotide composition grows, the distance becomes larger.

Figure 3. Chronological changes for seasonal human subtype strains. Seasonal human H1N1 and H3N2 strains that are isolated in the different period are separately marked in brown and blue, respectively.

The distance between the influenza B strain and either H1N1 (red + marks) or H3N2 (blue x marks) A strain has become smaller over time (Figure 4A), showing that the tetranucleotide composition in A strains has become analogous to that in B strain during the repeating pandemics among humans and directional changes have been accumulating in genome sequences in the seasonal A strains.

H17N10 Strains Isolated from Bat One of the most feared influenza viruses is the strain possessing antigen types, to which most humans do not possess antibodies, and therefore, the strains having caused epidemics in nonhuman sources (e.g., birds and pigs) attract attention.

2156

Yuki Iwasaki, Toshimichi Ikemura, Kennosuke Wada et al.

Figure 4. Euclidean distance between seasonal human A and B strains. (A) Euclidean distance of tetranucleotide composition between influenza B strain and human seasonal strain (influenza A strain). Euclidean distance between the average composition in influenza B strains and that in H1N1 (+) or H3N2 (×) strains isolated in each year is plotted. (B) Euclidean distance of tetranucleotide composition between the bat and human seasonal strains. Euclidean distance between the average composition in bat strains and that in H1N1 (+) or H3N2 (×) strains isolated in each year is plotted.

Influenza A viruses are categorized by the combinations of antigen types: 16 and 9 types of HA and NA, respectively. As a natural host, birds are capable of transmitting all of the 16×9=144 types of influenza A strains. During recent years, new H17N10 strains, which greatly vary from known influenza A strain, have been isolated from the bats in Republic of Guatemala and estimated as being separated from birds far into the past [16]. As previously mentioned, BLSOM have a power to focus on and visualize a specific category of strains with no difficulty, even massive amounts of strains are analyzed. When paying attention to the three bat strains on BLSOM (arrowed in Figure 2A), these are located near influenza B strains and thus far away from the territory of birds which should be their original sources. This indicates that these bat H17N10 strains have been well adapted to mammalian cellular environments during repetitive epidemics in the mammalian host. So far judged from locations on BLSOM, cellular environments of human and bat appear to resemble each other, because human influenza B and bat A strains are located in a close vicinity. Next, this prediction has been numerically checked, as done for the human influenza B strain in Figure 4A. In Figure 4B, we have plotted the Euclidean distance between the average composition in three bat H17N10 strains and that in H1N1 or H3N2 strains isolated in each year. As observed in Figure 4A, both H1N1 and H3N2 strains have shortened their Euclidean distances from the bat strains over time, indicating that cellular environments of human and bat appreciably resemble each other for the influenza virus growth. To sum up the findings in Figure 4A and B, the tetranucleotide composition most suitable to the growth in mammalian cells differs significantly from that for the growth in avian cells, and the avian strains invaded into a new host have to change their sequences for obtaining the composition suitable to the

Novel Bioinformatics Method …

2157

new cellular environments. This directional change can offer information on predictions of viral sequence changes that will occur in the near future.

BLSOM for Codon Usage Synonymous codon choice sensitively reflects constraints imposed on genome sequences and thus provides a sensitive probe for searching for molecular mechanisms responsible for the constraints, e.g., genome GC% and tRNA composition in the cases of micro-organisms [1720]. We have previously found that BLSOM efficiently detects species-specific codon-choice patterns of micro-organisms, resulting in self-organization of genes according to microbial species [9]. Furthermore, in the case of genes horizontally transferred relatively recently, synonymous codon choice reflects primarily that of the donor, but not the recipient, genome. In the case of influenza viruses, we have previously found host-dependent clustering on codonBLSOM [7], and in this chapter we introduce BLSOM for synonymous codon usage in influenza A and B virus genes (Figure 5A), by analyzing sequences including those published after our previous paper. In order to know codon biases for each strain, codon usages in eight genes are summed up for each strain. Human and avian territories are again clearly separated from each other, and human H1N1/09 strains (dark green in Figure 5B) are again separated from the major human territory and surrounded by avian, equine and swine territories. Synonymous codon-choice patterns of newly invading viruses, such as H1N1/09, should be close to those of the original host viruses, at least for a period immediately after the invasion. Codon choice will most likely shift towards the pattern of seasonal human viruses during many infection cycles among humans, because viruses depend on many cellular factors for their growth. Actually, the directional sequence changes in H1N1/09 towards the codon usage pattern of the seasonal human strains have been observed in our previous paper [7].

Figure 5. BLSOMs for codon usage. (A) Codon. BLSOM has been constructed for synonymous codon usage in 12,288 genes from influenza A and B strains, and lattice points are indicated in a color representing the host as described in Figure 2A. (B) Human subtype. On the Codon-BLSOM presented in (A), lattice points are indicated in a color representing the host as described in Figure 2B. (C) Occurrence levels of six codons, which are diagnostic for host-dependent separation, are indicated with different levels of two colors, as described in Figure 2C.

2158

Yuki Iwasaki, Toshimichi Ikemura, Kennosuke Wada et al.

When we focus on diagnostic codons (Figure 5C), one simple tendency is observed. Codons ending with G or C are more favored for the avian strains than the human strains (AAG for Lys in Figure 5C), and vice versa. While the GC% effect is most apparent in two-codon boxes, this is also observed for many codons in four- or six-codon boxes (four examples in Figure 5C).

BLSOM for Amino-Acid and Peptide Composition When we consider prediction of changes in virus sequences from a view of medical and pharmaceutical application, changes in amino acid sequences appear to be more informative than in nucleotide sequences, because amino acid sequences are more directly related to viral functions than genomic sequences; e.g., prediction of amino-acid sequence changes is very useful for designing vaccine and antiviral drug. Therefore, we next examine whether directional change of amino-acid and peptide composition can be detected with BLSOMs. We have constructed BLSOMs for mono amino-acid, dipeptide and tripeptide composition for a sum of major eight proteins (PB2, PB1, PA, HA, NP, NA, M1, and NS1) (Figures 6A and 7A, C). Strains isolated from avian (red) and human (green) are again clustered (self-organized) according to host, forming their own large continuous territories. One simple tendency is immediately apparent. Human strains tend to prefer the amino acids coded by A- and/or U-rich codons (Asn, Ile, Lys, Phe, and Tyr; designated as A&U-AA), while avian strains appear to prefer the amino acids coded by C- and/or G-rich codons (Ala, Gly, Pro, and Arg; designated as C&G-AA) (Figure 6C). This shows that viral protein sequences are strongly affected by the host-dependent base compositions.

Figure 6. BLSOMs for amino-acid composition. (A) Amino acid. BLSOM has been constructed for amino-acid composition in 12,288 genes from influenza A and B strains, and lattice points are indicated in a color representing the host as described in Figure 2A. (B) Human subtype. On the Amino-BLSOM presented in (A), lattice points are indicated in a color representing the host as described in Figure 2B. (C) Occurrence levels of six amino acids, which are diagnostic for host-dependent separation, are indicated with different levels of two colors, as described in Figure 2C.

Novel Bioinformatics Method …

2159

Figure 7. Oligopeptide-BLSOM for all influenza viruses. (A) Dipeptide-BLSOM. The color coding is the same as Figure 2A. (B) Occurrence levels of dipeptide, which are diagnostic for host-dependent separation, are indicated with different levels of two colors, as described in Figure 2C. (C) TripeptideBLSOM. The color coding is the same as Figure 2A. (D) Occurrence levels of tripeptide, which are diagnostic for host-dependent separation, are indicated with different levels of two colors, as described Figure 2C.

Figure. 8. Directional changes of amino-acid frequency in human seasonal strains for A&U-AA and C&G-AA. (A) The A&U-AA frequencies in human seasonal H1N1(+) and H3N2 (×) strains are plotted according to the chronological order. (B) The C&G-AA frequencies in human seasonal H1N1(+) and H3N2 (×) strains are plotted according to the chronological order.

In order to examine the directional changes of amino-acid composition during the human virus evolution, we calculate usage frequencies of A&U-AA and C&G-AA separately, and plotted the average of their frequencies in the seasonal human H1N1 or H3N2 strains isolated in each year using the red + or blue x mark (Figure 8). A&U-AAs for both H1N1 and H3N2 strains have been gradually growing since the beginning of their pandemic while C&G-AA appear to be reducing, showing the directional change at the amino-acid level, which is consistent with the direction observed for viral genome GC%.

2160

Yuki Iwasaki, Toshimichi Ikemura, Kennosuke Wada et al.

When we consider functions of individual viral proteins, a combination of amino acids such as di- and tripeptide may become more important than the simple amino-acid composition; i.e., prediction of directional changes of peptide compositions may provide information more directly related to change in functions and/or antigenicities of viral proteins. On both di- and tripeptide BLSOMs, strains isolated from avian (red) and human (green) are again clustered (self-organized) according to host, forming their own large continuous territories (Figure 7A, 7C). Six examples of diagnostic di- or tri-peptide for the host-dependent separation are presented in Figure 7B and 7D; most human strains prefer KL composed only of A&U-AAs and most avian strains prefer AR composed only of C&G-AAs. This is consistent to the prediction from their genome GC%. However, the trend of not relying on viral genome GC% is also seen for various di- and tri-peptides (e.g., RAA in Figure 7B). Host-dependent composition of the latter type of peptides appears to be interesting from a view of their biological significance, and therefore, detailed analyses of these peptides are in progress by our group.

CONCLUSION Influenza viruses isolated from humans and birds differed in mono- and oligonucleotide composition and in mono amino-acid and peptide composition. Time-dependent directional changes of these compositions, which are observed for the newly invaded viruses into the human population from other animal hosts, can provide predictive information about sequence changes of the invaded viruses, which should be useful for medical and pharmaceutical purposes. Basing on the findings obtained by BLSOM analyses, we have previously proposed a strategy for efficient surveillance of potentially hazardous nonhuman strains that may cause new pandemics with a high probability [7]. Millions of influenza and other virus sequences will become available in the near future because of their medical and social importance, and BLSOM can characterize such big data without difficulty and support efficient knowledge discovery.

ACKNOWLEDGMENTS This work was supported by Research Fellow of the Japan Society for the Promotion of Science, the Grant-in-Aid for JSPS Fellows (JSPS KAKENHI Number 24•9979), and Grantin-Aid for Scientific Research (C) and for Young Scientists (B) from the Ministry of Education, Culture, Sports, Science and Technology of Japan. We wish to thank Drs. Masae Itoh and Kouki Yonezawa (Nagahama Institute of Bio-Science and Technology) and Dr Kimihito Ito (the Research Center for Zoonosis Control, Hokkaido University) for valuable suggestions and discussions and to Ms. Yukari Yonemori for manuscript preparation.

Novel Bioinformatics Method …

2161

REFERENCES [1] [2]

[3] [4] [5]

[6] [7]

[8] [9]

[10] [11] [12] [13] [14]

[15] [16] [17] [18]

Abe, T., Kanaya, S., Kinouchi, M., et al. (2003) Informatics for unveiling hidden genome signatures, Genome Res., 13, 693–702. Abe, T., Sugawara, H., Kinouchi, M., Kanaya, S. and Ikemura, T. (2005) Novel phylogenetic studies of genomic sequence fragments derived from uncultured microbe mixtures in environmental and clinical samples, DNA Res., 12, 281–90. Kohonen, T. (1982) Self-organized formation of topologi- cally correct feature maps, Biol. Cybern., 43, 59–69. Kohonen, T., Oja, E., Simula, O., Visa, A. and Kangas, J. (1996) Engineering applications of the self-organizing map, Proc. IEEE, 84, 1358–84. Abe, T., Sugawara, H., Kanaya, S. and Ikemura, T., Sequences from almost all prokaryotic, eukaryotic, and viral genomes available could be classified according to genomes on a large-scale Self-Organizing Map constructed with the Earth Simulator, Journal of the Earth Simulator, 6, 17-23, 2006. Karlin, S., Campbell, A.M. and Mrazek, J. (1998) Comparative DNA analysis across diverse genomes, Annu. Rev. Genet., 32, 185–225. Iwasaki, Y., Abe, T., Wada, K., Itoh, M., and Ikemura, T. (2011), Prediction of Directional Changes of Influenza A Virus Genome Sequences with Emphasis on Pandemic H1N1/09 as a Model Case, DNA res., 18, 125-136. Bao, Y. (2008) The influenza virus resource at the National Center for Biotechnology Information, J. Virol., 82, 596 – 601. Kanaya, S., Kinouchi, M., Abe, T., et al. (2001) Analysis of codon usage diversity of bacterial genes with a self-organizing map (SOM): characterization of horizontally transferred genes with emphasis on the E. coli O157 genome. Gene, 276, 89-99. García-Sastre, A. (2001) Inhibition of interferon-mediated antiviral responses by influenza A viruses and other negative-strand RNA viruses. Virology, 279, 375-384. Voinnet, O. (2005) Induction and suppression of RNA silencing: insights from viral infections. Nat. Rev. Genet., 6, 206-220. Nelson, M.I., and Holmes, E.C. (2007) The evolution of epidemic influenza. Nat. Rev. Genet., 8, 196-205. Alexey, A., and Moelling, K. (2007) Dicer is involved in protection against influenza A virus infection. J. Gen. Virol., 88, 2627-2635. Rabadan, R., Levine, A.J., and Robins, H. (2006) Comparison of avian and human influenza A viruses reveals a mutational bias on the viral genomes. J. Virol., 80, 1188711891. Domingo, E., and Holland, J.J. (1997) RNA virus mutations and fitness for survival. Annu. Rev. Microbiol., 51, 151-178. Tong, S., Li, Y., Rivailler, P., Conrardy, C., Castillo, DA., Chen, LM., et al. (2012) A distinct lineage of influenza A virus from bats. PNAS, 109, 4269-4274. Ikemura, T. (1981) Correlation between the abundance of Escherichia coli transfer RNAs and the occurrence of the respective codons in its protein genes. J. Mol. Biol., 146, 1-21. Ikemura, T. (1985) Codon usage and transfer RNA content in unicellular and multicellular organisms. Mol. Biol. Evol., 2, 13-34.

2162

Yuki Iwasaki, Toshimichi Ikemura, Kennosuke Wada et al.

[19] Sharp, P.M., and Matassi, G. 1994, Codon usage and genome evolution. Curr. Opin. Gen. Dev., 4, 851-860. [20] Sueoka, N. (1995) Intrastrand parity rules of DNA base composition and usage biases of synonymous codons. J. Mol. Evol., 40, 318-325.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 101

ONCOGENES: CLASSIFICATION, MECHANISMS OF ACTIVATION, AND ROLES IN CANCER DEVELOPMENT ROLE OF ONCOGENES IN GYNECOLOGICAL PATHOLOGY Ciro Comparetto1, and Franco Borruto2 1

Division of Obstetrics and Gynecology, City Hospital, Prato, Italy 2 Obstetrics and Gynecology, Princess Grace Hospital, Monaco

ABSTRACT An oncogene is a modified gene, or a series of nucleotides that encode a protein, and direct the cell to the development of a neoplastic phenotype. Usually, oncogenes are involved in tumor development and increase the possibility that the development (proliferation and differentiation) of a cell directs towards cancer. New researches indicate that small ribonucleic acids (RNA) of 21-25 nucleotides, called micro RNA (miRNA), can control these genes through down-regulation. The first oncogene was discovered in 1970 and named Src. Src was first discovered in a retrovirus of chickens. In 1976, J. Michael Bishop and Harold E. Varmus of the University of California showed that this oncogene was a defective proto-oncogene present in many organisms including humans. For their studies Bishop and Varmus were awarded of the Nobel Prize in 1989. A proto-oncogene is a normal gene that can become oncogenic due to mutations or to increased expression. Proto-oncogenes encode proteins that regulate the cell cycle and differentiation. They may also be involved in the signal transduction of the start of mitosis. A proto-oncogene becomes an oncogene even with minimum modifications of its original functions. There are two basic types of activation: 1) a mutation of nucleotides which produce a different protein causing: a) increased enzymatic activity of the protein; b) the loss of regulatory sites; and c) the creation of hybrid proteins; and 2) an increase of the concentration of proteins caused by: a) an increase of gene expression (through misregulation); b) an increase of stability (half-life) of the protein; and c) a duplication or amplification of the gene coding for the protein. Growth factors (GF), or fitogens, are usually secreted in a few 

Corresponding Author’s Email: [email protected].

2164

Ciro Comparetto and Franco Borruto

cells specialized to induce proliferation in a paracrine, autocrine, or endocrine manner. If a cell that normally does not produce GF suddenly begins to produce them (because it has developed an oncogene), this induces the proliferation, without control, to adjacent cells (paracrine action) and to its cell type (autocrine action) increasing secretion. There are six known classes of protein kinases (PK) and related proteins that are potential oncogenes: 1) tyrosine kinase receptor (TKR), which becomes constitutively (permanently) activated, such as the epidermal growth factor receptor (EGFR), the platelet-derived growth factor receptor (PDGFR), and the vascular endothelial growth factor receptor (VEGFR); 2) cytoplasmic TK, such as TK enzymes of the Src family, Syk-ZAP-70 and Bruton’s TK (BTK); 3) regulatory guanosine triphosphate (GTP)ase, like Ras; mutations that activate permanently Ras are found in 20-25% of all human tumors and up to 90% in some types of cancer, such as pancreatic ones; 4) cytoplasmic serine/threonine kinase and its regulatory units, such as Raf kinase and cyclin-dependent kinase (CDK); 5) adapter proteins in signal transduction (for example in the apoptotic pathway); and 6) transcription factors, for example the Myc gene. A large number of genes have been identified as proto-oncogenes. Most of them are responsible for the production of a positive signal that induces cell division. Other proto-oncogenes play an important role in the regulation of cell death. As mentioned before, the “altered” versions of these genes (oncogenes) may induce the cell to replicate unruly. Such a development can take place even in the absence of normal progrowth signals, as for example the one provided by GF. A key feature in the activity of oncogenes is that a single altered copy is sufficient to induce an unregulated growth. Such behavior is in contrast with the one typical of tumor-suppressor genes (TSG) for which it is necessary that both copies of the gene are defective for triggering a process of abnormal cell division. Proto-oncogenes that have been identified until now have very different functions within the cell. Despite the differences in their normal functions, these genes all have the characteristic to contribute to unregulated cell division when present as mutated (oncogenic). The mutated proteins sometimes retain some features of their own, but are no longer sensitive to the regulation systems that determine and control the normal form of the protein itself. In this chapter we overview the role of oncogenes in gynecological pathology.

INTRODUCTION During the past decades, the expansion of molecular biology has had a pivotal role in understanding the basis of cancer development and progression. In addition, real advances have been made in the application of deoxy-ribonucleic acid (DNA) recombinant technology to cancer therapy and patient management [1]. Early studies designed to investigate the molecular basis of oncogenesis indicated the existence of discrete genes which could cause neoplastic transformation of normal cells in vitro. These genes (which became known as oncogenes) were originally thought to be derived from oncogenic retroviruses and neoplastic transformation was believed to be the result of infection of normal cells by an oncogenic retrovirus. However, recent studies have demonstrated that normal eukaryotic cells contain gene sequences which are highly homologous to oncogenes but which do not cause neoplastic transformation. These genes (termed proto-oncogenes) have been found to code for proteins which are intimately involved in the regulation of mitosis. These include growth factors, receptors for growth factors, proteins (such as protein kineses [PK] and guanosine triphosphate [GTP] binding proteins [BP]) which transduce exogenous signals through the plasma membrane, and nuclear BP. Thus, if the function or control of a proto-oncogene (or its product) is altered by mutation,

Oncogenes

2165

gene rearrangement, or translocation, its effects on the cell will also change. This, in turn, can lead to the loss of normal mitotic control. The tumorigenic process is, of course, much more complicated that just unchecked cell growth. However, the insights into the molecular basis of cellular regulation have suggested new approaches to the early diagnosis of cancer and may ultimately lead to the development of more effective treatment protocols [2]. Gynecologic malignancies, representing 13% of all cancers affecting women, have a major impact on women’s health. Cervical, endometrial, and ovarian cancers comprise the majority of these tumors and contribute significant morbidity and mortality to the female population. While cervical and endometrial cancers can be detected early in their development, sadly, many patients present with advanced disease, as do the majority of patients with ovarian cancer. Unfortunately, advanced cases of these malignancies are usually lethal despite modern therapeutic modalities. In order to impact upon these grim statistics, gynecologic researchers have turned to molecular biology in an attempt to elucidate the etiology of these cancers. Recent research describing dominant oncogene and tumor-suppressor gene (TSG) mutations common to these malignancies is providing a basis for the molecular genesis of these cancers. This information should offer new avenues for the development of early detection and chemoprevention, as well as novel treatment strategies [3].

ONCOGENES IN GYNECOLOGICAL CANCERS The multifactorial process of carcinogenesis involves mutations in oncogenes, or TSG, as well as the influence of environmental etiological factors. Common DNA polymorphisms in low penetrance genes have emerged as genetic factors that seem to modulate an individual's susceptibility to malignancy. Genetic studies, which lead to a true association, are expected to increase understanding of the pathogenesis of each malignancy and to be a powerful tool for prevention and prognosis in the future [4]. Cancer is a genetic disease, and inherited or acquired genetic defects contribute to the initiation and progression of cancer [5]. The genes responsible for hereditary cancers such as retinoblastoma, colorectal cancer, and breast cancer have been identified through application of positional cloning from human molecular genetics. Linkage analysis is a powerful method to locate a disease gene, however a precise genetic model, detailing the mode of inheritance, gene frequencies and penetrance, is required for parametric methods, but not for nonparametric methods. The nonparametric methods ignore unaffected people, and look for alleles that are shared by affected individuals within nuclear families as well as extended families. Hence, the methods usually have been performed to identify disease genes in many hereditary diseases [6]. Comparative genomic hybridization (CGH) is a powerful new molecular cytogenetic method which allows genome-wide mapping of regions with DNA sequence copy number changes (both increases and decreases) in a single experiment without previous knowledge of the locations of the regions of abnormality. CGH is based on in situ hybridization (ISH) of differentially labeled total genomic tumor DNA and normal DNA to normal human metaphase chromosomes. After hybridization, copy number variations among the sequences in the tumor DNA are detected by measuring the tumor/normal fluorescence intensity ratio for each locus in the target chromosomes. Many previously unknown chromosomal regions with relative copy number changes have been detected in various tumors by CGH. Some changes have been

2166

Ciro Comparetto and Franco Borruto

identified as genetic markers associated with biological and clinico-pathological characteristics (i.e., histopathological grade and clinical outcome) [7, 8]. Advances in molecular biology have facilitated the recent investigation of gynecological malignancies. The presence of certain oncogenes within gynecological tumors indicates that transformation may be associated with genetic alteration of normal regulatory processes. Several oncogenes have been implicated in the transformation of gynecological tissues [9]. Among them, the human epidermal growth factor receptor (EGFR) 2 (HER-2)/neu and microribonucleic acids (miRNA) are two examples of the most often studied. The HER-2/neu proto-oncogene (also known as c-erbB2, neu, and HER2) encodes a 185kDa trans-membrane glycoprotein with intrinsic tyrosine kinase (TK) activity that resembles the receptor for EGF. Aberrant HER-2/neu protein overexpression occurs in human gynecologic adenocarcinomas, including those of the ovary, endometrium, breast, fallopian tube, and cervix, and is secondary to gene amplification and/or overexpression of the p185HER2 protein. Overexpression of HER-2/neu was found to be a poor prognostic factor for survival from advanced-stage ovarian cancer, node-positive breast cancer, and endometrial cancer. Although a specific ligand has not been definitively identified, HER-2/neu may have unusually complex activation pathways because it can form both homodimeric and heterodimeric associations with other related receptor proteins. Preliminary findings suggest that serum HER-2/neu levels may be used as a tumor marker in a subset of patients with tumors that overexpress the HER-2/neu receptor. Receptor-targeted therapeutics currently being studied include the use of receptor antibodies, liposomally delivered antisense DNA, antigenactivated cytotoxic lymphocytes (CTL), and adenovirus-mediated E1A delivery to overexpressing tumor cells. HER-2/neu appears to play an important role in the biologic behavior of ovarian, endometrial, and breast cancers and holds potential as a target for oncogene-directed therapies [10]. miRNA are 21-22 nucleotide non-coding RNA that regulate gene expression and play fundamental roles in biological processes. These small molecules bind to target messengerRNA (mRNA), leading to translational repression and/or mRNA degradation. Aberrant miRNA expression is associated with several human diseases such as cancer, cardiovascular disorders (CVD), inflammatory diseases, and gynecological pathology. miRNA have a role in four gynecological disorders that affect the ovary or the uterus, one benign and frequent disease (endometriosis) that is classified as a tumor-like lesion and three malignant gynecological diseases (endometrial, cervical, and ovarian cancers). In cancer, miRNA have an important role as regulatory molecules, acting as oncogenes (oncomiR) or tumor-suppressors. Endometrial cancer is one of the most frequent gynecological malignancies in the developed countries. Cervical cancer, also one of the most common cancers in women, is associated with high risk Human Papillomaviruses (HPV), although this infection alone may not be enough to induce the malignant transformation. Ovarian cancer is the fifth leading cause of all cancer-related deaths among women. Over 80% of cases are diagnosed at an advanced stage, with a reduced fiveyear survival rate. Recent studies have shown that miRNA are aberrantly expressed in different human cancer types, including endometrial, cervical, and ovarian cancer, and that specific dysregulated miRNA may act as biomarkers of patients’ outcome. Recently, miRNA have been detected in serum and plasma, and circulating miRNA expression profiles have now been associated with a range of different tumor types. Their accessibility in peripheral blood and stability, given the fact that miRNA circulate confined within exosomes, make researchers foster hope in their role as emerging biomarkers of cancer and other disorders. The development

Oncogenes

2167

of therapies that might block the expression or mimic the functions of miRNA could represent new therapeutic strategies for any of the aforementioned gynecological disorders [11, 12].

Breast Cancer Breast cancer is the most common female malignancy in many industrialized countries [13]. Colony stimulating factor (CSF-1) and its receptor (CSF-1R, product of c-fms protooncogene) were initially implicated as essential for normal monocyte development as well as for trophoblastic implantation. However, studies have demonstrated that CSF-1 and CSF-1R have additional roles in mammary gland development during pregnancy and lactation. This apparent role for CSF-1/CSF-1R in normal mammary gland development is very intriguing because this receptor/ligand pair has also been found to be important in the biology of breast cancer, in which abnormal expression of CSF-1 and its receptor correlates with tumor cell invasiveness and adverse clinical prognosis. Recent findings also implicate tumor-produced CSF-1 in promotion of bone metastasis in breast cancer, and a certain membrane-associated form of CSF-1 appears to induce immunity against tumors. Recent findings on the role of CSF1 and its receptor in normal and neoplastic mammary development may elucidate potential relationships of GF-induced biological changes in the breast during pregnancy and tumor progression [14]. The mammary gland seems to be the only organ that is not fully developed at birth. Estrogens stimulate breast tissue via estrogen receptors (ER). In the mammary gland, ERmediated mechanisms have been shown to regulate: 1. 2. 3. 4.

various GF, such as transforming GF (TGF)-alpha and TGF-beta; enzymes, such as cathepsin D and plasminogen-activator; proto-oncogenes, such as c-fos, c-myc, and HER-2/neu; cyclines and other regulatory substances that provide signaling systems for cell division and differentiation; and 5. other steroid receptors and EGFR. Estrogen target genes contain estrogen-responsive elements. In these genes, transcription will be activated through interaction with the estrogen/ER protein complex. Subsequent activation of proto-oncogenes provides an explanation for the stimulating effect of estrogens on the glandular breast. Progesterone may be the key in influencing the risk of breast cancer with the peak of mitotic activity in the breast during the luteal phase of the menstrual cycle. On the other hand, in human breast cancer cell lines, both proliferation and inhibition have been observed with various progestational agents. Relevant biological and clinical issues are pregnancy and exposure to exogenous hormones. The intense hormonal stimulation of pregnancy (both estrogen and progesterone) has no adverse impact on the course of breast cancer. Pregnancy, with its mammogenetic differentiation, results in the protection of this organ from carcinogenesis. Characterization of specific lobular morphology serves as an indicator of the level of differentiation achieved by the organ, and thus provides means to assess the risk of the gland undergoing neoplastic transformation when exposed to given agents. Sufficient evidence exists to indicate the possibility of a slightly increased risk of breast cancer after approximately one decade of

2168

Ciro Comparetto and Franco Borruto

postmenopausal estrogen use. A review of the epidemiologic studies of postmenopausal hormone replacement therapy (HRT) and the risk of breast cancer fails to provide definitive evidence. Recent information derives from observations of cellular proliferation, plasma and tissue estradiol and progesterone receptor levels, and the percentage of apoptotic epithelial cells in human breast tissue. Several studies suggest that short-term, continuous combined HRT does not increase breast cancer recurrence or mortality. The participation of sexual hormones in the mammogenetic process during pregnancy might serve as an intermediate end point in assessing the effectiveness of hormones as chemopreventive agents. Investigations based on history, and breast morphology, should enable us to select estrogens and progestogens for HRT, and adopt optimal therapeutic regimens [15]. Breast cancer emerges by a multistep process which can be broadly equated to transformation of normal cells via the steps of hyperplasia, premalignant change, and carcinoma in situ (CIS). The elucidation of molecular interdependencies, which lead to development of primary breast cancer, its progression, and its formation of metastases is the main focus for new strategies targeted at prevention and treatment. Cytogenetic and molecular genetic analysis of breast cancer samples demonstrates that tumor development involves the accumulation of various genetic alterations including amplification of oncogenes and mutation or loss of TSG. Amplification of certain oncogenes with concomitant overexpression of the oncoprotein seems to be specific for certain histological types. Loss of normal tumorsuppressor protein function can occur through sequential gene mutation events (somatic alteration) or through a single mutational event of a remaining normal copy, when a germ-line mutation is present. The second event is usually chromosome loss, mitotic recombination, or partial chromosome deletion. Chromosome loci 16q and 17p harbor TSG, which seem to be pathognomonic for the development or progression of a specific histological subtype. There are an overwhelming number of abnormalities that have been identified at the molecular level which fit the model of multistep carcinogenesis of breast cancer. When the functions of all of these genes are known and how they participate in malignant progression, we will have the tools for a more rational approach to diagnosis, prevention, and treatment. A key critical longterm step in the molecular analysis of breast cancer will be to link the specific molecular damage with the effects of environmental carcinogens [16]. The question addressed is how far a multi-step progression model for sporadic breast cancer would differ from that for hereditary breast cancer. Hereditary breast cancer is characterized by an inherited susceptibility to breast cancer on basis of an identified germ-line mutation in one allele of a high penetrance susceptibility gene (such as breast cancer [BRCA]1, BRCA2, checkpoint kinase [CHEK]2, tumor protein [TP]53, or phosphatase and tensin homolog [PTEN]). Inactivation of the second allele of these TSG would be an early event in this oncogenic pathway (Knudson’s “two-hit” model). Sporadic breast cancers result from a serial stepwise accumulation of acquired and uncorrected mutations in somatic genes, without any germ-line mutation playing a role. Mutational activation of oncogenes, often coupled with non-mutational inactivation of TSG, is probably an early event in sporadic tumors, followed by more, independent mutations in at least four or five other genes, the chronological order of which is likely less important. Oncogenes that have been reported to play an early role in sporadic breast cancer are MYC, cyclin D1 (CCND1), and erbB2 (HER2/neu). In sporadic breast cancer, mutational inactivation of BRCA1/2 is rare, as inactivation requires both gene copies to be mutated or totally deleted. However, non-mutational functional suppression could result from various mechanisms, such as hypermethylation of the BRCA1 promoter or binding

Oncogenes

2169

of BRCA2 by EMSY. In sporadic breast tumorigenesis, at least three different pathway-specific mechanisms of tumor progression are recognizable, with breast carcinogenesis being different in ductal versus lobular carcinoma, and in well differentiated versus poorly differentiated ductal cancers. Thus, different breast cancer pathways emerge early in the process of carcinogenesis, ultimately leading to clinically different tumor types. As mutations acquired early during tumorigenesis will be present in all later stages, large-scale gene expression profiling using DNA microarray analysis techniques can help to classify breast cancers into clinically relevant subtypes [17]. C-erbB-2 (neu) oncogene was found on the cell membrane in primary breast cancers. No obvious relation was found between neu oncogene, age, and lymph node status and tumor size. There was a tendency towards smaller primary tumors and more ER-negative tumors in the oncogene-positive group. No case of distant metastasis during follow-up was found among the oncogene-negative patients, while several oncogene-positive patients developed such metastases. This suggests that the neu oncogene is an independent prognostic factor, which might predict the development of distant metastasis. Further studies including more patients and long-term survival analysis are, however, needed in order to evaluate the prognostic significance of the neu oncogene [18]. Pooling of microarray datasets seems to be a reasonable approach to increase sample size when a heterogeneous disease like breast cancer is concerned. Different methods for the adaption of datasets have been used in the literature. Influences of these strategies using a pool of Affymetrix U133A microarrays from breast cancer samples have been analyzed. Data on the resulting concordance with biochemical assays of well-known parameters highlight critical pitfalls. The cutoffs derived by a method for the inference of cutoff values directly from the data without prior knowledge of the true result displayed high specificity and sensitivity. Markers with a bimodal distribution like ER, progesterone-receptor (PgR), and HER2 discriminate different biological subtypes of disease with distinct clinical courses. In contrast, markers displaying a continuous distribution like proliferation markers as Ki67 rather describe the composition of the mixture of cells in the tumor [19]. The development of new chemotherapeutic agents and concepts of radiation therapy, administered as primary, adjuvant, and palliative therapy, has led to new perspectives in breast cancer therapy. Apart from conventional chemotherapy, recently developed novel agents interfere with molecular mechanisms that are altered in cancer cells. Those targets are not necessarily breast cancer-specific. Promising strategies include inhibition of GF receptors, blocking of tumor angiogenesis and signal transduction pathways, modulation of apoptosis, cancer vaccination, and inhibition of invasion and metastasis [20]. Approximately one fourth of all women diagnosed with early breast cancer present with tumors that are characterized by erbB2 amplification. While the associated HER-2/neu receptor over-expression results in a high risk of relapse and poor prognosis, these tumors also represent a target for a selective monoclonal antibody therapy with trastuzumab (Herceptin). The combination of trastuzumab with chemotherapy has led to a considerable reduction of recurrences and to a significant reduction in breast cancer mortality both in the adjuvant and metastatic setting. Unfortunately, despite HER-2/neu over-expression, not all patients equally benefit from trastuzumab treatment, and almost all women with metastatic breast cancer eventually progress during antibody therapy. Moreover, trastuzumab is burdened with cardiotoxicity, thus increasing the risk of symptomatic congestive heart failure. In addition, the marginal costs for one year therapy of trastuzumab-based therapy, which is currently considered to be the most effective treatment regimen in the adjuvant setting, may amount for up to US$ 40.000. Testing for erbB2

2170

Ciro Comparetto and Franco Borruto

oncogene amplification by fluorescence ISH (FISH) and chromogenic ISH (CISH), respectively, and staining for HER-2/neu receptor over-expression by immunohistochemistry (IHC) represent the current standard for determining patient eligibility for trastuzumab-based therapy. However, while the negative predictive value of these assays for predicting the absence of benefit from trastuzumab-based therapy is sufficiently high, their positive predictive value remains insufficient, i.e., only a proportion of patients selected by these tests substantially benefit from trastuzumab-containing regimen. Accordingly, over the last years a number of biomarkers have been evaluated in their potential to predict response to trastuzumab-based therapies. These include markers of activation of HER-2/neu (e.g. tyrosine phosphorylated HER-2/neu in tissue and cleaved HER-2/neu extracellular domain in serum) and its dimerization partners (e.g., EGFR), respectively, but also components of HER-2/neu-induced downstream signaling pathways that are crucial for the growth inhibitory effects of trastuzumab (e.g., PTEN and phosphatidyl-inositol 3-kinase [PI3K]). Other parameters, such as topoisomerase-II alpha and c-myc co-amplifications, have also been identified as potentially useful predictors of response to trastuzumab-based chemotherapy regimen. While the benefit of these predictive biomarkers in the metastatic setting is currently explored, their usefulness in the adjuvant setting is still largely unknown. It is, however, undisputable that, within the group of HER-2/neu over-expressing tumors, further response predictors are needed in order to minimize trastuzumab-associated side effects, and to reduce the considerable societal costs that are associated with trastuzumab-based treatment regimen [13]. As a consequence of the success with the HER2 targeting antibody trastuzumab (Herceptin) in the treatment of early stage and metastatic breast cancer, several antibodies inhibiting cellular signaling of vascular EGF (VEGF) and EGFR were tested with respect to their efficacy in breast cancer. In phase II and III clinical trials the humanized anti-VEGF antibody bevacizumab (Avastin), alone or in combination with capecitabine, exhibited responses in patients with metastatic breast cancer. Recent developments focus on small molecules interfering with different signal transduction pathways in tumor cells. Numerous inhibitors of EGF and VEGF TK receptor (TKR) and farnesyl transferases are in early stages of clinical development for breast cancer. Another promising approach is the targeting of endothelins and their two G-protein coupled receptors (ET(A)R und ET(B)R). Due to the heterogeneity of disease and varying response to conventional systemic therapies, these new perceptions may lead to substantial patient benefit and provide a promising basis for future clinical application [21]. Other further developed compounds show promising results in clinical studies as a second generation of GF inhibitors. Different approaches in anti-angiogenetic therapy are under preclinical and clinical phase-II trials. Pro-apoptotic agents show synergistic effects with docetaxel in a clinical phase-I trial. Other compounds that target heat shock protein 90 (HSP 90), histone deacetylase, and 3-hydroxy-3-methyl coenzyme A (HMG-CoA) reductase target atypical apoptotic pathways being lethal to tumor cells only but not to normal tissue, suggesting a tumor-specific way of action. Matrix metalloproteinases (MMP) inhibitors have been demonstrating promising results in patients with refractory malignant pleural effusion in a phase-I trial. Several TK inhibitors (TKI) currently under clinical investigation preliminarily show hopeful results in patients with advanced breast cancer. Furthermore, recent progress in defining the immunogenic epitopes of tumor antigens has rejuvenated the interest in cancer vaccines. Typical dose escalation studies leading to the highest clinically still tolerated dose do not appear to be equally appropriate for the estimation of efficiency of those compounds as for conventional cytotoxic regimes. Rather, escalation up to an amount of therapeutic agent that is

Oncogenes

2171

sufficient for maximum target inhibition should be promoted, where classical measures of cytoreduction such as complete or partial remission are replaced both by time to progression and treatment failure as an appropriate measure of the efficacy of an agent [20]. Clinical trial data indicate that epirubicin-based adjuvant treatment of breast cancer is associated with marked improvement in relapse-free and overall survival compared with traditional cyclophosphamide (CTX)/methotrexate (MTX)/5-fluorouracil (5-FU). The outcomes are comparable to those achieved with sequential use of doxorubicin/CTX and paclitaxel. Dose intensification of epirubicin is feasible, with tolerable side effects and no increased risk of cardiotoxicity beyond that expected. Clinical trial data coupled with pharmacokinetic evidence provide a strong foundation and rationale for current and future investigation of epirubicin in combination with the taxanes in the adjuvant setting. An ongoing German study is evaluating epirubicin/CTX in combination with trastuzumab as first-line therapy of metastatic breast cancer in patients whose tumors overexpress HER2/neu protein. These results, particularly the tolerability of this regimen, will form the basis for future adjuvant and neoadjuvant studies of epirubicin/trastuzumab-based regimens [22].

Ovarian Cancer Epithelial ovarian cancer is the leading cause of death from gynecological cancers, largely owing to the development of recurrent intractable disease. Surgical and chemotherapeutic advances have been made, yet the cause of ovarian oncogenesis is poorly understood. Only a small number of distinct genetic mutations are known to contribute to ovarian carcinogenesis. Furthermore, understanding mechanistic genotype-phenotype links is complicated by frequent aneuploidy. Recognition of the familial clustering has focused investigators in the direction of isolating genetic susceptibility loci for ovarian cancer. The familial clustering of breast and ovarian cancers, as well as the chromosomal alterations and oncogenes identified, have all contributed to our understanding of the genetic factors involved in the development of ovarian cancer. Epigenetic deregulation is even more prominent, and ovarian cancers are replete with such aberrations that repress tumor-suppressors and activate proto-oncogenes. Research on cytogenetic abnormalities have led to the identification of oncogenes and TSG, which have contributed to a multistep model of molecular oncogenesis. Epigenetic therapies are emerging as promising agents for resensitizing platinum-resistant ovarian cancers. These drugs may also have the potential to alter epigenetic programming in cancer progenitor cells and provide a strategy for improving therapy of ovarian cancer [23, 24]. As with many other tumors, the origin and development of ovarian cancer is constituted by several molecular mechanisms, many of which are still unknown. Our understanding of ovarian cancerogenesis has been hampered by the lack of a well-defined precursor lesion, the lack of knowledge about tumor progression, and by the relative inaccessibility of the ovaries in the abdominal cavity. Furthermore, data in the literature are incomplete and often contradictory, and they are mainly founded on results obtained on cell lines and not on observations based on the in vivo study of ovarian cancer. Despite this situation, the study of control mechanisms of proliferation and differentiation in normal ovarian functioning has enabled clinicians to identify certain growth factors and oncogenes which seem to have an important role in the neoplastic transformation of ovarian tissue. Recent studies using experimental models allow us to better

2172

Ciro Comparetto and Franco Borruto

define the fundamental mechanisms of carcinogenesis from the serous ovarian cells and of invasion of the abdominopelvic cavity by proximity [25, 26]. Most ovary carcinomas are epithelial tumors. Approximately 80-90% of adult ovarian cancers are assumed to originate from ovarian surface cells. The morphology of the ovarian surface epithelium changes constantly, exhibiting features such as crypts, inclusion cysts, villous processes, and different forms of Müllerian epithelium. The unique nature of ovarian surface features and their absence in the immediately adjacent peritoneal mesothelium suggest that local factors may play an important part in modifying the growth and morphology of the ovarian surface epithelium. Recent studies tend to emphasize oncogene activation, along with concomitant cytogenetic changes, in the development of ovarian cancer [27]. It has been proposed that epithelial ovarian cancers are of unifocal origin and arise from a single cell. Many alterations occur during the multistep carcinogenesis including interaction of peptide growth factors, activation of proto-oncogenes, and loss of TSG. Increased activity of TGF-alpha and decreased activity of TGF-beta may contribute to the development of many ovarian cancers. Loss of TGF-beta responsiveness has been associated with the down-regulation of c-myc expression in the development of ovarian cancer. Alternative expression of many oncogenes including ras, erbB2, and c-myc, were detected in many studies. Protein 53 (p53) mutation was detected in 50% of advanced ovarian cancer, suggesting that loss of TSG function facilitates transformation. Serum parameters like alpha-fetoprotein (AFP), carcinoembryonic antigen (CEA), cancer antigen 125 (CA-125), immunosuppressive acidic protein (IAP), lactate dehydrogenase (LDH), sialic acid (SA), TGF-alpha, and macrophage-CSF (M-CSF) have been used as ovarian tumor markers. None of these biochemical markers is presently consistent and specific enough to be an early detection for ovarian cancers [28]. However, the development and progression of epithelial ovarian cancer can be correlated with various biologic and molecular factors. Tumor growth has been associated with aberrant and dysfunctional expression and mutation of various genes. These genetic defects include oncogene over-expression, amplification or mutation, aberrant TSG expression or mutation, and the inappropriate expression of cytokines and GF and/or the cellular receptors for these molecules. Dysregulation of host immune responses may also play a permissive role in the pathogenesis of the disease. Since ovarian cancer has been associated with the frequency of ovulation, the repeated proliferation of epithelial cells may increase the chance of a genetic accident that could contribute to the activation of an oncogene or inactivation of a suppressor gene. These events, combined with the inherent ability of ovarian epithelial cells to respond to and produce various cytokines and GF, could promote oncogenesis [29]. Recent evidence indicates that inherited and acquired genetic mutations are the driving force behind carcinogenesis and cellular transformation. A number of proto-oncogenes and TSG are associated with ovarian carcinomas, including p53, BRCA1, and BRCA2, mismatch repair genes such as human mutS homolog 2 (hMSH2) and human mutL homolog 1 (hMLH1), and PTEN, HER-2/neu, K-ras, fms, and active serine⁄threonine PK 2 (AKT2). Novel genes recently implicated in ovarian tumorigenesis include novel ovarian epithelial Y2 (NOEY2), ovarian cancer-associated gene 1 protein (OVCA1), and PI3K. Although no singular gene alteration has been shown to initiate transformation in the ovarian epithelium, elucidation of the complex molecular and cellular mechanisms involving these known gene mutations may result in new clinical management strategies [30]. Ovarian cancer is caused by genetic alterations that disrupt proliferation, apoptosis, senescence, and DNA repair. Approximately 10% of ovarian cancers arise in women who have inherited mutations in cancer susceptibility genes (BRCA1 or

Oncogenes

2173

BRCA2). The ability to perform genetic testing allows identification of women at increased risk who can be offered prophylactic oophorectomy or other interventions aimed at preventing ovarian cancer. The vast majority of ovarian cancers are sporadic, resulting from the accumulation of genetic damage over a lifetime in the absence of a familial or heritable component. Several specific genes involved in ovarian carcinogenesis have been identified, including the p53 TSG and HER2/neu and PIK3CA oncogenes. The recent availability of expression microarrays has facilitated the simultaneous examination of thousands of genes, and this promises to extend further our understanding of the molecular events involved in the development of ovarian cancers. Hopefully, this knowledge can be translated into effective screening, treatment, surveillance, and prevention strategies in the future [31, 32]. The inability to identify relevant markers for pre-symptomatic screening in early stage or “pre-invasive” ovarian cancer has plagued investigators and clinicians facing the problems of early detection. The characteristic late stage of disease at initial presentation has hindered our understanding of the biologic progression and stepwise molecular alterations that result in ovarian carcinoma. To date, most screening studies have focused on identifying early anatomic changes using ultrasound or fluctuations in serum biomarkers such as CA-125. These screening methodologies have proven inadequate in both sensitivity and specificity for early stage ovarian cancer detection. Molecular analysis of ovarian carcinomas has revealed alterations in oncogenes and TSG associated with these tumors. The HER-2/neu oncogene, a member of the EGF family, is amplified or over-expressed in approximately 25-30% of ovarian carcinomas. Significant data substantiate an important role for HER-2/neu in the pathophysiology of ovarian cancer. While potentially an attractive surrogate endpoint biomarker (SEB), serum HER-2/neu levels have not proven to be a useful screening modality. In response to the urgent need for improved early detection for ovarian cancer, current research efforts include: 1) differential hybridization studies between normal and malignant ovarian epithelium to define potentially unique ovarian cancer antigens which may ultimately have utility; 2) defining physical alterations that occur in malignant ovarian tissues using implanted telemetry systems; 3) studies using positron emission tomography (PET) to detect changes in glucose metabolism between normal and malignant ovarian tissues; and 4) screening studies using a 3-dimensional (3-D) ultrasound unit to improve the accuracy of this technique in recognizing early neoplastic changes. By taking diverse approaches to tackle this problem, an improved understanding of ovarian carcinogenesis should translate into the identification of appropriate SEB for early detection [33]. The discovery of peptide GF and cancer-causing genes (oncogenes and TSG) has provided us with the exciting opportunity to begin to understand the molecular pathology of human ovarian cancer. Activation of several genes, including HER-2/neu, myc, ras, and p53 have been described in some ovarian cancers. In addition, some proto-oncogenes such as the EGFR (erbB) and the M-CSF receptor (fms) are expressed along with the respective ligands (peptide GF) in some ovarian cancers. Although the studies reviewed represent a promising beginning, we remain far from a comprehensive understanding of growth regulation and transformation of human ovarian epithelium [34]. Molecular genetic evaluation of ovarian cancer primarily has utilized mutation analysis, IHC techniques, and loss of heterozygosity (LOH) studies. Over-

2174

Ciro Comparetto and Franco Borruto

expression of the HER-2/neu oncogene is present in approximately one third of ovarian cancers and is associated with poor prognosis. Mutations of the K-ras oncogene have been identified in a similar proportion of mucinous ovarian tumors, including borderline tumors. Some authors have frequently detected LOH on chromosome 17, including the p53 and BRCA1 loci, and at 17p3.3 and 1717q22-23. Genetic linkage analysis indicates that the majority of inherited ovarian cancers are caused by mutations in the BRCA1 gene. Mutations in mismatch repair genes have been identified in ovarian cancers that occur as part of the hereditary non-polyposis colon-rectal cancer (HNPCC) syndrome. Sporadic ovarian tumors are the end result of a complex pathway involving multiple oncogenes and TSG, including HER-2/neu, K-ras, p53, BRCA1, and additional TSG on chromosome 17. The majority of inherited ovarian cancers are due to mutations in the BRCA1 gene, which appears to be a TSG [35]. K-ras activation is specific for mucinous tumors including adenomas, borderline tumors, and carcinomas, suggesting that K-ras activation may be associated with the mucinous differentiation rather than malignant transformation. Inactivation of p53 is detected in 30-40% of ovarian carcinoma. Mutations are more frequently observed in serous carcinomas, but not found in adenomas or rarely found in borderline tumors, suggesting that p53 mutations may be directly involved in malignant transformation. TGFbeta-2 mutations are found in 50% of endometrioid adenocarcinoma (EAC), but rarely in other type. Loss of deleted in colorectal carcinoma (DCC) mRNA expression is found in 50% of serous carcinomas but less frequently in other type. Loss of DCC expression is rare in borderline tumors and adenomas, suggesting that inactivation of DCC may be directly involved in malignant transformation. Microsatellite instability (MI) is found in 17% of ovarian carcinomas, and is frequently found in EAC. Although inactivation of p16 by point mutation or deletion is rare, p16 inactivation by loss of expression is relatively common [36]. The classic prognostic parameters are insufficient for predicting the prognosis of the individual patient. Knowledge of molecular and biological factors which are responsible for the development and progression of ovarian cancer may improve the prediction of prognosis. Recent data both on factors associated with the development and control of ovarian cancer cells and on DNA ploidy suggest that steroid and peptide hormones have a role in disease etiology and progression, and that peptide GF and cytokines, oncogenes and TSG, by their impact on mitosis and cell number may influence the rate of mutations, which could confer malignant transformation. DNA ploidy is an objective independent prognostic factor. DNA aneuploidy indicates high risk, diploidy low risk. Only tumors shown to be DNA diploid by flow-cytometry and image cytometry are considered diploid. S-phase fraction is currently not reliable. Understanding the mechanisms involved in ovarian cancer development and growth will allow opportunities for the rational design of effective anti-tumor treatment modalities. More objective and reproducible prognostic variables will improve the predictiveness of prognosis [37]. To date, there are no prognostic factors in ovarian cancer that adequately account for tumor biology and the course of the disease. In recent years, some reports have described the prognostic significance of the amplification and over-expression of the oncogene c-erbB-2 (HER2/neu) in various human cancers, including ovarian cancer. As we have seen, the c-erbB2 proto-oncogene is located on the long arm of chromosome 17. It encodes a 185 kD transmembrane glycoprotein receptor (p185HER2) that has sequence similarities with the EGFR. In ovarian cancer, the percentage of c-erbB-2 positive cases varies from 9% to 32%. Correlation with tumor stage and the degree of histological differentiation was not observed. The overexpression of c-erbB-2 is a new and statistically independent prognostic factor. The over-

Oncogenes

2175

expression of oncogene c-erbB-2 in ovarian cancer can-be detected by IHC staining for the protein p185 and characterizes a group with unfavorable tumor biology and a significantly worse prognosis. Elevated serum levels of the c-erbB-2 oncoprotein have been identified in patients with various cancers known to overexpress the c-erbB-2 oncogene. Antiproliferative effects of monoclonal antibodies directed against p185 have been demonstrated in breast cancer patients. This may lead to a new approach in ovarian carcinoma therapy too, over and above the diagnostic aspects [38]. Within past years, the measurement of serological, histochemical, and molecular genetic markers has had an increasing influence on clinical decisions about initial treatment and follow-up. The most studied and interesting markers in ovarian cancer, CA-125, CA-19.9, tumor-associated trypsin inhibitor (TATI), cancer associated serum antigen (CASA), CEA, tissue polypeptide antigen (TPA), tissue polypeptide specific antigen (TPS), and cytokeratin-19 fragment (CYFRA21-1) are now the most widely used serological tumor markers for management of ovarian cancer patients. Ras oncogenes, C-erb2 proto-oncogene, p53 suppressor gene, and B-cell lymphoma 2 (bcl-2) oncogene are examples of currently used molecular genetic markers. As histochemical markers-proliferation markers, flow cytometric analysis, thymidine labeling index, Ki-67 nuclear antigen or differentiation markers are nowadays the ones most often determined. Some of these markers might be useful adjuncts for monitoring response to therapy, including early detection of tumor reactivation to allow curative therapy and rapid detection of treatment failure. The study of these markers may also lead to a better understanding of the biological characteristics of ovarian cancer. Numerous tumor markers have been recognized as promising prognostic factors. The information derived from studies of these markers also represents the most promising avenue towards new treatment strategies. Nevertheless, to validate these factors, prospective studies of a large patient population are needed [39]. The biology of ovarian cancer covers essentially all aspects of the disease: from how it arises to how it responds to chemotherapy, often becomes refractory to treatment, and ultimately kills the patient. Ovarian cancer is often initially responsive to chemotherapy but ultimately becomes refractory [40]. Previous studies have suggested the safety of conservative surgery with unilateral salpingo-oophorectomy or cystectomy for patients with stage I borderline ovarian tumors. Laparoscopic treatment of adnexal masses has proved to be a safe and effective diagnostic and therapeutic tool in the hands of experienced laparoscopists. For women who are treated conservatively, follow-up is important. Surgery remains the most effective therapy for later stage lesions. Adjuvant therapy for advanced stage of borderline ovarian tumors remains controversial. Conservative management of borderline ovarian tumors is an appropriate therapeutic option for young women with early-stage lesions who wish to preserve their childbearing potential. Available data indicate that in these patients fertility, pregnancy outcome, and survival remain excellent [41]. Conventional therapy for epithelial ovarian cancer, including aggressive cytoreductive surgery followed by combination chemotherapy regimens, has failed to reduce the number of deaths caused by this disease, which remains the most lethal of gynecologic malignancies [42]. Surgery has reached its limits, and further aggressive surgery will result in an inordinate morbidity and mortality. Ovarian carcinoma is ideally treated by complete surgical removal of the cancer, followed by anticancer chemotherapy. Since it is often impossible to remove all of the cancer, adjunctive chemotherapy is playing an increasingly important role in the management of the cancer [43]. Drug discovery in the ovarian cancer arena has led to the activation of several important clinical trials. Many biologic agents have come down the pipeline and are being studied in

2176

Ciro Comparetto and Franco Borruto

phase II trials for recurrent disease. These agents include anti-vascular compounds that disrupt angiogenesis through a variety of mechanisms (e.g., prevention of ligand-binding to the VEGF receptor-2 (VEGF-R2), high-affinity VEGF blockade, oral TKI stimulated by VEGF, inhibition of alpha5beta1 integrin, neutralization of angioproteins, etc.). Other novel drugs include oral platinum compounds as well as those that antagonize the tumor proliferation genes in the Hedgehog pathway, and that target folic acid receptors which are expressed by ovarian cancer cells. In addition, studies are underway with oral agents that inhibit the TK activity associated with two oncogenes (EGFR and HER-2/neu). Finally, emerging technologies in clinical trials include nanotechnology to enhance delivery of chemotherapy to ovarian tumors, drug resistance/sensitivity assays to guide therapy, and agents that mobilize and induce proliferation of hematopoetic progenitor cells to aid in red blood cell, white blood cell, and platelet recovery following chemotherapy [44]. Monoclonal antibodies, which offer the promise of high selectivity for detection and therapy, may be targeted to tumor-associated antigens, GF, receptors, or oncogenes. They may be used alone as immunotherapeutic agents or conjugated to chemotherapeutic drugs, toxins, or radionuclides. Radioimmunoconjugates may also be used for preoperative or intraoperative tumor localization [42]. New anti-cancer drugs must be found or synthesized, and new combinations of current anti-cancer drugs with mechanisms to protect the bone marrow must be explored. The field of genetics and the identification of the patient at high risk because of a familial history of ovarian cancer must be expanded. The role of tumor markers and oncogenes requires more in-depth study so that these signs can play a greater role in monitoring and identifying the patient with early ovarian cancer. The emerging fields of genetic engineering and biologic response modifiers are opening up new avenues for additional modalities of therapy. The expanding areas of research in cancer are starting to dispel the doom and gloom of the last five decades with a spirit of optimism for the diagnosis and treatment of ovarian cancer [43]. In summary, ovarian cancer of epithelial origin is associated with the highest mortality rate of all gynecologic malignancies. Since no symptoms or signs are manifested at the early stages of the disease, it is no surprise that in 75% of patients peritoneal metastases are found during primary surgery. Despite advances in conservative treatment methods (invasive and noninvasive), screening for early detection of the disease is not yet available, and the overall survival rate is as low as 5-15%. Recent studies in molecular biology have drawn attention to different research directions in ovarian cancer and have contributed much to our understanding of this disease and its underlying pathologic mechanisms. Some of the new aspects of this research are, specifically: hereditary ovarian cancer, genetic background in terms of chromosomal changes, DNA anomalies, oncogenes, TSG, peptide GF and cytokines, invasiveness and metastasis, and finally, drug resistance. No breakthrough has as yet occurred in any of these subjects, but results are promising. The clinical application of the steadily increasing knowledge in the biology of ovarian cancer may assist in the development of new treatment modalities that will improve survival [45]. Significant progress has been made in understanding the molecular biology of ovarian cancer and the role that single-nucleotide polymorphisms, TSG, and oncogenes play in promoting tumor cell growth and proliferation. Strategies have been developed to correct gene defects or single out ovarian cancer cells for destruction. Molecular-based therapies are now under development to specifically target receptors and signal transduction pathways that control cell proliferation and apoptosis, angiogenesis, cellular adhesion, and cell motility in ovarian tumors. The end product of this

Oncogenes

2177

intense investigation will be new targeted therapies that offer the hope of improving the medical management of ovarian cancer while being significantly less toxic to normal cells [46].

Endometrial Cancer Endometrial carcinoma is today among the most common malignancies of the female genital tract in industrialized countries, with a lifetime risk among women of 2-3%, and occurs predominantly after the menopause. Recently, the prolonged life expectancy, post-menopausal use of HRT, and the availability of easily applied diagnostic techniques have led to increasing incidence of endometrial cancer. Although during the past several decades, the histopathology, spread patterns, and prognostic factors of endometrial cancers have been better defined, the clinic-pathologic and biologic prognostic parameters should be further evaluated for the better treatment results in endometrial cancer [47]. In order to improve the treatment and follow-up of these patients, various prognostic factors have been extensively studied. Patient age, stage of disease, histologic type, and histologic grade have been shown to influence survival significantly, and the prognostic impact of these traditional clinic-pathologic variables is well established. In addition, parity, hormone receptor concentration in the tumor, DNA ploidy, and morphometric nuclear grade have all been found to influence prognosis. Information about DNA ploidy has especially been used in the clinical situation to determine individualized treatment. Several prognostic markers for tumor cell proliferation, cell cycle regulation (p53, p21, and p16), and angiogenesis have been identified. It is likely that the information derived from these tumor biomarkers will reduce the need for extensive surgical staging and adjuvant treatment in endometrial carcinoma [48]. Approximately 75% of cases are diagnosed at an early stage with a tumor confined to the uterine corpus. Although most patients are cured by surgery alone, about 15-20% with no signs of locally advanced or metastatic disease at primary treatment recurs, with limited responsiveness to systemic therapy. The most common basis for determining the risk of recurrent disease has been classification of endometrial cancers into two subtypes [49]. Increasing evidence, in fact, suggests that the majority of cases can be divided into two different types of endometrial cancer based on clinic-pathological and molecular characteristics. Type I, associated with an endocrine milieu of estrogen predominance, accounts for the majority of cases and is associated with a low-stage, low-grade and endometrioid histology and develop from endometrial hyperplasia. They have good prognosis and are sensitive to endocrine treatment. In contrast, type II endometrial cancers are not associated with a history of unopposed estrogens and develop from the atrophic endometrium of elderly women, are characterized by a high-stage, high-grade and non-endometrioid histology. Mainly, they are of serous papillary or clear cell morphology, have a poor prognosis and do not react to endocrine treatment. However, the prognostic value of this distinction is limited, as up to 20% of type I endometrial cancers recur, while half of type II cancers do not [50]. Both types of endometrial cancer probably differ markedly with regard to the molecular mechanisms of transformation. The transition from normal endometrium to a malignant tumor is thought to involve a stepwise accumulation of alterations in cellular mechanisms leading to dysfunctional cell growth [49]. Molecular techniques have been used to identify specific genetic alterations in endometrial cancers. Overexpression of the HER-2/neu oncogene occurs in 10% of endometrial cancers and correlates with poor survival. Alterations in other TKR (c-fms and EGFR) also occur in some

2178

Ciro Comparetto and Franco Borruto

cases. The c-myc oncogene, which encodes a nuclear transcription factor, also may be overexpressed in some invasive cancers. Mutations in the K-ras oncogene occur in 10% and in 2030% of American and Japanese endometrial cancers, respectively. K-ras mutations also have been observed in endometrial hyperplasias, and this may represent an early event in the development of some cancers. Mutation of the p53 TSG, with resultant over-expression of mutant p53 protein, occurs in 20% of endometrial adenocarcinomas. Over-expression of p53 is associated with advanced stage and poor survival. Because p53 mutations do not occur frequently in endometrial hyperplasias, this may be a relatively late event in endometrial carcinogenesis. Recent studies have shown that mutations occur in microsatellite sequences in some endometrial cancers. Because microsatellite instability in HNPCC has been found to be caused by mutations in DNA repair genes, similar mutations are being sought in endometrial cancers. Although several molecular alterations have been identified, the molecular pathogenesis of endometrial cancer remains poorly understood [51]. Some endometrial cancers and endometrial adenocarcinoma cell lines show amplified expression of proto-oncogenes (fos, fms, myc, myb, neu, and erb-B) and augmented production of GF (CSF-1), EGF, TGF-alpha, and TGF-beta), and EGFR. Oncogene expression, the presence of ER and PgR, and the fraction of cells in S phase are useful biochemical prognostic indicators of clinical outcome, and markers recognized by monoclonal antibodies are available for use in following the clinical course of the disease and responses to treatment. In vivo and in vitro studies on normal and neoplastic tissues are providing evidence of paracrine influences on epithelial cell proliferation. Long-term administration of tamoxifen as adjuvant therapy for breast cancer has recently been found to increase the risk for development of endometrial cancer [52]. Uterine cancer is often diagnosed at an early stage and is therefore considered one of the most curable gynecologic malignancies. Despite this, a substantial number of women who present at more advanced stage or with unfavorable histologies suffer significant morbidity and death from this disease. Research continues along several fronts in an attempt to improve the prognosis for this group of women. Basic scientific research has continued to evaluate mechanisms of carcinogenesis in the hope that better targets for treatment and prevention of disease will be found. Epidemiologic studies have attempted to further define risk factors as well as elucidate risk in those patients receiving combination estrogen and progestin HRT. Clinical studies have further defined prognostic factors, and examined new surgical staging techniques and the need for adjuvant therapy after primary surgery. However, treatment options for advanced and recurrent disease remain limited [53, 54]. In summary, adenocarcinoma of the endometrium is the most common gynecologic malignancy in the United States, accounting for some 36,000 cases of invasive cancer each year. Although most endometrial carcinomas are detected at low stage, there is still a significant mortality from the disease. Hyperplastic lesions of the endometrium follow a continuum, with the risk of progression to carcinoma being related to the severity of the disorder. Risk factors associated with the development of adenocarcinoma include hyperplasia, obesity, menstrual abnormalities, diabetes, hypertension, prior pelvic irradiation, sequential oral contraceptive (OC) use, diet, and exogenous estrogen use. In post-menopausal women, prolonged life expectancy, changes in reproductive behavior and prevalence of overweight and obesity, as well as HRT use, may partially account for the observed increases of incidence rates in some countries. There is also some evidence of genetic predisposition, and some data indicating the possibility of specific genetic abnormalities and activation of oncogenes as factors determining the etiology of the disease. At this time there is no accepted screening test for endometrial

Oncogenes

2179

carcinoma, though the role of immunochemistry techniques for screening and follow-up has just begun to be realized. Dilatation and curettage (DandC) along with hysteroscopy remain the major means of diagnosis. In order to improve treatment and follow-up of endometrial carcinoma patients, the importance of various prognostic factors has been extensively studied. A variety of prognostic variables including tumor cell type (serous carcinoma and clear cell carcinomas [CCC] are poor prognostic types), histological grade, stage of disease, depth of myometrial invasion, lymph node status, peritoneal cytology, presence of disease in preformed vascular spaces, presence of adnexal metastases, lymphovascular space involvement, and presence of cervical involvement have been defined. Other factors currently being investigated are ER and PgR status, p53 status, flow cytometric analysis for ploidy and S-phase fraction, and oncogenes such as HER-2/neu (c-erbB-2). The identification of high-risk groups would make it possible to avoid unnecessary adjuvant treatment among patients with a good prognosis. Although the treatment plan for each patient must be individualized, the mainstay of treatment remains total abdominal hysterectomy with bilateral salpingo-oophorectomy. Metastatic and recurrent disease is usually treated with hormonal therapy and systemic chemotherapy. Radiation therapy like surgery in recurrent disease is only applicable for the treatment of local recurrences [55, 56].

Cervical Cancer Cervical carcinoma is one of the major causes of death in women worldwide. It is difficult to foresee a dramatic increase in cure rate even with the most optimal combination of cytotoxic drugs, surgery, and radiation. Therefore, testing of molecular targeted therapies against this malignancy is highly desirable. Cervical cancer is a multistep process with accumulation of genetic and epigenetic alterations in regulatory genes, leading to activation of oncogenes and inactivation or loss of TSG. In the last decade, in addition to genetic alterations, epigenetic inactivation of TSG by promoter hypermethylation has been recognized as an important and alternative mechanism in tumorigenesis. In cervical cancer, epigenetic alterations can affect the expression of HPV as well as host genes in relation to stages representing the multistep process of carcinogenesis [57]. Significant advances have been made toward the understanding of the initiation and progression of cervical dysplasia and neoplasia at the molecular level. To date, this has not translated into improvements in diagnosis or treatment although it is a realistic expectation that this will occur. Significant variation in the proportion of tissue specimens that exhibit genetic alterations is striking. This may be attributed to different methods of analysis, different methods of tissue fixation, which influence antigen preservation, and the analysis of small numbers of samples per report, which introduces the possibility of sampling error. In spite of the variation among published reports, it is clear that several genetic alterations occur in pre-neoplastic and early-stage invasive cervical neoplasms. The prognostic applicability of oncogene mutations is a particularly interesting area of investigation that is the closest to clinical application, although additional research involving larger numbers of patients is critical. The development of convenient methods of tissue fixation that preserve the myc oncoprotein, the synthesis of specific antibodies that provide consistent results, and the application of computer-assisted image analysis to quantitate results will be particularly important in this regard [58].

2180

Ciro Comparetto and Franco Borruto

Invasive cervical cancer remains a leading cause of morbidity and mortality, especially among women in the developing world where screening is either deficient or absent. Of all agents linked to the causation of this disease, high-risk HPV appears to be the strongest factor. However, not all women with HPV develop cervical cancer. Steroid contraception has been postulated to be one mechanism whereby HPV exerts its tumorigenic effect on cervical tissue. Steroids are thought to bind to specific DNA sequences within transcriptional regulatory regions on the HPV DNA to either increase or suppress transcription of various genes. Although some earlier studies were reassuring as no increased incidence of cervical cancer was observed, subsequent research has shown a causative association, especially among long-term users. The role of steroids was further enhanced by the discovery of hormone receptors in cervical tissue. Some earlier studies of OC steroids found no increased risk, even after controlling for other risk factors, including smoking and number of partners. However, prospective studies have shown a greater progression of dysplasia to CIS with more than 6 years of steroid OC use. Similar findings were also evident from other work, including the Royal College of General Practitioners (RCGP) Oral Contraception Study. The World Health Organization (WHO) Collaborative Study of Neoplasia and Steroid Contraceptives showed a relative risk of 1.2 for invasive cancer in users of the long-acting progestational contraceptive, depotmedroxyprogesterone acetate (DMPA). However, in users of more than 5 years duration, an estimate of 2.4 was reported. The upstream regulatory region (URR) of the HPV type 16 viral genome mediates transcriptional control of the HPV genome and is thought to contain enhancer elements that are activated by steroid hormones. It has been shown that steroid hormones bind to specific glucorticoid-response elements within HPV DNA. Experimental evidence has revealed that high-risk type HPV 16 are able to stimulate the development of vaginal and cervical squamous cell carcinomas (SCC) in transgenic mice exposed to slow-release pellets of 17 beta-estradiol (E2) in the presence of human keratin-14 promoter. SCC developed in a multistage pathway only in transgenic mice and not in non-transgenic mice. The E6 oncoprotein of HPV 16 has been shown to bind to the p53 TSG and stimulate its degradation by a ubiquitindependent protease system. Steroid hormones are thought to increase the expression of the E6 and E7 HPV 16 oncogenes, which in turn bind to and degrade the p53 gene product, leading to apoptotic failure and carcinogenesis. However, the molecular basis of this remains to be proven [59]. The mere presence of the HPV is not sufficient for the development of neoplasia. Genetic and other co-factors seem to be necessary for the expression of the invasive phenotype. The expression of HPV 16 E6-E7 oncogenes results in chromosomal aneuploidy, favoring the integration of high-risk HPV genomes into cellular chromosomes. The integration of HPV 16 may not always be required for the progression to the invasive phenotype, unlike HPV 18 DNA. Such integration sites are randomly distributed over the whole genome. The genetic susceptibility of codon 98 of the fragile histadine triad has been elucidated. The interaction between Human Immunodeficiency Virus (HIV) and HPV are complex and favor the persistence and progression of cervical disease. Future research should pave the way for therapeutic vaccine development [60].

Gestational Trophoblastic Disease Gestational trophoblastic diseases (GTD) are interrelated conditions characterized by abnormal growth of chorionic tissues with various propensities for local invasion and

Oncogenes

2181

metastasis. Complete mole seems to be more like choriocarcinoma and is a unique conception in that all nuclear DNA is paternally derived and all cytoplasmic DNA is maternally derived. In contrast, partial mole generally appears to be more like normal placenta and has a triploid karyotype, where the extra haploid set of chromosomes is paternally derived: GTD are characterized by altered expression of several regulatory GF and oncogenes. These results may have both prognostic and therapeutic consequences and provide insight into the relationship between normal placenta and gestational trophoblastic diseases. While differences in expression of oncoproteins may be important to the development of GTD, the precise molecular changes that are critical to pathogenesis remain unknown [61, 62]. Tumour invasion and trophoblastic invasion share the same biochemical mediators: the MMP and their inhibitors (tissue inhibitor of metalloproteinases [TIMP]). MMP are a family of enzymes capable of digesting the extracellular matrices of the host tissues. Human cytotrophoblastic cells are constitutively invasive and produce MMP. That MMP are causally related to trophoblast invasion in the endometrium is shown by the fact that TIMP inhibit cytotrophoblastic invasion in vitro. In contrast to tumor invasion of a host tissue, trophoblastic invasion during implantation and placentation is stringently controlled both in space and time. The factors responsible for these important regulatory processes are unknown, but in-vitro studies point to autocrine (trophoblastic) and paracrine (endometrial) controls by cytokines and GF. These regulators exert their effects directly or indirectly by activating nuclear transcription factors. Transcription factors are proteins or protein complexes (often the products of oncogenes) that activate genes by binding to specific sites of the DNA located in the regulatory (5’ flanking) region of genes. Some authors have speculated about a potential role of these transcription factors (particularly the oncogenes Jun and Fos) in regulating trophoblast invasion [63, 64].

Oncogenes and Cancer Therapy In the past few years, many encouraging advancements have been made in understanding the molecular mechanisms underlying carcinogenesis and tumor progression. These improvements have led to the identification of promising new targets for cancer therapy [21]. Antisense technology has emerged as an exciting and promising strategy in the fight against cancer. The antisense concept is to selectively bind short, modified DNA or RNA molecules to mRNA in cells and prevent the synthesis of the encoded protein. As anticancer agents, these molecules can be targeted against a myriad of genes involved in cell transformation, cell survival, metastasis, and angiogenesis. Indeed, the list of possible antisense targets increases as the knowledge of the genetic basis of oncogenesis expands. Antisense cancer drugs have entered human clinical trials. At least four of these compounds are currently in phase II trials, including those targeting PKC alpha, bcl-2, c-raf, and the R1-alpha subunit of PKA. A new development in antisense chemistry (peptide nucleic acids) is achieved, along with alternative antisense-related strategies (ribozymes and 2-5A-antisense) designed to overcome some of the challenges of this already encouraging technology [65]. Heparin-binding (HB)-EGF, a member of the EGF family, exerts its biological activity through activation of the EGFR and other erbB receptors. HB-EGF participates in diverse biological processes, including heart development and maintenance, skin wound healing, eyelid formation, blastocyst implantation, progression of atherosclerosis, and tumor formation, through the activation of signaling molecules downstream of erbB receptors and interactions

2182

Ciro Comparetto and Franco Borruto

with molecules associated with HB-EGF. Recent studies have indicated that HB-EGF gene expression is significantly elevated in many human cancers and its expression level in a number of cancer-derived cell lines is much higher than those of other EGFR ligands. Several lines of evidence have indicated that HB-EGF plays a key role in the acquisition of malignant phenotypes, such as tumorigenicity, invasion, metastasis, and resistance to chemotherapy. Studies in vitro and in vivo have indicated that HB-EGF expression is essential for tumor formation of cancer-derived cell lines. CRM197, a specific inhibitor of HB-EGF, and an antibody against HB-EGF are both able to inhibit tumor growth in nude mice. These results indicate that HB-EGF is a promising target for cancer therapy, and that the development of targeting tools against HB-EGF could represent a novel type of therapeutic strategy, as an alternative to targeting erbB receptors [66].

ONCOGENES IN REPRODUCTIVE ENDOCRINOLOGY The union of a healthy egg and a healthy sperm is required for propagation of mammalian species, and thus any factor that disrupts the normal production of female or male gametes is a potential threat to reproductive performance. These hazards to gonadal function are derived from both clinical and environmental sources, and can affect either somatic cell or germ cell lineages, or in some cases both, with equal consequences, i.e., the loss of fertility. Females of the species are particularly at risk to gonadal toxicants since, unlike males, females are born with an irreplaceable stockpile of germ cells in their ovaries at the time of birth. Natural selection processes further dwindle this precious reserve such that by the time of puberty, when eggs could actually be used for fertilization and pregnancy, the number of remaining oocytes has been depleted to less than three-quarters of the starting cohort. In the human female, this completely normal loss of oocytes eventually leads to near-exhaustion of the germ cell reserve around the fifth decade of life, and the menopause ensues. Consequently, exposure of women to potentially damaging agents, such as anti-cancer drugs, industrial chemicals, or even cigarette smoke, can have a dramatic and irreparable effect on the ovary by accelerating the natural process of germ cell depletion and, as a direct consequence, advance the time to menopause. Many gonadal toxicants exert their effects via modulation of discrete signaling pathways linked to apoptotic cell death in the female germ-line [67]. For decades, the mechanisms responsible for germ cell depletion from the ovary, either directly during the perinatal period or indirectly via follicular atresia during post-natal life, have remained relatively obscure. The recent application of sensitive biochemical techniques for the study of cell death to the analysis of ovarian function has revealed that these two events, as well as a third instance of ovarian cell degeneration (luteolysis), are dependent upon the activation of physiological cell death mechanisms. It is therefore hypothesized that the controlled deletion of ovarian cell populations is accomplished via activation of a “universal” pathway of cellular suicide involving altered expression of a conserved cohort of genes [68]. Apoptosis is a process of single-cell deletion requiring active participation of the cell in its own demise. First described in 1972, it is now known to play a major role in embryogenesis, tissue homeostasis, and neoplasia. Apoptosis can be initiated when DNA damage occurs causing the cell to pause in its reproductive cycle. If the DNA damage is beyond repair, the cell proceeds to apoptotic cell death. When the genetic mechanism involved in the pathway of apoptosis is altered, the cell

Oncogenes

2183

does not die. Further mutations occur by proliferation and such multiple mutational events can lead to a malignant phenotype and cancer growth. The TSG p53 causes a DNA-damaged cell to rest and attempt repair. If damage is irreparable, p53 levels will continue to increase, initiating apoptosis. Mutation of p53, found in approximately 50% of cancers, can stop the apoptotic process. Increased bcl-2 expression, an apoptosis inhibitor, also plays a role in cellular transformation and cancer growth. Its altered expression occurs in the presence of oncogene expression. Apoptosis has a role in malignant transformation, cancer growth, and response to therapy for gynecological cancers. For cervical cancer and its precursors, data on apoptotic index, bcl-2, and Bax expression have a relationship to HPV expression. In ovarian epithelial malignancies, apoptosis plays a role in chemotherapeutic responses. The data for endometrial cancer are currently limited to apoptotic index [69]. Through the study of naturally occurring mutations in humans, the creation of mutations by site-directed mutagenesis, and the production of transgenic knockout mice, further understanding of molecular reproductive endocrinology had been achieved. Mutations in the aromatase gene in females have confirmed that its deficiency results in a previously unrecognized form of sexual ambiguity with a 46,XX karyotype, and delayed puberty with multicystic ovaries. It has long been known that estrogen is necessary for skeletal growth and epiphyseal closure in the female, but aromatase and ER gene mutations in men have demonstrated for the first time, that estrogen is important for epiphyseal closure in the male. Mutations in the steroidogenic acute regulatory protein have been recently described that demonstrate the cause for lipoid congenital adrenal hyperplasia, a disorder characterized by the complete lack of steroid production. New gene mutations in human chorionic gonadotropin beta-subunits (beta-hCG), pituitary hormones, G-protein coupled receptors, G-proteins, steroid enzymes and their receptors have also been characterized recently. Site-directed mutagenesis experiments and transgenic knockout mice have been increasingly used to study the effects of normal endocrine function. Normal functions of steroid receptor genes (steroidogenic factor-1, ER, PgR), the glycoprotein alpha-subunit, luteinizing hormone (LH) beta, and proto-oncogenes such as rearranged during transfection (RET) have been better characterized by creating knockout models. Molecular biology techniques permit these types of studies which may be difficult, if not impossible, to perform otherwise in physiologic settings [70, 71]. E2 and ER signaling have been implicated in the development and progression of several cancers. Emerging evidence suggests that the status of ER co-regulators in tumor cells plays an important role in hormonal responsiveness and tumor progression. Proline, glutamic acid, and leucine-rich protein-1 (PELP1), also known as modulator of non-genomic actions of the ER (MNAR), a novel ER co-activator that plays an essential role in the ER’s actions and its expression, is de-regulated in several hormonal responsive cancers, including breast, endometrial, prostate, and ovarian cancer. The precise function of PELP1/MNAR in cancer progression remains unclear, but PELP1 appears to function as a scaffolding protein, coupling ER with several proteins that are implicated in oncogenesis. Emerging evidence suggests that PELP1/MNAR increases E2-mediated cell proliferation and participates in E2-mediated tumorigenesis and metastasis [72]. PELP1 has been shown to participate in both genomic and non-genomic functions of ER. The expression and localization of PELP1/MNAR are deregulated in a wide variety of tumors and have been implicated in the development of hormonal resistance in cancer cell lines. Emerging data suggest that PELP1/MNAR interacts with many proteins and activates several oncogenes, including Src kinase, PI3K, and signal

2184

Ciro Comparetto and Franco Borruto

transducers and activators of transcription 3 (STAT3). These new results suggest that PELP1/MNAR may act as an oncogene as well as cooperating with other oncogenes [73, 74]. The skin expresses ER, PgR, and androgen receptors (AR). In the presence of steroid hormones, such as those contained in OC, the skin likely responds to hormonal signals that control the cell cycle, apoptosis, DNA replication, and other cellular functions. Some estrogenresponsive pathways have the potential to promote tumor development, including the augmentation of EGF signaling, the expression of proto-oncogenes, and inhibition of apoptosis. The question of whether OC increase the risk for the development of skin cancer, particularly melanoma, is still an area of concern. The available evidence suggests that while the skin responds to estrogens, progestins, and androgens, these responses do not significantly increase the risk of developing skin cancer when estrogen exposure is not excessive [75].

Endometriosis Endometriosis, a disease affecting 3% to 10% of women in the reproductive-age group, is one of the most frequent benign gynecological diseases, with an unclear pathophysiology characterized by the ectopic growth of endometrial tissue under the influence of estrogen causing endometrium-like inflammatory lesions outside the uterine cavity. It is also becoming recognized as a condition in which ectopic endometrial cells exhibit abnormal proliferative and apoptotic regulation in response to appropriate stimuli. Apoptosis plays a critical role in maintaining tissue homeostasis and represents a normal function to eliminate excess or dysfunctional cells. Accumulated evidence suggests that, in healthy women, endometrial cells expelled during menstruation do not survive in ectopic locations because of programmed cell death, while decreased apoptosis may lead to the ectopic survival and implantation of these cells, resulting in the development of endometriosis. Both the inability of endometrial cells to transmit a “death” signal and the ability of endometrial cells to avoid cell death have been associated with increased expression of anti-apoptotic factors and decreased expression of preapoptotic factors. Further investigations may elucidate the role of apoptosis-associated molecules in the pathogenesis of endometriosis. Medical treatment with apoptosis-inducing agents may be novel and promising therapeutic strategy for endometriosis [76]. Endometriosis is well established as a condition showing heritable tendencies. Polygenic/multi-factorial etiology appears far more likely to be the etiology than Mendelian inheritance. The current task is to determine the number and location of genes responsible for endometriosis. Endometriosis is a genetic disorder of polygenic/multi-factorial inheritance and bears similarity to neoplasia and, hence, is a multistep phenomenon of clonal origin [77]. Recently, a number of studies have investigated genetic polymorphisms as a possible factor contributing to the development of endometriosis. Current data regarding genes with nucleotide polymorphisms investigated with regard to endometriosis found a strikingly large amount of conflicting results. About 50% of the reviewed studies demonstrated positive correlations between different polymorphisms and endometriosis. This relation is most clearly seen in groups 1 (cytokines and inflammation), 2 (steroid-synthesizing enzymes and detoxifying enzymes and receptors), 4 (estradiol metabolism), 5 (other enzymes and metabolic systems), and 7 (adhesion molecules and matrix enzymes). Group 8 (apoptosis, cell-cycle regulation, and oncogenes) seemed to be negatively correlated with the disease, whereas group 3 (hormone receptors), 6 (GF systems), and especially 9 (human leukocyte antigen [HLA] system

Oncogenes

2185

components) showed a relatively strong correlation. Polymorphisms may have a limited value in assessing possible development of endometriosis. There are some single nucleotide polymorphisms (SNP) relationships that are clinically stronger than others [78]. In a series of studies, it has been hypothesized that endometriotic proliferation is, in part, precipitated by mutations in oncogenes or deletions in TSG that have been shown to be important steps in the transformation from a benign to a malignant epithelium. It has been reported previously that no mutations in the p53 and k-ras genes in cases of endometriosis were find. However, having shown that endometriotic deposits were monoclonal, some authors showed loss of heterozygosity on chromosomes 9p (18%), 11q (18%), and 22q (15%): in total 28% of endometriotic lesions showed loss of heterozygosity at one or more sites. Any loss of heterozygosity in normal endometrium could be demonstrated. Adjacent endometriosis, atypical endometriosis, and EAC of the ovary have been examinated and showed common genetic alterations that are consistent with a common lineage. These common alterations were not seen in lesions that were distant from each other. In EAC, an increased frequency of mutations in the PTEN/methylmalonic aciduria cobalamin deficiency (MMAC) TSG has been reported that was not seen in CCC or serous carcinoma, suggesting distinct developmental pathways for these tumors [79]. Similarly to tumor metastasis, endometriotic implants require neo-vascularization to proliferate, invade the extracellular matrix, and establish an endometriotic lesion. Despite its high prevalence and incapacitating symptoms, the exact pathogenic mechanism of endometriosis remains unsolved. A relationship between endometriosis and gynecological cancer, especially ovarian cancer, has been reported. Endometriosis is a multifactorial and polygenic disease, and emerging data provide evidence that a dysregulation of miRNA expression may be involved. miRNA appear to be potent regulators of gene expression in endometriosis, raising the prospect of using miRNA as biomarkers and therapeutic tools in this disease [11]. There is evidence that endometriosis, as well as drugs used in the process of in vitro fertilization (IVF), appear to associate with increased risk for gynecological cancer. There are data to support that ovarian endometriosis could have the potential for malignant transformation. Epidemiologic and genetic studies support this notion. It seems that endometriosis is associated with specific types of ovarian cancer (EAC and CCC). There is no clear association between endometriosis and breast or endometrial cancer. More studies are needed to establish the risk factors that may lead to malignant transformation of this condition and to identify predisposed individuals who may require closer surveillance. Currently, there is no proven relationship between any type of gynecological cancer and drugs used for infertility treatment. In principle, infertile women have increased risk for gynecologic malignancies. Nulligravidas who received treatment are at increased risk for malignancy compared with women who had conceived after treatment. There is limited evidence that clomiphene citrate use for more than six cycles or 900 mg or treatment of women over the age of 40 could increase their risk for ovarian and breast cancer. More studies with the appropriate statistical power and follow-up time are required to evaluate accurately the long-term effects of these drugs and procedures [80]. Thus, although population-based studies have unequivocally reported an increased risk of ovarian cancer in women with endometriosis, the biological evidence supporting the idea of endometriosis as a pre-neoplastic condition is scanty and not well substantiated. The fundamental features of human neoplasms (monoclonal growth, genetic changes, mutations in TSG and replicative advantage) have been evaluated in endometriotic lesions but results obtained are discordant. It is plausible that ectopic glands may

2186

Ciro Comparetto and Franco Borruto

expand monoclonally but the entity of this phenomenon is debated. According to some allelotyping studies, from one-third to one-half of endometriosis lesions would harbor somatic genetic changes in chromosomal regions supposed to contain genes involved in ovarian tumorigenesis, especially for the endometrioid histotype. These findings would be consistent with the progression model for carcinogenesis from the benign precursor to ovarian cancer but they could not be unequivocally replicated. Gene mutational studies are rare in this context. A single group has found missense mutations and deletions of PTEN gene in about 20% of ovarian endometriotic cysts. Moreover, in a model of genetically engineered mice harboring an oncogenic allele of k-ras resulting in benign lesions reminiscent of endometriosis, a conditional deletion of PTEN caused the progression towards the EAC. Based on these data, the causal link between endometriosis and ovarian EAC/CCC remains to be defined both in terms of entity of association and of underlying molecular mechanisms [81]. In conclusion, although endometriosis generally remains a benign condition, it demonstrates somatically acquired genetic alterations. CCC and EAC are the most frequent types of epithelial ovarian carcinoma (EOC) associated with endometriosis. Retrograde menstruation or ovarian hemorrhage carries highly pro-oxidant factors, such as iron, into the peritoneal cavity or ovarian endometrioma. CCC and EAC should be considered separately in studies of endometriosis-associated EOC. The repeated events of hemorrhage in endometriosis can contribute to carcinogenesis and progression via three major processes: 1) increasing oxidative stress promotes DNA methylation; 2) activating anti-apoptotic pathways supports tumor promotion; and 3) aberrant expression of stress signaling pathways contributes to tumor progression [82, 83].

CONCLUSION Improved molecular techniques have led to the identification of many genetic mutations in gynecologic malignancies [5]. In gynecologic oncologic fields, there are many investigations to explore the basic pathogenesis of gynecologic cancer, such as cervical cancer, ovarian cancer, and endometrial cancer. It is now known that specific types of human papilloma virus (HPV) are the principal etiologic agents for both cervical cancer and its precursors. However, the various kinds of alterations in oncogenes and tumor suppressor genes may play additional roles in carcinogenesis of cervical cancer. Although ovarian carcinoma is the most frequent cause of death from gynecologic malignancies, the histogenesis and biological characteristics of these tumors are not well understood. During the last several years, many key observations have been made concerning the genetic alterations associated with ovarian cancer. Recent researches including some dominant oncogenes and tumor suppressor gene mutations common to these malignancies are providing bases to elucidate the mechanisms underlying this cancer. The most important basis of endometrial cancer is that K-ras and p53 mutations are also frequently observed [1]. The molecular characterization of cancer has provided a better understanding of tumor formation and the clinical behavior of different tumor types, with important implications for developing screening tests and prognostic markers. Applications of these findings have led to novel targeted gene therapies that correct the critical genetic defects

Oncogenes

2187

seen in gynecologic cancers. Future research will focus on the clinical translation of these genetic alterations as targets of cancer prevention, screening, and treatment [5].

REFERENCES [1] [2] [3] [4]

[5] [6] [7]

[8] [9] [10] [11]

[12] [13]

[14] [15] [16]

[17]

Whang, JD; Lee, JH. Molecular genetics of gynecologic cancer. J. Korean Med. Sci., 1997 12, 383-389. Lynch, DH. Oncogenes and cancer. Am. J. Reprod. Immunol. Microbiol., 1987 15, 2428. Taylor, RR; Teneriello, MG; Nash, JD; Park, RC; Birrer, MJ. The molecular genetics of gyn malignancies. Oncology, (Williston Park), 1994 8, 63-70. Ueda, M; Toji, E; Nunobiki, O; Izuma, S; Okamoto, Y; Torii, K; Noda, S. Germline polymorphism of cancer susceptibility genes in gynecologic cancer. Hum. Cell, 2008 21, 95-104. Cass, I; Baldwin, RL; Karlan, BY. Molecular advances in gynecologic oncology. Curr. Opin. Oncol., 1999 11, 394-400. Sekine, M; Tanaka, K. Linkage analysis for identifying genes implicated in hereditary cancers. Nihon Rinsho, 2000 58, 1206-1210. Sakamoto, M; Sakamoto, H; Suehiro, Y; Akiya, T; Iwabuchi, H; Sakunaga, H; Muroya, T; Noda, T; Sugishita, T; Tenjin, Y. CGH (comparative genomic hybridization). Nihon Rinsho, 1996 54, 933-943. Matsuta, M; Nishiya, I. Comparative genomic hybridization (CGH). Hum. Cell, 1993 6 231-236. Maxwell, GL; Carlson, JW. Oncogenes in gynecologic oncology. Obstet. Gynecol. Surv., 1996 51, 710-717. Cirisano, FD; Karlan, BY. The role of the HER-2/neu oncogene in gynecologic cancers. J. Soc. Gynecol. Investig., 1996 3, 99-105. Gilabert-Estelles, J; Braza-Boils, A; Ramon, LA; Zorio, E; Medina, P; Espana, F; Estelles, A. Role of microRNAs in gynecological pathology. Curr. Med. Chem., 2012 19, 2406-2413. Huang, Y. A mirror of two faces: Lin28 as a master regulator of both miRNA and mRNA. Wiley Interdiscip. Rev. RNA, 2012 3, 483-494. Singer, CF; Köstler, WJ; Hudelist, G. Predicting the efficacy of trastuzumab-based therapy in breast cancer: current standards and future strategies. Biochim. Biophys. Acta, 2008 1786, 105-113. Sapi, E. The role of CSF-1 in normal physiology of mammary gland and breast cancer: an update. Exp. Biol. Med. (Maywood), 2004 229, 1-11. Schneider, HP; Jackisch, C. Potential benefits of estrogens and progestogens on breast cancer. Int. J. Fertil. Womens Med., 1998 43, 278-285. Beckmann, MW; Niederacher, D; Schnürch, HG; Gusterson, BA; Bender, HG. Multistep carcinogenesis of breast cancer and tumour heterogeneity. J. Mol. Med. (Berl), 1997 75, 429-439. Kenemans, P; Verstraeten, RA; Verheijen, RH. Oncogenic pathways in hereditary and sporadic breast cancer. Maturitas, 2004 49, 34-43.

2188

Ciro Comparetto and Franco Borruto

[18] Makar, AP; Desmedt, EJ; De Potter, CR; Vanderheyden, JS; Schatteman, EA. Neu (CerbB-2) oncogene in breast cancer and its possible association with the risk of distant metastases. A retrospective study and review of literature. Acta. Oncol., 1990 29, 931934. [19] Karn, T; Metzler, D; Ruckhäberle, E; Hanker, L; Gätje, R; Solbach, C; Ahr, A; Schmidt, M; Holtrich, U; Kaufmann, M; Rody, A. Data-driven derivation of cutoffs from a pool of 3,030 Affymetrix arrays to stratify distinct clinical types of breast cancer. Breast Cancer Res. Treat, 2010 120, 567-579. [20] Sauer, G; Deissler, H; Kurzeder, C; Kreienberg, R. New molecular targets of breast cancer therapy. Strahlenther. Onkol., 2002 178, 123-133. [21] Fischgräbe, J; Wülfing, P. Targeted therapies in breast cancer: established drugs and recent developments. Curr. Clin. Pharmacol., 2008 3, 85-98. [22] Untch, M; von Koch, F; Kahlert, S; Konecny, G. Overview of epirubicin-based adjuvant therapy in breast cancer. Clin. Breast. Cancer, 2000 1 Suppl 1, S41-S45. [23] Murphy, SK. Targeting the epigenome in ovarian cancer. Future Oncol., 2012 8, 151164. [24] Karlan, BY; Krakow, D. Genetic aspects of ovarian cancer. Curr. Opin. Obstet. Gynecol., 1994 6, 105-110. [25] van den Brûle, FA; Lambotte, R; Castronovo, V. Epithelial cancers of the ovary. Recent trends. J. Gynecol. Obstet. Biol. Reprod., (Paris), 1995 24, 241-252. [26] Jassoni, VM; Amadori, A; Gentile, G; Alesi, L. Potential role of growth factors in ovarian cancer. Front Biosci., 1996 1, g14-g19. [27] Dietl, J; Marzusch, K. Ovarian surface epithelium and human ovarian cancer. Gynecol. Obstet. Invest., 1993 35, 129-135. [28] Chow, SN; Chien, CH; Chen, CT. Molecular biology of human ovarian cancer. Int. Surg., 1996 81, 152-157. [29] Berek, JS; Martínez-Maza, O. Molecular and biologic factors in the pathogenesis of ovarian cancer. J. Reprod. Med., 1994 39, 241-248. [30] Li, AJ; Karlan, BY. Genetic factors in ovarian carcinoma. Curr. Oncol. Rep., 2001 3, 2732. [31] Wenham, RM; Lancaster, JM; Berchuck, A. Molecular aspects of ovarian cancer. Best. Pract. Res. Clin. Obstet. Gynaecol., 2002 16, 483-497. [32] Baker, VV. Molecular biology and genetics of epithelial ovarian cancer. Obstet. Gynecol. Clin. North Am., 1994 21, 25-40. [33] Karlan, BY. Screening for ovarian cancer: what are the optimal surrogate endpoints for clinical trials? J. Cell Biochem. Suppl., 1995 23, 227-232. [34] Berchuck, A; Kohler, MF; Boente, MP; Rodriguez, GC; Whitaker, RS; Bast, RC Jr. Growth regulation and transformation of ovarian epithelium. Cancer, 1993 71, 545-551. [35] Gallion, HH; Pieretti, M; DePriest, PD; van Nagell, JR Jr. The molecular basis of ovarian cancer. Cancer, 1995 76, 1992-1997. [36] Fujita, M; Enomoto, T; Murata, Y. Genetic alterations in ovarian carcinoma: with specific reference to histological subtypes. Mol. Cell Endocrinol., 2003 202, 97-99. [37] Berek, JS; Martínez-Maza, O; Hamilton, T; Tropé, C; Kaern, J; Baak, J; Rustin, GJ. Molecular and biological factors in the pathogenesis of ovarian cancer. Ann. Oncol., 1993 4 Suppl 4, 3-16.

Oncogenes

2189

[38] Meden, H; Kuhn, W. Overexpression of the oncogene c-erbB-2 (HER2/neu) in ovarian cancer: a new prognostic factor. Eur. J. Obstet. Gynecol. Reprod. Biol., 1997 71, 173179. [39] Mazurek, A; Nikliński, J; Laudański, T; Pluygers, E. Clinical tumour markers in ovarian cancer. Eur. J. Cancer Prev., 1998 7, 23-35. [40] Auersperg, N; Edelson, MI; Mok, SC; Johnson, SW; Hamilton, TC. The biology of ovarian cancer. Semin. Oncol., 1998 25, 281-304. [41] Tinelli, R; Tinelli, A; Tinelli, FG; Cicinelli, E; Malvasi, A. Conservative surgery for borderline ovarian tumors: a review. Gynecol. Oncol., 2006 100, 185-191. [42] Muto, MG; Kassis, AI. Monoclonal antibodies used in the detection and treatment of epithelial ovarian cancer. Cancer, 1995 76, 2016-2027. [43] Barber, HR. New frontiers in ovarian cancer diagnosis and management. Yale J. Biol. Med., 1991 64, 127-141. [44] Chase, DM; Mathur, N; Tewari, KS. Drug discovery in ovarian cancer. Recent. Pat. Anticancer. Drug. Discov., 2010 5, 251-260. [45] Rabinerson, D; Kaplan, B; Levavi, H; Neri, A. The biology of ovarian cancer of epithelial origin. Isr. J. Med. Sci., 1996 32, 1128-1133. [46] DiSaia, PJ; Bloss, JD. Treatment of ovarian cancer: new strategies. Gynecol. Oncol., 2003 90, S24-S32. [47] Kim, JW; Kim, SH; Kim, YT; Kim, DK. Clinicopathologic and biological parameters predicting the prognosis in endometrial cancer. Yonsei. Med. J., 2002 43, 769-778. [48] Salvesen, HB; Akslen, LA. Molecular pathogenesis and prognostic factors in endometrial carcinoma. APMIS, 2002 110, 673-689. [49] Gründker, C; Günthert, AR; Emons, G. Hormonal heterogeneity of endometrial cancer. Adv. Exp. Med. Biol., 2008 630, 166-188. [50] Engelsen, IB; Akslen, LA; Salvesen, HB. Biologic markers in endometrial cancer treatment. APMIS, 2009 117, 693-707. [51] Berchuck, A; Boyd, J. Molecular basis of endometrial cancer. Cancer, 1995 76, 20342040. [52] Gurpide, E. Endometrial cancer: biochemical and clinical correlates. J. Natl. Cancer Inst., 1991 83, 405-416. [53] Yamada, SD; McGonigle, KF. Cancer of the endometrium and corpus uteri. Curr. Opin. Obstet. Gynecol., 1998 10, 57-60. [54] Takai, N; Ueda, T; Nishida, M; Nasu, K; Miyakawa, I. The relationship between oncogene expression and clinical outcome in endometrial carcinoma. Curr. Cancer Drug. Targets, 2004 4, 511-520. [55] Noumoff, JS; Faruqi, S. Endometrial adenocarcinoma. Microsc. Res. Tech., 1993 25, 246-254. [56] Uharcek, P. Prognostic factors in endometrial carcinoma. J. Obstet. Gynaecol. Res., 2008 34, 776-783. [57] Lu, Q; Ma, D; Zhao, S. DNA methylation changes in cervical cancers. Methods Mol. Biol., 2012 863, 155-176. [58] Baker, VV. Oncogene expression in cervical cancer. Cancer Treat Res., 1994 70, 43-51. [59] Moodley, M; Moodley, J; Chetty, R; Herrington, CS. The role of steroid contraceptive hormones in the pathogenesis of invasive cervical cancer: a review. Int. J. Gynecol. Cancer, 2003 13, 103-110.

2190

Ciro Comparetto and Franco Borruto

[60] Moodley, M. Update on pathophysiologic mechanisms of human papillomavirus. Curr. Opin. Obstet. Gynecol., 2005 17, 61-64. [61] Fulop, V; Mok, SC; Gati, I; Berkowitz, RS. Recent advances in molecular biology of gestational trophoblastic diseases. A review. J. Reprod. Med., 2002 47, 369-379. [62] Fulop, V; Mok, SC; Berkowitz, RS. Molecular biology of gestational trophoblastic neoplasia: a review. J. Reprod. Med., 2004 49, 415-422. [63] Bischof, P; Campana, A. A putative role for oncogenes in trophoblast invasion? Hum. Reprod., 2000 15 Suppl 6, 51-58. [64] Bajoria, R; Sooranna, SR; Ward, BS; Chatterjee, R. Prospective function of placental leptin at maternal-fetal interface. Placenta, 2002 23, 103-115. [65] Kushner, DM; Silverman, RH. Antisense cancer therapy: the state of the science. Curr. Oncol. Rep., 2000 2, 23-30. [66] Miyamoto, S; Yagi, H; Yotsumoto, F; Kawarabayashi, T; Mekada, E. Heparin-binding epidermal growth factor-like growth factor as a novel targeting molecule for cancer therapy. Cancer Sci., 2006 97, 341-347. [67] Tilly, JL. Molecular and genetic basis of normal and toxicant-induced apoptosis in female germ cells. Toxicol. Lett., 1998 102-103, 497-501. [68] Tilly, JL. Apoptosis and ovarian function. Rev Reprod, 1996 1, 162-172. [69] Sheets, EE; Yeh, J. The role of apoptosis in gynaecological malignancies. Ann. Med., 1997 29, 121-126. [70] Layman, LC. Molecular biology in reproductive endocrinology. Curr. Opin. Obstet. Gynecol., 1995 7, 328-339. [71] McDonough, PG. Oncogenic role of the Y chromosome. Ann. N Y Acad. Sci., 1997 816, 356-361. [72] Rajhans, R; Vadlamudi, RK. Comprehensive analysis of recent biochemical and biologic findings regarding a newly discovered protein-PELP1/MNAR. Clin. Exp. Metastasis., 2006 23, 1-7. [73] Nair, S; Vadlamudi, RK. Emerging significance of ER-coregulator PELP1/MNAR in cancer. Histol. Histopathol., 2007 22, 91-96. [74] Vadlamudi, RK; Kumar, R. Functional and biological properties of the nuclear receptor coregulator PELP1/MNAR. Nucl. Recept. Signal., 2007 5, e004. [75] Leslie, KK; Espey, E. Oral contraceptives and skin cancer: is there a link? Am. J. Clin. Dermatol., 2005 6, 349-355. [76] Nasu, K; Nishida, M; Kawano, Y; Tsuno, A; Abe, W; Yuge, A; Takai, N; Narahara, H. Aberrant expression of apoptosis-related molecules in endometriosis: a possible mechanism underlying the pathogenesis of endometriosis. Reprod. Sci., 2011 18, 206218. [77] Simpson, JL; Bischoff, FZ. Heritability and molecular genetic studies of endometriosis. Ann. N Y Acad. Sci., 2002 955, 239-251. [78] Falconer, H; D’Hooghe, T; Fried, G. Endometriosis and genetic polymorphisms. Obstet. Gynecol. Surv., 2007 62, 616-628. [79] Thomas, EJ; Campbell, IG. Molecular genetic defects in endometriosis. Gynecol. Obstet. Invest., 2000 50 Suppl 1, 44-50. [80] Vlahos, NF; Economopoulos, KP; Fotiou, S. Endometriosis, in vitro fertilisation and the risk of gynaecological malignancies, including ovarian and breast cancer. Best Pract. Res. Clin. Obstet. Gynaecol., 2010 24, 39-50.

Oncogenes

2191

[81] Viganó, P; Somigliana, E; Chiodo, I; Abbiati, A; Vercellini, P. Molecular mechanisms and biological plausibility underlying the malignant transformation of endometriosis: a critical analysis. Hum. Reprod. Update, 2006 12, 77-89. [82] Kobayashi, H; Kajihara, H; Yamada, Y; Tanase, Y; Kanayama, S; Furukawa, N; Noguchi, T; Haruta, S; Yoshida, S; Naruse, K; Sado, T; Oi, H. Risk of carcinoma in women with ovarian endometrioma. Front Biosci., (Elite Ed), 2011 3, 529-539. [83] Sekizawa, A; Amemiya, S; Otsuka, J; Saito, H; Farina, A; Okai, T; Tachikawa, T. Malignant transformation of endometriosis: application of laser microdissection for analysis of genetic alterations according to pathological changes. Med. Electron. Microsc., 2004 37, 97-100.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 102

THE CLASSIFICATION, MECHANISMS OF ACTIVATION AND ROLES IN CANCER DEVELOPMENT OF ONCOGENES Patricio Barros-Núñez, Mónica Alejandra Rosales-Reynoso and Clara Ibet Juárez-Vázquez Centro de Investigación Biomédica de Occidente, Instituto Mexicano del Seguro Social, Guadalajara, Jalisco, México

ABSTRACT Cancer is an uncontrolled cell growth caused by accumulation of genetic and epigenetic mutations in genes that normally play a role in the regulation of cell proliferation, survival, apoptosis and cell cycle. Mutations are occurring mainly in oncogenes, tumor-suppressor genes, microRNA genes, or as DNA repair defects and aberrant DNA methylation. Oncogenes encode proteins that control cell proliferation and/or apoptosis. Products of oncogenes can be classified into 6 groups by its biological activity: transcription factors, growth factors, growth factor receptors, signal transducers, chromatin remodeling and apoptotic regulators. The main changes related to oncogene activation are chromosomal translocations and mutations that can occur as early events or during tumor progression; whereas amplification usually occurs during the tumor progression. These alterations are usually somatic events, although germ-line mutations can also predispose to familial cancer. A single genetic change is rarely insufficient for developing a malignant tumor. Most evidences point to a multistep process of sequential alterations in a wide number of oncogenes, tumor-suppressor genes, or microRNA genes related with cancer. Recently, other mechanisms as the inflammation or alterations in the cellular metabolism have been associated with cancer. This chapter describes some of the key molecular mechanisms involved in the development and progression of cancer.



Corresponding Author’s Email: [email protected] (Genetic Research. Centro de Investigación Biomédica de Occidente. Instituto Mexicano del Seguro Social. Sierra Mojada 800. Colonia Independencia. CP: 44340. Guadalajara, Jalisco, México, Tel: 52-33 3668 3000 Ext. 31922).

2194

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez

INTRODUCTION During already long time, it has been accepted that the cancer is caused by the accumulation of genetic and epigenetic changes that lead to abnormal regulation of the cell growth control [1]. Discovery that abnormal genes, named oncogenes, play a crucial role in developing the malignant disease has been decisive in understanding the genetic nature of cancer. More recently, six biological capabilities acquired during the multistep development of human tumors were established as the principal hallmarks of cancer. These features rationalize the complexities of the neoplastic disease and comprise: sustaining proliferative signaling, evading growth suppressors, resisting cell death, enabling replicative immortality, inducing angiogenesis, and activating invasion and metastasis. In addition, two essential components of the tumorigenic disease, which guides the tumor progress, are: genome instability, which generates the genetic diversity that accelerates the hallmarks acquisition, and inflammation, which promotes multiple hallmark functions. Two other emerging tumor features have been added recently: reprogramming of energy metabolism and the microRNA genes that can initiate tumorigenesis, enhance its progression and evade the immune destruction. Finally, neoplastic cells exhibit another type of complexity: a repertoire of recruited and apparently normal cells that contribute to create a “tumor microenvironment” [2-5]. Only the whole understanding of this biological complexity will permit us to develop more efficient cancer treatments. In this chapter we intend review the most important features related with the oncogenes, their activation mechanisms and roles in cancer, and the malignant metabolic reprogramming.

ONCOGENES Are altered forms of normal cellular genes called proto-oncogenes. In human cancers, proto-oncogenes are frequently located adjacent to chromosomal breakpoints and are targets for mutation. Products of proto-oncogenes are highly conserved in evolution and serve to regulate the cascade of events that maintains the ordered progression through the cell cycle, reproduction, and differentiation. In cancer cells, this ordered progression is partially lost when one or more of the components of this pathway are altered [6]. Our understanding of the molecular mechanisms leading to cancer has considerably advanced from the study of oncogenes. The application of techniques from many cancer research disciplines has led to the discovery of both dominantly acting transforming genes and of tumor suppressor genes [6]. Discovery of oncogenes. The majority of oncogenes were initially isolated as altered forms of proto-oncogenes acquired (transduced) by RNA tumor viruses (v-onc). In 1990, Payton Rous [7] discovered that transplantable sarcomas in chickens could be induced by a cell free agent. The transforming agent was a retrovirus that had transduced part of a normal cellular gene called src (sarcoma). The virally transduced src gene (v-src) was altered by mutation compared with its normal cellular counterpart (c-src), rendering it constitutively activated. This discovery demonstrated

The Classification, Mechanisms of Activation and Roles in Cancer …

2195

that our cells harbor genes that, when abnormally activated, are capable of inducing tumorigenesis [8, 9]. Over 70 proto-oncogenes activated by proviral insertion of a non-transforming retrovirus have been identified. This number includes some genes first identified as viral oncogenes [1012]. Detection of oncogenes in human tumors. Evidence for a genetic role in cancer comes from multiple sources. Many of the cancer prone syndromes, such as Fanconi syndrome, Bloom syndrome, and ataxia telangiectasia, show greatly increased chromosome instability [13]. Studies of colon cancer demonstrate that many cancers have accumulated multiple chromosome deletions and mutations [14]. Identification that the bacterial mutS and mutL DNA mismatch repair genes as genetic lesions that predispose individuals to colon cancer further supports the role of mutation in the generation of cancer [15, 16]. Tumoral transformation. Transforming events in cancer development includes three stages: initiation, promotion and progression [17]. Table 1. Chromosome translocation in human cancers [1] Affected gene

BCL-2

Rearrangements Disease Oncogenes juxtaposed with IG loci t(8:14) (q24:q32) t(2:8) (p12:q24) Burkitt Lymphoma; BLt(8:22) (q24:q11) ALL t(11:14) (q13:q32) B-cell chronic lymphocyte leukemia t(14:18) (q32:q21) Follicular Lymphoma

BCL-3 IL-3

t(14:19) (q32:q13.1) t(5:14) (q31:q32)

c-MYC BCL1 (Cyclin D1)

c-MYC LYLA TALI/SCL/TCL-5 TAL-2 Rhombotin 1/ttg-1 Rhombotin 2/ttg-2 HOX11 TAN-1 TCL-1

c-ABL (9q34) BCR (22q11) PBX-1 (1q23)

Chronic B cell leukemia Acute pre-B cell leukemia Oncogenes juxtaposed with TRC loci t(8:14) (q24;q11) Acute T cell leukemia t(7:19) (q35;p13) Acute T cell leukemia t(1:14) (q32;q11) Acute T cell leukemia t(7:9) (q35;q34) Acute T cell leukemia t(11:14) (p15;q11) Acute T cell leukemia t(11:14)(p13;q11) Acute T cell leukemia t(7:11) (q35;p13) t(10:14) (q24;q11) Acute T cell leukemia t(7:9)(q34;q34.3) Acute T cell leukemia t(14:14) (q11;q32.1), T- cell prolymphocytic t(7q35-14q32.1) or leukemia inv14(q11;q32.1) Hematopoietic tumor Gene fusion Chronic and acute t(9:22) (q34;q11) myelogenous leukemia t(1:19) (q23;p13.3) Acute pre-B cell leukemia

Protein type

HLH domain PRADI-G1 Cyclin D1 Inner mitochondrial membrane CDC10 motif Growth factor

HLH domain HLH domain HLH domain HLH domain HLH domain HLH domain Homeodomain Notch homologue

Tyrosine Kinase activated by BCR Homeodomain

2196

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez Table 1. (Continued)

Affected gene E2A (19p13.3) PML(15q21) RAR (17q21) CAN (6-23) DEK (9q34) REL ALL1(MLL)*

Rearrangements

Disease

t(15:27) (q21;q11-22)

Acute promyelocytic leukemia

Protein type HLH Zn finger

T(6:9) (p23;q34)

Acute myeloid leukemia

No homology

Ins (2:12) (p11.2-14) 11q23

FL11, EWS

Non- Hodgkin lymphoma ALL and AML Solid tumors Gene fusions in sarcomas t(11:22) (q24; q12) Ewing´s sarcoma

ERG, EWS

t(21:22) (q22;q12)

Ewing´s sarcoma

ATV1, EWS

t(7:21) (q22;q12)

Ewing´s sarcoma

ATF1, EWS CHN, EWS WT1,EWS

t(12:22) (q13;q12) t(9:22) (q22.31;q12) t(11:22) (p13;q12)

SSX1, SSX2, SYT PAX3, FKHR PAX7, FKHR CHOP, TLS var, HMG1-C

t(X:18) (p11.2;q11.2) t(1:13) (q36;q14) t(1:13) (q36;q14) t(12:16) (q13;p11) t(var:12) (var:q13-15)

Soft-tissue clear cell sarcoma Myxoid chondrosarcoma Desmoplastic small round cell tumor Synovial sarcoma Alveolar Rhabdomyosarcoma Myxoid liposarcoma Lipomas

HMG2-C

t(12:14) (q13;q15)

Leiomyomas

RET/ptc1

Gene fusions in thyroid carcinomas Inv(10) (q11.2;q2.1) Papillary thyroid carcinomas

Ret/ptc2

t(1:17) (q11.2;q23)

Papillary thyroid carcinomas

RET/ptc3

Inv(10) (q11.2)

Papillary thyroid carcinomas

TRK

Inv(1) (q31;q22-23)

Papillary thyroid carcinomas

TRK-t1 (T2)

Inv(1) (q31;q25)

Papillary thyroid carcinomas

TRK-T3

T(1q31;3)

Papillary thyroid carcinomas

TMPR552

ERG ETV1

Gene fusions in prostate cancer T(21q22;21q22.3) 7p21.2

Deregulation of oncogenes Parathyroid tumors Inv(11) (p15q; q13) Parathyroid adenoma

NF-KB family Chromatin modifiers

Ets transcription factor family Ets transcription factor family Ets transcription factor family Transcription factor Steroid receptor family Wilm´s tumor gene HLH domain Homeobox homologue Homeobox homologue Transcription factor HMG DNA binding protein HMG DNA binding protein Tyrosine kinase activated by H4 Tyrosine kinase activated by RIa (Pka) Tyrosine kinase activated by ELE1 Tyrosine kinase activated by TPM3 Tyrosine kinase activated by TPR Tyrosine kinase activated by TFG Ets transcription factor family activated by TMPR552

PTH deregulates PRAD1/Cyclin D1 PRAD1 Cyclin D1 *ALL1 can fuse with more than 50 different genes. More frequently it fuses with AF4 in ALL and AF9 in AML.

The Classification, Mechanisms of Activation and Roles in Cancer …

2197

Oncogenes encode proteins that control cell proliferation, apoptosis or both and chromatin modification [1, 18]. They can be activated by chromosomal alterations resulting from mutation or gene fusion, by juxtaposition to enhancer elements, or by amplification. Genomic changes as chromosomal rearrangements, point mutations, deletions and gene amplification, activation of proto-oncogenes and inactivation of tumor suppressor genes are required for cancer initiation [19]. Amplification usually occurs during tumor progression [1, 20, 21]. Tissue specific mutations. Oncogene activation in human tumors is specific for some tissues; for example, gene amplification of N-myc occurs in neuroblastoma and small cell lung cancer but is extremely rare in other tissues; bcr-abl translocation is observed in most patients with chronic leukemia; mutations in the RAS gene are found in a high percentage of pancreatic, colorectal and lung cancers [22]. The activation of oncogenes by chromosomal rearrangements, mutations and gene amplification confers to the cells, carrying these alterations, greater growth and survival [1, 23]. Cytogenetic rearrangements. Chromosome abnormalities commonly found in cancer cells are inversions and translocations. In hematopoietic cancers and solid tumors, translocations and inversions deregulating the oncogenic transcription are present. In prostate cancer, the mechanism of oncogenic activation is a fusion between a gene with a very active promoter as TMPRSS2, and other with oncogenic activity as ERG1 [24]. In cancers of T and B cells, the most common alterations giving MYC gene deregulation are translocations; while gene fusion is more common in myeloid cancers and soft tissue sarcomas [1]. Table 1 summarizes the most important chromosome abnormalities giving human cancer. Oncogene response. After the oncogenic activation by mutations, the structure of the encoded protein enhances its transforming activity [25]. An example is the RAS oncogenes family: KRAS, HRAS and NRAS. Mutations in RAS genes has been associated with exposure to environmental carcinogens; when mutation occurs in codon 12, 13 or 61, the RAS gene encodes a protein which remains in the active state, so that induces continuous cell growth. KRAS mutations are common in carcinomas of the lung, colon and pancreas, whereas NRAS mutations occur primarily in acute myelogenous leukemia and myelodysplastic syndrome [1, 26]. Activating mutations in the BRAF gene occur in 59% of melanomas, 18% of colorectal cancers, 14% of hepatocellular carcinomas and 11% of gliomas [27]. Most BRAF mutations occur in the protein kinase domain by changing the valine residue to glutamic acid at position 599 (V599E), producing a protein with uncontrolled constitutive activity that stimulates the MAP kinase cascade, allowing proliferation, differentiation and cell survival [1, 27, 28]. Table 2 summarizes some oncogenes and tumor suppressors with their metabolic changes and related diseases.

Oncogene Classification The products of oncogenes can be classified into six broad groups: growth factors, growth factor receptors, transcription factors, chromatin remodelers, signal transducers, and apoptosis regulators (Table 3).

2198

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez Table 2. Biochemical functions of oncogenes and tumor suppressor genes [29]

Gene

Function

TSC1 (hamartin) and TSC2 (tuberin) PTEN

Oncogenes Activates Akt (via PIP3); reduces oxidation (via Akt) enzyme carnitine palmitoyltransferase 1A (CPT1A) Upregulates fatty acid synthase (FASN); activates mTOR complex 1 Increases, through activation of PI3K, Akt, and mTOR expression of FASN and acetylCoA carboxylase  (ACC) at the translational level Generate phosphotyrosines that can bind to pyruvate kinase isoform PKM2, converting it from a tetramer to a less active dimer Binds PKM2, converting it from a tetramer to a less active dimer Tumor Suppressor Genes Required for expression of SCO2 and hence optimal OXPHOS; enhances the expression of TIGAR; as glycolysis inhibitor, reduces the expression of the glycolytic enzyme phosphoglyceromutase Ubiquitin ligase required for degradation of HIF-1 Negative regulators of Rheb (Which inhibit mTOR) Negative regulator of class 1 PI3K

LKB1

Required for activation of AMPK

NF1

Negative regulator of RAS and PI3K-Akt pathway Negative regulator of mTOR complex 1

PI3K

Akt Her2

Tyrosine kinases

E7 from HPV16

p53

VHL

PML Succinate dehydrogenase (SDH). Subunits B,C and D. Fumarate hydratase (fumarase)

Accumulated succinate competitively inhibits HIF-1 prolylhydroxylases (PHDs)

Accumulated fumarate inhibits PHDs

Disease Ovarian and gastrointestinal cancer Breast and ovarian cancer Mammary carcinoma

Multiple cancers

Cervical carcinoma

Multiple cancers

Clear cell renal carcinoma Tuberous sclerosis and lymphangioleiomyomatosis Cowden syndrome and prostate cancer Peutz-Jeghers and sporadic lung adenocarcinoma Neurofibromatosis Promyelocytic leukemia and lung cancer Paraganglioma and pheochromocytoma.

Leiomyomatosis and papillary renal carcinoma

Growth Factors and Growth Factor Receptors Activation of a single growth factor gene can result in malignant transformation. Plateletderived growth factor (PDGF) is released from platelets during coagulation, induce proliferation of various cell types and stimulate fibroblasts to participate in wound healing [1, 30]. Over-expression of PDGF induces the in vitro transformation of fibroblasts containing

The Classification, Mechanisms of Activation and Roles in Cancer …

2199

PDGF receptors, but it does not influence fibroblasts lacking these receptors [1]. This autocrine loop entails over-expression of PDGF-, an antibody against its receptor, or small molecules that block the receptor and inhibit growth of the transformed fibroblasts. Table 3. Classification of oncogenes [1] Oncogene v-myc N-MYC L-MYC v-myb v-fos v-jun v-ski v-rel v-est-1 v-erbA1 v-erbA2 BCL2 MDM2 ALL1 (MLL) v-sis Int2 KS3 HST

EGFR v-fms v-KIT v-ros MET TRK NEU RET

Chromosome

Neoplasm Transcription factors 8q24.1 (MYC) Carcinoma myelocytomatosis 2p24 Neuroblastoma: lung carcinoma 1p32 Carcinoma of lung 6q22-24 Myeloblastosis 14q21-22 Osteosarcoma 1p32-p31 Sarcoma 1q22-24 Carcinoma 2p12-14 Lymphatic leukemia 11p23-24 Erythroblastosis 17p11-21 Erythroblastosis 3p22-24.1 Erythroblastosis Related to apoptosis and others 18q21.3 B cell lymphomas 12q14 Sarcomas Chromatin remodelers 11q23 Chromosome translocation Growth factors 22q12.3-13.1 Glioma/fibrosarcoma 11q13 Mammary carcinoma 11q13.3 Kaposi´s sarcoma 11q13.3 Stomach carcinoma Growth factor receptors Tyrosine kinases: integral membrane protein 7p1.1-1.3 Squamous cell carcinoma 5q33-34 Sarcoma 4q11-21 Sarcoma/GIST 6q22 Sarcoma 7p31 MNNG-treated human osteosarcoma cell line 1q21-q22 Colon/thyroid carcinomas 17q11.2-12 Neuroblastoma/breast 10q11.2 Carcinomas of thyroid Men 2A Men 2B

Mas

6q24-27

SRC v-yes

20q12-q13 18q21.3

Receptors lacking protein kinase activity Epidermoid carcinoma Signal transducers Cytoplasmic tyrosine kinases Colon carcinoma Sarcoma

Mechanism of Activation Deregulated activity Deregulated activity Deregulated activity Deregulated activity Deregulated activity Deregulated activity Deregulated activity Mutant NFkappa B Deregulated activity T3 transcription factors T3 transcription factors Antiapoptotic protein Complexes with p53 Chromatin modifier B chain PDGF Member of FGF family Member of FGF family Member of FGF family

EFG receptor CSF1 receptor Stem cell factor receptor ? HGF/SF receptor NGF receptor ? GFNG/NTT/ART/PSP receptor activation/ fusion proteins Angiotensin receptor

Protein tyrosine Kinase Protein tyrosine Kinase

2200

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez Table 3. (Continued)

Oncogene v-fgr v-fes ABL

Chromosome 1p36.1-36.2 15q25-26 9q34.1

H-RAS K-RAS N-RAS BRAF Gsp Gip

11p15.5 12p11.1-12.1 1p11-13 7q34 20q13.3 17q21.3-q22

Dbl

Xq27

Vav

19p13.2

v-mos v-raf Pim-1

8q11 3p25 6p21

v-crk

17p13.3

Neoplasm Sarcoma Sarcoma CML Membrane-associated G proteins Colon, lung, pancreas carcinomas AML, thyroid carcinoma Carcinoma, melanoma Melanoma, thyroid, colon ovary Adenomas of thyroid Ovary, adrenal carcinoma GTPase exchange factor (GEF) Diffuse B cell lymphoma Hematopoietic cells Serine/threonine kinases: cytoplasmic Sarcoma Sarcoma T-cell lymphoma Cytoplasmic regulators

Mechanism of Activation Protein tyrosine Kinase Protein tyrosine Kinase Protein tyrosine Kinase GTPase GTPase GTPase Gs alpha Gi alpha GEF for Rho and Cdc42Hs GEF for Ras ? Protein Kinase (ser/thr) Protein Kinase (ser/thr) Protein Kinase (ser/thr) SH-2/SH-3 adaptor

ALL: Acute lymphoblastic leukemia; AML: acute myeloid leukemia; CML: chronic myelogenous leukemia; GTPase: guanosine triphosphatase; PDGF: Platelet-derived growth factor

Another example is the WNT glycoprotein family that inhibits the phosphorylation of catenin, which participate in cell-cell adhesion and activation of several signal transduction pathways [31-33]. The APC protein actively participates controlling the activity of -catenin. In familial adenomatous polyposis, inactivating mutations of APC block the degradation of catenin by inhibiting its phosphorylation. As a result, free -catenin in the cytoplasm translocates into the nucleus, where activates genes involved in cell proliferation and invasion [33] (Figure 1). Growth factor receptors are altered in several cancer types (figure 2) [1, 34]. In many tumors, a deletion of the ligand-binding domain of epidermal growth factor receptor (EGFR), a trans-membrane protein with tyrosine kinase activity, causes constitutive activation of the receptor in absence of ligand binding. The activated receptor phosphorylates tyrosines in the intracellular domain of the receptor, providing interactions sites for cytoplasmic proteins containing the SRC homology domain and other binding domains. These interactions deregulate signaling in several pathways. Activating mutations occur in three other members of the EGFR family (ERBB2, ERBB3 and ERBB4) and within the kinase domains of the HER2/neu and KIT signaling receptors [35]. Such mutations occur in lung and breast cancer and gastrointestinal stromal tumors. Two classes of clinically active anti-EGFR agents have been developed: a monoclonal antibody against the extracellular domain of the receptor (e.g., cetuximab) and competitive inhibitors of the tyrosine kinase activity of the receptor (e.g., erlotinib and gefitinib) [35].

The Classification, Mechanisms of Activation and Roles in Cancer …

2201

Figure 1. Dual functions of  catenina in cell adhesion and transcription activation.  catenin is in a destructive cytoplasmic complex composed of activated protein C (APC), axin, glycogen synthase kinase 3 beta (GSK-3), and casein kinase (CK1).

Figure 2. Examples of receptor tyrosine kinases. The epidermal growth factor (EGF), platelet-derived growth factor (PDGF) and fibroblast growth factor (FGF) receptors have been found to be involved in a variety of human cancers. Modified to [36].

Vascular endothelial growth factor (VEGF) regulates hypoxia-dependent control of gene transcription (Figure 3). The activity of VEGF is mediated by three receptor tyrosine kinases: VEGFR1 (FLT1), VEGFR2 (FLK1-KDR) and VEGFR3 (FLT4). VEGF stimulates angiogenesis in a variety of cancers, and inhibitors of VEGF and VEGFRs have been developed. Bevacizumab is a monoclonal anti-VEGF antibody, and SU5412, a small molecule, binds the receptor tyrosine kinases of the VEGFR1 and VEGFR2 as well as the kinases of the

2202

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez

PDGF receptor and KIT. In addition to inhibiting the ABL kinase, imatinib also inhibits the PDGF and KIT receptor kinases. Gastrointestinal stromal tumors that carry activating mutations of KIT respond to imatinib or other inhibitors of these receptor kinases [37, 38].

Figure 3. Role of VEGF-VEGFR interaction in angiogenesis. Several pathways are activated by the interaction of vascular endothelial growth factor (VEGF) and VEGF receptor (VEGFR) FAK denotes fatal adhesion kinase, Flk fetal liver kinase, IP3 inositol triphosphate, KDR kinase insert domain containing receptor, MAPK mitogen-activated protein kinase, PI3K phosphoinositol 3 kinase, PKB protein kinase B, and PLC phospholipase C. (Modified to [1].

Transcription Factors Usually, transcription factors are members of multigene families sharing common structural domains. Many transcription factors require interaction with other proteins; for example, the Fos transcription protein dimerizes the Jun transcription factor to form the AP1 transcription factor, which increases the expression of several genes that control the cell division [39]. Chromosomal translocations often activate transcription factor genes in lymphoid cancers and sometimes in solid tumors (e. g., prostate cancer, see table 2). In certain sarcomas, chromosomal translocations resulting in fused proteins occur consistently; in Ewing´s sarcoma, for example, the EWS gene is fused with one of a number of partner genes, resulting in aberrant transcriptional activity of the fused proteins. The EWS protein is an RNA binding molecule with a domain that, when fused to a heterologous DNA binding domain, can greatly stimulate gene transcription. Prostate carcinomas carry translocations of the TMPR552 gene that fuse with and activate ERG1 or

The Classification, Mechanisms of Activation and Roles in Cancer …

2203

ETV1. These genes are members of the Ets (E-26) family of transcription regulators, which can activate or repress genes involved in cellular proliferation, differentiation, and apoptosis. The Ets family of transcription factors characterized by an evolutionarily-conserved DNAbinding domain regulates expression of a variety of viral and cellular genes by binding to a purine-rich GGAA/T core sequence in cooperation with other transcriptional factors and cofactors. Most Ets family proteins are nuclear targets for activation of Ras-MAP kinase signaling pathway and some of them affect proliferation of cells by regulating the immediate early response genes and other growth-related genes. Some of them also regulate apoptosis-related genes. Several Ets family proteins are preferentially expressed in specific cell lineages and are involved in their development and differentiation by increasing the enhancer or promoter activities of the genes encoding growth factor receptors and integrin families specific for the cell lineages. The fusion of TMPR552, which has androgen-responsive promoter elements, with an ETS related gene creates a fusion protein that increases proliferation and inhibits apoptosis of cells in the prostate gland, thereby facilitating their transformation into cancer cells [1, 40, 41].

Chromatin Remodelers Chromatin compaction plays a critical role in the control of gene expression, replication and repair, and chromosome segregation. Two kinds of enzymes participate in the remodeling of chromatin: 1. ATP dependent enzymes that move the positions of nucleosomes, the repeating subunits of histones in chromatin around which DNA winds, and 2. Enzymes that modify the N-terminal tails of histones [42, 43]. The pattern of histone modifications constitutes an epigenetic code that determines the interaction between nucleosomes and chromatin associated proteins. These interactions, in turn, determine the structure of chromatin and its transcriptional capacity [44]. In acute lymphocytic leukemia and acute myelogenous leukemia, the ALL1 (also named MLL) gene can fuse with 1 of more than 50 genes. ALL1 is part of a very large, stable multiprotein complex. Most of the proteins in the complex are components of transcription complexes; others are involved in histone methylation and RNA processing [45]. The entire complex remodels, acetylates, and methylates nucleosomes and free histones. The fusion of ALL1 with 1 of more than 50 proteins results in the formation of the chimeric proteins that underlie acute lymphoblastic leukemia and acute myelogenous leukemia. ALL1 fusion proteins deregulate homeobox genes (which encode transcriptions factors) the EPHA7 gene (which encodes a receptor tyrosine kinase), and microRNA genes such as miR191 [45].

Signal Transducers Binding of receptor tyrosine kinases to the appropriate ligand causes reorganization of the receptors and autophosphorylation of tyrosines in the intracellular portion of the molecules [46]. Autophosphorylation enhances the kinase activity of the receptor or promotes the interaction of the receptor with domains of cytoplasmic proteins that are effectors and

2204

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez

regulators of intracellular signaling [47]. In humans, there are approximately 120 SRC homology 2 domains in 100 different proteins that mediate responses to signals initiated by phosphorylated tyrosines. Some of these proteins share domains with enzymatic activity, whereas others link activated receptors to downstream targets. Many oncogenes encode members of signal transduction pathways. They fall into two main groups: nonreceptor protein kinases and guanosine-triphosphate-binding proteins. The nonreceptor proteins kinases are of two types: tyrosine kinases (e.g., ABL, LCK, and SRC) and serine and threonine kinases (e.g., AKT, RAF1, MOS and PIM1). Proteins involved in signal transduction become oncogenic if they bear activating mutations. An important example is PI3K and some of its downstream targets, such as AKT and SGK, which are critical in tyrosine kinase signaling and can be mutated in cancer cells [48, 49].

Apoptosis Regulators The BCL2 gene, which is involved in the initiation of roughly all follicular lymphomas and some diffuse large B-cell lymphomas [50, 51], encode a cytoplasmic protein that localizes in mitochondria and increases cell survival by inhibiting apoptosis. The BCL2 family members inhibit apoptosis and are up-regulated in several other cancer types as chronic lymphocytic leukemia and lung cancer [52]. Two main pathways lead to apoptosis: the stress pathway and the death-receptor pathway (Figure 4). The stress pathway is triggered by proteins that contain the BCL2 homology 3-domain, which inactivates BCL2 and BCL-XL and inhibits apoptosis. Drugs that mimic the BCL2 homology 3-domain and can bind to BCL-XL or BCL2 (peptides or small organic molecules that bind in a groove of these proteins) are under development. The death-receptor pathway is activated by binding of Fas ligand, TRAIL, and tumor necrosis factor , to their corresponding (death) receptors on the cell surface. Activation of death receptors activates caspases that cause cell death [53, 54] (Figure 4).

Figure 4. The two main pathways to programmed cell death, or apoptosis. The effectors of cell death are the downstream caspases, proteolytic enzymes activated by caspases 8 and 9, which are capable of clearing many of the cellular proteins causing cell death. FADD denotes Fas-associated death domain. Modified to [1].

The Classification, Mechanisms of Activation and Roles in Cancer …

2205

Gene amplification usually occurs before the tumor progression; an example is the DHFR amplification in methotrexate-resistant acute lymphoblastic leukemia [55]. Amplification of DHFR is accompanied by cytogenetic abnormalities that reflect the oncogene amplification [56, 57]. The amplified DNA segment contains many genes and usually involves hundreds of kilobases. Amplification phenomenon is frequently involved in oncogenes families as MYC, CCND1, EGFR and RAS. In several cancer types as small-cell lung, breast, esophageal, cervical, ovarian and head and neck, NMYC amplification correlates with advanced tumor stage [58]. CCND1 amplification occurs in breast, esophageal, hepatocellular, and head and neck cancer. EGFR is amplified in glioblastoma and head and neck cancer. ERBB2 amplification in breast cancer correlates with a poor prognosis [1, 59].

Chronic Inflammation as Activation Mechanism Inflammation is an important mechanism that can remove the agent responsible for the injury and initiate tissue repair and regeneration by a coordinated release of immune response [19]. The mechanism inflammatory involves innate and adaptive immune response. After elimination of the pathogen and wound healing, inflammation decreases [60]. However, an unsolved inflammatory process can disrupt cellular microenvironment, which leads to alterations in genes related to cancer and posttranslational modification of key proteins in the cell cycle, DNA repair and apoptosis [60]. In early stages of development and progression of tumor, mononuclear cells, macrophages, mast cells and neutrophils are present through up-regulation of pro-inflammatory cytokines such as interferon-γ, tumor necrosis factor (TNF), interleukin (IL)-1α / β or IL-6. Also the activated nuclear factor-kB (NF-kB) is a transcription factor that relates inflammation and tumorigenesis, allowing pre-neoplastic and malignant cells evade apoptosis. Therefore, all these factors may act as initiators and promoters of carcinogenesis [60]. The role of chronic inflammation in carcinogenesis has been evaluated in several epidemiological studies, where pro-inflammatory and anti-inflammatory cytokines, viral infections and genetic markers involved in the inflammatory response were analyzed [60, 61]. It is estimated that the underlying infections and inflammatory reactions are related to 15-25% of all cancer cases [60-62]. Association between inflammatory processes and cancer are well known in the case of intestinal disease and colorectal cancer, virus hepatitis B (or C) and alcoholic liver cirrhosis or hepatocellular carcinoma, chronic esophageal reflux resulting in Barrett's esophagus and esophageal carcinoma, infection by human papilloma virus and cervical cancer, prostatitis and prostate cancer and infection by helicobacter pylori with gastric cancer [60, 63, 64]. In other cases, cancer is related with chronic irritation caused by long exposure to cigarette, silica and asbestos [63, 64]. The mechanism by which inflammation predispose cancer depends on whether it is secondary to chronic irritation or infection. In the case of HPV malignant transformation is mediated by E6 and E7 oncoproteins [65]. In other cases, the oncogenic activation occurs by the classical mode; for example, H. pylori contain protein factors that affect host cell signaling [66]. The chronic inflammatory response can lead to genomic injury and initiation of malignant transformation. A defense mechanism is the production of free radicals such as reactive oxygen

2206

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez

intermediated (ROI), hydroxyl radical (•OH) and superoxide (O2-•) and reactive nitrogen intermediates (RNI), nitric oxide (NO•) and peroxynitrite (ONOO-), which are formed by the enzymatic reaction in the host (myeloperoxidase, NADPH oxidase and nitric oxide) governed by different signaling pathways [67]. Intrinsic cellular mechanisms to prevent the unregulated proliferation or mutations in DNA are diverse, among them tumor suppressors involved in DNA repair, cell cycle arrest, apoptosis and senescence [19]. During the face of massive cell death, by infectious or noninfectious injury, cell repopulation occurs from the undifferentiated precursor cells, for which two sequential steps are required: first, some cells must survive, and second, must be a clonal expansion of this undifferentiated precursor cells in order to maintain the tissue functioning. The development of new cells is regulated by inflammatory pathways [68, 69] as part of the repair process and in defense of the infection. In initiated cells, the inflammatory response, providing cell survival and proliferation, possibly is leading to tumor promotion [19]. Evident association between tumorigenesis and host defense and / or tissue repair have been reported. Most of the studies described are based in tissue injuries and wounds that support tumor growth and neoplastic progression. For example, injection of the Rous sarcoma virus causes sarcoma in the injection site [70], probably mediated by transforming growth factor-β (TGF-β) and fibroblast growth factors (FGFs) [71]. Some metabolic signaling pathways are involved; among them the Wnt-β-catenin pathway [72] and molecules COX-1 and 2 [73]. Other studies have focused on the role NF-kB (transcription factors) in tumorigenesis. Inactivation of the classical NF-kB in colonic epithelial cells due to deletion of the IKB protein kinase β (IKKβ) decreases the frequency of visible tumors [19, 74]. So in the colonic epithelium injured and that was added as a mutagen azoxymethane (AOM), the NF-B provides a survival signal for cells initiated [75]. Otherwise, the IKKβ acts protection injury infectious or noninfectious and host defense in intervening in survival of colon epithelial cells [76, 77]. Many inflammatory mediators such as cytokines, chemokines and eicosanoids stimulate the proliferation of normal and transformed cells [63]. After the administration of the phorbol ester TPA (12-O-tetradecanoylphorbol-13-acetato) and the mutagen DMBA (7, 12dimethylbenza-anthracene) in TNF-deficient mice, fewer skin tumors were observed. Based on these experiments, the authors suggest that inflammatory mediators act as tumor promoters [78]. In the presence of tumor initiation and tissue injury and apoptosis, activation of inflammation depend tissue repair/compensatory proliferation leading to tumor promotion [19].

REPROGRAMMING OF METABOLIC PATHWAYS IN CANCER Cancer cells require greater amounts of nutrients from the bioenergy reserves, for which different metabolic pathways are activated or modified. The signals that stimulate cell proliferation are also involved in the reorganization of the metabolic activities that allow the resting cells, initiate proliferation. The new conditions of the metabolism of cells differ from normal cells metabolism mainly by the high rate of glycolysis, lactate production, biosynthesis of lipids and other macromolecules [79].

The Classification, Mechanisms of Activation and Roles in Cancer …

2207

The first observations on metabolic alterations in tumors were reported in 1920, highlighting that tumor cells of ascites in conditions of rapid proliferation consume large amount of glucose, and excrete most of the carbon as lactate, rather than oxidize it completely as do the normal cells. This phenomenon is called "Warburg effect" [80]. Warburg proposed that tumor cells use the increase of the glycolytic flow as protection before permanent damage of oxidative metabolism [79, 81]. The Warburg effect is not observed in the process of cell proliferation from all tumors [29]. This increase in the consumption of glucose, which increases the production of ATP and anabolic reactions, offers some advantages for tumor growth. First, for obtaining ATP, tumor cells use glucose as the most abundant extracellular nutrient in anaerobic glycolysis, and although the production of ATP per glucose is low, the high glycolytic flow generated exceeds the production of ATP from oxidative phosphorylation (OXPHOS) [29, 81]. Second, degradation of glucose provides the necessary intermediate compounds for different anabolic reactions, thus: ribose for synthesis of nucleotides; glucose6-phosphate to form glycogen and ribose-5-phosphate; dihydroxyacetone phosphate for synthesis of triglycerides and phospholipids; pyruvate for synthesis of alanine and malate; and, through oxidative pentose phosphate pathway (PPP) produce nicotinamide adenine dinucleotide phosphate (NADPH) [29, 79]. Third, the cancer cells produce lactic and bicarbonic acid; lactate is the main end product of anaerobic glycolysis. The acidic conditions create a favorable environment for the tumor, inhibiting autoimmune effects of anti-cancer. In this atmosphere the anaerobic components (cancer cells) and aerobic (non-transformed stromal cells) are involved in metabolic pathways, complementary, recycling products of anaerobic metabolism to maintain the survival and growth of cancer cells. Fourth, tumors can metabolize glucose by the pentose phosphate pathway to generate NADPH and thus ensure antioxidant defenses against a hostile environment with chemotherapeutic agents [29]. In this way, the entire metabolism is reorganized to increase anabolic processes that enable growth and cell proliferation [29]. We will summarize some of the mechanisms modified in cellular signaling and key aspects of the metabolism of both normal physiological and tumorigenic proliferation. Likewise, the PI3K/Akt/mTOR pathway and the MYC and HIF-1a transcription factors, which appear to regulate complementary aspects of cell metabolism, will be analyzed [79].

Metabolic Activity in Cell Proliferation Normal mammalian cells do not proliferate in an autonomous way, entering the cell cycle by indication of growth factors and signaling pathways that influence gene expression and cellular physiology. The proliferating cells depend on growth factors to generate this metabolic flux and enhance the uptake of nutrients from the extracellular space [79]. In the absence of growth factors, mammalian cells quickly lose expression of transporters of nutrients and cannot keep cell autonomy for the synthesis of basal bioenergetics and macromolecular replacement. In this case, the cells carry out autophagy, which provides a limited supply of substrates generated from the macromolecular to maintain the production of ATP for cell survival [82]. The transduction of signals for cell proliferation has direct effects on the metabolic flux [79]. The mechanisms that integrate the signal transduction and cell metabolism are highly conserved between normal cells and tumor cells. The biggest difference is that in normal cells, the initiation of signaling requires extracellular stimulation, while cancer cells present

2208

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez

mutations chronically favoring these routes, maintaining metabolic biosynthesis phenotype, regardless of the physiological limitations of the normal cell. In other words, the cancer cells achieve an increase in metabolic autonomy. For example, in cell proliferation the enzyme lactate dehydrogenase (LDH-A) is induced by oncogenes like HER2/neu and MYC promoting cell proliferation [79]. Other enzymes highly expressed in tumors are the embryonic isoforms of pyruvate kinase (PKM2), fatty acids synthase (FASN), choline kinase (ChoK) [29, 83], and the lipogenic enzymes ATP citrate lyase and fatty acid synthase [79, 81, 84]. Rarely, tricarboxylic acid (TCA) cycle enzymes as succinate dehydrogenase (SDH) and fumarate hydratase (FH) behave as tumor suppressor; thus, mutations in the SDHB, SDHC and SDHD subunits can cause familial paraganglioma or pheochromocytoma [85], mutations in FH produce a dominant syndrome of uterine fibrosis, leiomyomata and renal carcinoma of papillary cells [79, 86]. Proliferating cells use intermediate compounds derived from the TCA cycle to synthesize lipids, proteins and nucleic acids, so use this cycle as a center of biosynthesis [79].

PI3K/Akt/mTOR Signaling Pathway The activation of the PI3K/Akt/mTOR pathway both in growth factors dependent cells as in tumour cells, improves many of the metabolic activities that keep the cell biosynthesis by several processes. First, the cells increase expression of transporters and the consumption of glucose, amino acids and other nutrients [87, 88]. Second, Akt (v-akt murine thymoma viral oncogene) increases glycolysis and the production of lactate, which is sufficient to induce the Warburg effect in normal and cancer cells [89]. Third, PI3K and Akt stimulate the synthesis of lipids in many cell types, mTOR (mechanistic target of rapamycin) is key in regulating the protein translation [81, 90, 91]. In normal cells, the activation of the PI3K system is controlled by the phosphatase PTEN (phosphatase and tensin homolog). In malignant cells, the pathway can be triggered by mutations that activate PI3K or increase the stimuli of the system (BCR-ABL, HER2/neu amplification, etc.) or eliminate negative regulators of the same PTEN [79] (Table 4). Table 4. Key mutations involved in PI3K pathway [79] Gene PIK3CA

Mutation Gene activation

Akt2 PTEN BCRABL

Gene amplification Gene amplification Loss of heterozygosity Fusion by chromosomal translocation

HER2/neu EGFR

Gene amplification Gene amplification

Cancer Breast Colon Head and neck Ovary Glioma Chronic myelogenous leukemia Acute lymphocytic leukemia Breast Lung (non-small cell)

Frequency 25% 30% 35% 12% 40% 90% 20% 25% 50

The Classification, Mechanisms of Activation and Roles in Cancer …

2209

Regulation of Glycolysis by HIF-1 One of the most important mechanisms involved in the aerobic glycolysis is the activation of hypoxia inducible factor (HIF); it is a transcription factor induced by hypoxic and oxidative stress, as well as oncogenic, inflammatory and metabolic factors [81, 92]. HIF-1 is a heterodimer composed of a stable β subunit and a unstable α subunit, both synthesized in normoxia by sequential action of the enzymes prolyl hydroxylase dependent of oxygen (PHDs) and ubiquitin ligase VHL [29, 81]. The active form of HIF-1 (HIF-1a subunit) is expressed under the control of growth factor signaling pathways, mainly PI3K/Akt/mTOR [93]. In hypoxia, prolyl hydroxylation is inhibited by reactive oxygen species (ROS) from mitochondria, resulting in stable transcriptional activity of HIF-1 complex [79]. In tumor cells, stimulation by growth factors is required to express HIF-1a, necessary for regulating the intracellular fate of carbon derived from glucose [79] (Figure 5).

Figure 5. Tumor cells near to blood vessels are well oxygenated, whereas more distant tumor cells are poorly oxygenated and express high levels of HIF-1, which induces the expression of proteins that increase: uptake of glucose (glucose transporter 1 (GLUT1); conversion of glucose to pyruvate (glycolytic enzymes [Glyc. Enz.]); generation of lactate and H+ (LDHA); and efflux of these molecules out of the cell (carbonic anhydrase IX (CA9), sodium-hydrogen exchanger 1 (NHE1), encoding the transporter 4 monocarboxylate (MCT4). In these hypoxic cells, two moles of lactate are produced for each mole of glucose, associated with a reduced substrate delivery to the mitochondria through the action of pyruvate dehydrogenase kinase 1 (PDK1). Hypoxic cells generate 2 mol of ATP and 2 mol of lactate for each mol of glucose consumed, whereas aerobic cells generate 36 mol of ATP per 2 mol of lactate consumed. Modified to [94].

HIF-1 stimulates the conversion of glucose to pyruvate and lactate by means of glucose transporter type 1 (GLUT1), hexokinase (HK2 and HK1), LDHA and monocarboxilate transporter type 4 (MCT4). In addition, HIF-1 reduces the conversion of pyruvate to acetylCoA by action of the pyruvate dehydrogenase (PDH) [79, 94]. HIF-1 cooperates with the protooncogene MYC to aerobic glycolysis promotion by induction of HK2 and pyruvate dehydrogenase kinase 1 (PDK1) [29, 79].

2210

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez

Tumor cells show cyclical changes in phases of oxygenation, which involves a dynamic regulation of metabolic symbiosis, where cells can change from a state of lactate production to one of consumption of the same. Intratumoral hypoxia is associated with increased risk of metastasis and mortality [94] (Figure 5).

Metabolic Changes and Cancer Cells Cancer cells differ from normal cells by a number of changes in their physiological processes, including autonomous proliferation, angiogenesis, apoptosis evasion, limitless replicative potential, tissue invasion or metastasis and immune response (Figure 6) [5, 29]. 









Autonomous proliferation: Growth factors regulate two transduction signals in the Ras/Raf/MAP kinase pathway: ERK and PI3K. Both activate mTOR to stimulate cell growth. Most cancers have mutations in the main regulators of this pathway: K-Ras, H-Ras, N-Ras, B-Raf, subunit p110a of PI3K, receptor tyrosine kinase (RTKs) or its effectors downstream (Akt and PDK1), or inactivating mutations of negative regulators of these proteins [95]. Over activation of the PI3K/Akt system in autonomous cells provides increase in the flow of glucose and amino acids that may be attributable to the activation of HIF-1a. Akt stimulates the expression of GLUT1 and translocation to the plasma membrane of GLUT4. In addition, Akt stimulates glycolysis by activation of 6-fosfofructo-2-kinase (PFK2) and synthesis of fatty acids by phosphorylation of ATP citrate lyase [29]. Apoptosis evasion: Alterations in the OXPHOS can induce resistance to apoptosis. Likewise, inhibition of the respiratory chain can inhibit the activation of proteins proapoptotic Bcl-2, Bax and Bak [96]. In studies published by Bonnet et al. [97], the pharmacological inhibition of PDK1, an enzyme that catalyzes the phosphorylation and inactivation of PDH, produces the reactivation of PDH, induces apoptosis in cancer cells, which is an interesting example of reversal of resistance to apoptosis and metabolic reprogramming [29]. Continuous replication: To immortalize the replicative power, tumor cells often mutate or inactivate inducers of senescence as the tumor suppressor p53 [98]. In glycolysis, enzyme phosphoglycerate mutase (PGM), which is negatively regulated by p53, catalyzes the conversion of 3-phosphoglycerate (3PG) to 2-phosphoglycerate (2PG) [99]. Angiogenesis: In response to hypoxia and HIF-1, many tumors over-express the vascular endothelial growth factor (VEGF) by activation of the ERK and PI3K signaling pathways [29, 100]. On the other hand, mitochondrial protein F1F0-ATPase, whose function is to provide the necessary protons for aerobic glycolysis, is inhibited by angiostatin, which prevents the endogenous angiogenesis by intracellular acidification [29]. Chi et al. [101], reported an antibody similar to angiostatin with angiogenesis inhibitor effect. Tissue invasion and metastasis: E-cadherin is involved in the intercellular union [29]. Activation of HIF-1a causes loss of E-cadherin and expression of proto-oncogenes met and TWIST that induce metastasis through the chemokines receptor (CXCR4) and lysyl

The Classification, Mechanisms of Activation and Roles in Cancer …



2211

oxidase (LOX) [102, 103]. Thus the activation of HIF-1 can lead to metabolic reprogramming and tissue invasion and metastasis [29]. Immune response: The antitumor effects of cytotoxic T lymphocytes (CTLs) can be inhibited by the metabolic micro-environment of the tumor cells [29]. The macrophages associated with tumors are markers of poor prognosis: facilitate angiogenesis as well as promotion and migration of tumor cells [104]. In advanced stage cancer, the production of lactate inhibits the production of cytokines, the CTLs cytolytic activity and the cell proliferation. Alternative therapies modifying the tumor metabolism have been proposed inhibiting the protons exportation and the production of lactate or indolamine 2, 3-dioxygenase, which could restore the defective antitumor immune response [29].

The metabolic inhibitors used as therapeutic targets in cancer, are in early stages; only the antagonists of mTOR and large AMPK activators have shown to reduce the incidence of cancer [105, 106] (Table 5).

Figure 6. Cancer cell changes and their links to tumor metabolism. Hypothetical links between different metabolic alterations and the non-metabolic characteristics of neoplasia [circle] are depicted. Centripetal arrows indicate how the changes in cancer cells can impinge on metabolism. Centrifugal arrows illustrate how neoplasia-associated metabolic reprogramming can contribute to the acquisition of cancer changes. Ang-2: angiopoietin-2; GLUT: glucose transporter; HIF: hypoxia-inducible factor; HK: hexokinase; OXPHOS: oxidative phosphorylation; PGM: phosphoglycerate mutase; PI3K: phosphatidylinositol 3-kinase; SCO2: synthesis of cytochrome c oxidase 2; VDAC: voltage-dependent anion channel; VEGF: vascular endothelial growth factor. Modified to [29].

2212

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez Table 5. Metabolic pathways in cancer as therapeutic target [29]

Target Glucose uptake Hexokinase [HK1 and HK2] Pyruvate dehydrogenase kinase 1 [PDK1] Lactate dehydrogenase A [LDHA] Pyruvate kinase [PK] isoenzyme PKM2

Desired Effects

Examples of Compounds

Glycolysis Glucose transport or initial glycolysis inhibition. Inhibition of enzymatic activity and dissociation from mitochondria Inhibition of PDK1 for deinhibition of pyruvate dehydrogenase Inhibition Translocation of PKM2 to the nucleus for induction of apoptosis

2-Deoxyglucose has radiosensitizing and chemosensitizing effects 3-Bromopyruvate has potent antitumor effects in vitro and in vivo Dichioroacetate [DCA]

SiRNA Somatostatin and its derivative TT-232 [in vitro]

Fatty Acid Synthesis ATP citrate lyase [ACL]

Inhibition

Acetyl-CoA Carboxylase [ACC] Fatty acid Synthase [FASN] Choline kinase [ChoK]

Inhibition

HIF-1  prolylhydroxylases [PHDs] Hypoxia-inducible factor 1 [HIF-1] Reactive oxygen species [ROS] Hypoxia

Na+/H+ exchanger Bicarbonate/Cl- exchanger MCT1 lactate /H+ symporter Carbonic anhydrases 9 and 12 [CA9 - CA12] F1F0 ATP synthase

SB-2049990 inhibits pancreatic cancer growth in nude mice Soraphen A induces apoptosis or autophagy in vitro Cerulenin and its derivative C57 inhibit human ovarian cancer MN58b reduces phosphomonoesters in human cancer xenografts

Inhibition Inhibition HIF Activation of PHDs for inhibition of HIF Inhibition of DNA binding

Cell-permeating -ketoglutarate derivatives reverse HIV activation in SDH- or FH-deficient cells Echinomycin

Antioxidants neutralize ROS and reduce HIF-1 function via PDHs and VHL Cytotoxic effects of components enriched in hypoxic cells Proton Extrusion Inhibition Inhibition Inhibition

N-acetylcysteine [NAC]; vitamin C

Inhibition

Sulfonamide indisulam

Inhibition

Tirapazamine [TPZ], a hypoxia activated prodrug. Cariporide S3705 -cyano-4-OH-cinnamate

Angiostatin; antibodies Other

AMPK

Activation

eIF4E

Inhibition of translation initiation by eIF4E Inhibition to reduce amino acid transport

L-type amino acid transporter 1 [LAT1]

Biguanides and thiazolidinediones activate AMPK through inhibition of OXPHOS, reducing the risk of cancer in diabetic patients Antisense oligonucleotide inhibits growth of human breast cancer 2-aminobicyclo [2.2.1]-heptane 2carboxylic acid inhibits tumor growth in a xenograft model

The Classification, Mechanisms of Activation and Roles in Cancer …

2213

CANCER INITIATION AND PROGRESSION Cancer is a very heterogeneous disease. Tumors that arise in the same tissue can even exhibit an array of cellular pathologies, ranging from benign hyperplasia to highly invasive malignancies. On the other hand, cancer is a complex disease which involves the deregulation of multiple pathways. Microarray analysis has identified thousands of genes that are transcriptionally deregulated in cancer [107]; however, it remains unclear which deregulated genes play a causative role in tumor initiation and maintenance and which ones represent passerby with no selective advantage. Regardless of the role that specific genes may play in cancer progression, when a tumor is histological or clinically identified, a large number of molecular lesions have been accumulated [108]. A literature survey on all published cancer genes identified 291 genes for which there were molecularly characterized mutations and evidence of a causative role in tumorigenesis; these genes represent more than 1 percent of the human genome [109]. The large number of mutations found in tumor samples raises the question of whether there exists a common thread that underlies most, if not all, human malignancies, or biological rules that govern cancer initiation and progression. Despite the heterogeneity observed in cancer, most tumors share certain characteristics: self-sufficiency in growth signals, insensitivity to anti-growth signals, evasion of apoptosis, acquisition of a limitless replicative potential, sustained angiogenesis, and tissue invasion and metastasis [5, 108]. The similarity in the cellular processes in all cancer cells, regardless of their tissue of origin, likely indicates common tumor-initiation mechanisms. When chronic myelogenous leukemia converts to acute leukemia, the malignant clone acquires an additional t(9;22) translocation, an isochromosome 17, or trisomy of chromosome 8. Likewise, when follicular lymphoma becomes aggressive, the lymphoma cells often bear a t(8;14) translocation in addition to the original t(14;18) translocation [1]. These findings support the hypothesis that most hematopoietic tumors and soft-tissue sarcomas are initiated by the activation of an oncogene, followed by alterations in tumor-suppressor genes and other oncogenes. In contrast, most carcinomas are initiated by the loss of function of a tumorsuppressor gene, followed by alterations in oncogenes and additional tumor-suppressor genes [110]. Comparative genomic hybridization has revealed a number of genes that can be amplified or deleted in cancer. Breast cancer genome analyses indicate that there are only a few genes that are frequently mutated but many that are rarely mutated, providing an explanation for the heterogeneity in cancer. Complex somatic DNA rearrangements, mostly intra-chromosomal duplications, have been found in the breast cancer genomes [111]. Genome sequences of primary breast cancer and cancer metastasis show restricted de novo mutations in metastasis, but significantly shared mutations in the primary tumor. These studies provide information on tumor evolution and identify pathways critical to breast cancer metastasis [112]. The ErbB2, PI3KCA, MYC, and CCND1 oncogenes are frequently deregulated in breast cancer. Loss-of-function mutations of RB in breast cancer cell lines and primary tumors were reported since 1988 [113]. At least ten tumor suppressor genes, all of which are involved in the regulation of genomic integrity, have been associated with hereditary breast cancer [114]. Cellular transformation is thought to take place through the accumulation of mutations, as well as epigenetic changes, that activate oncogenes or down regulate tumor-suppressor genes

2214

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez

and lead to uncontrolled clonal expansion. Oncogenes originally were identified as the transforming agents of tumor viruses; later oncogenes were recognized as mutated versions of normal cellular genes, or proto-oncogenes, which had been incorporated into the viral genome by recombination [115]. The positive control of cellular growth is associated with mutations in oncogenes, which are generally dominant. In contrast, tumor suppressor genes function as negative regulators of cellular growth and are generally recessive. Thus, inactivation of both copies of a tumorsuppressor gene is usually necessary for tumor development. Several lines of evidence indicate that mutations in a single oncogene or tumor suppressor are insufficient to give rise to cancer [115]. First, most cancers develop late in life and the incidence of disease increases dramatically with age. Statistical analysis of epidemiological data shows that a cell needs to accumulate four to five sequential genetic lesions in key regulatory pathways in order to become malignant [116]. Second, in vitro experiments using cell lines, as well as in vivo models of cancer, confirm the multiple-hit hypothesis (retinoblastoma and certain types of leukemia are exceptions). Experiments using retroviruses containing activated versions of growth-controlling genes could lead to transformation of rodent cells in culture [117, 118]. However, the cells used in these initial cancer studies were immortal and could therefore proliferate indefinitely. When these experiments were repeated with primary cell lines, it was found that activation of at least one pair of oncogenes was required for transformation [119]. Tumors are histologically classified as presenting with different “grades,” which correspond to a set of physiological markers as loss of differentiation, abnormal ploidy, and morphology, and correlate with patient outcome. Higher grade tumors have a more negative prognosis, while low-grade tumors are often considered early lesions and may progress to more invasive, high-grade disease. These observations have led to the hypothesis that cancer progression can be dissected into a small number of crucial steps whose sequential deregulation is critical for the clinical progression from low- to high-grade cancer. At least four pathways must be altered in order for tumor progression to occur: maintenance of telomere length (achieved by expressing human telomerase), deregulated cell-cycle entry (inactivation of Rb), deregulated cell growth arrest and apoptosis (inactivation of p53), and growth-factor independence (by oncogenic Ras overexpression). It remains to be explored how different oncogenes and tumor-suppressors found in tumor samples contribute to these cancer pathways and how they interact with each other to reinforce their tumorigenic potential [120]. Multistep process observed in human cancer has also been found in mouse models carrying activated oncogenes or inactivated tumor-suppressor genes, in which the duration and aggressiveness of the disease can be changed by introducing into the mouse genome the same sequential genetic alterations observed in human tumors.

ONCOGENES AS THERAPEUTIC TARGETS Cancer mouse models have been used to test the hypothesis that, if tumor growth remains dependent on their original transforming oncogenic mutations, oncogene inactivation could lead to tumor regression [121]. Several studies evaluating the over expression of the MYC oncogene in lymphoid and epidermal tissues showed that the inactivation of MYC led to sustained tumor regression with concomitant promotion of either differentiation or apoptosis

The Classification, Mechanisms of Activation and Roles in Cancer …

2215

[121-123]. However, in other models, a fraction of tumor cells were refractory to MYC inactivation; these cells presumably had acquired new mutations that allowed Myc-independent growth [124-126]. The main cause of treatment failure for cancer patients are the metastasis. According to the model of metastatic progression only a small subset of cells from the primary tumor acquire the requisite mutations to metastasize to distant sites, where new mutations are accumulated as a response to the different selective pressures of a novel environment [127]. However, recent data suggest that most cells in primary tumors with metastatic potential already contain the lesions necessary for metastasis and, possibly, for survival in a foreign environment. Microarray analysis compared patterns of gene expression in breast cancer patients with their known five-year survival and recurrence rates. Seventy genes were identified that could predict clinical outcome with a combined 83 percent accuracy [128]. Moreover, solid tumors of different origin shared the same metastatic signature, implying there is a common set of molecules regulating metastasis in a variety of primary tumors [129, 130]. Oncogenic proteins in cancer cells can be targeted by monoclonal antibodies when expressed on the cell surface, or by small molecules acting on specific molecules in particular metabolic ways. For example, imatinib targets the initial step of the multistep process in chronic myelogenous leukemia [131]. The same drug can affect the KIT and PDGFR receptor kinases. [132, 133]. Of particular interest are inhibitors of the BCL2 family, which can induce the apoptotic death of cancer cells. In acute promyelocytic leukemia, which is initiated by a t(15;17) chromosome translocation that fuses the PML gene to RARα (a nuclear receptor for retinoic acid), addition of retinoic acid can induce terminal differentiation and death of APL cells. This modality is called differentiation therapy [134, 135].

MicroRNA Genes Recent findings in molecular biology show that the participation of small regulatory noncoding RNA is required for cellular diversity in developing and mature organisms. These molecules act as sequence-specific post-transcriptional regulators in the expression of other RNA transcripts [136]. Small regulatory non-coding RNA molecules include microRNAs (miRNAs), small interfering RNAs (siRNAs) and repeat-associated siRNAs (rasiRNAs), which are unified by their association with the argonaute (AGO) family of proteins and by their function. All these RNAs direct the binding of protein complexes to specific nucleic acid sequences [137- 139]. Unlike other genes involved in cancer, miRNAs do not encode proteins. Their products are a single RNA strand of about 21 to 23 nucleotides implicated in to regulate the gene expression. A miRNA molecule can anneal to a messenger RNA (mRNA) containing a complementary nucleotide sequence and blocking the protein translation or causing degradation of the mRNA [140]. Mapping of numerous miRNA genes has shown that many of them occur in chromosomal regions that undergo rearrangements, deletions, and amplifications in cancer cells. The genome regions that are consistently involved in chromosomal rearrangements in cancer cells but that lack oncogenes or tumor-suppressor genes appear to harbor miRNA genes [141]. Recent studies have shown that the RNA Pol III drives miRNA transcription from dense human clusters interspersed among repetitive Alu elements. These gene clusters are transcribed

2216

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez

as polycistronic primary transcripts and subsequently cleaved into multiple miRNAs, or from intergenic regions as independent transcriptional units, or from intronic sequences of proteincoding or non-coding transcription units or exonic sequences of non-coding genes [142] (Figure 7). Primary miRNAs transiently receive a 7-methylguanosine (7mGpppG) cap and a poly(A) tail and is processed into a precursor miRNA (pre-miRNA) by the nuclear RNase III enzyme Drosha and its partner DiGeorge syndrome critical region gene 8 (DGCR8). Exportin-5 transports premiRNA into the cytosol, where it is processed by the Dicer RNaseIII enzyme into a mature double strand miRNAs. The RNA strand is recruited into the RNA-induced silencing (RISC) effector complex and assembled through processes that are dependent on Dicer and other double strand RNA binding domain proteins, as well as on members of the argonaute family. MiRNAs guide the RISC complex to the 30 untranslated regions (30-UTR) of the complementary messenger RNA (mRNA) targets for repress their expression by several mechanisms: repression of mRNA translation, destabilization of mRNA transcripts through cleavage, deadenylation, and localization in the processing body (P-body), where the miRNAtargeted mRNA can be sequestered from the translational machinery and degraded or stored for subsequent use. Nuclear localization of mature miRNAs has been described as a novel mechanism of action for miRNAs. Scissors indicate the cleavage on pri-miRNA or mRNA [143]. Expression profiling of miRNA genes has revealed signatures associated with tumor classification, diagnosis, staging, and progression, as well as prognosis and response to treatment. For example, miRNA expression profiling can distinguish between indolent and aggressive forms of chronic lymphocytic leukemia, and expression of a small panel of miRNA genes correlates with prognosis in lung cancer [144- 146]. Some miRNA genes that are deregulated in chronic lymphocytic leukemia have germ-line or somatic mutations in a miRNA precursor that affect the processing of short single-stranded miRNA molecules [144]. MiRNA genes can be up-regulated or down-regulated in cancer cells. The up-regulated miRNA genes function as oncogenes by down-regulating tumor-suppressor genes, whereas the down-regulated miRNA genes function as tumor- suppressor genes by down-regulating oncogenes [147]. Table 6 display a number of examples of up or down regulated miRNAs in cancer. The function of miRNA genes depends on their targets in a specific tissue. A miRNA gene can be a tumor suppressor if its critical target is an oncogene and it can be an oncogene if its target is a tumor-suppressor gene. Up-regulation of miRNA genes can be due to amplification, deregulation of a transcription factor, or demethylation of CpG islands in the promoter regions of the gene. For example, the ALL1 (MLL) fusion proteins of acute lymphoblastic leukemia or acute myeloblastic leukemia carrying chromosome 11q23 translocations target the Drosha nuclease complex to specific miRNA genes, including miR191, thereby enhancing the processing of their miRNA precursors [148]. The miR191 gene is also up-regulated in numerous types of solid cancers [149], suggesting that it is the downstream target of signaltranslocation pathways involved in cancer. MiRNA genes functioning as tumor suppressors can be down-regulated because of deletions, epigenetic silencing, or loss of the expression of one or more transcription factors [150]. The miR155 gene is over expressed in diffuse large B-cell lymphoma, the aggressive form of chronic lymphocytic leukemia, and in breast, lung, and colon cancers [151]. In transgenic mice under control of the Eμ enhancer of the immunoglobulin genes, over expression of

The Classification, Mechanisms of Activation and Roles in Cancer …

2217

miR155 causes acute lymphoblastic leukemia or high-grade lymphoma, indicating that deregulation of a single miRNA gene can cause malignant transformation. Since it takes several months for the tumors in these mice to become aggressive, it is likely that additional genetic alterations are needed for the development of truthful neoplasia [152]. The LET7 miRNA family, which are deleted or under expressed in lung cancer, target RAS; loss of LET7 results in overexpression of RAS [153]. MiR15a and miR-16-1, the microRNAs those are deleted or down-regulated in chronic lymphocytic leukemia, cause overexpression of BCL2, which protects cells from apoptosis [154]. The expression of a set of 21 miRNAs is altered in at least three types of solid tumors [149]. Among these, miR21 is of particular interest because inhibits expression of the tumor suppressor PTEN, which encodes a phosphatase involved in the PI3K kinase signaling pathway and is mutated in advanced breast, lung, gastric, and prostate cancers [155]. Table 6. MiRNAs aberrantly expressed in cancers [146] Cancer type

Up regulated

Down regulated

Breast cancer

miR-10b, miR-21, miR-22, miR-27a, miR-155, miR-210, miR-221, miR-222, miR-328, miR-373, miR-520c

let-7, miR-7, miR-9-1, miR17/miR-20, miR-31, miR-125a, miR-125b, miR-146, miR-200 family, miR-205, miR-206, miR335

Chronic lymphocytic leukemia

miR-21,miR-155

miR-15, miR-16, miR-29b, miR29c, miR-34a, miR-143, miR145, miR-181b, miR-223

Lung cancer

miR-17-92 cluster, miR-21, miR-106a, miR-155

miR-1, let-7 family, miR-7, miR15a/miR-16, miR-29 family

Lymphoma

miR-17-92 cluster, miR-155

miR-143, miR-145

Prostate cancer

miR-221, miR-222

miR-15a-miR-16-1 cluster, miR101, miR-127, miR-449ª

Glioblastoma

miR-21, miR-221, miR-222

miR-7

Hepatocellular carcinoma

miR-17-92 cluster, miR-21, miR-143, miR-224

miR-1, miR-101, miR-122a

Colorectal cancer

miR-17-92 cluster, miR-21

miR-34a, miR-34b/c, miR-127, miR-143, miR-145, miR-342

Gastric cancer

miR-21, miR-27ª

miR-143, miR-145

Ovarian cancer

miR-214

miR-34b/c, miR-200 family

Melanoma

miR-221, miR-222

let-7ª, miR-34ª

Head and neck squamous cell carcinoma

miR-21

let-7d, miR-138, miR-205

2218

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez

Primary miRNAs (pri-miRNAs) receive a 7-methylguanosine (7mGpppG) cap and a poly(A) tail. The pri-miRNA is processed into a precursor miRNA (pre-miRNA) and exported by the protein exportin-5 into cytosol, where is processed by the Dicer RNaseIII enzyme, into 22 nt-long double strand miRNAs. Then, miRNAs guide the RISC complex to the untranslated regions of the mRNA targets for repressing their expression.

Figure 7. On the top line: (A) Gene clusters giving polycistronic primary transcripts and cleaved into multiple miRNAs; (B) intergenic regions transcribed as independent transcriptional units; (C) intronic sequences (in grey) of non-coding transcription units or exonic sequences (black cylinders) of non-coding genes. TF: transcription factor.

REFERENCES [1] [2] [3]

Croce CM. Oncogenes and Cancer. New Engl. J. Med. 2008 Jan; 358(5):502-511. Carmeliet P, Jain RK. Angiogenesis in cancer and others diseases. Nature. 2000 Sep; 407(6801):249-257. Bergers G, Benjamin LE. Tumorigenesis and the angiogenic switch. Nat. Rev. Cancer. 2003 Jun; 3(6):401-410.

The Classification, Mechanisms of Activation and Roles in Cancer … [4] [5] [6]

[7] [8] [9]

[10] [11] [12] [13] [14] [15]

[16]

[17] [18]

[19] [20]

[21]

[22] [23]

2219

Bindea G, Mlecnik B, Fridman WH, Pagès F, Galon J. Natural immunity to cancer in humans. Curr. Opin. immunol. 2010 Apr; 22(2):215-222. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011 Mar 4; 144(5):646-674. Morag P. Oncogenes. En: The metabolic basis of inherited disease: Scriver CR. Beaudet AL, Sly WS, Valle D. Ed. Mc Graw-Hill. Inc. 7ma. Edition New York. 2001; pp 645644. Rous P. A sarcoma of the fowl transmissible by an agent separable from the tumor cells. J. Exp. Med. 1911 Apr; 13:397–411. Temin HM. On the origin of genes for neoplasia: Clowes Memorial Lecture. Cancer Res. 1974 Nov; 34(11):2835-41. Stehlin D, Varmus H, Bishop J, Vogt P. DNA related to the transforming genes of ovarian sarcoma viruses is present in normal avian. Nature. 1976 Mar; 260 (5547):1703. Bishop JM. Enemies within: The genesis of retrovirus oncogenes. Cell. 1981 Jan; 23(1):5-6. Aaronson SA. Growth factors and cancer. Science. 1991 Nov; 254(5035):1146-53. Butel JS. Viral carcinogenesis: revelation of molecular mechanism and etiology of human disease. Carcinogenesis. 2000(21):405-426. Hanawalt P, Sarasin A. Cancer prone hereditary diseases with DNA processing abnormalities. Trends Genet. 1986; 2:124. Vogelstein B, Fearon ER, Scott EK, Hamilton SR, Preisinger AC, Nakamura Y, et al. Allotype of colorectal carcinomas. Science. 1989 Apr; 244 (4901):207-11. Leach FSC, Nicolaides NC, Papadopoulos N, Liu B, Jen J, Parsons R. et al. Mutations of a mutS homolog in hereditary non-polyposis colorectal cancer. Cell. 1993 Dec; 75 (6):1215-25. Fishel R, Lescoe M, Rao MR, Copeland N, Jenkins NA, et al. The human mutator gene homolog MSH2 and its association with hereditary non polyposis colon cancer. Cell. 1993 Dec; 75 (5):1027-38. Kinzler KW, Vogelstein B. Lessons from hereditary colorectal cancer. Cell. 1996 Oct; 87(2):159-70. Konopka JB, Watanabe SM, Singer JW, Collins SJ, Witte ON. Cell lines and clinical isolates derived from Ph1 positive chronic myelogenous leukemia patients express c-abl proteins with a common structural alteration. Proc. Natl. Acad. Sci. USA. 1985 Mar; 82(6):1810-1814. Rakoff-Nahoum S. Why Cancer and Inflammation? Yale J. Biol. Med. 2006 Dec; 79 (34);123-130. Tsujimoto Y, Gorham J, Cossman J, Jaffe E, Croce CM. The t(14, 18) chromosome translocations involved in B-cell neoplasm result from mistakes in VDJ joining. Science. 1985 Sep; 229(4720):1390-1393. Finger LR, Harvey RC, Moore RC, Showe LC, Croce CM. A common mechanism of chromosomal translocation in T and B cell neoplasia. Science. 1986 Nov; 234(4779):982-985. Meza-Junco J, Montaño-Loza A, Aguayo-González A. Bases moleculares del cáncer. Rev. Invest. Clin. 2006 Jan-Feb; 58(1); 56-70. Bishop JM. Molecular themes in oncogenesis. Cell. 1991 Jan 25; 64(2):235-248.

2220

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez

[24] Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW, et al. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science. 2005 Oct; 310:644-8. [25] Rodenhuis S. ras and human tumors. Semin Cancer Biol. 1992 Aug; 3(4):241-247. [26] Beaupre DM, Kurzrock R. RAS and leukemia: from basic mechanisms to gene-directed therapy. J. Clin. Oncol. 1999 Mar; 17(3):1071-1079. [27] Davies H, Bignell GR, Cox C, Stephens P, Edkins S, Clegg S, et al. Mutations of the BRAF gene in human cancer. Nature 2002 Jun; 417(6892):949-54. [28] Frattini M, Ferrario C, Bressan P, Balestra D, De Cecco L, Mondellini P, et al. Alternative mutations of BRAF, RET and NTRK1 are associated with similar but distinct gene expression patterns in papillary thyroid cancer. Oncogene. 2004 Sep; 23(44): 743640. [29] Kroemer G & Pouyssegur J. Tumor Cell Metabolism: Cancer´s Achilles´ Heel. Cell Metabolism. 2008 Jun;13(6), 472-82. [30] Heldin CH, Westermark B. Mechanisms of activation and in vivo role of platelet-derived growth factor. Physiol. Rev. 1999 Oct; 79(4):1283-1316. [31] Giles RH, van Es JH, Clevers H. Caught up in a Wnt storm: wnt signaling in cancer. Biochim. Biophys. Acta. 2003 Jun; 1653(1):1-24. [32] MacDonald BT, Tamai K, He X. Wnt/beta-catenin signaling: components, mechanisms and diseases. Dev. Cell. 2009 Jul; 17(1):9-26. [33] Valkenburg KC, Williams BO. Mouse models of prostate cancer. Prostate Cancer. 2011;2011:895238. [34] Helding CH. Dimerization of cell surface receptors in signal transduction. Cell. 1995 Jan; 80(2):213-223. [35] Arteaga CL. Epidermal growth factor receptor dependence in human tumors: more than just expression?. Oncologist. 2002; 7 Suppl 4:31-39. [36] Schiller MR. Coupling receptor tyrosine kinases to Rho GTPases-GEFs wthat´s the link. Cell signal. 2006 Nov; 18(11):1834-1843. [37] Joensuu H, Dimitrijevic S. Tyrosine Kinase inhibitor imatinib (STI571) as an anticancer agent for solid tumours. Ann. Med. 2001 Oct; 33(7):451-455. [38] Tamborini E, Bonadiman L, Greco A, Albertini V, Negri T, Gronchi A et al. A new mutation in the KIT ATP pocket causes acquired resistance to imatinib in a gastrointestinal stromal tumor patient. Gastroenterology. 2004 Jul; 127(1):294-299. [39] Shaulian E, Karin M. AP-1 in cell proliferation and survival. Oncogene. 2001 Apr; 20(19); 2390-2400. [40] Oikawa T, Yamada T. Molecular biology of the Ets family of transcription factors. Gene 2003 Jan;16(303):11-34. [41] Tomlins SA, Rhodes DR, Perner S, Dhanasekaran SM, Mehra R, Sun XW, et al. Recurrent fusion of TMPRSS2 and ETS transcription factor genes in prostate cancer. Science. 2005 Oct; 310(5748):644-648. [42] Peterson CL, Workman JL. Promoter targeting and chromatin remodeling by SWI/SNF complex. Curr. Opin. Genet. Dev. 2000 Apr; 10(2):187-192. [43] Jenuwein T, Allis CD. Translating the histone code. Science. 2001 Aug; 293(5532):1074-1080. [44] Strahl BD, Allis CD. (2000). The language of covalent histone modifications. Nature. 2000 Jan; 403(6765):41-45.

The Classification, Mechanisms of Activation and Roles in Cancer …

2221

[45] Nakamura T, Mori T, Tada S, Krajewski W, Rozovskaia T, Wassell R, et al. ALL-1 is a histone methyltranferase that assembles a supercomplex of proteins involved in transcriptional regulation. Mol Cell. 2002 Nov; 10(5):1119-1128. [46] Pawson T, Warner N. Oncogenic re-wiring of cellular signaling pathways. Oncogene. 2007 Feb; 26(9):1268-1275. [47] Sicheri F, Moarefi I, Kuriyan J. Crystal structure of the Src family tyrosine kinase Hck. Nature. 1997 Feb; 385(6617):602-609. [48] Kaziro Y, Itoh H, Kozasa T, Nakafuku M, Satoh T. Structure and function of signaltransducing GTP- binding proteins. Annu. Rev. Biochem. 1991; 60:349-400. [49] Salgia R, Skarin AT. Molecular abnormalities in lung cancer. J. Clin. Oncol. 1998 Mar; 16(3):1207-1217. [50] Tsujimoto Y, Yunis J, Onorato-Showe L, Nowell PC, Croce CM. Molecular cloning of the chromosomal breakpoints of the B-cell lymphomas and leukemias with the t(11;14) chromosome translocation. Science. 1984 Jun; 224(4656):1403-1406. [51] Tsujimoto Y, Cossman J, Jaffe E, Croce CM. Involvement of the bcl-2 gene in human follicular lymphoma. Science. 1985 Jun; 228(4706):1440-1443. [52] Tsujimoto Y, Croce CM. Analysis of the structure, transcripts, and protein products of bcl-2, the gene involved in human follicular lymphoma. Proc. Natl. Acad. Sci. USA. 1986 Jul; 83(14):5214-5218. [53] Tsujimoto Y, Ikegaki N, Croce CM. Characterization of the protein product of bcl-2, the gene involved in human follicular lymphoma. Oncogene. 1987; 2(1):3-7. [54] Adams JM, Cory S. The Bcl-2 apoptotic switch in cancer development and therapy. Oncogene. 2007 Feb; 26(9):1324-1337. [55] Alt FW, Kellems RE, Bertino JR, Schimke RT. Selective multiplication of dihydrofolate reductase genes in methotrexate-resistant variants of cultured murine cells. J. Biol. Chem. 1978 Mar; 253(5):1357-70. [56] Cowell JK. Double minutes and homogeneously staining regions: gene amplification in mammalian cells. Annu. Rev. Genet. 1982; 16:21-59. [57] King CR, Kraus MH, Aaronson SA. Amplification of a novel v-erbB-related gene in a human mammary carcinoma. Science. 1985 Sep; 229(4717):974-6. [58] Schwab M, Alitalo K, Klempnauer KH, Varmus HE, Bishop JM, Gilbert F, et al. Amplified DNA with limited homology to myc cellular oncogene is shared by human neuroblastoma cell lines and a neuroblastoma tumour. Nature. 1983 Sep; 305(5931):2458. [59] Press MF, Bernstein L, Thomas PA, Meisner LF, Zhou JY, Ma Y, et al. HER-2/neu gene amplification characterized by fluorescence in situ hybridization: poor prognosis in node-negative breast carcinomas. J. Clin. Oncol. 1997 Aug; 15(8): 2894-904. [60] Eiró N, Vizoso FJ. Inflammation and cancer. World J. Gastrointest. Surg. 2012 Mar; 4(3); 62-72. [61] Lorusso G, Rüegg C. The tumor microenvironment and its contribution to tumor evolution toward metastasis. Histochem. Cell Biol. 2008 Dec; 130(6): 1091-1103. [62] Kuper H, Adami HO, Trichopoulos D. Infections as a major preventable cause of human cancer. J. Intern. Med. 2000 Sep; 248(3):171-83. [63] Balkwill F, Mantovani A. Inflammation and cancer: back to Virchow? Lancet. 2002 Feb; 357(9255):539-45. [64] Coussens LM, Werb Z. Inflammation and cancer. Nature. 2002 Dec; 420(6917):860-67.

2222

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez

[65] Munger K, Howley PM. Human papillomavirus immortalization and transformation functions. Virus Res. 2002 Nov; 89(2):213-28. [66] Peek RM Jr, Blaser MJ. Helicobacter pylori and gastrointestinal tract adenocarcinomas. Nat. Rev. Cancer. 2002 Jan; 2(1):28-37. [67] Hussain SP, Hofseth LJ, Harris CC. Radical causes of cancer. Nat. Rev. Cancer. 2003 Apr; 3(4):276-85. [68] Chen LW, Egan L, Li ZW, Greten FR, Kagnoff MF, Karin M. The two faces of IKK and NF-kappaB inhibition: prevention of systemic inflammation but increased local injury following intestinal ischemia-reperfusion. Nat. Med. 2003 May; 9 (5):575-81. [69] Wang D, Mann JR, DuBois RN. The role of prostaglandins and other eicosanoids in the gastrointestinal tract. Gastroenterology. 2005 May; 128 (5):1445-61. [70] Dolberg DS, Hollingsworth R, Hertle M, Bissell MJ. Wounding and its role in RSV mediated tumor formation. Science. 1985 Nov; 230 (4726):676-8. [71] Martins-Green M, Boudreau N, Bissell MJ. Inflammation is responsible for the development of wound-induced tumors in chickens infected with Rous sarcoma virus. Cancer Res. 1994 Aug; 54(16):4334-41. [72] Beachy PA, Karhadkar SS, Berman DM. Tissue repair and stem cell renewal in carcinogenesis. Nature. 2004 Nov; 432(7015):324-31. [73] Houchen CW, Stenson WF, Cohn SM. Disruption of cyclooxygenase-1 gene results in an impaired response to radiation injury. Am. J. Physiol. Gastrointest. Liver Physiol. 2000 Nov; 279 (5): G858-65. [74] Greten FR, Eckmann L, Greten TF, Park JM, Li ZW, Egan LJ, et al. IKKbeta links inflammation and tumorigenesis in a mouse model of colitis-associated cancer. Cell. 2004 Aug; 118(3):285-96. [75] Elewaut D, Di Donato JA, Kim JM, Truong F, Eckmann L, Kagnoff MF. NF-kappa B is a central regulator of the intestinal epithelial cell innate immune response induced by infection with enteroinvasive bacteria. J. Immunol. 1999 Aug; 163(3):1457-66. [76] Egan LJ, Eckman L, Greten FR, Chae S, Li ZW, Myhre GM, et al. IkappaBkinasebetadependent NF-kappaB activation provides radioprotection to the intestinal epithelium. Proc. Natl. Acad. Sci. USA. 2004 Feb; 101(8):2452-7. [77] Chae S, Eckmann L, Miyamoto Y, Pothoulakis C, Karin M, Kagnoff MF. Epithelial cell I kappa B-kinase beta has an important protective role in Clostridium difficile toxin Ainduced mucosal injury. J. Immunol. 2006 Jul; 177(2):1214-20. [78] Moore RJ, Owens DM, Stamp G, Arnott C, Burke F, East N, et al. Mice deficient in tumor necrosis factor-alpha are resistant to skin carcinogenesis. Nat. Med. 1999 Jul; 5(7):828-31. [79] DeBerardinis RJ, Lum JJ, Hatzivassiliou G, Thompson CB. The biology of Cancer: Metabolic Reprogramming Fuels Cell Growth and Proliferation. Cell Metabolism. 2008 Jan; 7 (1); 11-20. [80] Warburg O. On respiratory impairment in cancer cells. Science. 1956 Aug; 124(3215):269-70. [81] Soga T. cancer metabolism: Key players in metabolic reprogramming. Cancer Sci. 2013 Mar;104(3):275-81. [82] Lum JJ, Bauer DE, Kong M, Harris MH, Li C, Lindsten T, et al. Growth factor regulation of autophagy and cell survival in the absence of apoptosis. Cell. 2005 Jan; 120(2):23748.

The Classification, Mechanisms of Activation and Roles in Cancer …

2223

[83] Christofk HR, Vander Heiden MG, Harris MH, Ramanathan A, Gerszten RE, Wei R, et al. The M2 splice isoform of pyruvate kinase is important for cancer metabolism and tumour growth. Nature. 2008 Mar; 452(7184):230-33. [84] Bauer DE, Hatzivassiliou G, Zhao F, Andreadis C, Thompson CB. ATP citrate lyase is an important component of cell growth and transformation. Oncogene. 2005 Sep; 24(41):6314–22. [85] Astuti D, Latif F, Dallol A, Dahia PL, Douglas F, George E, et al. Gene mutations in the succinate dehydrogenase subunit SDHB cause susceptibility to familial pheochromocytoma and to familial paraganglioma. Am. J. Hum. Genet. 2001 Jul; 69(1):49–54. [86] Tomlinson IP, Alam NA, Rowan AJ, Barclay E, Jaeger EE, Kelsell D, et al. Germline mutations in FH predispose to dominantly inherited uterine fibroids, skin leiomyomata and papillary renal cell cancer. Nat. Genet. 2002 Apr; 30(4):406–10. [87] Roos S, Jansson N, Palmberg I, Säljö K, Powell TL, Jansson T. Mammalian target of rapamycin in the human placenta regulates leucine transport and is down-regulated in restricted fetal growth. J. Physiol. 2007 Jul; 582(Pt 1):449-59. [88] Wieman HL, Wofford JA, Rathmell JC. Cytokine stimulation promotes glucose uptake via phosphatidylinositol-3 kinase/Akt regulation of Glut1 activity and trafficking. Mol. Biol. Cell. 2007 Apr; 18(4):1437-46. [89] Elstrom RL, Bauer DE, Buzzai M, Karnauskas R, Harris MH, Plas DR, et al. Akt stimulates aerobic glycolysis in cancer cells. Cancer Res. 2004 Jun; 64(11):3892-99. [90] Chang Y, Wang J, Lu X, Thewke DP, Mason RJ. KGF induces lipogenic genes through a PI3K and JNK/SREBP-1 pathway in H292 cells. J. Lipid. Res. 2005 Dec; 46(12):262435. [91] Gingras AC, Raught B, Sonenberg N. Regulation of translation initiation by FRAP/mTOR. Genes Dev. 2001 Apr; 15(7):807-26. [92] Semenza GL. Hypoxia-inducible factor 1 (HIF-1) pathway. Sci STKE. 2007 Oct; 2007(407):cm8. [93] Majumder PK, Febbo PG, Bikoff R, Berger R, Xue Q, McMahon LM, et al. mTOR inhibition reverses Akt-dependent prostate intraepithelial neoplasia through regulation of apoptotic and HIF-1-dependent pathways. Nat. Med. 2004 Jun; 10(6):594-601. [94] Semenza GL. Tumor metabolism: cancer cells give and take lactate. J. of Clinical Investigation. 2008 Dec; 118(12); 3835-37. [95] Shaw RJ, Cantley LC. Ras, PI(3)K and mTOR signalling controls tumour cell growth. Nature. 2006 May; 441(7092):424-30. [96] Tomiyama A, Serizawa S, Tachibana K, Sakurada K, Samejima H, Kuchino Y, et al. Critical role for mitochondrial oxidative phosphorylation in the activation of tumor suppressors Bax and Bak. J. Natl. Cancer Inst. 2006 Oct;98(20):1462-73. [97] Bonnet S, Archer SL, Allalunis-Turner J, Haromy A, Beaulieu C, Thompson R, et al. A mitochondria-K+ channel axis is suppressed in cancer and its normalization promotes apoptosis and inhibits cancer growth. Cancer Cell. 2007 Jan; 11(1):37-51. [98] Culmsee C, Mattson MP. p53 in neuronal apoptosis. Biochem. Biophys. Res. Commun. 2005 Jun; 331(3):761-77. [99] Kondoh H, Lleonart ME, Gil J, Wang J, Degan P, Peters G, et al. Glycolytic enzymes can modulate cellular life span. Cancer Res. 2005 Jan; 65(1):177-85.

2224

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez

[100] Kim JW, Gao P, Liu YC, Semenza GL, Dang CV. Hypoxia inducible factor 1 and dysregulated c-Myc cooperatively induce vascular endothelial growth factor and metabolic switches hexokinase 2 and pyruvate dehydrogenase kinase 1. Mol. Cell Biol. 2007 Nov; 27(21):7381-93. [101] Chi SL, Wahl ML, Mowery YM, Shan S, Mukhopadhyay S, Hilderbrand SC, et al. Angiostatin-like activity of a monoclonal antibody to the catalytic subunit of F1F0 ATP synthase. Cancer Res. 2007 May; 67(10):4716-24. [102] Igney FH, Krammer PH. Death and anti-death: tumour resistance to apoptosis. Nat. Rev. Cancer. 2002 Apr; 2(4): 277-88. [103] Erler JT, Bennewith KL, Nicolau M, Dornhofer N, Kong C, Le QT, et al. Lysyl oxidase is essential for hypoxia-induced metastasis. Nature. 2006 Apr; 440(7088):1222-26. [104] Condeelis J, Pollard JW. Macrophages: obligate partners for tumor cell migration, invasion, and metastasis. Cell. 2006 Jan; 124(2):263-66. [105] Evans JM, Ogston SA, Emslie-Smith A, Morris AD. Risk of mortality and adverse cardiovascular outcomes in type 2 diabetes: a comparison of patients treated with sulfonylureas and metformin. Diabetologia. 2006 may; 49(5):930-36. [106] Faivre S, Kroemer G, Raymond E. Current development of mTOR inhibitors as anticancer agents. Nat. Rev. Drug Discov. 2006 Aug; 5(8):671-88. [107] Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, et al. Molecular portraits of human breast tumours. Nature. 2000 Aug; 406(6797):747-52. [108] Pedraza-Fariña LG. Mechanisms of oncogenic cooperation in cancer initiation and metastasis. Yale J. Biol. Med. 2006 Dec; 79(3-4):95-103. [109] Futreal PA, Coin L, Marshall M, Down T, Hubbard T, Wooster R, et al. A census of human cancer genes. Nat. Rev. Cancer. 2004 Mar; 4(3):177-83. [110] Ohta M, Inoue H, Cotticelli MG, Kastury K, Baffa R, Palazzo J, et al. The human FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma associated translocation breakpoint, is abnormal in digestive tract cancers. Cell. 1996 Feb; 84:58797. [111] Stephens PJ, McBride DJ, Lin ML, Varela I, Pleasance ED, Simpson JT, et al. Complex landscapes of somatic rearrangement in human breast cancer genomes. Nature. 2009 Dec; 462(7276):1005-10. [112] Ding L, Ellis MJ, Li S, Larson DE, Chen K,Wallis JW, et al. Genome remodelling in a basal-like breast cancer metastasis and xenograft. Nature. 2010 Apr; 464(7291): 9991005. [113] Lee EY, To H, Shew JY, Bookstein R, Scully P, Lee WH. Inactivation of the retinoblastoma susceptibility gene in human breast cancers. Science. 1988 Jul; 241(4862):218-21. [114] Walsh T, King MC. Ten genes for inherited breast cancer. Cancer Cell. 2007 Feb; 11(2):103-05. [115] Cooper GM. Oncogenes. 2nd ed Boston: Jones and Bartlett Publishers; 1995. [116] Armitage P, Doll R. The age distribution of cancer and a multi-stage theory of carcinogenesis. Br. J. Cancer. 1954 Mar; 8(1):1-12. [117] Bishop JM. Viral oncogenes. Cell. 1985 Aug; 42(1):23-38. [118] Krontiris TG, Cooper, GM. Transforming activity of human tumor DNAs. Proc. Natl. Acad. Sci. USA. 1981 Feb; 78(2):1181-84.

The Classification, Mechanisms of Activation and Roles in Cancer …

2225

[119] Land H, Parada LF, Weinberg RA. Tumorigenic conversion of primary embryo fibroblasts requires at least two cooperating oncogenes. Nature. 1983 Aug; 304(5927):596-02. [120] Hahn WC, Counter CM, Lundberg AS, Beijersbergen RL, Brooks MW, Weinberg RA. Creation of human tumour cells with defined genetic elements. Nature. 1999 Jul; 400(6743):464-68. [121] Felsher DW, Bishop JM. Reversible tumorigenesis by MYC in hematopoietic lineages. Mol. Cell. 1999 Aug; 4(2):199-207. [122] Rudolph B, HueberA O, Evan GI. Reversible activation of c-Myc in thymocytes enhances positive selection and induces proliferation and apoptosis in vitro. Oncogene. 2000 Apr; 19(15):1891-900. [123] Pelengaris S, Khan M, Evan GI. Suppression of Myc-induced apoptosis in beta cells exposes multiple oncogenic properties of Myc and triggers carcinogenic progression. Cell. 2002 May; 109(3):321-34. [124] Beer S, Zetterberg A, Ihrie RA, McTaggart RA, Yang Q, Bradon N et al. Developmental context determines latency of MYC-induced tumorigenesis. PLoS Biol. 2004 Nov; 2(11):e332. [125] Boxer RB, Jang JW, Sintasath L, Chodosh LA. Lack of sustained regression of c-MYCinduced mammary adenocarcinomas following brief or prolonged MYC inactivation. Cancer Cell. 2004 Dec; 6(6):577-86. [126] Jonkers J, Berns A. Oncogene addiction: sometimes a temporary slavery. Cancer Cell. 2004 Dec;6(6):535-38. [127] Fidler IJ. Critical determinants of metastasis. Semin. Cancer Biol. 2002 Apr; 12(2):8996. [128] van 't Veer LJ, Dai H, van de Vijver MJ, He YD, Hart AA, Mao M, et al. Gene expression profiling predicts clinical outcome of breast cancer. Nature. 2002 Jan; 415(6871):53036. [129] Ramaswamy S, Ross KN, Lander ES, Golub TR. A molecular signature of metastasis in primary solid tumors. Nat. Genet. 2003 Jan; 33(1):49-54. [130] Woelfle U, Cloos J, Sauter G, Riethdorf L, Jänicke F, van Diest P, et al. Molecular signature associated with bone marrow micrometastasis in human breast cancer. Cancer Res. 2003 Sep; 63(18):5679-84. [131] Goldman JM, Melo JV. Targeting the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N. Engl. J. Med. 2001;344:1084-6. [132] Heinrich MC, Blanke CD, Druker BJ, Corless CL. Inhibition of KIT tyrosine kinase activity: a novel molecular approach to the treatment of KIT-positive malignancies. J. Clin. Oncol. 2002;20:1692-703. [133] Casali PG, Messina A, Stacchiotti S, et al. Imatinib mesylate in chordoma. Cancer 2004;101:2086-97. [134] Wang ZG, Delva L, Gaboli M, et al. Role of PML in cell growth and the retinoic acid pathway. Science 1998;279:1547-51. [135] Salomoni P, Pandolfi PP. The role of PML in tumor suppression. Cell 2002;108: 16570. [136] Ambros V. The function of animal miRNAs. Nature 2004;431:350–355. [137] Sontheimer EJ, Carthew RW. Silence from within: endogenous siRNAs and miRNAs. Cell 2005;122:9–12.

2226

P. Barros-Núñez, M. A. Rosales-Reynoso and C. I. Juárez-Vázquez

[138] Meister G, Tuschl T. Mechanisms of gene silencing by double-stranded RNA. Nature 2004;431:343–349. [139] Chapman EJ, Carrington JC. Specialization and evolution of endogenous small RNA pathways. Nat. Rev. Genet. 2007;8:884–896. [140] Calin GA, Dumitru CD, Shimizu M, Bichi R, Zupo S, Noch E, et al. Frequent deletions and down-regulation of micro-RNA genes miR15 and miR16 at 13q14 in chronic lymphocytic leukemia. Proc. Natl. Acad. Sci. U S A. 2002 Nov; 99(24):15524-29. [141] Calin GA, Sevignani C, Dumitru CD, et al. Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc. Natl. Acad. Sci. U S A 2004;101:2999-3004. [142] Borchert GM, Lanier W, Davidson BL. RNA polymerase III transcribes human microRNAs. Nat. Struct. Mol. Biol. 2006;13:1097–1101. [143] Francesco Fazi and Clara Nervi. MicroRNA: basic mechanisms and transcriptional regulatory networks for cell fate determination. Cardiovascular Research 2008;79: 553– 561. [144] Calin GA, Ferracin M, Cimmino A, Di Leva G, Schimizu M, Wojcik SE, et al. A MicroRNA signature associated with prognosis and progression in chronic lymphocytic leukemia. N. Engl. J. Med. 2005 Oct; 353(17):1793-801. [145] Calin GA, Croce CM. MicroRNA signatures in human cancers. Nat. Rev. Cancer, 2006;6:857-66. [146] Mengfeng Li, Jun Li, Xiaofan Ding, Mian He, and Shi-Yuan Cheng. MicroRNA and Cancer. The AAPS Journal 2010; 12:309-317. [147] Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc. Natl. Acad. Sci. U S A. 2006 Feb;103(7):2257-61. [148] Nakamura T, Canaani E, Croce CM. Oncogenic All1 fusion proteins target Droshamediated microRNA processing. Proc. Natl. Acad. Sci. U S A. 2007 Jun; 104(26): 1098085. [149] Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K, Yi M, et al. Unique microRNA molecular profiles in lung cancer diagnosis and prognosis. Cancer Cell. 2006 Mar; 9(3):189-98. [150] Nakamura T, Canaani E, Croce CM. Oncogenic All1 fusion proteins target Droshamediated microRNA processing. Proc. Natl. Acad. Sci. USA 2007;104: 10980-5. [151] Eis PS, Tam W, Sun L, Chadburn A, Li Z, Gomez MF, et al. Accumulation of miR-155 and BIC RNA in human B cell lymphomas. Proc. Natl. Acad. Sci. USA. 2005 Mar; 102(10):3627-32. [152] Costinean S, Zanesi N, Pekarsky Y, Tili E, Volinia S, Heerema N, et al. Pre-B cell proliferation and lymphoblastic leukemia/high grade lymphoma in E (mu)-miR155 transgenic mice. Proc. Natl. Acad. Sci. USA. 2006 May; 103(18):7024-29. [153] Johnson SM, Grosshans H, Shingara J, et al. RAS is regulated by the let-7 microRNA family. Cell 2005;120:635-47. [154] Cimmino A, Calin GA, Fabbri M, et al. miR-15 And miR-16 induce apoptosis by targeting BCL2. Proc. Natl. Acad. Sci. USA 2005;102:13944-9. [155] Meng F, Henson R, Lang M, et al. Involvement of human microRNA in growth and response to chemotherapy in human cholangiocarcinoma cell lines. Gastroenterology 2006;130:2113-29.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 103

DICER AND MICRORNAS: ONCOMIRS ARE THE NEXT FRONTIER OF ONCOGENES AFFECTING CANCER ETIOLOGY AND TUMOR PROGRESSION Ha T. Nguyen and Mandi M. Murph American Cancer Society Research Scholar Georgia Cancer Coalition Distinguished Cancer Scholar University of Georgia College of Pharmacy Department of Pharmaceutical and Biomedical Sciences Athens, Georgia, US

ABSTRACT Recent understanding of oncogene regulation has uncovered an emerging new field of molecular cancer biology in which tumor suppressors and mediators are controlled through RNA regulation. Among the most critical players are microRNA (miRNA), also referred to as ‘oncomirs’, and Dicer, the major enzyme responsible for cleaving double-stranded RNA and forming the RNA induced silencing complex. These components are aberrantly expressed in cancer and among some tumor types are hypothesized to be causative to the etiology of malignancy. For example, prostate and colorectal cancers express abundantly high levels of Dicer mRNA while lung, ovarian and endometrial cancers express low levels of Dicer, which is believed to correlate to poor cancer prognosis. In addition, mutations of the Dicer encoding gene (DICER1) occur in non-epithelial ovarian cancers and pediatric tumor pleuropulmonary blastoma. Paradoxically, Dicer is a haploinsufficient tumor suppressor; the loss of a single allele of DICER enhances tumor growth where the loss of the second allele results in halting tumor proliferation. MicroRNA regulates oncogenic signaling pathways as well as the expression of tumor suppressors and oncogenes, making it a major contributor to the overall status of the cell and its malignant potential. The let-7 miRNA family members are well-known as tumor suppressor genes, which target and silence the Ras oncogene. On the other hand, miRNAs may induce tumor growth; one example is miR-17-19 cluster negatively regulating two tumor suppressor genes, PTEN and Bim. In this chapter, the regulation of oncomirs will be discussed with focus on the

2228

Ha T. Nguyen and Mandi M. Murph

post-transcriptional control by miRNA biogenesis machinery, which consist Dicer as a major player.

INTRODUCTION MicroRNAs (miRNAs) are noncoding RNAs 18-25 nucleotides in length, which regulate gene expression by targeting messenger RNAs (mRNAs). Through miRNA binding to mRNA’s complementary base pair sequences, mRNA is then degraded, which ultimately silences gene expression in the cell. Alternatively, gene silencing may also be achieved by translation inhibition without a requirement for exact complementarity. Profiling miRNAs in human cancer showed that miRNA expression differs between normal and cancer tissues, and also between tumor types [1]. MicroRNAs are suggested to have roles in cancer development both as oncogenes as well as tumor suppressors [2, 3]; therefore they are referred as ‘oncomirs’. To further complicate the issue, other miRNAs like miR-146 and miR-29 are context-dependent [4], which means they can function as either an oncogene or tumor suppressor, depending on the cell type and the specific regulatory pathways that are either functional or deficient in that system.

MICRORNA AND CANCER MicroRNAs regulate mRNA levels by directing the RISC to the 3’-unstranslated region (UTR) of target mRNAs by complementary sequences on miRNAs to achieve gene silencing [5, 6]. The RISC complex contains Ago, an RNase III endonuclease. Although human cells have four Ago proteins (Ago1-4], only Ago2 in the miRNA-RISC complex processes mRNA cleavage [7]. The extent of complementarity between miRNAs and target mRNAs also determines whether the mRNA will be cleaved or just inhibited from translation [6]. A single miRNA can regulate different target genes and one target mRNA can also be regulated by multiple miRNAs [3]. Since miRNAs regulate multiple fundamental biological processes, alterations in their normal functioning could result in contributing to the etiology of cancer. As such, research continues to elucidate the roles of miRNAs in tumorigenesis as both tumor suppressors and oncogenes. Analysis of tumor and normal tissues from different types of cancers showed altered expression levels of many miRNAs, either via overexpression or downregulation [1, 8-15]. To date many miRNAs have been identified for their crucial roles in cancer, among them the let-7 family and the miR-17-92 cluster are well studied as tumor suppressors and oncogenes.

MICRORNA-BASED THERAPIES IN CANCER Increasing evidence demonstrates significant regulatory roles of miRNAs. Due to their aberrant expression and function in cancer, miRNAs and their antagomirs have become appealing therapeutic potentials against cancer. There are three principal directions or applications for miRNA therapies. The first application for miRNAs as therapeutics consists of

Dicer and MicroRNAs

2229

replacing the lost miRNA or using antagomirs as direct targets against malignancy, which means overexpressing antitumor miRNAs and/or repressing oncogenes. Combinations of appropriate miRNAs or antagomirs might increase specificity to the target and reduce the risk for acquired resistance. In order for this approach to be successful at the level of molecular mechanisms, an in-depth knowledge of all the biological targets and regulatory pathways, including the ensuing off-target effects would have to be elucidated for a given miRNA first. The goal of the second application is to increase drug sensitization of cancer cells through modulation of related miRNAs. This direction is based on the results from multiple labs, which show that despite some miRNAs not displaying significant direct effects on cancer cell survival, their alterations increase cancer cell sensitivity to drug treatment or radio therapy [16-18]. With this approach, a new era in pharmacogenomics would emerge since it is highly likely there would be significant patient variability to drug resistance and miRNA expression. The third application of miRNA therapies is inhibiting specific aberrant functions of cancer cells in a context-dependent fashion (e.g., cancer invasion and migration) through the modulation of specific miRNAs, such as miR-34a, miR-34b, and miR-21 [19-21]. To sum up, miRNA therapies are attempts to block “bad miRNAs” and increase “good miRNAs” to achieve the desired therapeutic effects. Since foreign oligonucleotides like synthetic small-interfering RNA (siRNA) molecules in general are subject to degradation by nucleases, many modifications have been developed to increase their stability. At the same time, increases in potency and reductions in toxicity have been improved from early modifications such as phosphorothioate antisense oligonucleotides, 2’-O-methyl or 2’-O-methoxy-ethyl anti-sense oligonucleotides [22-26]. Synthetic anti-sense oligonucleotides, which have complementary sequences to oncogenic miRNAs, are used to inactivate miRNAs at tumor sites. An improvement to these is the cholesterol conjugation of anti-sense oligonucleotides, which are very stable in vivo and improves therapeutic efficacy [27-29]. Among all the chemical modifications of antisense oligonucleotides, LNA is likely the most common. For example, it is used to create antagomirs for miR-34a and the miR-17-92 cluster in vivo and in vitro [30-33]. Locked nucleic acid (LNA) is defined as an oligonucleotide that contains one or more 2’-O,4’-methylene--D-ribofuranosyl monomer(s) [30]. Furthermore, LNA mediated silencing of miRNA-122 has reached clinical trials in non-human primates [34-36]. It will be intriguing to follow this progress and learn whether or not these modifications are sufficient for the application of miRNA therapy. Since miRNAs are highly tissue specific, another challenge is to deploy these therapeutics at the appropriate site. In this regards, multiple efforts have been spent on developing carriers to deliver antitumor miRNAs to tumors and even a greater understanding of how miRNAs are transported in biological systems. Interestingly, studies have demonstrated that miRNAs are highly stable and abundant extracellular entities found in circulating plasma and protected from degradation by endogenous RNases, although subject to degradation by proteases [37, 38]. Thus, circulating miRNAs are protected through several mechanisms, including binding and forming a complex with Argonaute2 [38], secretion into microvesicles from the cell and highdensity lipoproteins [39]. The scenario of the normal regulation of miRNAs in circulation may differ from lessons learned through the usage of foreign siRNAs, which have several challenges during the process to reach targets. First, foreign siRNAs are degraded in plasma by nucleases [40] (whereas endogenous miRNAs have natural protection). Second, siRNAs are cleared from circulation

2230

Ha T. Nguyen and Mandi M. Murph

rapidly through kidney filtration due to their small size [41]. Third, oligonucleotides’ negative charge prevents them from passing through the cellular lipid bilayer, which is impermeable to ions and polar molecules. Fourth, even after cellular internalization, foreign oligonucleotides still need to escape endosomal entrapment and degradation in order to get loaded by the RISC complex and target complimentary mRNAs. To overcome barriers and facilitate therapeutic usage of miRNAs, several delivery systems have been introduced. Viral vector-based systems were successfully tested in murine models of lung and liver cancer [42, 43]. However, because safety and host immune responses are considerable concerns for viral vectors, lipid based delivery systems are a more promising option for clinical use. Using a liposome, which is a lipid bilayer vesicle, has been developed to carry nucleic acids for an unusually long time. The lipid cage allows the liposome to remain in circulation for a much longer time [44]. The particle itself is biodegradable to optimize safety administration to host body [41]. Moreover, the liposome lipid membrane can be cationized to improve cellular fusion and uptake [45]. Antibody incorporation into the liposomal membrane increases target site specificity, thus reducing undesirable off-target effects [46, 47]. Further techniques help facilitate liposomes to escape from endosomal engulfment, such as ion-pair formation, the “proton sponge” effect or de-assembly [41]. Other methods and rising trends in cancer therapy include using nanoparticles, either lipidbased or nonlipid-based, to deliver miRNAs or antagomir oligonucleotides. Interfering nanoparticles (iNOPs), a lipid nanoparticle with its surface modified with cationic lysines, has succeeded in delivering anti-miR-122 to mouse liver [48, 49]. Nanoparticles coated with cellpenetrating peptides were used to increase the efficiency of anti-miRNA-155 delivery to cancer cells [50]. Gold nanoparticles are another promising delivery system due to reduced toxicity, a favorable ability to penetrate cells, a longer retention in circulation and easiness in biosensing [51-55]. Gold nanoparticles conjugated with miRs or antagomirs have good transfection and delivery results in vitro [56-58].

MICRORNA BIOGENESIS AND DEGRADATION MicroRNAs are transcribed by RNA polymerase II into large RNA precursor primarymiRNA (pri-miRNA) [59, 60]. Similar to mRNAs, pri-miRNAs have caps at the 5’ end and are poly-adenylated at the 3’ end [61]. Pri-miRNAs form stem-loop secondary structures and are processed in the nucleus by Drosha and DGCR8, reducing the structure from hundreds of nucleotides to approximately 70-nucleotide pre-miRNAs [62]. Pre-miRNAs are then exported to the cytoplasm by Exportin-5 (Exp-5) [63]. In the cytoplasm, pre-miRNAs are cleaved by DICER, with assistance from TARBP2, to generate a 22-nucleotide, double-stranded miRNAmiRNA* duplex, which is also referred to as the miR-5p/miR-3p duplex [64, 65]. Mature miRNAs and miRNAs* are then separated and miRNAs are loaded into the RNA-induced silencing complex (RISC) while miRNAs* are more often degraded [66, 67]. However, recent publications, including our own, have altered our understanding of the fate of miRNAs* and questioned whether they are always degraded. More work is needed to elucidate the roles and contributions of these so-called “passenger” strands because studies have shown significant effects of miRNAs* in cancer and also suggested they have important regulatory abilities on their own [68-70]. It is no longer the accepted dogma that miRNAs* are

Dicer and MicroRNAs

2231

simply non-functional byproducts of the miRNA-miRNA* duplex and have no purpose other than degradation. This is an exciting time in the field of miRNA research because there is still much to uncover in our understanding of these strands and which biological effects they regulate. In particular, are they involved when things go awry and lead to cancer?

LET-7 FAMILY Let-7 in Cell Differentiation Let-7, together with lin-4, was the first known miRNA [71-73]. Let-7 was first identified in the nematode Caenorhabditis elegans as a component involved in early development [71]. In C. elegans, let-7 is important for and highly expressed during the larval-to-adult transition. In this period, a type of C. elegans stem cell called seam cells switches from proliferating in the early larval stage to terminal differentiating [71]. In the absence of functioning let-7, seam cells fail to exit the cell cycle at this transition point, thus continuing to divide instead of differentiating. As a result, the let-7 mutant animals die by bursting through vulvas, and that is the origin of the name let-7, which means lethal-7 [71]. The sequence of let-7 and its temporal expression are conserved in a wide range of animal species, from as simple as C. elegans to as complicated as humans [74]. In zebra fish let-7 is also detected at 48 hours after fertilization, in annelids and mollusks, the time points are adult stages [74]. Later sequencing in mouse and humans extends let-7 to a family of identical mature miRNAs encoded by 13 genomic loci from let-7a to let-7i [75]. Among them, let-7a has its sequence identical across species; while the other members keep the seed sequence but vary in other nucleotides. Current hybridizationbased techniques, such as microarray and northern blot, can hardly distinguish closely related miRNAs. Thus, it is a challenge to quantify each single let-7 family member in one sample. For this reason, in this book chapter we will refer to let-7 as a term to generally describe this whole let-7 family. Let-7 is reportedly absent in embryonic stem cells or pluripotent cells but up-regulated in differentiating cells, such as brain cells, or breast stem-cell progenitors at the differentiating phase [76-80]. Lower expression of let-7 is observed as one feature of certain types of stem cells while overexpression of let-7 seems to reduce dividing [80]. Let-7 is considered one factor involved in switching cells from the proliferation phase to differentiation phase [81].

LET-7 AND CANCER: RAS, HMGA2 AND THE CELL CYCLE The early evidence of let-7’s role in cancer was the observation that let-7 expression levels are reduced in lung cancer tissues and this event is associated with shorter postoperative survival among patients [90]. Furthermore, let-7 miRNAs are mapped to the frequently deleted chromosomal sites in lung cancer [91]. More importantly, the introduction of let-7 to a low-let7 lung cancer cell line inhibited cell growth [90]. Based on this information, a later study showed that down regulating Ras is one important mechanism whereby let-7 ceases lung cancer cell growth [92]. Ras is an enzymatic protein at the cell membrane, which is activated through binding to GTP and then triggering a cascade of

2232

Ha T. Nguyen and Mandi M. Murph

downstream signaling events, including ERK/MAPK activation [82]. Ras signaling cascades favor cell proliferation and survival [83, 84]. Mutations in RAS genes (e.g., HRAS, NRAS and KRAS), which cause increased Ras expression and activity, are reported in a number of different cancers, including pancreatic and colorectal [85-87]. Similarly, overexpression and increased activity of Ras due to RAS gene mutations occurs in lung cancer [88, 89]. There are multiple let-7 complementary sites in the 3’ UTRs of human RAS genes, allowing let-7 to bind and block the expression of Ras through Ras mRNA silencing [92]. The antitumor effect of let-7 was proved in vivo when the delivery of let-7 reduced tumor burden in K-Ras G12D, a Ras mutated, human lung cancer xenograft model [93]. Beside Ras, HMGA2 is another oncoprotein regulated by let-7 [94]. HMGA2 is a member of the high mobility group AT-hook (HMGA) family, a family of nonhistone chromatin proteins that act as architectural transcription factors [95]. HMGA2 is involved in the transcription of various genes and is essential for growth during embryonic development [95-97]. HMGA2 is reported to be up-regulated in tumors, such as lung cancers and liposarcomas [97-99]. Taken together, HMGA2 is suggested to be an oncogenic factor in differentiated tissues, which express negligible HMGA2 under normal conditions. Multiple studies have provided evidence of let-7 as a negative regulator of HMGA2 in cancers [94, 100, 101]. Sequencing and reporter assays confirm that the 3’UTR of HMGA2 contains let-7 complementary sites [94, 100]. In fact, removing the let-7 complementary sites in HMGA2 3’UTR causes HMGA2 overexpression and tumorigenesis [100]. Interestingly, a study on self-renewing-tumor-initiating breast cancer cells showed that increased let-7 levels had negative effects on both Ras and HMGA2, while Ras seemed to be involved in self renewal and HMGA2 was involved in differentiation [102]. However, the antitumor effects of let-7 though Ras and HMGA2 are not always equal. In non-small cell lung cancer, overexpression of let-7 caused a reduction in both Ras and HMGA2, but ectopic expression of Ras showed a reversal of effects to let-7 mediated tumor suppression more so than ectopic expression of HMGA2 [42]. It is predicted that one miRNA strand can target hundreds of mRNAs. Correspondingly, let-7 exerts antitumor effects through not only Ras and HMGA2 but also many other targets that are important to the regulation of the cell. For example, a large number of cell-cycle genes have been identified to have let-7 complementary sites [103]. Among them, CDC25A, which is an oncogene, CDK6 and cyclin D1 are confirmed to be directly regulated by let-7 [103-106]. Upsetting the delicate balance of the regulation of the cell cycle could wreck havoc upon normal cells and homeostasis. In some systems these alterations are involved in the etiology of cancer.

REGULATION OF LET-7 Lin-28 inhibits the processing of let-7 family members through binding to pri-let-7, then blocks the let-7 precursor from Drosha-DGCR8 cleavage in the nucleus [107, 108]. This binding and blocking process is mediated through the recognition of Lin-28 to several conserved nucleotides shared by let-7 family members, thus it seems to be selective for the let7 family with little or no effect observed on other miRNAs [107-110]. Another step that Lin28 uses to negatively regulate let-7 is inducing the uridylation and recruiting the uridylating enzyme TUT4 to pre-let-7 in the cytoplasm [111-114]. All these modifications block pre-let-7 from being processed by Dicer to form mature let-7 and ultimately cause it to be degraded in

Dicer and MicroRNAs

2233

the cytosol [113]. Lin-28 facilitates cellular transformation and is overexpressed in multiple human primary tumor types in concert with let-7 reduction [115]. Lin-28 is believed to be involved in let-7 regulation from the observation that Lin-28 expression is high in early developmental stages and low during differentiation, which is reciprocal to let-7 levels [116]. The same reciprocal pattern is also observed in cancer cells [117, 118]. Furthermore, Lin-28 is identified as one of the four genes that together can convert human adult fibroblasts to pluripotent stem cells (the others three names are Oct4, Nanog and Sox-2) [119]. Even though it is regulated by Lin-28, let-7 creates a regulatory loop through direct targeting of Lin-28 mRNA 3’UTR [120, 121]. These pieces of evidence suggest that let-7 can escape Lin-28 mediated down-regulation and amplify itself [121, 122]. In the process of transforming from somatic cells to pluripotent stem cells, Lin28 can be replaced by Myc [123, 124]. Myc is an oncogenic transcription factor, which induces tumorigenesis through transactivating multiple genes involved in proliferation and survival [125-128]. Interestingly, very similar to Lin-28, Myc also inhibits let-7 expression through binding to promoters or sequences upstream of genes encoding the let-7 family and directly repressing transcription [129]. On the other hand, Myc induces Lin-28B expression, which in turn further represses let-7 maturation as described above [130]. Again, similar to the case of Lin28, let-7 comes back to directly target and down-regulate Myc expression [131-135].

MIR-17-92 FAMILY AND ORGANIZATION OF MIRNA CLUSTERS The miR-17-92 family of miRNA includes six miRNAs (miR-17, miR-18a, miR-19a, miR20a, miR-19b-1, and miR92a), which share the same seed sequence, and are encoded tightly in an intron on human chromosome 13 [136, 137]. This cluster has two paralogs: the miR-106b25 located on human chromosome 7, and the miR-106a-363 located on chromosome X. The miR-106a-363 cluster consists of six miRNAs: miR-106, miR-18b, miR-20b, miR-19b-2, miR92a-2, and miR-363. The miR-106b-25 cluster consists of three miRNAs: miR-106b, miR93, and miR-25 [137]. The miR-106b-25 cluster consists of three miRNAs: miR-106b, miR93, and miR-25 [137]. Members of the microRNA-17-92 family clusters are grouped into 4 sub-families, in which they share the same seed: miR-17 (miR-17, miR-20a, miR-20b, miR106a, miR-106b, and miR-93), miR-18 (miR-18a and miR-18b), miR-19 (miR-19a and miR19b), and miR-92 (miR-25, miR-92a, and miR-363) [137, 138].

REGULATION OF THE MIR-17-92 FAMILY AND ITS ROLES CANCER The miR-17-92 family are potential oncogenes: studies showed that this cluster facilitates tumor development in a mouse B-cell lymphoma model [139]. The oncogenic effects of this family are confirmed in many other types of cancers, such as lung, colorectal, liver and thyroid cancer [140-144]. Studies showed that the miR-17-92 family induces cancer through multiple mechanisms. For example, they induce proliferation through repression of Bim, a proapoptotic protein, and PTEN, a tumor suppressor [145]. High expression of miR-17-92 inhibits hypoxiainduced apoptosis because the key transcription factor involved in this process, hypoxiainducible factor 1α (HIF-1α), is a direct target [143, 146]. MiR-17-92, and miR106b down-

2234

Ha T. Nguyen and Mandi M. Murph

regulate CDKN1A (p21Waf1/Cip1), a well-known tumor suppressor, which stops cell proliferation by suspending the cell-cycle progression [147, 148]. Myc is the factor that transactivates the cluster through binding to the promoter regions [149]. The E2F family of transcription factors also up-regulate miR-17-92 expression through direct binding to its promoter [150, 151]. In an interesting twist, miR-17 and miR-20 come back to inhibit translation of E2F1, E2F2, and E2F3 [149-151]. Table 1. miRNAs associated with cancer and their known targets miRNA miR-15a miR-16-1

Cancer association B-cell lymphocytic leukemia

Function TS

Targets BCL2, MCL1, CCND1, WNT3A

References [152-154]

miR-122 miR-143

Breast, liver cancer Pancreatic, colorectal, prostate cancer Colorectal cancer Leukemia Lung cancer

TS TS

ADAM17, IGF1R GEF1, GEF2, Ras

[155-157] [158-160]

TS OC TS

mTOR HDAC4 HMGA2, Ras

[161] [162] [93, 94]

Colorectal and lung cancer Acute leukemia Lung cancer

OC

PTEN

[21, 163]

TS OC

Breast cancer, Prostate cancer Ovarian cancer Ovarian cancer, breast cancer

OC

4-3-3 theta PTEN, Bim, CDKN1A (p21Waf1/Cip1), E2F Smad7 p21 BRCA1, HMGA2, FOXO3 TUBB3 (class III betatubulin gene), TrkB, NFkB

[164] [145, 148, 150] [165], [166] [167] [168], [169]

miR-23b miR-218

Prostate cancer Cancer metastasis to bone Gastric cancer

TS OC/TS

[170] [171],[172]

miR-34c

Resistance to apoptosis induced by paclitaxel in lung cancer Cervical cancer

OC

Src kinase, Akt Wnt inhibitors: SOST (Sclerostin), Dikkopf2 (DKK2), SFRP2 (Secreted frizzled-related protein2) Robo1 receptor Bmf (Bcl-2-modifying factor), Myc CyclinD1, Akt1, indirectly up-regulate p271, p21

[174]

miR-144 miR-155 Let-7 family miR-21 miR-27a miR-17-19 family miR-106b-25 miR-182 miR-200c

miR-302-367 cluster

OC TS

TS

[173]

OC- Oncogene, TS- Tumor Suppressor

CAUSES OF ALTERATIONS IN MIRNA EXPRESSION Chromosomal Instability Large portions of miRNAs are located at cancer-associated genomic regions. These regions contain oncogenes, tumor-suppressor genes and fragile sites, which are sensitive to sister-

Dicer and MicroRNAs

2235

chromatid exchange, translocation, deletion and amplification. MicroRNA loci are also prone to have alterations in human cancers [175]. Furthermore, multiple miRNAs with roles in cancer are located in cancer fragile regions. For example, the cluster miR-17-92 is located at chromosome 13q31, a region amplified in B-cell lymphomas, malignant lymphomas and lung cancers [139, 140, 176].

Epigenetic Regulations MicroRNAs are also subject to epigenetic regulations, processes which can be involved in tumorigenesis. Epigenetic alterations are changes in gene expression caused by factors other than DNA coding, including DNA methylation, histone modifications and miRNA regulation. Multiple genes encoding miRNAs are methylated in cancer progression, such as multiple myeloma and chronic lymphocytic leukemia [177, 178]. Histone modification is also reported to have an essential role in miRNA regulation in hepatocellular carcinoma [179]. Furthermore, simultaneous inhibition of DNA methylation and histone deacetylation with a combination of 5-aza-2’-deoxycytidine and 4-phenylbutyric acid (PBA) significantly changes miRNA expression in bladder cancer cells [180].

Abnormalities in miRNA Biogenesis Machineries Since miRNAs regulate many crucial pathways to maintain normal biological functions, the regulation of miRNAs themselves is strictly controlled. After transcription, pri-miRNAs need to go through multiple steps in order to transform into mature and fully functional miRNAs, which can target and silence complementary mRNAs. MicroRNA microbiogenesis is a complex process involving multiple proteins, any alteration in such factors may lead to changes in miRNAs expression and furthermore, cancer.

Drosha Drosha expression in cancer is controversial. In triple-negative breast cancer tissue, the expression of Drosha is reported to be significantly higher than in normal breast tissue [181]. The same pattern is also observed in ovarian serous carcinoma [182]. However, in another clinical study, Drosha mRNA and protein expression were shown to be reduced in epithelial ovarian cancer specimens [183] and nasopharyngeal carcinoma [184]. BRCA1 regulates miRNA biogenesis through interaction with Drosha [185]. The alterations of Drosha in cancer are usually coupled with changes in overall miRNA expression. However, there is not yet any report showing a correlation between pathological Drosha expression and any specific miRNA(s).

2236

Ha T. Nguyen and Mandi M. Murph

DGCR8 In order for Drosha to process pri-miRNA, it needs to form a complex with DGCR8, a double-stranded RNA binding protein [184, 186]. DGCR8 is encoded by a gene located in a region frequently deleted in DiGeorge syndrome, the most common genetic deletion syndrome in humans [187]. DGCR8 binds pri-miRNAs while Drosha cleaves them and the two proteins interact with each other and form a so-called microprocessor complex [188]. Interestingly, while DGCR8 is known to stabilize Drosha through protein-protein interactions, knockdown of Drosha increases both DGCR8 mRNA and protein levels in cells [188, 189]. This could be interpreted as a mechanism cells use to maintain certain levels of these important proteins in the miRNA biogenesis complex.

Exportin-5 After being processed by the microprocessor complex, pre-miRNAs are transported from the nucleus to the cytoplasm by Exportin-5, a nucleocytoplasmic transport factor. In order to transport pre-miRNAs, Exportin-5 creates a complex with RanGTP and migrates from the nucleus to the cytoplasm. In the cytoplasm, pre-miRNA is released when RanGTP is hydrolyzed to RanGDP, which will be transported back to the nucleus with Exportin-5 [190193]. Exportin-5 is reported to have tumor suppressor features since cancer cells have a genetic defect in Exportin-5, leading to the accumulation of pre-miRNAs in the nucleus [194].

The Structure of Dicer Dicer is an endonuclease III that cleaves pre-miRNA into its final products, miRNA and miRNA*. The protein structure of Dicer from N-terminal to C-terminal includes an ATPase/helicase domain, DUF283 domain, PAZ domain, RNAseIIIa and RNAaseIIIb domain, and dsRBD domain (Figure 1a). The ATPase/helicase domain helps Dicer to differentiate RNA substrates through binding to their terminal loops. Deletion of the ATPase/helicase domain leads to equal enzyme activity on both pre-miRNA and dsRNA substrates, while wild-type Dicer has favorable activity toward pre-miRNA [195]. DUF283 is a function unknown domain [196]. The PAZ domain anchors the ds-RNA end for RNAse cleavage; therefore, the distance between the PAZ domain and the active sites of the RNAse III domains determines the size of Dicer products [195]. Besides that, the dsRBD domain in Dicer is required for dsRNA binding only when the PAZ domain is absent [195]. The RNAse IIIb domain is required for miRNA cleavage while the RNAse IIIa domain is preferred for miRNA* cleavage [197, 198] (Figure 1b).

Dicer in Early Development Dicer is essential for development in the early stages [199, 200]. The deletion of the DICER gene can lead to deficient and abnormal sperm cell formation. [201]. Similarly, Dicer has

Dicer and MicroRNAs

2237

critical roles in meiosis of the female germline [202]. Dicer null oocytes appear to have nonefficient chromosome-microtubule engagement, triggering a spindle checkpoint and delayed arrest, which results in a failure in mitotic chromosome segregation [202]. DICER heterozygous mutant mice embryos are not viable [199]. Elimination of DICER during embryogenesis causes perinatal death with loss of skeletal muscle mass and abnormal myofiber morphology, thus arresting embryonic development before the body plan is configured [199, 203]. Heterozygous mutation of DICER leads to small and abnormal embryonic morphology [199]. More interestingly, DICER mutant embryos have reduced Oct4 expression, which is one of key components to maintain embryonic stem cell proliferation [119, 199]. Dicer is also important for the later stages of development. It plays crucial roles in the development of lung epithelial morphogenesis and the normal maintenance of the mature pancreas [204, 205]. Deletion of DICER in somatic cells such as ovarian granulosa cells, mesenchyme-derived cells of the oviducts and uterus resulted in female sterility and multiple reproductive defects [206].

Figure 1. The schematic structure of the human Dicer protein.

The Role of Dicer in Cancer Alterations of Dicer expression are observed in multiple genetic diseases. For example, “DICER1 syndrome” is a term used to describe familial pleuropulmonary blastoma, a rare malignant lung tumor that occurs in children under age of 6 [207]. Results from sequencing of DNA from a large amount tumors show that germ-line mutations in the DICER gene are the main causes of pleuropulmonary blastoma. Besides that, mutations of DICER may lead to different types of tumors, preferentially cystic nephroma and ovarian Sertoli-Leydig tumors [207]. Germline mutation of DICER1, the gene encoding Dicer in human, plays an important

2238

Ha T. Nguyen and Mandi M. Murph

role in Embryonal rhabdomyosarcoma, the most common childhood soft tissue sarcoma and its somatic mutation may have certain influence on the cause of the disease [208]. Dicer is a haploinsufficient tumor suppressor, which means the deletion of one DICER allele leads to tumorigenesis while complete loss of DICER suppresses tumors [209]. Mouse models of human cancers show that deletion of one DICER copy reduces survival compared to controls and DICER deleted animals. In a DICER conditional knockout mouse model of lung cancer, tumor progression showed selection against complete DICER recombination, which means growing tumors consisted mainly of Dicer haplodeficient cells instead of Dicer wholly deficient cells. On the other hand, forced complete deletion of Dicer led to a significant decrease in tumor burden compared to tumors where one DICER allele remained (Figure 2). Surveys of human tumors also showed frequent loss of one allele of the gene encoding DICER in several tumor types, including breast, kidney, liver, lung, ovarian, pancreas and stomach [209]. The expression of Dicer is altered in many types of cancer. In epithelial ovarian cancer, low Dicer mRNA expression is recorded in the majority of specimens [183].

Figure 2. Haploinsufficiency of Dicer in cancer.

Reduction of Dicer is also correlated to advanced tumor stage, poor prognosis and lower survival [183]. Low Dicer reduces the cells’ ability to process siRNAs [183]. DNA sequencing of DICER showed several mutations from tumor samples but there is not enough evidence to prove that DICER mutations are associated with the reduction of Dicer mRNA expression [183]. In endometrioid endometrial cancer, lower Dicer transcription is associated with disease recurrence and worse disease free survival [210]. The cause of low Dicer expression in this type of cancer was neither gene deletion nor DNA methylation and still remains unknown [210]. A study on chronic lymphocytic leukemia, the most common leukemia, showed that lower Dicer expression is associated with more aggressive cancer stages based on Binet

Dicer and MicroRNAs

2239

clarification and higher prognostic factors, such as CD38 and ZAP-70 [211]. Furthermore, a reduction of Dicer is also believed to be one indicator of shorter overall survival and lower disease free survival [211]. Dicer is over-expressed in many human breast cancer cells but the pattern is not consistent across all breast cancer subtypes [212]. High expression of Dicer increases breast cancer resistant protein, which effluxes tamoxifen from cells and increases resistance to tamoxifen treatment [212]. Dicer expression is reported to be higher in triple-negative breast cancer, another type of breast cancer with very poor prognosis due in part to its absence of drug targets (e.g., ER, PR and HER2 receptors) [181]. Interestingly, high concentrations of Dicer protein in triple-negative breast cancer samples are detected in the nuclear compartment while in normal breast tissue it is located mainly in the cytosol [181]. Thus, it is hypothesized that in triplenegative breast cancer, there are changes in the subcellular localization mechanisms of Dicer [181]. On the other hand, Dicer tends to be down-regulated in the non-luminal (ER negative) subgroup of breast cancer through correlations with high histological grade, lack of Bcl-2, high proliferation and expression of basal-like markers [213]. Basal-like breast cancer is associated with high grade, poor prognosis and younger patient age, and is identified by specific markers, such as EGFR, CKs, CAV1, CAV2 and nestin [214, 215]. The loss of Dicer is linked with breast cancer malignancy and a possible cause of miRNAs down-regulation in breast cancer [216, 217]. However, low Dicer expression does not affect the outcomes of breast cancer adjuvant anthracyclin-based therapy [213]. In lung cancer, Dicer is reduced in invasive adenocarcinoma but over-expressed in non-invasive precursor lesions (atypical adenomatous hyperplasia and bronchioloalveolar carcinoma) areas [218]. It is suggested that the upregulation of Dicer can be an early sign of lung peripheral adenocarcinomas [218]. In another lung cancer study, reduced expression of Dicer was reported to be associated with poor prognosis and a shorter postoperative survival [219]. The cause of Dicer reduction was not known but it appears to be another mechanism than DNA methylation in the promoter region of DICER [219]. Table 2. Dicer alterations in cancers Types of cancer Ovarian Endometrial Breast Leukemia Lung Colorectal Prostate Melanoma

Regulation of Dicer Down Down Down/Up Down Down Up Up Up

References [183] [210] [181, 212, 213] [211] [218, 219] [220] [224] [226]

In contrast, in certain types of cancers, such as colorectal cancer, high expression of Dicer is associated with poor overall survival and low disease free survival [220]. Since a decrease in overall miRNAs is believed to happen frequently in more aggressive tumors, dysfunction of alternative miRNA processing pathways might be an explanation for the occurrence of upregulated Dicer in certain types of cancer [220-223]. In prostate adenocarcinoma, overall miRNAs expression is increased and Dicer levels increase as a correlation with disease stage, lymph node status and Gleason score [224]. Since it is believed that luminal cells tend to be the

2240

Ha T. Nguyen and Mandi M. Murph

origin of prostate cancer, the observance that Dicer is overexpressed in neoplastic luminal prostate cells suggested that high Dicer level might be an early sign of cancer development, probably facilitating the overall up-regulation of miRNAs [224, 225]. Also in cutaneous melanoma there is an up-regulation of Dicer mRNA in tumor cells, especially metastatic melanoma specimens, which suggests that Dicer overexpression may be a biomarker of cutaneous metastatic melanoma [226].

Regulation of Dicer Currently it is still unknown exactly what or how Dicer is regulated. However, evidence suggests that the change in Dicer expression levels could be a consequence of feedback loops in miRNA processing machinery. MicroRNAs are an important factor that regulates DICER. For example, let-7 directly down-regulates Dicer in multiple normal and cancer cell lines, both at the mRNA and protein level [227]. Sequencing results showed that members of the let-7 family are complementary to the 3’ UTR region of DICER [227]. In fact, Dicer regulation is considered an intermediate step for let-7 to regulate other miRNA expression [227]. This result requires further investigation on whether let-7 acts as tumor suppressor gene through Dicer down-regulation. Another miRNA family that directly targets Dicer is the miR-103/107 family [228]. Similar to the let-7 family, this direct targeting attenuates miRNA biosynthesis [228]. In contrast to the let-7 family, the miR-103/107 family is a biomarker for worse prognosis in breast cancer [228]. Since they are oncogenic miRs, Dicer down-regulation is an intermediate step before these miRNAs are capable of exerting oncogenic effects. For example, miR-103/107 can trigger the events of metastasis or epithelial to mesenchymal transition (EMT) [228]. In others words, in spite of the complicated expression patter of Dicer in breast cancer, it is the miR-103/107 family, not DICER, that should be targeted for cancer therapy. Exportin-5, the factor responsible for miRNA transport across the nuclear membrane, also regulates Dicer post-transcriptionally [229]. Inhibition of Exportin-5 leads to the accumulation of Dicer mRNA in the nucleus and ultimately the reduction of cytosolic DICER mRNA and functional DICER protein [229]. Furthermore, an increase in pre-miRNA saturates Exportin-5, thus preventing Dicer mRNA transport to the cytoplasm for translation [229]. This event is suggested to be a cross-regulation mechanism in miRNA biosynthesis with the purpose of maintaining miRNA homeostasis inside the cells [229]. Beyond miRNA processing machineries, several different factors are shown to regulate Dicer. One study of multiple cell lines with different Dicer expression levels showed that Dicer protein is repressed by reactive oxygen species, phorbol esters, the Ras oncogene, Type 1 interferon and double-stranded RNAs [230]. These data suggest that Dicer has a role in the cellular stress response and proposed that interferons are regulators of Dicer proteins [230]. Metformin, a medication for diabetes, increases Dicer mRNA and thus protein expression levels [231]. Indeed, metformin enhances the binding of transcription factor E2F3 and inhibits the transcriptional repressor E2F5 at the promoter of the Dicer gene [231]. Metformin exerts its anticancer effects by up-regulating Dicer and multiple miRNAs, many of which are involved in metabolism [231]. Interestingly, a recent study reported that Dicer has other functions beyond miRNA microbiogenesis. In fact, Dicer processes transcripts from RD2 Alu repeats into small RNAs

Dicer and MicroRNAs

2241

(28-65nt), which will target critical stem-cell RNAs, including Nanog mRNA [232]. These data suggest that our understanding of this multifaceted protein in incomplete; further research is needed to identify the complex nature of Dicer.

Argonautes After being processed by Dicer, the miRNA:miRNA* duplex is loaded into the RISC (RNA-induced silencing complex) [233-235]. MicroRNA* is primarily released (although in some systems it may exert significant biological effects) while miRNA is used to target mRNA for cleavage [236, 237]. Argonaute proteins (AGO1-4) are essential components of the RISC complex. Even though all four AGOs can repress mRNA expression, only AGO2 plays an essential role in mRNA cleavage [238, 239]. AGO1 and AGO2 are shown to up-regulated in serous ovarian cancer [182]. Furthermore, promoting expression and activation of AGO2 has positive effects on cancer by enhancing multiple tumor-suppressive miRNAs [240].

REFERENCES [1]

Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, et al. MicroRNA expression profiles classify human cancers. Nature. 2005;435:834-8. [2] Zhang BH, Pan XP, Cobb GP, Anderson TA. microRNAs as oncogenes and tumor suppressors. Developmental Biology. 2007;302:1-12. [3] Esquela-Kerscher A, Slack FJ. Oncomirs - microRNAs with a role in cancer. Nature Reviews Cancer. 2006;6:259-69. [4] Kasinski AL, Slack FJ. Epigenetics and genetics. MicroRNAs en route to the clinic: progress in validating and targeting microRNAs for cancer therapy. Nat. Rev. Cancer. 2011;11:849-64. [5] Cummins JM, He Y, Leary RJ, Pagliarini R, Diaz LA, Jr., Sjoblom T, et al. The colorectal microRNAome. Proc. Natl. Acad. Sci. USA. 2006;103:3687-92. [6] Bartel DP. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 2004;116:281-97. [7] Filipowicz W, Bhattacharyya SN, Sonenberg N. Mechanisms of post-transcriptional regulation by microRNAs: are the answers in sight? Nature Reviews Genetics. 2008;9:102-14. [8] Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, et al. MicroRNA expression profiles classify human cancers. Nature. 2005;435:834-8. [9] Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, et al. A microRNA expression signature of human solid tumors defines cancer gene targets. Proc. Natl. Acad. Sci. USA. 2006;103:2257-61. [10] Garzon R, Pichiorri F, Palumbo T, Iuliano R, Cimmino A, Aqeilan R, et al. MicroRNA fingerprints during human megakaryocytopoiesis. Proc. Natl. Acad. Sci. USA. 2006;103:5078-83.

2242

Ha T. Nguyen and Mandi M. Murph

[11] Calin GA, Liu CG, Sevignani C, Ferracin M, Felli N, Dumitru CD, et al. MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias. Proc. Natl. Acad. Sci. USA. 2004;101:11755-60. [12] Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, et al. MicroRNA gene expression deregulation in human breast cancer. Cancer Res. 2005;65:7065-70. [13] Ciafre SA, Galardi S, Mangiola A, Ferracin M, Liu CG, Sabatino G, et al. Extensive modulation of a set of microRNAs in primary glioblastoma. Biochem. Biophys. Res. Commun. 2005;334:1351-8. [14] Murakami Y, Yasuda T, Saigo K, Urashima T, Toyoda H, Okanoue T, et al. Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene. 2006;25:2537-45. [15] Roldo C, Missiaglia E, Hagan JP, Falconi M, Capelli P, Bersani S, et al. MicroRNA expression abnormalities in pancreatic endocrine and acinar tumors are associated with distinctive pathologic features and clinical behavior. J. Clin. Oncol. 2006;24:4677-84. [16] Xu K, Liang X, Cui D, Wu Y, Shi W, Liu J. miR-1915 inhibits Bcl-2 to modulate multidrug resistance by increasing drug-sensitivity in human colorectal carcinoma cells. Mol. Carcinog. 2013;52:70-8. [17] Pouliot LM, Chen YC, Bai J, Guha R, Martin SE, Gottesman MM, et al. Cisplatin sensitivity mediated by WEE1 and CHK1 is mediated by miR-155 and the miR-15 family. Cancer Res. 2012;72:5945-55. [18] Salim H, Akbar NS, Zong D, Vaculova AH, Lewensohn R, Moshfegh A, et al. miRNA214 modulates radiotherapy response of non-small cell lung cancer cells through regulation of p38MAPK, apoptosis and senescence. Br. J. Cancer. 2012;107:1361-73. [19] Majid S, Dar AA, Saini S, Shahryari V, Arora S, Zaman MS, et al. miRNA-34b Inhibits Prostate Cancer through Demethylation, Active Chromatin Modifications, and AKT Pathways. Clin. Cancer Res. 2013;19:73-84. [20] Li L, Xie X, Luo J, Liu M, Xi S, Guo J, et al. Targeted expression of miR-34a using the T-VISA system suppresses breast cancer cell growth and invasion. Mol. Ther. 2012;20:2326-34. [21] Liu ZL, Wang H, Liu J, Wang ZX. MicroRNA-21 (miR-21) expression promotes growth, metastasis, and chemo- or radioresistance in non-small cell lung cancer cells by targeting PTEN. Mol. Cell Biochem. 2013;372:35-45. [22] Geary RS, Watanabe TA, Truong L, Freier S, Lesnik EA, Sioufi NB, et al. Pharmacokinetic properties of 2'-O-(2-methoxyethyl)-modified oligonucleotide analogs in rats. J. Pharmacol. Exp. Ther. 2001;296:890-7. [23] Henry SP, Geary RS, Yu R, Levin AA. Drug properties of second-generation antisense oligonucleotides: how do they measure up to their predecessors? Curr. Opin Investig. Drugs. 2001;2:1444-9. [24] Levin AA. A review of the issues in the pharmacokinetics and toxicology of phosphorothioate antisense oligonucleotides. Biochim. Biophys. Acta. 1999;1489:69-84. [25] Henry SP, Zuckerman JE, Rojko J, Hall WC, Harman RJ, Kitchen D, et al. Toxicological properties of several novel oligonucleotide analogs in mice. Anticancer Drug Des. 1997;12:1-14. [26] Henry SP, Monteith D, Levin AA. Antisense oligonucleotide inhibitors for the treatment of cancer: 2. Toxicological properties of phosphorothioate oligodeoxynucleotides. Anticancer Drug Des. 1997;12:395-408.

Dicer and MicroRNAs

2243

[27] Bijsterbosch MK, Rump ET, De Vrueh RL, Dorland R, van Veghel R, Tivel KL, et al. Modulation of plasma protein binding and in vivo liver cell uptake of phosphorothioate oligodeoxynucleotides by cholesterol conjugation. Nucleic Acids Res. 2000;28:2717-25. [28] Krutzfeldt J, Rajewsky N, Braich R, Rajeev KG, Tuschl T, Manoharan M, et al. Silencing of microRNAs in vivo with 'antagomirs'. Nature. 2005;438:685-9. [29] Yang M, Mattes J. Discovery, biology and therapeutic potential of RNA interference, microRNA and antagomirs. Pharmacol. Ther. 2008;117:94-104. [30] Petersen M, Wengel J. LNA: a versatile tool for therapeutics and genomics. Trends Biotechnol. 2003;21:74-81. [31] Chabot S, Orio J, Castanier R, Bellard E, Nielsen SJ, Golzio M, et al. LNA-based oligonucleotide electrotransfer for miRNA inhibition. Mol. Ther. 2012;20:1590-8. [32] Obad S, dos Santos CO, Petri A, Heidenblad M, Broom O, Ruse C, et al. Silencing of microRNA families by seed-targeting tiny LNAs. Nat. Genet. 2011;43:371-8. [33] Matsubara H, Takeuchi T, Nishikawa E, Yanagisawa K, Hayashita Y, Ebi H, et al. Apoptosis induction by antisense oligonucleotides against miR-17-5p and miR-20a in lung cancers overexpressing miR-17-92. Oncogene. 2007;26:6099-105. [34] Elmen J, Lindow M, Schutz S, Lawrence M, Petri A, Obad S, et al. LNA-mediated microRNA silencing in non-human primates. Nature. 2008;452:896-9. [35] Elmen J, Lindow M, Silahtaroglu A, Bak M, Christensen M, Lind-Thomsen A, et al. Antagonism of microRNA-122 in mice by systemically administered LNA-antimiR leads to up-regulation of a large set of predicted target mRNAs in the liver. Nucleic Acids Res. 2008;36:1153-62. [36] Lanford RE, Hildebrandt-Eriksen ES, Petri A, Persson R, Lindow M, Munk ME, et al. Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection. Science. 2010;327:198-201. [37] Mitchell PS, Parkin RK, Kroh EM, Fritz BR, Wyman SK, Pogosova-Agadjanyan EL, et al. Circulating microRNAs as stable blood-based markers for cancer detection. Proc. Natl. Acad. Sci. USA. 2008;105:10513-8. [38] Arroyo JD, Chevillet JR, Kroh EM, Ruf IK, Pritchard CC, Gibson DF, et al. Argonaute2 complexes carry a population of circulating microRNAs independent of vesicles in human plasma. Proc. Natl. Acad. Sci. USA. 2011;108:5003-8. [39] Vickers KC, Palmisano BT, Shoucri BM, Shamburek RD, Remaley AT. MicroRNAs are transported in plasma and delivered to recipient cells by high-density lipoproteins. Nat. Cell Biol. 2011;13:423-33. [40] Layzer JM, McCaffrey AP, Tanner AK, Huang Z, Kay MA, Sullenger BA. In vivo activity of nuclease-resistant siRNAs. RNA. 2004;10:766-71. [41] Tseng YC, Mozumdar S, Huang L. Lipid-based systemic delivery of siRNA. Adv. Drug Deliv. Rev. 2009;61:721-31. [42] Kumar MS, Erkeland SJ, Pester RE, Chen CY, Ebert MS, Sharp PA, et al. Suppression of non-small cell lung tumor development by the let-7 microRNA family. Proc. Natl. Acad. Sci. USA. 2008;105:3903-8. [43] Kota J, Chivukula RR, O'Donnell KA, Wentzel EA, Montgomery CL, Hwang HW, et al. Therapeutic microRNA delivery suppresses tumorigenesis in a murine liver cancer model. Cell. 2009;137:1005-17. [44] Klibanov AL, Maruyama K, Torchilin VP, Huang L. Amphipathic polyethyleneglycols effectively prolong the circulation time of liposomes. FEBS Lett. 1990;268:235-7.

2244

Ha T. Nguyen and Mandi M. Murph

[45] Wu Y, Crawford M, Yu B, Mao Y, Nana-Sinkam SP, Lee LJ. MicroRNA delivery by cationic lipoplexes for lung cancer therapy. Mol. Pharm. 2011;8:1381-9. [46] Park JW, Kirpotin DB, Hong K, Shalaby R, Shao Y, Nielsen UB, et al. Tumor targeting using anti-her2 immunoliposomes. J. Control Release. 2001;74:95-113. [47] Chen Y, Zhu X, Zhang X, Liu B, Huang L. Nanoparticles modified with tumor-targeting scFv deliver siRNA and miRNA for cancer therapy. Mol. Ther. 2010;18:1650-6. [48] Baigude H, McCarroll J, Yang CS, Swain PM, Rana TM. Design and creation of new nanomaterials for therapeutic RNAi. ACS Chem. Biol. 2007;2:237-41. [49] Su J, Baigude H, McCarroll J, Rana TM. Silencing microRNA by interfering nanoparticles in mice. Nucleic Acids Res. 2011;39:e38. [50] Cheng CJ, Saltzman WM. Polymer nanoparticle-mediated delivery of microRNA inhibition and alternative splicing. Mol. Pharm. 2012;9:1481-8. [51] Daniel MC, Astruc D. Gold nanoparticles: assembly, supramolecular chemistry, quantum-size-related properties, and applications toward biology, catalysis, and nanotechnology. Chem. Rev. 2004;104:293-346. [52] Rosi NL, Giljohann DA, Thaxton CS, Lytton-Jean AK, Han MS, Mirkin CA. Oligonucleotide-modified gold nanoparticles for intracellular gene regulation. Science. 2006;312:1027-30. [53] Lee SH, Bae KH, Kim SH, Lee KR, Park TG. Amine-functionalized gold nanoparticles as non-cytotoxic and efficient intracellular siRNA delivery carriers. International Journal of Pharmaceutics. 2008;364:94-101. [54] Storhoff JJ, Elghanian R, Mucic RC, Mirkin CA, Letsinger RL. One-pot colorimetric differentiation of polynucleotides with single base imperfections using gold nanoparticle probes. Journal of the American Chemical Society. 1998;120:1959-64. [55] Prencipe G, Tabakman SM, Welsher K, Liu Z, Goodwin AP, Zhang L, et al. PEG branched polymer for functionalization of nanomaterials with ultralong blood circulation. J. Am. Chem. Soc. 2009;131:4783-7. [56] Ghosh R, Singh LC, Shohet JM, Gunaratne PH. A gold nanoparticle platform for the delivery of functional microRNAs into cancer cells. Biomaterials. 2013;34:807-16. [57] Crew E, Tessel MA, Rahman S, Razzak-Jaffar A, Mott D, Kamundi M, et al. MicroRNA conjugated gold nanoparticles and cell transfection. Anal Chem. 2012;84:26-9. [58] Kim JH, Yeom JH, Ko JJ, Han MS, Lee K, Na SY, et al. Effective delivery of antimiRNA DNA oligonucleotides by functionalized gold nanoparticles. J. Biotechnol. 2011;155:287-92. [59] Lee Y, Kim M, Han JJ, Yeom KH, Lee S, Baek SH, et al. MicroRNA genes are transcribed by RNA polymerase II. Embo Journal. 2004;23:4051-60. [60] Lee O, Kim VN. Evidence that microRNA genes are transcribed by RNA polymerase II. Cell Structure and Function. 2004;29:68-. [61] Cai XZ, Hagedorn CH, Cullen BR. Human microRNAs are processed from capped, polyadenylated transcripts that can also function as mRNAs. RNA-a Publication of the RNA Society. 2004;10:1957-66. [62] Denli AM, Tops BBJ, Plasterk RHA, Ketting RF, Hannon GJ. Processing of primary microRNAs by the Microprocessor complex. Nature. 2004;432:231-5. [63] Bohnsack MT, Czaplinski K, Gorlich D. Exportin 5 is a RanGTP-dependent dsRNAbinding protein that mediates nuclear export of pre-miRNAs. RNA-a Publication of the RNA Society. 2004;10:185-91.

Dicer and MicroRNAs

2245

[64] Hutvagner G, McLachlan J, Pasquinelli AE, Balint E, Tuschl T, Zamore PD. A cellular function for the RNA-interference enzyme DICER in the maturation of the let-7 small temporal RNA. Science. 2001;293:834-8. [65] Ketting RF, Fischer SEJ, Bernstein E, Sijen T, Hannon GJ, Plasterk RHA. DICER functions in RNA interference and in synthesis of small RNA involved in developmental timing in C-elegans. Genes Dev. 2001;15:2654-9. [66] Gregory RI, Chendrimada TP, Cooch N, Shiekhattar R. Human RISC couples microRNA biogenesis and posttranscriptional gene silencing. Cell. 2005;123:631-40. [67] Lin SL, Chang D, Ying SY. Asymmetry of intronic pre-miRNA structures in functional RISC assembly. Gene. 2005;356:32-8. [68] Sikand K, Slaibi JE, Singh R, Slane SD, Shukla GC. miR 488* inhibits androgen receptor expression in prostate carcinoma cells. Int. J. Cancer. 2011;129:810-9. [69] Eichner LJ, Perry MC, Dufour CR, Bertos N, Park M, St-Pierre J, et al. miR-378(*) mediates metabolic shift in breast cancer cells via the PGC-1beta/ERRgamma transcriptional pathway. Cell Metab. 2010;12:352-61. [70] Jia W, Eneh JO, Ratnaparkhe S, Altman MK, Murph MM. MicroRNA-30c-2* expressed in ovarian cancer cells suppresses growth factor-induced cellular proliferation and downregulates the oncogene BCL9. Mol. Cancer Res. 2011;9:1732-45. [71] Reinhart BJ, Slack FJ, Basson M, Pasquinelli AE, Bettinger JC, Rougvie AE, et al. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature. 2000;403:901-6. [72] Lee RC, Feinbaum RL, Ambros V. The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 1993;75:843-54. [73] Wightman B, Ha I, Ruvkun G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 1993;75:855-62. [74] Pasquinelli AE, Reinhart BJ, Slack F, Martindale MQ, Kuroda MI, Maller B, et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 2000;408:86-9. [75] Ruby JG, Jan C, Player C, Axtell MJ, Lee W, Nusbaum C, et al. Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans. Cell. 2006;127:1193-207. [76] Schulman BR, Esquela-Kerscher A, Slack FJ. Reciprocal expression of lin-41 and the microRNAs let-7 and mir-125 during mouse embryogenesis. Dev. Dyn. 2005;234:104654. [77] Wulczyn FG, Smirnova L, Rybak A, Brandt C, Kwidzinski E, Ninnemann O, et al. Posttranscriptional regulation of the let-7 microRNA during neural cell specification. FASEB J. 2007;21:415-26. [78] Suh MR, Lee Y, Kim JY, Kim SK, Moon SH, Lee JY, et al. Human embryonic stem cells express a unique set of microRNAs. Dev. Biol. 2004;270:488-98. [79] Sempere LF, Freemantle S, Pitha-Rowe I, Moss E, Dmitrovsky E, Ambros V. Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol. 2004;5:R13. [80] Ibarra I, Erlich Y, Muthuswamy SK, Sachidanandam R, Hannon GJ. A role for microRNAs in maintenance of mouse mammary epithelial progenitor cells. Genes Dev. 2007;21:3238-43.

2246

Ha T. Nguyen and Mandi M. Murph

[81] Bussing I, Slack FJ, Grosshans H. let-7 microRNAs in development, stem cells and cancer. Trends Mol. Med. 2008;14:400-9. [82] Shields JM, Pruitt K, McFall A, Shaub A, Der CJ. Understanding Ras: 'it ain't over 'til it's over'. Trends Cell Biol. 2000;10:147-54. [83] Bonni A, Brunet A, West AE, Datta SR, Takasu MA, Greenberg ME. Cell survival promoted by the Ras-MAPK signaling pathway by transcription-dependent and independent mechanisms. Science. 1999;286:1358-62. [84] Pruitt K, Der CJ. Ras and Rho regulation of the cell cycle and oncogenesis. Cancer Lett. 2001;171:1-10. [85] Almoguera C, Shibata D, Forrester K, Martin J, Arnheim N, Perucho M. Most human carcinomas of the exocrine pancreas contain mutant c-K-ras genes. Cell. 1988;53:54954. [86] Shibata D, Capella G, Perucho M. Mutational activation of the c-K-ras gene in human pancreatic carcinoma. Baillieres Clin. Gastroenterol. 1990;4:151-69. [87] Bos JL, Fearon ER, Hamilton SR, Verlaan-de Vries M, van Boom JH, van der Eb AJ, et al. Prevalence of ras gene mutations in human colorectal cancers. Nature. 1987;327:2937. [88] Ahrendt SA, Decker PA, Alawi EA, Zhu Yr YR, Sanchez-Cespedes M, Yang SC, et al. Cigarette smoking is strongly associated with mutation of the K-ras gene in patients with primary adenocarcinoma of the lung. Cancer. 2001;92:1525-30. [89] Johnson L, Mercer K, Greenbaum D, Bronson RT, Crowley D, Tuveson DA, et al. Somatic activation of the K-ras oncogene causes early onset lung cancer in mice. Nature. 2001;410:1111-6. [90] Takamizawa J, Konishi H, Yanagisawa K, Tomida S, Osada H, Endoh H, et al. Reduced expression of the let-7 microRNAs in human lung cancers in association with shortened postoperative survival. Cancer Res. 2004;64:3753-6. [91] Calin GA, Sevignani C, Dan Dumitru C, Hyslop T, Noch E, Yendamuri S, et al. Human microRNA genes are frequently located at fragile sites and genomic regions involved in cancers. Proc. Natl. Acad. Sci. USA. 2004;101:2999-3004. [92] Johnson SM, Grosshans H, Shingara J, Byrom M, Jarvis R, Cheng A, et al. RAS is regulated by the let-7 microRNA family. Cell. 2005;120:635-47. [93] Trang P, Medina PP, Wiggins JF, Ruffino L, Kelnar K, Omotola M, et al. Regression of murine lung tumors by the let-7 microRNA. Oncogene. 2010;29:1580-7. [94] Lee YS, Dutta A. The tumor suppressor microRNA let-7 represses the HMGA2 oncogene. Genes Dev. 2007;21:1025-30. [95] Reeves R. Molecular biology of HMGA proteins: hubs of nuclear function. Gene. 2001;277:63-81. [96] Zhou X, Benson KF, Ashar HR, Chada K. Mutation responsible for the mouse pygmy phenotype in the developmentally regulated factor HMGI-C. Nature. 1995;376:771-4. [97] Rogalla P, Drechsler K, Frey G, Hennig Y, Helmke B, Bonk U, et al. HMGI-C expression patterns in human tissues. Implications for the genesis of frequent mesenchymal tumors. Am. J. Pathol. 1996;149:775-9. [98] Berner JM, Meza-Zepeda LA, Kools PF, Forus A, Schoenmakers EF, Van de Ven WJ, et al. HMGIC, the gene for an architectural transcription factor, is amplified and rearranged in a subset of human sarcomas. Oncogene. 1997;14:2935-41.

Dicer and MicroRNAs

2247

[99] Sarhadi VK, Wikman H, Salmenkivi K, Kuosma E, Sioris T, Salo J, et al. Increased expression of high mobility group A proteins in lung cancer. J. Pathol. 2006;209:20612. [100] Mayr C, Hemann MT, Bartel DP. Disrupting the pairing between let-7 and Hmga2 enhances oncogenic transformation. Science. 2007;315:1576-9. [101] Hebert C, Norris K, Scheper MA, Nikitakis N, Sauk JJ. High mobility group A2 is a target for miRNA-98 in head and neck squamous cell carcinoma. Mol Cancer. 2007;6:5. [102] Yu F, Yao H, Zhu P, Zhang X, Pan Q, Gong C, et al. let-7 regulates self renewal and tumorigenicity of breast cancer cells. Cell. 2007;131:1109-23. [103] Johnson CD, Esquela-Kerscher A, Stefani G, Byrom M, Kelnar K, Ovcharenko D, et al. The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 2007;67:7713-22. [104] Galaktionov K, Lee AK, Eckstein J, Draetta G, Meckler J, Loda M, et al. CDC25 phosphatases as potential human oncogenes. Science. 1995;269:1575-7. [105] Huang JC, Babak T, Corson TW, Chua G, Khan S, Gallie BL, et al. Using expression profiling data to identify human microRNA targets. Nat. Methods. 2007;4:1045-9. [106] Schultz J, Lorenz P, Gross G, Ibrahim S, Kunz M. MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorageindependent growth. Cell Res. 2008;18:549-57. [107] Viswanathan SR, Daley GQ, Gregory RI. Selective blockade of microRNA processing by LIN28. Science. 2008;320:97-100. [108] Newman MA, Thomson JM, Hammond SM. Lin-28 interaction with the Let-7 precursor loop mediates regulated microRNA processing. RNA. 2008;14:1539-49. [109] Piskounova E, Viswanathan SR, Janas M, LaPierre RJ, Daley GQ, Sliz P, et al. Determinants of microRNA processing inhibition by the developmentally regulated RNA-binding protein LIN28. J. Biol. Chem. 2008;283:21310-4. [110] Nam Y, Chen C, Gregory RI, Chou JJ, Sliz P. Molecular basis for interaction of let-7 microRNAs with LIN28. Cell. 2011;147:1080-91. [111] Heo I, Joo C, Cho J, Ha M, Han J, Kim VN. LIN28 mediates the terminal uridylation of let-7 precursor MicroRNA. Mol. Cell. 2008;32:276-84. [112] Heo I, Joo C, Kim YK, Ha M, Yoon MJ, Cho J, et al. TUT4 in concert with LIN28 suppresses microRNA biogenesis through pre-microRNA uridylation. Cell. 2009;138:696-708. [113] Hagan JP, Piskounova E, Gregory RI. LIN28 recruits the TUTase Zcchc11 to inhibit let7 maturation in mouse embryonic stem cells. Nat Struct Mol. Biol. 2009;16:1021-5. [114] Thornton JE, Chang HM, Piskounova E, Gregory RI. LIN28-mediated control of let-7 microRNA expression by alternative TUTases Zcchc11 (TUT4) and Zcchc6 (TUT7). RNA. 2012;18:1875-85. [115] Viswanathan SR, Powers JT, Einhorn W, Hoshida Y, Ng TL, Toffanin S, et al. LIN28 promotes transformation and is associated with advanced human malignancies. Nat. Genet. 2009;41:843-8. [116] Richards M, Tan SP, Tan JH, Chan WK, Bongso A. The transcriptome profile of human embryonic stem cells as defined by SAGE. Stem. Cells. 2004;22:51-64. [117] Pan L, Gong Z, Zhong Z, Dong Z, Liu Q, Le Y, et al. Lin-28 reactivation is required for let-7 repression and proliferation in human small cell lung cancer cells. Mol. Cell Biochem. 2011;355:257-63.

2248

Ha T. Nguyen and Mandi M. Murph

[118] Sakurai M, Miki Y, Masuda M, Hata S, Shibahara Y, Hirakawa H, et al. LIN28: a regulator of tumor-suppressing activity of let-7 microRNA in human breast cancer. J. Steroid Biochem. Mol. Biol. 2012;131:101-6. [119] Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, et al. Induced pluripotent stem cell lines derived from human somatic cells. Science. 2007;318:1917-20. [120] Moss EG, Tang L. Conservation of the heterochronic regulator Lin-28, its developmental expression and microRNA complementary sites. Dev. Biol. 2003;258:432-42. [121] Rybak A, Fuchs H, Smirnova L, Brandt C, Pohl EE, Nitsch R, et al. A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment. Nat. Cell Biol. 2008;10:987-93. [122] Viswanathan SR, Daley GQ. LIN28: A microRNA regulator with a macro role. Cell. 2010;140:445-9. [123] Takahashi K, Okita K, Nakagawa M, Yamanaka S. Induction of pluripotent stem cells from fibroblast cultures. Nat. Protoc. 2007;2:3081-9. [124] Park IH, Zhao R, West JA, Yabuuchi A, Huo H, Ince TA, et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature. 2008;451:141-6. [125] McCormick F. Signalling networks that cause cancer. Trends Cell Biol. 1999;9:M53-6. [126] Vogelstein B, Kinzler KW. The multistep nature of cancer. Trends Genet. 1993;9:13841. [127] Vaux DL, Cory S, Adams JM. Bcl-2 gene promotes haemopoietic cell survival and cooperates with c-myc to immortalize pre-B cells. Nature. 1988;335:440-2. [128] Hartwell LH, Kastan MB. Cell cycle control and cancer. Science. 1994;266:1821-8. [129] Chang TC, Yu D, Lee YS, Wentzel EA, Arking DE, West KM, et al. Widespread microRNA repression by Myc contributes to tumorigenesis. Nat. Genet. 2008;40:43-50. [130] Chang TC, Zeitels LR, Hwang HW, Chivukula RR, Wentzel EA, Dews M, et al. Lin28B transactivation is necessary for Myc-mediated let-7 repression and proliferation. Proc. Natl. Acad. Sci. USA. 2009;106:3384-9. [131] Sampson VB, Rong NH, Han J, Yang Q, Aris V, Soteropoulos P, et al. MicroRNA let7a down-regulates MYC and reverts MYC-induced growth in Burkitt lymphoma cells. Cancer Res. 2007;67:9762-70. [132] Buechner J, Tomte E, Haug BH, Henriksen JR, Lokke C, Flaegstad T, et al. Tumoursuppressor microRNAs let-7 and mir-101 target the proto-oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastoma. Br. J. Cancer. 2011;105:296-303. [133] Koscianska E, Baev V, Skreka K, Oikonomaki K, Rusinov V, Tabler M, et al. Prediction and preliminary validation of oncogene regulation by miRNAs. BMC Mol. Biol. 2007;8:79. [134] Wong TS, Man OY, Tsang CM, Tsao SW, Tsang RK, Chan JY, et al. MicroRNA let-7 suppresses nasopharyngeal carcinoma cells proliferation through downregulating c-Myc expression. J. Cancer Res. Clin. Oncol. 2011;137:415-22. [135] Molenaar JJ, Domingo-Fernandez R, Ebus ME, Lindner S, Koster J, Drabek K, et al. LIN28B induces neuroblastoma and enhances MYCN levels via let-7 suppression. Nat. Genet. 2012;44:1199-206. [136] Ota A, Tagawa H, Karnan S, Tsuzuki S, Karpas A, Kira S, et al. Identification and characterization of a novel gene, C13orf25, as a target for 13q31-q32 amplification in malignant lymphoma. Cancer Res. 2004;64:3087-95.

Dicer and MicroRNAs

2249

[137] Concepcion CP, Bonetti C, Ventura A. The microRNA-17-92 family of microRNA clusters in development and disease. Cancer J. 2012;18:262-7. [138] Mendell JT. miRiad roles for the miR-17-92 cluster in development and disease. Cell. 2008;133:217-22. [139] He L, Thomson JM, Hemann MT, Hernando-Monge E, Mu D, Goodson S, et al. A microRNA polycistron as a potential human oncogene. Nature. 2005;435:828-33. [140] Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, et al. A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung cancers and enhances cell proliferation. Cancer Res. 2005;65:9628-32. [141] Connolly E, Melegari M, Landgraf P, Tchaikovskaya T, Tennant BC, Slagle BL, et al. Elevated expression of the miR-17-92 polycistron and miR-21 in hepadnavirusassociated hepatocellular carcinoma contributes to the malignant phenotype. Am. J. Pathol. 2008;173:856-64. [142] Takakura S, Mitsutake N, Nakashima M, Namba H, Saenko VA, Rogounovitch TI, et al. Oncogenic role of miR-17-92 cluster in anaplastic thyroid cancer cells. Cancer Sci. 2008;99:1147-54. [143] Yan HL, Xue G, Mei Q, Wang YZ, Ding FX, Liu MF, et al. Repression of the miR-1792 cluster by p53 has an important function in hypoxia-induced apoptosis. EMBO J. 2009;28:2719-32. [144] Lu Y, Thomson JM, Wong HY, Hammond SM, Hogan BL. Transgenic over-expression of the microRNA miR-17-92 cluster promotes proliferation and inhibits differentiation of lung epithelial progenitor cells. Dev. Biol. 2007;310:442-53. [145] Xiao C, Srinivasan L, Calado DP, Patterson HC, Zhang B, Wang J, et al. Lymphoproliferative disease and autoimmunity in mice with increased miR-17-92 expression in lymphocytes. Nat. Immunol. 2008;9:405-14. [146] Taguchi A, Yanagisawa K, Tanaka M, Cao K, Matsuyama Y, Goto H, et al. Identification of hypoxia-inducible factor-1 alpha as a novel target for miR-17-92 microRNA cluster. Cancer Res. 2008;68:5540-5. [147] Inomata M, Tagawa H, Guo YM, Kameoka Y, Takahashi N, Sawada K. MicroRNA-1792 down-regulates expression of distinct targets in different B-cell lymphoma subtypes. Blood. 2009;113:396-402. [148] Ivanovska I, Ball AS, Diaz RL, Magnus JF, Kibukawa M, Schelter JM, et al. MicroRNAs in the miR-106b family regulate p21/CDKN1A and promote cell cycle progression. Mol. Cell Biol. 2008;28:2167-74. [149] O'Donnell KA, Wentzel EA, Zeller KI, Dang CV, Mendell JT. c-Myc-regulated microRNAs modulate E2F1 expression. Nature. 2005;435:839-43. [150] Sylvestre Y, De Guire V, Querido E, Mukhopadhyay UK, Bourdeau V, Major F, et al. An E2F/miR-20a autoregulatory feedback loop. J. Biol. Chem. 2007;282:2135-43. [151] Woods K, Thomson JM, Hammond SM. Direct regulation of an oncogenic micro-RNA cluster by E2F transcription factors. J. Biol. Chem. 2007;282:2130-4. [152] Bhattacharya R, Nicoloso M, Arvizo R, Wang E, Cortez A, Rossi S, et al. MiR-15a and MiR-16 control Bmi-1 expression in ovarian cancer. Cancer Res. 2009;69:9090-5. [153] Aqeilan RI, Calin GA, Croce CM. miR-15a and miR-16-1 in cancer: discovery, function and future perspectives. Cell Death Differ. 2010;17:215-20.

2250

Ha T. Nguyen and Mandi M. Murph

[154] Cimmino A, Calin GA, Fabbri M, Iorio MV, Ferracin M, Shimizu M, et al. miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc. Natl. Acad. Sci. USA. 2005;102:13944-9. [155] Wang B, Wang H, Yang Z. MiR-122 inhibits cell proliferation and tumorigenesis of breast cancer by targeting IGF1R. PLoS One. 2012;7:e47053. [156] Tsai WC, Hsu PW, Lai TC, Chau GY, Lin CW, Chen CM, et al. MicroRNA-122, a tumor suppressor microRNA that regulates intrahepatic metastasis of hepatocellular carcinoma. Hepatology. 2009;49:1571-82. [157] Kutay H, Bai S, Datta J, Motiwala T, Pogribny I, Frankel W, et al. Downregulation of miR-122 in the rodent and human hepatocellular carcinomas. J Cell Biochem. 2006;99:671-8. [158] Hu Y, Ou Y, Wu K, Chen Y, Sun W. miR-143 inhibits the metastasis of pancreatic cancer and an associated signaling pathway. Tumour Biol. 2012;33:1863-70. [159] Tavano F, di Mola FF, Piepoli A, Panza A, Copetti M, Burbaci FP, et al. Changes in miR-143 and miR-21 Expression and Clinicopathological Correlations in Pancreatic Cancers. Pancreas. 2012;41:1280-4. [160] Huang S, Guo W, Tang YB, Ren D, Zou XN, Peng XS. miR-143 and miR-145 inhibit stem cell characteristics of PC-3 prostate cancer cells. Oncology Reports. 2012;28:18317. [161] Iwaya T, Yokobori T, Nishida N, Kogo R, Sudo T, Tanaka F, et al. Downregulation of miR-144 is associated with colorectal cancer progression via activation of mTOR signaling pathway. Carcinogenesis. 2012;33:2391-7. [162] Sandhu SK, Volinia S, Costinean S, Galasso M, Neinast R, Santhanam R, et al. miR-155 targets histone deacetylase 4 (HDAC4) and impairs transcriptional activity of B-cell lymphoma 6 (BCL6) in the Emu-miR-155 transgenic mouse model. Proc. Natl. Acad. Sci. USA. 2012;109:20047-52. [163] Xiong B, Cheng Y, Ma L, Zhang C. MiR-21 regulates biological behavior through the PTEN/PI-3 K/Akt signaling pathway in human colorectal cancer cells. Int. J. Oncol. 2013;42:219-28. [164] Scheibner KA, Teaboldt B, Hauer MC, Chen X, Cherukuri S, Guo Y, et al. MiR-27a Functions as a Tumor Suppressor in Acute Leukemia by Regulating 14-3-3theta. PLoS One. 2012;7:e50895. [165] Smith AL, Iwanaga R, Drasin DJ, Micalizzi DS, Vartuli RL, Tan AC, et al. The miR106b-25 cluster targets Smad7, activates TGF-beta signaling, and induces EMT and tumor initiating cell characteristics downstream of Six1 in human breast cancer. Oncogene. 2012;31:5162-71. [166] Li B, Shi XB, Nori D, Chao CK, Chen AM, Valicenti R, et al. Down-regulation of microRNA 106b is involved in p21-mediated cell cycle arrest in response to radiation in prostate cancer cells. Prostate. 2011;71:567-74. [167] McMillen BD, Aponte MM, Liu Z, Helenowski IB, Scholtens DM, Buttin BM, et al. Expression analysis of MIR182 and its associated target genes in advanced ovarian carcinoma. Mod. Pathol. 2012;25:1644-53. [168] Cittelly DM, Dimitrova I, Howe EN, Cochrane DR, Jean A, Spoelstra NS, et al. Restoration of miR-200c to Ovarian Cancer Reduces Tumor Burden and Increases Sensitivity to Paclitaxel. Mol. Cancer Ther. 2012;11:2556-65.

Dicer and MicroRNAs

2251

[169] Howe EN, Cochrane DR, Cittelly DM, Richer JK. miR-200c targets a NF-kappaB upregulated TrkB/NTF3 autocrine signaling loop to enhance anoikis sensitivity in triple negative breast cancer. PLoS One. 2012;7:e49987. [170] Majid S, Dar AA, Saini S, Arora S, Shahryari V, Zaman MS, et al. miR-23b Represses Proto-oncogene Src Kinase and Functions as Methylation-Silenced Tumor Suppressor with Diagnostic and Prognostic Significance in Prostate Cancer. Cancer Res. 2012;72:6435-46. [171] Hassan MQ, Maeda Y, Taipaleenmaki H, Zhang W, Jafferji M, Gordon JA, et al. miR218 Directs a Wnt Signaling Circuit to Promote Differentiation of Osteoblasts and Osteomimicry of Metastatic Cancer Cells. J. Biol. Chem. 2012;287:42084-92. [172] Tie J, Pan Y, Zhao L, Wu K, Liu J, Sun S, et al. MiR-218 inhibits invasion and metastasis of gastric cancer by targeting the Robo1 receptor. PLoS Genet. 2010;6:e1000879. [173] Catuogno S, Cerchia L, Romano G, Pognonec P, Condorelli G, de Franciscis V. miR34c may protect lung cancer cells from paclitaxel-induced apoptosis. Oncogene. 2012. [174] Cai N, Wang YD, Zheng PS. The microRNA-302-367 cluster suppresses the proliferation of cervical carcinoma cells through the novel target AKT1. RNA. 2013;19:85-95. [175] Zhang L, Huang J, Yang N, Greshock J, Megraw MS, Giannakakis A, et al. microRNAs exhibit high frequency genomic alterations in human cancer. Proc. Natl. Acad. Sci. USA. 2006;103:9136-41. [176] Tagawa H, Seto M. A microRNA cluster as a target of genomic amplification in malignant lymphoma. Leukemia. 2005;19:2013-6. [177] Wong KY, Huang X, Chim CS. DNA methylation of microRNA genes in multiple myeloma. Carcinogenesis. 2012;33:1629-38. [178] Baer C, Claus R, Frenzel LP, Zucknick M, Park YJ, Gu L, et al. Extensive promoter DNA hypermethylation and hypomethylation is associated with aberrant microRNA expression in chronic lymphocytic leukemia. Cancer Res. 2012;72:3775-85. [179] Wang Y, Toh HC, Chow P, Chung AY, Meyers DJ, Cole PA, et al. MicroRNA-224 is up-regulated in hepatocellular carcinoma through epigenetic mechanisms. FASEB J. 2012;26:3032-41. [180] Saito Y, Liang G, Egger G, Friedman JM, Chuang JC, Coetzee GA, et al. Specific activation of microRNA-127 with downregulation of the proto-oncogene BCL6 by chromatin-modifying drugs in human cancer cells. Cancer Cell. 2006;9:435-43. [181] Passon N, Gerometta A, Puppin C, Lavarone E, Puglisi F, Tell G, et al. Expression of DICER and Drosha in triple-negative breast cancer. J. Clin. Pathol. 2012;65:320-6. [182] Vaksman O, Hetland TE, Trope CG, Reich R, Davidson B. Argonaute, DICER, and Drosha are up-regulated along tumor progression in serous ovarian carcinoma. Hum. Pathol. 2012;43:2062-9. [183] Merritt WM, Lin YG, Han LY, Kamat AA, Spannuth WA, Schmandt R, et al. DICER, Drosha, and outcomes in patients with ovarian cancer. N. Engl. J. Med. 2008;359:264150. [184] Guo X, Liao Q, Chen P, Li X, Xiong W, Ma J, et al. The microRNA-processing enzymes: Drosha and DICER can predict prognosis of nasopharyngeal carcinoma. J Cancer Res Clin Oncol. 2012;138:49-56. [185] Kawai S, Amano A. BRCA1 regulates microRNA biogenesis via the DROSHA microprocessor complex. J. Cell Biol. 2012;197:201-8.

2252

Ha T. Nguyen and Mandi M. Murph

[186] Gregory RI, Yan KP, Amuthan G, Chendrimada T, Doratotaj B, Cooch N, et al. The Microprocessor complex mediates the genesis of microRNAs. Nature. 2004;432:235-40. [187] Shiohama A, Sasaki T, Noda S, Minoshima S, Shimizu N. Molecular cloning and expression analysis of a novel gene DGCR8 located in the DiGeorge syndrome chromosomal region. Biochem. Biophys. Res. Commun. 2003;304:184-90. [188] Han J, Pedersen JS, Kwon SC, Belair CD, Kim YK, Yeom KH, et al. Posttranscriptional crossregulation between Drosha and DGCR8. Cell. 2009;136:75-84. [189] Triboulet R, Chang HM, Lapierre RJ, Gregory RI. Post-transcriptional control of DGCR8 expression by the Microprocessor. RNA. 2009;15:1005-11. [190] Zeng Y, Cullen BR. Structural requirements for pre-microRNA binding and nuclear export by Exportin 5. Nucleic Acids Research. 2004;32:4776-85. [191] Yi R, Qin Y, Macara IG, Cullen BR. Exportin-5 mediates the nuclear export of premicroRNAs and short hairpin RNAs. Genes Dev. 2003;17:3011-6. [192] Lund E, Guttinger S, Calado A, Dahlberg JE, Kutay U. Nuclear export of microRNA precursors. Science. 2004;303:95-8. [193] Wang X, Xu X, Ma Z, Huo Y, Xiao Z, Li Y, et al. Dynamic mechanisms for pre-miRNA binding and export by Exportin-5. RNA. 2011;17:1511-28. [194] Melo SA, Moutinho C, Ropero S, Calin GA, Rossi S, Spizzo R, et al. A genetic defect in exportin-5 traps precursor microRNAs in the nucleus of cancer cells. Cancer Cell. 2010;18:303-15. [195] Ma E, Zhou K, Kidwell MA, Doudna JA. Coordinated activities of human DICER domains in regulatory RNA processing. J. Mol. Biol. 2012;422:466-76. [196] Nicholson AW. Dissecting human DICER: some assembly required. J. Mol. Biol. 2012;422:464-5. [197] Takeshita D, Zenno S, Lee WC, Nagata K, Saigo K, Tanokura M. Homodimeric structure and double-stranded RNA cleavage activity of the c-terminal RNase III domain of human DICER. Journal of Molecular Biology. 2007;374:106-20. [198] Zhang H, Kolb FA, Jaskiewicz L, Westhof E, Filipowicz W. Single processing center models for human DICER and bacterial RNase III. Cell. 2004;118:57-68. [199] Bernstein E, Kim SY, Carmell MA, Murchison EP, Alcorn H, Li MZ, et al. DICER is essential for mouse development. Nat. Genet. 2003;35:215-7. [200] Wienholds E, Koudijs MJ, van Eeden FJ, Cuppen E, Plasterk RH. The microRNAproducing enzyme DICER1 is essential for zebrafish development. Nat. Genet. 2003;35:217-8. [201] Korhonen HM, Meikar O, Yadav RP, Papaioannou MD, Romero Y, Da Ros M, et al. DICER is required for haploid male germ cell differentiation in mice. PLoS One. 2011;6:e24821. [202] Murchison EP, Stein P, Xuan Z, Pan H, Zhang MQ, Schultz RM, et al. Critical roles for DICER in the female germline. Genes Dev. 2007;21:682-93. [203] O'Rourke JR, Georges SA, Seay HR, Tapscott SJ, McManus MT, Goldhamer DJ, et al. Essential role for DICER during skeletal muscle development. Developmental Biology. 2007;311:359-68. [204] Harris KS, Zhang Z, McManus MT, Harfe BD, Sun X. DICER function is essential for lung epithelium morphogenesis. Proc. Natl. Acad. Sci. USA. 2006;103:2208-13. [205] Morita S, Hara A, Kojima I, Horii T, Kimura M, Kitamura T, et al. DICER is required for maintaining adult pancreas. PLoS One. 2009;4:e4212.

Dicer and MicroRNAs

2253

[206] Nagaraja AK, Andreu-Vieyra C, Franco HL, Ma L, Chen R, Han DY, et al. Deletion of DICER in somatic cells of the female reproductive tract causes sterility. Mol. Endocrinol. 2008;22:2336-52. [207] Slade I, Bacchelli C, Davies H, Murray A, Abbaszadeh F, Hanks S, et al. DICER1 syndrome: clarifying the diagnosis, clinical features and management implications of a pleiotropic tumour predisposition syndrome. Journal of Medical Genetics. 2011;48:2738. [208] Doros L, Yang J, Dehner L, Rossi CT, Skiver K, Jarzembowski JA, et al. DICER1 mutations in embryonal rhabdomyosarcomas from children with and without familial PPB-tumor predisposition syndrome. Pediatr Blood Cancer. 2012;59:558-60. [209] Kumar MS, Pester RE, Chen CY, Lane K, Chin C, Lu J, et al. DICER1 functions as a haploinsufficient tumor suppressor. Genes Dev. 2009;23:2700-4. [210] Zighelboim I, Reinhart AJ, Gao F, Schmidt AP, Mutch DG, Thaker PH, et al. DICER1 expression and outcomes in endometrioid endometrial adenocarcinoma. Cancer. 2011;117:1446-53. [211] Zhu DX, Fan L, Lu RN, Fang C, Shen WY, Zou ZJ, et al. Downregulated DICER expression predicts poor prognosis in chronic lymphocytic leukemia. Cancer Sci. 2012;103:875-81. [212] Selever J, Gu G, Lewis MT, Beyer A, Herynk MH, Covington KR, et al. DICERmediated upregulation of BCRP confers tamoxifen resistance in human breast cancer cells. Clin. Cancer Res. 2011;17:6510-21. [213] Dedes KJ, Natrajan R, Lambros MB, Geyer FC, Lopez-Garcia MA, Savage K, et al. Down-regulation of the miRNA master regulators Drosha and DICER is associated with specific subgroups of breast cancer. Eur. J. Cancer. 2011;47:138-50. [214] Jennifer R. Choo TON. Biomarkers for Basal-like Breast Cancer. Cancers. 2010;2:104065. [215] Cheang MC, Voduc D, Bajdik C, Leung S, McKinney S, Chia SK, et al. Basal-like breast cancer defined by five biomarkers has superior prognostic value than triple-negative phenotype. Clin. Cancer Res. 2008;14:1368-76. [216] Khoshnaw SM, Rakha EA, Abdel-Fatah TM, Nolan CC, Hodi Z, Macmillan DR, et al. Loss of DICER expression is associated with breast cancer progression and recurrence. Breast Cancer Res. Treat. 2012;135:403-13. [217] Yan M, Huang HY, Wang T, Wan Y, Cui SD, Liu ZZ, et al. Dysregulated expression of DICER and drosha in breast cancer. Pathol. Oncol. Res. 2012;18:343-8. [218] Chiosea S, Jelezcova E, Chandran U, Luo J, Mantha G, Sobol RW, et al. Overexpression of DICER in precursor lesions of lung adenocarcinoma. Cancer Res. 2007;67:2345-50. [219] Karube Y, Tanaka H, Osada H, Tomida S, Tatematsu Y, Yanagisawa K, et al. Reduced expression of DICER associated with poor prognosis in lung cancer patients. Cancer Sci. 2005;96:111-5. [220] Faber C, Horst D, Hlubek F, Kirchner T. Overexpression of DICER predicts poor survival in colorectal cancer. Eur. J. Cancer. 2011;47:1414-9. [221] Cheloufi S, Dos Santos CO, Chong MM, Hannon GJ. A DICER-independent miRNA biogenesis pathway that requires Ago catalysis. Nature. 2010;465:584-9. [222] Cifuentes D, Xue H, Taylor DW, Patnode H, Mishima Y, Cheloufi S, et al. A novel miRNA processing pathway independent of DICER requires Argonaute2 catalytic activity. Science. 2010;328:1694-8.

2254

Ha T. Nguyen and Mandi M. Murph

[223] Kumar MS, Lu J, Mercer KL, Golub TR, Jacks T. Impaired microRNA processing enhances cellular transformation and tumorigenesis. Nat. Genet. 2007;39:673-7. [224] Chiosea S, Jelezcova E, Chandran U, Acquafondata M, McHale T, Sobol RW, et al. Upregulation of DICER, a component of the MicroRNA machinery, in prostate adenocarcinoma. Am. J. Pathol. 2006;169:1812-20. [225] Garber K. A tale of two cells: discovering the origin of prostate cancer. J. Natl. Cancer Inst. 2010;102:1528-9, 35. [226] Ma Z, Swede H, Cassarino D, Fleming E, Fire A, Dadras SS. Up-regulated DICER expression in patients with cutaneous melanoma. PLoS One. 2011;6:e20494. [227] Tokumaru S, Suzuki M, Yamada H, Nagino M, Takahashi T. let-7 regulates DICER expression and constitutes a negative feedback loop. Carcinogenesis. 2008;29:2073-7. [228] Martello G, Rosato A, Ferrari F, Manfrin A, Cordenonsi M, Dupont S, et al. A MicroRNA targeting DICER for metastasis control. Cell. 2010;141:1195-207. [229] Bennasser Y, Chable-Bessia C, Triboulet R, Gibbings D, Gwizdek C, Dargemont C, et al. Competition for XPO5 binding between DICER mRNA, pre-miRNA and viral RNA regulates human DICER levels. Nat. Struct. Mol. Biol. 2011;18:323-7. [230] Wiesen JL, Tomasi TB. DICER is regulated by cellular stresses and interferons. Mol. Immunol. 2009;46:1222-8. [231] Blandino G, Valerio M, Cioce M, Mori F, Casadei L, Pulito C, et al. Metformin elicits anticancer effects through the sequential modulation of DICER and c-MYC. Nat. Commun. 2012;3:865. [232] Hu Q, Tanasa B, Trabucchi M, Li W, Zhang J, Ohgi KA, et al. DICER- and AGO3dependent generation of retinoic acid-induced DR2 Alu RNAs regulates human stem cell proliferation. Nat. Struct. Mol. Biol. 2012;19:1168-75. [233] Hammond SM, Bernstein E, Beach D, Hannon GJ. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature. 2000;404:293-6. [234] Nykanen A, Haley B, Zamore PD. ATP requirements and small interfering RNA structure in the RNA interference pathway. Cell. 2001;107:309-21. [235] Martinez J, Patkaniowska A, Urlaub H, Luhrmann R, Tuschl T. Single-stranded antisense siRNAs guide target RNA cleavage in RNAi. Cell. 2002;110:563-74. [236] Schwarz DS, Hutvagner G, Haley B, Zamore PD. Evidence that siRNAs function as guides, not primers, in the Drosophila and human RNAi pathways. Mol. Cell. 2002;10:537-48. [237] Schwarz DS, Hutvagner G, Du T, Xu Z, Aronin N, Zamore PD. Asymmetry in the assembly of the RNAi enzyme complex. Cell. 2003;115:199-208. [238] Chu Y, Yue X, Younger ST, Janowski BA, Corey DR. Involvement of argonaute proteins in gene silencing and activation by RNAs complementary to a non-coding transcript at the progesterone receptor promoter. Nucleic Acids Research. 2010;38:7736-48. [239] Janas MM, Wang B, Harris AS, Aguiar M, Shaffer JM, Subrahmanyam YV, et al. Alternative RISC assembly: binding and repression of microRNA-mRNA duplexes by human Ago proteins. RNA. 2012;18:2041-55. [240] Hagiwara K, Kosaka N, Yoshioka Y, Takahashi RU, Takeshita F, Ochiya T. Stilbene derivatives promote Ago2-dependent tumour-suppressive microRNA activity. Sci. Rep. 2012;2:314.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 104

THE ROLE OF THE EPIDERMAL GROWTH FACTOR RECEPTOR AS A THERAPEUTIC TARGET IN GLIOBLASTOMA AND OTHER MALIGNANCIES Andrej Pala*, Christian Rainer Wirtz and Marc-Eric Halatsch† Department of Neurosurgery, University of Ulm School of Medicine, Ulm, Germany

ABSTRACT Glioblastoma multiforme (GB) is the most common primary brain tumor among adults. Rapid tumor progression and diffuse invasion of brain tissue results in a poor prognosis despite advances in the understanding of the tumor’s molecular biology. Recently, targeted therapy has been introduced as a potential therapeutic option in several types of cancer. Dysregulation of the epidermal growth factor receptor (EGFR) has been identified in a number of different malignant tumor entities, such as GB. Despite promising reports from preclinical studies, clinical trials yielded no significant improvement of outcomes of patients with GB who were treated with anti-EGFR-targeted agents. Molecular mechanisms underlying resistance to this treatment approach have become a focus of scientific efforts in the last years. The variations and complexity of EGFR signaling pathways demand a composite therapeutic strategy to quench alternative signaling routes which otherwise might enable cancer cell survival and subsequently tumor progression.

INTRODUCTION In the last years, molecularly targeted therapy has rapidly evolved. Within this concept, the epidermal growth factor receptor (EGFR) became a common therapeutic target in many cancers 1-3. The EGFR is a 170 kDa single-chain transmembraneous glycoprotein transmitting signals for various pathways, thereby playing an important role in cellular proliferation 1,2. * Corresponding †

Author’s Email: [email protected]. Corresponding Author’s Email: [email protected].

2256

Andrej Pala, Christian Rainer Wirtz and Marc-Eric Halatsch

Glioblastoma (GB) is the most common primary brain tumor among adults. Despite intense research efforts, the prognosis of patients with GB remains poor with current standard therapy consisting of tumor resection, adjuvant irradiation and temozolomide 2-4. The EGFR is the most frequently altered oncogene in GB 3. While the clinical use of small-molecule EGFR tyrosine kinase (TK) inhibitors has fallen short of expectations in patients with GB 4, a better understanding of molecular signaling pathway interactions may allow for the development of new rational therapeutic strategies to overcome intrinsic and/or acquired resistance of GB cells towards EGFR inhibition.

THE EGFR AND ITS ROLE IN TUMORIGENESIS The human epidermal growth factor receptor (HER) family consists of four structurally related receptors, i.e., HER1/EGFR, HER2/neu, HER3 and HER4. They are composed of internal, transmembraneous and external domains. The EGFR is activated by various ligands, most importantly epidermal growth factor (EGF) and transforming growth factor (TGF)-α 1,2. Dimerization is a crucial step in HER signaling pathway activation. Both homo- and heterodimerization are possible, allowing variable receptor combinations 5. Formation of dimers results in the activation of EGFR´s internal TK domain with subsequent phosphorylation of tyrosine residues which, in turn, promote the activation of cytoplasmic downstream signaling routes. The phosphorylated tyrosine residues bind to signaling molecules with SRC homology 2 (SH2) which promote further intracellular signaling. The signalling routes involve activation of RAS-RAF-mitogen-activated kinase (MAPK), phosphatidylinositol-3-kinase (PI3K), phospholipase Cγ (PLCγ) or Janus-activated kinase (JAK)-2. These molecular signaling mechanisms regulate various cellular processes involving proliferation and differentiation (Figure 1) 1-5. Growth factor receptor binding protein 2 is a docking protein that is able to bind to activated EGFR-TKs, thereby creating complexes with the guanine nucleotide factor son of sevenless (SOS) through a SH3 domain. Activated SOS mediates the exchange of guanosine diphosphate (GDP) for guanosine triphosphate (GTP) in RAS that induces the activation of the serine/threonine protein kinase RAF, which, in turn, phosphorylates another serine/threonineproteinkinase, MEK. MEK activates MAPK that targets nuclear transcription factors, such as the E-Twenty-Six (ETS) family factors FOS, JUN and SLUG (SNAI-2) and hereby regulates cellular proliferation or differentiation 2,6. The other signalling pathway mediated by EGFR is activated through PI3K, which forms phosphatidylinositol-3,4,5triphosphate (PIP3) that further (through activation of AKT also known as PKB (protein kinase B)) indirectly phosphorylates the mammalian target of rapamycin (mTOR), which is playing a crucial role in cellular proliferation 7. In addition, AKT is involved in the regulation of apoptosis through inactivation of proapoptotic proteins, such as BCL-2-associated death protein (BAD) or caspase 9. The next well-known signaling cascade promoted through EGFRTK activation is the PLCγ pathway. Phospholipase Cγ produces diacylglycerol (DAG) and inositoltriphosphate (IP3) through hydrolisation of phosphatidylinositol-4,5-biphosphate (PIP2). Inositoltriphosphate binds to the IP3 receptor that triggers the influx of calcium ions from the endoplasmic reticulum and thereby triggers the activity of various proteins within the cytoplasm (Figure 1) 6,8.

The Role of the Epidermal Growth Factor Receptor ...

2257

These diverse signaling routes, mediated through EGFR activation, possess various messengers, alteration of which may contribute to the dysregulation of precisely coordinated signaling networks. Moreover, the plasticity of tumor cells may result in preference and potentiation of parallel signaling pathways and hereby contribute to the development of resistance to targeted therapy. Thus, simultaneous targeting of more signaling routes could lead to better inhibition and control of tumor cell proliferation.

Figure 1. EGFR-mediated signaling cascades. DAG – diacylglycerol, EGF – epidermal growth factor, FGF – fibroblast growth factor, HGF – hepatocyte growth factor, IGF – insulin-like growth factor, IP3 – inositoltriphosphate, MAPK – mitogen-activated protein kinase, MEK – mitogen-activated protein kinase kinase, mTOR – mammalian target of rapamycin, PI3K – phosphatidylinositol-3-kinase.

Amplification and overexpression of the EGFR gene is frequently present in GB and other malignancies such as breast cancer or non-small cell lung cancer (NSCLC), contributing to unregulated cell proliferation 3,4,9. Other mechanisms that lead to functional alteration of the EGFR are autocrine or paracrine overproduction of ligands and deletion-mutation of the receptor. The most common mutation, with an incidence of up to 58% in GBM, is EGFR variant (v)III which results from in-frame deletion of 801 base pairs in the DNA sequence encoding the extracellular receptor domain 3,4,9. This mutation yields a constitutively activated receptor without any control mechanisms. In addition, mutations in the carboxyl terminal domain, referred to as EGFRvIV, have been described. Their activity exhibits significant tumorigenic potential 10. The EGFR-TK inhibitors gefitinib and erlotinib are small molecules that compete with adenosine triphosphate (ATP) for intracellular TK domains. Hereby they prevent TK phosphorylation and inhibit downstream signaling that engages intracellular MAPK and PI3K/AKT pathways. Gefitinib has been used for the treatment of NSCLC 11. Even if the initial results were disappointing, further analysis enabled specification and selection of patients who harbour mutations of the intracellular EGFR domain that confer significant treatment

2258

Andrej Pala, Christian Rainer Wirtz and Marc-Eric Halatsch

responses. Thus, gefitinib became an option in advanced and metastatic NSCLC. Analysis of structural receptor changes in both NSCLC and GB has revealed different types of alterations. Mutations found in NSCLC that confer response to erlotinib affect almost exclusively the intracellular EGFR domain whereas mutations in the external domain are mostly present in GB. Accumulating evidence suggests that the type of mutation that is characteristic for GB does not confer sensitivity to erlotinib, in contrast to EGFR mutations present in NSCLC 12,13. Erlotinib binds to the active conformation of the TK domain that is less effective in GB. The absence of ATP-binding domain mutations in GB may be the explanation for failure of erlotinib against this disease. In contrast, lapatinib, a dual HER1/2 inhibitor, interacts with the inactive conformation of the TK domain, inducing cell death in EGFR-mutated GB cells. Almost complete inhibition of EGFR is required to achieve cell death induction 12,13. The concentration of lapatinib that effectively leads to EGFR inhibition in GB cells in vivo remains unclear, and this may contribute to actually disappointing clinical results that show no clinical benefit of this approach 12-15. It has been reported that low doses of dual EGFR and HER2 inhibitors result in better overall survival in xenograft models. In contrast, high-dose treatments may evoke rapid activation of alternative signalling routes and hereby enhance the development of resistance and tumor invasion 14,15. The EGFRvIII and EGFRvIV contribute significantly to the activation of distinct signaling routes. The variability and complexity of this signaling enhance the adaptability of tumor cells 10. The deletion-mutants EGFRvIII and EGFRvIV are stabilized by heat shock protein (HSP) 90 16. This is a common intracellular protein that guides folding and intracellular distribution of many other proteins, such as AKT or RAF-1. Heat shock protein 90 interacts with other cochaperones and hereby forms and modulates protein complex conformation. Its action is attached to ATP hydrolysis, which ultimately results in conformational changes of other proteins. Heat shock protein 90 together with co-chaperone p50cdc37 build complexes with nascent EGFR and HER2/neu. Mature EGFR dissolves from Hsp90-p50cdc37 16,17. HER2/neu requires association with Hsp90-p50cdc37. This molecular dependence might be another possible target that could bring about new therapeutic options 17. Monoclonal antibodies such as cetuximab have been investigated as possible inhibitors of the EGFR signaling pathway 18,19. Cetuximab binds to EGFR with high affinity and blocks further signal transduction within the EGFR-mediated signaling route. This effect contributes to the inhibition of cell cycle progression and angiogenesis. Moreover, cetuximab may induce apoptosis through overexpression of BAX and reduction of BCL-2 activity. It has been reported that in combination with other chemotherapeutic drugs, cetuximab increases the frequency of apoptosis in vitro and in vivo. However, the insufficient penetration of the blood-brain barrier may impede a relevant therapeutic effect 18,19. The scientific efforts of the last few years were preferably concerned with the kinaserelated activity of EGFR. However, TK-independent EGFR activation may play a significant role within cellular signaling pathways as well and may constitute an important reason for clinical failure of EGFR-TK inhibition in GB. Kinase-independent activity of EGFR is involved in cellular energy metabolism by maintaining intracellular glucose levels that prevent cells from undergoing cell death 20. This observation is supported by the fact that the inhibition of EGFR phosphorylation results in diminished glucose uptake. However, the level of intracellular glucose does not reach the low concentration found in cells with entirely inactive EGFR. It has been reported that EGFR stabilizes the sodium-glucose linked transporter

The Role of the Epidermal Growth Factor Receptor ...

2259

(SGLT)-1 and hereby maintains the cellular uptake of glucose that is necessary for cell survival 20. The SGLT-1 is a transmembraneous protein that enables glucose transport across the cell membrane. The inhibition of EGFR-TK activity provides deceleration of cell proliferation, but in the majority of cases does not result in cell death 20.

EPITHELIAL-TO-MESENCHYMAL TRANSITION Epithelial-to-mesenchymal transition (EMT) may serve as another possible explanation for cell survival despite the inhibition of EGFR. Generally, EMT is a sequence of molecular signaling events that ultimately lead to increased invasiveness and dissemination of tumor cells 21,22. These molecular changes play a crucial role in many physiological processes such as wound healing or organ development. Under pathological conditions, EMT is considered an important factor responsible for cancer progression. During EMT, cells loose their epithelial characteristics and acquire mesenchymal features such as the expression of fibronectin and vimentin 4,9,21,22. These steps contribute to the acquisition of the biologically aggressive mesenchymal phenotype. Numerous signaling pathways have been implicated in EMT during cancer progression. For example, E-cadherin is a cell surface protein that mediates cell-to-cell contact. This main epithelial surface protein is involved in the regulation of critical processes in the development of epithelium 21,22. Thus, minimal alterations in the regulatory network may significantly influence the overall physiology of the epithelial cell. E-cadherin belongs to a large superfamily of cell-to-cell, calcium-dependent, homophilic adhesion molecules that are specified according to the tissue in which they are preferably formed. In general, cadherins build dimers that bind through their extracellular domains to cadherin dimers of neighbouring cells. The intracellular region is anchored to the plasma membrane and binds to the cytoskeleton through catenins. In particular, β-catenin and p120 catenin mediate the intracellular E-cadherin contact with the cytoskeleton, either directly or through other proteins, such as vinculin or β-actinin 9,21,22. Epithelial cells are contact-inhibited through cell cycle arrest after reaching monolayer formation. Dysregulation of E-cadherin results in the dissolution of tight junctions, so that neighbouring cells loose their connections 9,21-23. In addition, the loss of apico-basal polarity together with reorganisation of cytoskeletal components potentiates the cellular transformation from a cuboidal to a spindle-like shape. The anti-migratory and antiproliferative effects of E-cadherin decrease. During organ development or wound healing, these processes are clearly coordinated and well-defined. Under pathological conditions, dysregulation of the signaling network occurs, facilitating the progression of cell transformation and behavioural modulation 21-23. E-cadherin expression can be altered in different manners. Production of growth factors by the microenvironment may result in E-cadherin downregulation. Furthermore, overexpression of EGFR has a direct influence on E-cadherin function. Intracellular E-cadherin complexes can become direct targets of TKs. Phosphorylated complexes destabilize, and the strength of cellto-cell adhesion weakens. Moreover, phosphorylation of E-cadherin complexes may be regulated through cytoplasmic kinases, such as SRC 21-23. E-cadherin activates different signaling pathways, such as MAPK or PI3-K, after formation of cell-to-cell contact 9,21-23. Additionally, E-cadherin can activate EGFR in the absence of

2260

Andrej Pala, Christian Rainer Wirtz and Marc-Eric Halatsch

ligand and hereby trigger its signaling pathways 24. This mechanism may significantly enhance cell proliferation or survival. Alterations of several transcription factors and oncogenes contribute to the complex multilevel molecular transformation involved in EMT. The key transcriptional factors are SNAI-1/2, zinc finger E-box (ZEB)-1/2, TWIST and WNT/β-catenin 21-24. Their activity promotes loss of epithelial characteristics within cells and progressive acquisition of the mesenchymal phenotype. TWIST-1 is a helix-loop-helix protein that binds to DNA as a heterodimer, activates the mesenchymal marker N-cadherin and inhibits the expression of Ecadherin 4. Specific inhibition of TWIST expression leads to reduction of glioma invasion in vitro 4,25. Moreover, TWIST is involved in the regulation of p53-regulated apoptosis. The prevention of growth arrest further promotes the invasive phenotype of tumor cells, especially in GB 4,25. This mechanism may lead to increased resistance to different therapeutic agents and ultimately to failure of targeted therapy. SNAI-1 represents a transcriptional repressor that targets the expression of E-cadherin and belongs to a family composed of three members. SNAI-1 contains a SNAG domain which plays a crucial role for SNAI-1 activity. The repression of E-cadherin potentiates cellular invasion and migration 9,21-23. Additionally, SNAI-1 induces the activation of matrix metalloprotease (MMP)-2. Matrix metalloproteases belong to a large family of zinc-dependent endoproteases that dissolve extracellular matrix proteins. This effect contributes to the increased invasiveness and aggressiveness of cells with the mesenchymal phenotype 9, 21-23. Signal transducer and activator of transcription (STAT) signaling routes play an important role in EGFR-mediated signal transmission. Dysregulation of this pathway is associated with many human malignancies. Signal transducer and activator of transcription (STAT) proteins are located in the cytoplasm of all dividing cells. The STAT family contains seven protein members (STAT-1-4, STAT-5a, STAT-5b, STAT-6) which interact with different cytokines and various downstream signaling molecules as well as with EGFR autophosphorylation sites 26. Cytokine receptors, such as interleukin (IL)-6, possess no intrinsic TK activity. They initiate Janus activated kinase (JAK) family members that mediate signaling to STAT molecules through phosphorylation of specific tyrosine residues. This process results in homoor heterodimerisation of STAT molecules via SH2 domains. These complexes translocate into the nucleus, bind to specific DNA sequences and influence STAT genes that are associated with cell proliferation, differentiation, motility and apoptosis. Signal transducer and activator of transcription dimers can also be formed directly through phosphorylation by EGFR-TKs. Additionally, the activation via cytoplasmic SRC or Abelson murine leukemia viral oncogene homolog (ABL)-1 kinases is possible as well 26,27. Signal transducer and activator of transcription-3 expression is typically associated with GB, and STAT-3 is activated by phosphorylation of tyrosine residue Y705 or by serine phosphorylation at the domain S727. The extent of STAT-3 activation correlates with glioma grade 27. Activated STAT-3 translocates into the nucleus and regulates the expression of various genes, such as PIM-1, c-MYC, cyclin D2 or cyclin A, that are involved in cell cycle progression, oncogenesis, and apoptosis. Increased expression of TWIST results in the activation of EMT signaling. In addition, STAT-3 is able to interact with EGFRvIII and contributes to the malignant transformation of astrocytes in gliomas 27,28. Signal transducer and activator of transcription-3 and EGFR-EGFRvIII promote together the activation of the pro-inflammatory gene cyclooxygenase (COX)-2 at the nuclear level 28. Cyclooxygenase-2

The Role of the Epidermal Growth Factor Receptor ...

2261

is overexpressed in various malignancies such as NSCLC. Its activity may promote resistance to apoptosis and through the activation of angiogenesis confer invasiveness of tumour cells. Prostaglandin E-2 (PGE-2) as the main effector of COX-2 reduces the expression of E-cadherin via ZEB-1 and SNAI-1. Signal transducer and activator of transcription-3 contributes to the regulation of different signaling pathways and has an important influence on EMT and the cell cycle. It may represent an important strategic factor that could become an additional molecular target in the therapy of GB 27,28. Signal transducer and activator of transcription-5 is activated by numerous cytokines, such as IL-2, IL-3, IL-5, erythropoietin, granulocyte macrophage colony stimulating factor (GMCSF) or growth hormone. Upon activation and translocation into the nucleus, STAT-5 dimers regulate genes that are involved in apoptosis, e.g., the BCL genes. Constitutive STAT-5 activation has been implicated in hematopoietic malignancies and various solid tumors, such as breast or prostate cancer 29. The general regulatory network may be modified through EMT epigenetically. For example, methylation of histones or DNA may significantly influence activation of genes associated with cell cycle regulation or apoptosis. CDH-1 represents the gene that encodes Ecadherin. It has been reported that SNAI-1, which is an important EMT-associated repressor of E-cadherin, activates DNA-methylating enzymes and simultaneously histone demethylases 30. Transforming growth factor (TGF)-β is a protein that takes part in the regulation of cell proliferation and differentiation. Transforming growth factor-β contributes to EMT induction and activates many routes that result in the mesenchymal transformation of cells, e.g., SNAI, ZEB and TWIST which are commonly associated with tumor invasion. Additionally, TGF-β is associated with apoptosis induction via the SMAD pathway. Transforming growth factor-β enhances signaling in the MAPK and PI3K-AKT pathways and hereby mediates the expression of SNAI-1 and SNAI-2 31. Subsequently, the expression of fibronectin, vimentin and other proteins associated with the mesenchymal phenotype is increased. In contrast, the expression of E-cadherin decreases. SNAI proteins influence the activation of RHO and RAC. This action reduces adhesiveness and stimulates motility of cells. RHO is a small signaling G protein that belongs to the RAS superfamily of proteins that are involved in the regulation of actin 31.

EXTRACELLULAR MATRIX AND MICROENVIRONMENT The extracellular matrix (ECM) is separated from epithelial cells by the basement membrane. As a result of malignant transformation and tumor dissemination, the integrity of the basement membrane destabilises. After elimination of this barrier, different signaling molecules produced by the ECM interact with epithelial cells and hereby activate cell responses at the nuclear level that are normally inhibited through the basement membrane. Besides the changes within cell-to-cell adhesion, alterations of cell-to-matrix adhesions determine the invasive features of cells 21-24,31. Integrins build a large protein family involved in cell-tomatrix interactions 32,33. They form heterodimer receptors for ECM proteins such as collagen, laminin or fibronectin 31,32. Intracellular components of integrins cooperate with different TKs such as EGFR-TK. This signaling leads ultimately to actin polymerisation and phosphorylation of focal adhesion kinase (FAK), and binding residues for PI3-K, SRC or PLCγ

2262

Andrej Pala, Christian Rainer Wirtz and Marc-Eric Halatsch

form 31,32,34. Within this context, cell migration is induced by ECM via integrins. Dysregulated EGFR signaling subsequently dephosphorylates and inactivates FAK 34. This process increases the migratory potential of solitary tumor cells. They detach from the ECM, disseminate and create new metastasis. On the other hand, integrin-mediated alignment may be an important step for the inverted process, called mesenchymal-to-epithelial transition (MET) 21-23. Tumor cells acquire some adhesive properties again and form new solid masses. It has been reported that EGFRvIII interacts with integrins and hereby promotes metastatic progression 35.

MECHANISMS OF RESISTANCE TO CURRENT THERAPY OF GB Within current GB studies, cancer stem-like cells (CSC) have received much attention. They exhibit a high tumorigenic potential in combination with relatively low proliferative activity. Cancer stem-like cells express the CD133 (prominin-1) gene which is a characteristic feature of all normal neural stem cells 36,37. Additionally, CSCs demonstrate stem cell properties, such as colony formation or multilineage potency. Glioblastoma typically presents as a diffuse tumor that invades normal brain tissue and frequently recurs or progresses after radiation therapy. Cancer stem-like cells possess high resistance to radiation and chemotherapy 36,37. A great extent of activation of DNA repair mechanisms represents a relevant factor that may contribute to this phenomenon. Moreover, the high self-renewal activity of cells expressing CD133 stimulates initiation, growth, invasion and recurrence of GB. Moreover, CSCs overexpress angiogenic vascular endothelial growth factor under hypoxic conditions 3638. A hypoxic microenvironment plays a crucial role in the recruitment and growth of stromal cells that consecutively support tumor progression. Compensatory activation of HER2/neu and HER3 may result in increased resistance of CSCs against the inhibition of EGFR signaling 36,37. Based on this observation, lapatinib as a dual EGFR/HER2 inhibitor yielded significantly better antiproliferative responses compared to cetuximab and other anti-EGFR-targeted agents. In the absence of an exogenous EGF stimulus, MAPK and AKT signaling remained constant through the activation of alternative signaling mediated by HER2/neu and HER3. In contrast, lapatinib decreases AKT and MAPK downstream signalling more effectively. This example provides a possible explanation for GB resistance to anti-EGFR-targeted monotherapy 36. The multiple targeting of HER family members is an option which could potentially overcome resistance to anti-EGFR therapy and improve the clinical outcome of patients with GB. Normal stem cells play a crucial role in differentiation, development and organogenesis. Transcription factors, such as NOTCH, ID1, SOX2 or OCT4 have been implicated in the regulation of balance between stem cell proliferation and differentiation. Dysregulation of this balance contributes to tumorigenesis. Myeloid Elf-1-like factor (MEF) is a member of the EST family of proteins. Myeloid Elf-1-like factor downregulates p53 through overexpression of MDM2 36-38. This process reduces activation of INK4a and promotes phosphorylation of the retinoblastoma protein. SOX2 is a high mobility group (HMG) box transcription factor that contributes to the self-renewal of stem cells. Moreover, its activity has been described in different malignancies and in GB. SOX2 is a direct target of MEF and through this action may potentiate stem-like features of tumor cells 37.

The Role of the Epidermal Growth Factor Receptor ...

2263

The WNT signaling route is related to EMT as well. WNT is associated with β-catenin. The transmembraneous Frizzled receptor is activated via WNT protein and targets Dishevelled, which inhibits glycogen synthase kinase (GSK)-3β and thereby reduces the phosphorylation and degradation of β-catenin. Disinhibited β-catenin translocates into the nucleus and binds to T-cell factor (TCF) and to lymphoid enhancer factor (LEF)-1 38. This signaling activates various genes that are associated with EMT, such as SNAI-2 or JUN. In addition, the expression of proteins with mesenchymal characteristics increases, resulting subsequently in the development of a more aggressive cellular phenotype. The WNT/β-catenin pathway induces cell migration which is important not only for embryonic development but for tumor progression as well. Additionally, this signaling route may lead to the acquisition of stem-like features in GB cells, which, in turn, increases the resistance to current standard therapy and may play a crucial role in tumor recurrence. Overexpression of the signaling regulator Frizzled 4 potentiates signalling within the WNT route and consecutively may influence the development and maintenance of CSCs 39.

CONCLUSION The complexity and structural density of the molecular pathways involved in EMT result in fast and dynamic changes in the pathophysiology of GB. The inhibition of one downstream pathway may potentiate alternative signaling routes and challenge or induce adaptation mechanisms of tumor cells. The combination of various inhibitory mechanisms could lead to a better control of dysregulated signaling pathways in the future. Additionally, this approach might be effective in preventing the development of tumor cell resistance. The definition of mutational variations and their systematic conquering at different levels together with the identification of patients who would probably benefit from targeted therapy is urgently needed. The pharmacokinetics of anti-EGFR-targeted agents remains another challenge to be addressed. Future stepwise improvements in the areas outlined above hold the potential for progressively improving the prognosis of patients with GB.

REFERENCES [1] [2] [3]

[4] [5]

Normanno N., De Luca A., Bianco C., et al. Epidermal growth factor receptor signaling in cancer. Gene 2006, 366, 2-16. Hynes N.E., Lane H.A. ERBB receptors and cancer: the complexity of targeted inhibitors. Nat Rev Cancer 2005, 5, 341-354. Loew S., Schmidt U., Unterberg A., et al.. The epidermal growth factor receptor as a therapeutic target in glioblastoma multiforme and other malignant neoplasms. Anticancer Agents Med Chem 2009, 9, 703-715. Mikheeva S.A., Mikheev A.M., Petit A., et al. Twist 1 promotes invasion through mesenchymal change in human glioblastoma. Mol Cancer 2010, 9, 194-212. Schlessinger J. Ligand-induced, receptor-mediated dimerization and activation of EGF receptor. Cell 2002, 110, 669-672.

2264 [6] [7]

[8] [9] [10]

[11]

[12] [13]

[14]

[15]

[16]

[17] [18]

[19] [20] [21] [22]

[23]

Andrej Pala, Christian Rainer Wirtz and Marc-Eric Halatsch Citri A., Yarden Y. EGF-ERBB signalling: towards the systems level. Nat Rev Mol Cell Biol 2006, 7, 505-516. Sekulic A., Hudson C.C., Homme J.L., et al. A direct linkage between the phosphoinositide-3-kinase AKT signalling pathway and the mammalian target of rapamycin in mitogen-stimulated and transformed cells. Cancer Res 2000, 60(13), 35043513. Berridge M.J. Inositol triphosphate and calcium signalling. Nature 1993, 361, 315-325. Pala A., Karpel-Massler G., Kast R.E., et al. Epidermal to mesenchymal transition and failure of EGFR-targeted therapy in glioblastoma. Cancers 2012, 4, 523-530. Pines G., Huang P.H., Zwang Y, et al. EGFRvIV: a previously uncharacterized oncogenic mutant reveals a kinase autoinhibitory mechanism. Oncogene 2010, 29, 58505860. Suda K., Tomizawa K., Fujii M., et al. Epithelial to mesenchymal transition in an epidermal growth factor receptor-mutant lung cancer cell line with acquired resistance to erlotinib. J Thorac Oncol 2011, 6, 1152–1161. Vivanco I., Robins H.I., Rohle D. Differential sensitivity of glioma- versus lung cancerspecific EGFR mutations to EGFR kinase inhibitors. Cancer Discov 2012, 2, 458-471. Barkovich K.J., Hariono S., Garske A.L. Kinetics of inhibitor cycling underlies therapeutic disparities between EGFR-driven lung and brain cancers. Cancer Discov 2012, 2, 450-457. Thiessen B., Stewart C., Tsao M., et al. A phase I/II trial of GW572016 (lapatinib) in recurrent glioblastoma multiforme: clinical outcomes, pharmacokinetics and molecular correlation. Cancer Chemother Pharmacol 2010, 65, 353-361. Wang L., Liu Q., Zhao H., et al. Differential effects of low- and high-dose GW2974, a dual epidermal growth factor receptor and HER2 kinase inhibitor, on glioblastoma multiforme invasion. J Neurosci Res 2013, 91, 128-137. Hernandez M.P., Sullivan W.P., Toft D.O. The assembly and intermolecular properties of Hsp70-Hop-Hsp90 molecular chaperone complex. J Biol Chem 2002, 277, 3829438304. Xu W., Mimnaugh E.G., Kim J.S., et al. Hsp90, not Grp94, regulates the intracellular trafficking and stability of nascent ERB2. Cell Stress Chaperones 2002, 7, 21-26. Lu Y., Li X., Liang K., et al. Epidermal growth factor receptor (EGFR) ubiquitination as a mechanism of acquired resistance escaping treatment by the anti-EGFR monoclonal antibody cetuximab. Mol Cancer Res 2007, 67, 8240-8247. Li S., Schmitz K.R., Jeffrey P.D., et al. Structural basis for inhibition of the epidermal growth factor receptor by cetuximab. Cancer Cell 2005, 7, 301-311. Weihua Z., Tsan R., Huang W.-C., et al. Survival of cancer cells is maintained by EGFR independent of its kinase activity. Cancer Cell 2008, 13(5), 385-393. Guarino M., Rubino B., Ballabio G. The role of epithelial-mesenchymal transition in cancer pathology. Pathology 2007, 39, 305-318. Wever O.D., Pauwels P., Craene B.D., et al. Molecular and pathological signatures of epithelial-mesenchymal transitions at cancer invasion front. Histochem Cell Biol 2008, 130, 481-494. Thiery J.P., Sleeman J.P. Complex networks orchestrate epithelial-mesenchymal transition. Nat Rev Mol Cell Biol 2006, 7, 131-142.

The Role of the Epidermal Growth Factor Receptor ...

2265

[24] Qian X., Karpova T., Sheppard A.M., et al. E-cadherin mediated adhesion inhibits liganddependent activation of diverse receptor tyrosine kinases. Embo J 2004, 23, 1739-1748. [25] Elias M.C., Tozer K.R., Silber J.R., et al. TWIST is expressed in human gliomas and promotes invasion. Neoplasia 2005, 9, 824-837. [26] Yu H., Jove R. The STATs of cancer - new molecular targets come of age. Nat Rev Cancer 2004, 4(2), 97-105. [27] Lo H.W., Cao X., Zhu H., et al. Constitutively activated STAT-3 frequently coexpresses with epidermal growth factor receptor in high-grade gliomas and targeting STAT 3 sensitizes them to Iressa and alkylators. Clin Cancer Res 2008, 14, 6042-6054. [28] Lo H.W., Cao X., Zhu H., et al. COX-2 is a novel transcriptional target of the nuclear EGFR-STAT3 and EGFRvIII-STAT3 signaling axis. Mol Cancer Res 2010, 8, 232-245. [29] Moriggl R., Sexl V., Kenner L., et al. STAT5 tetramer formation is associated with leukemogenesis. Cancer Cell 2005, 7(1), 87-99. [30] Micalizzi D.S., Farabaugh S.M., Ford H.L. Epithelial-mesenchymal transition in cancer: parallels between normal development and tumor progression. J Mammary Gland Biol Neoplasia 2010, 15, 117-134. [31] Xu J., Lamouille S., Derynck R. TGF-β-induced epithelial to mesenchymal transition. Cell Res 2009, 19, 156-172. [32] Guo W., Giancotti F.G. Integrin signalling during tumor progression. Nat Rev Mol Cell Biol 2004, 5, 16-26. [33] Hynes R.O., Lively J.C., McCarthy J.H., et al. The diverse roles of integrins and their ligands in angiogenesis. Cold Spring Harb Symp Quant Biol 2002, 67, 143-153. [34] Sieg D.J., Hauck C.R., Illic D, et al. FAK integrates growth factor and integrin signals to promote cell migration. Nat Cell Biol 2000, 2, 249-256. [35] Ning Y., Zeineldin R., Liu Y., et al. Down-regulation of integrin α2 surface expression by mutant epidermal growth factor receptor (EGFRvIII) induces aberrant cell spreading and focal adhesion formation. Cancer Res 2005, 65, 9280-9286. [36] Clark P.A., Lida M., Treisman D.M., et al. Activation of multiple ERBB family receptors mediates glioblastoma cancer stem-like cell resistance to EGFR-targeted inhibition. Neoplasia 2012, 4(5), 420-428. [37] Bazzoli E., Pulvirenti T., Oberstadt M.C., et al. MEF promotes stemness in the pathogenesis of gliomas. Cell Stem Cell 2012, 11, 836-844. [38] Bao S., Wu Q., Sathornsumetee S., et al. Stem cell-like glioma cells promote tumor angiogenesis through vascular endothelial growth factor. Cancer Res 2006, 66, 78437848. [39] Jin X., Jeon H.-Y., Joo K.M., et al. Frizzled 4 regulates stemness and invasiveness of migrating glioma cells established by serial intracranial transplantation. Cancer Res 2011, 71(8), 3066-3075.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 105

TUMOR SUPPRESSORS INVOLVED IN DNA REPAIR AND CARCINOPREVENTION Yasuko Kitagishi and Satoru Matsuda* Department of Environmental Health Science, Nara Women's University Kita-Uoya Nishimachi Nara, Japan

ABSTRACT Cells possess a machinery to maintain the genomic integrity in response to the DNA damage. Mutations in several genes whose product improve the effects of DNA damage are known to predispose to develop a cancer. Under the genotoxic conditions, cells do not progress into S or M phase by activating DNA damage checkpoint, which acts as a process to transmit information from the damaged DNA lesions to cell cycle regulators. Tumor development may be accelerated by disruption of the balance between cell proliferation and the cell cycle regulation, which is maintained through regulations of various signal transduction pathways. It has been demonstrated that the signal transduction pathways are built on complicated networks between oncogenes and tumor suppressor genes such as p53 and its downstream factors. When the tumor suppressors lose their function, the cell may progress to cancer in combination with other genetic changes. Tumor suppressors regulate diverse cellular activities including DNA damage repair, cell proliferation, cell differentiation, cell migration, and programmed cell death. A better understanding of the cellular response to DNA damage will not only inform our knowledge of cancinogenesis but also provide better therapeutic opportunities.

Keywords: DNA repair, p53, BRCA1, PTEN, PI3K, AKT, ROS, cell signaling

*

Corresponding Author’s Email: [email protected] (Tel: +81 742 20 3451; Fax: +81 742 20 3451).

2268

Yasuko Kitagishi and Satoru Matsuda

ABBREVIATIONS ATF2: ATM: DSBs: ERK: MAPK: NF-κB: mTOR: PI3K: PIP2: PIP3: PTEN: PPAR: PTP: ROS: SAPK: TGF:

activating transcription factor 2 ataxia telangiectasia-mutated DNA double strand breaks Extracellular Signal-regulated Kinase mitogen activated kinase nuclear factor kappaB mammalian target of rapamycin phosphoinositide-3 kinase phosphatidylinositol 4,5- bisphosphate phosphatidylinositol 3,4,5-triphosphate phosphatase and tensin homologue deleted on chromosome 10 peroxisome proliferator-activated receptor protein tyrosine phosphatase Reactive oxygen species stress-activated protein kinase transforming growth factor

1. INTRODUCTION Increased level of the oxidative stress results in cellular damage. To deal with DNA damages, cells are equipped with the multiple DNA repair mechanisms, which provoke a process to inhibit cell cycle progression and to induce DNA repair [1, 2]. One mechanism by which the oxidative stresses are thought to exert the effects may be through the reversible regulation of target molecules including several kinases, PI3K, and PTEN [3]. In addition, the main DNA damage recognition molecule is ataxia telangiectasia-mutated (ATM), which is a checkpoint kinase that phosphorylates a number of proteins including p53 and BRCA1 in response to the DNA damage (Figure 1). The p53 protein is a key transcription factor that regulates several signaling pathways involved in the cellular response to genome stress and DNA damage. Through the stress-induced activation, p53 triggers the expression of target genes that protect the genetic integrity of cells [4, 5]. A number of studies have demonstrated an antioxidant role for tumor suppressor proteins, activating the expression of some antioxidant genes in response to the oxidative stress. The tumor suppressors regulate diverse cellular activities including DNA damage repair, cell cycle arrest, cell proliferation, cell differentiation, migration, and apoptosis [6]. Normal cells show an exquisite balance among these various mechanisms of DNA repair. Mutations in the ATM have been associated with increased risk of developing a cancer. In addition, it is well known that mutations in the p53 and BRCA1 tumor suppressor genes account for a certain amount of cancers.

Tumor Suppressors Involved in DNA Repair and Carcinoprevention

2269

Figure 1. Schematic representation of the Cell proliferation, DNA repair and Growth arrest signaling pathways. Examples of the molecule known to act on the regulatory pathways are shown.

Figure 2. Schematic diagram indicating the domain structures of the p53, BRCA1, and PTEN proteins. The functionally important sites including the sites are also shown. Note that the sizes of protein are modified for clarity. TA= transactivation domain; PxxP= proline rich region; RING= (Really Interesting New Gene) finger domain, NLS= Nuclear Localization Signal, BRCT= BRCA1 C Terminus; C2 domain= a protein structural domain involved in targeting proteins to cell membranes; PDZ= a common structural domain in signaling proteins (PSD95, Dlg, ZO-1, etc.).

2270

Yasuko Kitagishi and Satoru Matsuda

Genomic instability is often linked to DNA repair deficiencies. Standard DNA repair pathways available in mammalian cells include homologous repair, nonhomologous end joining, single strand annealing and so on. Those are different pathways that repair DNA double strand breaks (DSBs) [7]. The DNA repair is essential for the survival of both normal and cancer cells. An elaborate set of signaling pathways detect the DSBs and mediate either survival on the DNA repair or apoptotic cell death [8, 9]. The DNA damaging agents for cancer therapies are potent inducers of cell death triggered by the apoptosis. Recent advances in basic science have led to a better understanding of the molecular events important in the pathogenesis of cancer. In the present review, we summarize the function of prominent DNA repair molecules and the tumor suppressor gene products, p53, BRCA1 and PTEN (Figure 2), at a viewpoint of carcinogenic DNA damage and cellular response in cancer.

2. RELATIONSHIP BETWEEN DNA REPAIR AND CARCINOGENESIS The DNA repair system is a highly conserved DNA editing process that maintains genomic fidelity through the recognition and repair of the damaged nucleotides. Genetic defects in DNA damage response genes and/or down-regulation of the DNA repair mechanism promote genomic instability, which can lead to carcinogenesis [10]. Cells are then equipped with multiple DNA repair mechanisms to the maintenance of genomic stability. The main DNA damage recognition molecule is ATM [11], which is a checkpoint kinase that phosphorylates a number of proteins in response to DNA damage including p53 and BRCA1 (Figure 1). Schematic structures of these important molecules are shown in Figure 2. An additional consequence of defective DNA repair is cellular hypersensitivity to DNA damaging agents [12]. Inhibition of DNA repair pathway seems to block the mechanisms that are required for survival in the presence of oncogenic mutations. Epigenetic mechanisms such as histone modifications and DNA methylation have been evaluated with a view for enhancing the cancer therapy via the regulation of the expression of genes involved in DNA repair [13]. Through the stresses-induced activation, p53 triggers the expression of the target genes that protect the genetic integrity of cells. The p53 gene is frequently mutated in multiple cancer tissues, suggesting that p53 plays a critical role in preventing cancers. Mutant p53 can be classified as a loss-of-function or gain-of-function protein depending on the mutation-type [14]. Wild-type p53 is inactive under normal physiological conditions and is activated in response to various types of DNA damaging stresses. The p53 activation may lead to regression of existing neoplastic lesions and therefore may be important in developing cancer prevention [15]. Failure of the DNA repair functions leads to p53-mediated induction of apoptotic cell death [16]. In this way, the p53 has been known to play a central role in maintaining a stable genome through its role in DNA repair, and apoptosis. BRCA1 also fulfills the criteria for a tumor suppressor gene whose function is required to block cancer development. The mutation is associated with increased genomic instability in cells, which accelerates the mutation rate of other critical genes. Studies have established functional roles for BRCA1 in DNA damage signaling, DNA repair processes, and cell cycle checkpoints [17]. Consistent with these functional roles, cells deficient for BRCA1 exhibit severe genomic instability and chromosomal aberrations. BRCA1 cDNA encodes for 1863 amino acids protein with an amino terminal zinc ring finger motif and two putative nuclear

Tumor Suppressors Involved in DNA Repair and Carcinoprevention

2271

localization signals (Figure 2). The amino-terminal domain possesses E3 ubiquitin ligase activity [18] and the carboxyl-terminal domain is involved in binding to specific phosphoproteins [19]. BRCA1 becomes hyperphosphorylated after exposure to the DNA damaging agents, and the specific function of BRCA1 seems to be regulated by the phosphorylations [20]. Hence the DNA repair levels may be a novel therapeutic modality in cancer. Either survival or apoptosis, which is determined by the balance between DNA damage and DNA repair levels, may raise the major problems in cancer therapy.

3. SIGNAL TRANSDUCTION OF P53 AND BRCA1 IN DNA REPAIR PATHWAY The p53 is inactive under normal physiological conditions and activated in response to various types of cellular stresses including DNA damage, which is also induced and activated in the nucleus by a stress such as hypoxia and oxidative stress. In addition, p53 undergoes posttranslational modifications in response to the stresses [21]. The p53 protein is involved in a lot of signaling pathways of cell growth regulation, and multiple mechanisms have been revealed to accomplish the regulation of p53 activity, which determines the selectivity of p53 for specific transcriptional targets, resulting in control of the p53 activity. A number of molecules capable of activating p53 have been developed. Convincing evidence exists for the 53BP1 affecting the outcome of DNA double strand break repair [22, 23]. Among a number of transcriptional targets of the p53, the p21WAF1 has been shown to play an important role in both p53dependent and independent pathways [24]. The p21 WAF1 inhibits cell cycle progression through interaction with the cyclin and CDK complexes. Studies have shown that p53 is mutated or deleted in nearly half of all human cancers, suggesting that p53 plays a critical role in preventing cancers. During neoplastic progression, the p53 is often mutated and fails to perform its normal functions. The p53 activation by something cellular regulator including a gain of function-mutation may lead to regression of an early neoplastic lesion, and therefore may be important in developing cancer-prevention. Mutations in the tumor suppressor gene BRCA1 confer an increased risk for the development of breast and ovarian cancers [25]. In particular, BRCA1 hereditary breast cancer is a type of cancer with defects in a DNA repair pathway. Mutation of a single allele of the cancer susceptibility gene BRCA1 is associated with increased genomic instability in human breast epithelial cells [26], which accelerates the mutation rate of other critical genes. Several functions of BRCA1 may contribute to its tumor suppressor activity including roles in the DNA repair. Although BRCA1 gene mutations are rare in sporadic breast and/or ovarian cancers, BRCA1 protein expression is frequently reduced in the sporadic cases. The BRCA1 has the important role in concert with BRCA2, Rad50 and Rad51 [27], in order to activate the checkpoints. For example, BRCA1 is colocalized with Rad51, a DNA recombinase related to the bacterial RecA protein. The BRCA1 protein becomes hyper-phosphorylated after exposure to the DNA damaging agents, and the function of BRCA1 seems to be regulated by the phosphorylation in response to DNA damage. Pharmacological inhibition of poly-ADP-ribose polymerase induces cell death in tumors with mutations in certain DNA repair pathways, when combined with DNA damaging chemotherapies. Then, poly-ADP-ribose polymerase inhibitors have been investigated for the treatment of patients with BRCA 1 mutation, as a strategy to

2272

Yasuko Kitagishi and Satoru Matsuda

potentiate the DNA damaging effects of chemotherapy and irradiation [28, 29]. The role of BRCA1 in cell cycle control has been understood by its ability to interact with various cyclins and cyclin-dependent kinases. The BRCA1 activates the CDK inhibitor p21 and the p53 tumor suppressor protein, which regulates several genes that control cell cycle checkpoints.

4. PROTEIN INTERACTION AND FUNCTIONAL INTERPLAY BETWEEN PTEN AND P53 PTEN gene is the frequently mutated and deleted tumor suppressor in human cancer. Human genomic PTEN locus consists of nine exons on chromosome 10q23.3, encoding a 5.5 kb mRNA that specifies a 403 amino-acid open reading frame [30, 31] (Figure 2), which is ubiquitously expressed throughout early embryogenesis [32]. The translation product is a 53 kDa protein with homology to tensin and protein tyrosine phosphatases. The PTEN inactivation is implicated in the carcinogenesis of several cancers [33], which causes an increase in cellular PIP3 levels, by which activated PI3K/AKT signaling causes increased expression of several genes for cell survival. PTEN and p53 is known to interact and regulate each other (Figure 1) at the transcription as well as protein level, which could be at the important control machinery for switching between survival and death. This cross talk is frequently a combination of reciprocally antagonistic pathways, which often involves another tumor suppressor gene MDM2.The cross talk may serve as an added regulatory effect on the expression of key genes involved in cancer. It has also been revealed that PTEN regulates p53 stability and in turn regulates its own transcriptional activity. The PTEN and p53 complex enhances p53 DNA binding and transcriptional activity [34]. An important p53 function is to act as a transcription factor by binding to the specific DNA consensus sequence in responsive genes, which may increase the synthesis of p21waf1 that is an important protein involved in cell cycle arrest [35]. In addition, one of transcriptional targets of p53 is also the PTEN. One way by which p53 inhibits production of PIP3 indirectly is by inducing the expression of PTEN [36]. The p53 and AKT influence the process of apoptosis in opposite ways. The AKT promotes cell survival by suppressing pro-apoptotic proteins such as Bad through phosphorylation [37]. There are also cross talks between p53 and AKT involving gene transcription as well as posttranslational protein modifications. One way by which p53 inhibits PIP3 production indirectly is by repressing the catalytic subunit of PI3K. A subsequent p53-induced expression of PTEN causes the p53-PTEN interaction, which then suppresses the cell survival machinery of AKT pathway. PTEN is required for the maintenance of p53 acetylation, which is also required for target gene transcription [38]. Growth factor-activated AKT signaling promotes progression of cell cycles by acting on downstream factors involved in controlling the G1/S and/or G2/M transitions. Several studies have also implicated AKT in modulating DNA damage responses and genome stability [39]. AKT therefore modifies downstream signaling in complex ways. In addition, PTEN also plays a critical role in DNA damage repair and DNA damage response through its interaction with p53 pathways in an AKT-independent manner [40]. Furthermore, nuclear PTEN is sufficient to reduce tumor progression in a p53 dependent manner. It has also been suggested that nuclear PTEN play a unique role to protect cells upon oxidative damage and to regulate carcinogenesis [41]. One aspect of the PTEN tumor suppressor signaling is achieved through stabilization of

Tumor Suppressors Involved in DNA Repair and Carcinoprevention

2273

the p53 protein. PTEN has been shown to physically interact with p53 and prevent its degradation. The instability of PTEN correlated with its missense mutations has been shown to involve protein interactions. PTEN may be regulated by ubiquitin-mediated proteasomal degradation, a common mechanism to control protein levels.

Figure 3. Implication of tumor suppressor gene modulations in cancer. Expression of tumor suppressor genes is regulated by genetic, epigenetic, and transcriptional changes, which may result in the DNA repair activity in a cell. The DNA repair downregulation can contribute to genomic instability, which promotes malignant transformation of cells.

5. PERSPECTIVE Tumor suppressor molecules protect a cell from cancers. When the tumor suppressor genes lose their function by genetic changes such as mutations or deletions, the cell may progress to cancer in combination with other genetic changes (Figure 3). The phenotype of the cancerous cell may also arise from epigenetic events that may alter the gene expression. Epigenetic silencing of the tumor suppressor genes is a well-established oncogenic process [42]. So, the epigenetic modifications are of particular importance for the imprinted genes which are generally located in clusters [43, 44]. They are differentially marked by DNA methylation, histone acetylation, deacetylation, and histone methylation [45]. However, the molecular mechanisms by which they regulate developmental transitions have not yet been well defined. Epigenetic differences accumulate with age and different environments create different patterns of cellular modifications. Transient nutritional, biophysical, or biochemical stimuli occurring at specific stages may have influences on gene expression by interacting with epigenetic mechanisms and altering chromatin compaction and transcription factor accessibility [46] (Figure 3). Actually, the mRNA and protein expression level of the tumor suppressor genes is increased following treatment with drug, hormone, or food. For example, rosemary extract represses PTEN expression in K562 leukemic culture cells [47]. It has been paid more attention

2274

Yasuko Kitagishi and Satoru Matsuda

to the DNA repair, because specific cancer prevention may be possible via the mechanisms. The cancer cell genome is aberrant as a consequence of incomplete DNA repair. As many anticancer drugs further reduce the integrity of DNA, they may be able to cause more mutations and another cancer, if the lesions are not repaired. However, cancer cells, in which its DNA repair is down-regulated, have been shown to exhibit increased sensitivity to DNA damaging chemotherapy. Understanding of the cellular aberrations of cancer cells has allowed the development of therapies to target biological pathways. Several studies have evaluated the role of DNA repair enzyme inhibitors for treatment of cancer [48, 49]. Further investigations will be required to identify other additional mechanisms associated with the therapeutic sensitivity. Also, future studies should be conducted to determine whether the combination of DNA damaging agents and DNA repair modulator has potential for the treatment against cancer.

ACKNOWLEDGMENTS This work was supported by grants-in-aid from the Ministry of Education, Culture, Sports, Science and Technology in Japan. In addition, this work was supported in part by the grant from Nakagawa Masashichi Shoten Co., Ltd.

Competing Interests Statement The authors declare that they have no competing financial interests.

REFERENCES [1] [2] [3] [4] [5] [6] [7] [8]

Frame FM, Maitland NJ (2011) Cancer stem cells, models of study and implications of therapy resistance mechanisms. Adv Exp Med Biol. 720: 105-118. Athar M, Elmets CA, Kopelovich L (2011) Pharmacological activation of p53 in cancer cells. Curr Pharm Des. 17: 631-639. Li ZY, Yang Y, Ming M, and Liu B, “Mitochondrial ROS generation for regulation of autophagic pathways in cancer,” Biochem Biophys Res Commun, vol. 414, pp. 5-8, 2011. Bykov VJ, Lambert JM, Hainaut P, Wiman KG (2009) Mutant p53 rescue and modulation of p53 redox state. Cell Cycle. 8: 2509-2517. Liu B, Chen Y, St Clair DK (2008) ROS and p53: a versatile partnership. Free Radic Biol Med. 44: 1529-1535. Asai T, Liu Y, Bae N, and Nimer SD, “The p53 tumor suppressor protein regulates hematopoietic stem cell fate,” J Cell Physiol, vol. 226, pp. 2215-2221, 2011. Gostissa M, Alt FW, Chiarle R (2011) Mechanisms that promote and suppress chromosomal translocations in lymphocytes. Annu Rev Immunol. 29: 319-350. Al-Ejeh F, Kumar R, Wiegmans A, Lakhani SR, Brown MP, Khanna KK (2010) Harnessing the complexity of DNA-damage response pathways to improve cancer treatment outcomes. Oncogene. 29: 6085-6098.

Tumor Suppressors Involved in DNA Repair and Carcinoprevention [9] [10] [11]

[12]

[13] [14] [15] [16]

[17] [18] [19] [20] [21] [22] [23] [24]

[25]

[26]

2275

Krystof V, Uldrijan S (2010) Cyclin-dependent kinase inhibitors as anticancer drugs. Curr Drug Targets. 11: 291-302. Kelly GL and Strasser A, “The essential role of evasion from cell death in cancer,” Adv Cancer Res, vol. 111, pp. 39-96, 2011. Bhatti S, Kozlov S, Farooqi AA, Naqi A, Lavin M, and Khanna KK, “ATM protein kinase: the linchpin of cellular defenses to stress,” Cell Mol Life Sci, vol. 68, pp. 29773006, 2011. Okumura N, Yoshida H, Kitagishi Y, Nishimura Y, Iseki S, and Matsuda S, “Against Lung Cancer Cells: To Be, or Not to Be, That Is the Problem,” Lung Cancer Int doi:10.1155/2012/659365, in press, 2012. Gigek CO, Chen ES, Calcagno DQ, Wisnieski F, Burbano RR, and Smith MA, “Epigenetic mechanisms in gastric cancer,” Epigenomics, vol. 4, pp. 279-294, 2012. Martinez-Rivera M and Siddik ZH, “Resistance and gain-of-resistance phenotypes in cancers harboring wild-type p53,” Biochem Pharmacol, vol. 83, pp. 1049-1062, 2012. Stegh AH, “Targeting the p53 signaling pathway in cancer therapy - the promises, challenges and perils,” Expert Opin Ther Targets, vol. 16, pp. 67-83, 2012. Zawacka-Pankau J, Krachulec J, Grulkowski I, Bielawski KP, and Selivanova G, “The p53-mediated cytotoxicity of photodynamic therapy of cancer: recent advances,” Toxicol Appl Pharmacol, vol. 232, no. 3, pp. 487-497, 2008. Roy R, Chun J, and Powell SN, “BRCA1 and BRCA2: different roles in a common pathway of genome protection,” Nat Rev Cancer, vol. 12, pp. 68-78, 2011. Ohta T, Sato K, and Wu W, “The BRCA1 ubiquitin ligase and homologous recombination repair,” FEBS Lett, vol. 585, pp. 2836-2844, 2011. Leung CC and Glover JN, “BRCT domains: easy as one, two, three,” Cell Cycle, vol. 10, pp. 2461-2470, 2011. Ouchi T, “BRCA1 phosphorylation: biological consequences,” Cancer Biol Ther, vol. 5, pp. 470-475, 2006. Kim DH, Kundu JK, Surh YJ (2011) Redox modulation of p53: mechanisms and functional significance. Mol Carcinog. 50: 222-234. Aly A, Ganesan S (2011) BRCA1, PARP, and 53BP1: conditional synthetic lethality and synthetic viability. J Mol Cell Biol. 3: 66-74. Kobayashi J, Iwabuchi K, Miyagawa K, Sonoda E, Suzuki K, Takata M, Tauchi H (2008) Current topics in DNA double-strand break repair. J Radiat Res. 49: 93-103. Lo PK, Lee JS, Sukumar S (2012) The p53-p21WAF1 checkpoint pathway plays a protective role in preventing DNA rereplication induced by abrogation of FOXF1 function. Cell Signal. 24: 316-324. Chionh F, Mitchell G, Lindeman GJ, Friedlander M, Scott CL (2011) The role of poly adenosine diphosphate ribose polymerase inhibitors in breast and ovarian cancer: current status and future directions. Asia Pac J Clin Oncol. 7: 197-211. Konishi H, Mohseni M, Tamaki A, Garay JP, Croessmann S, Karnan S, Ota A, Wong HY, Konishi Y, Karakas B, Tahir K, Abukhdeir AM, Gustin JP, Cidado J, Wang GM, Cosgrove D, Cochran R, Jelovac D, Higgins MJ, Arena S, Hawkins L, Lauring J, Gross AL, Heaphy CM, Hosokawa Y, Gabrielson E, Meeker AK, Visvanathan K, Argani P, Bachman KE, Park BH (2011) Mutation of a single allele of the cancer susceptibility gene BRCA1 leads to genomic instability in human breast epithelial cells. Proc Natl Acad Sci U S A. 108: 17773-17778.

2276

Yasuko Kitagishi and Satoru Matsuda

[27] Rebbeck TR, Mitra N, Domchek SM, Wan F, Chuai S, Friebel TM, Panossian S, Spurdle A, Chenevix-Trench G; kConFab, Singer CF, Pfeiler G, Neuhausen SL, Lynch HT, Garber JE, Weitzel JN, Isaacs C, Couch F, Narod SA, Rubinstein WS, Tomlinson GE, Ganz PA, Olopade OI, Tung N, Blum JL, Greenberg R, Nathanson KL, Daly MB (2009) Modification of ovarian cancer risk by BRCA1/2-interacting genes in a multicenter cohort of BRCA1/2 mutation carriers. Cancer Res. 69: 5801-5810. [28] Orlando L, Schiavone P, Fedele P, Calvani N, Nacci A, Cinefra M, D'Amico M, Mazzoni E, Marino A, Sponziello F, Morelli F, Lombardi L, Silvestris N, Cinieri S (2012) Poly (ADP-ribose) polymerase (PARP): rationale, preclinical and clinical evidences of its inhibition as breast cancer treatment. Expert Opin Ther Targets. 16:S83-S89. [29] Banerjee S, Kaye S (2011) PARP inhibitors in BRCA gene-mutated ovarian cancer and beyond. Curr Oncol Rep. 13: 442-449. [30] Okumura N, Yoshida H, Kitagishi Y, Murakami M, Nishimura Y, and Matsuda S, “PI3K/AKT/PTEN Signaling as a Molecular Target in Leukemia Angiogenesis,” Adv Hematol, vol. 2012, pp. 843085, 2012. [31] Okumura N, Yoshida H, Kitagishi Y, Nishimura Y, and Matsuda S, “Alternative splicings on p53, BRCA1 and PTEN genes involved in breast cancer,” Biochem Biophys Res Commun, vol. 413, pp. 395-399, 2011. [32] Croushore JA, Blasiole B, Riddle RC et al., “Ptena and ptenb genes play distinct roles in zebrafish embryogenesis,” Dev Dyn, vol. 234, pp. 911-921, 2005. [33] Barbieri SS, Ruggiero L, Tremoli E, and Weksler BB, “Suppressing PTEN activity by tobacco smoke plus interleukin-1beta modulates dissociation of VE-cadherin/betacatenin complexes in endothelium,” Arterioscler Thromb Vasc Biol, vol. 28, pp. 732-738, 2008. [34] Freeman DJ, Li AG, Wei G et al., “PTEN tumor suppressor regulates p53 protein levels and activity through phosphatase-dependent and -independent mechanisms,” Cancer Cell, vol. 3, no. 2, pp. 117-130, 2003. [35] Lo PK, Lee JS, and Sukumar S, “The p53-p21WAF1 checkpoint pathway plays a protective role in preventing DNA rereplication induced by abrogation of FOXF1 function,” Cell Signal, vol. 24, no. 1, pp. 316-324, 2012. [36] Puszyński K, Hat B, and Lipniacki T, “Oscillations and bistability in the stochastic model of p53 regulation,” J Theor Biol, vol. 254, no. 2, pp. 452-465, 2008. [37] Sen P, Mukherjee S, Ray D, and Raha S, “Involvement of the Akt/PKB signaling pathway with disease processes,” Mol Cell Biochem, vol. 253, no. 1-2, pp. 241-246, 2003. [38] Li AG, Piluso LG, Cai X, Wei G, Sellers WR, and Liu X, “Mechanistic insights into maintenance of high p53 acetylation by PTEN,” Mol Cell, vol. 23, no. 4, pp. 575-587, 2006. [39] Quevedo C, Kaplan DR, and Derry WB, “AKT-1 regulates DNA-damage-induced germline apoptosis in C. elegans,” Curr Biol, vol. 17, no. 3, pp. 286-292, 2007. [40] Ming M, and He YY, “PTEN in DNA damage repair,” Cancer Lett, vol. 319, no. 2, pp. 125-129, 2012. [41] Bonavida B, and Baritaki S, “The novel role of Yin Yang 1 in the regulation of epithelial to mesenchymal transition in cancer via the dysregulated NF-κB/Snail/YY1/RKIP/PTEN Circuitry,” Crit Rev Oncog, vol. 16, no. 3-4, pp. 211-226, 2011. [42] Ren J, Singh BN, Huang Q et al., “DNA hypermethylation as a chemotherapy target,” Cell Signal, vol. 23, no. 7, pp. 1082-1093, 2011.

Tumor Suppressors Involved in DNA Repair and Carcinoprevention

2277

[43] Ribarska T, Bastian KM, Koch A, and Schulz WA, “Specific changes in the expression of imprinted genes in prostate cancer--implications for cancer progression and epigenetic regulation,” Asian J Androl, vol. 14, no. 3, pp. 436-450, 2012. [44] Abramowitz LK and Bartolomei MS, “Genomic imprinting: recognition and marking of imprinted loci,” Curr Opin Genet Dev, vol. 22, no. 2, pp. 72-78, 2012. [45] Issa JP, “Epigenetic changes in the myelodysplastic syndrome,” Hematol Oncol Clin North Am, vol. 24, no. 2, pp. 317-330, 2010. [46] Martino DJ and Prescott SL, “Silent mysteries: epigenetic paradigms could hold the key to conquering the epidemic of allergy and immune disease,” Allergy, vol. 65, no. 1, pp. 7-15, 2010. [47] Yoshida H, Okumura N, Kitagishi Y, Nishimura Y, and Matsuda S, “Ethanol extract of Rosemary repressed PTEN expression in K562 culture cells,” Int J appl Boil pharm Technol, vol. 2, pp. 316-322, 2011.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 106

MOLECULAR PATHOGENESIS OF NEUROFIBROMATOSIS TYPE 1 Ming-Jen Lee1, Alton Etheridge2, David J. Galas2,3 and Kai Wang2 1

Department of Neurology and Medical Genetic, National Taiwan University School of Medicine, National Taiwan University, Taipei, Taiwan, Republic of China 2 Institute for Systems Biology, Seattle, WA, US 3 Luxembourg Centre for Systems Biomedicine, Esch-sur-Alzette, Luxembourg

ABSTRACT Neurofibromatosis type 1 (NF1) is one of the most common inherited neurological disorders. Clinically, NF1 is characterized by café-au-lait spots, skinfold freckling, cutaneous and subcutaneous neurofibroma, plexiform neurofibroma, Lisch nodules, bony defects and frequently by a positive family history in first degree relatives. The causative gene encodes a large protein, neurofibromin, a negative regulator of the RAS signaling pathway. In addition to neurofibromatosis, several other disorders such as Noonan syndrome, Costello syndrome, Legius syndrome and cardio-facio-cutaneous (CFC) syndrome also result from a dysfunctional RAS pathway; therefore, all of these diseases have been grouped as RASopathies. While the molecular genetics of NF1 are well studied, the biological processes underlying the development of NF1-associated pathologies have yet to be fully understood. Using a systems biology approach to integrate various global, molecular profiling data can provide insights into the function and interactions of key regulatory molecules associated with NF1. These include transcription factors and microRNAs. This may ultimately lead to the discovery of new diagnostic markers and the identification of therapeutic targets.

2280

Ming-Jen Lee, Alton Etheridge, David J. Galas et al.

INTRODUCTION Neurofibromatosis (NF) is the most common hereditary neurological disorder. It was first described by German pathologist Friedrich Daniel von Recklinghausen [1]. Neurofibro-matosis type 1 and 2 (NF1 and NF2) are the two major forms of autosomal dominant neuro-cutaneous syndromes. They show no special preference for race and gender. NF1 is caused by mutation(s) of the neurofibromatosis type 1 gene (NF1), which encodes a multi-domain protein, neurofibromin. Clinically, NF1 has extremely variable manifestations which include multiple café-au-lait spots (CALS), cutaneous neurofibromas, plexiform neurofibromas, iris hamartomas (Lisch nodules), bony defects and neoplasms of the nervous system. Although tumors in NF1 are usually benign in nature, transformation of plexiform neurofibroma to form malignant peripheral nerve sheath tumors, occurs in approximately 10% of NF1 patients.

EPIDEMIOLOGY OF NF1 In 1981, Samuelsson reported the first population-based prevalence study of NF1 with a prevalence of 1/4600 in the Gothenburg region, Sweden [2]. Huson et al. surveyed South East Wales, UK and reported a prevalence of 1/4150 [3]. The highest estimated prevalence of NF1, 1/2190, was reported in 1989 in Dunedin, New Zealand [4]. Several studies with populations from northeast Italy and northern Finland also gave an estimated occurrence rate between 1/2983 and 1/6711 [5]. Accordingly the average prevalence of NF1 has been estimated to be about 1/3500 [6-8] with a birth incidence varying from 1/2558 to 1/4292. There is no evidence of ethnicity differences in the frequency of NF1 based on the results of different prevalence studies [9].

CLINICAL FEATURES OF NF1 For the majority of patients, the diagnosis of NF1 is based exclusively on the clinical features. The NF1 diagnosis requires the presence of at least two of the major clinical criteria: six or more CALS, axillary or inguinal freckling, two or more cutaneous neurofibromas, one plexiform neurofibroma, characteristic bony defects (pseudarthrosis, sphenoid wing hypoplasia, and scoliosis), optic glioma, two or more iris Lisch nodules, or a positive family history with a first-degree relative with NF1 [10]. Most of the clinical features associated with NF1 increase in frequency with age among affected children [3, 6, 11-15]. Many infants and young children who are NF1 gene mutation carriers do not fulfill the clinical diagnostic criteria for NF1 [3, 14, 16-18], but the disease is apparent in almost all affected individuals by 8 years of age and in all affected individuals by age 20 [11, 14]. CALS, pseudarthrosis, and externally visible plexiform neurofibromas can be identified in early infancy, while freckling, optic gliomas, and severe scoliosis occur by the first decade of life. Upon progression, cutaneous neurofibromas and iris Lisch nodules usually appear in teenage to young adult years in NF1 patients [19]. Therefore, NF1 is a progressive condition with variable complications and may worsen with time.

Molecular Pathogenesis of Neurofibromatosis Type 1

2281

Skin Manifestations CALS are well circumscribed, evenly pigmented light to dark brown macules averaging 2–5cm in diameter in adults, but they may vary from 2mm to more than 20cm [20]. The frequency of having more than six CALS, which is considered as a cut-off for the NF1 diagnostic criteria, is rare in normal individuals. The CALS must be at least 0.5 cm in diameter in prepubertal individuals and 1.5 cm in postpubertal patients. In addition to NF1, other syndromes associated with one or multiple CALS include McCune-Albright syndrome, Legius syndrome, Noonan syndrome, other cardio-facial-cutaneous syndromes (RASopa-thies), and constitutional mismatch repair deficiency syndrome [20]. A significant increase in melanocyte and mast cell density in CALS indicates the possible involvement of mast cells and melanocytes in CALS formation [21]. Even though the etiopathogenesis of these skin macules is still elusive, the local fluctuations of keratinocyte-derived membrane-bound stem cell factor (SCF) and mast cell growth factors (MCF) could be important for the development of CALS [22, 23]. Diffuse freckling is another common clinical phenotype in NF1 and clustering hyperpigmentation on the axilla and inguinal area is very common in NF1 patients. Whether the freckling is also associated with SCF and MCF has yet to be determined. Neurofibroma, a benign tumor derived from cutaneous or subcutaneous nerve sheath is common among NF1 patients. The tumor is comprised of Schwann cells, fibroblasts, perineural cells, mast cells, nerve axons and blood vessels. Some neurofibromas erupt with a broad base of skin involvement, but others are pedunculated lesions. Neurofibroma may be discrete, homogeneous, and well circumscribed, or diffuse, heterogeneous, and infiltrative (plexiform). Plexiform neurofibromas account for substantial morbidity associated with NF1, including disfigurement, functional impairment, and can be life threatening. Facial dysmor-phisms with visual loss are not uncommon in large facial plexiform neurofibromas [24, 25]. In a retrospective survey, six patients with hemifacial hypertrophy were identified to be caused by plexiform neurofibroma with a delayed diagnosis [26]. Histologically, plexiform neurofibromas are similar to cutaneous neurofibromas, but have more extracellular matrix and blood supply. They can arise from the dorsal spinal roots, nervous plexi, large nerve trunks, or sympathetic chains. Malignant transformation into malignant peripheral nerve sheath tumors (MPNST) occurs in approximately 10% of NF1 patients. The diagnosis if often delayed since these cancers typically arise in pre-existing tumors, i.e., neurofibromas. Surgical resection is the mainstay of treatment, and the adjuvant radiation therapy and/or chemo-therapy are not well defined, although adjuvant therapy may be of benefit in some patients [27]. The prognosis of patients with incompletely resected, recurrent or metastatic MPNST is dismal.

Skeletal and Osseous Abnormalities Abnormal skeletal development occurs in roughly 10–20% of NF1 patients [28, 29]. Skeletal manifestations in NF1 patients include bony dysplasia, bony erosion, demineralizing osteoporosis, non-ossifying fibromas, and scoliosis [30]. The most incapacitating problem is congenital pseudarthroses of long bones.

2282

Ming-Jen Lee, Alton Etheridge, David J. Galas et al.

Five percent of NF1 patients develop pseudarthrosis, usually involving the distal one third of the tibia and fibula [31]. Orthopedic surgery to correct NF1 skeletal defects often fails due to pseudarthrosis [28]. Low bone mass, consistent with osteoporosis, has been reported in both young and adult NF1 patients [32]. Fractures of deformed bones occur in 5–10% of young NF1 children, especially boys [31]. Both the demineralization and non-ossifying fibromas can lead to fracture especially in the femur, tibia, and humerus. Multiple forms of scoliosis occur in at least 10% of NF1 patients. In our NF1 clinic, 25% (17/68) of the NF1 patients were diagnosed with spinal scoliosis [33]. Images from an NF1 patient with both scoliosis and ankylosing spondylitis are shown in Figure 1, implying both developmental and inflammatory processes are involved in the development of skeletal problems in NF1 patients (Figure 1A and 1B). Rapid progressive abnormal curvature of the spine (kyphoscoliosis) needs to be corrected surgically. Fortunately, juvenile scoliosis is often self-limited. A mouse model lacking a functional Nf1 allele develops misalignment between vertebral bodies by 1 month of age, scoliosis by 3 months of age and vertebral fusion with severe loss of bone density by 6 months [34]. Blocking RAS/ERK activation by lovastatin during embryonic development reduces the cortical porosity, which suggests the involvement of neurofibromin in RAS/ERK pathway activation. Therefore, the abnormal activity of RAS/ ERK pathway maybe critical for the vertebral and tibia lesions in NF1 patients, and proteins associated with the RAS/ERK pathway may represent good therapeutic targets for NF1 [34].

(A)

(B)

Figure 1. Plain X-ray images of the thoracolumbar spine viewing through lateral (A) and anteriorposterior (B). The patient suffered from scoliosis and ankylosing spondylitis, resulting in vertebral fusion (bamboo spine).

Molecular Pathogenesis of Neurofibromatosis Type 1

2283

Vascular Lesions The majority of functional defects in NF1 involve neuroectodermal tissues including nervous tissue, skin, skeletal system, tooth and blood vessels. Structural abnormalities such as overgrowth after intimal injury, dysplasia of the vascular smooth muscle layer and adventitia in both large and small vessels can be identified in NF1 patients [35]. Common vascular complications of NF1 include arterial stenosis, aneurysm, and arteriovenous fistulas involving the abdominal aorta and its branches. We have reported a fatal brain ischemia caused by multifocal stenosis in intracranial arteries with complete occlusion of the left middle cerebral artery in a NF1 patient [36]. Recently, Gao et al. also reported a case with coexistence of a left renal artery stenosis and aneurysm detected by the color duplex ultrasound [37].

Psychiatric Disorders and Cognitive Dysfunction As compared to the general population, psychiatric disorders occur more frequently in patients with NF1 (33% of the patients) [38]. The most common psychiatric problem is dysthymia (21%). There is also a high prevalence of depression, anxiety, and personality disorders in NF1 patients. The impaired quality of life (QoL) associated with NF1 might contribute to the development of psychiatric disorders. Using the questionnaire SF-36 and Skindex, Page et al. screened 176 American NF1 patients and showed that the more visible NF1 associated skin disfiguration, the greater the impact on the QoL [39]. Learning disabilities and attention deficit have been reported in as many as 60% of NF1 patients, which may lead to poor performance in school [19]. However, the frequency of major cognitive impairment in our cohort is low [33] and most of our NF1 patients’ intelligence falls within normal limits.

Rare Manifestations In addition to the common clinical features associated with NF1, there are also some rare clinical manifestations such as segmental neurofibromatosis (NF type V) which involves only parts of the body. Most segmental neurofibromatosis patients do not have a positive family history and the disorder has been speculated to be derived from postzygotic NF1 gene mutation(s). The disease is usually confined to one sector of the body and patients may not have other NF1 stigmata, such as axillary freckling, neurofibroma or CALS [40]. Segmental NF does not progress to the common NF1 phenotype and malignancy is also rare among segmental NF1 patients [40].

RASopathies A few diseases, such as NF1, Noonan, Costello, Legius and cardio-facio-cutaneous (CFC) syndromes share some clinical features including mental subnormalities, facial dysmorphism, cardiomyopathy, short-stature, dysplasia, bony defects, and cutaneous freckling and

2284

Ming-Jen Lee, Alton Etheridge, David J. Galas et al.

pigmentation. All of these disorders result from aberrations in the RAS-MAPK pathway and they have been grouped together as RASopathies. Relative macrocephaly, ventriculomegaly and Chiari malformation can also occur in patients with RASopathy [41]. Dinçer et al. reported that 7 out of 54 NF1 patients suffered from hydrocephalus. Although the types of obstruction vary among patients, the presence of hamartomas was a common finding [42]. Figure 2A and 2B show the obstructive hydrocephalus with large ventricles in one of our NF1 patients. An abnormal flap bridges the fourth ventricle between the vermis and area postrema.

Dysplasia and Developmental Defects Dysplasia is an abnormal growth of a tissue during development or dysregulated wound healing, while neoplasia is an uncontrolled proliferation of cells. Cortical dysplasia with seizure has been reported in some NF1 patients. Animal models with neurofibromin haploinsufficiency also resulted in abnormal astrocyte proliferation in different brain regions [43]. In some cases, cortical dysplasia is correlated with ganglioglioma and dysembryoplastic neuroepithelial tumors in NF1 patients (Figure 3A and 3B) [44, 45]. NF1 patients also show wide-spread vasculature dysplasia in endothelial cells and pericytes, especially in the brain, gastrointestinal tract and kidney [36], [46-48]. The common clinical symptoms associated with NF1 including short stature, scoliosis, and joint pseudarthrosis are also dysplastic features of osteoblasts. Even though some neurofibromas in NF1 patients appear to arise from dysplastic responses to injury, a significant number of them are present from birth, suggesting embryonic or fetal growth abnormalities [49].

(A)

(B)

Figure 2. Sagittal T2WI (A) and axial T1WI (B) MRI images of an NF1 patient demonstrates the prominent enlarged ventricles and an abnormal flap bridge (arrow) in the forth ventricle between the vermis and area postrema. There is no tonsillar herniation, Chiari malformation, progressive forehead bossing or posterior fossa crowding.

Molecular Pathogenesis of Neurofibromatosis Type 1

2285

Histopathologically, neurofibroma is different from the proliferation of a single cell type frequently seen in neoplasm. Instead, neurofibromas are a mixture of multiple cell types including Schwann cells, fibroblasts, endothelial cells, pericytes, mast cells, occasionally lymphocytes and perineurial cells with extensive extracellular matrix, intercellular collagen and mucopolysaccharide-rich substances [50, 51]. In an animal model, the grafted plexiform neurofibroma will not grow unless neurofibromin-deficient Schwann cells are explanted with NF1+/- mast cells [52]. In addition, a few patients report intense itching during the growth of neurofibroma which may indicate the involvement of mast cells [53]. Based on these findings, an initial trail of imatinib mesylate (a receptor tyrosine kinase and cKit inhibitor for mast cells) on one patient with a large mediastinum plexiform neurofibroma, had positive results [53]. Imatinib mesylate has also shown efficacy in treating plexiform neurofibroma in a xenograft model [54]. Studying the interactions among different cell types in neurofibromas will continue to shed light on the mechanisms of tumor formation and growth [55].

MOLECULAR GENETICS OF NF1 Genetic Diagnosis The human NF1 gene has 60 exons and encodes a 12-kb transcript covering 350 kb at chromosome 17q11.2 [56, 57]. Mutations of the NF1 gene consist of small deletions, small insertions, nonsense and missense mutations, intronic mutations, and deletions of the majority of the NF1 gene or the entire NF1 gene. Most of the mutations are minor changes while only approximately 5% are total gene deletions [58]. Many germline mutations result in frameshift or nonsense mutations. The mutation rate at the NF1 gene is estimated to be ~1x10-4/ gamete/ generation making it one of the most frequently mutated genes in human [3, 8]. Approximately 50% of all mutations arise de novo and do not appear to be clustered within the gene. Mutations in the NF1 gene have been observed in several different types of malignancies including neurofibroma, glioma, MPNST, non-lymphocytic leukemia, and pheochromocytoma. To date, 1348 publically available mutations of the NF1 gene have been collected in The Human Mutation Database (HGMD, http://www.hgmd.cf.ac.uk/ac/gene.php? gene=NF1) which may explain, in part, the wide spectrum of clinical presentation of NF1. There are probably additional mutations associated with the NF1 gene. However, the identification of new mutations is hindered by the absence of mutation hotspots and the size of the gene. For the vast majority of patients, the identification of the specific type of NF1 mutation does not currently aid in prognostication, disease management, or treatment selection. Several methods are used to screen for NF1 mutations including single-strand conformational polymorphism (SSCP) [59], denaturing gradient gel electrophoresis [60], denaturing high-performance liquid chromatography [33], protein truncation test [61] and florescence in situ hybridization [62]. Some of these tests must be combined with DNA sequence analysis to document changes leading to abnormal profiles. Loss of heterozygosity of the flanking and intragenic microsatellite markers and the quantification of NF1 copy number, have been used in detecting large deletions [33].

2286

Ming-Jen Lee, Alton Etheridge, David J. Galas et al.

(A)

(B) Figure 3. Brain MRI (A) and PET (B) images of an NF1 patient with intractable seizure. The patient demonstrates a suspected dysembryoplastic neuroepithelial tumor (DPNT) in the left frontal region (arrow). The 18F-glucose PET images (B) show a high intensity at the tumor site indicating a correlation between the tumor and epilepsy.

Because screening for NF1 mutations is laborious and expensive, a robust, sensitive and cost-effective alternative for the heteroduplex detection or large-scale sequencing would be preferred by genetic laboratories. DNA sequencing-by-hybridzation (SBH) was initially proposed by Drmanac and Crkvenjakov [63]. This approach is an indirect sequencing method in which probes designed to read all possible sequences in any DNA sample hybridizing to DNA template molecules. A further advance of SBH technology is combinatorial SBH (cSBH), which utilizes a DNA ligation step for two short probes, in which one is attached to a solid support (a glass array slide) and the other is free in solution and labeled with a fluorophore. When both array-bound and solution-phase labeled probes hybridize to the target DNA at contiguous complementary positions, they are covalently linked by DNA ligase, creating one long labeled probe attached to the array surface. The combinatorial process generates all possible probes that are complementary to the target. Using the cSBH method, Schirinzi et al. screened 30 NF1 patients and identified 25 mutations with high accuracy and readability [64]. Although genetic testing for NF1 has been available since the mid-1990s, technical difficulties in sequencing the entire NF1 region have prevented it from becoming a routine practice in the clinic [65]. The recent development and maturation of next generation sequencing technology provides a new tool to address the complexity of mutations associated with NF1 [66].

Molecular Pathogenesis of Neurofibromatosis Type 1

2287

Tumors Associated with NF1 Neurofibromas are comprised of multiple cell types. The most prevalent cell type in the tumor is Schwann cells, which have been proposed to be the tumorigenic cell population [6769]. In addition to haploinsufficiency resulting from germline mutations in the NF1 gene, complete inactivation of both copies of the NF1 gene through additional de novo somatic mutations have been reported in NF1 related tumors [70-72]. Based on Schwann cell cultures derived from neurofibromas (38 tumors from 9 NF1 patients), Maertens and his colleagues detected 29 somatic mutations (29/38) in the neurofibromin gene, and the majority of the mutations are small alterations (26/29) of the gene [73, 74]. Only 3 in 29 mutations are loss of heterozygosity (LOH). A similar phenomenon was reported in tumors of patients with von Hippel-Lindau syndrome and in patients with retinoblastoma [75-77]. Given the high occurrence of somatic mutations, reduced DNA repair efficiency could be a trigger in neurofibroma development. The frequent changes in the genome of cancer cells led to the hypothesis of genetic instability as a prerequisite factor for cancer progression. MPNST in NF1 patients usually originates from plexiform neurofibroma. To elucidate the transition, Kobayashi et al. karyotyped 10 MPNSTs from nine patients and found more chromosomal aberrations as a consequence of chromosomal instability in MPNST [78]. However, these results must be interpreted with caution due to inadequate detection techniques, the limited number of samples and the mixed cell population that were used in the studies.

Disease Modifier Genes in NF1 The high inter- and intra-familial variability of NF1 symptoms suggests the possible involvement of modifier genes and/or environmental factors in NF1. Identifying these modifier genes or environmental factors could provide new insights into the underling mechanism of the disease and offer more effective therapeutic or disease management approaches. Atypical NF1-like symptoms may be the result of mutations in genes other than NF1 [79], and these mutations may also affect the symptoms and severity of NF1 gene-associated neurofibromatosis. Clinical statistics show that patients who are homozygous or compound heterozygous with MSH6 (mutS homolog 6) mutations, a mismatch repair gene, will develop NF1 like symptoms [80, 81]. The expression level of MSH6 gene also correlates with the number of café-au-lait spots, which is one of the key clinical phenotypes of NF1. In addition to MSH6, individuals with SPRED1 (sprouty-related, EVH1 domain containing 1) mutations also display NF1-like disorders. Easton and his colleague showed monozygotic twins have the highest NF1 gene genotype and neurofibromatosis phenotype correlation followed by first-degree relatives and more distant relatives. The high degree of correlation between monozygotic twins suggests a strong genetic component in NF1 pathology, but the low correlation between distant relatives suggests additional genetic factors other than the NF1 locus may play a role in the pathology of neurofibromatosis [82]. The NF-France Network has phenotyped and genotyped 750 NF1 patients and affected relatives from 275 families. NF1related clinical features, including five quantitative traits including number and size of cafe-aulait spots, and number of cutaneous, subcutaneous and plexiform neurofibromas were scored. Heritability estimates of those quantitative traits ranged only from 0.26 to 0.62 [83] which suggest the contribution of additional genetic factors to the NF1 clinical symptoms.

2288

Ming-Jen Lee, Alton Etheridge, David J. Galas et al.

However, a separate study of 175 NF1 individuals, including six monozygotic twin pairs, showed high degree of concordance in clinical features between twins and first degree relatives [83]. Two additional studies also demonstrated strong phenotype and NF1 genotype correlation [82, 84]. In addition, patients with deletions in the NF1 gene exhibit severe phenotypes with early-onset neurofibroma [85]. Upadhyaya and her colleague also demonstrated that NF1 patients from five unrelated multi-generation families having a single amino acid deletion (‘AAT’ p.990delM) in exon 17 do not developed cutaneous neurofibromas [86]. These studies revealed a strong phenotype-genotype correlation which argues against the existence of symptom-specific modifier genes for NF1. More recently, a study using a Gene-Chip containing over 900K single nucleotide polymorphism to genotype 300 patients with extreme tumor burden failed to identify a single common polymorphism associated with tumor burden [87].

Molecular Pathogenesis of NF1 NF1 is expressed ubiquitously in different tissues and cell types [88, 89]. Results from immunoprecipitation and Western blot analysis suggest neurological tissues and associated cells including neurons, oligodendrocytes, dorsal root ganglia, and nonmyelinating Schwann cells have the highest concentration of neurofibromin. In rat and human skin, neurofibromin is also expressed in keratinocytes and menalocytes [90]. The NF1 encoded protein, neurofibromin, contains a GTPase activating protein (GAP) family domain [91]. It has been shown that loss of neurofibromin function is associated with increased levels of activated RAS-GTP in malignant Schwann cells, which suggests the involvement of neurofibromin in modulating cellular RAS-GDP and RAS-GTP levels [92, 93]. In addition, neurofibromin degradation is necessary for maximal RAS activation by growth factors, and neurofibromin expression is required to attenuate the RAS-mediated signaling process [94]. Activation of PKC rapidly induces neurofibromin degradation. McGillicuddy et al. demonstrated that only the protein kinase C (PKC) inhibitor bisindolylmaleimide I (Bis I), but not the inhibitors of PI3K or MEK, blocked neurofibromin degradation in response to multiple growth factors in NIH 3T3 cells [95]. These results suggest the involvement of neurofibromin in the growth factor receptor-PKC-RAS signal pathway [95] and NF1 associated clinical phenotypes may be the results of aberrant activation of the RAS pathway [92, 96]. Recently, Yang et al. demonstrated that transforming growth factor-β (TGFβ) secreted by +/Nf1 mast cells can increase the proliferation, migration and collagen synthesis of the Nf1+/fibroblasts [97]. This TGFβ-induced change in fibroblasts was mediated through RASdependent activation of c-abl [97]. The same group further demonstrated the need of proper microenvironment for the growth of neurofibroma from NF1 deficient Schwann cells in a xenograft animal model. After transplanting human NF1-/- Schwann cells in bone marrow, the growth of neurofibroma from nerve roots can be identified in the recipient mice with a defective Nf1 allele in bone marrow [53], while those in the wild type did not develop any neoplasm. Based on the understanding of the RAS-c-abl and c-Kit signaling pathway, these investigators demonstrated the inhibition of neurofibroma growth in animal model by treating the animal with imatinib mesylate which is an inhibitor for c-Kit tyrosine kinase. Imatinib has

Molecular Pathogenesis of Neurofibromatosis Type 1

2289

also been successfully tested on a patient with an enlarged plexiform neurofibroma on the neck and mediastinum [53]. Neurofibromin may have additional non-RAS related functions, including regulating intracellular cAMP level [98]. The phenotype associated with NF1-deficiency in Drosophila can be rescued by over expression of cAMP dependent activated protein kinase A but not by manipulating RAS signaling [99]. Tong et al. also showed that the cAMP-related phenotypes of these flies could be rescued by the expression of a human NF1 transgene [100]. In mouse Nf1-/- astrocyte culture, loss of neurofibromin was found to have a positive influence on cAMP generation and activation of cAMP regulatory targets [101]. In yeast, it was shown that the C-terminal to the GAP related domain (GRD) region of the neurofibromin homologue, Ira1 and Ira2 proteins (RasGAP protein), interact with the kelch Gb proteins Gpb1/2 to stabilize the complex leading to unchecked cAMP–protein kinase A signaling. Thus, the destabilization of the kelch protein–neurofibromin complex may facilitate tumor initiation [102]. Dasgupta et al., using a proteomics-based approach, demonstrated that loss of neurofibromin in astrocytes results in hyperactivation of RAS-dependent and phosphatidylinositol 3-kinase (PI3)-dependent rapamycin (mTOR) signaling pathway [103]. In both Nf1 mutant mouse optic nerve glioma and in human NF1-associated pilocytic astrocytoma tumors, high levels of ribosomal S6 activation were found to be involved in hyperactivation of the mTOR pathways. Inhibition of the mTOR pathway results in the improvement of Nf1-/astrocyte growth in vitro [103]. AKT signaling in fibroblasts of the Nf1 null mouse was found to be aberrantly activated leading to S6 kinase hyper-phosphorylation [104]. Wortmannin, a PI3 kinase inhibitor, blocks inappropriate activation of mTOR, which depends on the RAS/PI3 kinase effector pathway. The primary target for AKT in this pathway is proposed to be tuberin, and phosphorylation of tuberin has been shown to inactivate the TSC1/TSC2 complex, which results in subsequent activation of mTOR [105, 106]. Finally, Johannson et al. reported that treatment of subcutaneous sporadic MPNST cell xenografts with mTOR inhibitor, RAD001 (Everolimus) significantly delayed tumor growth and decreased vessel permeability within xenografts [107]. The preclinical results support the consideration of RAD001 in treating NF1 associated and sporadic MPNST.

USING SYSTEMS APPROACHES TO STUDY NF1 One of the aims of systems biology is to decipher biological systems at the network level. The systems approach uses global experimental measurements, such as data from the genome, transcriptome, proteome and metabolome, to build testable hypotheses on molecular interactions. Ideally, identifying networks perturbed in diseases will allow us to identify key molecular events underlying the disease, as well as provide new approaches for restoring disease-perturbed networks. We have previously adapted the systems approach to study complex diseases including human interstitial lung diseases, B cell chronic lymphocytic leukemia, chronic obstructive pulmonary disease and a prion disease model [108-111]. In each of these cases, new molecular processes involved in the diseases and key regulatory factors that could provide new therapeutic intervention were identified.

2290

Ming-Jen Lee, Alton Etheridge, David J. Galas et al.

While previous work has elucidated some of the genes likely to be involved in NF1 pathogenesis and has identified some NF1 biomarkers, a thorough systems approach to identify the changes in the molecular networks underlying NF1 remains to be done. The most comprehensive global molecular profiling with NF1 samples to date, including 20 MPNSTs, 37 neurofibroma, 27 Schwannomas, and 13 synovial sarcomas by Subramanian et al. revealed inactivation of p53 and down-regulation of miR-34a in most of the MPNST samples [112]. Down-regulation of the tumor suppressor p53 is commonly observed in cancers, and miR-34a has been previously shown to be directly regulated by p53 [113]. Furthermore, after overexpression of miR-34a in the colon cancer cell line HCT116, expression levels of over 1200 genes were changed [113]. However, the potential roles of p53 and miR-34a dysregulation in MPNST remain unclear. To expand the network of genes possibly affected by the down-regulation of p53 and miR34a in MPNST, the results of miR-34a overexpression [113] were used to construct a gene network, taking into account gene expression patterns, protein-protein interactions, transcription factor and miRNA regulation [114]. One of the more interesting changes observed from this analysis is the identification of E2F transcription family members that are upregulated after miR-34 overexpression. E2F transcription factors are involved in cell cycle regulation and aberrant expression of E2F transcription factors has previously been reported in other cancers. This suggests the possibility that part of the dysregulation underlying MPNST is caused through changes in E2F transcriptional activity. Regulatory networks such as these can be useful because they can be applied to longitudinal datasets to follow disease progression.

CURRENT TREATMENT AND DISEASE MANAGEMENT Despite significant effort, there is currently no effective treatment for NF1. The hallmark of the disease, dermal neurofibromas, although benign, can be painful, debilitating, disfiguring, and can grow large enough to encompass an entire body region. In addition to the high tumor burden for some patients, many cannot be surgically removed because of underlying nerve and vascular involvement. Furthermore, lesions frequently regrow after surgical resection. It has been shown that dysfunction of several signal transduction elements, including the GTPase RAS, the kinase Src, the tumor suppressor p53 and mTOR-AKT are involved in neurofibroma development. Thus, reagents that block or reverse the abnormal activities related to these pathways may have therapeutic potential in NF1 treatment. As RAS pathway activation is an important feature involved in NF1 associated malignancies, several RAS pathway inhibitors are currently at different stages of clinical evaluation. To date, there are a number of drugs and treatment strategies in various stages of clinical trials (http://clinicaltrials.gov/ct2/results?term=NF1andpg=1) (Table 1). A majority of the trials are aimed at patients with plexiform neurofibroma, including pirfenidone, PEG-interferon alpha-2b, imatinib, sirolimus, vinblastine with methotrexate, and photodynamic therapy [115]. Some of these trials are listed below. Tipifarnib (IR115777): Tipifarnib is an inhibitor for farnesyl transferase, a key enzyme for RAS activation, which transfers a farnesyl group from farnesyl pyrophosphate (FPP) to the preRas protein. A phase 1 clinical trial with tipifarnib including NF1 patients with plexiform

Molecular Pathogenesis of Neurofibromatosis Type 1

2291

neurofibromas has been conducted by Widemann et al. [116]. A subsequent phase 2 study has been completed, but the results have not yet been published. Table 1. Summary of clinical trials for NF1 and related conditions registered in US National Institutes of Health (http://clinicaltrials.gov/ct2/results?term=NF1andpg=1) and in the recent report from Children’s Tumor Foundation Annual Meeting [87]

Condition NF1

Agent

Plexiform neurofibroma

Low-grade glioma associated with NF1

Unresectable meningioma, intracranial hemangioblastoma

MPNST

Lovastatin

Imatinib Methylate

Tarceva and Rapamycin

Sunitinib Malate

Filgrastim, doxorubicin hydrochloride, etoposide, ifosfamide, conventional surgery, and radiation therapy

Skincerity plus sirolimus/ rapamycin

Sorafenib

RAD001 (Everolimus)

Bevacizumab

Imatinib Mesylate

Methyphenidate

Nilotinib

Carboplatin, Vincristine

Pirfenidone

R115777 (Tipifarnib)

Sorafenib

Bevacizumab and Everolimus

Local injection of Sirolimus Lenalidomide ranibizumab Imiquimod 5% Pirfenidone Cream PEGCediranib maleate interferonalfa-2b Erbium-YAG Cediranib maleate laser vaporization Peg-Interferon alpha-2b, Sorafenib Celecoxib, Temozolomide, Vincristine Mexotrexat, Vitamin D3 Vincristine LS 11 (Talaporfin sodium)

Sorafenib: Plexiform neurofibroma may be susceptible to the inhibition of Ras/Raf/ mitogen-activated protein kinase (MAPK) pathway. Thus, sorafenib, an oral receptor tyrosine kinase inhibitor has been evaluated in children with inoperable plexiform neurofibrmas and MPNST [115], with publication of the final study results pending.

2292

Ming-Jen Lee, Alton Etheridge, David J. Galas et al.

Sirolimus (Rapamycin): Sirolimus is an antifungal antibiotic. It inhibits cell cycle progression through the inactivation of mTOR kinase and has anti-proliferative effects [117]. Sirolimus is being evaluated for the treatment of plexiform neurofibromas in a phase 2 study. Cediranib: Cediranib is a small molecule inhibitor of vascular endothelial growth factor receptor (VEGFR) and is being investigated in patients with NF1 and plexiform neurofibromas. Pirfenidone: Pirfenidone, an inhibitor for TGF synthesis has been tested in adult patients with NF1 in an open label trial published by Babovic-Vuksanovic et al. [118]. Four out of 17 patients had a decrease in tumor volume by 15% or more [118]. Imatinib: Imatinib targets c-kit and PDGFR, and has been reported to be effective in tumor reduction in a subset of patients with plexiform neurofibroma. Symptom improvement was also reported in some patients [87]. HMG-CoA reductase inhibitor: Besides treating NF1 associated tumors, approximately 30% to 65% of children with NF1 suffer from a broad range of both nonverbal and verbal learning disabilities [119]. A Phase I trial of Lovastatin for children with NF1 and cognitive deficits was completed and found improvement of specific cognitive areas, such as memory, recall, and recognition [115].

CONCLUSION Neurofibromatosis type 1 is a complex disorder, with widely variable clinical features. Anticipatory guidance, surveillance, symptom management and surgical and/or medical treatment of NF1-associated tumors are the main therapeutic approaches in the clinic. Current evidences suggest the haploinsufficiency of neurofibromin is the underlying key pathogenic factor for NF1 and its associated dysplasia and neoplasm. Understand how normal molecular network affected by dysfunctional neurofibromin through comprehensive systems biology studies may inform new therapeutic approaches in the future.

REFERENCES [1]

[2]

[3]

[4]

[5]

Von Recklinghausen, F., Uber die Multiplen Fibrome der Haut und Ihre Beziehung zu Multiplen Neuromen. [About the Multiple Fibromas of the Skin and Their Relationship to Multiple Neuromas]. 1882, Berlin: August Hirschwald. Samuelsson, B. and R. Axelsson, Neurofibromatosis. A clinical and genetic study of 96 cases in Gothenburg, Sweden. Acta Derm. Venereol. Suppl. (Stockh.), 1981. 95: p. 6771. Huson, S. M., et al., A genetic study of von Recklinghausen neurofibromatosis in south east Wales. I. Prevalence, fitness, mutation rate, and effect of parental transmission on severity. J. Med. Genet., 1989. 26(11): p. 704-11. Fuller, L. C., B. Cox and R. J. Gardner, Prevalence of von Recklinghausen neurofibromatosis in Dunedin, New Zealand. Neurofibromatosis, 1989. 2(5-6): p. 27883. Clementi, M., et al., Neurofibromatosis-1: a maximum likelihood estimation of mutation rate. Hum. Genet., 1990. 84(2): p. 116-8.

Molecular Pathogenesis of Neurofibromatosis Type 1 [6] [7] [8] [9] [10]

[11]

[12] [13]

[14] [15] [16] [17] [18] [19] [20] [21]

[22] [23]

[24] [25] [26]

2293

Huson, S. M. and R. Hughes, The neurofibromatoses: a pathogenetic and clinical overview. 1994, London: Chapman and Hall. Riccardi, V., Neurofibromatosis: phenotype, natural history, and pathogenesis. 2nd ed. 1992, Baltimore: Johns Hopkins University Press. Upadhyaya, M. and D. N. Cooper, Neurofibromatosis type 1: from genotype to phenotype. 1998, Guildford: Biddles. Friedman, J. M., Epidemiology of neurofibromatosis type 1. Am. J. Med. Genet., 1999. 89(1): p. 1-6. National Institutes of Health Consensus Development Conference Statement on Acoustic Neuroma, December 11-13, 1991. The Consensus Development Panel. Arch. Neurol., 1994. 51(2): p. 201-7. DeBella, K., J. Szudek and J. M. Friedman, Use of the national institutes of health criteria for diagnosis of neurofibromatosis 1 in children. Pediatrics, 2000. 105(3 Pt 1): p. 60814. Friedman, J. M. and P. H. Birch, Type 1 neurofibromatosis: a descriptive analysis of the disorder in 1,728 patients. Am. J. Med. Genet., 1997. 70(2): p. 138-43. Niimura, M., Neurofibromatosis in Japan, In: Tuberous sclerosis and neurofibromatosis: epidemiology, pathophysiology, biology, and management., Y. Ishibashi and Y. Hori, Editors. 1990, Elsevier: Amsterdam. p. p 23-31. Obringer, A. C., A. T. Meadows and E. H. Zackai, The diagnosis of neurofibromatosis1 in the child under the age of 6 years. Am. J. Dis. Child, 1989. 143(6): p. 717-9. Wolkenstein, P., et al., Usefulness of screening investigations in neurofibromatosis type 1. A study of 152 patients. Arch. Dermatol., 1996. 132(11): p. 1333-6. Goldberg, Y., et al., Neurofibromatosis type 1--an update and review for the primary pediatrician. Clin. Pediatr. (Phila.), 1996. 35(11): p. 545-61. Korf, B. R., Diagnostic outcome in children with multiple cafe au lait spots. Pediatrics, 1992. 90(6): p. 924-7. Riccardi, V. M., Von Recklinghausen neurofibromatosis. N Engl. J. Med., 1981. 305 (27): p. 1617-27. Tonsgard, J. H., Clinical manifestations and management of neurofibromatosis type 1. Semin. Pediatr. Neurol., 2006. 13(1): p. 2-7. Shah, K. N., The diagnostic and clinical significance of cafe-au-lait macules. Pediatr. Clin. North Am., 2010. 57(5): p. 1131-53. Okazaki, M., et al., Correlation between age and the secretions of melanocytestimulating cytokines in cultured keratinocytes and fibroblasts. Br. J. Dermatol., 2005. 153 Suppl. 2: p. 23-9. Wehrle-Haller, B., The role of Kit-ligand in melanocyte development and epidermal homeostasis. Pigment. Cell. Res., 2003. 16(3): p. 287-96. Wehrle-Haller, B., M. Meller and J. A. Weston, Analysis of melanocyte precursors in Nf1 mutants reveals that MGF/KIT signaling promotes directed cell migration independent of its function in cell survival. Dev. Biol., 2001. 232(2): p. 471-83. Korf, B. R., Plexiform neurofibromas. Am. J. Med. Genet., 1999. 89(1): p. 31-7. Woodruff, J. M., Pathology of tumors of the peripheral nerve sheath in type 1 neurofibromatosis. Am. J. Med. Genet., 1999. 89(1): p. 23-30. Overdiek, A., et al., Diagnostic delay of NF1 in hemifacial hypertrophy due to plexiform neurofibromas. Brain Dev., 2006. 28(5): p. 275-80.

2294

Ming-Jen Lee, Alton Etheridge, David J. Galas et al.

[27] Stucky, C. C., et al., Malignant peripheral nerve sheath tumors (MPNST): the Mayo Clinic experience. Ann. Surg. Oncol. 19(3): p. 878-85. [28] Crawford, A. H. and E. K. Schorry, Neurofibromatosis in children: the role of the orthopaedist. J. Am. Acad. Orthop. Surg., 1999. 7(4): p. 217-30. [29] Riccardi, V. M., J. E. Womack and T. Jacks, Neurofibromatosis and related tumors. Natural occurrence and animal models. Am. J. Pathol., 1994. 145(5): p. 994-1000. [30] Lee, M. J. and D. A. Stephenson, Recent developments in neurofibromatosis type 1. Curr. Opin. Neurol., 2007. 20(2): p. 135-41. [31] Gilbert, A. and R. Brockman, Congenital pseudarthrosis of the tibia. Long-term followup of 29 cases treated by microvascular bone transfer. Clin. Orthop. Relat. Res., 1995(314): p. 37-44. [32] Kuorilehto, T., et al., Decreased bone mineral density and content in neurofibromatosis type 1: lowest local values are located in the load-carrying parts of the body. Osteoporos Int, 2005. 16(8): p. 928-36. [33] Lee, M. J., et al., Identification of forty-five novel and twenty-three known NF1 mutations in Chinese patients with neurofibromatosis type 1. Hum. Mutat., 2006. 27(8): p. 832. [34] Wang, W., et al., Mice lacking Nf1 in osteochondroprogenitor cells display skeletal dysplasia similar to patients with neurofibromatosis type I. Hum. Mol. Genet., 2011. 20 (20): p. 3910-24. [35] Norton, K. K., J. Xu and D. H. Gutmann, Expression of the neurofibromatosis I gene product, neurofibromin, in blood vessel endothelial cells and smooth muscle. Neurobiol. Dis., 1995. 2(1): p. 13-21. [36] Tang, S. C., et al., Novel mutation of neurofibromatosis type 1 in a patient with cerebral vasculopathy and fatal ischemic stroke. J. Neurol. Sci., 2006. 243(1-2): p. 53-5. [37] Gao, J., A. Fisher and J. Chung, Color duplex ultrasonography in detecting renal artery abnormalities in a patient with neurofibromatosis 1: a case report. Clin. Imaging, 2006. 30(2): p. 140-2. [38] Belzeaux, R. and C. Lancon, [Neurofibromatosis type 1: psychiatric disorders and quality of life impairment]. Presse Med., 2006. 35(2 Pt 2): p. 277-80. [39] Page, P. Z., et al., Impact of neurofibromatosis 1 on Quality of Life: a cross-sectional study of 176 American cases. Am. J. Med. Genet. A, 2006. 140(18): p. 1893-8. [40] Dang, J. D. and P. R. Cohen, Segmental neurofibromatosis and malignancy. Skinmed, 2010. 8(3): p. 156-9. [41] Gripp, K. W., et al., High incidence of progressive postnatal cerebellar enlargement in Costello syndrome: brain overgrowth associated with HRAS mutations as the likely cause of structural brain and spinal cord abnormalities. Am. J. Med. Genet. A, 2010. 152 A(5): p. 1161-8. [42] Dincer, A., U. Yener and M. M. Ozek, Hydrocephalus in patients with neurofibromatosis type 1: MR imaging findings and the outcome of endoscopic third ventriculostomy. AJNR Am. J. Neuroradiol., 2011. 32(4): p. 643-6. [43] Bajenaru, M. L., et al., Neurofibromatosis 1 (NF1) heterozygosity results in a cellautonomous growth advantage for astrocytes. Glia, 2001. 33(4): p. 314-23. [44] Ostertun, B., et al., Dysembryoplastic neuroepithelial tumors: MR and CT evaluation. AJNR Am. J. Neuroradiol., 1996. 17(3): p. 419-30.

Molecular Pathogenesis of Neurofibromatosis Type 1

2295

[45] Prayson, R. A., Composite ganglioglioma and dysembryoplastic neuroepithelial tumor. Arch. Pathol. Lab. Med., 1999. 123(3): p. 247-50. [46] Munchhof, A. M., et al., Neurofibroma-associated growth factors activate a distinct signaling network to alter the function of neurofibromin-deficient endothelial cells. Hum. Mol. Genet., 2006. 15(11): p. 1858-69. [47] Teixeira, F., et al., Vascular changes in cutaneous neurofibromas. Neurofibromatosis, 1988. 1(1): p. 5-16. [48] Wu, M., M. R. Wallace and D. Muir, Nf1 haploinsufficiency augments angiogenesis. Oncogene, 2006. 25(16): p. 2297-303. [49] Riccardi, V., The potential role of trauma and mast cells in the pathogenesis of neurofibromas., In Tuberous sclerosis and neurofibromatosis: epidemiology, pathophysiology, biology and management., Ishibashi, Y. and H. Y., Editors. 1990, Elsevier: Amsterdam. p. pp. 167-190. [50] Harkin, J. C. and R. J. Reed, Tumors of the peripheral nervous system., In: Atlas of tumor pathology. 1969, Armed Forces Institute of Pathology: Washington, D.C. p. PP. 67-106. [51] Jaakkola, S., et al., Type 1 neurofibromatosis: selective expression of extracellular matrix genes by Schwann cells, perineurial cells, and fibroblasts in mixed cultures. J. Clin. Invest., 1989. 84(1): p. 253-61. [52] Staser, K., F. C. Yang and D. W. Clapp, Mast cells and the neurofibroma microenvironment. Blood, 2010. 116(2): p. 157-64. [53] Yang, F. C., et al., Nf1-dependent tumors require a microenvironment containing Nf1+/- and c-kit-dependent bone marrow. Cell, 2008. 135(3): p. 437-48. [54] Demestre, M., et al., Imatinib mesylate (Glivec) inhibits Schwann cell viability and reduces the size of human plexiform neurofibroma in a xenograft model. J. Neurooncol., 2010. 98(1): p. 11-9. [55] Yang, F. C., et al., Neurofibromin-deficient Schwann cells secrete a potent migratory stimulus for Nf1+/- mast cells. J. Clin. Invest., 2003. 112(12): p. 1851-61. [56] Viskochil, D., et al., Deletions and a translocation interrupt a cloned gene at the neurofibromatosis type 1 locus. Cell, 1990. 62(1): p. 187-92. [57] Wallace, M. R., et al., Type 1 neurofibromatosis gene: identification of a large transcript disrupted in three NF1 patients. Science, 1990. 249(4965): p. 181-6. [58] Wimmer, K., et al., Spectrum of single- and multiexon NF1 copy number changes in a cohort of 1,100 unselected NF1 patients. Genes Chromosomes Cancer, 2006. 45(3): p. 265-76. [59] Upadhyaya, M., et al., Characterisation of germline mutations in the neurofibromatosis type 1 (NF1) gene. J. Med. Genet., 1995. 32(9): p. 706-10. [60] Toliat, M. R., et al., Analysis of the NF1 gene by temperature gradient gel electrophoresis reveals a high incidence of mutations in exon 4b. Electrophoresis, 2000. 21(3): p. 5414. [61] Heim, R. A., et al., Distribution of 13 truncating mutations in the neurofibromatosis 1 gene. Hum. Mol. Genet., 1995. 4(6): p. 975-81. [62] Messiaen, L. M., et al., Exhaustive mutation analysis of the NF1 gene allows identification of 95% of mutations and reveals a high frequency of unusual splicing defects. Hum. Mutat., 2000. 15(6): p. 541-55. [63] Drmanac, R., et al., Sequencing by hybridization: towards an automated sequencing of one million M13 clones arrayed on membranes. Electrophoresis, 1992. 13(8): p. 566-73.

2296

Ming-Jen Lee, Alton Etheridge, David J. Galas et al.

[64] Schirinzi, A., et al., Combinatorial sequencing-by-hybridization: analysis of the NF1 gene. Genet. Test., 2006. 10(1): p. 8-17. [65] Han, S. S., D. N. Cooper and M. N. Upadhyaya, Evaluation of denaturing high performance liquid chromatography (DHPLC) for the mutational analysis of the neurofibromatosis type 1 (NF1) gene. Hum. Genet., 2001. 109(5): p. 487-97. [66] Hodges, E., et al., Genome-wide in situ exon capture for selective resequencing. Nat. Genet., 2007. 39(12): p. 1522-7. [67] Kluwe, L., R. Friedrich and V. F. Mautner, Loss of NF1 allele in Schwann cells but not in fibroblasts derived from an NF1-associated neurofibroma. Genes Chromosomes Cancer, 1999. 24(3): p. 283-5. [68] Rutkowski, J. L., et al., Genetic and cellular defects contributing to benign tumor formation in neurofibromatosis type 1. Hum. Mol. Genet., 2000. 9(7): p. 1059-66. [69] Serra, E., et al., Schwann cells harbor the somatic NF1 mutation in neurofibromas: evidence of two different Schwann cell subpopulations. Hum. Mol. Genet., 2000. 9(20): p. 3055-64. [70] Knudson, A. G., Jr., Mutation and cancer: statistical study of retinoblastoma. Proc. Natl. Acad. Sci. US, 1971. 68(4): p. 820-3. [71] Legius, E., et al., Somatic deletion of the neurofibromatosis type 1 gene in a neurofibrosarcoma supports a tumour suppressor gene hypothesis. Nat. Genet., 1993. 3(2): p. 122-6. [72] Shannon, K. M., et al., Loss of the normal NF1 allele from the bone marrow of children with type 1 neurofibromatosis and malignant myeloid disorders. N Engl. J. Med., 1994. 330(9): p. 597-601. [73] Maertens, O., et al., Comprehensive NF1 screening on cultured Schwann cells from neurofibromas. Hum. Mutat., 2006. 27(10): p. 1030-40. [74] De Raedt, T., et al., Somatic loss of wild type NF1 allele in neurofibromas: Comparison of NF1 microdeletion and non-microdeletion patients. Genes Chromosomes Cancer, 2006. 45(10): p. 893-904. [75] Vortmeyer, A. O., et al., Somatic point mutation of the wild-type allele detected in tumors of patients with VHL germline deletion. Oncogene, 2002. 21(8): p. 1167-70. [76] Whitcup, S. M., et al., Use of microdissection and molecular genetics in the pathologic diagnosis of retinoblastoma. Retina, 1999. 19(4): p. 318-24. [77] Xing, E. P., et al., Loss of heterozygosity of the Rb gene correlates with pRb protein expression and associates with p53 alteration in human esophageal cancer. Clin. Cancer Res., 1999. 5(5): p. 1231-40. [78] Kobayashi, C., et al., Aberrant expression of CHFR in malignant peripheral nerve sheath tumors. Mod. Pathol., 2006. 19(4): p. 524-32. [79] Muram-Zborovski, T. M., et al., SPRED 1 mutations in a neurofibromatosis clinic. J. Child Neurol., 2010. 25(10): p. 1203-9. [80] Menko, F. H., et al., A homozygous MSH6 mutation in a child with cafe-au-lait spots, oligodendroglioma and rectal cancer. Fam. Cancer, 2004. 3(2): p. 123-7. [81] Ostergaard, J. R., L. Sunde and H. Okkels, Neurofibromatosis von Recklinghausen type I phenotype and early onset of cancers in siblings compound heterozygous for mutations in MSH6. Am. J. Med. Genet. A, 2005. 139A(2): p. 96-105; discussion 96.

Molecular Pathogenesis of Neurofibromatosis Type 1

2297

[82] Easton, D. F., et al., An analysis of variation in expression of neurofibromatosis (NF) type 1 (NF1): evidence for modifying genes. Am. J. Hum. Genet., 1993. 53(2): p. 30513. [83] Sabbagh, A., et al., Unravelling the genetic basis of variable clinical expression in neurofibromatosis 1. Hum. Mol. Genet., 2009. 18(15): p. 2768-78. [84] Szudek, J., H. Joe and J. M. Friedman, Analysis of intrafamilial phenotypic variation in neurofibromatosis 1 (NF1). Genet. Epidemiol., 2002. 23(2): p. 150-64. [85] Kayes, L. M., et al., Deletions spanning the neurofibromatosis 1 gene: identification and phenotype of five patients. Am. J. Hum. Genet., 1994. 54(3): p. 424-36. [86] Upadhyaya, M., et al., An absence of cutaneous neurofibromas associated with a 3-bp inframe deletion in exon 17 of the NF1 gene (c.2970-2972 delAAT): evidence of a clinically significant NF1 genotype-phenotype correlation. Am. J. Hum. Genet., 2007. 80 (1): p. 140-51. [87] Kalamarides, M., et al., Neurofibromatosis 2011: a report of the Children's Tumor Foundation annual meeting. Acta Neuropathol. 123(3): p. 369-80. [88] Nishi, T., et al., Differential expression of two types of the neurofibromatosis type 1 (NF1) gene transcripts related to neuronal differentiation. Oncogene, 1991. 6(9): p. 15559. [89] Suzuki, Y., et al., Brain tumors predominantly express the neurofibromatosis type 1 gene transcripts containing the 63 base insert in the region coding for GTPase activating protein-related domain. Biochem. Biophys. Res. Commun., 1991. 181(3): p. 955-61. [90] Malhotra, R. and N. Ratner, Localization of neurofibromin to keratinocytes and melanocytes in developing rat and human skin. J. Invest. Dermatol., 1994. 102(5): p. 812-8. [91] Xu, G. F., et al., The neurofibromatosis type 1 gene encodes a protein related to GAP. Cell, 1990. 62(3): p. 599-608. [92] Basu, T. N., et al., Aberrant regulation of ras proteins in malignant tumour cells from type 1 neurofibromatosis patients. Nature, 1992. 356(6371): p. 713-5. [93] Sherman, L. S., et al., Single cell Ras-GTP analysis reveals altered Ras activity in a subpopulation of neurofibroma Schwann cells but not fibroblasts. J. Biol. Chem., 2000. 275(39): p. 30740-5. [94] Cichowski, K., et al., Dynamic regulation of the Ras pathway via proteolysis of the NF1 tumor suppressor. Genes Dev., 2003. 17(4): p. 449-54. [95] McGillicuddy, L. T., et al., Proteasomal and genetic inactivation of the NF1 tumor suppressor in gliomagenesis. Cancer Cell, 2009. 16(1): p. 44-54. [96] DeClue, J. E., et al., Abnormal regulation of mammalian p21ras contributes to malignant tumor growth in von Recklinghausen (type 1) neurofibromatosis. Cell, 1992. 69(2): p. 265-73. [97] Yang, F. C., et al., Nf1+/- mast cells induce neurofibroma like phenotypes through secreted TGF-beta signaling. Hum. Mol. Genet., 2006. 15(16): p. 2421-37. [98] Guo, H. F., et al., Requirement of Drosophila NF1 for activation of adenylyl cyclase by PACAP38-like neuropeptides. Science, 1997. 276(5313): p. 795-8. [99] The, I., et al., Rescue of a Drosophila NF1 mutant phenotype by protein kinase A. Science, 1997. 276(5313): p. 791-4. [100] Tong, J., et al., Neurofibromin regulates G protein-stimulated adenylyl cyclase activity. Nat. Neurosci., 2002. 5(2): p. 95-6.

2298

Ming-Jen Lee, Alton Etheridge, David J. Galas et al.

[101] Dasgupta, B., L. L. Dugan and D. H. Gutmann, The neurofibromatosis 1 gene product neurofibromin regulates pituitary adenylate cyclase-activating polypeptide-mediated signaling in astrocytes. J. Neurosci., 2003. 23(26): p. 8949-54. [102] Harashima, T., et al., The kelch proteins Gpb1 and Gpb2 inhibit Ras activity via association with the yeast RasGAP neurofibromin homologs Ira1 and Ira2. Mol. Cell, 2006. 22(6): p. 819-30. [103] Dasgupta, B., et al., Proteomic analysis reveals hyperactivation of the mammalian target of rapamycin pathway in neurofibromatosis 1-associated human and mouse brain tumors. Cancer Res., 2005. 65(7): p. 2755-60. [104] Johannessen, C. M., et al., The NF1 tumor suppressor critically regulates TSC2 and mTOR. Proc. Natl. Acad. Sci. US, 2005. 102(24): p. 8573-8. [105] Garami, A., et al., Insulin activation of Rheb, a mediator of mTOR/S6K/4E-BP signaling, is inhibited by TSC1 and 2. Mol. Cell, 2003. 11(6): p. 1457-66. [106] Tee, A. R., et al., Tuberous sclerosis complex gene products, Tuberin and Hamartin, control mTOR signaling by acting as a GTPase-activating protein complex toward Rheb. Curr. Biol., 2003. 13(15): p. 1259-68. [107] Johansson, G., et al., Effective in vivo targeting of the mammalian target of rapamycin pathway in malignant peripheral nerve sheath tumors. Mol. Cancer Ther., 2008. 7(5): p. 1237-45. [108] Cho, J. H., et al., Systems biology of interstitial lung diseases: integration of mRNA and microRNA expression changes. BMC Med. Genomics. 4: p. 8. [109] Hwang, D., et al., A systems approach to prion disease. Mol. Syst. Biol., 2009. 5: p. 252. [110] Moussay, E., et al., MicroRNA as biomarkers and regulators in B-cell chronic lymphocytic leukemia. Proc. Natl. Acad. Sci. US. 108(16): p. 6573-8. [111] Ezzie, M. E., et al., Gene expression networks in COPD: microRNA and mRNA regulation. Thorax. 67(2): p. 122-31. [112] Subramanian, S., et al., Genome-wide transcriptome analyses reveal p53 inactivation mediated loss of miR-34a expression in malignant peripheral nerve sheath tumours. The Journal of pathology, 2010. 220(1): p. 58-70. [113] Chang, T. C., et al., Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Molecular cell, 2007. 26(5): p. 745-52. [114] Lee, M. J., et al., The systems biology of neurofibromatosis type 1--critical roles for microRNA. Experimental neurology, 2012. 235(2): p. 464-8. [115] Huson, S. M., et al., Back to the future: Proceedings from the 2010 NF Conference. Am. J. Med. Genet. A, 2010. [116] Widemann, B. C., et al., Phase I trial and pharmacokinetic study of the farnesyltransferase inhibitor tipifarnib in children with refractory solid tumors or neurofibromatosis type I and plexiform neurofibromas. J. Clin. Oncol., 2006. 24(3): p. 507-16. [117] Van Rossum, H. H., et al., Everolimus and sirolimus antagonize tacrolimus based calcineurin inhibition via competition for FK-binding protein 12. Biochem. Pharmacol., 2009. 77(7): p. 1206-12. [118] Babovic-Vuksanovic, D., et al., Phase II trial of pirfenidone in adults with neurofibromatosis type 1. Neurology, 2006. 67(10): p. 1860-2. [119] Rosser, T. L. and R. J. Packer, Neurocognitive dysfunction in children with neurofibromatosis type 1. Curr. Neurol. Neurosci. Rep., 2003. 3(2): p. 129-36.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 107

IMAGING OF PLEXIFORM NEUROFIBROMAS IN NEUROFIBROMATOSIS TYPE 1 Eva Dombi1, Nicholas Patronas2 and Brigitte Widemann1 1

National Cancer Institute, Pediatric Oncology Branch, National Institutes of Health, Bethesda, MD, US 2 Department of Radiology, Center for Cancer Research, National Institutes of Health, Bethesda, MD, US

ABSTRACT This chapter describes the radiographic appearance and distribution of plexiform neurofibromas (PNs) in NF1. Although PNs are histologically benign tumors, they are the source of significant morbidity including disfigurement, pain, functional impairment and they can undergo malignant transformation. Identifying targeted agents that slow the growth or decrease the size of PNs is an area of intense research. Volumetric MRI analysis of PNs is helpful in detecting treatment response and progression in these large and complex shaped tumors with greater sensitivity compared to 1-dimensional or 2dimensional measurements.

INTRODUCTION Plexiform neurofibromas are benign nerve sheath tumors affecting multiple fascicles and branches of peripheral nerves. They can develop on any segment of the nerve from the nerve root to the nerve endings. The prevalence of PNs is estimated around 25% in NF1 patients [13]. There is no sex predilection. Deep internal PNs are common and may not be clinically apparent [4]. In one study whole body MRI of 65 consecutive pediatric NF1 patients identified 37 patients with PN (57%), only 16 of those patients (25%) had symptomatic tumors [5]. Most PNs present at a young age, may be congenital, and have a tendency to increase in size, especially in early childhood [6]. Significant PN growth in adults is unusual. Overall tumor burden does not always correlate with clinical symptoms, but rapidly growing lesions are more

2300

Eva Dombi, Nicholas Patronas and Brigitte Widemann

likely to become symptomatic. Complete surgical removal is rarely achievable and regrowth after surgery is common. Multiple medical treatment options are currently tested in clinical trials. The goal of this chapter is to illustrate the heterogeneity and complexity of these tumors.

IMAGING APPEARANCE OF PLEXIFORM NEUROFIBROMAS On CT images, PNs present as low attenuation masses and appear hypodense relative to muscle. On post contrast CT scans, PNs enhance only faintly. MRI is the preferred imaging modality for the evaluation of PN burden. On the T1-weighted images (Figure 1A), large PNs demonstrate homogeneous low signal intensity, but smaller tumors can be isointense to muscles. On T2-weighted images PNs are hyperintense with signal intensity similar to or slightly higher than fatty tissue [7, 8]. The pulse sequence known as short TI inversion recovery (STIR) accentuates the long T2 value of the tumors while it provides fat suppression of the surrounding tissues. This technique allows clear separation of PNs from the adjacent tissues and therefore it is uniquely suitable for automatic tissue segmentation and volumetric analysis of these tumors. On the post contrast scans, peripheral PNs show a variable degree and often heterogeneous enhancement which depends on size and vascularity (Figure 1C). The extent of nerve overgrowth varies among patients. Mild segmental nerve enlargement can appear as string of beads alongside the normal distribution of the peripheral nerve (Figure 2A). Around larger solitary nodes the normal rim of fat layer is preserved (split fat sign) and the entering and exiting nerve can be seen centrally to the node. Massive overgrowth of a large segment of the nerve imparts a rope-like appearance (Figure 2B).

Figure 1. MRI characteristics of PN. Axial T1-weighted image of the chest (A) shows a homogeneous low signal intensity mass. On T2-weighted fat suppressed images (B) the mass appears multinodular with peripheral hyperintensity and central hypointensity of the nodes (target sign). On T1 post-contrast images (C) gadolinium enhancement is variable.

Imaging of Plexiform Neurofibromas in Neurofibromatosis Type 1

2301

Figure 2. PN distribution. Coronal whole body STIR MR images demonstrate high PN burden in three patients. Case 1: (A) 14 year-old female diagnosed with NF1 at the age of 2 years when she was noted to have a neurofibroma on her scalp. Widespread nodular enlargement of peripheral nerves can be seen on the MRI. Her total PN volume measured by volumetric MRI is 2268 ml, accounting for 5.8% of her body weight. Case 2: (B) 34 year-old male diagnosed with NF1 when he suffered a sports injury as a high school athlete and found to have massive PN burden along his sciatic nerves and lumbosacral spine. He developed cervical cord compression at age 28 that required extensive decompression surgery. He has developed progressive weakness, requires wheelchair assistance, and suffers from chronic neuropathic pain. His whole body tumor burden is 6931 ml, 8.3% of his body weight. Case 3: (C) 13 year-old male with large paraspinal PN that extends to of the left thigh and diffusely infiltrates the thigh muscles. Note the leg length discrepancy and scoliosis of the lumbosacral spine. His whole body tumor burden is 3304 ml, 11.2% of his body weight.

Multiple tumors originating from adjacent nerve branches can form large conglomerate multinodular masses (Figure 2C). The center of each individual nodule contains densely packed collagen fibers and has lower signal intensity on T2-weighted and STIR images while the periphery of the tumor contains less organized myxoid intracellular matrix and appears hyperintense. The combined effect of the central hypointensity with the peripheral hyperintese region has been described as the target sign, or central dot sign and is a unique feature of PNs (Figure 1B). The target sign can also be appreciated on CT and ultrasound [9]. Most PNs display pronounced vascularity.

Plexiform Neurofibroma Types On large nerves, the epineurium is preserved and fully encapsulates the tumor (displacing tumor type) (Figure 3A). Neurofibromas arising from smaller nerves are locally invasive and extend into the surrounding tissues (infiltrative tumor type) (Figure 3B-E).

2302

Eva Dombi, Nicholas Patronas and Brigitte Widemann

Figure 3. PN types. Imaging characteristics and variety of PN types on axial STIR MR images of the upper neck in 6 different patients. Panel A shows a fully encapsulated displacing multi-lobular tumor. The larger nodes appear heterogeneously hyperintense while the smaller nodes display the characteristic target sign. On panel B the nerve involvement is more peripheral, the nodes are smaller and interlock with the surrounding muscles. The bright signal in the overlaying skin indicates diffuse infiltration of the skin. The PN shown on panel C appears coarsely granular and infiltrative, involving mostly the muscle layer. On panel D a similar tumor is seen invading the skin, subcutaneous fat as well as facial muscles. Panel E shows a PN with a superficial and a highly vascular deep component. Panel F shows a diffuse superficial PN.

Superficial PNs are diffuse, infiltrative tumors involving the upper layers of skin or subcutaneous fat layer (Figure 3F) [7]. Some patients have a predilection for displacing or infiltrative tumor types, while others exhibit mixed features.

Volumetric Analysis The size of PNs can range from small to very large, span a few centimeters or the full height of the patient. Most PNs have irregular, complex shape and assessing change over time with line measurements used in the response evaluation of solid malignant tumors is challenging [10-12]. Volumetric MRI analysis allows to sensitively and reproducibly determine small changes in PN size that would be impossible to quantify with conventional response criteria. There is a concerted effort (REiNS, Response Evaluation in Neurofibromatosis and Schwannomatosis) to standardize response criteria on clinical trials for NF1 and other related disorders.

Imaging of Plexiform Neurofibromas in Neurofibromatosis Type 1

2303

Figure 4. Volumetric MRI analysis of PNs. An outline is generated for every MRI slice that shows PN. The area within the border multiplied by the slice thickness gives the PN volume.

One of the recommendations from the REiNS group is the implementation of volumetric MRI analysis to measure PN size. Different tumor segmentation programs are now available [13-15]. Response evaluation on most clinical trials for PN to date is based on a semi-automatic lesion detection method developed on the MEDx platform [15]. On STIR MR images the bright tumor is separated from the surrounding normal tissue based on signal intensity histogram analysis. The resulting outline is projected over the original image for review (Figure 4). This method has been validated and used successfully in prior and ongoing clinical trials for PNs [16, 17] and also to study the growth behavior and natural history of these tumors [6]. Even with sensitive measurement methods size change is rarely detected within a few months and imaging intervals on clinical trials can be as long as 3-6 months, particularly when the goal of the trial is to increase time to disease progression.

Cranial Nerves Among the cranial nerves PNs most often affect the trigeminal, glossopharyngeal and vagal nerves. Tumors of the trigeminal nerve can originate from the main trunk in the prepontine cistern or from one of its three branches within the cavernous sinus often causing expansion of this sinus (Figure 5A-B). Unlike other space occupying processes of the cavernous sinus, the slow growing PNs rarely result in overt symptoms. Tumors of the V1 branch can enter the orbit through the superior orbital fissure, leading to the remodeling of the bony structure. Intraorbital PNs of the V1 branch can compress the optic nerve resulting in visual loss. They also commonly produce proptosis of the globe (Figure 5C-D). Sphenoid wing dysplasia can be present with or without PN. Neurofibromas originating from the V2 or V3 branch of the trigeminal nerve may extend into the pterygopalatine fossa or into the soft tissues of the nasopharynx. The V2 and V3 peripheral branches give rise to tumors in the maxillary or mandibular region. They often involve the tongue, gums and salivary glands. Facial PNs originating from the trigeminal nerve are almost always diffuse, highly invasive and prominently vascular.

2304

Eva Dombi, Nicholas Patronas and Brigitte Widemann

Figure 5. Cranial nerve PNs. Case 4: (A, B) 7 year-old female. At birth protuberance of the left eye was noted leading to the diagnosis of NF1 and orbital PN. Her left face became increasingly disfigured. She underwent a partial resection of the tumor at age 5. She has no vision in her left eye and complains of frequent headaches. Coronal (A) and axial (B) STIR MR images through the orbit show a nodular, invasive PN in the inferior aspect of the orbit and facial muscles. Note the marked expansion of the cavernous sinus (arrow). Total volume of the mass is 162 ml. Case 5: (C, D) 13 year-old male with family history of NF1. At birth only a slight fullness around the left eye was noted, but soon the size of his orbital PN increased and he underwent multiple debulking surgeries by age 3. In addition to the orbital lesion he has asymptomatic deep abdominal and paraspinal PNs. His total tumor burden at age 3 was 269 ml that increased to 800 ml currently, about 29% increase in volume per year. MRI shows a diffuse infiltrative PN of the orbit and deep structures of the face with nodular components in the temporal area. The associated sphenoid wing dysplasia is better appreciated on CT (not shown). Case 6: (E, F) 8 year-old female, diagnosed with NF1 at 15 months of age based on skin findings. Right facial swelling was noted at 18 months. Her PN is confined within the parotid gland. The tumor is associated with mandibular remodeling, temporo-mandibular joint asymmetry, malposition of the lower molars, an open bite and asymmetric smile. She has mild conductive low-frequency hearing loss in the right ear due to narrowing of the external auditory canal. Although the tumor is relatively small, 42 ml, it profoundly impacts her quality of life.

They are often associated with varying degrees of cosmetic deformity and functional impairment. Neurofibromas of the facial nerve are rare; some arise within the petrous bone or the facial canal. PNs of the intracanalicular segment can compress the eighth nerve and clinically present with hearing loss or dizziness. When the origin is at the geniculate ganglion PNs cause bone destruction and project into the middle cranial fossa as an extraaxial mass. Neurofibromas of cranial nerve VII have also been described within the parotid gland (Figure 5E-F) arising from the parotid plexus [18]. Facial nerve injury and paralysis most often develops secondary to surgical procedures. The 9th and 10th nerve can give rise to periauricular, retropharyngeal, occipital and neck masses.

Imaging of Plexiform Neurofibromas in Neurofibromatosis Type 1

2305

Spinal Nerves Neurofibromas of the spinal canal can be intradural, extradural or both. The intradural tumors are most often found in the cervical and in the lumbar canal. These tumors are best shown on post contrast T1-weighted scans where they show intense enhancement. The intradural tumors, spinal cord and cerebrospinal fluid are also well visualized using Balanced Fast Field Echo (BFFE) technique (Figure 8). They are rounded or fusiform in configuration and, depending on their size, and deform or compress the spinal cord (Figure 6A–C).

Figure 6. Spinal neurofibromas. Case 7: (A, B, C) 40 year-old female with long-standing history of NF1 who presented with right-sided shoulder pain. Coronal (A), axial STIR (B) and sagittal T2-weighted images (C) of the cervical spine show an intradural neurofibroma on the right at C5/6 level that occupies more than 50% of the canal and displaces the cord to the left. Additional smaller intraforaminal neurofibromas and scattered subcutaneous neurofibromas are also present. Case 8: (D, E, F) 15 year-old male diagnosed with NF1 at a young age. His spinal neurofibromas first manifested at the age of 13 years. The MRI shows large bilateral dumbbell lesions at virtually every nerve root with severe cord compression at C2-5 level resulting in pancake like flattening of the spinal cord. After repeated decompression surgeries he developed swan-neck deformity. Now at age 22 he has limited mobility of the neck, but otherwise good performance status. Case 9: (G, H, I) 5 year-old male diagnosed with NF1 at 6 weeks of age based on multiple cafe-au-lait macules. Increase in the circumference of the left upper arm was first noted at age 1. An MRI obtained at that time showed a large left brachial plexus PN with extension into the left hemithorax. Between age 3 and 5 his PN volume increased more than 3-fold from 498 ml to 1513 ml. The MRI shows a large nodular, fascicular PN extending to the upper arm.

2306

Eva Dombi, Nicholas Patronas and Brigitte Widemann

Figure 7. Spine deformities associated with PNs. Case 10: (A) 9 year-old male with multiple paraspinal neurofibromas. Enlargement of the neural foramina is seen on the sagittal T2-weighted MR image of the spine at T2-T6 level. Case 11: (B) 4 year-old male with dural ectasia and scalloping of the thoracic and lumbar vertebrae. Case 12: (C) 5 year-old male with large neck PN and history of cord compression. He developed swan neck deformity after multiple laminectomies.

Figure 8. Evaluation of spinal neurofibromas. On axial T2-weighted MR image of the cervical spine (A) the relationship between the spinal cord and C5/6 nerve root is obscured by cerebrospinal fluid (CSF) flow-related signal loss. Balanced Fast Field Echo (BFFE) sequence (B) shows clear definition of the CSF space, spinal cord and extradural neurofibroma on the left side.

Mild spinal cord compression by small tumors can be asymptomatic, while large tumors often produce myelopathy requiring surgical intervention. Extradural tumors are usually located within the neural foramina and often project into the spinal canal causing variable degree of spinal canal stenosis. They are best evaluated by post contrast T1-weighted technique with or without fat suppression. Since they are slowly growing, these tumors tend to gradually erode the bone and produce enlargement of the neural foramina (Figure 7A) and scalloping of the adjacent vertebral body (Figure 7B). Because of the tight confines of the neural foramina, neurofibromas in this location typically assume a dumbbell shape. Spinal cord compression can also occur by extradural tumors, particularly when they happen to be in two neural foramina at the same level and have acquired significant size to project within the spinal canal on both sides (Figure 6D-F). Compression of the spinal cord, either by intradural or extradural tumors, is often accompanied by abnormal signal changes within the cord parenchyma as a result of edema. Cord signal changes that are secondary to edema are reversible after surgical resection

Imaging of Plexiform Neurofibromas in Neurofibromatosis Type 1

2307

of the tumor and decompression of the cord. Chronic edema however usually leads to alteration of myelin, resulting in myelomalacia that is not reversible and clinically presents with chronic myelopathy. Careful serial neurological evaluation is particularly important in patients with spinal cord compression since development of neurologic deficits can occur with minimal or absent visible changes on imaging studies and may require prompt surgical intervention. Tumor regrowth after surgery occurs frequently and may require multiple revisions. Extensive laminectomies carry the risk of spinal instability that is compounded by NF1 related primary bony dysplasia and manifests as progressive scoliosis, kyphoscoliosis or in most severe form swan-neck deformity of the cervical spine (Figure 7C). Many patients require spine stabilization with metal implants. With current imaging technology, metal artifacts from those implants make radiological evaluation of the spine challenging. The use of titanium reduces this artifact. Enlargement of spinal nerve roots beyond the neural foramina can present as round solitary, fusiform or multilobular masses in the paraspinal soft tissues. In some cases, tumors of the brachial and lumbosacral plexus form giant masses that extend to the extremity and may cause overgrowth of the affected limb (Figure 6G–I). The neurofibromas in the paraspinal regions are best evaluated by STIR MRI technique.

Neck, Mediastinum, Chest Paraspinal neurofibromas in the thoracic area tend to be less bulky than cervical and lumbosacral tumors, they are most often displacing although invasion into the paraspinal muscles can occur (unpublished observation).

Figure 9. Neck and chest PNs. Case 13: (A, B) 15 year-old male, diagnosed with NF1 at age 10, based on skin findings including subcutaneous neurofibromas. The peripheral nerves throughout his body are enlarged; his whole body tumor burden is 4630 ml, 7.9% of his body weight. The coronal and axial MR images of the chest highlight the thickening of intercostal nerves. Case 14: (C, D) 10 year-old female, diagnosed with NF1 at 18 months of age. A large PN is seen along the descending aorta in the mediastinum and abdomen. She has severe scoliosis and chest deformity resulting in restrictive lung disease. Her brachial plexus PN causes pain in the left axilla and arm. The volume of her tumor is 1175 ml, increased from 263 ml at age 4, at a rate of 75% per year. Case 15: (E, F) 3 year-old male with neck and chest PN and severe airway compression requiring tracheostomy.

2308

Eva Dombi, Nicholas Patronas and Brigitte Widemann

Tumors growing along the intercostal nerves (Figure 9A,B) can erode the lower edge of the ribs (ribbon ribs). Mediastinal tumors originate from the vagal nerve or the sympathetic chain (Figure 9C,D). They can be extreme in size, are mostly diffuse, and may cause airway compromise (Figure 9E,F, 10A,B) or swallowing difficulties.

Abdomen, Pelvis PNs of the autonomic plexus are mostly retroperitoneal [19], some may extend into the mesentery alongside the mesenteric vessels (Figure 11A,B) or more rarely into the liver through the portal system (Figure 11C,D). Bowel obstruction is a rare, but serious complication. Diffuse pelvic tumors can invade the muscle layer of the bladder and cause urinary obstruction (Figure 11E,F) in particular at the vesicoureteric junction. The dense neural network of the uterine wall or the soft tissues of perineum can also give rise to PNs in that area. Tumors of the lumbosacral plexus can be unilateral (Figure 12A,B) or bilateral (Figure 12C,D), and may cause erosive changes to the spine. The concurrent scoliosis can be severe. PN expansion into the paraspinal, iliopsoas, abdominal wall and gluteal musculature is common (Figure 12E,F). Involvement of the sciatic nerve is more frequent than the femoral nerve.

Malignant Peripheral Nerve Sheath Tumors (MPNSTs) Malignant peripheral nerve sheath tumors are aggressive soft tissue sarcomas with poor prognosis. Rarely seen in the general population, about half the cases are diagnosed in patients with NF1. The lifetime risk of MPNST in NF1 is 8-13% (20, 21). That risk is further elevated if the patient received radiation therapy for optic glioma or other malignancy. The 5-year survival with combination therapy is 21-52% and appears to be worse for individuals with NF1 associated versus sporadic MPNSTs [20, 22-24].

Figure 10. Tracheomalacia. Case 16: 16 year-old male with severe tracheomalacia as a result of a large neck and chest PN. CT of the chest during inspiration (A) shows mild narrowing of the airway (crosssectional area 1.2 cm2). In expiration phase (B) the narrowing becomes severe (0.2 cm2). He underwent a Y stent placement in the distal trachea that temporarily relieved the symptoms of respiratory distress. He died of probable cardiac arrest a year later.

Imaging of Plexiform Neurofibromas in Neurofibromatosis Type 1

2309

Figure 11. Abdomino-pelvic PNs of the autonomous nervous system. Case 17: (A, B) 8 year-old female. Multiple areas of skin hyperpigmentation were noted at birth; on the right chest wall one large patch of the hyperpigmentation was associated with roughening of the skin indicating a superficial PN. In addition to the PN in the paraspinal muscles and subcutaneous tissues of the back she also has a large retroperitoneal lesion originating from the sympathetic chain. The PN encases the descending aorta, celiac artery, superior mesenteric artery and renal arteries. Case 18: (C, D) 10 year-old female with family history of NF1. She complains of intermittent abdominal pain since age five; her height and weight are around the 10th percentile. The MRI reveals a PN around the porta hepatis and expanding along the biliary system. The size of the PN has not changed significantly within the past 5 years and she maintains normal liver function. Case 19: (E, F) 3 year-old female, multiple café-au-lait macules were noted at birth raising the suspicion of NF1. The large pelvic PN was discovered at age 1 confirming the NF1 diagnosis. The PN surrounds the bowels and invades the bladder wall causing urinary obstruction. She subsequently underwent ureterostomy and the hydronephrosis resolved. Additional neurofibromas fill the lumbosacral thecal sac, expand the spinal canal, the sacral neuroforamina and infiltrate the gluteal muscles. Between age 3 and 8 the volume of her PNs increased from 808 ml to 3685 ml, more than 90% volume change per year.

In the setting of NF1, most MPNSTs (65-88%) arise in preexisting PNs [20, 25-27] and can be large, invasive or metastatic at diagnosis [22]. Patents with high PN burden may be at higher risk for MPNST [28, 29]. The goal of surveillance is early detection with the hope of curative surgery, which requires complete resection of the MPNST. The most predictable clinical sign of malignant degeneration is new or increasing pain. The pain can present locally at the site of disease, radiate along the affected nerve or project distally from the lesion. The imaging field should be selected to include the entire nerve from the site of pain to the matching nerve root. Numbness, paresthesia, weakness, other functional deficits, change in consistency on palpation or swelling are also common. Change in size, especially if it is focal and out of proportion to the rest of the PN is concerning. Volumetric MRI analysis allows to accurately establish the tumor growth rate and detect accelerating growth sooner compared to line measurements.

2310

Eva Dombi, Nicholas Patronas and Brigitte Widemann

Figure 12. Lumbosacral PNs. Case 20: (A, B) 6 year-old male with family history of NF1. The coronal (A) and axial (B) STIR MR images demonstrate a right-sided lumbosacral and pelvic PN. His tumor first became symptomatic at age 3. He started to turn the right leg outward and his ankle collapsed. Currently he walks with a lower leg brace and requires regular pain medication. Case 21: (C, D) 11 year-old male diagnosed with NF1 in early infancy. By age 5 he was complaining of pain in his legs when walking. His current symptoms include lower extremity weakness that prevents him from bending the knees and severe radiating pain in the back of the legs that he rates 8 out of 10. The MRI shows bilateral paraspinal and deep pelvic PNs. Case 22: (E, F) 7 year-old male with extreme tumor burden; the 5629 ml PN accounts for more than 25% of his body weight. The muscles are atrophied on both lower extremities and he is unable to walk. The bulky gluteal mass makes sitting in the wheelchair uncomfortable and the family is considering amputation.

Other imaging signs that indicate malignant transformation (Figure 13) include changes in the characteristics in some part of the PN, such as disappearance of the target sign, inhomogeneity, patchy contrast enhancement, intra-tumor hemorrhage, necrosis or edema. None of these signs are specific enough to reliably separate MPNST from a PN. The usefulness of 18F-fluorodeoxyglucose positron emission tomography (FDG-PET) in the detection of MPNSTs has been extensively studied [30-32]. Maximum FDG uptake in benign neurofibromas is generally below 2.0 g/mL, while high grade MPNSTs demonstrate FDG uptake consistently above 3.5 g/mL. However above-background focal uptake can be present in histologically confirmed benign neurofibromas. Therefore, selecting a single diagnostic cutoff that is unequivocal for MPNST is not possible [33]. Diagnostic specificity may be increased with delayed imaging, performed 4 hours after FDG injection. Further increase in uptake on delayed imaging is suggestive of a malignant lesion [32]. FDG-PET is a helpful tool to identify concerning areas in a patient with high PN burden and can be used as a guide to targeted biopsy (Figure 14). Benign lesions with increased FDG uptake, especially those that show cellular atypia, should be closely monitored. There is evidence that atypical neurofibromas harbor chromosomal aberrations reminiscent of MPNST and therefore can be considered premalignant tumors [34].

Imaging of Plexiform Neurofibromas in Neurofibromatosis Type 1

2311

Figure 13. MPNST. Case 23: (A, B, C) 15 year-old male, diagnosed with NF1 and a neck PN at age 7. Axial (A) and coronal (B) STIR MR images show a right brachial plexus tumor, with nodules displaying the characteristic target sign at the periphery and a distinct homogeneous area in the center. The area where the target sign is lost (arrow) corresponds to high grade MPNST within the PN. The tumor was unresectable at diagnosis. Despite intensive chemotherapy the patient had rapid progression (C) and died of the disease 14 months after diagnosis. Case 24: (D, E, F) 15 year-old male, with long standing history of NF1 and large PN burden. He complained of a fast growing painful node in his right buttock. The fat suppressed T1 post contrast MR image (D) shows avid enhancement at the periphery of the nodule (arrow). On STIR sequence (E) the lesion shows inhomogeneous bright signal and there is edema in the surrounding tissues. Biopsy confirmed a low grade MPNST; the lesion was resected with negative margins. One year after surgery there was no sign of recurrence (F), and four years after diagnosis the patient is alive with no evidence of malignancy. Case 25: (G, H, I) 20 year-old male, diagnosed with NF1 in infancy. Persistent lower back pain prompted the MRI that revealed multiple dumbbell lesions and an 8 cm left paraspinal mass eroding the L1 vertebral body (arrow). On T1 post contrast images (G) his tumors show avid enhancement with some inhomogeneity within the larger node. On T2-weighted images (H) the large node displays variable high signal intensity. CT of the spine demonstrates bony erosion without sclerotic rim (I) suggestive of a fast growing tumor. Histology of the completely resected lesion was consistent with low grade MPNST. Four years after surgery the patient is alive with no evidence of malignancy.

Surgical removal of these lesions should be considered, if feasible without untoward morbidity. FDG-PET may also have a role in detecting treatment response and as a prognostic tool for long-term survival in NF1 patients with MPNST [35]. It remains to be seen whether

2312

Eva Dombi, Nicholas Patronas and Brigitte Widemann

alternative PET tracers, for example 18F-fluoro-L-thymidine (FLT) that localizes to sites of high cell proliferation, better differentiate benign from malignant nerve sheath tumors.

Figure 14. FDG-PET imaging. Case 26: 24 year old female with family history of NF1 and large PN burden involving all the major nerves (A). At age 14 she developed a low grade MPNST in the right calf, underwent surgical resection of the tumor followed by radiotherapy. 4 years later she was found to have a high grade MPNST in the right sacral/ischial area; after complete resection she received adjuvant chemotherapy and radiation. She is at high risk of recurrence and is closely followed by MRI and yearly PET scans. The FDG uptake in the majority of her benign tumors is similar to background, however several areas of increased uptake are noted (C), SUV 1.9 g/mL in right thigh, 4.0 g/mL in right iliac fossa, 3.6 g/mL in left flank, corresponding to circumscribed nodules within the PNs (B). The size, imaging appearance and PET avidity of these lesions has been stable in the past 6 years.

CONCLUSION PNs are the second most frequently diagnosed NF1-associated tumors after dermal neurofibromas. PNs involve multiple nerve branches, tend to be large, and often have a complex shape. PNs are best imaged by MRI. On STIR sequences the clear separation of high signal intensity tumor from the surrounding low signal intensity normal tissue allows for automatic tissue segmentation and volume measurement. Volumetric analysis helps to assess the overall tumor burden that can range from a few milliliters to several liters. In one of the above examples PNs account for 25% of the patient’s body weight. Over time volumetric analysis can detect small incremental changes in PN size. Fast growing PNs can as much as double in volume within a year; typically PNs grow more slowly or remain stable for prolonged time periods. Other than young age we do not know what influences PN growth rates. Growth behavior may

Imaging of Plexiform Neurofibromas in Neurofibromatosis Type 1

2313

depend on tumor type, location, size, vascularity, genetic background, hormone levels or environmental exposures. We hope to get better insight about these factors through our ongoing longitudinal natural history study. The extent of PN involvement often can’t be predicted from clinical exam. Screening for asymptomatic internal PNs is not recommended at this time due to the lack of effective treatment options. Recently published clinical trials show promise of identifying active medical treatments for PNs. Some of these therapies appear to be more effective in slowing the tumor growth rather than shrinking the tumors and therefore could be tested as preventive interventions before symptoms appear. The recommendation for screening may be reconsidered if prevention of PN growth proves to be feasible and safe. PNs have a high risk for malignant transformation and there is a need to develop better diagnostic tools for the early detection of MPNSTs.

REFERENCES [1]

Huson SM, Harper PS, Compston DA. Von Recklinghausen neurofibromatosis. A clinical and population study in south-east Wales. Brain: a journal of neurology. 1988;111 (Pt 6):1355-81. Epub 1988/12/01. [2] Friedman JM, Birch PH. Type 1 neurofibromatosis: a descriptive analysis of the disorder in 1,728 patients. American journal of medical genetics. 1997;70(2):138-43. Epub 1997/05/16. [3] Waggoner DJ, Towbin J, Gottesman G, Gutmann DH. Clinic-based study of plexiform neurofibromas in neurofibromatosis 1. American journal of medical genetics. 2000;92(2):132-5. Epub 2000/05/08. [4] Tonsgard JH, Kwak SM, Short MP, Dachman AH. CT imaging in adults with neurofibromatosis-1: frequent asymptomatic plexiform lesions. Neurology. 1998;50(6):1755-60. Epub 1998/06/20. [5] Nguyen R, Kluwe L, Fuensterer C, Kentsch M, Friedrich RE, Mautner VF. Plexiform neurofibromas in children with neurofibromatosis type 1: frequency and associated clinical deficits. The Journal of pediatrics. 2011;159(4):652-5 e2. Epub 2011/05/31. [6] Dombi E, Solomon J, Gillespie AJ, Fox E, Balis FM, Patronas N, et al. NF1 plexiform neurofibroma growth rate by volumetric MRI: relationship to age and body weight. Neurology. 2007;68(9):643-7. [7] Friedrich RE, Korf B, Funsterer C, Mautner VF. Growth type of plexiform neurofibromas in NF1 determined on magnetic resonance images. Anticancer research. 2003;23(2A):949-52. [8] Rodriguez D, Poussaint TY. Neuroimaging findings in neurofibromatosis type 1 and 2. Neuroimaging clinics of North America. 2004;14(2):149-+. [9] Lin J, Jacobson JA, Hayes CW. Sonographic target sign in neurofibromas. Journal of ultrasound in medicine: official journal of the American Institute of Ultrasound in Medicine. 1999;18(7):513-7. Epub 1999/07/10. [10] Miller AB, Hoogstraten B, Staquet M, Winkler A. Reporting results of cancer treatment. Cancer. 1981;47(1):207-14. Epub 1981/01/01.

2314

Eva Dombi, Nicholas Patronas and Brigitte Widemann

[11] Eisenhauer EA, Therasse P, Bogaerts J, Schwartz LH, Sargent D, Ford R, et al. New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur. J. Cancer. 2009;45(2):228-47. Epub 2008/12/23. [12] Sasaki T. [New guidelines to evaluate the response to treatment "RECIST"]. Gan to kagaku ryoho Cancer & chemotherapy. 2000;27(14):2179-84. Epub 2001/01/06. [13] Cai W, Kassarjian A, Bredella MA, Harris GJ, Yoshida H, Mautner VF, et al. Tumor burden in patients with neurofibromatosis types 1 and 2 and schwannomatosis: determination on whole-body MR images. Radiology. 2009;250(3):665-73. [14] Poussaint TY, Jaramillo D, Chang Y, Korf B. Interobserver reproducibility of volumetric MR imaging measurements of plexiform neurofibromas. AJR Am. J. Roentgenol. 2003;180(2):419-23. Epub 2003/01/24. [15] Solomon J, Warren K, Dombi E, Patronas N, Widemann B. Automated detection and volume measurement of plexiform neurofibromas in neurofibromatosis 1 using magnetic resonance imaging. Comput Med. Imaging Graph. 2004;28(5):257-65. [16] Widemann B, Babovic-Vuksanovic D, Dombi E, Goldman S, Goodspeed W, Goodwin A, et al., editors. Phase II trial of pirfenidone in children and young adults with neurofibromatosis type 1 (NF1) and progressive plexiform neurofibromas (PN). Children's Tumor Foundation; 2009; Portland, OR. [17] Widemann B, Dombi E, Gillespie A, Belasco J, Goldman S, Korf B, et al., editors. Phase II randomized, flexible cross-over, double-blinded, placebo-controlled trial of the farnesyltransferase inhibitor (FTI) tipifarnib (R115777) in pediatric patients (pts) with neurofibromatosis type 1 (NF1) and progressive plexiform neurofibromas (PN). Children's Tumor Foundation; 2009; Portland, OR. [18] McGuirt WF, Sr., Johnson PE, McGuirt WT. Intraparotid facial nerve neurofibromas. The Laryngoscope. 2003;113(1):82-4. Epub 2003/01/07. [19] Zacharia TT, Jaramillo D, Poussaint TY, Korf B. MR imaging of abdominopelvic involvement in neurofibromatosis type 1: a review of 43 patients. Pediatr Radiol. 2005;35(3):317-22. Epub 2004/11/02. [20] Ducatman BS, Scheithauer BW, Piepgras DG, Reiman HM, Ilstrup DM. Malignant peripheral nerve sheath tumors. A clinicopathologic study of 120 cases. Cancer. 1986;57(10):2006-21. [21] Evans DG, Baser ME, McGaughran J, Sharif S, Howard E, Moran A. Malignant peripheral nerve sheath tumours in neurofibromatosis 1. J. Med. Genet. 2002;39(5):3114. [22] Carli M, Ferrari A, Mattke A, Zanetti I, Casanova M, Bisogno G, et al. Pediatric malignant peripheral nerve sheath tumor: the Italian and German soft tissue sarcoma cooperative group. J. Clin. Oncol. 2005;23(33):8422-30. [23] deCou JM, Rao BN, Parham DM, Lobe TE, Bowman L, Pappo AS, et al. Malignant peripheral nerve sheath tumors: the St. Jude Children's Research Hospital experience. Ann. Surg. Oncol. 1995;2(6):524-9. [24] Wong WW, Hirose T, Scheithauer BW, Schild SE, Gunderson LL. Malignant peripheral nerve sheath tumor: analysis of treatment outcome. Int. J. Radiat. Oncol. Biol. Phys. 1998;42(2):351-60. [25] Hruban RH, Shiu MH, Senie RT, Woodruff JM. Malignant peripheral nerve sheath tumors of the buttock and lower extremity. A study of 43 cases. Cancer. 1990;66(6):1253-65.

Imaging of Plexiform Neurofibromas in Neurofibromatosis Type 1

2315

[26] Meis JM, Enzinger FM, Martz KL, Neal JA. Malignant peripheral nerve sheath tumors (malignant schwannomas) in children. Am. J. Surg. Pathol. 1992;16(7):694-707. [27] King A, Listernick R, Charrow J, Piersall L, Gutmann DH. Optic pathway gliomas in neurofibromatosis type 1: the effect of presenting symptoms on outcome. Am. J. Med. Genet A. 2003;122(2):95-9. [28] Ferner RE, Gutmann DH. International consensus statement on malignant peripheral nerve sheath tumors in neurofibromatosis. Cancer Res. 2002;62(5):1573-7. [29] Tucker T, Wolkenstein P, Revuz J, Zeller J, Friedman JM. Association between benign and malignant peripheral nerve sheath tumors in NF1. Neurology. 2005;65(2):205-11. [30] Benz MR, Czernin J, Dry SM, Tap WD, Allen-Auerbach MS, Elashoff D, et al. Quantitative F18-fluorodeoxyglucose positron emission tomography accurately characterizes peripheral nerve sheath tumors as malignant or benign. Cancer. 116(2):4518. [31] Ferner RE, Lucas JD, O'Doherty MJ, Hughes RA, Smith MA, Cronin BF, et al. Evaluation of (18)fluorodeoxyglucose positron emission tomography ((18)FDG PET) in the detection of malignant peripheral nerve sheath tumours arising from within plexiform neurofibromas in neurofibromatosis 1. J. Neurol. Neurosurg. Psychiatry. 2000;68(3):353-7. [32] Warbey VS, Ferner RE, Dunn JT, Calonje E, O'Doherty MJ. [18F]FDG PET/CT in the diagnosis of malignant peripheral nerve sheath tumours in neurofibromatosis type-1. Eur. J. Nucl. Med. Mol. Imaging. 2009;36(5):751-7. [33] Meany H, Dombi E, Reynolds J, Whatley M, Kurwa A, Tsokos M, et al. 18fluorodeoxyglucose-positron emission tomography (FDG-PET) evaluation of nodular lesions in patients with neurofibromatosis type 1 and plexiform neurofibromas (PN) or malignant peripheral nerve sheath tumors (MPNST). Pediatric blood & cancer. 2012. Epub 2012/05/31. [34] Beert E, Brems H, Daniels B, De Wever I, Van Calenbergh F, Schoenaers J, et al. Atypical neurofibromas in neurofibromatosis type 1 are premalignant tumors. Genes, chromosomes & cancer. 2011;50(12):1021-32. Epub 2011/10/12. [35] Brenner W, Friedrich RE, Gawad KA, Hagel C, von Deimling A, de Wit M, et al. Prognostic relevance of FDG PET in patients with neurofibromatosis type-1 and malignant peripheral nerve sheath tumours. Eur. J. Nucl. Med. Mol. Imaging. 2006;33(4):428-32. Epub 2006/01/13.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 108

SURGICAL TREATMENT OF GIANT NEUROFIBROMAS Stamatis Sapountzis1, Ji Hoon Kim2, Abid Rashid1 and Hung-Chi Chen1 1

Department of Plastic and Reconstructive Surgery, China Medical University Hospital, Taichung, Taiwan 2 Department of Plastic and Reconstructive Surgery, Seoul National University Bundang Hospital, South Korea

ABSTRACT Neurofibromatosis Type 1 (NF1) is an autosomal dominant systemic disease. Up to fifty percent of patients with NF1 are reported to have concomitant vascular abnormalities, incidence which increases the mortality especially in young patients. Among the complications of giant neurofibromas, spontaneous rupture and massive hemorrhage has been reported, leading to limb loss and death as well. The resection of larger neurofibromas is a challenging procedure because the risk of uncontrolled hemorrhage is much higher. In this chapter, we present a review of the medical literature of the methods that have been used to control intraoperative bleeding in large neurofibromas. We also discuss a novel surgical technique, which includes the ligation of the base of the giant neurofibroma tissue using a continuous loop-shaped suture. This method makes the operation field relatively bloodless and facilitates identification and ligation of the intralesional vessels. In addition, this surgical technique is less complicated and easier to perform and compared to others.

INTRODUCTION Neurofibromatosis type 1 (NF1) is an autosomal dominant disorder with an incidence of approximately one in 3,000 live births [1]. The gene locus of NF1 is localized to chromosome 17. Patients with this disorder develop Schwann cell tumors, called neurofibromas, and skin abnormalities. The most characteristic features are the “café-au-lait” pigmented skin spots, Lisch nodules (iris hamartomas), and multiple neurofibromas, including cutaneous and plexiform neurofibromas [2].

2318

Stamatis Sapountzis, Ji Hoon Kim, Abid Rashid et al.

In NF1 patients, transformation to a malignant peripheral nerve sheath tumor (MPNST) should be suspected if there is progressive enlargement and pain related to a neurofibroma. If this occurs, surgical excision is absolutely indicated, and also yields the best cosmetic results. Even though hemorrhage following trauma is a rare complication of neurofibromatosis, vascular abnormalities have been found in almost half of neurofibromatosis patients [3]. Macroscopically, these can be vascular stenosis, aneurysms, and arteriovenous fistulae. Microscopically, the most vulnerable are the small and the medium-sized vessels, in which the intima becomes thicker and the media thinner and fibrotic. Abnormal vascular structures are also observed in the neurofibromatous tissue. There are thin-walled, ecstatic blood vessels lying in a loose neural stroma, which replace the normal adipose tissue. For this reason, the risk for severe bleeding during the surgical excision is high, especially in giant neurofibromas [4]. This chapter presents a review in medical literature about the reconstruction options, as well as novel methods to control intraoperative bleeding. Using these methods, the authors present their personal experience in reconstructive surgery of giant neurofibromas and their novel techniques to reduce intraoperative bleeding.

SURGICAL TECHNIQUES From 2004 to 2012, 16 patients (10 men and 6 women) with giant neurofibromas were operated on in our department. The mean age of the patient was 34 year old. The location of the giant neurofibroma was in the upper limb in 6 patients, in the head and neck region in 5 patients, in the lower limb in 3 patients, and in the chest wall and back in 2 patients. In two patients, one with neurofibroma in the face and the other with it in the left upper limb, the neurofibroma was associated with AVM malformation. In 12 patients, the neurofibroma was excised and primary closure of the surgical wound was achieved. In the remaining patients, grafting of the surgical skin defect was required. In one patient with neurofibroma in the upper limb, the ulnar nerve was affected and a segment of the nerve was sacrificed. In order to reconstruct the nerve defect, a sural nerve graft was obtained from the right leg and was used to bridge the defect between the ulnar nerve proximally to the common digital nerve of the 4th and 5th digits distally. Another patient with neurofibroma of the upper limb required functional reconstruction of the hand after surgical excision. In this case the extensor carpi radialis longus and radiobrachialis tendon were transferred from the ulnar site to the first metacarpal head, in order to restore the normal function of the hand. In patients with head and neck region involvement, all of the tumors were excised successfully and primary closure of the surgical defect could be obtained. Increased attention should be given to the branches of the facial nerve because of this particular region. In all cases the operations were started with the identification of the marginal mandibular branch of the facial nerve, which crosses the facial artery. Then, working from distal to proximal, the dissection was advanced to the main trunk of the facial nerve as well as to the rest of the branches. In all patients, a total parotidectomy was performed as the tumor extended into the parotid gland (Figures 1–10).

Surgical Treatment of Giant Neurofibromas

Figure 1. A 53 year-old patient with neurofibroma of the face — front view.

Figure 2. Same patient — lateral view.

Figure 3. A 14 year-old boy with giant neurofibroma of the left upper limb associated with AVM malformation.

2319

2320

Stamatis Sapountzis, Ji Hoon Kim, Abid Rashid et al.

Figure 4. MRI revealed the intrathoracic extension of the neurofibroma.

Figure 5. Intraoperative photo showing dilated abnormal superficial venous system of the upper limb.

Figure 6. Excision of the AVM of the upper limb and partial excision of the neurofibroma.

Surgical Treatment of Giant Neurofibromas

2321

Figure 7. Postoperative photo after the first operation.

Figure 8. A 38 year-old woman with giant neurofibroma of the left upper limb.

A novel technique for prevention of the intraoperative bleeding was used by the authors [5] on a 46-year-old female patient with giant neurofibromas in the bilateral hip region. In the past, the patient had had three surgical excisions of subcutaneous nodules in different anatomical regions for cosmetic purposes, but never in the gluteal region because of the high tendency of intraoperative bleeding. The operation was performed under general anesthesia with the patient in prone position and the hips bent about 15 degrees. After performing the elliptical resection margin, the tumor base was tightened by use of a continuous loop shaped suture ligation. The thread was woven up and down in a loop shaped pattern, with a space of 2 cm between each loop, using a straight needle and prolene 2-0. After skin incision, the dissection was obliquely carried out toward the central and inferior sides of the mass using Metzenbaum scissors, while entering into large vascular sinuses was avoided. The tumor was resected in a wedge shape. The small vessels, which were visualized during the dissection, were

2322

Stamatis Sapountzis, Ji Hoon Kim, Abid Rashid et al.

coagulated, and the small bleeding sites were also controlled with the electrocautery. After the skin closure, the loop-shaped ligation of the base was removed, and compressive dressing was performed with gauzes and elastic bandages. The size of the resected tumor was 26x31x21 cm and 24x30x19 cm on the left and right sides, respectively. Due to moderate blood loss, the patient was transfused with two units of packed red blood cells after the operation. The pressure dressing was maintained until the 7th post-operative day. The sciatic nerve was also evaluated during this period, with no evidence of nerve damage. The postoperative period was uneventful with no sign of infection, bleeding, or hematoma. The sutures were removed on the 13th postoperative day, and the patient was discharged the next day (Figure 11–14).

Figure 9. The excised tumor of the left upper limb.

Figure 10. Postoperative photo after total excision of the giant neurofibroma and coverage of the defect with split-thickness skin graft.

Surgical Treatment of Giant Neurofibromas

2323

In medical literature there are few reports of successful surgical treatment of giant neurofibromas. The high incidence of postoperative complications, the necessity for preserving vital structures such as nerves in head and neck area, and at the same time the importance if the achievement good cosmetics result make the surgical treatment quite challenging. The surgical excision of giant neurofibromas and coverage of the defect using surrounding tissue remains the most popular technique. However, special considerations should be given to the control of intraoperative bleeding and the management of postoperative complications. Ross [6] presented their experience with the management of a giant 49-kg neurofibroma of the lower extremity in a 37-year-old male with NF1 associated with right thigh pain, paresthesias, increasing edema, and accelerated growth of the mass. In this case the tumor was excised using electrocautery, and hemostasis was maintained with bipolar cautery, ligature and clips. Intraoperative EMG stimulation was used to avoid further nerve injury. An 18-cm rectangular fasciocutaneous flap along the medial proximal thigh was created to cover the defect. The estimated blood loss was 800ml, and the patient received two units of packed-red blood cells. During the following months, the patient was admitted to the hospital three times due to fever, signs of infection and poor wound healing. However, after the appropriate management no further problems occurred, and at the one year follow-up the wound had successfully healed with some residual lymphedema. Liu et al. [7] reported a 13-year old girl with a large neurofibroma on the back extending into the midaxillary line and measuring 42x48x5cm3. The MRI revealed a diffuse neurofibroma with associated dysplastic blood vessels exhibiting irregular areas of tunica media and sinusoidal-like vascular channels (pseudohemangioma). An angiography demonstrated that the blood vessels of the tumor originated from the intercostal arteries and the transverse cervical artery. Interventional radiologists were unable to embolize such complex vasculature. The neurofibroma tissue was dissected and elevated above the deep muscle fascia, and a large splitthickness skin graft was harvested from the resected tumor tissue in order to cover the entire back. Less frequently, large neurofibroma can be developed in genitalia. Sadeghi et al. [8] reported a case of giant neurofibroma of the labia major, associated with pain and bleeding from an ulcer on its lateral surface. The size of the tumor was 16 cm in length and 2 to 3 cm in thickness. Special consideration should be given to head and neck giant neurofibromas. Cheng at el [9] reported a 45-year-old man with a giant tumor in the head, face, and neck. Facial asymmetry was found at birth and became more and more serious with aging. Subsequently, the tumor gradually extended to the head, face and neck and resulted in obvious deformity. This giant tumor was 50 cm in length and 44 cm in perimeter and led to a dislocated and deformed earlap and a longer external auditory channel. The tumor was resected successfully and eyelid anaplasty was performed. However, apart from the surgical excision of the giant neurofibroma, a novel approach has been presented by Hamdoon et al. [10] using photodynamic therapy in a patient with giant solitary neurofibroma. Their report describes a 70-year old female with painful neck mass associated with slight shortness of breath and dysphagia. Examination revealed a large mass in the neck with no vascular compromise. A core biopsy was performed and histopathological examination revealed a disorganized array of peripheral nerve fascicles. The patient elected to receive photodynamic therapy as the primary intervention. The photosensitizing agent was mTHPC (0,15mg.KG), which was undertaken under general anaesthesia. Post-PDP follow-up

2324

Stamatis Sapountzis, Ji Hoon Kim, Abid Rashid et al.

showed that the patient’s pain, dysphagia and shortness of breath issues had improved. The disfigurement of the neck caused by the mass was no longer a problem. Three months postPDT, MRI revealed a significant reduction in the neurofibroma size.

DISCUSSION Neurofibromatosis type I (NF-1), or von Recklinghausen disease, is an autosomal dominant disorder affecting approximately 1 in 3000 individuals [4]. Typically the disease is diagnosed clinically during childhood, as the first sign in 80% of NF1 individuals is usually café-au-lait macules by 1 year of age. NF1 is a progressive and unpredictable disease that is associated with a variety of clinical outcomes and complications; prognosis is dependent on age, severity of the disease, and organ involvement by the growth of neurofibromas. The life expectancy of individuals with neurofibromatosis may be reduced by 10 to 15 years, most often as a result of malignancies such as peripheral nerve sheath tumors or soft-tissue sarcoma [11]. Furthermore, vascular disease appears to contribute to the excess mortality of young patients [12]. In addition, about the half of the patients also have vascular lesions, however the pathogenesis of these lesions are not well defined. The vascular lesions have been described in the entire arterial tree, but involvement of the renal arteries is most common. NF1 vasculopathy of the cerebrum, endocrine system, gastrointestinal tract, and heart have also been reported. Frequently multiple vessels are involved [13]. In 1944 Reubi [14]classified the vascular histology into intimal, aneurismal and fusocellular forms. A common finding between the types is spindle cell proliferation. Other theories support that the vascular lesions are due to nerve proliferation within the vessel wall or from compression or invasion by neural tumors. More often, the histologic feature is fibromuscular dysplasia with a predominance of intimal thickening. Salyer and Salyer [15] suggested that intimal thickening in NF1 vasculopathy is the result of proliferation of Schwann cells within the arteries. This implies a pathogenic relationship between these lesions and the neurofibromas that characterize this disease. Riccardi has suggested that NF1 vasculopathy results from a dysplastic process, in which abnormal function of neurofibromin alters vascular histogenesis. Macroscopically, these lesions can take a variety of forms including vascular stenosis, aneurysms, and arteiovenous fistulae. In histological examination the small and medium sized vessels are presented with thickening of the intima and a thin but fibrotic media. The vascular structure in neurofibromatous tissue also has histological alterations with thin walled ecstatic blood vessels lying in a loose neural stroma, which replace the normal adipose tissue [2]. Coexisting coagulopathies may increase the complication rates. These may be inherited or secondary to vascular anomalies causing platelet trapping and consumption of clotting factors. Hemostasis can be difficult to obtain, following injury to these lesions. Diathermy is of limited use as the tissue is very friable [16-18].

Surgical Treatment of Giant Neurofibromas

Figure 12. The schematic view of a continuous loop-shaped suture ligation, from ref. [5].

Figure 13. Postoperative view 2 days after surgery, from ref. [5].

Figure 14. Postoperative result 12 months after surgery, from ref. [5].

2325

2326

Stamatis Sapountzis, Ji Hoon Kim, Abid Rashid et al.

Preoperative angiography and superselective embolization have been used in elective excision of vascular neurofibromas. The results of such treatment without associated surgery have been disappointing, because the tumors tend to revascularize quickly. It has been suggested that embolization therapy by a skilled interventional radiologist should be considered prior to elective excision of neurofibromas to reduce intraoperative blood loss. The most effective way to control the bleeding seems to be the ligation of the neurofibromata’s vascular pedicle under direct vision of the feeding vessels and the external compression [3].

CONCLUSION This chapter presents the experiences of the authors in 16 cases of giant neurofibroma, as well as a literature review of the surgical methods that have been used in giant neurofibroma surgery. The preservation of significant structures such as the facial nerve and the control of the intraoperative bleeding in the cases that, associated with vascular malformations, are important steps when excision of these tumors is decided. In our cases, two patients with neurofibroma of the upper limb required further reconstruction after the tumor excision; one of them required nerve graft to bridge the nerve defect, and a second patient required tendon transfer in order for the normal function of the hand to be restored. In one case of giant neurofibroma of the buttock, a novel method was performed to obtain a bloodless field using a continuous loop-shaped suture in order to ligate the base of the tumor. In addition, we presented several other approaches, methods and tools facilitating successful tumor surgery.

REFERENCES [1] [2] [3] [4] [5]

[6] [7]

[8]

Choi KR, Yoon KM, Kim KS, Lee SY, Cho BH: Histopathological study of the vascular lesions in neurofibromatosis. J Korean Soc Plast Reconstr Surg 24: 45, 1997. White N, Gwanmesia I, Akhtar N, Withey SJ: Severe haemorrhage in neurofibromatoma: a lesson. Br J Plast Surg 57: 456, 2004. Tung TC, Chen YR, Chen KT, Chen CT, Bendor-Samuel R: Massive intratumor hemorrhage in facial plexiform neurofibroma. Head Neck 19: 158, 1997. Choi HY, Lee HY, Kim YS, Kim SI, Kim JT: The treatment of neurofibromatosis involving trigeminal ganglion. J Korean Soc Plast Reconstr Surg 26: 263, 1999. Stamatis Sapountzis, Ji Hoon Kim, Jin Sik Burm, Pham Minh, Chan Yeong Heo: A safe method for excision of a giant neurofibroma on both buttocks using a loop-shaped suture. European Journal of Plastic Surgery, 2012, Volume 35, Number 5, Pages 389-393. Ross AL, Panthaki Z, Levi AD: Surgical management of a giant plexiform neurofibroma of the lower extremity. World Neurosurg. 2011 May-Jun;75(5-6):754-7. Liu L, Fan J, Gan C, Tian J, Jiao H.: Total resection of giant plexiform neurofibroma of the entire back in one stage by autologous tumor skin graft. J Plast Reconstr Aesthet Surg. 2012 Feb;65(2):276-7. Epub 2011 Sep 8. Sadeghi E, Johari HG, Seifi M, Rahmani M, Madani SH, Shemshadi M, Eskandari S.: Giant Neurofibroma of Labia Major. J Low Genit Tract Dis. 2012 Jan 5. [Epub ahead of print].

Surgical Treatment of Giant Neurofibromas [9]

[10]

[11] [12]

[13] [14]

[15] [16] [17] [18]

2327

Cheng XB, Lei DL, Li YP, Tian L, Liu YP, Feng XH, Hu XG, Sun MY, Ma Q, Mao TQ, Liu BL, Zhao YM, Feng ZH, Xu LX, Zhang H, Zhang TC, Liu R, Shen L.: Surgical treatment of a giant neurofibroma. J Craniofac Surg. 2011 Nov;22(6):2244-6. Hamdoon Z, Jerjes W, Al-Delayme R, Hopper C.: Solitary giant neurofibroma of the neck subjected to photodynamic therapy: case study. Head Neck Oncol. 2012 Jun 6;4(1):30. [Epub ahead of print]. Viskochil DH. Neurofibromatosis Type 1. Management of Genetic Syndromes. 2001; 229-251. New York: Wiley-Liss, Inc. Rasmussen S, Yang QH, Friedman JM. Mortality associated with neurofibromatosis 1 in the United States from 1983 to 1995: an analysis using data from death certificates. Am J Hum Genet 1999: 65: A49. Halpern M, Currarino G. Vascular lesions causing hypertension in neurofibromatosis. N Engl J Med 1965: 273 (5): 248–252. Reubi F. Les vaisseaux et les glandes endocrines dans la neurofibromatose: le syndrome sympathicotonique dans le maladie de Recklinghausen. [Vessels and endocrine glands in neurofibromatosis: sympathicotonic syndrome in Recklinghausen's disease]. Schweiz Z Pathol Bacteriol 1944;7:168-236. Salyer WR, Salyer DC. The vascular lesions of neurofibromatosis. Angiology 1974: 25: 510–519. Kitao T, Miyabo S, Hittori K. Hemophillia associated with von Recklinghausens disease. South Med J 1976;69:16—39. Farah GR, Awidi AS. Massive bleeding in neurofibromatosis with congenital hypofibrinogenaemia. Eur J Surg Oncol 1985; 11:57—60. Francis DMA, Mackie W. Life threatening haemorrhage in patients with neurofibromatosis. Aust NZ J Surg 1987;57: 679—82.

In: Encyclopedia of Genetics: New Research (8 Volume Set) ISBN: 978-1-53614-451-2 Editor: Heidi Carlson © 2019 Nova Science Publishers, Inc.

Chapter 109

NEUROFIBROMATOSIS TYPE 1-ASSOCIATED NERVOUS SYSTEM TUMORS AND CURRENT TREATMENT STRATEGIES Nilika Shah Singhal1 and Sabine Mueller1,2 1

Department of Neurology, Division of Child Neurology, University of California San Francisco, San Francisco, CA, US 2 Department of Pediatrics and Neurosurgery, University of California San Francisco, San Francisco, CA, US

ABSTRACT Patients with Neurofibromatosis 1 (NF 1) suffer from a myriad of medical problems including benign as well as malignant tumors. Malignancy is the most common cause of death in affected individuals, and reduces life expectancy by 10-15 years. Amongst other tumors, patients with NF1 carry an elevated risk of specific central nervous system (CNS) tumors. The most common NF1-associated CNS tumors are low-grade gliomas (LGG) such as optic pathway gliomas, hypothalamic gliomas, and other parenchymal gliomas located in the brainstem, cerebellar peduncles, globus pallidus, and midbrain. In addition to CNS tumors, patients with NF1 also develop peripheral nervous system (PNS) tumors such as neurofibromas and schwannomas. These tumors arise most commonly from major peripheral nerves such as the radial and ulnar nerve. These are benign tumors however can cause significant disfiguration, pain and depending on the location specific neurological complications. Malignant transformation of these tumors leads to malignant peripheral nerve sheath tumors (MPNST). These tumors occur in less than 5% of children with NF1, but are the leading cause of mortality in adult patients with NF1. Significant advances in our understanding of LGG have been achieved over the last several years. Several genetic aberrations, which activate the MAPK pathway have been identified in the majority of LGGs, most notably the BRAF-KIA1549 fusion protein and the activating BRAFV600E mutation. Specific inhibitors of MEK1/2, the immediate downstream target of BRAF, are currently being tested in the clinic for children with LGGs. Treatment for symptomatic plexiform neurofibromas remains a clinical challenge for most pediatric neuro-oncologists. Recent studies have shown promise to use pegylated (PEG)-interferon-alpha-2b. Other treatment strategies also target the MAPK pathway for

2330

Nilika Shah Singhal and Sabine Mueller

these tumors. Treatment of MPNST remains under investigation and outcome remains poor. Most patients are currently treated with a combination of surgery, radiation and chemotherapy. In this chapter, we will outline NF1 associated CNS and PNS tumors and discuss current treatment approaches.

INTRODUCTION Neurofibromatosis 1 (NF1) is a genetic syndrome due to loss-of-function of the NF1 gene that encodes neurofibromin [1]. NF1 is a tumor suppressor gene that is a negative regulator of the RAS signaling cascade [2]. Loss of neurofibromin results in increased activity of ras, which leads to tumorigenesis [3]. The incidence of NF1 is estimated to be about 1 in 3000 [4]. Patients with NF1 suffer from a myriad of medical problems, including benign as well as malignant tumors [5]. Malignancy is the most common cause of death in affected individuals and reduces life expectancy by 10-15 years [6]. Amongst other tumors, patients with NF1 carry an elevated risk of specific central nervous system (CNS) tumors. The most common NF1-associated CNS tumors are low-grade gliomas (LGG), such as optic pathway gliomas, hypothalamic gliomas, and other parenchymal gliomas located in the brainstem, cerebellar peduncles, globus pallidus, and midbrain [7, 8, 9]. In addition to CNS tumors, patients with NF1 also develop peripheral nervous system (PNS) tumors, such as neurofibromas and schwannomas [6]. These tumors arise most commonly from major peripheral nerves such as the radial and ulnar nerve. While these tumors are typically low-grade, they can cause significant disfiguration, pain and other neurological complications. Further, malignant transformation of these tumors leads to malignant peripheral nerve sheath tumors (MPNST). MPNSTs occur in less than 5% of children with NF1, but are the leading cause of mortality in adult patients with NF1 [6]. Significant advances in our understanding of these tumors have been achieved in recent years. Several genetic aberrations, which upregulate the RAS pathway and activate VEGF, play a role in the tumorigenesis of these tumors. In addition, mutations that activate the MAPK pathway have been identified in pediatric LGGs, most notably the BRAF-KIAA1549 fusion protein and the activating BRAFV600E mutation [10, 11, 12, 13, 14], however these might be less common in patients with NF1 [12, 15, 16, 17]. These identified mutations might play a role as biomarkers, and identification of these pathways has led to new therapeutic developments that are currently being tested in clinical trials. For instance, specific inhibitors of MEK1/2, the immediate downstream target of BRAF, are currently being tested in the clinic for children with LGGs via the Pediatric Brain Tumor Consortium (PBTC). Treatment for symptomatic plexiform neurofibromas remains a clinical challenge for pediatric neuro-oncologists [18], but recent studies have shown promise in the use of PEG-interferon-alpha-2b [19, 20]. To date we have not yet identified an effective treatment strategy for patients with MPNST, and patients are often treated on clinical trials with a combination of surgery, radiation and chemotherapy. In this chapter, we outline NF1 associated CNS and PNS tumors, and discuss current treatment approaches.

Neurofibromatosis Type 1-Associated Nervous System Tumors …

2331

CENTRAL NERVOUS SYSTEM TUMORS IN CHILDREN WITH NF1 The most common NF1-associated CNS tumors are optic pathway gliomas (OPG) and hypothalamic gliomas, as well as other parenchymal gliomas located in the brainstem, cerebellar peduncles, globus pallidus, and midbrain [7, 8, 9]. OPGs are the most common CNS tumors in patients with NF1, occurring in up to 15% of children with NF1 [21, 22, 23]. In patients with symptomatic OPGs, the risk of developing other glial tumors in the CNS is nine times more frequent than in patients without symptomatic OPGs [24].

Figure 1. Optic Glioma. Coronal T2-weighted magnetic resonance imaging (MRI) scan demonstrating right optic glioma. Note enlargement of the optic nerve.

Low Grade Glioma: Clinical Presentation OPGs can occur anywhere along the optic tract. In most patients, these tumors are asymptomatic, but about one third of patients will develop symptoms, including vision loss or proptosis. Other clinical findings include abnormal color vision, optic atrophy and afferent pupillary defect. In addition, precocious puberty can be seen in OPGs involving the optic

2332

Nilika Shah Singhal and Sabine Mueller

chiasm and the hypothalamus [25, 26]. In general, children become symptomatic of these tumors within the first decade of life [27]. About 50% of children with NF1 and OPG will develop vision loss. Consequently, close clinical observation is typically done for initial management [23]. A recent retrospective, multi-center study evaluated visual outcomes in patients following chemotherapy for NF1-associated OPG. Mean age of diagnosis of OPG was 2.66 years, age of first chemotherapy dose median was 4.04 years with a median range of diagnosis to treatment being 133 days. Outcomes were assessed at the completion of therapy: about one third of patients had improved visual acuity and 40% had stable visual acuity. While most subjects experienced stabilization or improvement in vision after therapy, visual acuity worsened in 28% of subjects after treatment. The most consistent prognostic factor for poor visual outcome was tumor involvement of the optic tracts or radiations (P = .02 per subject) and optic pallor at the start of treatment (P = .005 per eye). Age was another prognostic factor for poor visual outcome, with subjects younger than 2 years or older than 5 years more likely to have a decline in visual acuity. Further, none of the children younger than 2 years of age demonstrated any improvement in visual acuity with treatment. Of note, there was a poor correlation between radiographic outcome and visual acuity outcome; as many as 25% of patients with complete response or partial response by MRI had worsening of visual acuity, and 29% with stable disease or minor response showed worsening of visual acuity, thus calling into question the utility of MRI as adequate measure of visual outcome [23]. Other LGGs that occur in patients with NF1, though less commonly than OPGs, include astrocytomas and ependymomas, and are located within the cerebellum, brainstem, deep grey nuclei, and spinal cord [28]. Like OPGs, these low-grade gliomas tend to have a better prognosis in NF-1 patients as compared to non-NF1 patients [29]. This is true regardless of location including brainstem tumors [30, 31]. NF1 patients with brainstem gliomas tend to have more indolent courses. A study of 17 patients with NF1 and brainstem tumors indicated that the medulla was most commonly involved structure, in 82% of these patients, in contrast to the pontine location as more commonly occurs in non-NF1 patients [30]. Median follow-up was 52 months; 15 of 17 patients remained alive, and 14 of those did not require adjuvant chemotherapy [30]. Another study described 23 NF1 patients with brainstem tumors with a median follow-up period of 67 months for 17 of 23 patients who were untreated and 102 months for the six of 23 patients who received therapy; only one previously untreated patient experienced radiographic and clinical progression, and all but one remain alive [32].

Low Grade Glioma: Imaging Characteristics The characteristics of optic pathway glioma are often apparent on head CT scans, however; MRI is the preferred method and current clinical standard for diagnosis and follow up imaging. CT characteristics include enlargement of the optic nerve(s), chiasm or tract. Further, there can be changes to the bony structures of the optic canal and sphenoid wing [33, 34]. MRI T2weighted imaging more clearly delineates anatomic changes including enlargement of the optic nerve(s) (Figure 1), chiasm (Figure 2) or tract. In addition, both homogenous and heterogenous contrast enhancement can be seen [33, 35, 36]. Other characteristics include a cystic component to the tumor, as well as mass effect on adjacent structures [37]. Other parenchymal lesions, such as gliomas involving the thalami and basal ganglia, appear as hyperintense T2 lesions that may or may not be enhancing [35, 36].

Neurofibromatosis Type 1-Associated Nervous System Tumors …

2333

Figure 2. Low-grade Glioma. Coronal T2-weighted MRI (left) and T1-weighted MRI (right) demonstrating low-grade glioma of optic chiasm. Note enlargement of the optic chiasm.

Low Grade Glioma: Prognosis OPG tumors are common and the natural history demonstrates often follows a benign course and some tumors may even regress after initial diagnosis [38]. The overall 5-year survival rate is 90% at 5 years [37]. However, these tumors may lead to symptoms, typically visual loss and hypothalamic dysfunction such as precocious puberty. The highest-risk period for the development of symptomatic OPGs in NF1 patients is during the first 6 years of life [39], and further, ages 5 years are poor prognostic factors [23]. Screening MRIs of asymptomatic children remains controversial since it has not been proven effective in reducing complications related to OPGs [39]. Further, a recent study demonstrated a poor correlation between radiographic outcome and visual acuity outcome [23]. Thus, functional outcomes are of highest importance, and yearly ophthalmological evaluation is indicated in younger children, and older children should undergo sporadic ophthalmological evaluations [39]. OPGs that present in older patients are more likely to progress compared to younger patients under age 10 years [39]. Other features associated with shorter survival aside from diagnosis in adulthood include extra-optic location and symptomatic tumors [37]. Of note, symptomatic and/or progressive tumors are often found to be of more aggressive histologic subtype [37]. Brainstem glioma and optic pathway glioma tend to be less aggressive in NF1 patients than in non-NF1 patients [30, 40]; in a study of 23 patients with OPG, only 1 patient with NF1 and OPG died due to disease progression, whereas 7 of 39 non-NF1 patients died (p=.045) [40].

Low Grade Glioma: Treatment Modalities 1. Role of Surgery For lesions that are easily resectable, such as LGGs located within the posterior fossa, surgery is standard of care and often curative. Conservative treatment such as serial

2334

Nilika Shah Singhal and Sabine Mueller

neuroimaging and serial ophthalmological evaluations, however, is often preferred for most asymptomatic LGGs for which complete surgical resection cannot be achieved without significant morbidity such as OPG or midline LGG. In these cases, surgery is reserved for those with radiographic progression or associated severe symptoms [7], e.g., significant or complete visual loss, severe proptosis or strabismus, or associated hydrocephalus [7]. Cerebrospinal fluid shunts are used when patients are symptomatic from hydrocephalus [37].

2. Radiation Therapy Most centers avoid radiation therapy as a first-line treatment in young children with NF1, and only patients who have failed initial chemotherapy options are considered for radiation therapy. Various doses of radiation therapy have been used in the treatment of OPGs, and while tumor control is attained in up to 80-90% of patients with NF1 [41, 42], this type of treatment is associated with significant delayed morbidity, including neuro-cognitive decline, radiationinduced vasculopathies and endocrinopathies, such as deficiency in growth hormone [43]. Currently the rate of malignant transformation in pediatric LGG is not well characterized since biopsies at recurrence are rarely performed for these patients. While the risk of spontaneous transformation of LGG might be rare in pediatric patients [44], it has been noted in patients treated with radiation therapy [41, 45]. A study examining 82 tumors in 18 NF1 patients at a median age of 25 years (range, 4.3-64 years) showed that the most common reason to initiate radiation therapy was radiographic evidence of growth. 67% of patients received radiation therapy. Of all NF1 patients, the overall survival at 5 years was 94%. Five patients with NF1 were treated for LGG, which accounted for 11% of the tumors. Two of these patients developed malignant transformation of tumors, and both of these patients subsequently died [41]. Given these significant morbidities, radiation therapy is often avoided in children with NF1, unless they fail other treatment modalities. 3. Chemotherapy Conventional chemotherapy is used effectively, particularly in young patients under age 5 years old in whom radiation therapy poses significant morbidity [27, 46]. Carboplatin and vincristine are the two agents most commonly used together, resulting in stabilization or reduction of tumor, with a beneficial 3-year progression-free survival (PFS) [19]. A recent study involving children with progressive or residual LGGs were randomly assigned to receive either a combination of carboplatin and vincristine, or a combination of thioguanine, procarbazine, lomustine, and vincristine (TPCV). Among all children, the 5-year event-free survival and overall survival were both higher for those receiving TPCV. This study also included a nonrandomized arm for patients with NF1, the results of which are to be reported separately [47]. Given the loss of a known tumor suppressor gene as occurs in NF1, there is concern that NF1 patients are at higher risk for transformation of residual or progressive tumor to a more aggressive phenotype after alkylating chemotherapy, as this has been reported in two patients occurring in the absence of radiation therapy and within 4 months of receiving chemotherapy [48]. Other agents that are currently being used for patients with LGG include vinblastine, the combination of bevacizumab and irinotecan, as well as temozolomide [49, 50, 51]. Weekly treatment with vinblastine for one year resulted in a 5-year PFS in a phase II trial of 42.3% ± 7.2% and was in general well-tolerated, thus seems to be a good alternative to radiation therapy in pediatric patients with LGG who have failed other chemotherapy [50]. In children with multiple recurrent LGG treated with the combination of bevacizumab and

Neurofibromatosis Type 1-Associated Nervous System Tumors …

2335

irinotecan every 2 weeks, 7 of 10 had an objective neuroradio- graphic response after two cycles of treatment, and 7 of 10 demonstrated clinical improvements, the majority with a lasting response, and this combination is reasonably well-tolerated. Of these patients, 6 of 10 remained on treatment for up to 22 months after treatment initiation [51].

4. Targeted Therapy PI3K/mTOR Pathway: TOR is an evolutionarily conserved serine/threonine protein kinase; it plays an important role in cell growth and proliferation across species [52]. Mammalian TOR (mTOR) controls a variety of cellular processes involving regulation of growth factors and energy [52]. mTOR signals downstream targets within the PI3K/AKT pathway. This pathway is known to be dysregulated in a wide spectrum of human cancers through loss/mutation of PTEN as a negative regulator, PI3K mutation/amplification, AKT/PKB overexpression, and modulation of TSC1/TSC2 tumor suppressors. In addition, activation of the PI3K/AKT/mTOR pathway is frequently a characteristic of worsening prognosis through increased aggressiveness, resistance to treatment and progression. As such, mTOR inhibition might be an effective treatment strategy for LGG [53]. NF1-related low-grade astrocytomas exhibit increased levels of mTOR pathway activation, demonstrated by western blot analysis assessing phospho-S6, a marker reflecting mTOR activation [54]. A current trial is investigating the potential benefit of mTOR inhibitor everolimus in children with chemotherapy-refractory progressive or recurrent LGGs, including children with NF1. Results of this trial are pending. (www.poeticphase1.org). RAS-MAPK Pathway Neurofibromin, encoded by the NF1 gene, is a GTPase-activating protein (GAP). It acts as a tumor suppressor by negatively regulating RAS pathway output by the conversion of active RAS-GTP to inactive RAS-GPD [55]. Thus lack of NF1 results in increased RAS activity leading to dysregulated cell growth. There are three important isoforms of RAS: K-RAS, NRAS, and H-RAS. It has been demonstrated that activation of the K-RAS isoform leads to a proliferative advantage seen in astrocytes [56]. Further, K-RAS has been shown to modulate the RAF/mitogen-activated protein kinase (MAPK)/extracellular signal-regulated kinase kinase (ERK) pathway; typically, increased RAS activity results in increased signal transduction via this pathway. One avenue for possible therapeutics for LGGs involves targeting the MAPK pathway. Antibodies that block the MAPK-ERK pathway in the Nf1:p53 mouse tumor model cell lines in vivo have been demonstrated to block EGFR-stimulated tumor cell line growth [57]. Recent advances investigating the underlying oncogenic events in pediatric LGG have led to the discovery of activating mutations in BRAF, a member of the RAF family of serine/threonine protein kinases. The RAS-MAPK signaling pathway utilizes a series of kinases to relay signals from the cell membrane to the nucleus, playing important roles in cell proliferation, differentiation, cell-cycle arrest, and apoptosis [58]. In pediatric LGG, particularly in pilocytic astrocytomas, a copy number gain of 2 Mb at the chromosomal region 7q34 has been identified. This copy number results in a fusion of the genes KIAA1549 and BRAF, and leads to constitutive activation of BRAF due to loss of the Ras-binding domain of BRAF [13, 16, 59]. BRAF activation leads to phosphorylation of MEK1/2, which in turn phosphorylates ERK. The various KIAA1549-BRAF fusion genes are thought to be functionally similar, all possessing the BRAF kinase domain, while the NH2 terminus is

2336

Nilika Shah Singhal and Sabine Mueller

replaced by KIAA1549, implying that the fusion protein is constitutively activated, leading to high levels of phosphorylated MEK and ERK [60]. In a study of 106 LGG (grade I-II) from primarily pediatric patients, including pilocytic astrocytomas, low-grade glioneuronal/neuroepithelial tumors, pleomorphic xanthoastrocytomas, diffuse astrocytomas, pilomyxoid astrocytoma, and unclassifiable lowgrade gliomas, KIAA1549-BRAF fusions were identified by sequencing in nearly 50% of tumors overall and were found in the majority of pilocytic astrocytomas [61]. Importantly, no KIAA1549: BRAF fusions were seen as higher-grade tumors (five high-grade astrocytomas, four medulloblastomas, two ependymomas, and one dysembryoplastic neuroectodermal tumor were tested) [61]. Of note, in this cohort of patients, 5% had a clinical diagnosis of neurofibromatosis, and all of these lacked BRAF alterations [61]. Identification of KIAA1549 - BRAF fusion may be an important molecular marker to help in distinguishing pilocytic astrocytomas and other tumors such as low-grade diffuse astrocytomas and mixed oligoastrocytomas grade II, as these fusion products are detected in 80% of pilocytic astrocytomas but only infrequently in these other tumors [60]. However, classifying pediatric LGG based on specific molecular aberrations is still subject of debate and additional research is required. BRAF rearrangements have been shown to be an independent favorable prognostic factor in pediatric LGG [62]. In a study of 70 pediatric low-grade astrocytomas compared with 76 control tumors, five-year PFS was 61% for BRAF-KIAA1549 fusion-positive compared with 18% for fusion-negative patients (P=0.0004) [62]. Further, it has been demonstrated that pediatric gliomas demonstrate activating point mutations of BRAF, the BRAFV600E mutation [12]. The BRAFV600E mutation is found in approximately 60% of pleomorphic xanthoastrocytomas and 10–15% of pediatric astrocytomas, but are also seen in pediatric gangliogliomas [12, 15, 16, 17]. In addition to BRAF mutations, other targets along the MAPK signaling pathway include K-RAS, PTPN11, MEK1/2, and H-RAS. In some pilocytic astrocytomas, the SRGAP3-RAF1 gene fusion, as well as activating mutations in KRAS, have been identified [13, 59]. Additional studies are needed to inquire how common these mutations are in NF1-associated tumors. MEK inhibitors are currently introduced in clinical trials for other types of tumors, such as melanoma and lung cancer. Given the upregulation of the MAPK pathway in pediatric LGG, an ongoing study from the Pediatric Brain Tumor consortium is currently testing a MEK inhibitor for the treatment of pediatric progressive LGG including children with NF1 (www.pbtc.org).

PERIPHERAL NERVOUS SYSTEM TUMORS IN CHILDREN WITH NF1 In addition to CNS tumors, patients with NF1 also develop peripheral nervous system (PNS) tumors such as neurofibromas and schwannomas [6]. These tumors arise most commonly from major peripheral nerves such as the radial and ulnar nerve. While benign, these tumors can cause significant disfiguration, pain and other neurological complications. Malignant transformation to malignant peripheral nerve sheath tumors (MPNST) can occur. These occur in less than 5% of children with NF1, but are the leading cause of mortality in adult patients with NF1 [6].

Neurofibromatosis Type 1-Associated Nervous System Tumors …

2337

Figure 3. Plexiform Neurofibroma. Axial T2-weighted MRI (top) and T1-weighted post-contrast MRI (bottom) demonstrating large, diffuse, infiltrating plexiform neurofibroma involving the left sacral plexus extending into the left sacral neural foramina.

Plexiform Neurofibromas: Clinical Presentation Neurofibromas are comprised of a mixture of fibroblasts, pericytes and proliferated Schwann cells [63]. Schwann cells are thought to be the primary pathogenic cell in neurofibromas [64]. These tumors originate from within the nerve, expanding that portion of nerve, and are well-circumscribed. Neurofibromas in NF1 patients can be classified as cutaneous neurofibromas, subcutaneous neurofibromas and plexiform neurofibromas (PNs). Cutaneous and subcutaneous neurofibromas arise at the nerve terminus or just beneath the skin. The size ranges from only millimeters to large enough to be disfiguring. Localized cutaneous neurofibromas are the most common clinicopathologic subtype. These can be colored and are typically soft. The subcutaneous neurofibromas are sometimes firm, tender, palpable nodules under the skin. Both can vary in number from just a few to innumerable in any given patient and typically appear in late childhood or early adolescence [65]. PNs occur in over 50% of people with NF1 [66]. These can be nodular or diffuse. Nodular PNs arise from nerves or organs beneath the skin, commonly clustering around proximal nerve roots with the potential to extend through the neural foramina and compress the spinal cord. Diffuse PNs involve multiple nerves, often expanding into surrounding tissues and organs. The overlying

2338

Nilika Shah Singhal and Sabine Mueller

skin is often thickened and hyperpigmented. Diffuse PNs tend to enlarge with age and can become disfiguring. As such, they may limit range of motion or function of involved limbs or organs [27].

Plexiform Neurofibromas: Imaging Characteristics Neuroimaging can determine the precise nerves involved or the extent of involvement of peripheral nerve sheath tumors (Figure 3). Certain subsets of these tumors have a typical appearance on imaging. For instance, nodular PN take on a classic “dumbbell” appearance on neuroimaging [27]. Imaging can sometimes be helpful for determining the transformation from benign to malignant peripheral nerve sheath tumors, as characteristics such as rapid growth compared to prior radiographic appearance, avid enhancement and invasion of surrounding structures correlate with malignancy. However, these qualitative measures may be difficult to assess at times, thus necessitating biopsy [7, 67].

Plexiform Neurofibromas: Prognosis Treatment of plexiform neurofibromas remains challenging. The natural history of these tumors is not well understood. One study showed that PN can remain stable in older individuals, but have a higher tendency for growth in children < 21 years of age. These tumors tend to grow and enlarge over time, with no proven medical therapies to reduce or prevent their growth [27]. A recent study followed 34 NF1 patients with a total of 44 tumors with longitudinal MRI scans over 16 years. Most of the PN in this study were small (