Latin American Technopoetics: Scientific Explorations in New Media 9781138322073, 9780429452338

Table of contents :
Cover
Half Title
Title Page
Copyright Page
List of Figures
Foreword
Acknowledgements
Introduction: Latin American Technopoetics, Scientifically Speaking
1 Autopoiesis and Robopoetics in Gustavo Romano’s IP Poetry Project
2 The Poetics of Visualizing Scientific Complexity: Santiago Ortiz
3 Loss Pequeño Glazier’s Quantum Poetics: Algorithmic Poetry and Its Variants
4 A Poetics of Biocybernetic Reproducibility: Eduardo Kac’s Telematic and Transgenic Art
Concluding Thoughts on (New) Media and Mediation: Locating the Latin American in Contemporary Technopoetics
Afterword: Carlos Cociña and Luis Correa-Díaz’s Scientific Technopoetics (todavía in Print)
Works Cited
Index

Citation preview

Latin American Technopoetics

Latin American Technopoetics: Scientific Explorations in New Media analyzes the ways in which poetry and multimedia installations by six prominent poets and artists engage, and in turn are engaged by, ­scientific discourses. In its innovative readings of contemporary digital media works, Latin American Technopoetics is the first book to investigate the powerful dialogue between recent techno-cultural phenomena, literature, and various scientific fields. This cutting-edge analysis of poetic and artistic experimentation—robots that compose and recite poetry, algorithms that create visualizations of poetic language or of the connections between everyday language and scientific terminology, arrays of multi-dimensional poetic spaces, and telematic and transgenic art— makes a strong case for the increasing viability of a scientific poetics currently gaining prominence in Latin American literary and media studies, digital humanities, and science and technology studies. Latin American Technopoetics is therefore a groundbreaking but highly readable study of six of the most challenging Latin(o) American poets working at the interface of science and poetics, and proposes a new way to consider the question of techno-cultural modernity in Latin America. Scott Weintraub (PhD Emory University, 2006) is an Associate ­Professor of Hispanic Studies at the University of New Hampshire, where he teaches classes on twentieth- to twenty-first-century Latin American literature, poetry, cultural studies, literary theory, and the relationship between literature, philosophy, science, and technology. He is the author or co-editor of over ten books and special journal issues, including two books on experimental Chilean poet Juan Luis Martínez; he has published extensively in journals and edited collections in the United States, Canada, Latin America and Europe.

New Hispanisms: Cultural and Literary Studies

New Hispanisms: Cultural and Literary Studies presents innovative studies that seek to understand how the cultural production of the Hispanic world is generated, disseminated, and consumed. Ranging from the Spanish Middle Ages to modern Spain and Latin America, this series offers a forum for various critical and disciplinary approaches to cultural texts, including literature and other artifacts of Hispanic culture. Queries and proposals for single author volumes and collections of original essays are welcome. Policing Gender and Alicia Giménez Bartlett’s Crime Fiction Nina L. Molinardo African Immigrants in Contemporary Spanish Texts Crossing the Strait Edited by Debra Faszer-McMahon and Victoria L. Ketz The Formation of the Child in Early Modern Spain Edited by Grace E. Coolidge Intersections of Race, Class, Gender and Nation in Fin-de-siècle Spanish Literature and Culture Edited by Lisa Nalbone and Jennifer Smith The Dynamics of Masculinity in Contemporary Spanish Culture Edited by Ana Corbalán and Lorraine Ryan Spanish Women Writers and Spain’s Civil War Edited by Maryellen Bieder and Roberta Johnson Latin American Technopoetics Scientific Explorations in New Media Scott Weintraub For a full list of titles in this series, please visit www.routledge.com.

Latin American Technopoetics Scientific Explorations in New Media

Scott Weintraub

First published 2018 by Routledge 711 Third Avenue, New York, NY 10017 and by Routledge 2 Park Square, Milton Park, Abingdon, Oxon OX14 4RN Routledge is an imprint of the Taylor & Francis Group, an informa business © 2018 Taylor & Francis The right of Scott Weintraub to be identified as author of this work has been asserted by him in accordance with sections 77 and 78 of the Copyright, Designs and Patents Act 1988. All rights reserved. No part of this book may be reprinted or reproduced or utilised in any form or by any electronic, mechanical, or other means, now known or hereafter invented, including photocopying and recording, or in any information storage or retrieval system, without permission in writing from the publishers. Trademark notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation without intent to infringe. Library of Congress Cataloging-in-Publication Data CIP data has been applied for. ISBN: 978-1-138-32207-3 (hbk) ISBN: 978-0-429-45233-8 (ebk) Typeset in Sabon by codeMantra

for K, Q, C, and P

Contents

List of Figures Foreword

ix xi

LEONA R DO FLOR E S

Acknowledgements Introduction: Latin American Technopoetics, Scientifically Speaking

xv

1

1 Autopoiesis and Robopoetics in Gustavo Romano’s IP Poetry Project

17

2 The Poetics of Visualizing Scientific Complexity: Santiago Ortiz

36

3 Loss Pequeño Glazier’s Quantum Poetics: Algorithmic Poetry and Its Variants

71

4 A Poetics of Biocybernetic Reproducibility: Eduardo Kac’s Telematic and Transgenic Art 89 Concluding Thoughts on (New) Media and Mediation: Locating the Latin American in Contemporary Technopoetics 118 Afterword: Carlos Cociña and Luis Correa-Díaz’s Scientific Technopoetics (todavía in Print) Works Cited Index

125 143 151

List of Figures

1.1 IP Poetry Project schematic 23 1.2 Robot poets (unnamed exhibition) 24 1.3 Installation: “Fin del Mundo” Biennial Exposition in Ushuaia, ­A rgentina (April 2007) 24 1.4 IP Poetry Creator 26 1.5 Online visualization of IP Poetry Project 27 2.1 Screen capture, “Árboles de textos” 44 2.2 Screen capture, “Árboles de textos” 44 2.3 Screen capture, “Árboles de textos” 45 2.4 Screen capture, “Esferas” 48 2.5 Screen capture, “Esferas” 51 2.6 Screen capture, “Bacterias argentinas” 59 2.7 Screen capture, “Bacterias argentinas” 59 3.1 Screen capture, White-Faced Bromeliads on 20 Hectares 74 3.2 Screen capture, White-Faced Bromeliads on 20 Hectares 82 3.3 Screen capture, Four Guillemets 83 4.1 Genesis translations 97 4.2 The Genesis gene 98 4.3 Cloning of the Genesis gene in plasmids 110 4.4 Bioluminescent bacteria 111 4.5 Genesis installation 112

Foreword Leonardo Flores

This book is both a celebration and a warning. It celebrates a poetic tradition that engages media and technology to explore ideas in science, engineering, social sciences, mathematics, and culture. Here, Scott Weintraub examines the work of six Latin American artists whose work explores “recent techno-cultural phenomena, literature, scientific fields (genetics, genetic engineering, neurobiology, virology, robotics, cognitive science, and AI) and the social sciences (linguistics, structural anthropology and network-systems theory).” This book reveals— and revels in—the productive cross-pollination of s­ cience, technology, and poetry. The warning emerges as you realize that the poetry and scientific discoveries discussed within require an educational ecosystem that values the contributions of poets, scientists, and scholars alike, and that this education is endangered. By showcasing the innovative work of artists who clearly come from well-rounded educational backgrounds, and highlighting moments in which scientific insight emerges from humanistic inquiry, this book reminds us of what we stand to lose by focusing education primarily on training in STEM fields. The past two decades have brought about a major refocusing of investment in education towards job creation in specific academic disciplines. In 1998, the NSF changed the name of their less-successful acronym METS (Math, Engineering, Technology, and Science) to the more metaphorically effective STEM (a palindrome of METS, no less), using it to make a renewed and more successful bid for the need for education focused on these areas. The implementation of this program has been detrimental to higher education in the United States and other countries in many ways. Cathy N. Davidson has denounced this trend in a recent book, titled The New Education (2017): These politicians and critics call for more “skills training” to make students “workforce ready.” They assume that humanities departments and programs such as women’s and gender studies are a waste of time and money. They typically argue that only skills in STEM— science, technology, engineering, and mathematics—lead to good

xii Foreword jobs and economic growth. At the level of state and federal legislatures, they justify the radical defunding of public higher education on the grounds that we should be cutting away the “frills” outside of narrow job training. This is a disaster for youth in the new economy. Specific skills-defined jobs are doomed to obsolescence fast, through outsourcing and automation. IBM is convinced use of its robots, driven by artificial general intelligence, will eliminate whole swaths of middle-class employment in the next two decades, especially in the STEM sector. Anyone who claims to know which specific skills will protect students in the future is misinformed. By excluding the arts, humanities, social sciences, and business administration, the very concept of STEM does violence to the concept of a university, an institution that gets its name from the latin word universus, meaning “whole, entire.” Students who attend universities are supposed to get a complete education that prepares them to be well-versed in all of the major areas of knowledge and develop critical thinking and communication skills, in order to contribute to society as they enter the workforce. University students learn to learn, become adaptable, gain multidisciplinary knowledge, and can integrate it in their major areas of specialization. A narrow focus on STEM education undermines this preparation and weakens the value of a university education. A scientist or engineer whose creativity has not been nurtured is less likely to harness it to make intuitive leaps and come up with innovative solutions. Without humanities education, people in the workforce or government may make the naive assumption that their world view is somehow universal, rational, and neutral, and confidently but unwittingly create policies, technologies, and works that are sexist, racist, biased, ableist, heteronormative, unethical, or oppressive in other ways, which reflects their uncritical ignorance. Without training to build strong communication skills, or training in entrepreneurship to bring innovations to market, the best ideas may never be discovered. Without understanding how societies function, the implementation of a new technology or invention can cause social, environmental, and economic upheaval. These critiques of STEM-focused education are not new and have been posed from the outset by scholars at universities around the world. Ironically enough, after 20 years of focusing investment and institutions on STEM areas, employers are not as pleased with the workers they’re hiring and are starting to realize the error of their ways. Corporations like Google are increasingly employing liberal arts majors, and requiring more complete and well-rounded education from their future employees. An indication of a societal shift is evident in the very acronym STEM, as it begins to morph into other formulations such as STEAM (STEM + Arts), STREAM (STEM + Robotics + Arts), and

Foreword  xiii STEMS2 (STEM + Social Science and Sense of Place), among others. The need for a complete education that values all areas of human knowledge is increasingly obvious to those willing to look at and heed the research, as evidenced by Prof. Cathy Davidson’s recent book. Scott Weintraub’s book also contributes to the growing discourse of interdisciplinarity by examining the work of six Latin American artists whose digital-literary practice integrates poetry, technology, and science. We don’t have to go into detail about the degrees they have received to see that they have been formed by institutions and educational experiences that allowed them to productively integrate science and technology into their poetic practice. In his examination of their poetry and poetics, Scott Weintraub wisely broadens the focus from digital poetry to “technopoetry” because the writing practices examined here engage robotics, genetics, quantum physics, and pre-digital electronic technologies, among others. His detailed analysis of their work demonstrates a multidirectional flow of information between scientific and poetic discourses and the technologies that make such integration possible in (print and digital) writing. One rich literary tradition that evidences the important cross-­ pollination between science, engineering, and literature is science ­fiction. When literary creativity is placed in conversation with scientific concepts and imagined technologies, writers can extrapolate and explore their logistical, social, and ethical implications. And this is a bi-­directional flow as the imagination that science fiction offers has inspired innovation in science, engineering, and technology. Technopoetry takes this a step further by innovating writing itself in ways that directly engage the technologies they are written with. This study, aptly subtitled ­“Scientific Explorations in New Media,” showcases works that engage scientific concepts in ways the printed word is simply unable. So while science fiction might tell stories about biological principles, some of the works discussed in this study create working models of cellular bacterial behavior as linguistic writing spaces or use genetic engineering as means of inscription to produce unique bioart. These technopoetic works extend literary traditions into new writing spaces made available by scientific and technological advances. The Latin American focus of this study is a welcome counterbalance to the neocolonialist rhetoric of global STEM education, particularly as applied to Latin America and the Caribbean. A quick Google search for “STEM education Latin America” shows great investment by nonprofit organizations to improve access to education and retention in STEM fields with the goal of stimulating economic development in Latin ­A merica. As laudable as these initiatives seem to be at face value, one needs only to examine the history of Latin America and the Caribbean and its relationship with Europe and the United States of America to be suspicious of such efforts. Education and improved access to higher

xiv Foreword education is certainly a good thing, but hopefully it doesn’t come at the cost of brain drain of a country’s best and brightest minds. Even worse, foreign investment in STEM fields can have a detrimental impact on the balance of disciplines in universities, particularly in countries with weak economies, creating even worse deficiencies in the education offered. Latin American countries aren’t passive recipients of such aid, however, and tend to resist the latest fashions in educational policy to protect their educational values. It is therefore important—essential even—to celebrate artistic and scientific work created by writers who have benefitted from a holistic education and who push the boundaries of literary tradition. Scott Weintraub’s book does that and more by focusing his study on Latin American authors writing in Spanish and Portuguese, extending the field of electronic literature itself from its overwhelmingly Anglophone canon. We have much to learn from our Latin American brethren. Truly innovative work in literature, science, and technology depends upon it.

Works Cited Davidson, Cathy N. The New Education: How to Revolutionize the University to Prepare Students for a World in Flux. New York: Basic Books, 2017. “University.” Wiktionary, The Free Dictionary. 10 February 2018, 04:02 UTC. 20 February 2018, 20:37 https://en.wiktionary.org/w/index.php?title= university&oldid=48976153.

Acknowledgements

Even the most solitary writing projects are nevertheless collective in nature. I am grateful to many colleagues and friends for help and support during the time I spent writing this book. My colleagues in the Department of Languages, Literatures, and Cultures at the University of New Hampshire—especially Holly Cashman, Daniel Chávez, Lori Hopkins, and Avary Thorne—provided constant encouragement for my interdisciplinary projects. The Center for the Humanities’ Faculty Fellowship enabled me to write a significant portion of this book while on leave during Spring 2015. Generous financial support for this project came from the College of Liberal Arts, the Graduate School, and LLC. I originally developed the proposal that would eventually become this book at UNH’s Research Engagement Academy; the feedback I received from my colleagues (and my writing coach Jeff Bolster) was vital to the early stages of conceptualizing the project. Finally, Tom Haines deserves special recognition for his friendship and commiseration during the first stage of our careers at UNH. I would like to thank a number of colleagues across the globe who have helped me to refine the ideas presented in this book. I am indebted to Osvaldo Cleger, Craig Epplin, Belén Gache, Carolina Gaínza, Ethan Haydn, Angélica Huízar, Claudia Kozak, Eduardo Ledesma, and Laura Shackleford for conversations about digital literature and related topics. Leo Flores has encouraged my work on digital poetics for years and honored me with a brilliant and ambitious foreward for this book. Claire Taylor and Thea Pitman’s pioneering work in the field of Latin American digital culture has been inspiring, and I am grateful for their support (especially in the form of letters written and feedback in writing and at conferences). I have directed two MA final projects on the topic of digital literature in Latin America, and I enjoyed working closely with Alysha Balbo and Heather Fletcher on this topic. My dear friends and colleagues Hilda Chacón and Pedro Morán-Palma read and commented on significant sections of this manuscript, and their generosity and kindness are immeasurable. The imagined and real interlocutor for very nearly all of my scholarly work is Luis Correa-Díaz, my friend, cómplice, collaborator, and biggest fan. As with my work on Juan Luis

xvi Acknowledgements Martínez, numerous ideas contained in this book are the outgrowth of memorable conversations we shared on poetry and science in the corner booth of Trappeze in Athens, Georgia. I am a restless, nomadic writer. Like much of my scholarly output, this book was written at a number of different coffee shops, bars, and libraries. I would like to thank the helpful staff at Atomic Café and Starbucks in Newburyport, the Public Library and D Squared in Exeter, as well as Book and Bar, Breaking New Grounds, and White Heron in Portsmouth. My coaches at CFFP and GBCF keep me motivated and strong. At Routledge, Michelle Salyga showed confidence in the merit and feasibility of this project. It has been a pleasure working with her, Tim Swenarton, and the Routledge team. I would like to thank the anonymous reviewers for their helpful suggestions regarding clarifications of some of the points I make here. I owe most humble thanks to the six talented artists whose work is showcased in this book: Gustavo Romano, Santiago Ortiz, Loss Pequeño Glazier, Eduardo Kac, Carlos Cociña, and Luis Correa-Díaz. They not only allowed me to reproduce material from their fascinating projects, they each corresponded with me about their work at different stages of the book. Loss, who is the director of the world-famous E-Poetry Festival, has supported my academic career for years, and has become a friend, interlocutor and collaborator. My family, of course, makes everything possible. My brother Michael is my sounding board and editor, especially when I think my ideas sound crazy. My parents Sue and Jay couldn’t be prouder of my success, measured in the intangible terms of academic merit. My wife Kacey, my go-to science consultant, explained numerous biological phenomena to me in terms I could understand and repurpose. She makes me laugh and helps me to not take myself too seriously. Finally, this book is dedicated to our three wonderful children, Quinn, Clara, and Paige. Paige’s arrival in April 2015 marked the beginning of a new phase in our lives and in my career. The manuscript grew alongside her, although, admittedly, more slowly than she did.

Introduction Latin American Technopoetics, Scientifically Speaking

I’ve often joked that poetry no longer speaks adequately to the cultural condition of the 21st Century, in part because poetry doesn’t recognize the impact of important disciplines outside its own domain of expertise: for example, I think that science has probably become the most important cultural activity that we do as a species, in part because science has the greatest potential to influence our own long term viability on the planet. I always ask my students, for example, to name their favorite, canonical work of poetry about the moon landing—and of course, they can’t, because it hasn’t yet been written; but, if the ancient Greeks had built a trireme and rowed it to the moon, you can bet that there would’ve been a 12-volume epic about such a grandiose adventure. I’m just surprised that, despite the fact that the 20th Century has seen intercontinental battles and extraterrestrial voyages that would rival the fantasies found in our epic works of classical literature, poets don’t seem willing to address the discourses of these cultural activities…. —Christian Bök (interviewed by Stephen Ross, June 5, 2011)

In a book that is primarily concerned with Latin American techno- and digital poetics, the reader may find the Classical context and epic form to which this quote refers to be a bit remote from any expected point of departure. Bök’s somewhat tongue-in-cheek commentary does, however, permit a brief reflection on the curious status of poetry’s infrequent incursions into the scientific domain, as part of a larger contextualization of those works of poetry that engage the sciences in a meaningful way. Perhaps the artists studied here have not yet composed the (virtual) equivalent of “the poem of the moon landing” to which Bök alludes, but in Latin American technopoetry there are numerous sophisticated examples of works whose scientific poetics make a strong case for a growing transdiscursive space in which to situate new media production by Latin American authors. From a larger perspective, it is crucial to recognize that the advent of digital technology has radically reshaped and reconfigured nearly all aspects of contemporary culture. In literary and cultural studies, the digital turn has begun to facilitate interdisciplinary dialogue between the sciences

2  Introduction and the humanities in ways perhaps never seen before, providing “digital humanists” with radically new objects of study and new tools with which to approach them. In order to address the rich conversation developing between disciplines often considered incompatible, this book analyzes the ways in which contemporary digital media, techno-art, literature, and cultural criticism in Latin America are informed by, and in turn inform, scientific discourses.1 The interdisciplinary approach employed in this book calls for a re-examination of the discursive frontiers that purport to separate scientific and artistic inquiry, and that also tend to privilege science’s (alleged) sovereignty over art. In this study, I argue for the creation of a transdiscursive space in which to situate a certain strain of new media poetics in Latin America: as a new and perhaps powerful or enriching bridge between the sciences and the humanities. As the first scholarly work to address the rich interface between science and digital poetics, this book makes a valuable contribution to a number of different fields, most directly as a rigorous treatment of the complex mediation of scientific discourses by literature and culture (and vice versa) from a media studies and digital humanities perspective. It thus proposes a new way to consider the relationship between (digital) poetics, science, and technology, as well as the related, complex question of techno-cultural modernity in Latin A ­ merica. In its discussion of a wide variety of online interfaces, ­installations and literary-cultural texts by Gustavo Romano (­Argentina-Spain), Santiago O ­ rtiz (Colombia-­Spain-Argentina), Loss Pequeño Glazier (USA), ­Eduardo Kac ­(Brazil-USA), Carlos Cociña (Chile), and Luis Correa-Díáz (­Chile-USA), this book ­investigates the complex dialogue that these six artists, writers, and critics create between recent techno-cultural phenomena, ­literature, scientific fields (genetics, genetic engineering, neurobiology, virology, robotics, cognitive science, and AI) and the social sciences ­(linguistics, structural anthropology and network-systems theory).2 The digital ­poetic apparatus deployed by these six artists, then, represents the most sophisticated engagement with scientific discourses to date amongst the rapidly-­expanding field of Latin American digital poetry.3 A number of terminological clarifications are needed at this juncture, especially with respect to the shifting borders delimiting the scope of the literary in the digital age. While the question is by no means new, our current modes of production and the circulation of objects that may or may not be “literary” in nature provide a unique set of challenges, as does the designation of said objects as “poetic.” The current study ­u nderstands the term “technopoetry” in a wide-reaching, inclusive sense, following Argentine critic Claudia Kozak’s claim regarding “una relación estrecha y estéticamente productiva entre la poesía y los medios técnicos que le dan su materialidad específica, así como al diálogo que la poesía establece con el entramado tecnológico del que surge” (224) [“a strictly and aesthetically productive relationship between poetry and the technological media that provide it with its specific

Introduction  3 materiality, as with the dialogue that poetry establishes with the technological framework from which it emerges4”]. Kozak refers to a study by Italian critic Caterina Davinio (Tecno-Poesia e a realtà virtuali; 2002), which ­established the term in a general sense as encompassing inter- and transmedial works outside of the realm of digital poetry, such as videopoetry, ­videoart, works that incorporated radio or the typewriter, as well as poetic forms like techno- or visual concretism, mail art, objectivism, semiotic and performance art, holopoetry, and electronic poetry, among others (Kozak 224–5). Digital poetry, claims Kozak, should be considered a subgenre of technopoetry: [está] basada en una experimentación con formas en general no narrativas que hasta cierto punto la separan de otros tipos de literatura electrónica o ciberliteratura como son la narrativa hipertextual y el ciberdrama. En tal caso, se trataría de poesía programada informáticamente que por sus recursos habilita ser leída desde la tradición poética. De todas formas, en un campo tan inestable como el de la tecnopoesía, el abordaje acerca de terminologías más o menos apropiadas y límites entre géneros resulta algo necesario pero también casi absurdo porque el propio desarrollo tecnológico con su lógica de la novedad desbarranca con nueva evidencia los intentos de limitar nombres y conceptos. (225) [[it is] based on experimentation with generally non-narrative forms, which, to a certain degree, separates it from other kinds of electronic literature or cyberliterature, such as hypertext narrative and cyberdrama. In such cases, it is a question of poetry programmed with a computer, which due to its specific features permits a reading departing from the poetic tradition. Nevertheless, in a field as unstable as that of technopoetry, the approach regarding terms more or less appropriate, or the limits between genres, is somewhat necessary but also somewhat absurd, because technological development itself, with its logic of newness or novelty, uses new evidence to frustrate attempts to limit names and concepts.] This attempt to delimit the scope and characteristics of technopoetry is useful, yet it must be further developed and historicized vis-à-vis the larger field of electronic literature. A common point of departure for examinations of the features of electronic literature involves the “born-­digital” nature of an e-literary text. A born-digital work, according to N. ­Katherine Hayles, is “a first-generation digital object created on a computer and (usually) meant to be read on a computer” (­Electronic Literature 3); poet Stephanie Strickland begins a seminal essay titled “Born Digital” by asserting that “E-poetry relies on code for its creation, preservation, and display: there is

4  Introduction no way to experience a work of e-­literature unless a computer is running it—reading it and perhaps also generating it.” “Born-­digital,” then, is often cited as a key feature of e-­literary texts, or at the very least, it is considered to be a criterion through which many critics approach this emerging form. Hayles goes on to cite the Electronic ­Literature ­Organization’s identification of electronic literature as ­including “work with an important ­literary aspect that takes advantage of the capabilities and contexts provided by the stand-alone or networked computer” (in Hayles 3). While Hayles problematizes this tautological argument r­ egarding “the literary,” she ultimately deems this move necessary, given electronic literature’s ­departure from, and continual dialogue with, the conventions of print literature. In her groundbreaking book ­Electronic Literature: New Horizons for the Literary (2008), Hayles calls attention to the digital nature of all literary texts: Except for a handful of books produced by fine letter presses, print literature consists of digital files throughout most of its existence. So essential is digitality to contemporary processes of composition, storage, and production that print should properly be considered a particular form of output for digital files rather than a medium separate from digital instantiation. (159) Therefore, following Hayles, it is clear that digitality and computation are central to all literary practice, insofar as “[c]ontemporary literature, and even more so the literary that extends and enfolds it, is computational” (85). Electronic literature, argues Hayles, has certain critical consequences that are directly linked to the confluence of scientific and humanistic discourses explored in the present study. Hayles writes: Much as the novel both gave voice to and helped to create the liberal humanist subject in the seventeenth and eighteenth centuries, so contemporary electronic literature is both reflecting and enacting a new kind of subjectivity characterized by distributed cognition, networked agency that includes human and non-human actors, and fluid boundaries dispersed over actual and virtual locations. (Electronic Literature 37) She goes on to emphasize e-literature’s creation of “recursive feedback loops” in a way that goes beyond those produced through the interaction of work and reader in a print literary work:5 Electronic literature extends the traditional functions of print literature in creating recursive feedback loops between explicit articulation, conscious thought, and embodied sensorimotor knowledge. The

Introduction  5 feedback loops progress in both directions, up from embodied sensorimotor knowledge to explicit articulation, and down from ­explicit articulation to sensorimotor knowledge. While print literature also operates in this way, electronic literature performs the additional function of entwining human ways of knowledge with machine cognitions. (135) The notion of the multifarious feedback loops created between the e-­ poetic text, machine, and embodied reader/user will be explored in detail in the following chapter, which analyzes Gustavo Romano’s IP Poetry Project. For now, we might inquire as to the links between the “new kind[s] of subjectivity” (Hayles) enacted or activated by, or in, electronic literature, and the multiple poetic traditions explicitly or implicitly invoked by the digital projects studied in this book. With respect to the designation of virtual, textual objects by Gustavo Romano, Santiago Ortiz, Loss Pequeño Glazier, Eduardo Kac, Carlos Cociña, and Luis Correa-Díaz as poetic in nature, Leonardo Flores’ definition in the “Digital Poetry” entry in The Johns Hopkins Guide to Digital Media is particularly helpful: Digital poetry is a poetic practice made possible by digital media and technologies. A genre of electronic literature, it is also known as electronic poetry or e-poetry (see ELECTRONIC LITERATURE). The technologies that shape digital media are diverse, are rapidly evolving, and can be used to such different effects that the term has expanded to encompass a large a number of practices[6]… we can define the digital poem as one that distinctively uses digital media in the creation, production, or reception performances of the poem. (Flores 155–6) And whereas Flores emphasizes that “[d]igital poetry isn’t simply poetry written on a computer and published in print or on the web” (155), Loss Pequeño Glazier—whose algorithm-driven poetics are the focus of Chapter 3—reminds us that it is important to note that digital poetries are not print poetry merely repositioned in the new medium. Instead, e-poetries extend the investigations of innovative practice as it occurred in print media, making possible the continuation of lines of inquiry that could not be fulfilled in that medium. (Glazier 26) Glazier’s study Digital Poetics: The Making of E-Poetries (2002) was groundbreaking with respect to the continuity it established between

6  Introduction innovative poetic practice and digital poetry. He is particularly concerned with the materiality of the digital object, with a digital flavor of poeisis involved in the poem-as-process: The poem is not some idealized result of thinking: the poet thinks through the poem. Similarly, investigated here is not the idea of the digital work as an extension of the printed poem, but the idea of the digital poem as the process of thinking through this new medium, thinking through making. As the poet works, the work discovers. (6) In all, Glazier summarizes the main qualities of e-poetry in the following manner: • •

•

Works that cannot be adequately delivered via traditional paper publishing or cannot be displayed on paper. This would include innovative works circulated in electronic form. Texts with certain structural/operative forms not reproducible in ­paper or in any other non-digital medium. These include works employing hyperlinks, kinetic elements, multi-layered features, and programmable elements and events. Digital media works that have some relation to twentieth-century innovative practices. (163)

Interestingly, Glazier’s explicit focus on making as techné is an especially salient link between the genealogy of experimental poetic practice and the set of approaches that comprise what is currently known as the digital humanities. This discussion is of particular relevance to the current investigation of the scientific poetics at play in a certain zone of Latin ­American digital poetics for two principal reasons. The first involves a rather sweeping generalization regarding contemporary Latin American poetry and poetics as a whole: the frequent citation and evocation of the historical avant-garde and concrete poetic traditions (in a way that recalls Glazier’s thesis regarding contemporary digital ­media’s continuity with Modernism). The second reason is that a science and technology studies approach to e-poetry facilitates the link between thinking-­making processes in Latin American digital poetics and current debates in the digital humanities, which are principally located in academic circles in the United States. Regarding the possibility of understanding poesis as making, since academic Stephen Ramsay’s delivery of a controversial position paper at a panel titled “History and Future of Digital Humanities” at the 2011 Modern Language Association Convention, there has been significant debate over his claim that “Digital Humanities is about building things. […] If you are not making anything, you are not…a digital humanist”

Introduction  7 (“Who’s In And Who’s Out”). Ramsay would soon respond to the controversy with a blog post titled “On Building,” in which he argues that: Building is, for us, a new kind of hermeneutic—one that is quite a bit more radical than taking the traditional methods of humanistic inquiry and applying them to digital objects. Media studies, game studies, critical code studies, and various other disciplines have brought wonderful new things to humanistic study, but I will say (at my peril) that none of these represent as radical a shift as the move from reading to making. Other formulations of digital humanities (DH) exist, of course, as evidenced by the explosive growth of the field vis-à-vis the founding of DH centers and institutes, available grant funding at the federal, state, and local levels, popular media coverage, and changes to tenure and promotion procedures, among other innovations in academia and beyond. A fundamental source for addressing the multifarious nature of DH approaches and methodologies can be found in the volume Debates in the Digital Humanities.7 In an essay on the disciplinary home(s) and spaces of DH, Matthew Kirschenbaum asserts that the digital humanities “is more akin to a common methodological outlook than an investment in any one specific set of texts or even technologies,” and emphasizes the social nature of collaborative work across more traditionally defined disciplines. In her contribution to the volume, Kathleen Fitzpatrick cites her own July 2010 blog post for the Chronicle of Higher Education on the topic, defining the digital humanities as a nexus of fields within which scholars use computing technologies to investigate the kinds of questions that are traditional to the humanities, or, as is more true of my own work, as traditional kinds of humanities-oriented questions about computing technologies. At the same time, her updated piece in Debates in the Digital Humanities accounts for the ways that technology impacts all aspects of humanities scholarship, as well as the tension between those scholars who create digital objects (of a creative and/or academic nature) and those who primarily interpret digital materials via more traditionally-­conceived humanistic methodologies. In the context of my own approach to the DH questions at issue in the current study, I would like to briefly gloss Ramsay’s bold final statement regarding “making” or “building,” which Fitzpatrick roughly maps onto the theory-practice debate that has existed for many decades in academia.8 First, the “flavor” of DH most directly engaged in Latin ­American Technopoetics: Scientific Explorations in New Media is the field of science and technology studies (STS), a discipline that, according

8  Introduction to Alan Liu, is “curiously underrepresented in both new media studies and the digital humanities even as they are clearly relevant in a way represented by such scholars as N. Katherine Hayles and Tim Lenoir” (“The Meaning of the Digital Humanities” 410). Liu explains the relevance of this subfield to DH approaches in the following manner: any quest for stable method in understanding how knowledge is generated by human beings using machines founders on the initial fallacy that there are immaculately separate human and machinic orders, each with an ontological, epistemological, and pragmatic purity that allows it to be brought into a knowable methodological relation with the other—whether a relation of master and slave, cause and effect, agent and instrument, or other. (416) The notion of a “knowable methodological relation” between human and non-human realms,9 between the arts and the sciences—to paraphrase Liu and to extend the scope of his claims a bit—is part and parcel of the transdiscursive space in or upon which this book constructs its argument. The methodology employed here goes beyond Ramsay’s remark about the application of “traditional methods of humanistic ­inquiry…to digital objects.” This is due, at least in part, to an important distinction in praxis regarding the poets and digital artists whose work is analyzed here. The poetic projects studied in the following chapters do not simply appropriate terminology and tropes from the sciences; rather, the poetic machines built by these technopoets employ humanistic methods which, in turn, infuse the digital poem’s scientific imaginary with new potentialities and approaches. That is to say, this book’s approach to the ­complex relationship between science and poetry is bidirectional in nature, and does not resemble, for example, the premises underlying Daniel Albright’s book Quantum Poetics: Yeats, Eliot, Pound and the Science of Modernism. In this study, Albright analyzes the pseudomorphism (a term he borrows from Theodor Adorno’s Philosophy of Modern Music) between poetry and physics: “the remapping of the theory of poetry on models supplied by physicists” (2). Albright’s interest here is in “the appropriation of scientific metaphors by poets” (1), which implies a one-­ directional flow of concepts and discourses. Poets like Rae ­A rmantrout, on the contrary, offer a different perspective on the relationship between poetry and the sciences. Armantrout, for example, highlights the role that figurative language plays in scientific formulations: metaphor is “always already” embedded in the language of science. The language of physics, in particular, is math. When a physicist tries to tell us about quantum mechanics, he/she has to use metaphor. What does it mean, for instance, to say that an electron has

Introduction  9 “spin?” It doesn’t mean that an electron is very like a top. I think one can question the metaphors used by scientists without necessarily doubting that they are describing something real. (“Metaphor or More?”) Armantrout’s reflections on metaphor and its importance to scientific inquiry and discovery are well-taken, and subsequent chapters on S­ antiago Ortiz’s visualization of the links between everyday langauge and scientific terminology and Eduardo Kac’s genetic “translations” will engage with this question of the “embeddedness” of scientific imaginaries in language. Armantrout’s statements also recall quantum physicist W ­ erner Heisenberg’s discussion of the relationship between natural language and scientific concepts.10 In his seminal work Physics and Philosophy (1958), Heisenberg writes: When we represent a group of connections by a closed and coherent set of concepts, axioms, definitions and laws which in turn is represented by a mathematical scheme we have in fact isolated and idealized this group of connections with the purpose of clarification. But even if complete clarity has been achieved in this way, it is not known how accurately the set of concepts describes reality. These idealizations may be called a part of the human language that has been formed from the interplay between the world and ourselves, a human response to the challenge of nature. (116–7) Heisenberg goes even further in a key moment in the book: f­ ollowing his discussion of the inadequacy of mathematical formalisms to ­explain quantum theory, he quotes Goethe’s Faust at some length. Amy ­Catanzano glosses the German physicist’s literary moment in the ­following manner: where Mephistopheles says that while formal education instructs that logic braces the mind “in Spanish boots so tightly laced,” and that even spontaneous acts require a sequential process (“one, two, three!”), in truth, “the subtle web of thought / Is like the weaver’s fabric wrought, / One treadle moves a thousand lines, / Swift dart the shuttles to and fro, / Unseen the threads unnumber’d flow, / A thousand knots one stroke combines.” Heisenberg is arguing, of course, that science must be as attentive to imagination as to logic, but he also seems to be suggesting something extraordinary: that novel sciences must have novel languages beyond mathematics that can be used to describe them. To my mind, art/poetry have the ability to not only describe novel theories and expressions of physical reality but invent them as well. (“Metaphor or More?”)

10  Introduction In a somewhat similar vein, in his call for a “post-poetry poetics” in the Hispanic world as a whole, Spanish writer Agustín Fernández Mallo remarks that la ciencia, como las artes, no es el mundo, sino una representación del mundo, y como tal representación es ficción. Nadie debe ser ingenuo como para pensar que las manzanas caen como lo describen las leyes de Newton, ni que los electrones vuelan como lo describe la mecánica cuántica. Son modelos teóricos, sólo eso. (19) [science, like the arts, is not the world, it is but a representation of the world, and as a representation it is fiction. No one should be so naïve as to think that apples fall in the ways that Newton’s laws describe, nor that electrons fly in the manner described by quantum physics. They are theoretical models, nothing more.] Whereas Fernández Mallo deals with theoretical models in this example, the entire statement hinges around the link between representation and fiction. The question of literary figuration and its centrality to the creation of scientific imaginaries is a major topic of discussion in this book’s analyses of electronic literary texts, and is particularly important to my claims regarding the bidirectional flow of information between humanistic and scientific discourses.11 Turning to the specific readings undertaken in this book, Chapter 1, “Autopoiesis and Robopoetics: Gustavo Romano’s IP Poetry Project,” analyzes visual artist Romano’s online and real-time installation that interface collects snippets of text (“poems”) from the internet—fragments based on user-entered data or pre-generated poems, in the case of an installation. Its four internet-connected automaton-bots, each endowed with the image of a human mouth on a TV screen, recite the generated poems (composed of phonemes “learned” by the machines) on screens displayed at public performances or installations. According to Romano, The IP Poetry Project studies the role of poetry and of poets themselves. On the one hand, as far as the construction of the robots is concerned, it highlights the increasing subjectivity of technology, which is endowed with certain artificially enhanced human characteristics (in this case, memory, and the ability to speak and listen). On the other hand, as concerns the resulting poetic structures, it uses the virtual arrangement of the collective human memory found on the Internet to compose poetry that has both mechanical and random elements. (IP Poetry Project 105)

Introduction  11 My reading of Romano’s recursive robopoetics, as poetry composed through the interaction of structurally coupled elements (including user, bots, interface, poems, internet search, etc.), seeks to classify the autopoietic organization of the project, following pioneering work by ­Chilean biologists Humberto Maturana and Francisco Varela in the context of evolutionary biology and systems theory. Santiago Ortiz summarizes Maturana and Varela’s main contributions in the following manner: …desarrollaron un autómata celular con el cual pueden expresar y poner a prueba aspectos de sus teorías en torno a la autopoiesis y la cognición. Este autómata genera patrones que bajo cierta interpretación mantienen una coherencia a la vez que intercambian información con el exterior…Para ellos vida es cognición. De esta forma presentan el autómata celular no como un modelo de la vida sino como una metáfora, un apoyo lingüístico (“gramatrama”). […they developed a cellular automaton through which they could express and test aspects of their theories regarding autopoiesis and cognition. This automaton generates patterns that, according to a certain interpretation, maintain closure while exchanging information with its exterior…For them life is cognition. In this way they present the cellular automaton not as a model of life but as a metaphor, as a linguistic support.] Following a brief elaboration of the intricacies of Maturana and Varela’s theory of autopoiesis, my analysis of the IP poetic interface postulates the cognitive function of a “languaging” system which, according to Maturana and Varela’s theoretical framework, is a living system. In this way Romano’s IP bots are, as artist Belén Gache argues, “machines with human mouths,” which poetically demonstrate how humans are also, in turn, “talking machines” (IP Poetry Project 105). ­ omplexity: The second chapter, “The Poetics of Visualizing Scientific C Santiago Ortiz,” analyzes several online artistic and theoretical works by this Colombian digital artist who currently resides in San ­Francisco, California. In the first section I explore the literary and aesthetic ­features of his projects “Árboles de textos” [“Textual Trees”] and “esferas” [“spheres”] in terms of what Joanna Drucker has called “speculative computing.” My discussion of the interdisciplinary character of Ortiz’s “Textual Trees” and “spheres” focuses on the ways in which the visual and interactive nature of these two works seeks to fundamentally challenge critical notions about the literary character of digital media (as a consequence of the paradigm shift from digital humanities to speculative computing, as Drucker ­ etween (human) reader and maargues). Here, I discuss the interaction b chine in Ortiz’s literary-visual interfaces, as an encounter that constitutes the textuality of this feedback loop between programmer, text and (e-)

12  Introduction reader. I am particulary interested in elaborating the ways in which key ideas from cognitive science, mathematics, formal logic, (literary) combinatorics, literary theory, linguistics, genetics, and evolutionary biology converge in Ortiz’s online projects. By exploring the interplay between science, technology, and poetics in Ortiz’s work, I propose several ways in which we might rethink our conceptualization of the posibilities of humanistic inquiry in light of Ortiz’s scientific poetics. In a subsequent discussion of Ortiz’s project “bacterias argentinas” [“Argentine bacteria”], my analysis of Ortiz’s digital projects is principally focused on the applicability of autopoietic and linguistic-­phylogentic theoretical models—which Ortiz develops in “spheres” and “gramatrama”— to the autopoietic universe of his “Argentine bacteria.” I describe the ways in which the linguistic-multicelluar environment of “Argentine bacteria” models the interactions of basic organisms in a trophic network of words in its virtual and autopoietic ecosystem. I discuss the transdiscursive character of this attempt to create a visual model of the exchange of genetic and literary “information,” as well as a way to facilitate bidirectional exchange between discourses frequently considered to be on unequal ­footing: the arts and science. Ortiz’s technopoetic projects, then, provide us with an especially innovative and interdisciplinary visualization of the mediation of scientific discourses by literature and culture. The third chapter focuses on the workings of a “quantum mechanism” in Loss Pequeño Glazier’s digital poetry.12 Through close readings of two of Glazier’s algorithmic poetic works—titled White-Faced ­Bromeliads on 20 Hectares and Four Guillemets—I develop a “quantum poetics of variant strings,” which links digital poetry’s programmatics of quantum superposition with Glazier’s own emphasis on “variant protocols” and palimpsestic textualities. I argue that the variance at play in Glazier’s multi-valent poetic variants illustrates the principle of quantum superposition in a very non-metaphorical way, showing that the time of reading(s) in Glazier’s programmable poem converges and diverges around a series of poetic possibilities, according to probabilistic algorithms. Glazier’s poetry thus creates multiply connected space-times that are materially and immaterially spliced together. In this way, I conclude that the literary dynamics of his writing contributes to an ongoing and enriching conversation between artistic and scientific discourses. The book’s final chapter, titled “Genetic Engineering as Poetic ­Creation: Eduardo Kac,” undertakes a technopoetic analysis of the well-known ­Brazilian artist’s telematic and transgenic projects.13 I examine Kac’s online and real-time installations “Time Capsule” (1997), “A Positive” (1997), and “Genesis” (1999) in order to analyze major works by one of the most sophisticated, interdisciplinary artists working today. My reading of “Time Capsule” and “A Positive” elaborates a new formulation of what I call Kac’s poetics of skin. With respect to Kac’s transgenic work ­“Genesis,” on the other hand, this chapter takes a multidisciplinary (digital humanities, STS,

Introduction  13 and media studies) approach to the question of translation and translatability in this groundbreaking artwork. All in all, my discussion of Kac’s oeuvre shows how a certain zone of contemporary art seeks to challenge ­traditionally-conceived boundaries between the human and the non-­ human, the living and the non-living, as well as aesthetics and technology. His work therefore “brings to life” the way that poetics (both digital and analog) and scientific discourses interact with, nurture, and constantly modify or transform each other. The study concludes with a series of theoretical re-evaluations of science’s dependence on literary figuration in its creation of models, ­especially with respect to the question of interpretation as mediation. Following Johanna Drucker, I argue that design is in fact a form of m ­ ediation; we might also consider Katherine Hayles’ claim that “by changing how the work means, such a move alters what it means” (My Mother Was a Computer 90). The second question addressed in the ­conclusion is the outgrowth of a series of equally serendipitous and intellectual decisions. At some point while I was writing this book, I was struck by the fact that none of the poets whose work I was studying—in a book ostensibly on “Latin ­A merican technopoetry”—actually resided in a Latin American country at that time. The tension between physical and virtual cartographies, then, quickly rose to the forefront of my argument. More specifically, I asked myself, “what justification exists for framing this book in terms of ‘Latin American poetry’ if three of the artists studied here left South America (Romano, Ortiz, and Kac) for Spain or for the U.S. and the remaining poet—born in San Antonio, Texas—has spent the vast majority of his life in the U.S.?” I therefore address the issue of the virtual and lived places or sites of current digital poetics in the book’s conclusion. It draws, in particular, on recent work by Claire Taylor and Thea Pitman in its analysis of the non-place of Latin ­A merican technopoetics, especially in their book Latin American Identity in Online Cultural Production. As a preliminary response to the question of virtuality and identity, we might say that each of these poets writes with a positionality that departs from a specific cultural, linguistic, and geographic cartography that is marked and transected by “the Latin American” in a particular way. Following Taylor and Pitman, the conclusion argues that technopoetic projects by Gustavo Romano, Santiago Ortiz, Loss Pequeño Glazier, and Eduardo Kac articulate a praxis of “Latin American-ness,” since their work is postregional in nature and thoughtfully engages “tropes and discourses of ‘Latin American-ness’” (Taylor and Pitman, Latin American Identity in Online Cultural Production 21). Finally, a brief afterword reflects on the innovative ways in which scientific technopoetics can take new forms in the “old” medium of print, through close readings of digital poetics (either still in print or situated at the interface of the analog and the digital) by Carlos Cociña and Luis Correa-Díaz. In all, the case studies included in Latin American Technopoetics argue for the existence of

14  Introduction an interdisciplinary “Latin American scientific technopoetry.” This categorization might initially appear to be narrowly conceived or highly specialized, but it in fact provides a useful heuristic with which to approach the increasingly visible intersections of Latin American literature, new media studies, digital humanities, and science and technology studies.

Notes 1 It is important to recall that science fiction has established a fascinating dialogue between science, technology, and literature. The interdisciplinary conversation produced in this outgrowth of Enlightenment rationalism (and further developed with the novel’s increased prominence in the nineteenth-­ century literary world) has indeed sustained a rich exchange between many fields, including robotics, sociology, engineering, physics, genetics, literature, and philosophy, among many others. I would like to thank Pedro Morán-Palma for reminding me of the intimations of science fiction haunting a great deal of my manuscript. 2 A subsequent discussion of postregional digital art and culture makes the case for the “Latin American” affiliation I use as a descriptor for these six artists, despite the fact that only one of them currently resides in Latin America. In a way, their diasporic work bridges the gap between technologies of the North and technologies of the Global South. And while a term like “Global or Diasporic Latin(o) American digital artists” might better suit the positionality of the creators whose work is analyzed in detail in this book, it is far too cumbersome and—as I will argue in the book’s conclusion (drawing on work by Claire Taylor and Thea Pitman)—their writing takes “Latin-Americanness” as a point of departure from a specific cultural cartography that is marked and transected by “the Latin American.” 3 Several Latin American poets and artists have explored scientific topoi in highly innovative ways, yet it is noteworthy that they often approach the question of the technological and the digital from within the confines of the traditional book itself. We might say that the Latin American trajectory begins in the historical avant-gardes with works like Oliverio Girondo’s Veinte poemas para ser leídos en el tranvía (1922) and Vicente Huidobro’s ­Altazor (1931). ­ eruvian poet ­Carlos A more recent scientific-digital poetics can be found in P Germán Belli’s landmark book ¡Oh, hada cibernética! (1961) and Chilean poet and visual artist Juan Luis Martínez’s La nueva novela (1977), to pick two well-known examples. The lineage of scientific poetics continues through ­Eduardo Kac’s early (multi-media) work (see Chapter 4), performance pieces by ethno-­techno cyborg and border artist Guillermo Gómez-Peña (in works like his “Tech-Illa Sunrise” (2001)), Silvia Veloso’s (Spain-Chile) envisioning of the relationship between a machine and its creator in Escritura en caos y máquina: la educación sentimental de la inteligencia artificial (2003), some pieces contained in Argentine-Spanish visual artist Belén Gache’s Flash book-object Word Toys (2006), and, most recently, Luis Correa-Díaz’s (Chile-USA) bilingual explorations of new technologies and the poetic self in his Cosmological Me (2010) and Clickable Poem@s (2013) (discussed in the Afterword). At issue is also the profound questioning of human agency in artistic creation and machine consciousness, most deeply explored by Gustavo ­Romano (Chapter 1), Gache, Eugenio Tisselli (Mexico), and Eduardo Navas (El Salvador-USA), who works on sampling and remix. That said—and as I will suggest below—the six writers included in the present study are of particular interest not only because

Introduction  15 of the depth of their engagement with digital poetics and science, but also due to the reinscription of a certain resistant Latin American praxis in their digital-­ scientific poetics, as I argue in the book’s conclusion. 4 All translations are mine, unless otherwise indicated. 5 In the Introduction to Electronic Literature, Hayles summarizes the long-standing discussion regarding the problems associated with using the hyperlink as a central criterion for the identification of electronic literature, as early studies of e-lit tended to do. She particularly highlights work by George Landow and Jay David Bolter, in which these two critics claimed that electronic literature was distinguished by its use of the hyperlink. Hayles remarks that “print texts had long ago employed analogous technology in such apparati as footnotes, endnotes, cross-reference, and so on, undermining the claim that the technology was completely novel” (31). She also—as numerous other critics have done since the publication of books like Landow’s Hypertext and Bolter’s Writing Space– dismisses the claim that the hyperlink imbues the reader with freedom or power to construct her own text, citing Espen Aarseth’s assertion that “the reader/user can only follow the links that the author has already scripted” (Hayles 31). 6 It is true that there exists a certain fuzziness in these formulations regarding the generic and stylistic frontiers purporting to separate, for example, digital poetry from computer games, online performance art, visual artworks, etc. To wit, Hayles acknowledges this messiness in the following manner: Like the boundary between computer games and electronic literature, the demarcation between digital art and electronic literature is shifty at best, often more a matter of the critical traditions from which the works are discussed than anything intrinsic to the works themselves. (12) Her point regarding the genealogical lines drawn by the works themselves is well-taken, and is particularly salient when considered with respect to G ­ lazier’s claim (cited below) that e-poetry (and contemporary digital media practice as a whole) dialogues with innovative, Modernist and avant-garde poetic practice. 7 This volume was first published in 2012 in a print form and was subsequently released in an open-access edition (2013) that allows for reader comments and interaction through a social media platform. A third, updated edition was released in May 2016. 8 Fitzpatrick writes: It’s certain that there’s an overlap between [rhetoric and composition, digital media studies, and other fields of humanistic inquiry] and that which has been called digital humanities—between scholars who use digital technologies in studying traditional humanities objects and those who use the methods of the contemporary humanities in studying digital objects—but clear differences lie between them. Those differences often produce significant tension, particularly between those who suggest that digital humanities should always be about making (whether making archives, tools, or new digital methods) and those who argue that it must expand to include interpretation. I should also acknowledge here that Ramsay is talking about building tools for textual analysis, which is not the same thing as building machines that “compose” poetry. With this in mind, I will return to the question of design as mediation in digital poetics in a subsequent chapter, as I firmly believe that the objects of study in this book can be understood by employing some of the methodologies and ideas of the digital humanities.

16  Introduction 9 Two important studies by N. Katherine Hayles come to mind here. The first is The Cosmic Web: Scientific Field Models and Literary Strategies in the Twentieth Century; the second is How We Became Posthuman: Virtual Bodies in Cybernetics, Literature, and Informatics. 10 See Hayles’ The Cosmic Web (esp. pp. 19–21) for a particularly clear discussion of the limits of natural language’s ability to describe the world. 11 In an article titled “Imagining Braneworlds in String Theory Technical Discourse,” Sean Miller extends ideas from Michèle Le Doeuff’s book The Philosophical Imaginary towards an examination of scientific realism and the occasionally tense relationship between concept and image. Whereas the Conclusion treats this topic in more detail, for now it is helpful to quote Miller on the notion of a scientific imaginary: One may then also identify a scientific tradition by the continuity of its imaginary from text to text, generation to generation. In effect, a ­scientific tradition necessarily includes a repository of stock imagery that provides a scaffolding for structuring both affect and ideological possibility. (79–80) 12 I should acknowledge that Glazier’s inclusion in a project overtly framed as “Latin American” in nature is somewhat problematic at first glance. G ­ lazier is of Mexican-American heritage; his mother is of Mexican origin and he grew up in San Antonio, Texas. Glazier is indeed an excellent speaker of Spanish and works collaboratively with a translator and friend—Néstor Cabrera Quesada—on some of his more intensive multi-lingual poetic and academic projects. In the conclusion, I argue that several of the poets whose work I study in this book articulate a specific cultural, linguistic, and geographical positionality that is marked and transected by “the Latin American.” 13 Telematic artworks involve computer networks and telecommunication devices (such as videoconferencing or the internet) in their transmedia exploration of locality and user-system feedback loops. In an essay simply titled “Transgenic Art,” Eduardo Kac describes this “new art form based on the use of genetic engineering techniques to transfer synthetic genes to an organism or to transfer natural genetic material from one species into another, to create unique living beings.”

1 Autopoiesis and Robopoetics in Gustavo Romano’s IP Poetry Project 1

In the epilogue to his recent book Uncreative Writing: Managing ­Language in the Digital Age, Kenneth Goldsmith glosses poet and critic Christian Bök’s insightful analysis of robopoetic composition, arguing that computer code composed of an alphanumeric language could be programmed and (h)activated for literary production. In fact, Bök’s prognostications project a robopoetic futurity that has, in a sense, always already arrived: We are probably the first generation of poets who can reasonably expect to write literature for a machinic audience of artificially intellectual peers. Is it not already evident by our presence at conferences on digital poetics that the poets of tomorrow are likely to resemble programmers, exalted, not because they can write great poems, but because they can build a small drone out of words to write great poems for us? If poetry already lacks any meaningful readership among our own anthropoid population, what have we to lose by writing poetry for a robotic culture that must inevitably succeed our own? If we want to commit an act of poetic innovation in an era of formal exhaustion, we may have to consider this heretofore unimagined, but nevertheless prohibited, option: writing poetry for inhuman readers, who do not yet exist, because such aliens, clones, or robots have not yet evolved to read it. (Bök, “The Piecemeal Bard is Deconstructed: Notes Toward a Potential Robopoetics” 17) Robopoets therefore endeavor to writ[e] a type of literature readable by other bots. And as a result of networking with each other, their feedback mechanism will create an ever-evolving, sophisticated literary discourse, one that will not only be invisible to human eyes but bypass humans altogether. (225)2 Truly, if Bök deems the poet to be “a virtually vestigial, if not defective, component in the relay of aesthetic discourse” (10), Italo Calvino had already claimed, nearly 50 years ago (1967), that “[w]riters, as they have

18  Autopoiesis and Robopoetics always been up to now, are already writing machines” (15).3 Calvino’s Oulipian wisdom is particularly prescient here in the context of digital poetics; nevertheless, the brief discussion of robopoetics alluded to here (and developed below)4 can be reframed in more strictly (neo-)cybernetic terms, by way of a case study of a (robo-)poetic project that incorporates machines reciting poetry composed via Internet searches: the IP Poetry Project, created by Gustavo Romano, an Argentine visual artist who currently resides in Madrid and is part of the art collective findelmundo [endoftheworld] (1996–).5 His digital projects and real-time installations have been exhibited in numerous museums and galleries in Asia, the United States, Europe, and Latin America, and Romano is a former director of the Spanish Cultural Center in Buenos Aires’ Media Lab, as well as curator of the netart project NETescopio (of Badajoz, Spain’s Museo Extremeño e Iberoamericano de Arte Contemporáneo (MEIAC); http://netescopio.meiac.es/).6 Among the many grants and prizes Romano has won, two are of particular significance: the Vida 7.0 competition’s Premio Incentivo [Incentive Prize] for new productions (given by Spain’s Fundación Telefónica; 2004) and the prestigious John Simon Guggenheim Memorial Foundation Fellowship (2006). Romano is therefore one of the most prominent experimental, visual artists working in the Hispanic world today, and—as the subsequent analysis of the IP Poetry Project will reveal—his work’s sophisticated dialogue with a number of scientific discourses makes for an illuminating initial approach to Latin American technopoetics. At its core, the IP Poetry Project seeks to explore the multifaceted relationship between the poet, poetry, and technology. As Romano explains, On the one hand, as far as the construction of the robots is concerned, it highlights the increasing subjectivity of technology, which is endowed with certain artificially enhanced human characteristics (in this case, memory, and the ability to speak and listen). On the other hand, as concerns the resulting poetic structures, it uses the virtual arrangement of the collective human memory found on the Internet to compose poetry that has both mechanical and random elements. (IP Poetry Project 106) As a theoretical lens for the present study of the IP Poetry’s literary machines—given the robopoetic context in which this exploration of the (conditions of possibility of) literary writing by robotic entities is framed—this chapter engages the neocybernetic formulation of the concept of autopoiesis, whose development enacted a paradigm shift in biology and systems theory in its radical reformulation of the definition of living systems.7 This chapter, then, begins by tracing out the

Autopoiesis and Robopoetics  19 conceptual framework of Humberto Maturana and Francisco Varela’s formulation of autopoiesis.8 After recounting the most significant contributions made by Maturana and Varela’s early formulations of autopoietic theory, this chapter explicates key features of Gustavo Romano’s IP Poetry Project in order to explore the critical consequences of analyzing the structurally-­coupled elements of the robopoetic IP bots as an autopoietic system. As the first case study included in Latin American ­Technopoetics, this chapter therefore functions as a kind of a thought experiment that considers Romano’s experimental “writing machines” as a way to provide crucial insight into the scientific potentiality present in this zone of Latin American poetic exploration. The term autopoiesis, from the Greek for “self-creation” or “self-­ production,” was first coined by Chilean biologists Humberto ­Maturana and Francisco Varela in the early 1970s.9 The theory was originally developed in the context of the effort to revise the definition of living systems, and it describes the organization of the living by way of its individual ­autonomy as well as its production and maintenance of the components necessary for the continuation of its life processes. I­ nterestingly, the need for a concise term encompassing the notion of the “circular ­organization of the living” found its resolution in a literary encounter—a discussion of Chapter ­XXXVIII of the first volume of Don Quijote, as Maturana recounts: It was in these circumstances that one day, while talking with a friend (José Bulnes) about an essay of his on Don Quixote de la Mancha, in which he analyzed Don Quixote’s dilemma of whether to follow the path of arms (praxis, action) or the path of letters (poiesis, creation, production), and his eventual choice of the path of praxis deferring any attempt at poiesis, I understood for the first time the power of the word “poiesis” and invented the word that we needed: autopoiesis. This was a word without a history, a word that could directly mean what takes place in the dynamics of the autonomy proper to living systems. Curiously, but not surprisingly, the invention of this word proved of great value. It simplified enormously the task of talking about the organization of the living without falling into the always gaping trap of not saying anything new because the language does not permit it. We could not escape being immersed in a tradition, but with an adequate language we could orient ourselves differently and, perhaps, from the new perspective generate a new tradition. (xvii) Maturana’s observations regarding the poetic (poietic) nature of the “organization of the living” represent a key moment in cybernetic thinking, and are particularly germane to our present literary-scientific investigations.10 It is significant that this story highlights the literary and even

20  Autopoiesis and Robopoetics quixotic aspects of the origin of the concept of autopoiesis, whose formalization in the book Autopoiesis and Cognition [De máquinas y seres vivos: organización de lo vivo] (197211) revised the definition of living systems. The basic, mechanistic model of the cell is paradigmatic for Maturana and Varela’s conceptualization of life through autopoiesis. They describe an autopoietic machine as follows: a machine organized (defined as a unity) as a network of processes of production, transformation and destruction of components that produces the components which: (1) through their interactions and transformations regenerate and realize the network of processes (relations) that produced them; and (ii) constitute it as a concrete unity in the space in which they exist by specifying the topological domain of its realization as such a network. (135)12 Katherine Hayles’ How We Became Posthuman: Virtual Bodies in ­Cybernetics, Literature, and Informatics is particularly helpful in unpacking Maturana and Varela’s dense prose. She writes that, according to Maturana and Varela, reality (or at least what we consider reality, in a quotidian sense) “comes into existence for us, and for all living creatures, only through interactive processes determined solely by the organism’s own organization” (136). This is a result of the circular nature of the system’s organization, which closes in on itself in a self-reflexive and self-making circularity. Whereas Maturana and Varela’s examples tend to come from cell biology, Hayles provides a clear example of the Chilean scientists’ avoidance of anthropomorphic assumptions and prejudices in a more large-scale example: Seeing system and medium together over a period of time, observers draw connections between cause and effect, past and future. But these are the observers’ inferences; they are not intrinsic to the autopoietic processes in themselves. Let’s say I see a blue jay flash through the trees and settle on the birdbath. I may think, ‘Oh, it’s getting a drink.’ Other species, for example those lacking color vision, would react to this triggering event with different constructions. A frog might notice the quick, erratic flight but be oblivious to the blue jay at rest. Each living system thus constructs its environment through the ‘domain of interactions’ made possible by its autopoietic organization. What lies outside that domain does not exist for that system. (137) In this way, in Maturana and Varela’s radically constructivist, early work (especially in Autopoiesis and Cognition) there is no concept of an objective reality: the construction of what one might call “reality” by

Autopoiesis and Robopoetics  21 living systems is a function of the specificity of their autopoietic organization, insofar as the external world “triggers13” responses in the organization of the autopoietic system. In Hayles’ example about the blue jay and the frog, we could say that for the human observer the event of the blue jay’s incursion into her visual field triggers one specific response (in this case, culminating in the thought regarding the bird’s thirst). In terms of the perturbation of the frog’s autopoietic closure, the disruption in the visual field produced by the bird’s flight concludes when the blue jay alights on a branch, since a frog’s neural cortex is not stimulated by objects at rest.14 In this way, the external world triggers a response from the autopoietic system and thus provokes reactions in the system’s organization. This argument avoids the infinite regressions of solipsism, at least according to Maturana, since the domain of interactions between autopoietic systems, “structurally coupled” in the specific terminology of the two Chilean biologists (meaning engaged with each other and co-evolving), is the space of the construction of a shared environment.15 In other words—and turning to their somewhat odd formulation of language and linguistic interaction—it is in these overlapping domains between structurally-coupled human beings where linguistic phenomena take place. Language thus is considered to be a perception-like phenomenon triggering a response from another system. Significantly, in his later writings (in the 90s), Maturana would opt for the gerund “languaging” instead of the noun “language,” thus ­highlighting the way in which language is conceived of as a trigger that causes autopoietic systems to become structurally coupled (Hayles 147), rather than as a stable code or source of information with an external reality all “its” own. One might also argue that despite Maturana and Varela’s idiosyncratic (or at least unfamiliar) definitions of terms like organization, structure, language, and reality, they made a strong and influential case for a new way to address the observer problem in systems theory. In an essay titled “ ­ Biology of Cognition,” Maturana writes that: “The observer is a living system and any understanding of cognition as a biological phenomenon must account for the observer and his role in it” (Autopoiesis and ­Cognition 48).16 Famously, Autopoiesis and Cognition argued that “living systems are cognitive systems, and living as a process is a process of cognition. This statement is valid for all organisms, with or without a nervous system” (13). Living systems are recursive insofar as they interpolate other living systems through a shared domain. These systems are also reflexive given that they demonstrate self-consciousness. As ­Katherine Hayles has suggested in this context, “The observer generates self-­consciousness…when he endlessly describes himself describing himself” (144–5)—thereby characterizing self-consciousness as a linguistic ­epiphenomenon subordinate to autopoietic processes. Or, in terms of cognition, according to Hayles, “For autopoiesis, cognition emerges from the recursive operation of a system representing to itself its own representations” (156). An observer

22  Autopoiesis and Robopoetics makes distinctions, but is not (necessarily, completely) “outside” the system being observed; as Randall Whitaker writes, “[t]hrough the recursive distinguishing of entities through action, the observer is ‘…able to operate as if external to (distinct from) the circumstances in which he finds himself’” (Maturana, “The Organization of the Living: A Theory of the Living Organization.” 315). This summary of Maturana and Varela’s early attempt to redefine the classification of living systems offers an innovative way to reassess a key question posed by Belén Gache in the context of Gustavo R ­ omano’s IP Poetry Project. In her essay titled “On Non-Human Poems and Talking Heads,”17 internationally renowned visual artist Gache (who is married to Romano and is also a member of findelmundo), inquires: “Their bodies may consist of different technological gadgets, but their mouths retain a human shape. Are they machines with human mouths, or is man a talking machine instead?” (IP Poetry Project 117) Gache’s question deals with the evolution of non-human (or perhaps “merely” posthuman) readers of poetry, like those predicted by Bök, and also reverses the (purported) binary opposition of human and machine. With this as our guiding question or heuristic, we can now undertake a detailed examination of the organization and functioning of the IP Poetry Project in order to evaluate the applicability of the autopoietic model to the IP poetic system. At the very least, an interrogation of specific philosophico-­linguistic themes vis-à-vis autopoietic theory’s formulation of cognition, consciousness, life and language (poetic or not) will permit a more rigorous approach to the IP Poetry Project’s quasi-linguistic system in terms of a living machine that perhaps thinks and even has self-consciousness. In a way, my analysis of the IP Poetry Project will show that the IP bots are “machines with ­human mouths” as much as “man is a talking machine” (IP Poetry ­Project 117), to rephrase Gache’s provocative statement, cited above. As Romano describes in the IP Poetry Project’s MEIAC exhibition catalogue, the robopoetic apparatus is composed of “a software and hardware system that uses text from the Internet to generate poetry that is then recited in real time by automatons connected to the web” (105). The textual fragments composing the poems themselves are a combination of phrases entered by users and information drawn from Internet searches. With respect to the setup for exhibitions and installations of the IP Poetry Project—which have taken place in Portugal, Spain, the United States, Argentina, France, Uruguay, and China—Romano writes: The recitals will be performed at various public venues. Using a proximity sensor, the system detects the presence of an audience and sends a command to the robots to start reciting the poems especially created for each event. At that point the Internet search begins. The results are sent to the automatons (IP Bots), which convert the search results into the pre-recorded sounds and images of a moving human mouth.

Autopoiesis and Robopoetics  23 As new text appears on a daily basis on the web, the poems recited maintain their structure, but the varying search results ensure a poem is never recited in the same way twice. (105) He illustrates these multiple feedback loops in the following manner (Figure 1.1): The recital of poems by the four automaton-bots connected to the Internet is the element that truly captures the attention and imagination

Figure 1.1  I P Poetry Project schematic.

24  Autopoiesis and Robopoetics of the spectator; the following image, taken from the assembly phases of an unnamed exhibition (unidentified in the MEIAC catalogue), is a photograph of the robot poets (Figure 1.2). The next image is taken from an outdoor installation at the April 2007 “Fin del Mundo” Biennial Exposition in Ushuaia, Argentina, which was situated on the banks of the Beagle Canal in Patagonia (Figure 1.3).

Figure 1.2  Robot poets (unnamed exhibition).

Figure 1.3  Installation: “Fin del Mundo” Biennial Exposition in Ushuaia, ­Argentina (April 2007).

Autopoiesis and Robopoetics  25 The current analysis considering the IP Poetry Project as an autopoietic system, however, will specifically focus on two interfaces available on the Internet: the first is the IP Poetry Local Viewer, where, according to ­Romano, “it is possible to see on the computer those poems recited by robots installed for the Fundación Telefónica’s Premios Vida historical show ‘Art and Artificial Life,’ which opened May 9 in the new Telefónica Space at Fuencarral 3, Madrid” [“es posible ver en el ordenador los poemas que recitan los robots instalados para la muestra antológica de los Premios Vida, ‘Arte y Vida Artificial’ de Fundación Telefónica, que inaugura el 9 de mayo en el nuevo Espacio Telefónica, Fuencarral 3, Madrid”]. The second is the IP Poetry Creator, whose texts “will be added to the IP Poetry library and selected poems will be recited during an exhibition” [“se agregarán a la biblioteca de IP Poetry y los seleccionados serán recitados ­durante la exhibición”]18 (http://ip-poetry.findelmundo.com.ar/index.html). In the IP Poetry Creator, the user first creates an account in order to compose her own IP poem. Next, she inputs the poem’s title as well as two short search terms (for which the MC bot, or “Master of ­Ceremonies,” searches the Internet and transmits to the four “subservient” bots) and two optional “sentencias” (or maxims) that serve, as Romano describes, “as wildcards or for the refrain” (106) to be recited by all of the bots in chorus during the poem’s performance.19 The user may then define the structure of the poem by using multiple drop-down menus—one for each “subservient” robot, respectively named Arthur, Boris, Charlie, and Dante—thus arranging the newly created poetic verses and selecting which of these four humanoid robots is to recite which line and which is to remain silent (Figure 1.4). One might therefore say that the user assigns a kind of poetic subjectivity to each robot, as Calvino has suggested in other contexts (and as Gache’s analysis of Romano’s project reveals): The so-called personality of the writer exists within the very act of writing: it is the product and the instrument of the writing process. A writing machine that has been fed an instruction appropriate to the case could also devise an exact and unmistakable “personality” of an author, or else it could be adjusted in such a way as to evolve or change “personality” with each work it composes. (Calvino 15) What is also at stake in this iteration of the project is also the “baptism” of the robots with names in alphabetical order, as Arthur, Boris, ­Charlie, and Dante recite the generated verses. 20 Prior to taking in the virtual poetic performance, the user has the option to revise and modify her poem before saving it in the project’s online database, to be recited either online by future, remote users, or potentially in a subsequent exhibition of the IP Poetry Project.

26  Autopoiesis and Robopoetics

Figure 1.4  I P Poetry Creator.

The robot’s recital of the poem is really where the deliberate blurring of the line between man and machine hits its most striking visual and aural chord. After the user finalizes the poem, the four bots recite the text according to the information received by the MC-bot: The robots execute an application to transform the information provided by the IPPB-MC into a series of sounds and images of a mouth speaking. The method chosen for this type of voice synthesizer

Autopoiesis and Robopoetics  27 involves the use of syllabic phonemes. Over 2,000 phonemes were pre-recorded. Since the number of resulting “theoretical” syllabic combinations were in excess of 25,000, it was decided to create a program to “teach” the robots how to speak. In other words, as sounds are found which are not yet in the program, a list is generated so these sounds can be subsequently recorded and added to the program, until all the phonemes used in Spanish are recorded. (106) As a point of clarification regarding the role of the user here, whereas Romano himself encoded a remarkable number of phonemes with which the bots might verbalize IP poems, the machines make distinctions between “familiar” and “unfamiliar” phonemes in the poems (for ­Romano’s subsequent use). Whether or not this “learning process” constitutes something like cognition or intelligence is a very relevant question in the present discussion of the autopoietic features of the IP Poetry Project.21 It is clear that the cyborg aspect of Romano’s project represents the blurring of the human (the visual focus on the image of the mouth, the quasi-human and robotic voice, the intimations of poetic subjectivity, etc.) and the machinic; as Heather Fletcher has argued, “these robotic systems represent a kind of reverse cyborg since they are machines that acquire human characteristics, instead of human beings that become more machinic” [“estos sistemas robóticos son una especie de reverse cyborgs ya que son máquinas que adquieren las características humanas, en vez de seres humanos que se vuelven más mecánicos”] (“Literatura cibercreativa…” 341). 22 This formulation recalls Gache’s discussion of the IP Poetry Project, and is especially pertinent to the context of the techno-scientific poetics that is the focus of this chapter (Figure 1.5).

Figure 1.5  Online visualization of IP Poetry Project.

28  Autopoiesis and Robopoetics At the same time, one might inquire if these hybrid organisms could be considered autopoietic machines per the specific sense in which autopoietic theory understands cognitive systems. For Maturana, A cognitive system is a system whose organization defines a domain of interactions in which it can act with relevance to the maintenance of itself, and the process of cognition is the actual (inductive) acting or behaving in this domain. Living systems are cognitive systems, and living as a process is a process of cognition. This statement is valid for all organisms, with and without a nervous system. (Autopoiesis and Cognition 13) The first question that arises from considering this bold statement by Maturana in the context of the IP Poetry Project is whether or not the structurally coupled system comprised of user, bots, interface, poems, Internet, and Romano (as designer) constitutes a closed autopoietic system of a higher order. Is it possible to say that the linguistic material received by the bots—decontextualized fragments from the Internet and also text entered by users—has something to do with the production of components which: (1) through their interactions and transformations regenerate and realize the network of processes (relations) that produced them; and (ii) constitute it as a concrete unity in the space in which they exist by specifying the topological domain of its realization as such a network? (135) What is the role of learning here, in terms of the addition of new phonemes to the enunciatory capabilities and capacities of the bots? If one considers the user input of poetic search terms and refrains to be an example of the kind of action that triggers the structural coupling of human and machine (as a system), it is possible to see how the arbitrary and aleatory nature of the Internet search to compose “poetry” shows that there is no intrinsic “value” to the (human linguistic and binary code) information selected. This is a very phenomenological move that is in line with the theoretical underpinnings of autopoietic theory, insofar as information is only “for” a unity or observer. As Maturana himself famously asserted, “[a]nything said is said by an observer” (8), thus arguing that conceptual abstractions like meaning and causality are present only in the domain of the observer (in other words, they do not exist from the “point of view” of the system being observed). The user, then, interpolates the IP Poetic system vis-à-vis selected linguistic elements and becomes structurally coupled to a machine that recursively turns back on its own capture of arbitrary linguistic signs. The robot “seeks”

Autopoiesis and Robopoetics  29 to imbue these signs with human inflection via the human “voice over”; it even attempts to master Spanish phonetics by learning new phonemes. By mechanistically acknowledging the distinction between known and unknown linguistic elements, the bots therefore make distinctions through their use of signs. They thus demonstrate the kind of effective interaction triggered by an environment that autopoietic theory would call “cognition” or “self-consciousness.” This recursive generation of distinctions resembles Maturana’s discussion of the way in which an organism becomes an observer by “generat[ing] discourse as a domain of interactions with representations of communicative descriptions (orienting behaviors)” (29). This is, for Maturana, the self-consciousness of the system, which can thus be posited as a feature of the IP bots in their autopoietic structural coupling with aspiring posthuman poets. At the same time, Maturana and Varela’s famous dictum—“life is cognition”— initially appears to complicate the applicability of the autopoietic model to the IP Poetry Project, since at first glance (and perhaps even following a more detailed analysis) it is difficult to conceive of this robopoetic system as an organism that lives and thinks. But if—as Maturana and ­Varela did—one defines a cognitive system as possessing the characteristics of an autopoietic system (regarding its closure, metabolism, structural coupling, etc.), then it is possible to situate the cognition of this system of poetic robots in the context of their effective interaction, thus conceiving of the virtual space of Romano’s design and programming as a linguistic ecosystem that is alive and demonstrates cognition, according to the conceptual schema of autopoiesis (as described by Maturana and Varela in Autopoiesis and Cognition). The next steps involved in extending this line of thinking might include a more in-depth examination of the relationship between autopoiesis and embodiment in Maturana and Varela’s later work, Von Foerster’s constructivist arguments as well as the neo-cybernetic concept of emergence, to name several possibilities among many. 23 In her essay “On Non-Human Poems and Talking Heads,” Belén Gache highlights the ironic implications of Romano’s cyborg robopoetics: In the case of IP Poetry, we are witnesses to a paradigmatic event: while many of these new digital formats are anonymous, here each robot takes the opportunity to leave its personal stamp on the text recited. Each robot defines its own “humanoid” personality, which includes its own recitational characteristics. Such is the case of ­Astor, a bot that is characterized by reciting love poems. In the series Love Poems for Astor, this bot is introduced as a desperate, tragic reader, in that it seems to be struggling against the limitations imposed by its non-human body. Astor reawakens the unsettling fantasy of inorganic beings who become organic, of robots come to life, a recurring theme ever since

30  Autopoiesis and Robopoetics the robots of Karel Capek and Asimov’s I, Robot; from HAL in 2001 to the replicants in Blade Runner. In fact, it is not only Astor who comes across as tragic when reciting his love poems, but the other bots as well, who, by insisting on their own names, vainly try to save an illusory subjectivity which, in fact, they never had. (136) The (tragicomic) nostalgia for the presence of an absence, as Gache describes it here, is to a certain extent rather moving. What the bots do, however—in terms of the autopoietic theoretical apparatus described above—is quite far from a metaphysics of presence or the interpolation of a strictly humanist-humanizing reader. If the structural coupling ­between human users and these cyborg entities produces something ­beyond chains of aleatory text—whether or not one wants to call it poetry, per the complex and often self-contradictory history of the term 24 — readers might harbor some doubts as to whether or not this poetic ­creation is at the service of a struggle “against the limitations imposed by [a] non-­human body” (136). On the other hand, regarding the specific definition of self-consciousness provided by autopoietic theory, Astor’s “difficult situation” is linguistic in nature, insofar as “he” is a machine that reflexively preserves “his” autopoietic organization by searching for specific textual sequences on the Internet, fragments of language whose selection is triggered by IP Poetry Project users. That said, one could argue that responses to Gache’s inquiry—“Are they machines with human mouths, or is man a talking machine instead?” (117)—cast mankind as (­higher-order autopoietic) machines with human mouths at least as much as the IP bots are poetry-reciting machines. Romano’s robots, in addition to being prosthetics, cyborgs, replicants, poetic surrogates, etc., thus also show how language itself is, in its raw material, nothing more than an artificial, technological and largely non-human code—circulating beyond our control—even beyond the poetic dreams of supposedly sentimental languaging machines. By way of a conclusion, it is helpful to return to Christian Bök’s insightful observations regarding robopoetics, which served as the introductory remarks for this chapter. Bök analyzes poetic creation by RACTER, a computer program designed by William Chamberlain in 1984 “in compiled BASIC on a Z80 micro with 64K of RAM” (“Racter”). Bök writes: RACTER, the author, is an automated algorithm, whose output confounds the metaphysics of authorship, refuting the privileged uniqueness of poetic genius. RACTER gives voice to its own electric delirium, doing so without cognition or intention, so that, much like a somniloquist, the device automatically blurts out statements that are syntactically orthodox, but semantically aberrant. While

Autopoiesis and Robopoetics  31 we might take solace in our own anthropic prejudice, dismissing such nonsensical communiqués as nothing more than computerized gobbledygook, we might unwittingly miss a chance to study firsthand the babytalk of an embryonic sentience, struggling abortively to awaken from its own phylum of oblivion. (10) The anthropic principle, as Bök describes it here, appears to be the greatest impediment to the valuation of the sense of (the threat of) nonsense, or the “semantically aberrant,” as Bök asserts regarding robopoetic composition. But in the context of the present exploration of the autopoietic features of Gustavo Romano’s IP Poetry Project, the Canadian poet’s analysis offers precisely “a chance to study firsthand the babytalk of an embryonic sentience.” The structural coupling of the higher-order autopoietic system involving user and technological apparatus vis-à-vis material and virtual language fragments, provides a unique approach to a future, non-human, silicon reader—always already present and human (all too human)—who is alive and who thinks, according to the critical terminology of autopoiesis. If the IP Poetry Project’s performance of “poetic innovation in an era of formal exhaustion” (Bök 17) is a worthy candidate for embryonic autopoietic sentience—which would constitute a point of convergence between robopoetics and autopoiesis— then Gache is correct to call Arthur, Boris, Charlie, and Dante “the last poets” (136).25 While the poetic wager cast by Romano here only gestures towards a future in which, as Kenneth Goldsmith prognosticates, a certain strain of literary discourse excludes humans (225), Romano’s project nevertheless invites the user-reader to engage in a kind of poetic interaction between autopoietic systems composed of a series of literary machines—encompassing poets constructed of silicon, plastic, and metal, as well as flesh and blood.

Notes 1 A preliminary version of my argument regarding the IP Poetry Project and autopoietic theory can be found on Gustavo Romano’s project website (http://ip-poetry.findelmundo.com.ar). This essay appeared in Spanish in the edited volume Poéticas y poesías digitales/electrónicas/tecnos/New-Media en América Latina: Definiciones y exploraciones. Eds. Luis Correa-Díaz y Scott Weintraub. Bogotá: Ediciones Universidad Central, 2016. E-book. 2 Leonardo Flores historicizes the role of the bot in electronic literature and provides numerous examples on his website I♥E-Poetry. His initial categorization reads: The bot is an e-lit genre that goes as far back as 1966 with Joseph ­Weizenbaum’s ELIZA, a chatterbot that engaged users in conversation through text entered and displayed in a computer terminal. This concept informed interactive fiction from the 1980s and has breathed life into video game characters ever since. Poetically, bots are also related

32  Autopoiesis and Robopoetics to generative works, producing poetry in many forms (haiku, couplets, sonnets, and more), techniques (n-grams, Markov-chains, templates, variables, etc), and datasets (self-contained, data mining, streaming APIs, user-­generated, dictionaries, and more). (“Genre: Bots”) 3 Prior to making this striking assertion, Calvino traces the historicity of the applicability of mathematical procedures to literature, speculating about potential styles employed by literary automatons. Regarding the “writer as machine” statement, he argues that [w]hat Romantic terminology called genius or talent or inspiration or intuition is nothing other than finding the right road empirically, following one’s nose, taking short cuts, whereas the machine would follow a systematic and conscientious route while being extremely rapid and multiple at the same time. (15) 4 Argentine-Spanish media artist Belén Gache’s book Escrituras nómades does an excellent job of contextualizing and historicizing the experimental practices of this current of literary expression. 5 While the programming for the IP Poetry Project was done by Milton Laüfer, Gustavo Romano was responsible for the project’s idea as well as the audiovisual design and direction (“Créditos”; http://ip-poetry.findelmundo. com.ar/creditos.html). 6 Most recently, Romano curated the Bienal de la Fundación ONCE (CentroCentro, Madrid, 2016). 7 Katherine Hayles reminds us that cybernetics revised the way in which the relationship between humankind and machines was viewed: “humans were to be seen primarily as information-processing entities who are essentially similar to intelligent machines” (How We Became Posthuman 7). In their I­ ntroduction to the book Emergence and Embodiment: New Essays on Second-Order ­Systems Theory, editors Bruce Clarke and Mark Hansen highlight the development of Heinz von Foerster and Gregory Bateson’s theoretical apparatus by thinkers Henri Atlan, Humberto Maturana, Francisco Varela, Lynn Margulis, Susan Oyama and Niklas Luhmann in the realm of neocybernetics (5). 8 In the present study’s elaboration of autopoietic theory it is important to delimit the range of my engagement with Maturana and Varela’s challenging theoretical model. This discussion of autopoiesis is limited to Maturana and Varela’s foundational early writings, excluding later work on consciousness, cognition, and the observer problem, as well as subsequent applications of autopoiesis to social systems (by Niklas Luhmann, for example). 9 A comprehensive guide to autopoietic theory can be found on Randall Whitaker’s “The Observer Web.” His tutorial on the basics of this complex theory is a clear pedagogical introduction to the topic (www.enolagaia.com/ UMUArchive/Tutorial.html). 10 The corresponding section in the Spanish-language version of the text goes into more detail about the term’s coinage, especially regarding Maturana’s ownership of the term. Here, Maturana emphasizes that it was not specifically proposed by Bulnes, that Bulnes’ wife Verónica suggested “autopraxis” in a subsequent conversation (which Maturana rejected), that it was ­Maturana who proposed “autopoiesis” to Varela the following day, etc.: un día que yo visitaba a un amigo, José María Bulnes, filósofo, mientras él me hablaba del dilema del caballero Quejana (después Quijote de la Mancha) en la duda de si seguir el camino de las armas, esto es el camino

Autopoiesis and Robopoetics  33 de la praxis, o el camino de las letras, esto es el camino la poiesis, me percaté de que la palabra que necesitaba era autopoiesis si lo que quería era una expresión que captase plenamente lo que yo connotaba cuando hablaba de la organización circular de lo vivo. La palabra autopoiesis no surgió de José María, no la propuso él ni podría haberla propuesto pues no era su problema, la inventé o propuse yo. Aún así le agradezco la conversación posterior que tuvimos en la compañía de su esposa, Verónica, quien sugirió como alternativa la palabra “autopraxis” que yo rechacé, pues me pareció limitadora en otros aspectos. Al día siguiente se la ­propuse a Fernando [Varela] a quién le gustó, y comenzamos a hablar de autopoiesis para referirnos a la organización de los seres vivos. (17) 11 The first Spanish edition of the book was published in 1972 by Editorial Universitaria in Santiago, Chile; the first full English edition was published in 1980 (with a preface by cybernetics pioneer Stafford Beer). 12 On the other hand, any system that does not make use of the products that it produces in order to continue functioning—such as a chemical factory or an automobile assembly line—is deemed allopoietic (80). 13 While the English-language version of Maturana and Varela’s book uses the cognate “perturbs” (for the Spanish “perturbar”), scholars such as ­Katherine Hayles opt for the verb “triggers,” which I believe better encapsulates the ­relationship between an autopoietic system and its immediate environment. 14 “Studies indicate that objects at rest elicit little or no neural response in a frog’s brain. Maximum response is elicited by small objects in rapid, erratic motion—say, a fly buzzing by” (28). In Realism and Representation: Essays on the Problem of Realism in Relation to Science, Literature, and Culture. Ed. George Lewis Levine. Madison: University of Wisconsin Press, 1993. 15 Although it is beyond the scope of the present discussion of the IP Poetry Project, it is useful to point out the reasoning behind the accusation of solipsism levied against this conceptualization of language. As Hayles explains: Consistent with [Maturana’s] emphasis on circularity, he prefers to talk not about language but “languaging,” a process whereby observers, acting solely within their own domains of interactions, provide the triggers that help other observers similarly orient themselves within their domains. Autopoietic theory sees this exchange as a coupling between two independent entities, each of which is formed only by its own ongoing autopoietic processes. As this description shows, the theory is constantly in danger of solipsism, a danger it both acknowledges and attempts to avoid by protesting that it is not solipsistic. The main reason the theory adduces for not being solipsistic is its acknowledgement of “structural coupling,” the phrase used to denote an organism’s interaction with the environment. Even if we grant that this move rescues the theory from solipsism, the theory still seriously understates the transformative effects that language has on human subjects. We have only to recall the term that Maturana employs for a language-using subject—“the observer”— to see how curiously inert and self-enclosing is his view of language. (147) 16 This essay was written by Maturana and was originally published in English in 1970. It was included in the first edition of Autopoiesis and Cognition (1980). 17 This essay is included in the (bilingual) exposition catalogue for the IP Poetry Project, which is cited above (Museo Extremeño e Iberoamericano de

34  Autopoiesis and Robopoetics Arte Contemporáneo de Badajoz, España; 2008). It is available at: http:// ip-poetry.findelmundo.com.ar. 18 My translations. 19 During my initial attempts to create IP poems, the server asserted that the session had expired, thus resulting in the infamous “404 Not Found” error. Per my early correspondence with Romano, the error was caused by changes to Yahoo!’s search platform, which conducts the searches (email from ­Gustavo Romano; June 1, 2011). The latest iteration of the project—version 3.0, inaugurated in March 2013 with support from the Spanish Ministry of ­Education, Culture and Sport—is more English-friendly and is optimized for mobile interfaces; it also incorporates female voices, according to the project website. Nevertheless, the IP Poetry Creator unfortunately still does not work properly. A more recent attempt to create an IP Poem yielded the following software error message: CGI version 3.47 required—this is only version 3.15 at incs/CGI/as_utf8. pm line 5. BEGIN failed—compilation aborted at incs/CGI/as_utf8.pm line 5. Compilation failed in require at /home2/gusrom/public_html/ip-­poetry/ creator/remotecreator.cgi line 7. BEGIN failed—compilation aborted at /home2/gusrom/public_html/ ip-poetry/creator/remotecreator.cgi line 7. For help, please send mail to the webmaster (webmaster@ip-poetry. findelmundo.com.ar), giving this error message and the time and date of the error (February 1, 2014). The IP Poetry Creator is listed as “temporalmente deshabilitado” [“temporarily out of service”] on the Project website (http://ip-poetry.findelmundo. com.ar/localviewer.cgi, December 15, 2017). 20 In the IPP catalogue, Romano explains the logic according to which the bots were named: …an IPPB 10 series robot could be called Arthur, Bors, Charlie, Dante, etc., according to the order in which it is built. This nomenclature is similar to that used by the World Meteorological Organization (which assigns different names alphabetically to hurricanes or storms each year, starting with the letter A and continuing in order with the remaining letters of the alphabet), or to the International Phonetic Alphabet used in radio communications, and which assigns a code word to each letter of the alphabet. (112) It should also be noted that the act of naming clearly implies power relations and agency/intentionality. The literary-poetic resonances of the name Dante are significant, of course. 21 The historicity of the question of machine learning and artificial intelligence is extremely complex. Some important touchstones in this discussion include (and this list is by no means exhaustive, of course): the development of the Turing Test (1950), the founding of the Department of Defense’s DARPA ­(Defense Advanced Research Projects Agency) following the Russian launch of Sputnik in 1958, John Searle’s Chinese room experiment (1980), and IBM’s Deep Blue (the chess-playing computer that famously beat Grand Master Gary Kasparov in 1996). With respect to more recent—and highly-­ publicized—experiments, we might consider Google’s AlphaGo computer, which defeated Go master Lee Sedol in March 2016, as well as the failed

Autopoiesis and Robopoetics  35 AI (teen girl) chatbot “Tay,” which was created and almost immediately “deleted” by Microsoft following a series of tremendously racist and misogynistic tweets (March 2016). 22 My translation. See also the often-cited bibliography on cyborg studies, which includes Gray, Haraway, Hayles, et al. In the Latin American context, the most substantial treatment of the topic can be found in J. Andrew Brown’s book, Cyborgs in Latin America. 3 In her work on the IP Poetry Project—in an article titled “Cybercreative 2 Literature: What Will be the Place of Technotexts in the Future of the ­Humanities? (The Case of Gustavo Romano and his IP Poetry Project)” [“Literatura cibercreativa: ¿qué lugar tendrán los tecnotextos en el futuro de las Humanidades? (El caso de Gustavo Romano y su proyecto de poesía IP)”)] and in an MA thesis titled “Literary Potential: A Perspective on Two Digital Projects by Findelmundo.com.ar” [“El potencial literario: una perspectiva sobre dos proyectos digitales de Findelmundo.com.ar”]—Fletcher touches on the topic of the robot-poets’ embodiment. However, there remains a great deal of work to be done in more strict phenomenological and cybernetic terms, following the writings of Clarke and Hansen, Luhmann, as well as Evan Thompson and Varela, among others. 4 The classification of the IP Poetry Project’s informational output as “po2 etry” might be seen by some readers as problematic. The line between sense and non-sense in the robopoetic context in which Romano is working is, admittedly, rather blurry (which is kind of the point, I think). That said, I would like to again invoke Claudia Kozak’s definition of technopoetry (cited in the book’s Introduction) to make a non-essentialist case for the IPP as a poetic machine: [la tecnopoesía está] basada en una experimentación con formas en general no narrativas que hasta cierto punto la separan de otros tipos de literatura electrónica o ciberliteratura como son la narrativa hipertextual y el ciberdrama. En tal caso, se trataría de poesía programada informáticamente que por sus recursos habilita ser leída desde la tradición poética. De todas formas, en un campo tan inestable como el de la tecnopoesía, el abordaje acerca de terminologías más o menos apropiadas y límites entre géneros resulta algo neceesario pero también casi absurdo porque el propio desarrollo tecnológico con su lógica de la novedad desbarranca con nueva evidencia los intentos de limitar nombres y conceptos. (225) 25 Gache’s translates “los últimos poetas” as “the latest poets” in the English version of her essay, but I believe that “the last poets” better encapsulates the apocalyptic tone of her writing here.

2 The Poetics of Visualizing Scientific Complexity Santiago Ortiz

Despite a series of aleatory events that included the loss of the computer containing his first novel—during “a series of moves that culminated in [his] definitive departure from Bogotá”—artist and digital designer Santiago Ortiz recounts a labyrinthine anecdote about the genesis and apocalypse of said novel, in an attempt to situate his virtual corpus outside the realm of (what is commonly classified as) literary space: El libro era en todo caso, he de decirlo, mediocre, con lo cual no me afectó demasiado la pérdida; y fue más el alivio: me liberé así de esa red insoportable y literalmente interminable. Al mismo tiempo abandonaba la idea de dedicar mi vida a escribir. El futuro me deparaba un trabajo que también se hace desde la escritura pero que muy pocos asociarían a la literatura (“arte: la mínima letra”). [The book was, in any case, I must say, mediocre, thus the loss did not affect me greatly; my feeling of relief was stronger: I thereby rid myself of that insufferable and literally interminable network. At the same time I abandoned the idea of dedicating my life to writing. The future provided me with a job that also has writing as its point of departure but which very few would associate with literature.1] This brief text expresses (in an oblique or inverse way) the ars poetica of the prodigious co-founder of the digital art and culture journal Blank as well as of the Bestiario and Moebio data visualization teams. It situates the creative articulation of Ortiz’s work “with writing as its point of departure,” from the ephemeral materiality of digital writing, rather than what might more commonly be classified as something like electronic or digital literature, for example. Born in Colombia, Ortiz currently resides in San Francisco, California; his academic preparation is notably interdisciplinary in nature: he studied music at the ­Universidad Javeriana in Bogotá in 1994 and moved to the Universidad de los Andes to study mathematics and literature (BS, 2000). One might safely assume that the radically transdisciplinary nature of his expositions, online works, and journal publications—as well as the numerous seminars on data visualization that he has led in the U. S., Latin America and Europe—derive

The Poetics of Visualizing Scientific Complexity  37 from this preparation. The multifarious nature of his digital-artistic ­design—which Ortiz himself excludes from the theoretical questions that simply don’t interest him 2 —is a key element of the present chapter’s attempt to locate the literary in his work and also to evaluate the rich interplay between scientific and artistic discourses in these innovative digital projects. The initial approach to Ortiz’s artistic data visualizations in this chapter will be through a theoretical framework that Johanna Drucker has called “speculative computing,” which shares a great deal with that which Ortiz has somewhat awkwardly termed “la escritura de código informático de forma creativa (arte digital)” [“writing computer code creatively (digital art)”] (“Narrativa, vida, arte, y código” 1). I then explore Ortiz’s ­linguistic-genetic modeling in “bacterias argentinas” vis-à-vis Humberto Maturana and Francisco Varela’s theory of autopoiesis, discussed in the previous chapter. Here, I apply Maturana and ­Varela’s theoretical framework to the multicellular, linguistic ecosystem designed by Ortiz in order to analyze the interaction of basic organisms in a trophic network of words. This discussion highlights the ways in which ­Ortiz’s work represents a fascinating confluence of cell biology, linguistics, narrative, genetics and computer modeling, showing how this transdiscursive space of digital writing allows us to rethink our conceptualization of the scope and limits of humanistic inquiry in light of Ortiz’s scientific poetics. Regarding the terminological and discursive convergence between Santiago Ortiz’s work and the origins of speculative computing, it is instructive to examine the theoretical and methodological underpinnings of an innovative project conceived in the 1990s by Johanna Drucker and Jerome McGann at the University of Virgina’s Institute for Advanced Technology. Drucker’s book SpecLab: Digital Aesthetics and Projects in Speculative Computing (2009) offers a detailed account of the major projects undertaken in this experimental space. She is particularly interested in outlining the passage from a digital humanities perspective to one informed by speculative computing. Drucker describes the paradigm shift in the following terms: the activities encompassed by the digital humanities emphasize the centrality of: The statistical analysis of texts, creation of structured data, and design of information architecture…Representation and display are integral aspects of these activities, but they are often premised on an approach influenced by engineering, grounded in a conviction that transparency or accuracy in the presentation of data is the best solution. Blindness to the rhetorical effects of design as a form of mediation (not of transmission or delivery) is an aspect of the cultural authority of mathesis that plagues the digital humanities community. (6)

38  The Poetics of Visualizing Scientific Complexity These areas of digital humanities research and critical intervention, argues Drucker, privilege the paradigm of mathesis that confers cultural supremacy on the notion that formal logic is capable of providing us with an absolute base upon which to ground all rational knowledge (4). Thus, the digital humanities engage, at their most fundamental level, “the requirement to disambiguate knowledge representation so that it operates within the codes of computational processing” (5). 3 DH establishes technical protocols that allow texts to be processed in a significant/­signifying manner, utilizing varying types of quantitative analysis, pattern recognition, and stylometrics in said analysis (22–3). Contrasting with the “cultlike” reliance on mathematical exactitude postulated in this account of the digital humanities, Drucker’s speculative computing draws on, and is informed by, the following theoretical paradigms: Ernst von Glaserfeld’s radical constructivism, Heinz von Foerester’s systems theory, Maturana and Varela’s account of autopoiesis, Alan MacEachren’s model of visual processing, ‘pataphysics, the Oulipo’s mathematical combinatorics, the Situationist International, quantum mechanics’ probabilistic models, Bakhtin’s dialogic method, French post-structuralism, as well as semiotics (especially as theorized by Jacques Bertin and Charles Peirce) (19–25). Basing her approach on this wide constellation of thinkers and theoretical frameworks, Drucker summarizes speculative computing in a rather clear and concise manner: Speculative computing takes seriously the destabilization of all categories of entity, identity, object, subject, interactivity, process, or instrument. In short, it rejects mechanistic, instrumental, and formally logical approaches, replacing them with concepts of ­autopoiesis (contingent interdependency), quantum poetics and emergent ­systems, heteroglossia, indeterminacy and potentiality, ­intersubjectivity, and deformance. Digital humanities is focused on texts, images, meanings, and means. Speculative computing engages with interpretation and aesthetic provocation. Like all computational activity, it is generative (involved with calls, instructions, encoding), iterative (emergent, complex, nonlinear, and noncausal), intra- and inter-­subjective ­(dealing with reference frames and issues of granularity and ­chunking), and recursive (repeating but never identical) deformances. (29) It is important to highlight the emphasis that speculative computing places on aesthesis, defined here as a discourse that “challenges the authority of [the] systematic rationality [of mathesis] by questioning its founding assumptions, particularly its totalizing concepts of knowledge” (xiv). In the context of the many historical attempts to understand human thought through “a perfect representation of it in some unambiguous, diagrammatic symbol set” (133), of particular relevance

The Poetics of Visualizing Scientific Complexity  39 to SpecLab’s critique are Gottfried Leibniz’s calculus ratiocinator, ­ avid Hilbert’s mathematical formalisms, the many incarnations of D AI, and Gottlob Frege’s axiomatic predicate logic in the Begriffsschrift, among others. But curiously absent from Drucker’s account here are Alan ­Turing (mentioned only once in SpecLab (23), in the context of the origins of digital processing in the so-called “Turing machine,” a key digital humanities tool) as well as Kurt Gödel, whose incompleteness theorems have been applied to all sorts of critical problems in cognitive science, computing, philosophy, theoretical physics and even in art (including literature).4 Readers familiar with Santiago Ortiz’s interactive digital projects as well as his more theoretical online texts will immediately recognize ­certain affinities between the philosophical-critical foundation of ­SpecLab (as described by Drucker) and Ortiz’s multimedia works. In order to establish specific links between the critical scaffolding of speculative computing and Ortiz’s digital experiments, it will be helpful to explore the innovative textualities of his online works in order to see how they define their own theoretical coordinates. In Jerome ­McGann’s words, we might first consider the ways in which “a literary work codes a set of instructions for how it should be read” (“Texts in ­N-Dimensions” 10), with particular potential and implications for digital texts. With this in mind, the following discussion of Ortiz’s work focuses on two particular projects—”Árboles de textos” [“Textual Trees”] and “esferas” [“spheres”]—whose visual and theoretical modules challenge fundamental critical notions about the literary character of digital media. I also discuss the feedback loop between human and machine in the literary-visual environment (despite Ortiz’s own protests about his lack of interest in the topic, cited above), as an encounter generated by the constructive/constructed textuality at play in the interaction between designer, text, and (e-)reader. Specifically, I put forward several key ­observations regarding the ways that discourses such as cognitive science, mathematics, formal logic, combinatorics (of a quasi-literary nature), literary theory, linguistics, genetics, evolutionary biology, and computing converge in Ortiz’s work to contribute to a radical reformulation of the possibilities and the roles of the humanities in the second decade of the twenty-first century.

Combinatorics, Constraints and Remediation: “Textual Trees” (2006) As an initial approach to Santiago Ortiz’s visual textualities, it is instructive to explore a project that in fact does not demonstrate the interactive element that he employs in such a sophisticated manner in other works. 5 Titled “Textual Trees,” this project stands out amongst Ortiz’s body of work in its direct engagement with the Spanish and Portuguese poetic

40  The Poetics of Visualizing Scientific Complexity traditions via a series of initially deconstructive, and subsequently reanimating, operations produced by algorithms written in Adobe Flash.6 “Textual Trees” is a fine example of what Jay David Bolter and Richard Grusin have called remediation, following Marshall McLuhan, one of the true visionaries of the first wave of cybernetics: On the opening page of Understanding Media (1964), Marshall ­McLuhan remarked that ‘the ‘content’ of any medium is always another medium. The content of writing is speech, just as the written word is the content of print, and print is the content of the telegraph’ (23–4). As his problematic examples suggest, McLuhan was not thinking of simple repurposing, but perhaps of a more complex kind of borrowing in which one medium is itself incorporated or represented in another medium…we call the representation of one medium in another remediation, and we will argue that remediation is a defining characteristic of the new media. (Bolter and Grusin 45) In this study, Bolter and Grusin define the double logic of remediation in terms of: (1) the mediation of mediation; (2) the inseparability of mediation and reality; and (3) remediation as reform. They thus highlight the degrees of mediation present in all operations and iterations of remediation, the nature of remediated texts as real artifacts, as well as participants in the transformation of reality itself (55–6). In terms of the remediation of the “original” texts upon which ­“Textual Trees” performs its visual and semantic operations, Ortiz selected four poems by four different authors as the source texts (three in Spanish and one in Portuguese): “Me defiendo” [“I Defend Myself”], by Raúl ­Gómez Jattin; “Floresta meu diccionario” [“My Dictionary, the Forest”],  by Márcia Theóphilo; “Variaciones del árbol” [“Variations on a Tree”], by José Lezama Lima; and “Poema del árbol” [“Poem about the Tree”], by José Ángel Buesa. All four are poems that are about the tree as figure or trope, albeit in very different ways: one links the tree, for example, to a predilection for poetry (“Me defiendo”); one narrates the disappearance of the tree at night and at a river’s edge (“Variaciones del árbol”); another is an apostrophe to the tree, whose slow growth of new, green leaves is compared to hope incarnate in the poetic voice (“Poema del árbol”). But these symbolic or hermeneutic readings are subordinate to the main critical preoccupation of the project, according to the explanatory text that accompanies the program, which is titled “Árboles de textos: el lenguaje vivo, el lenguaje vida, un caligrama autogenerativo y fractal” [“Textual Trees: Living Language, Language as Life, a Self-­Generating and ­Fractal Caligram”].7 According to this text, the main idea that gave rise to this visual experiment was, in Ortiz’s words, that “[el] lenguaje, el lenguaje verbal, las lenguas: están vivos. O mejor aún: son vida” [“language, verbal

The Poetics of Visualizing Scientific Complexity  41 language, languages: they are alive. Or, better still: they are life”]. He goes on: “[e]l lenguaje, cualquier lengua, es entre muchas cosas, y sin que unas entren en conflicto con las demás: no-lineal, topológicamente asociable a redes, difuso, dinámico, inestable, abierto, complejo, recursivo, autorreferencial, evolutivo, ­fractal” [“language, any language, is, among many (non-­conflicting) things: non-linear, ­topologically ­associable with ­ ynamic, unstable, open, complex, recursive, self-­ networks, diffuse, d referential, evolutionary, fractal”]. In this brief essay, Ortiz focuses on the fractal-like property of language, drawing on Benoit Mandlebrot’s set theory—a geometry of infinite regression, informed by the study of complex numbers (combinations of real and imaginary numbers)—in order to explore the relationship between “the size of a word and its importance in a given text.” Ortiz’s exploration of the fractal-like aspects of language in his visual remediation of these four poems is particularly salient in the context of Mandlebrot’s fractal geometric surfaces, whose structures appear irregular from a certain distance, but which appear frequently in the natural world; as N. Katherine Hayles notes, “thinking that non-linearities are strange is itself strange, since complex figures appear regularly in nature” (Chaos Bound 164). In his “reading” of these four arboreal poems, Ortiz analyzes the length of individual words as a possible function of their semantic importance in the linguistic system as a whole. He highlights the largely exponential distribution of this phenomenon in language, in which short words abound, a fact that he relates to certain natural phenomena where—within a given category—there exist few large organisms but many small ones. For example, there are relatively few adult blue whales whereas there are many that are approximately the size of a mouse (and even more that are the size of a bacteria such as E. coli).8 Ortiz mentions the hierarchical ­organization of trees (“trunk, large branches, medium ones, small ones…”), the cosmos (“Clusters of galaxies, galaxies, stars, [planets?], …molecules, ­atoms, … [?]”), urban planning (“Cities, neighborhoods, business centers, stores, homes…”), Catholic ecclesiastical leadership (“Popes, cardinals, ­bishops, archbishops, priests…”), and the army (“Commander-in-Chief, ­generals, ­ istinguish majors, coronels, lieutenants, sergeants, soldiers…”) in order to d between the relations of continence and of conformance that structure these organizational systems. He also uses this discussion to transition to the notion of scale in the meta-analysis he employs in this project, evaluating the distribution of long words in language versus short ones in order to see if there is some sort of semantic scale at play in the comparison between the two groups.9 In order to carry out this experiment, “Textual Trees” employs an algorithm (whose ActionScript code is provided at the end of Ortiz’s introductory essay to the project) that explores the function of words in language, according to the individual words’ (presumed) relative importance in poems by Gómez Jattin, Teóphilo, Lezama, and Buesa. “Textual

42  The Poetics of Visualizing Scientific Complexity Trees” thus undertakes a visual and remediated reorganization of poetic language according to the length of the words contained in the poems: así el tronco del árbol será la palabra más larga, y las últimas ramas los signos de puntuación y las palabras de una sola letra. El texto original se va descomponiendo perdiendo sus palabras en orden de tamaño, y cada palabra que se sustrae al texto se añade al árbol, eligiendo cada vez un [sic] rama aleatoria. Los ángulos de las nuevas ramas se calculan como una variación respecto a la rama antigua sobre la que crece la nueva. De esta forma el resultado es parcialmente aleatorio y cada vez distinto (“Árboles de textos: el lenguaje vivo, el lenguaje vida. Un caligrama autogenerativo y fractal”). [therefore the trunk of the tree will be the longest word, and the outermost branches will be the punctuation marks and single-­letter words. The original text is deconstructed, removing its words according to their size, and each word removed from the text is added to the tree, each time picking a random branch. The angles of the new branches are calculated with respect to the previously-­ constructed branches, upon which the new branch grows. Thus the result is partially aleatory and different each time.] The effect of this combinatory procedure emphasizes the materiality of words (given the importance of the number of letters that each word in each poem possesses), in the face of what “should be”—or what should have been prior to the “reorganization” of the poem into an arboreal, visual form—the poem’s meaning or the semantics of the word order, and, mutatis mutandis, the poem as a supposedly stable entity. This ­critical operation, of course, appeals to a long tradition of visual or concrete poetry: the lineage of the caligram is of particular interest, beginning in the early sixteenth century with poems by Henry Lok, George Wither, and George Herbert, among others, and passing through notable early twentieth-century visual experiments by Guillaume Apollinaire, ­Vicente Huidobro, and Juan José Tablada, to name a few. Regarding the aesthetic of literary combinatorics employed by Ortiz in this poem, the most prominent practitioners of this type of formal constraint were the Oulipo (Ouvroir de littérature potentielle, or Workshop of Potential Literature), a French collective founded in 1960 by Raymond Queneau and François Le Lionnais, and whose formal experimentation in literature was made famous in works like Queneau’s Cent Mille Millards de poèmes (One Hundred Thousand Billion Sonnets, a poetic machine composed of ten sonnets whose combinatory potential permitted 1014 possible sonnets), La disparition (Georges Perec’s infamous detective novel written without the letter ‘e’) and even If on a Winter’s Night a Traveler (a novel by Italo Calvino that explores its own readerly conditions of possibility).10 In fact,

The Poetics of Visualizing Scientific Complexity  43 in a short essay titled “palindromedario” (a portmanteaux combining the words “palindrome” and “dromedary”)—a text that describes the critical potentiality generated by linguistic constraints, in this case, the palindrome—Ortiz praised Oulipian writings and Perec’s La disparition in the context of the positive effect of formal restrictions: La restricción, el nudo, la dificultad y el forcejeo me parecen en todo caso cualidades interesantes y positivas que se manifiestan en los palíndromos. Escribir bajo el dominio tiránico de una regla que poco entiende, y poco le importa la semántica, el significado, el sentido, la coherencia, … quizá contribuya a liberarnos, precisamente, de las tiranías oscuras de la semántica, el significado, el sentido y la coherencia (“palindromedario”). [The constraint, the knot, the difficulty, and the struggle all seem to me to be interesting and positive qualities manifested in palindromes. Writing under the tyrannical control of a rule that understands little, and to which semantics, meaning, coherence mean little…perhaps contributes to freeing us, precisely, from the dark tyrannies of semantics, meaning, sense and coherence.] “Textual Trees” thus spatially reorganizes poetic diction first by examining the length of individual words and then visualizing the possibilities of cybernetic algorithms that facilitate the partially aleatory re-writing (remediation) of these literary texts. This material operation therefore decenters the univocality of meaning supposedly possessed by the “original” poetic word, henceforth destabilized by the new iteration of each poem. Below are several screenshots from “Textual Trees,” which highlight the ­ Variations on step-by-step deconstruction of José Lezama Lima’s poem “ a Tree.” In Figure 2.1, the green thread seeks to “reconnect” or “recover” (in Ortiz’s words) the words according to the order found in the original poem. This green line is a trail or trace remaining from the previous material operation upon the poem “My Dictionary a Forest,” which precedes ­L ezama’s poem in the Flash animation. When the full text of ­“Variations on a Tree” appears on the screen, one can almost immediately recognize it as a sonnet in the brief time allotted to the reader to review the complete poem, prior to the dissection of its fourteen lines (and its subsequent visual transformation into tree-form by way of the algorithm that determines the spatial orientation of signifiers in the remediated ­caligram). Regarding the partial poetic deconstruction visible in ­Figure 2.2, it is noteworthy that the trunk is constructed from the long phrase “quemándose, retoma” (which the ActionScript code “thinks” is a single word11) and long words such as “Variaciones”, “caminando”, etc., thus allowing shorter words such as articles, prepositions, and some nouns or possessive adjectives to remain in place for the time being.

44  The Poetics of Visualizing Scientific Complexity

Figure 2.1  S creen capture, “Árboles de textos”.

Figure 2.2  S creen capture, “Árboles de textos”.

The Poetics of Visualizing Scientific Complexity  45 It is interesting to note that in this screenshot the poet’s first name remains on the screen without his last names, since the selection and combination algorithm is unable to differentiate between the text of the poem and the name of its author. It is almost as if it were under the influence of a kind of New Critical metaphysics of presence in which the incorporation of the signifiers “Lezama” and “Lima” into the body (corpus) of the tree-poem treated these proper nouns as if they belonged to the poem “itself.” Upon the conclusion of the process directing the selection of words and their sculpting into the trunk and branches of the tree,12 the program scrawls a green line across the resulting arboreal poem (“partially aleatory and different each time”), which according to Ortiz seeks to recover “el orden original de las palabras en el texto” [“the original order of the words in the text”] (Figure 2.3). Upon conjecturing that “si alguien pudiese tirar del cordel verde el árbol se desintegraría y el texto resurgiría en su configuración legible; el sentido de las palabras se recuperaría” [if one were able to pull the green string the tree would break up and the text would rise again in its readable configuration; the meaning of the words would be recovered”], Ortiz presupposes key features about the constitutive literariness of the “original” poems as well as the effects of the remediation carried out in “Textual Trees.” First, the reading of José Lezama Lima’s poem

Figure 2.3  S creen capture, “Árboles de textos”.

46  The Poetics of Visualizing Scientific Complexity “Variaciones del árbol”, as undertaken in Ortiz’s remediatory textual intervention, asserts the univocality of the poem insofar as it postulates the recuperation of a stable and present-to-itself meaning. This operation denies the coherence or stability of the “original” text, here translated into a calligraphic form with no remaining material traces in the semantic field. In Johanna Drucker’s terms, [t]he work is not an inert or fixed text or image, no matter how stable it appears in print or on a screen. It is not an information delivering system but a medium of exchange in social space, the instrument for creation of value through interpretative activity. (29) Second, the theorization of the green thread in “Textual Trees” (which, when pulled, would supposedly be able to reestablish the original stability of the sonnet) ignores the rhetorical effect of design as an active form of (re)mediation and not merely a kind of transmission or representation (Drucker 6). This field registers the generation of a polyvalent text refusing the supremacy of a “legible” original text in the face of the purported “illegibility” of the new iteration of the visual poem. Nevertheless, in the context of these metaphysical prejudices regarding the textual and graphic entity produced by the Flash algorithm, it is important to highlight the way in which “Textual Trees” carries out a performance that deconstructs the self-identity of the “original” literary text. In this way, this project shows how reading, as an affective, recursive, and transformative force, constructs the object in its multifarious signifieds—following Drucker, McGann, and even the formulations of theories of perception and autopoietic theory as developed by Maturana and Varela, which are explicitly cited by Ortiz in numerous digital projects and critical texts.

Networks, Linguistic Phylogenetics, and Memetics: “esferas” [“spheres”] (2004–) When philosophers use a word—‘knowledge’, ‘being’, ‘object’, ‘I’, ‘proposition’, ‘name’—and try to grasp the essence of the thing, one must always ask oneself: is the word ever actually used in this way in the language which is its original home?— What we do is to bring words back from their metaphysical to their everyday use. —Ludwig Wittgenstein; Philosophical Investigations §116 “spheres” is a project that uses visual modeling to explore the relationship between words as a generator of semantic networks. It not only investigates the convergence between the vocabulary of scientific complexity and the quotidian use of such words—truly a Wittgentsteinian

The Poetics of Visualizing Scientific Complexity  47 topic of inquiry—but also highlights the semantic potential generated through the linking of two words “para desencadenar narrativa, reflex­ nravel iones, teorías, arbitrariedad, poesía, humor…” [“in order to u ­narrative, reflections, theories, arbitrariness, poetry, humor…”] (“esferas: ­superficies esféricas de diálogo”). This interactive program uses Flash to construct four spheres of words—one “of scientific complexity” (which is trilingual), one in Spanish (created in March 2004), one in ­English (November 2004), and one in Portuguese (March 2005)13 — which constitute, according to their designer: “no sólo una metáfora de una superficie de diálogo entre científicos y no científicos en torno a términos y preocupaciones comunes; es un espacio real de conversación pausada y acumulativa” [“not only a metaphor of a surface of dialogue between scientists and non-scientists regarding shared terms and concerns; it is a real space for paused and accumulating conversation”]. The words in their spatial distribution on the screen form the surface of a sphere, and the user-reader has several options to engage with the interface: she may spin the sphere by clicking on a word and dragging the mouse, navigate between the three “spheroid” language structures (English, Spanish and Portuguese), change the point of view of the interaction (choosing between three possible configurations: from a given distance, from the surface of the sphere, or from within the sphere), and also vary the algorithm that controls the spatial distribution of words in the sphere.14 The user-reader first selects (clicks on) any two words, and is then prompted with the following simple question in a small dialogue box that appears on the screen: “What relationship exists between A and B?” (A and B represent the two selected words). A red line is immediately drawn between the two selected words (in contrast with the green or gray network of lines that connects the words at the start of the visual modeling). When this small window pops up, the user may also read the entries/interventions already inputted by previous users (which appear in small boxes), thus providing a model for a new response (Figure 2.4). The complexity sphere (in its Spanish “incarnation”) includes 122 terms entered by Ortiz himself, selected for their use scientific as well as quotidian contexts. These include: la vida, la complejidad, el caos, el orden, el desorden, los límites, el calor, el infinito, un proceso, el azar, la evolución, la selección, la forma, un algoritmo, la estabilidad, la inteligencia, la ­consciencia, la mente, el cuerpo, los virus, las bacterias, hongos, los animales, las plantas, los fractales, lo lineal, lo no-lineal, lo aleatorio, las estructuras, la organización, las redes, los sistemas dinámicos, el m ­ ovimiento, el cambio, la mutación, la geometría, las escalas, los sistemas, los fluidos, la interacción, la diversidad, los cristales, lo periódico, lo aperiódico, la generación, la conformación, los patrones, la repetición, el ritmo, las espirales, las partículas, las sociedades, la cultura,

48  The Poetics of Visualizing Scientific Complexity

Figure 2.4  S creen capture, “Esferas”.

la etiología, los memes, los genes, la genética, el ADN, el efecto ­mariposa, los números imaginarios, la biosfera, los ­planetas, las estrellas, las galaxias, la materia, el sonido, la luz, las ondas, las señales, la información, la entropía, la ecología, la multidisciplinaridad, los sistemas abiertos, los sistemas cerrados, las órbitas, la cognición, la autoorganización, la cibernética, la ­inteligencia artificial, las paradojas, fluctuación, el tiempo, la química, la oscilación, el metabolismo, una célula, el lenguaje, la topología, la flecha del tiempo, la ­relatividad, la difusión, la fusión, las fases, los seres vivos, las esferas, una esfera, lo simple, lo complejo, la autorreferencialidad, lo impredecible, las bifurcaciones, la energía, la fuerza, la ­incertidumbre, la reversibilidad, la irreversibilidad, la ­autosemejanza, las neuronas espejo, la memoria, el aprendizaje, la nanotecnología, un cuanto, una partícula, el cosmos, el origen del universo, el origen del hombre, el origen de la vida, la vida extraterrestre, la clonación, la mutación, la necesidad [life, complexity, chaos, order, disorder, limits, heat, infinity, process, chance, evolution, selection, form, algorithm, stability, intelligence, ­consciousness, mind, body, virus, bacteria, fungus, animals, plants, fractals, linear, non-linear, aleatory, structures, ­organization,

The Poetics of Visualizing Scientific Complexity  49 ­networks, ­ dynamic systems, movement, change, ­mutation, geometry, scales, systems, fluids, interaction, diversity, crystals, periodic, ­aperiodic, ­generation, conformity, patterns, r­ epetition, rhythm, s­ pirals, particles, societies, culture, etiology, memes, genes, genetics, DNA, the ­ umbers, biosphere, planets, stars, galaxbutterfly effect, imaginary n ies, matter, sound, light, waves, signals, ­information, entropy, ecology, multidisciplinarity, open systems, closed s­ ystems, orbits, cognition, self-­organization, cybernetics, artificial intelligence, paradoxes, fluctuation, time, chemistry, oscillation, metabolism, cell, language, topology, the arrow of time, relativity, diffusion, f­ usion, phases, living beings, spheres, a sphere, simple, complex, ­self-­referentiality, unpredictable, bifurcations, energy, force, ­uncertainty, reversibility, irreversibility, self-­similarity, ­mirror neurons, memory, learning, nanotechnology, quantum, particle, cosmos, the origin of the universe, the origin of humankind, the origin of life, extraterrestrial life, cloning, mutation, necessity] The program’s designer also provides an open invitation to users to intervene in these initial conditions of the sphere: “si consideras que falta alguna palabra -que reúna los requisitos-, escríbeme a santiago@­ moebio.com” [“if you feel that a word is missing—one which fills the requirements—please email me at [email protected]”]. But despite what this statement appears to suggest—vis à vis the code that “creates” a virtual, linguistic organism with 7,381 possible linkages between 122 words15 —the initial conditions of the project also account for the possible “evolution” of the system in each of the spheres for two reasons. First, there is a principle of renewed selection, in which [l]as palabras que menos atención reciben (las que menos textos de relaciones tienen) se remplazan por otras palabras nuevas. Estas esferas son como organismos vivos que renuevan sus células, o como comunidades vivas en donde opera un mecanismo de selección. [the words that receive less attention (those with fewer linkages) are replaced by new words. These spheres are like living organisms that renew their cells, or like living communities in which there is a mechanism of selection at work.] Second, Ortiz, as “creator,” introduces a conscious “filter” in the system, since he claims that he occasionally intervenes (“cada cierto tiempo”, he writes), in order to eliminate “textos vacíos de sentido, del estilo sdfg” or “kkkkkk” [“texts lacking meaning, of the type ‘sdfg’” or “kkkkkk”] (“esferas: superficies esféricas de diálogo”).16 As a subsequent discussion will show, by labelling certain user-interventions as “lacking meaning,” ­Ortiz ends up mediating the “genetic” evolution of the linguistic network

50  The Poetics of Visualizing Scientific Complexity in a highly active way, selecting for specific linguistic “genes” according to principles that may or may not be read as part of a “natural” selection. I have selected several examples from the “sphere of relations in Spanish” that are pertinent to the present analysis, which are transcribed below exactly as they appear in Ortiz’s interactive model: “¿Qué relación hay entre los virus y el lenguaje?” “no lo se aun”; “lo pensare”; “el lenguaje deviene en parte del contenido genético y en parte de la carga cultural del contexto inicial, evoluciona, pilla nuevas palabras del cruce de culturas, se expande por individuos de la misma ciudad de maneras tan diferentes qe dificilmente miembros de gettos aislados logran entenderse. Los Virus IDEM. [email protected]”. [“What is the relationship between viruses and language?” “I don’t know yet”; “I will think about it”; “language arises in part from genetic content and in part from the cultural charge of the initial context, it evolves, it takes new words from the intersection of cultures, it spreads among individuals of the same city in ways so different that members of distant ghettos have difficulty understanding each other. Viruses as well. [email protected].”] “¿Qué relación hay entre las matemáticas y la literatura?” “todos los dias se estudian en el colegio”; “la sintaxis”; “Otis”; “las proporciones y las mismas intenciones”; “Racionalismo”; “Borges y las matematicas”; “son sumas y restas…”; “todo y más”; “QUE AUNQUE SEAN BUENAS ARTES AMBAS ME CAEN COMO PATADAS EN EL CUL……..Y EN LA………LAS ODIO MALPA…”; “eulalia” [“What is the relationship between mathematics and literature?” “they are studied every day in high school”; “syntax”; “Otis”; “proportions and the same intentions”; “Rationalism”; “Borges and mathematics”; “they are additions and subtractions”; “everything and more”; “EVEN THOUGH THEY ARE GOOD ARTS EACH ONE TO ME IS LIKE A KICK IN THE A…AND IN THE….I HATE THE BAST….”; “eulalia”] “¿Qué relación hay entre los genes y los políticos?” “Existirá el gen de la corrupción en los políticos?”; “que los genes de los politicos colombianos son importados”; “Existe un gen predominante de la vanidad?”; “condicion que va de degeneracion en ­ ROMOSOMA degeneracion”; “TODOS YA VIENEN CON UN C DOMINANTE EL CUAL LE SIRVE A LA CELULA DEL GOBIERNO”; “el tiburon devora todas las presas del mar el politico todas las riquezas del pueblo”

The Poetics of Visualizing Scientific Complexity  51 [“What is the relationship between genes and politicians?” “Does a corruption gene exist in politicians?”; “the genes of ­Colombian politicians are imported”; “Is there a dominant gene for vanity?”; “a condition that passes from degeneration to degeneration”; ­ HROMOSOME “EVERYONE COMES WITH A DOMINANT C THAT SERVES THE GOVERNMENT’S CELL”; “the shark devours the entire catch of the sea the politician all the riches of the people”] This selection does not purport to be exhaustive nor necessarily representative, given the number of possible links between the elements in the network and the possible responses (which is essentially infinite). But it should be clear that there are comical responses, vulgar ones, and those that seek to make a literary or social commentary; there are others that are largely banal (or perhaps idiosyncratic), as well as more profound or detailed ones.17 What interests me, however, is not the specific character of the individual responses per se, rather the way in which “spheres”—as a programmatic formalism that delineates multiple discursive relationships between scientific language and everyday language—demonstrates how “interpretation is a performative transformation of the material condition of an artifact” (Drucker 96) through its poetic feedback loop comprised of the system, users, and language (Figure 2.5). Ortiz theorizes about the language of “spheres”—in constant evolution, as a function of the selection of terms and the links established between them—with respect to what he calls “linguistic phylogenetics.”

Figure 2.5  S creen capture, “Esferas”.

52  The Poetics of Visualizing Scientific Complexity Structural linguistics—at least since Ferdinand de Saussure’s Course on General Linguistics (1916)—is based on the notion of language (langue) as a system of differences without positive terms, conceived as a network of signs that establishes codependent relationships through which the (supposed) stability of each individual sign is established (a sign that is arbitrary and unmotivated, according to Saussure). The genetic analogy with linguistics, which is frequently cited by Ortiz, seeks to: deja[r] de lado las sustancias y observa[r] las relaciones y los flujos, [para] pode[r] llegar a observar, por ejemplo, que fenómenos que ocurren con la evolución de las lenguas (filogenética lingüística) son comparables a otros que ocurren en la evolución de seres vivos desde el punto de vista de su código genético (filogenética biológica) (“de la relación a la invención”). [put aside substances and observe relations and flows, in order to be able to observe, for example, that phenomena that occur with the evolution of languages (linguistic phylogenetics) are comparable to others that occur in the evolution of living organisms from the point of view of their genetic code (biological phylogenetics).] Ortiz’s specific conceptualization of this scientific discourse—which has key resonances in the study of the evolution of languages and other ideological constructs—finds its most well-developed theoretical basis in Richard Dawkins’ memetic theory, which departs from the notion that “la información genética no trata de organismos sino de relaciones entre organismos y entornos” (“narrativa, vida, arte y código” 8) [“genetic information does not deal with organisms but with relationships between organisms and their environments”]. Ortiz glosses the notion of the meme, a term coined by the British scientist in the late 1970s, in the following manner: El concepto de meme, acuñado por Richard Dawkings [sic] en su popular libro El gen egoísta plantea cómo las ideas se ven sometidas a procesos de selección, replicación y mutación, y, de forma paralela a la sugerencia principal de[l] libro, que es que los cuerpos de los organismos vivos son los vehículos de transporte y eventualmente de intercambio de los genes -los auténticos replicadores-, las ideas usan nuestras cabezas para desplazarse y reproducirse (“redes metaconcientes”). [The concept of meme, a term coined by Richard Dawkins in his popular book The Selfish Gene, lays out the ways in which ideas are subjected to processes of selection, replication, and mutation. And—in a way that parallels the main idea of the book, which is that the bodies of living organisms are the vehicles of transport and

The Poetics of Visualizing Scientific Complexity  53 eventually of the exchange of genes (the true replicators)—ideas use our brains to move around and reproduce.] If the exploration of linguistic relations in “spheres” accurately portrays the mutation of a system and its code—with the proliferation of interventions by users whose actions (re-)construct the virtual text—what one could (or at least should) anticipate are changes according the principles of “selection, replication, and mutation” described above. In terms of the “cellular” renovation that continually renews the (eco)system comprised of a network of words, the “filter” that Ortiz introduces by eliminating “texts lacking meaning” may be read as (a performance of) the extinction of “genes” that simply do not succeed in their (unconscious) affinity to self-replicate,  or which represent genes that are not stable in the larger system. Similarly, Ortiz’s “external” intervention—which at first glance seems “unnatural” given the conscious selection of the program’s designer-creator (or perhaps Creator?) and the ambiguity of what might be deemed a “text lacking meaning”—ends up imitating or mimicking a principle of natural selection by favoring stable “genes,” which have success in “spheres’” linguistic ecosystem.18 In turn, the ­terminological convergence between scientific discourses and everyday language in “spheres” shows the way in which: una interfase [sic] de diálogo, debate, especulación, poética, humor y reflexión, en torno a temas comunes…crea pretextos para la aclaración, confronta visiones del mundo, es la materia prima de la poesía y del humor; en conclusión: genera diálogo (“las palabras de las ciencias de la complejidad: de la ambigüedad al diálogo”). [an interface of dialogue, debate, speculation, poetics, humor and reflection on common themes…creates opportunities for clarification, confronts different worldviews, is the source for poetry and for humor; in conclusion: it generates dialogue.] In other words, the polysemy of the linguistic code constitutes the system and also is constituted by the users, who, in turn, are constituted by the code itself. However, the implicit metaphorization of the concept of linguistic phylogenetics appears to break down here, to a certain degree, since a single gene codes only one segment of DNA, whereas polysemia (or, perhaps, dissemination) is the condition of possibility of the generation of dialogue, as Ortiz himself points out.19 In essence, Ortiz’s “spheres” interface provides a sophisticated approach to the generation of dialogue in a transdiscursive, virtual space. Here we might locate an advantage for the force of aesthesis in “spheres’” digital textualities, in the face of the computational model that characterizes the supposed priority of scientific discourses in (early) digital humanities methodologies.

54  The Poetics of Visualizing Scientific Complexity

Genetic Code as Narrative: “bacterias argentinas” [“Argentine bacteria”] as an Autopoietic System The specular (and asymmetrical) nature of genetic-linguistic formulations in Ortiz’s work evokes another important theoretical touchstone in his writings, which represents a link between his digital projects and Drucker’s speculative computing: Humberto Maturana and ­Francisco Varela’s theory of autopoiesis, which was discussed at length in the previous chapter. Drucker is particularly interested in the way in which autopoiesis radically reconfigures the relationship between subject and object: “The conventional distinctions of subject and object are not blurred; rather, the ground on which they can be sustained disappears because there is no figure/ground, subject/object dichotomy, only a constituting system of codependent relations” (27). Ortiz writes on autopoiesis in several text, including the aphoristic, hypertextual essay “gramatrama”: …Humberto Maturana y Francisco Varela desarrollaron un autómata celular con el cual pueden expresar y poner a prueba aspectos de sus teorías en torno a la autopoiesis (automantenimiento) y la cognición. Este autómata genera patrones que bajo cierta interpretación mantienen una coherencia a la vez que intercambian información con el exterior. Y si bien su trabajo está íntimamente relacionado con la cibernética, su visión de la vida es muy lejana a cualquier versión mecanisista [sic], incluso opuesta. Para ellos vida es cognición. De esta forma presentan el autómata celular no como un modelo de la vida sino como una metáfora, un apoyo lingüístico (“gramatrama”). […Humberto Maturana and Francisco Varela developed a cellular automaton with which they could express and test aspects of their theories of autopoiesis (self-regulation) and cognition. This automaton generates patterns that according to a certain interpretation maintain coherence as they exchange information with their external environment. And if Maturana and Varela’s work is intimately linked to cybernetics, their vision of life is far from any mechanistic account, on the contrary. For them life is cognition. In this way they use the cellular automaton not as a model for life but as a metaphor, a linguistic support.] In “bacterias argentinas” [“Argentine bacteria”] Ortiz models a visual and literary “system of codependent relations,” creating a linguistic-­ multicellular environment that models the interactions between basic organisms in a trophic web of words in a “living” virtual ecosystem. In Ortiz’s words, it is “[un] modelo dinámico de agentes autónomos que recombinan información genética comiéndose unos a otros y en donde la información genética es narración” [“a dynamic model of autonomous

The Poetics of Visualizing Scientific Complexity  55 agents that remix genetic information by consuming one another, and in which genetic information is narrative”]. Ortiz bases his project on metaphors of structural and isomorphic equivalence in order to first establish an analogy between grammatical networks (linguistics) and trophic networks (ecology), and subsequently to extend the logic of this analogy to linguistic phylogenetics through the creation of a visual model (using Flash animation) that “gives life” to his “Argentine bacteria.” Regarding the theorization of grammatical networks, Ortiz draws on a dynamic scheme of grammatical equivalence in order to map out the possible sentence fragments produced by the combination of words in a way that preserves semantic and grammatical coherence. Here Ortiz highlights the multitude of possible combinations of grammatical elements in this network, and emphasizes that with a slightly larger or more complex lexicon (if each node contained a unique sequence of words, for example), one could create a (more) sophisticated narrative. The digital-­ visual interface employed in “bacterias” is “tridimensional, dinámica y hablada” [“three-dimensional, dynamic, and spoken”], since “cada fragmento de frase fue leído y grabado por lo que el texto generado, que es cada vez, por supuesto, diferente, también se habla” [“each sentence fragment was recited and recorded so that each generated text—which is, of course, different each time—also speaks”]. The user-reader can hear the recorded voice by moving the cursor over a single “bacteria” in this dynamic Flash model, upon which she may confirm the “nationality” of the bacteria—since the voice of Argentine Edgardo Franzetti reveals the easily identifiable accent that gives the project its title.20 ­Regarding the trophic relationship established here, Ortiz highlights the directionality of the circulation of matter and energy in his positing of structural equivalence between this network and the grammatical one, regarding its connected and necessarily sequential (or irreversible) aspect. Upon combining both of these networks—the grammatical one and the trophic one—Ortiz describes two narratological possibilities for connecting phrases. He offers the following example: “Un roedor fue comido por un ave depredadora que murió, se descompuso y alimentó la vegetación que fue comida por un protozoo…” [“A rodent was eaten by a predatory bird that died, decomposed and nourished the vegetation that was eaten by a protazoa…”]. Therefore, the linguistic ecology presented in “Argentine bacteria” draws on the notion of directionality as well as the aleatory aspect of the bio-linguistic interactions observed in the digital model. The adaptation of these models to the interface of “Argentine bacteria” is based on the metaphor of structural equivalence, as was previously noted. Ortiz designates the changeable fragments of sentences—“los fragmentos permutables de oración”—as “genes,” since in his visual model the bacteria exchange genetic material upon accumulating or losing energy through the process of phagocytosis (the feeding method of many microorganisms).

56  The Poetics of Visualizing Scientific Complexity Obviously, as in any biological system, there is a limited quantity of resources (the energy in the system), and the locomotion involved in hunting for other bacteria requires the consumption of the energy that a given bacteria ingests via phagocytosis. Upon consuming another bacteria, energy is redistributed in the community, since the consumed bacteria cedes its energy (measured here with respect to the length of its genetic code) to the bacteria that consumes it. It is important to note that each bacteria can only consume other members of the ecosystem whose genetic information may be linked to its own, in terms of the grammatical-­semantic coherence of its genetic code (thus forming a coherent sentence fragment in Spanish). In this way, the interaction between bacteria, whose continual feeding strings together a series of narratives within the bacterial community, provides materia prima for metabolic processes that write narratives and also for the decomposition of bacteria whose genetics are not favorable for the elaboration of narratives, thus constituting a kind of “natural” selection. Ortiz explains that the logic of the communal phagocytosis employed here functions in the following manner: Toda bacteria puede ser comida y toda bacteria puede comer, pero, ¿quién come a quién? Los textos que conforman la información genética se componen de fragmentos iguales a los descritos en la red gramatical. En el modelo, cada uno de estos fragmentos es un gen. El gen final, el último fragmento de frase, sólo puede concatenarse con unos pocos de los fragmentos o genes, según la estructura de la red. De esta forma una bacteria sólo podría comerse a otra si el gen inicial de la otra bacteria puede seguir al gen final de la propia. Así, al componerse el nuevo texto concatenando el de la bacteria comensal con el de la bacteria comida, se obtiene un nuevo texto que preserva una gramática correcta. [Each bacterium can be eaten and each bacterium can eat, but who eats whom? The texts that make up the genetic information are composed of fragments identical to those described in the grammatical network. In the model, each of these fragments is a single gene. The final gene, the last fragment in the phrase, can only be attached to a few phrases from the fragments or genes, according to the structure of the network. In this way a bacterium can only consume another one if the first gene of the other bacteria can [grammatically] follow its own final gene. Therefore, the new text is formed by linking the gene of the “eating” bacterium with the “eaten” one, obtaining a new text that maintains correct grammar.] If a given bacterium is unable to feed itself—for lack of “food” that is appealing to it, in grammatical terms—it dies, and is reborn as a bacteria possessing a single gene (a single word). This rule thus guarantees the

The Poetics of Visualizing Scientific Complexity  57 renovation of the ecosystem through competition and the decomposition/­ rebirth of genes selected by the (supposedly) natural laws of the community. Ortiz’s final comments in the introductory text to “bacterias argentinas” are very revealing, with respect to the principle of highly unnatural selection at play in this project. According to Ortiz, this project models a principle of “infinite injustice”: Quien ha comido más, es decir, quien posee un texto más largo, avanza más rápido. A esta característica del modelo la he bautizado injusticia infinita. Los modelos como éste en donde los individuos que más poseen características positivas son los que más probabilidad tienen de consguir nuevas características positivas pueden ser denominados modelos de tipo neoliberal. En principio un modelo así es retroalimentativo y la conducta de algunos de sus parámetros debería exhibir un crecimiento exponencial que tarde o temprano colapsará el sistema. ¿Ocurre esto en el modelo de bacterias argentinas? [Whichever bacterium eats more—that is to say, whichever possesses a longer text—moves faster. I have named this characteristic of the model infinite injustice. Models like this one in which the individuals possessing the most positive characteristics are the most likely to acquire new positive characteristics can be called neoliberal models. In principle a model like this gives feedback and the behavior of some of its parameters should show an exponential growth that sooner or later will cause the collapse of the system. Does this happen in the “Argentine bacteria” model?] The reference to the neoliberal model has a jocular tone, but it can also be read as a commentary on the Argentine economic crisis of the early 2000s. The criticism implicit here—regarding the “infinite injustice” that results from the neoliberal model—is hardly subtle. Ortiz thus models a virtual biopolitics conceived within a linguistic ecosystem, which clearly constitutes a criticism of neoliberal politics destined to result in the “collapse of the system.” With respect to the framing of this project in terms of the interaction between bacteria, Ortiz writes that this is debido a que éstas acostumbran a compartir información genética de forma bastante promiscua. De hecho se ha dado un inusitiado [sic] y novedoso interés por las bacterias. En particular las bacterias y su comportamiento constituyen una rica metáfora de la libre circulación de la información. [since these organisms tend to share genetic information in a rather promiscuous manner. In fact there has been an unusual and novel

58  The Poetics of Visualizing Scientific Complexity interest in bacteria. In particular, bacteria and their behavior comprise a rich metaphor for the free circulation of information [emphasis in the original].] Ortiz’s description of the metaphoricity of this “free circulation of information” is well-taken, especially in light of several flaws in Ortiz’s modeling of biological processes in “Argentine bacteria.” It is crucial that these inconsistencies be discussed in terms of the specific representation of biological structure and function, as they seriously call into question the validity of Ortiz’s analogical design process. 21 First of all, a trophic network is a representation of the transmission of matter and energy, not of genetic material as portrayed in “bacterias argentinas”. Second, the transmission of genetic material between individual organisms occurs either through sexual or asexual reproduction. There is no reproduction of any kind represented in “Argentine bacteria;” there is only the spontaneous generation of new bacteria when one “dies” (and disappears). This “unnatural selection” is not a true process of natural selection, in a Darwinian sense. And since there is no reproduction of any sort in Ortiz’s model, the kind of exchange of genetic information that takes place is problematic, as it finds no parallel in nature. Next, in “Argentine bacteria,” there are no producers of energy (such as photosynthesizers) nor decomposers: there are only consumers. In fact, there is no clear differentiation between species in this ecosystem. The bacteria exhibit very nearly uniform behavior but in fact do not look like any bacteria that appear in nature (since they do not reproduce sexually nor asexually). Finally, the analogy between the grammatical network and the trophic network, then, is valid, but the link that Ortiz establishes between the trophic and the genetic is highly problematic. 22 Notwithstanding all of these inconsistencies, I firmly believe that “Argentine bacteria” still offers a useful model through which to explore the encounter between humanistic and scientific approaches to the question of life as information. Ortiz’s focus on the free circulation of information at a microscopic level through a closed system allows us to investigate the facticity of autopoietic processes in these cellular automatons. “Argentine bacteria” thus provides a model—albeit a flawed one—through which to approach life as a construct of narratological and biological processes. Before analyzing the autopoietic nature of the “Argentine bacteria” system, it is important to describe the complex interface involved in the program. The visualization of these bacteria interacting in a narrative, trophic system appears as follows (Figures 2.6 and 2.7): In this interface, the user observes the circulation of the bacteria in their quest to survive and reproduce, including their multiple and simultaneous processes of seeking food (visualized through the lines drawn between bacterial cells), eating, competition, decomposition and rebirth, as well as the creation of narratives through the linking of genetic codes (phrases), whose

Figure 2.6  S creen capture, “Bacterias argentinas”.

Figure 2.7  S creen capture, “Bacterias argentinas”.

60  The Poetics of Visualizing Scientific Complexity texts are read aloud (in the Argentine Spanish of Edgardo F.). As opposed to (some) other digital projects by Ortiz, the user-reader may not intervene in this program in a significant way; rather, she may only make a bacteria “speak” by moving the cursor over it. However, the genetic-literary ecosystem of “Argentine bacteria”—observed by an observer who visually consumes the bacterial locomotion around a habitat in search of food, thereby weaving together narratives—provides us with an aesthetic that is both literary and sub-microscopic, comprised of coccus bacteria (spherical, like streptococcus and staphylococcus) and only a few microns in size. While the specific features of the programming involved in creating this micro-scale universe are not especially relevant to the present analysis, a careful accounting of the system is needed to adequately evaluate the ecosystem of these talking bacteria in terms of Maturana and ­Varela’s autopoietic theory. Several concerns immediately arise when considering the possible autopoietic organization of “Argentine bacteria.” First of all, we might inquire if the bacteria—identified by Ortiz in the project’s introductory text as individual cells—are components of a higher-­ order autopoietic system, coupled “como resultado de las modificaciones mutuas que las unidades interactuantes sufren, sin perder su identidad, en el transcurso de sus interacciones…[que son] perturbaciones mutuas compensables” (Maturana and Varela 101) [“as a result of mutual modifications that interacting enities undergo, without losing their respective identities, in the course of their interactions…[which are] compensatory, mutual perturbations”]. Put another way, do the individual bacteria represent closed systems that produce and consume the material needed for their self-regulation/metabolic processes—and thus living (surviving) to tell the tale? Or perhaps the search for food represents a kind of structural coupling, since it connects segments of genetic code? Might we say that the extinction of a specific genetic pattern—not “selected” by the circulation of bacteria in the module—and the appearance (rebirth) of another code (a simple gene) is a violation of the organizational closure postulated in autopoietic theory? Despite the fact that Ortiz does not specify where the new bacteria comes from, he suggests that: Cuando una bacteria muere porque es comida o porque su energía fue consumida, aparece otra, una recién nacida que viene al mundo portando un solo gen. De esta forma la población de bacterias se mantiene estable. Una vez una bacteria acaba de nacer se puede encontrar con la desagradable sorpresa de que su gen, el único que posee inicialmente, es apetecido por otras bacterias. Por otro lado también es posible que rápidamente encuentre una bacteria que puede comer. [When a bacterium dies because it is eaten or because its energy is consumed, another one appears, one that comes into the world bearing a single gene. In this way the bacterial population remains

The Poetics of Visualizing Scientific Complexity  61 stable. Once a bacterium is born it may have the unpleasant surprise that its gene, the only one it initially possesses, is desired by other bacteria. On the other hand it is also possible that it quickly finds a bacterium it can consume.] The final point of concern regarding potential objections to the applicability of autopoiesis to “Argentine bacteria” has to do with one of the fundamental points of Maturana and Varela’s theory, the dictum that “life is cognition,” which is cited by Ortiz himself in “gramatrama” and in other texts. John Mingers succinctly summarizes this key point in the Chilean biologists’ work in the following manner: A cognitive system is a system whose organization defines a domain of interactions in which it can act with relevance to the maintenance of itself, and the process of cognition is the actual (inductive) acting or behaving in this domain. Living systems are cognitive systems, and living as a process is a process of cognition. This statement is valid for all organisms, with and without a nervous system. (Autopoiesis and Cognition 13; in Mingers 68) In light of these considerations, the following discussion of “Argentine bacteria” will explore the following points: (1) if autopoiesis is in fact a valid paradigm through which to analyze “Argentine bacteria”; (2) what is gained from applying autopoietic theory to Oritz’s work; and (3) if the link drawn between Ortiz’s digital model and Maturana and Varela’s theory succeeds in challenging the boundaries between science and poetics in a way that opens new lines of inquiry within the more traditionally-defined limits of humanistic exploration. It may be argued, for the purposes of the current discussion of ­“Argentine bacteria’s” autopoietic closure, that the bacteria are structurally-­coupled with the purpose of maintaining their homeostatic equilibrium; that is, they are structurally coupled in order to feed and to reproduce their genetic code. The closure exists at the level of the model as a system, since—following Maturana and Varela’s ­formulation—the individual bacteria do not produce the components needed for their survival. At the macro level, however, the observer perceives a system that is more or less closed, which constitutes a unity in the virtual space of the Flash simulation. 23 Postulating the structural coupling of the individual bacteria, however, is slightly more problematic, in the context of the structural equivalence between the grammatical and trophic networks that Ortiz emphasizes in “Argentine bacteria.” Since (at the individual level) they do not produce and consume the primary matter that feeds them and provides them with the energy necessary to move about the ecosystem, we must consider the cycle of seeking food and its subsequent phagocytic action as the structural coupling responsible

62  The Poetics of Visualizing Scientific Complexity for the metabolism of the autopoietic system. In order to more deeply explore this question of metabolism—in terms of the analogy between the exchange of genetic material and the linking of linguistic segments to construct a narrative—it is useful to review the parallels between linguistics and genetics highlighted by Ortiz in several places in his writing. As he argues in a text called “redes metaconscientes” [“metaconscious networks”]: La cantidad de información (en este caso genética) que las bacterias hacen circular a nivel planetario supera ya no sólo a internet sino a toda la trasmisión de información cultural humana. Esta reflexión resulta más interesante si se tiene en cuenta que la información genética de un organismo no sólo lo describe a él y el proceso de su constitución, sino también la relación que éste tiene con el entorno, algo implícito en ideas antes planteadas, y que los entornos de las bacterias son increíblemente variados ya que se alojan, entre otras partes, al interior de una gran cantidad de otros organismos ­vivientes –de forma parasitaria o simbiótica-. [the quantity of information (in this case genetic) that bacteria circulate at the global level is greater than not only that of the internet but even the entire quantity of cultural information transmitted by humankind. This observation is more interesting if one keeps in mind that an organism’s genetic information not only describes it and its process of constitution, but also the relationship that it has with its environment (this is implicit in the aforementioned ideas). Bacterial environments are incredibly varied since they live, among other places, inside a great number of other living organisms, in a parasitic or symbiotic manner.] Thus for Ortiz, this “parasitic or symbiotic” way of exchanging information has a symbolic function, since it encompasses the phenomenon of describing the relationship between an organism and its immediate environment. One might inquire whether or not the metaphorical relationship established here between genetics and narration—conceived of in a way similar to the structural equivalence postulated between trophic and linguistic networks in “Argentine bacteria”—can also be applied to the workings of the bacterial simulation. The consumption of bacteria as part of preserving bio-genetic stability, linking phrases at the paradigmatic and syntagmatic levels, thus represents a parasitic or symbolic existence, from the point of view of the autopoietic closure and the coupling of “Argentine bacteria’s” visual modeling. In other words, does “bacterias argentinas” propose that narration (cognition) is parasitic to genetics (material life, bios), or vice versa? The reformulation of this line of thinking in terms of ­autopoiesis shows the relevance of this series of questions to the nature of the

The Poetics of Visualizing Scientific Complexity  63 “Argentine bacteria” model’s autopoietic functioning. Narration, as a tool (or as consequence) of bacterial metabolism in this work, recalls the famous storyteller, Sherezade. Her brilliant tactic in The Arabian Nights—­telling stories to stave off death—appears, to a certain degree, in the bacteria’s feeding efforts, since they link phrases together and tell stories to escape death. Despite the literary or even folkloric roots of this storytelling function, the famous assertion by Maturana and Varela, that “life is cognition,” complicates the applicability of autopoietic thought to the “Argentine bacteria” model, since at first glance—and possibly even upon additional analysis—it is difficult to conceive of Ortiz’s submicroscopic world with respect to organisms that think. But if, following Maturana and Varela, we define a cognitive system as one that demonstrates the central features of autopoiesis (in terms of its closure, metabolism and structural coupling, etc.), then “bacterias argentinas” is in fact a cognitive system in the context of its effective interaction (Mingers 208). The program’s virtual space is thus a linguistic ecosystem that lives and demonstrates the features of cognition, following the conceptual schema of autopoiesis proposed by Maturana and Varela in Autopoiesis and Cognition. A possible next step, admittedly beyond the purview of the current study, would be a detailed analysis of the “languaging” undertaken by the linguistic-­ genetic modeling present in “Argentine bacteria,” in addition to other concerns related to (or as consequences of) this analysis, such as the relationship between autopoiesis and embodiment, Von Foerster’s constructivist argument, and the neocybernetic concept of emergence, discussed by Ortiz in several texts.

“Bacterias argentinas” and Linguistic Phylogenetics El gran parecido entre el lenguaje y la genética es que ambos utilizan la explosión combinatoria a todos los niveles jerárquicos: letras, raíces, sufijos, palabras, frases y sentencias complejas en el lenguaje; bases, tripletes, dominios, exones, genes, operaciones genéticas complejas y organismos vivos enteros en la genética. Y que la evolución se basa en TODAS esas explosiones combinatorias (de las que la última, la combinatoria de organismos vivos enteros, es precisamente la simbiosis). [The great similarity between language and genetics is that both use combinatorial explosion at all hierarchical levels: letters, roots, ­suffixes, words, phrases and complex sentences in language; bases, codons, domains, exons, genes, complex genetic operations and entire living organisms in genetics. As such, evolution is based on ALL of these combinatorial explosions (the latter, the combination of entire living organisms, is precisely symbiosis).] —Javier Sampedro, geneticist (cited in “Árboles de textos” [“Textual Trees”])

64  The Poetics of Visualizing Scientific Complexity This epigraph, drawn from a text written for the symposium and exposition “Banquete_05” (“Árboles de textos…”), establishes a clear connection between genetics and language through each’s propensity to combine basic elements, a link that Ortiz himself highlights in terms of evolution by observing that “fenómenos que ocurren con la evolución de las lenguas (filogenética lingüística) son comparables a otros que ocurren en la evolución de seres vivos desde el punto de vista de su código genético (filogenética biológica)” [“phenomena that occur with the evolution of languages (linguistic phylogenetics) are comparable to others that occur in the evolution of living beings from the point of view of their genetic code (biological phylogenetics)”] (“De la relación a la invención”). For Ortiz, what stands out in the genetic makeup of living organisms is the linguistic metaphoricity of a code composed of the four letters of the DNA “alphabet” (A, C, G, and T; adenine, cytosine, guanine, and thymine, the four nitrogenous bases), which produces: El juego de crear modelos que imiten aspectos de lo vivo ­(alimentación, autopoiesis, metabolismo, lenguaje, reproducción, sexualidad, genoma y fenoma, selección, competencia, motilidad, nacimiento y muerte, conformación de comunidades, y un largo etcétera) opera de diversas formas pedagógicas, científicas y artísticas. Los modelos no son utilizados por los científicos únicamente con el ánimo de simular condiciones, predecir y probar teorías, puede ocurrir que contribuyan a crear nuevas teorías. (“Narrativa, vida, arte y código” 5) [The game of creating models that imitate aspects of life (feeding, autopoiesis, metabolism, language, reproduction, sexuality, genome and phenome, selection, competition, motility, birth and death, community formation, and so on) operates in diverse pedagogical, scientific, and artistic ways. Models are not used by scientists solely in order to simulate conditions, predict, and prove theories, they might also contribute to the creation of new theories.] This confluence of biological, artistic, and social science discourses predominates in Ortiz’s writing and in his digital projects, as well as in the interactive spaces of his commercial data visualization projects, available at Moebio Labs’ website (www.moebio.com). “Argentine bacteria” is a particularly salient example of transcultural and transdiscursive ­digital writing, with a marked emphasis on the creation and fragmentation of narrative through visual and genetic modeling. What the “symbiotic” approach here makes possible—as opposed to a “parasitic” one, to use the terminology found in “bacterias argentinas”—is an interdisciplinary operation “worthy of the name,” which calls for bidirectional exchange

The Poetics of Visualizing Scientific Complexity  65 between discourses often taken as diametrically opposed: the sciences and the arts. In this way, by focusing his virtual projects on the subjective situation of design and textual modeling—whether or not they are conceived of as literary, computational, scientific, visual, or even “desde la escritura” [“departing from writing”], as Ortiz himself contextualized the origins of his work—Ortiz’s digital corpus eschews the simple application or incorporation of scientific theories into humanistic studies, insofar as his work engages the paradigm of the reformulation and remediation of the correlations between these discourses previously considered incompatible or even antagonistic. Ortiz’s visual mapping of the confluence between genetic and linguistic codes, for example, together with a bio-literary poetics, paves the way for the construction of new bridges between the sciences and the arts. Regarding his conceptualization of the network as trope and as strategic model, Ortiz writes: Ciertas técnicas simples de estudio comparativo de código genético se pueden aplicar a cualquier entidad que también posea un sustrato de código, como un libro (cuyo código es el texto), o una pieza musical tonal (cuyo código es la partitura). Por otro lado los bioinformáticos han desarrollado estrategias y técnicas de visualización que ayudan a evidenciar propiedades del código que cierta investigación necesite. Así por ejemplo, por medio del trazo de arcos, es posible develar las repeticiones de secuencias de código. Correlacionando estas ideas podemos entonces aplicar técnicas de visualización de propiedades de código genético a una fuga de Bach o cualquier otra pieza y obtendríamos una técnica de visualización musical. (“de la relación a la invención”) [Certain simple tools of comparative analysis of genetic code can be applied to any entity that also is code-based, like a book (whose code is the text), or a tonal piece of music (whose code is the score). On the other hand, Biocomputing specialists have ­developed strategies and visualization tools that help to prove properties of code required by particular research. Thus, for example, by tracing out arcs, it is possible to reveal repetitions in sequences of code. Linking together these ideas we can subsequently apply visualization tools from the attributes of genetic code to a fugue by Bach or any other piece, and thus obtain a technique for musical visualization. 24] Ortiz argues that this reconceptualization of the barriers between the sciences and the humanities, nevertheless, is not as radical as it might first appear, since “[n]o es sólo posible sino que siempre ha ocurrido” [“it is not only possible but has always occurred”]. It takes place today with

66  The Poetics of Visualizing Scientific Complexity “renewed energy” as a result of technological advances that permit the creation and theorization of this new textuality. Curiously, Ortiz suggests that when new bridges are established between art and science, and discourses and interests mix, the main contribution is that “las humanidades, el arte, la ciencia y todas las formas de conocimiento se retroalimentan y contribuyen así a la formación de un ser humano menos fragmentado (“de la relación a la invención”) [“the humanities, the arts, and the sciences and all forms of knowledge feed off of each other and contribute to the development of a less fragmented human being”]. His emphasis on human subjectivity—on the improvement of humankind’s conditions of existence (be they intellectual, empirical or perhaps even ontological) as a function of transformations in the processing of information and in cognition—recovers agency or regains ground for aesthesis in the face of the hegemonic paradigm of mathesis that characterized early DH approaches. This might be read, perhaps (only) at first glance, as a rather traditional reaction on ­Ortiz’s part to the supposed (apocalyptic) “threat” of posthumanism and the primacy of mathematical logic to subjectivity. However, as Johanna Drucker points out—in a way that is similar to Ortiz’s own reflections— what is at stake here is not simply a reversal of the aesthesis-­m athesis paradigm: From my very first encounters with digital media, I have been convinced that the powerful cultural authority exerted by computational media, grounded in claims to objectivity premised on formal logic, can be counterbalanced through aesthetic means in which subjectivity is central to the concept of knowledge as interpretation. (xiii) Perhaps in a larger sense—and as I will argue in more detail below—in the context of the current crisis of the humanities (both in terms of the delimitation of its objects of study and in university, state, and national budgets, for example), we might read Ortiz and Drucker as indications of the Kuhnian paradigm shift needed for the humanities (as an umbrella term for specific discursive and intellectual concepts) to reformulate its roles and its goals in the early twenty-first century. The speculative model outlined above thus offers certain avenues through which the humanities might reconsider its object of study as well as its predominant methodologies. Regarding Ortiz’s optimism for “the development of a less fragmented human being,” at the very least one can see how in Ortiz’s work the praxis of writing facilitates a profound theoretical and artistic exploration that elicits or innovates new forms of (conceiving of) intersubjectivity upon “unravel[ling] narrative, reflections, theories, arbitrariness, poetry, humor” and networks in his

The Poetics of Visualizing Scientific Complexity  67 visual models. This is precisely the way in which we might locate the literary nature of Ortiz’s digital projects, since they construct interactive computing spaces that permit the creative linking of phrases from the articulation of the materiality of writing and coding. They also unfold semantic and discursive networks that foster new modalities of an ongoing conversation between the humanities and the sciences. It is this potentiality and literary-critical encounter—facilitated by new virtual/ virtualized textualities—that best highlights the connections that already exist (as Ortiz correctly shows) between scientific and humanistic discourses.

Notes 1 All translations are mine unless otherwise noted. 2 Such as “la relación entre hombre-máquina, los grandiosos o desastrozos [sic] futuros debido a la tecnología, la red digital como cerebro colectivo, lo ciberpunk, los activismos tecnológicos y los hacktivismos, los copyleft y los commons, y un gran etc[é]tera” (“arte: la mínima letra”) [“the relationship between man and machine, grandiose or disastrous futures resulting from technology, the digital network as a collective brain, cyberpunk, techno-­ activism and hacktivism, copyleft and commons, and a big etcetera”]. 3 This is, of course, a very narrow view of the myriad conceptualizations of DH that continue to proliferate within (and outside of) academic circles. For some, my reliance on Drucker’s argument might appear to set DH up as a straw man. However, since my book is primarily a study of Latin American digital poetics and science, I do not wish to distract from my main object of inquiry by devoting additional space to the larger stakes of the DH debate in the academy. I refer the reader to other challenges to the mechanistic side of digital humanities that Drucker targets in SpecLab, incluing, for example, cultural studies DH approaches by Alan Liu, HASTAC (Humanities, Arts, Science and Technology Advanced Collaboratory), “That-Camp,” and ­Postcolonial Digital Humanities (better known by its Twitter handle, #dh poco, an initiative founded by Adeline Koh and Roopika Risam). 4 Nevertheless, Drucker deconstructs—with a certain Gödelian and poststructuralist flair, I would argue—the supposed impartiality of the language of mathematics and computing: Because mathematical forms of knowledge are presumed to lie outside of ideology, this conception validates digital representation in a way that forecloses interrogation. My double agenda is to disclose the ideological assumptions in the way the ontological identity of the digital image is posed and to suggest that graphesis (information embodied in material, and thus ambiguous, formats) can challenge mathesis. (136) 5 George Landow’s seminal study Hypertext (in its 3.0 incarnation, in particular) discusses the limitations of the ubiquitous terms “interactive” and “interactivity” (42–3). Here, Landow cites Espen Aarseth’s groundbreaking book Cybertext in his critique: “to declare a system is interactive is to endorse it with a magic power” (Aarseth 48, in Landow 42). Aarseth prefers a theory of “ergodicity,” insofar as in ergodic works, “non-trivial

68  The Poetics of Visualizing Scientific Complexity effort is required to allow the reader to traverse the text” (1). While Landow points out that Aarseth’s neologism is not immune to criticism, since the definition of “non-trivial” is hardly objectively quantifiable, Aarseth’s analysis as a whole offers a useful warning about the overuse of terms like “interactive.” 6 Flash is a very popular platform for e-literary works produced in Latin ­A merica and by (those that self-identify as) Latin Americans. C. T. Funkhouser’s book New Directions of Digital Poetry neatly summarizes the changes implemented in each successive version of Flash (10). Nevertheless, Flash has been in decline in North American e-lit circles for nearly ten years. At the Modern Language Association’s annual convention in January 2014 a particularly suggestive roundtable addressed this very issue. A summary of the discussion can be found on Mark Sample’s homepage: www.samplereality.com/2013/04/10/ electronic-literature-after-flash-mla14-proposal/#more-2785. 7 The choice of the tree motif for Ortiz’s poetic data visualization is important, as it evokes images of logic trees in problem solving, as well as the arboreal examples employed in linguistic accounts by Aristotle and Ferdinand de Saussure, among other thinkers. 8 Ortiz does not specify what he considers a “long word” nor a “short word” here. And as the following discussion will show, the hierarchy that he establishes in “Textual Trees” is relative within a given poem, thus more precise terminology is not needed. 9 Interestingly, in his study of the fractal-like properties of language, Ortiz’s algorithm shows how structures generated linguistically (mathematically) end up mimicking structures that appear in nature, as demonstrated by ­B enoit Mandelbrot in a number of contexts. 10 See Oulipo: A Primer of Potential Literature (trans. and ed. by W ­ arren Motte) and Oulipo Compendium (ed. Harry Mathews and Alastair Brotchie) for an excellent selection of texts by and about this experimental group. 11 I have been able to verify that this is always the case by observing numerous iterations of the program’s cycling. 12 “[E]ligiendo cada vez un [sic] rama aleatoria” [“Each time selecting a branch at random”], as Ortiz asserts, conferring a kind of agency on each signifier “capable” of selecting its place in the tree’s linguistic architecture. 13 Although the spheres I will discuss in detail are the complexity sphere and the one in Spanish, for the purposes of this chapter it is also important to note that the other two spheres—at least per my own observations—­ demonstrate the same general properties and internal logic, but with distinct interventions (mediated as a function of the specific linguistic, cultural, and discursive particularities implied by the choice of language). It is clear that as part of this trilingual project the possibility to move between spheres in three languages is extremely interesting, but the program in fact does not permit movement or navigation within a sphere constructed in/of three languages (despite what the instructions accompanying the module appear to suggest), which would truly be a trilingual sphere. Nevertheless, Ortiz suggests that he wishes to add other linguistic spheres to this “proyecto abierto en constante desarrollo (work in progress)” [“open project in constant development”], including those “de uso extendido en internet (alemán o francés) y otros…muy locales y de baja aparición en internet (basco [sic], criollo cabo verdiano)” [“widely used on the internet (German or French) and others…that are very localized and appear much less frequently on the internet (Basque, Cape Verdean ­Creole)”] (“esferas: superficies esféricas de diálogo”).

The Poetics of Visualizing Scientific Complexity  69 14 According to Ortiz, the distribution of the words works in the following manner: Los puntos se ubican en la esfera utilizando coordenadas polares; la posición en la esfera está determinada por un par de valores correspondientes a dos ángulos (el sistema es equivalente a la ubicación por altitudes y latitudes). Para la distribución aleatoria basta con generar dos ángulos aleatorios. Para la distribución ordenada, en cambio, es necesario crear un algoritmo que distribuya los puntos de forma que la variación de la distancia entre puntos vecinos sea mínima. El algoritmo que utilizé [sic] es simple: ubica todos los puntos en anillos, un número proporcional de puntos a la langitud [sic] de cada anillo, verificando que la distancia entre anillos resulte lo más aproximada a la distancia entre puntos en cada anillo (“esferas: superficies esféricas de diálogo”). [The points are assigned on the sphere using polar coordinates; their position on the sphere is determined by a pair of values corresponding to two angles (the system is equivalent to location by altitudes and latitudes). For the aleatory distribution it is enough to generate two aleatory angles. For the ordered distribution, however, it is necessary to create an algorithm that distributes the points such that the variation in distance between neighboring points is minimal. The algorithm that I used is ­simple: it places all the points on rings, with a proportional number of points on the length of each ring, checking that the distance between rings approximates the distance between points on each ring.] 15 Ortiz arrives at this figure through the use of an equation that shows that the number of connections between N elements in a system (counting the number of pairs in a system of 122 elements) is ∑N(N−1)/2; he thus calculates that 122 elements produce 7,381 relations amongst them (“esferas: superficies esféricas de diálogo”). 16 Nevertheless, my exploration of these “spheres” has turned up numerous entries that would certainly constitute “texts lacking meaning,” according to this criterion. 17 Also noteworthy is the interactive potential provided by the user who provided her email address, thus generating another level of interactivity through the loop formed by the system, the material and virtual trace of the user’s intervention, and future users of the program. 18 The reference to “unnatural selection” here recalls Richard Dawkins’ discussion of cumulative selection in computer simulations of evolutionary processes (The Blind Watchmaker). 19 A subsequent discussion of Eduardo Kac’s bioart will analyze the relationship between genetic code and polysemia (see Chapter 4). 20 The visual model is based on another program previously written by Ortiz, called “el cerebro de Edgardo (el inventor de historias)” [“Edgardo’s Mind (the Inventor of Stories)”]. It was presented at the exposition “El ­I nventor de Historias” [“The Inventor of Stories”] in Madrid’s Centro Cultural Conde Duque (from April 14 to May 16, 2004; www.medialabmadrid.org/­ inventor/), and is an installation whose narración emerge de un algoritmo aleatorio que recorre una red semántica, recombinando palabras y manteniendo una gramática correcta. Esta red (que por otro lado es isomorfa a una red trófica de una ecología) se representa tridimensionalmente, con lo cual el ‘cerebro’ de Edgardo, queda al descubierto

70  The Poetics of Visualizing Scientific Complexity [narration emerges from an aleatory algorithm that scans a semantic network, remixing words and maintaining correct grammar. This network (which on the other hand is isomorphic to the trophic network of an ecosystem) is represented in three dimensions, through which Edgardo’s “mind” is revealed] (http://moebio.com/cerebro/) The tension between the placelessness of the network and the project’s specific geo-political coordinates (Argentina following the crash of 2001) is very interesting in the context of Latin American Technopoetics’ concluding remarks about postregional writing that is nevertheless transected by “the Latin American.” 21 As I will argue below, these problems do not entirely undercut the value of Ortiz’s model to the present examination of the growing dialogue between scientific and humanistic discourses. 22 I am very grateful to my friend and colleague, biologist Pedro Morán-Palma, for helping me to analyze Ortiz’s project from a scientific standpoint, as well as for our ongoing conversation about the relationship between the sciences and the humanities. 23 There remains, however, an additional hiccup in the formulation of the system’s closure. It is implicit in the life cycle of those bacteria who die from not finding suitable material to consume (“El gen final, el último fragmento de frase, sólo puede concatenarse con unos pocos de los fragmentos o genes, según la estructura de la red”); they are reborn as bacteria possessing only one gene, thus maintaining a stable population. This is a manifestation of a phenomenon finally refuted by Louis Pasteur in 1854: the principle of the spontaneous generation of microbes. Since there is no explanation of this erroneous principle, it may be read as a weak point in the modeling of this biological system. 24 This question of the translation and translatability of code will be a major subject of discussion in Chapter 4, in my analysis of Brazilian-American bioartist Eduardo Kac’s installation “Genesis” (1999).

3 Loss Pequeño Glazier’s Quantum Poetics Algorithmic Poetry and Its Variants

In her ambitious essay “Quantum Poetics: Six Thoughts,” Stephanie Strickland analyzes the multifarious ways that poetry has been mediated by new technologies in its move from page to screen and beyond. She summarizes her six primary areas of concern regarding the current multi-­ dimensional nature of digital art with respect to the following points: 1) the discovery or refinement of new time dimensions, from macroscopic “world lines” to engagements at the periphery of attention to “curled-up” hidden possibilities; 2) privileging what I call a stenographic paradigm for interaction: “moving through me as I move”; 3) cultivation of an oscillatory or flickering kind of attention, directed not only to different components but also to different emergent levels as we have learned to understand these in dynamic systems; 4) ­thinking beyond oscillation to superposition; 5) ­remolding our ­sensorium, our neuro-cognitive capabilities, through these new works; and finally, 6) a sense of the importance of the practice of translation, understood as encompassing acts of transduction, transposition, transliteration, transcription, transclusion, and the transformation we call morphing. (25) Strickland’s essay is dedicated to elucidating these six points, and while each individual section is relevant to our analysis of the scientific explorations undertaken in a certain zone of Latin American digital poetics, the fourth point—titled “Superposition”—is of particular interest here. I thus reproduce it in its entirety: To recognize threads in the cloth, then patterns in the weave, and then to understand every thread, every pattern, as co-present, superimposed on each other in a multi-dimensional space, a superposition space: all “there” until “then, when” only one is observed, one trailing and entailing long-range correlations. Quantum mechanics is an engineering science used for building electronic devices. The equations “work,” as well tested as any, but the language describing what they do is either entirely mathematical

72  Loss Pequeño Glazier’s Quantum Poetics or verbally extremely counter-intuitive. To explain all the observed effects, one must acknowledge that “the particle” is in more than one place, is in fact “everywhere at once”. It takes a very long time to compute atomic angles in a molecule, using quantum mechanics, yet the forming molecule figures it instantly. It seems to store superpositions, many states at once, or to do many calculations simultaneously. In a quantum system when two particles interact, their fates are entangled, interdependent, remarkably correlated, beyond any such interdependence in the classical world. Quantum mechanics suggest every possible separate configuration and a profound entanglement, that can yet be undone, can decohere. What it does not suggest: intermediate states, fused combinate states, Gesamtkunstwerke. The physics of neuron and transistor depend on quantum mechanics, but neural processing appears to take place at the c­ lassical, ­Newtonian level. I offer no suggestion of quantum mechanism, here, with regard to digital art; but rather a set of metaphors for understanding that draws on the struggle between mathematical abstractions and words in coming to terms with quantum mechanical effects. I suggest that we may need and expect a new level of emergence, a new form of gesture, of notation, perhaps notating processes rather than images or outcomes—even as the Feynman diagrams permitted a rethinking of quantum mechanics—to grasp the situation that has emerged in the ever-filling space of interconnected digital structures, to understand the effects of network connectivity on the synchronization of biological oscillation. (35–6) In Strickland’s essay, which is ostensibly focused on “the quantum in poetry,” this rather lengthy selection is the place where she most directly confronts the tension between classical and quantum worldviews in the context of the Kuhnian paradigm shift that occurred in poetics with the arrival of digital technologies to the literary world. It is, however, the shortest “talking point” by far in Strickland’s essay, and it is the only one that does not cite a single poetic work as an example. It also, significantly, offers no specific quantum framework through which the reader might consider a paradigm for quantum art; to ­reiterate, ­Strickland remarks that she “offer[s] no suggestion of quantum mechanism, here, with regard to digital art; but rather a set of metaphors for understanding that draws on the struggle between mathematical abstractions and words in coming to terms with quantum mechanical effects” (36). The present chapter seeks to respond to this puzzling lacuna in Strickland’s otherwise suggestive essay, by elucidating the workings of a sophisticated “quantum mechanism” in the digital poetics of Loss

Loss Pequeño Glazier’s Quantum Poetics  73 Pequeño Glazier. Through close readings of two of Glazier’s algorithmic poetic works—titled White-Faced Bromeliads on 20 Hectares and Four Guillemets—I develop a “quantum poetics of variant strings,” which marries Strickland’s gestures towards digital poetry’s quantum superposition and decoherence with Glazier’s own emphasis on “variant protocols” and palimpsestic textualities. I argue that the variance at play in Glazier’s multi-valent poetic variants illustrates the principle of quantum superposition in a very non-metaphorical way, and therefore the literary dynamics of his writing contributes to an ongoing and enriching conversation between artistic and scientific discourses. Loss Pequeño Glazier directs the E-Poetry Center (http://epc.buffalo. edu), one of the world’s largest and most prominent online resources for digital poetry and poetics. Glazier is a Professor Emeritus in the ­Department of Media Studies at the State University of New York at ­Buffalo, and is the founder and President of the internationally renowned festival E-Poetry, which is held every other year at locations spanning the globe. In addition to authoring the groundbreaking book of criticism Digital Poetics: The Making of E-Poetries (2002), Glazier has published numerous print and digital collections of poetry, as well as visual and sound works, performance pieces, and installations. Glazier’s online algorithmic works, however, represent his most profound engagement with the artistic, mystical, and scientific worldviews that together engage a highly-complex and multifarious approach to (digital) literary production. White-Faced Bromeliads on 20 Hectares (1999–) is, in Glazier’s own words, a “JavaScript investigation of literary variants with a new text generated every ten seconds.” He provides a detailed, yet concise set of “reading instructions” that accompany this online poetic exploration of algorithmic literary composition: Allow this page to cycle for a while, so you can take in some of the images and variant titles. When you are ready, press begin. Once there, read each page slowly, watching as each line periodically re-constitutes itself re-generating randomly selected lines with that line’s variant. Eight-line poems have 256 possible versions; nine-line poems have 512 possible versions. It is noteworthy that this project is now tri-lingual, as Glazier recently released a translation of the entire Bromeliads work into digital French and Spanish versions. The project homepage includes images of the ­Glazier family’s trip to Costa Rica, which are juxtaposed with a one-line subtitle that changes every ten seconds, along with the accompanying photo (Figure 3.1). Upon clicking “Begin,” the reader is first confronted by a photo (usually a different one, per the algorithm that selects the specific image) and an invariable “subtitle” for the poem to be displayed on the screen. The first

74  Loss Pequeño Glazier’s Quantum Poetics

Figure 3.1  S creen capture, White-Faced Bromeliads on 20 Hectares.

poem, which is composed of eight lines and simply designated as “Uno,” cycles visually and semantically at a ten-second interval until the reader clicks “Dos” at the bottom of the screen. When “Dos” is selected, another image and (predetermined) one-line poetic subtitle appears, which is followed by the shifting text of an eight-line poem titled “Dos.” A similar pattern takes shape when the reader clicks on “Tres,” “Cuatro,” etc. up to “Ocho,” the final poem in the series. The number of verses per poem, however, grows as the series’ narrative evolves: the first three ­poems have eight lines each, poems four and five have nine lines each, and the final two poems have ten lines each. The key feature of these poems, with respect to the current exploration of ­Glazier’s ­quantum poetics of variance/ variants, operates at the level of the individual line. Each line that appears on the screen is a selection from one of two possibilities written into the source code, thus exhibiting a binary logic of variants that, as we will see, evinces a logic of quantum superposition and also takes into account the effect of the observer on the quantum state of the poetic system.

Loss Pequeño Glazier’s Quantum Poetics  75 Leonardo Flores has written an insightful essay that proposes several close reading strategies for Glazier’s White-Faced Bromeliads on 20  Hectares. Flores suggests that Glazier’s combinatorial work might best be approached in successive stages: 1 Follow the instructions and experience the poem as suggested by Glazier. Reread each stanza several times until you get a feel for it, and press on to the next sections. 2 Read each line carefully along with its preceding and following lines, seeking grammatical and syntactic connections between them, while waiting for its variant. Repeat the process for several cycles, seeking also connections between variants of the same line. Work your way down each line carefully until you have a clearer picture of how the stanza holds together grammatically, syntactically, and thematically. 3 Print out several variants in order to have some stable material texts and do close readings of them. Screen captures of the poem also work. 4 View the source code for the poem, which will reveal each variant and the programmed instructions that determine their behavior (1). As Flores notes, if each poem, from “Uno” through “Ocho,” is considered as a separate text, then there are 4,342 possible individual ­poems given the binary logic of each potential line. If one considers each text as a stanza in a larger poem comprised of 71 lines, then this calculation yields a whopping 2.36 × 1021 possible texts (Flores 2–3). The aesthetic of literary potentiality employed by Glazier resembles the experimental procedures of the Oulipo (Ouvroir de littérature potentielle, or ­Workshop of Potential Literature), which sought—in the words of Raymond Queneau—”[t]o propose new ‘structures’ to writers, mathematical in nature, or to invent new artificial or mechanical procedures that will contribute to literary activity: props for inspiration as it were, or rather, in a way, aids for creativity” (51). As is wellknown (and as Chapter 2 briefly described), the Oulipo’s mechanical and often mechanistic procedures employed formalist constraints such as the lipogram (including Georges Perec’s masterful detective novel La ­disparition [A Void]), the S+7 method (“taking a text and replacing each substantive with the seventh following it in a given dictionary” (Queneau 61)), “X takes Y for Z,” as well as various isomorphisms (such as isosyntaxism and the matrical analysis of language, for example) and algorithms. The most famous implementation of an aesthetic of literary potential can be found in Queneau’s well-known work “Cent mille millards de poèmes” (cited in the previous chapter), which is a machine for the production of sonnets—one hundred thousand billion of them. The ten 14-line sonnets compose a kind of flip-book in which the reader might replace any given verse with a corresponding verse from one of the other nine sonnets,

76  Loss Pequeño Glazier’s Quantum Poetics moving down the page to compose one of the 1014 potential poems.1 On ­Queneau’s estimate, a reader who dedicated 24 hours a day to reading through the potential sonnets would require 190, 258, 751 years to finish this insurmountable task (Mathews and Brotchie 14). Flores’ close reading of Bromeliads first analyzes Glazier’s poetic work vis-à-vis a Critical Code Studies approach. According to Mark Marino, the director of the Humanities and Critical Code Studies Lab at the University of Southern California, this involves an approach that applies critical hermeneutics to the ­interpretation of computer code, program architecture, and documentation within a socio-historical context. CCS holds that lines of code are not value-­neutral and can be analyzed using the theoretical approaches applied to other semiotic systems in addition to particular interpretive methods developed particularly for the discussions of programs. (“Critical Code Studies”) Flores subsequently carries out a nuanced, interpretative reading of Bromeliads that traces the evolving affective and linguistic perspectives evinced by the first-person speaker throughout the poem. The media-specific analysis employed in Flores’ reading of Glazier’s poetic machine strips the poem of its dynamic behavior and reconstructs the text in its “analog” form, which constitutes, as Flores notes (following Jerome McGann and Lisa Samuels), a kind of deformative reading. At the same time, by carefully exploring formal patterns that emerge within the variants, Flores shows that the sense of fragmentation that characterizes the first few poems’ distracted focus on work, computing, confrontation, etc. (all the while not succumbing to Costa Rica’s natural beauty) quickly dissolves into a much more peaceful and contemplative state reflecting the poetic voice’s immersion in this exotic land. 2 What is particularly striking, with respect to the current exploration of Loss Pequeño Glazier’s scientific poetics, is the quantum formulation of the concept of variant poetic lines in Glazier’s own writings, especially where he discusses the variance embodied by Bromeliads’ shifting signifiers. In an essay titled “Stringing Disturbances/­Degramaticalidad,” Glazier presents several examples from the code he wrote for ­Bromeliads, the first of which reads: a9 = new makeArray(2); a9[0] = ‘bathe in the river heated by the lava’s light. Pura vida, compita.’ a9[1] = ‘bathe in the river heated by the lava’s flow. Pura vida, compita’.

(95)3

Loss Pequeño Glazier’s Quantum Poetics  77 This subtle, one-word variance, according to Glazier, is part of a textual architecture that is not palimpsestic in nature. He writes, “Each time each string is either physically present or physically absent. The trace of the variant is not physical; it is phenomenal” (95). Further, Glazier’s second example revolves around the poetic technique of enjambment, recruiting readers’ propensity to “fill in the blanks” (95) in the face of “non-sensical” output by the code/machine, given the absent connective lines that often result from his use of binary variance. And while ­Glazier’s third example explores the privileging of “poetic sensibility over semantic content,” the discussion of multiple textual states that appears on the following page of the essay constitutes the clearest allusion to the quantum nature of this formulation. In fact, a few short paragraphs later, Glazier cites Vilém Flusser’s Does Writing Have a ­Future?, in which Flusser writes that in light of discoveries in physics, the emergence of the digital will shift our worldview in two principal ways: “space, once seen as absolute, and time, once seen as clearly elapsing, are nothing more than relationships between observers…[and] the world, once seen as solid, is no more than a swarm of tiny particles whirling about at random” (Flusser 141 in Glazier 96). Glazier explicitly limits his analysis here to the literary realm, insofar as his essay is principally interested in the ways that “forms of digital literary practice break grammar, spew it across the screen, and reassemble it” (96), but the poet’s hint at what I am calling a “quantum poetic superposition of variants” in White-Faced Bromeliads on 20 Hectares is quite prominent in his emphasis on “multiplicity, simultaneity, temporality, transmission, and computer generation” (96). The quantum logic I refer to here emerged from the development of a quantum mechanical model as part of the advances in theoretical and experimental physics that took place in the early part of the twentieth century. The scientific revolution associated with the shift from a classical (Newtonian) to a quantum worldview was not, however, limited solely to scientific discourses. Alicia Rivero highlights the dramatic paradigm shift that also took place in humanistic circles: “Einstein’s relativity and the Copenhagen interpretation of quantum mechanics presented a new world-view, which conceptualized time, space and other aspects of classical physics, while metamorphosing the art, literature and philosophy of the twentieth century” (137). Whereas a complete historical portrait of the quantum revolution is well beyond the scope of the present study, certain key concepts must be explored in order to develop a rigorous theory of quantum poetics, as it pertains to this analysis of Loss Pequeño Glazier’s sophisticated algorithmic variance, as well as to the incomplete argument put forth by Stephanie Strickland at the start of this chapter. Quantum physics encompasses a series of notoriously complex theoretical and experimental developments that originated in the late nineteenth century, growing out of studies of light and radiation by Michael

78  Loss Pequeño Glazier’s Quantum Poetics Faraday, Heinrich Hertz, Ludwig Boltzmann, Max Planck, and Albert Einstein. Einstein’s application of Planck’s quantum hypothesis to explain the photoelectric effect was part of his annus mirabilis of 1905, in which he published four groundbreaking papers that would forever change our view of the physical world: the first on the photoelectric effect, the second on Brownian motion, the third on special relativity, and the final one on the equivalence between matter and energy. Whereas Niels Bohr would elaborate a quantum model of the atom in 1913 using Planck’s quantum hypothesis, it was Louis de Broglie who described the wave-like behavior of matter, a development that would give rise to the quantum mechanical formalism found in the work of Werner ­Heisenberg and Max Born. In 1927 Heisenberg formulated his uncertainty principle, which states that there are limits to the accuracy with which a particle’s position and momentum may be measured. The Copenhagen interpretation of quantum mechanics, based largely on Heisenberg’s uncertainty principle, has stood the test of time as the most widely-accepted explanation for the behavior of sub-atomic particles. This probabilistic model for particle behavior radically rejected the certainty of the classical model, and its calculations provide scientists with a series of probabilistic measurements about a particle and its behavior when it is observed. In addition to the probabilistic accounting for the whereabouts and velocity of sub-atomic particles, another type of complexity exists in quantum mechanics’ model of the atom. As Edwin Schrödinger proved with the development of his wave equation, Newton’s second law of motion (Force = mass × acceleration) was inadequate to explain the evolution of a system over time; rather, Schrödinger crafted a differential equation that precisely accounted for the wave function of a given particle or system. When the system is observed, however, the Copenhagen interpretation of quantum mechanics provides for what is known as a “wave function collapse,” in which the particle “chooses” a path and can no longer be described by a superposition of potential states. If no measurement is made, the system continues according to the Schrödinger equation; following measurement, the particle or system can be described according to the laws of classical physics. Regarding the superposition of quantum states, this formulation would give rise to the infamous paradox involving “Schrödinger’s cat,” a thought experiment that explored the ­strangeness of a quantum system’s superposition of possible states “coexisting” at the same time prior to observation. Schrödinger postulated this large-scale quantum thought experiment in the following terms: A cat is penned up in a steel chamber, along with the following device (which must be secured against direct interference by the cat): in a Geiger counter, there is a tiny bit of radioactive substance, so small, that perhaps in the course of the hour one of the atoms

Loss Pequeño Glazier’s Quantum Poetics  79 decays, but also, with equal probability, perhaps none; if it happens, the counter tube discharges and through a relay releases a hammer that shatters a small flask of hydrocyanic acid. If one has left this entire system to itself for an hour, one would say that the cat still lives if meanwhile no atom has decayed. The psi-function of the entire system would express this by having in it the living and dead cat (pardon the expression) mixed or smeared out in equal parts. (Schrödinger n/p) Schrödinger’s proposition responds to the quantum superposition argument developed in a well-known paper by Einstein, Boris Podolsky, and Nathan Rosen, whose resulting publication (1935) would pave the way for the concept of quantum entanglement and for the many-worlds interpretation of quantum mechanics (in which each event triggers a branching point for new universes, each of which encompasses a different quantum “decision”). The point driven home by Schrödinger sounds a bit absurd when considered in non-quantum terms (relative to largescale objects, that is), but his discussion of the principle of superposition and of the observer problem represents an important contribution to the difficult issue of measurement in quantum mechanics. These questions of superposition, measurement, and observation are, in fact, a crucial part of the quantum poetic operations at play in Loss Pequeño Glazier’s White-Faced Bromeliads on 20 Hectares. The most prominent feature of his quantum poetics resides in the binary logic employed in Glazier’s poetic variance. For example, upon reviewing the data set of all possible poems emerging from the code that selects which variant to display in a given iteration of Bromeliads, the word “Indians” appears in one of the two possible outputs for line nine of Bromeliads’ sixth poem: a1[0] = “Buzz-dived by 6 a.m. hummingbirds chirrups volcano with shroud” a1[1] = “of elusive quetzal. Tropical mountains rising Tahitian ridged green.” a2[0] = “Renamed ‘Fortuna’ (‘Luck’) when it was the only town left after” a2[1] = “the 1968 eruption. Everything jumping by 7 am, 37¢ coffee.” a3[0] = “Reading the Pre-Socratics in Havana. Who just came down here” a3[1] = “six years ago and never left, leggotts, open waisted, fresh-washed” a4[0] = “canary scent. The eggs with salt, black-sugared coffee, how it” a4[1] = “comes. Past casaba (yucca) eat the root not the tree to Los Chiles.”

80  Loss Pequeño Glazier’s Quantum Poetics a5[0] = “Did you have a chance to see the volcano last night? Pendulous” a5[1] = “Black ash of the sugar cane. Dried pulp firewood. Turn bright” a6[0] = “papayas upon tree stalks in front of sugar cane fields. The sap can” a6[1] = “burn your lips savia blanca de la papaya. Ginger plantations with” a7[0] = “red and white flowers, putting pineapple peels in water with sugar” a7[1] = “3 or 4 days for a potent licor de piña. El Flechazo’s hundreds of” a8[0] = “green sunlight-sucking iguanas form a canopy above the trees.” a8[1] = “green sunlight-seeking iguanas form a canopy above the trees.” a9[0] = “orange in the mating season. Behind the hibiscus head is an orange grove.” a9[1] = “needs water. Only Indians allowed to eat iguanas. Nicaraguan cane cutters.” (reproduced in Flores 9) There is (ostensibly) a 50% chance that the variant a9[0] will be the final verse in any given iteration of this poem; by the same token, the odds are the same that the displayed variant will be a9[1]. Therefore, the appearance of an explicit reference to an indigenous element in this poem has a probability of p = 0.5. That said, might we then conclude that in a poem displaying a9[0], then, a9[1] is simply absent? Or, does a material trace of a9[0] remain in the virtual space of the algorithmic poem? With respect to this poem or series of poems that rigorously theorizes and embodies the variant, Glazier writes—as I cited above—“Each time each string is either physically present or physically absent. The trace of the variant is not ­physical; it is phenomenal” (95). This is a textuality that, as he rightly argues here, is not palimpsestic—it is, rather, quantum in nature. ­Glazier’s text therefore demonstrates what I would call a principle of quantum ­poetic superposition in the uncertain ontology of the digital variant string. Whereas Stephanie Strickland’s discussion of the principle of superposition failed to offer a specific quantum mechanism at play in digital poetic texts, instead providing “a set of metaphors for understanding that draws on the struggle between mathematical abstractions and words in coming to terms with quantum mechanical effects” (36), this chapter’s brief excursus on quantum mechanical principles sheds light on the mechanisms of variance that Bromeliads explores and employs from a robopoetic perspective. It is also important to remember that for ­Glazier, these mechanisms of superposition and variant poetic expression are

Loss Pequeño Glazier’s Quantum Poetics  81 also of a mystical and psychological nature, insofar as the stream-­of-­ consciousness flow of the hypnotizing, shifting lyrical and visual metamorphosis of verse on the screen is part and parcel of the larger poetic effect achieved through algorithmic and procedural programming. For Glazier, who was trained as a painter and a bibliographer (“Stringing” 93), the visual nature of the code and the displayed poetic output of the generated texts possesses a delicate (and) sculpted form; as he remarked in an essay on his poem-program “Io sono at swoons,” The work grew from a dialogue between the visual structure of its code and the sound of the generated text when read aloud from the browser’s display. It was a back-and-forth process: seeing how the text sounded and adding to it, seeing how the code looked and sculpting it. Incrementally, the code was adjusted to shape the sound and image. At the same time, the visual layout of the code was cultivated to create a complementary aesthetic complexity. This process of working in the code, evaluating the rendered version, then working more in the code continued until the code and the onscreen textuality achieved a dynamic relation. Thus the poem was built as a sound and visual poem in the browser, a browser interpreting a concrete poem built of code. (213–14) With respect to the quantum fluctuations in poetic potential built into the architecture of Bromeliads, there is a principle of superposition that operates in a very meaningful way in the artful interplay between code and poetry, poetry and code, in each and every iteration of Glazier’s poem-­program. Here, neither variant is simply present nor simply absent, which is not quite what Glazier argues in the context of his Bromeliads, cited above. He is correct that the “trace of the variant is not physical; it is phenomenal” (95), but the phenomenality of the trace of the variant is inconsistent with simple presence and absence when considered as part of the larger quantum poetics of the textual machine comprised of the Bromeliads code and its poetic arrays. For example, the following two screen shots represent two eerily similar iterations of the sixth poem in the Bromeliads series, thus facilitating a side-by-side, visual comparison of the variant present in the final line of each text (Figure 3.2). Glazier’s algorithm provides for the superposition of poetic verses here, as lines a9[0] and a9[1] exist in, or as, a superposition of potential poetic states and outcomes: a9[0] = “orange in the mating season. Behind the hibiscus head is an orange grove.” a9[1] = “needs water. Only Indians allowed to eat iguanas. Nicaraguan cane cutters.”

82  Loss Pequeño Glazier’s Quantum Poetics

Figure 3.2  S creen capture, White-Faced Bromeliads on 20 Hectares.

The a9 path is only “chosen” via measurement or observation, which takes place via the algorithm-driven selection between possible poetic states (and the subsequent display of text on a computer monitor or other web-enabled device). The orange grove is present and absent in a complex way, superimposed upon the iguana-eating Indians in a nonsolely metaphorical way. As John Cayley remarks in a well-known essay titled “The Code is Not the Text (Unless it is the Text)” (2002), Glazier doesn’t think in UNIX, nor would he ever wish to do so. But his language is not ‘mere metaphor’ (poetry is not metaphor) it is centered on language-making (what poetry is), and it demands a poetic practice which is alive to new procedures and new potential and which is sensitive to the changes this practice produces in the materiality of the language itself. In Glazier’s language-making activity, the resulting output on the screen thus constitutes a measurement of the system, insofar as it provides data about the state of each line of poetry in its interaction with the measuring apparatus. The poetic wave function, as it were, collapses and the probability goes from 0.5 to 1 as a line of poetry definitively takes shape on the screen—if only for ten seconds.

culled from each page’s density, but you enjoy lateral movement, like swimming and sea currents. —Four Guillemets, Loss Pequeño Glazier A number of related questions regarding literary potentiality and probability emerge from the quantum formulation of Glazier’s algorithmic poetics of variants. They are of particular intensity or relevance when this reading of White-Faced Bromeliads on 20 Hectares is allowed to inform the logic of variance in Glazier’s more recent poem-program,

Loss Pequeño Glazier’s Quantum Poetics  83 Four Guillemets, which dates to 2012. Four Guillemets employs more sophisticated poetic and programmatic principles than Bromeliads, at least from a code-based standpoint. It is also a work deeply concerned with formalistic grammatical and poetic elements, as the title attests; the “guillemet” in the title refers to angle quotes, also known as French or Latin quotation marks. Named after French punch cutter and engraver Guillaume Le Bé (1525–1598), in programming they provide for forward and backward navigation in an HTML environment. The visual-­ poetic field of Glazier’s Four Guillemets is rigorously organized into several discrete quadrants (for lack of a better term) in the six pages that make up this algorithmic poetic project. The introductory page provides thematic and structural guidance for the four subsequent algorithmic, visual-poetic texts that follow, each of which can be categorized into five elements, moving from top to bottom, left to right (Figure 3.3): 1 A variable text largely describing kanreki, the sixtieth-birthday celebration featured in several Asian cultures, whose significance is related to the completion of the fifth (twelve year) cycle of the Chinese zodiac. This text has four possible variations. 2 Where on this page we find the Japanese character for kanreki (with different lines highlighted in pink every twenty seconds), in subsequent poems the user finds cycling photographs of natural elements (water, circular designs in snow, rocks, the moon—four total per poem). 3 Where the poem’s title and author appear—again, with different letters highlighted every twenty-second interval—the four subsequent poems present cycling pairings of words (four possible pairings per poem).

Figure 3.3  S creen capture, Four Guillemets.

84  Loss Pequeño Glazier’s Quantum Poetics 4 The bottom algorithmic text on the Four Guillemets home page is drawn from several sections of Moby Dick; in the following four poems the text is composed of a larger poetic source text of a heterogeneous nature. 5 The final, one-line “footer” also has four possible variations, and is a brief poetic text ostensibly written by Glazier himself. From this rather brief description of the elements present on the Four Guillemets home page, several thematic and structural concerns are clear. First, the numerological preoccupation with sets of four is immediately obvious. Regarding his specific poetic architecture, Glazier has described this structural element in terms of four-line sets: in a talk given at the 2014 E-Poetry Intensive in Mayagüez, Puerto Rico, he asserted that these four-line sets resemble a room’s four walls, and that these groups of four variants in turn construct one line of poetry.4 From a numerological standpoint, the particular astrological architecture of the Chinese zodiac is of special relevance, as was previously noted: the series of poetic texts collected under the auspices of these Four Guillemets perhaps (likely) commemorates Glazier’s own kanreki. The variants that, as I will argue below, exist in quantum superposition with this reflection on the cycles of time, include the following statements: a1[0] Is the occasion…when five cycles of the Chinese zodiac, the jikkan junishi have completed— a1[1] The white cranes are a symbol of 1,000 years, and the red turtle represents 10,000 years— a1[2] A sleeveless red chanchanko represents a baby’s jacket and a return to the beginning of life— a1[3] One is said to be reborn. At kanreki the birthday person has a party with a decorated cake— At first glance Four Guillemets appears closer to a text like the I Ching—the aleatory text par excellence, according to digital artist Belén Gache5 —than to Buffalo’s own L=A=N=G=U=A=G=E poetics, upon which Glazier’s work draws, in its insistence that language creates meaning (and not vice versa). Like the I Ching, which, according to translator Alfred Huang, “is a book that speaks in images, not words” (xxv), the visual aspect of Four Guillemets appears to be at least as important as the destabilization of semantics and sense in the aleatory, quantum poetics displayed on screen. Regarding the tensions between sound, sense, and visuality in ­Glazier’s Four Guillemets, of particular relevance in the third poetic array—in which pairings of words (with four possible pairings per page) cycle across the screen—is the interplay between word shifts and shifting color highlights. The following arrays adorn the center of each of the four poems, with different groupings of three letters per pairing adorned

Loss Pequeño Glazier’s Quantum Poetics  85 in either blue, red, purple, or orange, respective to the individual poems (the remaining letters are gray): a1[0] water lines [blue] a1[1] water signs a1[2] water sighs a1[3] water scripts a2[0] the cessations [red] a2[1] images form a2[2] images from a2[3] images foam a3[0] of elements [purple] a3[1] in increments a3[2] form tors a3[3] as massifs a4[0] interstellar forms [orange] a4[1] stellar lines a4[2] its constellations a4[3] as curvature One of the main poetic techniques employed here is known as paronomasia, or punning, the best example of which can be found in the shifting, fluid textuality present in the “images form / images from / images foam” sequence of poem “Three.” Along with the Joycean resonances of this deft linguistic manipulation, a notable precursor of this verbal and visual fluctuation can be found in Brazilian concrete poetry’s “verbivocovisual” textualities, in which—according to a concrete poetry Manifesto written by the Noigandres group (1956)— graphic-phonetic functions-relations (“factors of proximity and likeness”) and the substantive use of space as an element of composition maintain a simultaneous dialectic of eye and voice, which, allied with the ideogrammic synthesis of meaning, creates a s­ entient “verbivocovisual” totality. In this way words and experience are juxtaposed in a tight phenomenological unit impossible before. The concretistas, quite unsurprisingly—in light of their coinage of the concept of verbivocovisuality (drawing on Joyce’s writing, of course)— were pioneers in reformulating the relationship between semantics and visuality in the concrete poem. For example, we might consider an early work such as Décio Pignatari’s widely known “beba coca cola” [“drink coca cola”], in which the injunction to consume Coca-Cola drips down the page into imagery ranging from drool to glue to shards to cocaine, finally ­ ortuguese). coming to rest in the final line in a “cesspool” (“cloaca,” in P

86  Loss Pequeño Glazier’s Quantum Poetics Significant new media innovation employed by the ­Concrete Poets would later include Augusto de Campos’ hologram poems (mid-80s) and his remediated “poema-bomba” videopoem (1983–1997), among many others. The work of Brazilian-American biopoet Eduardo Kac—whose work is the subject of the next chapter of this book—also features prominently in this trajectory, especially with respect to his mixed-media art, early computer poems, and holopoems. John Cayley has described the complex temporality of programmable media in a way that understands digital writing as a manifestation requiring a radical rethinking of the representation of time in the literary text. He writes: To take an obvious example: the screen-based temporal presentation of textual events materializes a virtual performativity of graphic writing practices, both remediating and recalling actual performances of orality, and restoring a restructured time-based dimension to language, one that is at least ostensibly or potentially more complex than the apparently resolved or resolvable linearity of print. In general, this restructuring, in language, of the human culture of time is, in my opinion, one of the few recent developments in aesthetic language practices that requires a fundamental rethinking of the object of literary criticism — of those that are enabled by programmable media, that is. More and more (poetic) writing will be, literally, materially, time-based, and it will be inappropriate if not impossible to address many literary objects/processes as established texts, or as texts in a ‘before,’ ‘after,’ or any other state. (“Science-Informed Readings”) Cayley’s analysis, in turn, recalls Stephanie Stickland’s elaboration of quantum poetics; she argues that new media poetry provides a new way of entering time, unmatched by our other experiences. We are taken…not by the archive or database, but by the ever re-contextualized act of retrieval; it is, then, not stasis, not velocity, but a new sort of time connection: what speeds me up, what slows me down, what hangs. (26) Whereas the “uncannily aesthetic turbulence” (Cayley) of the pulsion of time deformance at play in a work like Four Guillemets is a function of the principle of quantum superposition present in the poem-program’s code, it is important to note that both Cayley and Strickland focus on the fluctuating temporal experience of the user, who—as we learned from such luminaries as Galileo and Einstein (but as much so from Jorge Luis Borges and Lewis Carroll)—exists in a physical world that lacks

Loss Pequeño Glazier’s Quantum Poetics  87 an absolute clock or time. In a way, the superposition of quantum poetic states in a work like Four Guillemets means that users experience all present and absent possibilities for each poetic line. Therefore, the timeline of each reader of Glazier’s programmable poem converges and diverges around a series of poetic possibilities according to probabilistic algorithms, evincing multiply-connected space-times that are materially and immaterially spliced together. This is hardly a whimsical, “roadnot-taken” formulation; rather, it recalls Sol LeWitt’s statement that “For each work of art that becomes physical, there are many variations that do not.”6 We can thus see how programmable new media works bring to the forefront the fact that literature in general facilitates “a new sort of time connection” (Strickland 26), and how literary texts tend to disrupt the supposedly linear temporality of reading. Amy Catanzano, in turn, argues the following: when the writer-reader experiences language outside of linear time, which might include time slowing, time speeding up, a sense of no time, or a sense of all times at once, where simultaneity occurs between time scales. Poems also work in tandem (toward unity and/or disjunction) with space in a way that is attentive to the space-time of the poem’s medium, which transcends physical contexts such as the page, screen, or voice. In poetry, as in quantum mechanics, it might not be possible to forecast the future with certainty; any measure of a poem’s activity might only be described in terms of probability. With respect to the probabilistic potentiality that Catanzano describes here, in the case of the two algorithmic works discussed above, we might say that Loss Pequeño Glazier has masterfully “plac[ed] simple but craftily fashioned obstacles into natural flows of language” (Cayley, “Definition of Basics”) in such a way as to elaborate a quantum poetics of variants/variance. The models of quantum superposition in language, along with the traces of unheard and unseen poetic materialities, deform the temporal lineaments of the reading-encounter and, ultimately, might offer quantum physics an innovative set of figural tools with which to approach, describe, and perhaps even construct reality or realities.

Notes 1 Nick Montfort (@nickmofo), however, tweeted that “Actually there are 1017 possible sonnets of Queneau’s. You can choose which of 10 blank lines you want in 3 slots” (9:12 a.m., 14 March, 2015). 2 See Flores’ article for an excellent reading of poetic techniques such as enjambment, shifting variables and syntax, fragmentation, and parallel constructions (which alternatively seek to highlight sameness and difference) in Bromeliads. 3 [0] and [1] represent the two possible variants for line 9 (a9) in the code for Bromeliads.

88  Loss Pequeño Glazier’s Quantum Poetics 4 E-Poetry Intensive, March 20, 2014. University of Puerto Rico-Mayagüez. 5 In Escrituras nómades [Nomadic Writings], Gache describes the I Ching as: [p]osiblemente…el texto aleatorio por antonomasia. El I Ching o ­Libro las mutaciones es un antiguo sistema oracular chino, que se compone de 64 hexagramas o combinaciones binarias de seis líneas (continuas o discontinuas) cada uno. El lector, mediante una manipulación de monedas o varas de milenrama y en forma aleatoria, va formando diferentes hexagramas que le señalarán determinados capítulos del libro relacionados directamente, a partir de la teoría de las correspondencias, con una particular situación de su contexto existencial. (184) [possibly…the aleatory text par excellence. The I Ching or The Book of Changes is an antique Chinese oracular system, which is composed of 64 hexagrams or binary combinations of six (continuous or discontinuous) lines each. The reader, using an aleatory procedure to manipulate coins or yarrow stalks, forms different hexagrams that point to specific chapters of the book directly related, according to the theory of correspondences, to a particular situation from his existential context.] 6 LeWitt’s assertion recalls a series of observations that Glazier made about his algorithmic work Io Sono at Swoons: A poem-program such as “Io Sono” produces its surface text whether the author is there or not. When I first make a piece that generates poems regardless of my presence, I often panic at the thought of all the poems that are getting “lost.” I will hit the Print Screen key to try to archive versions of the text. But the program goes on and on, producing a new poem every forty seconds, and eventually, I come to terms with such loss. I eventually realize that the iterations aren’t the point. I become less attached. I will then sometimes first look away for the period of time it takes to display one interaction just to “let it go.” I understand that, even as the writer, I don’t have to see every text that my code produces. Later, I become more fascinated with the poem’s endless ability to produce “my” poem, and I just sit back and let it run. I will often leave it on all night then get up the next morning to see if it is still making text. One can only imagine all the poems produced through the night, never to be seen by anyone, pure products of poetry.” (“Io Sono at Swoons” 214)

4 A Poetics of Biocybernetic Reproducibility Eduardo Kac’s Telematic and Transgenic Art

This final chapter, dedicated to the work of Brazilian-American bioartist Eduardo Kac, shows how a certain zone of contemporary art seeks to challenge traditionally conceived boundaries between the human and the non-human, the living and the non-living, the local and the remote, as well as aesthetics and technology. It also registers a key paradigm shift in thinking about posthumanism, insofar as Kac’s telerobotic and transgenic projects mark the passage from a digital posthumanism to a biocybernetic one, following a terminological and methodological turn proposed by critic W. J. T. Mitchell. The techno-poetic approach I ­employ in this chapter focuses on Kac’s installations, including the following pieces: “Time Capsule” (1997), “A Positive” (1997), and ­“Genesis” (1999). My reading of Kac’s telematic works from 1997 elaborates a technophenomenological approach to what I call a poetics of skin. The analysis of Kac’s transgenic work “Genesis,” on the other hand, takes a multifarious (science and technology studies, digital humanities, and media studies) approach to the question of poetic-genetic translation and translatability in this groundbreaking artwork. In an influential essay titled “The Work of Art in the Age of Biocybernetic Reproduction,” W. J. T. Mitchell calls into question the validity of designating our current, post-2000 epoch as something like an “age of information,” the “digital age,” or the “age of the computer.” He highlights the increasingly important blurring of the boundary between the machinic and the living, especially with respect to its bidirectional nature of exchange: It’s not simply that living things become like machines, but that machines more than ever behave now like living things, and that the line between hardware and software is increasingly entangled with a third zone that might be called ‘wetware’. (484) Mitchell defines the concept of “biocybernetic reproduction” in terms of the combination of computer technology and biological science that makes cloning and genetic engineering possible. In a more extended

90  A Poetics of Biocybernetic Reproducibility sense, it refers to the new technical media and structures of political economy that are transforming the conditions of all living organisms on this planet. (483) He is particularly keen to oppose modernism’s Benjaminian “mechanical reproduction” with the notion of a postmodern biocybernetic reproduction: biocybernetic reproduction has replaced Walter Benjamin’s mechanical reproduction as the fundamental technical determinant of our age. If mechanical reproducibility (photography, cinema, and associated industrial processes like the assembly line) dominated the era of modernism, biocybernetic reproduction (high-speed computing, video, digital imaging, virtual reality, the internet, and the industrialization of genetic engineering) dominates the age that we have called ‘postmodern’. (486) Mitchell draws upon numerous artistic, historical, political, and social examples to elaborate this paradigm of biocybernetic reproduction. He analyzes Eduardo Kac’s transgenic artwork in detail in the essay—­ specifically, he examines “Genesis” (1999) as well as Kac’s multifarious “genetic engineering as art” project concerning Alba, the green florescent rabbit (both works will be discussed below). Mitchell devotes ample space to the relative invisibility of biocybernetic art, to “the invisibility of the genetic revolution, its inaccessibility to representation” (495), a topic that Cary Wolfe treats in detail in his study What is Posthumanism?1 To evaluate the relevance of Mitchell’s claims regarding biocybernetics to Kac’s art as a whole, additional contextualization of his transgenic and telematic poetic experiments is needed. Eduardo Kac (1962–) is currently a Professor of Art and Technology Studies at the Art Institute of Chicago. His art has been exhibited in many international venues and he is the recipient of various awards, such as Ars Electronica’s prestigious Golden Nica Award (2009). In addition to his revolutionary merging of visual, literary, and scientific discourses in a challenging body of work, Kac is the author of numerous books of poetry and artist’s books, and he is the editor of several academic volumes devoted to the study of multimedia art. With respect to the trajectory of his artistic career, Kac has been careful to document the execution and critical reception of his work in a highly detailed, multi-lingual website located at . Kac’s early, pre-Internet artistic experiments ranged from multimedia poetry and performance to robotics, from holopoetry2 to experiments in telepresence, some of which will be discussed below. His telematic works make use of telecommunication technologies to create what Kac has called “dialogical aesthetics,” involving the interaction of sentient beings, both human and non-human.3 An early example can be found in “Rara avis” (1996), an interactive work that allowed local and remote users to explore an aviary

A Poetics of Biocybernetic Reproducibility  91 containing thirty birds, seen from the vantage point of a telerobotic macaw. Local visitors to the exhibition wore a headset whose movement triggered analogous movement by the robot macaw’s ocular cameras; remote visitors could access the cameras via the Internet and also hear what the robotic “Macowl” flock heard through their microphones. A subsequent experiment in telepresence, called “Time Capsule” (1997), was the piece that launched the field of bio art, according to the artwork’s creator. Kac described the preparation for staging this minimalistic, yet nuanced work, in the following manner: “Time Capsule” is a work-experience that lies somewhere between a local event-installation, a site-specific work in which the site itself is both my body and a remote database, a simulcast on TV and the Web, and interactive webscanning of my body. The live component of the piece was realized on November 11, 1997, in the context of the exhibition “Arte Suporte Computador,” at the cultural center Casa da Rosas, in Sao Paulo, Brazil. “Time Capsule” was carried live on the evening newscast of the TV station Canal 21 and on tape by two other TV stations (TV Manchete and TV Cultura). The webscast was transmitted by Casa das Rosas. (“Time Capsule”) In terms of the telematic nature of the performance, Kac’s art action consisted of the self-implantation of an RFID chip above his left ankle. The event—staged in a gallery adorned with “seven sepia-toned photographs shot in Eastern Europe in the mid 1930s (family mementos), a horizontal bedstead surrounded by an on-line computer, a telerobotic finger connected to the microchip scanner, and additional broadcasting equipment”—called for Kac to inject his lower leg with a needle containing the microchip (after sterilizing the area with an antiseptic). Upon injecting himself and scanning the implanted chip, Kac registered himself remotely in a US-based database designed to facilitate the recovery of lost pets, listing himself as both pet and owner. This particular type of RFID chip is very common in the veterinary world: microchip tracker implantation technology is currently employed in the United States by companies like Petfinder and Home Again, who use the chip to help owners, veterinarians, and shelters recover lost animals. In “Time Capsule,” Kac interrogates the decaying mimetic and auratic powers of the photograph, since late twentieth-century digital technologies such as Photoshop (and others) have rendered the photograph an unreliable archive of social interaction. In an essay in which he discusses the work, Kac highlights the linkage between memory as techné and the malleability of flesh and image: Throughout the 19th and 20th centuries photography and its adjacent imaging tools functioned as a social time capsule, enabling the collective presentation of memory of our social bodies. At the end of

92  A Poetics of Biocybernetic Reproducibility the 20th century, however, we witness a global inflation of the image and the erasure by the digital technologies of the sacred power of the photograph as truth. Today we can no longer trust the representational nature of the image as the key agent in the preservation of social or personal memory and identity. The present condition allows us to change the configuration of our skin through plastic surgery as easily as we can manipulate the representation of our skin through digital imaging, so that we can now embody the image of ourselves that we desire to become. With the ability to change flesh and image also comes the possibility of erasure of their memory. (“Art at the Biological Frontier”) Regarding this question of memory and photography, Edward Lucie-­ Smith has written on the biopolitics of the inclusion of photographs of Kac’s ancestors, who were Polish Jews killed during the Holocaust: Photographs of some of these lost relatives were included as part of the display in the gallery where the insertion of the microchip took place. The microchip incorporating a number alludes to the numbers tattooed on the arm of those who were herded into the concentration camps. It also alludes to the fact that the genetic heritage of those lost relatives lives on in Kac’s own body. (Lucie-Smith 20) Lucie-Smith’s biopolitical reading of the work astutely draws out a key component of the overall meaning of Kac’s “Time Capsule,” and is also interesting insofar as it subtly evokes the tension between the inserted microchip and the “superficial” skin-marking operation of the tattoo as signifier. In Kac’s own discussion of the piece, he returns to the question of the surface-boundary conditions of the skin as living gradient later in his analysis. He writes: “[s]canning of the implant remotely via the Web revealed how the connective tissue of the global digital network renders obsolete the skin as a protective boundary demarcating the limits of the body” (“Art at the Biological Frontier”). Here, Kac postulates the recolonization of the corporeal via a technological supplement. He thus reimagines bodily markers in a way that is part and parcel of what Amelia Jones has dubbed the “technophenomenological examination” of the body in art, which began in the 1990s. Bernadette Wegenstein cites Jones’ nuanced analysis in the following manner: In these “1990s extensions” of the body, the self is no longer explored mainly in relation to culture and context (constructivism). Now, through the new possibilities of the technologies of the body, particularly those enhanced by new media, the body is under “technophenomenological” examination, to quote Jones once more:

A Poetics of Biocybernetic Reproducibility  93 “The body/self is technophenomenological: fully mediated through the vicissitudes of bio and communications technologies, and fully engaged with the social (what Merleau-Ponty called ‘enworlded’). The body/self is hymenal, reversible, simultaneously both subject and object.” (235, cited in Wegenstein 90) The body, as a mediated, technophenomenological construct, argues Wegenstein, “is definitively not a determinable, impermeable border between the self and the world (or the self and the other) that fixes this self in a final way” (207). The skin is the site of these enmeshed or intertwining networks, and is a physical membrane that sheds and reconstitutes itself continually… as a permeable, shifting physical perimeter, a limbic surround of virtual containment, and as the visible trace of the human body (whose contours are never stable in one’s own or an other’s visual field. (207) Wegenstein’s phenomenological perspective, then, offers strong support for W. J. T. Mitchell’s argument regarding the prevalence of a paradigm of biocybernetic reproducibility in posthumanist thinking, and also provides a powerful theoretical apparatus through which to approach ­Eduardo Kac’s poetics of skin in his bio-telematic performance pieces “Time Capsule” and “A Positive” (1997). In “A Positive,” a work produced in collaboration with Ed Bennett and staged merely seven weeks before “Time Capsule,” Kac establishes a dialogical and symbiotic interaction between the artist and a biological robot (which he dubs a “biobot”): In A-positive, the human body provides the robot with life-­sustaining nutrients by actually donating blood to it; the biobot accepts the human blood and from it extracts enough oxygen to support a small and unstable flame, an archetypal symbol of life. In exchange, the biobot donates dextrose to the human body, which accepts it intravenously. As the blood circulates through the human body, it transports oxygen from the lungs to body tissue and carbon dioxide from body tissue to the lungs. As blood passes through the lungs, oxygen molecules attach to the protein hemoglobin (which is bright red in color and therefore responsible for the blood’s tincture). Along the way the hemoglobin releases the oxygen to the cells. The “empty” hemoglobin molecules then bond with the tissue’s carbon dioxide transporting it away. In A-positive, oxygen is extracted by the phlebot and used to support the erratic flame. (“Art at the Biobotic Frontier”)

94  A Poetics of Biocybernetic Reproducibility Whereas the biochemical apparatus employed in “A Positive” might not quite be currently categorized as representing “high-tech media” (at least as far as the present study has used the term so far), Kac’s bioartistic work is an excellent example of the ways in which high-tech media act via interfaces that mark the artwork as a site of the exchange between subjects, the site of joining between subjects and objects, the locus where intersubjectivity reverses into what ­Vivian Sobchak has called interobjectivity and vice versa. (Wegenstein 236) Kac himself suggests that “emerging forms of human/machine interface penetrate the sacred boundaries of the flesh” (“A Positive”), while Steve Dixon analyzes the penetration of the skin in “A Positive” in rather uncanny and monstrous terms, evoking the specters of vampirism and an apocalyptic cyborgism: Flesh is penetrated to give succor to the nonhuman, ‘undead’ machine, and human oxygen is breathed into it to give it life. The machine is directly humanized, pumped by corporeal fluid, while the human body beside it is mechanized, its own lifeblood invaded and fed by technology. (280) The negativity regarding the machinic in Dixon’s description of the biobot model is striking. This, however, is not at all the thrust of “A Positive’s” model of symbiotic, mechanical/organic exchange. As Kac himself points out in the essay “Art at the Biobotic Frontier,” the master/slave model that has dominated descriptions of human/machine relations is an “unfortunate” turn of phrase. By deconstructing this rather facile binary opposition, Kac strives to “develop new conceptual models and perhaps influence the new kinds of synergies emerging at the frontier where the organic and the digital meet.” Insofar as the human-machine network in Kac’s performances is transdermal in nature, we may oppose his telematic works with influential media theorist Marshall McLuhan’s famous sound byte that “[a]ll media are extensions of some human faculty—­ psychic or physical” (26). Instead, as Kac remarks in the context of “Time Capsule,” biocybernetic reproducibility demonstrates how [i]t is almost as if the body has become an extension of the computer, and not the other way around. This, perhaps, only reflects technology’s general outlook, since living systems are indeed becoming an extension of the computer, as the emerging vectors in microchip technology clearly point to biological sources as the only way to continue the exponential process of miniaturization, beyond the limits of traditional materials.

A Poetics of Biocybernetic Reproducibility  95 While Eduardo Kac’s telematic corpus as a whole—including “Time Capsule” and “A Positive”—has garnered critical acclaim in the international popular press as well in academic fora, this branch of his work may be reconsidered from the point of view of a media studies perspective specifically attuned to the dermatological figures constructing and deconstructing the interface between self and other. Skin, as a complex site of negotiation of organic and inorganic materials in Kac’s work, is analogous to the “wetware”—“chemical materials organized so as to perform arithmetic or logical operations; brain substance, as having this ability” (“wetware”)—to which Mitchell alludes in his analysis of the mode of biocybernetic reproducibility that characterizes our current posthuman epoch. In this way, insofar as Kac asserts that “Time ­Capsule’s” “[s]canning of the implant remotely via the Web revealed how the connective tissue of the global digital network renders obsolete the skin as a protective boundary demarcating the limits of the body,” the appeal to a “moist interface” (or biofilm-like (permeable) barrier) in this ­ lanagan piece theorizes the skin as a locus where—following Mary F and Austin Booth’s evocation of Donna Haraway’s famous writings on the figure of the cyborg—“identity is both revealed and concealed” ­(Flanagan and Booth 3). I would even go a step further, however, drawing on Kac’s apocalyptic-sounding warning that “[w]ith the ability to change flesh and image also comes the possibility of erasure of their memory” (“Time Capsule”). Skin, for Eduardo Kac, is a programmable and dynamic membrane that joins and separates the living and the machinic. With the erasure of memory vis-à-vis the move from a humanistic conceptualization of memory to one that incorporates the technophenomenological extension of the body (“the wet hosting of digital memory”), Kac’s poetics of skin invokes the multifarious nature of these interfaces. At the same time, as Mitchell, Wolfe, and others have argued, the most salient examples of biocybernetic reproducibility can be found in Kac’s more well-known transgenic artworks, especially in “Genesis,” “Natural History of the Enigma,” and the (in)famous “GFP Bunny.”

Living Artworks and the Question of Translation: Eduardo Kac’s “Genesis” With the execution of “Time Capsule” in November 1997, Eduardo Kac pioneered the field of bioart. Over the next several years he turned his attention to the creation of living artworks and pieces whose transgenic features continued the dialogical aesthetics present in his earlier works, and also pushed the limits of artistic (and ethical) engagement with scientific experimentation. While the “GFP Bunny” (2000–) is, far and away, the work that has garnered the most international attention (in both academic circles and in popular media), this section will analyze the early transgenic work “Genesis” (1999) in great detail. We will pay special attention to the

96  A Poetics of Biocybernetic Reproducibility question of translation as it pertains to the perceived incommensurability of scientific and poetic imaginaries. This focus on translation reveals a curious blind spot in Kac’s transgenic artwork, which, nevertheless, illuminates some fascinating features of the way in which, as John Cayley has argued, there is a vast subset of aesthetic linguistic practice that is unlikely ever to be accepted as scientific while, on the contrary, all of scientific linguistic practice can be encompassed by the poetic, and deturned for aesthetic effect, without implying any incoherence of poetic practice. (“Science-informed readings”) Given that the present analysis of Kac’s bioart constitutes the final series of readings included in this study, the discussion of the role of translation in Kac’s artistic projects is especially important as a way to sum up the problematic tensions that exist between natural, poetic, and ­scientific language in artistic works that depend on the figuration of translation and translatability. “Genesis” was first presented in Austria, at the O. K. Center for Contemporary Art in Linz (September 4–19, 1999). Commissioned by Ars Electronica 99, it demonstrated a local-remote duality, insofar as web­enabled participants could intervene in the installation seen by local viewers. More specifically, this transgenic work, writes Kac, “explores the intricate relationship between biology, belief systems, information ­technology, dialogical interaction, ethics, and the Internet” ­(“GENESIS”). His “summarized description” of “Genesis,” found on the eKac homepage, is particularly clear, and is thus worth reproducing in its entirety: The key element of the work is an “artist’s gene,” a synthetic gene that was created by Kac by translating a sentence from the biblical book of Genesis into Morse Code, and converting the Morse Code into DNA base pairs according to a conversion principle specially developed by the artist for this work. The sentence reads: “Let man have dominion over the fish of the sea, and over the fowl of the air, and over every living thing that moves upon the earth.” It was chosen for what it implies about the dubious notion—divinely sanctioned—of humanity’s supremacy over nature. Morse code was chosen because, as the first example of the use of radiotelegraphy, it represents the dawn of the information age—the genesis of global communication. The Genesis gene was incorporated into bacteria, which were shown in the gallery. Participants on the Web could turn on an ultraviolet light in the gallery, causing real, biological mutations in the bacteria. This changed the biblical sentence in the bacteria. After the show, the DNA of the bacteria was translated back into Morse code, and then back into English. The mutation that took

A Poetics of Biocybernetic Reproducibility  97 place in the DNA had changed the original sentence from the Bible. The mutated sentence was posted on the Genesis web site. In the context of the work, the ability to change the sentence is a symbolic gesture: it means that we do not accept its meaning in the form we inherited it, and that new meanings emerge as we seek to change it. (“GENESIS”) The process of translation between poetic verse, Morse code, and DNA base pairs, however, must be very carefully explored, since the postulated equivalency between these codes has not been interrogated in the sizable bibliography on Kac’s art. And, as I will argue below, the issue of translation and translatability is key to truly understanding the complex dialogue between the sciences and the humanities in Kac’s work, and, in a way, in Latin American techno-biocybernetic poetics as a whole. The first step in the translation procedure employed by Kac involved the conversion of the chosen poetic sentence—“Let man have dominion over the fish of the sea, and over the fowl of the air, and over every living thing that moves upon the earth”—into Morse Code. Developed by the painter and inventor Samuel Morse along with L. J. Gale and ­machinist Alfred Vail, Morse Code was first employed as part of the development of a large-scale electric telegraph system in the 1830s. The now famous dot-dash system was based on Vail’s estimations of the relative frequency of letters in the English language (which he determined by examining the type-cases found in a Morristown, NJ newspaper office) (Burns 84). Morse code would be employed in numerous communication ­applications beginning in the mid-nineteenth century, including amateur radio, the telegraph, aviation, and military communications. The first image in Figure 4.1 is a graphic illustration of the way in which Kac

Figure 4.1  Genesis translations.

98  A Poetics of Biocybernetic Reproducibility converted the “Let man have dominion…” sentence into Morse Code; the second image reveals the “conversion principle” through which the Morse Code text was translated into DNA nucleotide bases. Before analyzing Kac’s (Morse and genetic) coding in more depth, a few biochemical clarifications are necessary. Deoxyribonucleic acid, or DNA for short, is composed of a phosphate and sugar backbone and sequences of four nucleobases (the “rungs” of the ladder) bonded to a phosphate-sugar, double helix-shaped structure. These four bases are: the purines, adenine (A) and guanine (G), and the pyrimidines, cytosine (C) and thymine (T).4 The purines form hydrogen bonds with the pyrimidines, and during DNA replication or protein synthesis these weak chemical bonds between bases are easily broken and repaired for future replication or protein manufacture. As Figure 4.1 reveals, Kac created a multi-step algorithm through which he translated “Genesis’” Morse Code into nucleotide bases: each dash in the poetic sentence was replaced by thymine (T), each dot by cytosine (C), spaces between words became adenine (A), and spaces between letters were represented by guanine (G). According to the algorithm that Kac developed, the initial phrase “Let man have” first was translated into Morse Code as: “.-…- --.--. …..-…-.”, which was coded via the four nucleotide bases as ­“CTCCGCGTATTGCTGTCACCCCGCTGCCCTGCA” (Figure 4.2). The four-letter promoter sequence—indicated in bold above—is a site for the enzyme RNA polymerase and other transcription factors (which regulate the rate of transcription from DNA to the complementary molecule mRNA, or messenger RNA) to bind to the DNA molecule. This promoter indicates that transcription—the first step in

Figure 4.2  T he Genesis gene.

A Poetics of Biocybernetic Reproducibility  99 protein synthesis—­will begin shortly “downstream” from the promoter sequence. The four-base TATT sequence that occurs towards the start of the Genesis gene is known as a TATA or Pribnow box, which is the most important promoter sequence found in nature. It is a common general transcription factor, which interacts directly with the enzyme RNA polymerase. The TATT sequence included in the Genesis gene is a variant of this common promoter sequence, and is part of what is otherwise designated as an “untranslated region” of the Genesis gene. It should be noted that the function of untranslated or noncoding DNA sequences is currently a hot topic in biology. These regions, often referred to as “junk DNA,” seem to have multiple biochemical functions, including the production of microRNA, transcription regulation of local genes (genetic switches and regulators of gene expression), protection from chromosomal deterioration, and transcription factor sites. Whereas it appears that so-called “junk DNA” is unworthy of its pejorative adjective, there is still an active debate in genomics regarding the functions of these noncoding segments of DNA. Some 95 bases downstream of the promoter sequence in Kac’s ­G enesis gene, there is an initiation or start codon, ATG. With respect to protein synthesis, the corresponding tRNA (transfer RNA) molecule’s start codon is AUG, 5 since uracil is substituted for thymine in RNA.6 The process of converting DNA code into mRNA is called transcription, and the conversion of mRNA’s homologous code (relative to DNA) to tRNA—from which proteins will be synthesized—is called translation. The segment of DNA described by the “open reading frame” in Kac’s depiction of the Genesis gene represents the sequence coding for a protein, which Kac calls, fittingly, “the Genesis protein,” and claims that it is “the first art protein” (“The Genesis Protein”). This process itself might seem simple and mechanical, albeit rather intricate, but it involves several complications that surely made the development of the algorithm much more difficult. These complications or material difficulties, strangely enough, are not even mentioned in Kac’s own writings about “Genesis” nor in the bibliography on this important transgenic work. They appear almost immediately in the translation from poetic sentence to Morse Code to the coding of the 109-base sequence making up Kac’s so-called “Genesis gene.” First of all, it is noteworthy that the initial segment of the Genesis gene is biologically “untranslated,” but is “translated” from poetic sentence to Morse Code to DNA sequence (or, we might say, at least prepared for transcription). That is, the Genesis protein’s DNA code begins with the start codon ATG, thus picking up at the “t” in “the sea and over the fowl…” In other words, the phrase “Let man have dominion over the fish of” portion is transcribed (to mRNA) but not translated (to tRNA and to a subsequent chain of amino acids that comprise a protein molecule). Therefore, the purported translation of the poetic sentence depends on, and at the same time elides,

100  A Poetics of Biocybernetic Reproducibility a key segment of what is necessarily an “untranslatable region.” From a thematic standpoint, then, the simultaneous presence and absence of the notion of mankind’s dominion reinforces Kac’s own selection principle regarding the Biblical text utilized in “Genesis”: “[t]his sentence was chosen for its implications regarding the dubious notion of (divinely sanctioned) humanity’s supremacy over nature” (“Genesis”). With this in mind, prior to examining the actual insertion of the DNA fragment into plasmids and then into actual, living bacteria, the simultaneous translatability and untranslatability of this segment requires additional unpacking, vis-à-vis a media studies and science and technology studies approach that incorporates a rigorous understanding of the principles of translation at play in “Genesis.” Whereas genetics and cell biology employ the noun “translation” to describe “[t]he process by which genetic information represented by the sequence of nucleotides in messenger RNA gives rise to a definite sequence of amino-acids in the protein or polypeptide that is synthesized” (“translation”), literary studies has a more tenuous or ambivalent relationship with the term. In an interview with Dominque Moulon, Eduardo Kac was asked a question linking French Symbolist Charles Baudelaire’s poetics—specifically, his theory of correspondences—to the issue of translation and code in “Genesis.” The question and complete response are reproduced below, since they are particularly interesting in light of the assumptions underlying the question of translation in the coding for, and production of, “Genesis’” artist’s gene: Q20: At the core of the transgenic work “Genesis” (1999) is what you call the “artist’s gene.” To produce it, you translated into Morse Code the sentence “Let man have dominion over the fish of the sea, and over the fowl of the air, and over every living thing that moves upon the earth” from The Book of Genesis. Then you converted the Morse into DNA base pairs according to a code you conceived specifically for this work. You have a unique poetic trajectory. You have also developed communications-based artworks, from telepresence to interspecies exchanges. Are your human and nonhuman linguistic correspondences linked to those of Baudelaire? A20. When Baudelaire wrote his sonnet on correspondences, he was alluding to synesthesia, to sensorial correspondence. Granted, Baudelaire experimented physically with hashish but he was not a synesthete himself and the poem fundamentally makes reference to the intermingling of the senses. The types of relationships that I am interested in exploring are less in the realm of allusion as Baudelaire pursued, and more in the realm of a physical sensorial phenomenon that is experienced directly by the participant, be it human or non-human. There is a fundamental difference between using language to allude to a sensorial phenomenon and creating a work

A Poetics of Biocybernetic Reproducibility  101 of art that is itself a sensorial phenomenon. I created a code for ­“Genesis” that allows me to translate a statement written in English to the binary system of Morse code, and then to DNA. (Of course, when I refer to Morse as “binary” I don’t mean to say it is a binary system of the kind found in computers; I simply mean it is composed of two things.) When you mention “Genesis” in relation to this idea of correspondences, which in this particular case is actually encoding, there is no Baudelarian correspondence between the senses, but there is a process in which the system of natural language gets encoded into a binary system, Morse, which is encoded into the four chemical bases of DNA. This DNA is then fully operational within a living body. When this DNA is actually physically manufactured, synthesized, and produced, it exists just like anything else in the physical world, and it actually functions inside of a cell. That encoded text is now an integral part of the body of the bacteria. Thus we have the Genesis bacteria, a new life form that did not exist on planet earth before the creation of this artwork. We have come a long way from the Baudelarian correspondences, the “ecstasies of the mind and senses,” and we have entered the realm of creation of life. (“Fifty questions for Eduardo Kac: an interview”) Baudelaire’s famous sonnet “Correspondences,” to which Kac refers here, is a literary manifesto for the nineteenth-century Symbolist movement, and postulates intimate connections between the physical world and the spiritual one in a striking series of musical and metaphorical lines. Kac’s interest does not reside in the sensorial, insofar as ­Baudelaire’s synesthetic experience of a world in which “[les] parfums, les couleurs, et les sons se répondent” [“the perfumes, colors, and the sounds respond”] is not really relevant to the kind of physical experience that Kac creates in his performances and installations. This experience, for Kac, is part and parcel of “the realm of creation of life” and supports claims put forth earlier in this chapter regarding the paradigm of biocybernetic reproducibility at play in Kac’s work. His remarks on the process of coding in “Genesis,” however, involve some curious formulations about the correspondences between natural language, the genetic code, and its manifestation in living organisms. “Genesis” employs natural language, according to Kac, by encoding specific elements from the linguistic s­ ystem into the binary system of Morse code,7 and then into the four nucleotide bases that make up the DNA of all living things. But language is a complex system that cannot be reduced to a univocal code. As Andrew Joron asserts, the complex nature of language is such that: it is applicable to language & poetry directly, without the use of metaphor: language is not like a complex system, it is itself such a system, possessing all of the propensities of complex system to

102  A Poetics of Biocybernetic Reproducibility undergo nonlinear dynamics (displaying a sensitivity to initial conditions that result in large-scale changes throughout the system: so that a single word such as “no” can change the dynamic of an entire system of words), self-organization (no one “invented” language), and emergence of novel properties from a set of interacting elements. (“Magical Correspondences, part 1 of 6”) An understanding of language as a complex system—vis-à-vis its nonlinear dynamics, self-organization, and emergence—stands in stark ­contrast to Kac’s assertion that the translation principles at play in ­ “Genesis” are unproblematic (or at least his omission of said “complications”). In the previously cited interview, Kac remarks that “[w]hen this DNA is actually physically manufactured, synthesized, and produced, it exists just like anything else in the physical world, and it actually functions inside of a cell.” As we will see shortly, it is true that in ­“Genesis,” the DNA incorporated into an E. coli plasmid did function in a b ­ iological sense. But the contention that a poetic sentence translated from natural language to Morse Code to DNA (when manufactured) simply “exists just like anything else in the physical world” ignores some of the complexities and nuances of Kac’s own work of translation (in its limits and its possibilities), what might be called “the principles of design-­as-intervention,” the (textual) deformations at play in “Genesis,” as well as the challenges posed (and faced) by Kac’s discourse-bridging and radically interdisciplinary project as a whole. The first issue that requires elaboration hinges on some of the same problems regarding representation and translatability that were discussed in Chapter 2 of the current study. Joanna Drucker’s commentary on the paradigm shift from a digital humanities perspective to one informed by what she calls “speculative computing” is especially relevant. She argues that: the activities encompassed by the digital humanities emphasize the centrality of: The statistical analysis of texts, creation of structured data, and design of information architecture…Representation and display are integral aspects of these activities, but they are often premised on an approach influenced by engineering, grounded in a conviction that transparency or accuracy in the presentation of data is the best solution. Blindness to the rhetorical effects of design as a form of mediation (not of transmission or delivery) is an aspect of the cultural authority of mathesis that plagues the digital humanities community. (6) Her insistence on “the rhetorical effects of design as a form of mediation (not of transmission or delivery)” is well-taken, and forces us to consider how Kac’s multi-step translation in fact mediates the purport­ enesis edly transparent procedure employed in the construction of the G

A Poetics of Biocybernetic Reproducibility  103 gene. Drucker’s critique of the digital humanities—at the very least, of a particular kind of DH—draws on work by her former colleague at the University of Virginia’s Institute for Advanced Technology in the ­Humanities, Jerome McGann, whose account of “textual deformation” in the widely read book Radiant Textuality: Literature After the World Wide Web shows “that the poem’s intelligibility is not a function of the interpretation, but that all interpretation is a function of the poem’s systemic intelligibility” (120). This definition is particularly useful in light of McGann’s claims regarding the ways both print and electronic literary works contain multilayer code that generates their textual condition. As Katherine Hayles suggests, McGann has repeatedly argued that “all texts are marked” in a way that considers “paragraph indentations and punctuation as forms of marking equivalent to HTML, the Hypertext Markup Language used to format documents for electronic environments” (My Mother Was a Computer 99). This is part and parcel of the ways in which “a literary work codes a set of instructions for how it should be read” (McGann, “Texts in N-Dimensions” 10); ­McGann further contends that “all texts are algorithmic, containing within themselves instructions to generate themselves as displays (the display form of the document here being considered distinct from the data and algorithms used to create it)” (in My Mother Was a Computer 99). And in a piece co-authored with Dino Buzzetti, McGann describes the ways that markup mobilizes and destabilizes the text, it “immediately opens itself to interpretive indeterminacy,” and “is essentially ambivalent and sets forth self-reflexive ambiguous aspects of the text, which can produce structural shifts and make it unstable and mobile” (Buzzetti and ­McGann 65). The applicability of this analysis to the “translation-as-­ design” principle present in Eduardo Kac’s “Genesis,” then, is multifarious in nature. There is something very digital in what I would like to call the “paratextual” elements of the Genesis gene, insofar as Kac’s work of translation—­especially through the use of the (biologically necessary) open reading frame, promoter, and initiation codon—­establishes a grammar, syntax, and paratext of genetic-linguistic translation and translatability that is much less simple or straightforward than Kac asserts. Any change in the means of presentation of a text—in this case, navigating between poetic sentence (Bible quote), Morse Code, and a sequence of DNA nucleotide bases—involves a design process that is also interpretative. As Hayles asserts, “by changing how the work means, such a move alters what it means” (My Mother Was a Computer 90). She goes on to posit a specific class of translation that draws on McGann and Drucker’s arguments regarding the links between literary textuality and materiality: If literature and materiality are indeed closely entwined, what happens when a text is translated into a different medium than that in which it was originally created?...I use the term “media translation”

104  A Poetics of Biocybernetic Reproducibility to suggest that recreating a text in another medium is so significant a change that it is analogous to translating it from one language to another. (109) Perhaps Hayles does not go far enough here, and the multidisciplinary “translation-as-deformation” that Kac carries out upon “Genesis’” poetic sentence constitutes an even more radical or significant strain of what she would term media translation. As was previously noted, in “Genesis,” the literary-religious touchstone upon which the entire project is based—the Bible verse “Let man have dominion over the fish of the sea, and over the fowl of the air, and over every living thing that moves upon the earth”—was selected for thematic concerns. The specific translation employed by Kac, however, is also of particular importance: I selected the King James English version (KJV), instead of the ­Hebrew original text, as a means of highlighting the multiple mutations of the Old Testament and its interpretations and also to ­illustrate the ideological implications of an alleged “authoritative” translation. King James tried to establish a final text by c­ ommissioning several ­ roject) to produce scholars (a total of forty-seven worked on the p this translation, meant to be univocal. Instead, this collaborative effort represents the result of several “voices” at work simultaneously. (“Transgenic Art Online” 259) From the standpoint of the multiple codes employed in “Genesis,” Kac highlights the symbolism “both meant to expose the continuity of ideology and technology and to reveal important aspects of the rhetorical strategies of molecular biology” (261). Given Samuel Morse’s allegiance to the xenophobic, eighteenth-century movement known as Nativism, Kac argues that [t]he translation from KJV/Morse to a gene is meant to reveal the continuity between imperialist ideology and the reductionistic view of genetics, both focused on suppressing the complexity of historic, political, economic, and environmental forces that make up social life. (261) Kac goes on to cite the atomistic model of genetic material that physicist Erwin Schrödinger proposes in the essay “What is Life?” (1943)— which predated Watson and Crick’s discovery of the structure of DNA by ten years—highlighting the link that Schrödinger establishes between Morse code and genetic code: It has often been asked how this tiny speck of material, the nucleus of the fertilized egg, could contain an elaborate code-script

A Poetics of Biocybernetic Reproducibility  105 involving all the future development of the organism…For illustration, think of the Morse code. The two different signs of dot and dash in well-ordered groups of not more than four allow of thirty different specifications. (262) Kac remarks on the persistence of Schrödinger’s analogical or metaphorical “code-script” in molecular biology, and extends this line of reasoning to “Genesis’” innovative interrogation of the way in which “meaning is constructed in science.” He inquires: “How do we go from the metaphor of ‘genes as code’ to the “fact” that ‘genes are code’? Is it by the progressive erasure of the initial conditions of enunciation of a metaphor (262)?” Unfortunately, Kac does not explicitly answer his own questions regarding the move from the metaphoricity of the genetic code to the paradigm of biocybernetic reproducibility. In effect, as David Hunt has argued, Kac’s complex and material engagement with scientific material seeks to dodge the figurational traps of metaphor: Kac is well aware that when describing in lay terms the nuances of recent genomic mapping, whether mathematical algorithms or New Age biorhythms are your operative metaphor of choice, ultimately you must face the fact that metaphors simplify. They reduce. What was once a dynamic concept, merely becomes a static literary conceit. A double–helix described as a Mobius strip, or an M.C. Escher painting, or even some kind of primitive aquatic radiolarian, might help you to visualize the process of a chain of amino acids folding itself up into a unique protein, but a metaphor, no matter how inventive or well phrased, doesn’t allow you to become a part of that process. (“Eduardo Kac: Metaphor into Motif”) The devaluation of metaphor that Hunt identifies in Kac’s work recognizes the problematics of representation in more facile (or even in some more sophisticated) applications of science to art. However, despite the acknowledgement of these assumptions, Hunt and others fail to account for Kac’s own interventions in the construction of the Genesis gene, instead preferring to obviate the active role that the bioartist plays in the (conceptualization and execution of the) translation process. To understand this role in more depth, it is important to examine in detail the biological mechanism through which the Genesis gene is read. As was previously stated, the initial “untranslated” segment of the poetic sentence—“Let man have dominion over the fish of…”— is transcribed (to mRNA) but not translated (to tRNA for subsequent protein synthesis). From a biological standpoint, all protein production begins with RNA polymerase’s recognition of the promoter sequence TATT

106  A Poetics of Biocybernetic Reproducibility that resides within this untranslated region. The promoter is of the utmost importance in gene expression and protein synthesis: The principal method of control of gene expression in bacteria is by regulating the amount of mRNA produced from that gene, which is primarily determined by the affinity of RNA polymerase for the promoter...Strong promoters are highly efficient and lead to high levels of transcription, while others (weak promotors) give rise to low levels of transcription. The nature of the promoter is therefore of major importance as a fixed level of control that determines the potential level of expression of different genes. (Dale and Park 73–4) In the Genesis gene the four-base promoter TATT is preceded by seven nucleotide bases, and is followed by 109 bases and then the initiation codon, ATG. The lengthy region following the initiation codon is designated as the open reading frame, which is a sequence characterized by “long stretches of nucleotide sequence that can encode polypeptides because they do not contain any of the three chain-terminating codons (UAA, UAG and UGA)” (Ahluwalia 208). In this segment of the DNA code there exists a rich grammar and semantics, which may be summarized as follows: 1 The code is commaless, that is, there is no nucleotide reserved for punctuations in order to indicate the end of one codon and the beginning of the next. The triplets are read successively one after the other. 2 It is a degenerate code in the sense that most of the amino acids are coded for by more than one triplet. For example, the amino acids tyrosine, histidine, glutamic acid and some others are coded by two triplets each; and amino acids arginine, serine and leucine are each coded by six triplets. There are only two amino acids tryptophan and methionine which are coded by a single triplet. 3 Out of the 64 triplets, three do not code for any amino acid. These are, UAG, UAA and UGA. These triplets serve as signals for the termination of polypeptide chains. 4 The first two bases in the triplet specify the amino acid; the third base is less specific…8 5 The genetic code is universal. It is applicable to tobacco mosaic virus, bacteriophages, E. coli, animals and man. In all the species tested the code triplets are identical. (Ahluwalia 195–6) Several of these points require additional elaboration. First, the universality of the genetic code across living organisms is quite remarkable, and it in part depends on the flexibility of the coding algorithm that

A Poetics of Biocybernetic Reproducibility  107 is described in several different ways above. Second, since the code is “degenerate”—that is, more than one codon can specify the same amino acid—many mutations have no effect (and are thus known as silent mutations).9 Third, the lack of punctuation in the genetic code is especially germane to the present discussion of “Genesis.” There are at least two points to be made here. The first involves the specific algorithmic intervention chosen by Kac for the mechanism of translation. Kac’s poetic sentence contains 27 words, which are composed of 103 letters; of the 26 letters in the English alphabet, 19 unique letters appear in the sentence. It is crucial to note that in his translation to Morse code, Kac removes the two commas found in the King James version, as well as the final period. This is ostensibly because the subsequent translation to the four nucleotide bases for the composition of the Genesis gene only allowed for a limited number of elements. Whereas transmitted Morse code does in fact contain coded punctuation marks and other signs—and its overarching guidelines account for the length of the transmitted signals and spaces between words10 —Kac incorrectly assumes that the translation of words (26 letters plus letter and word spacing) to Morse Code (dot/ dash, punctuation omitted), to four nucleotide bases is unproblematic. Next, the reading frame as a “polysemic” genetic structure adds additional complexity to the construction of this living poetic machine: Since the mRNA is read in consecutive groups of three (with no punctuation), it could code for three completely different proteins, depending on where it starts; i.e. there are three potential reading frames. The position of the RBS [ribosomal binding site] and the initiation codon determines the reading frame…the addition or deletion of a single base will change the reading frame, and the coding property of the subsequent message is totally different. (Dale and Park 27) In light of the potential messages that may be transcribed (to mRNA) and translated (to tRNA, amino acids, polypeptides, proteins, etc.) from the Genesis gene’s reading frame, we might describe this genetic potentiality as something like polysemia, with respect to the bacterial composition of poetry through the expression of the Genesis gene. And, when one accounts for the additional complexity of the ultraviolet light irradiating the genetically-modified bacteria in Kac’s project—a process that introduced mutations into the Genesis gene-poetic sentence—the larger significance of this polysemia goes beyond the “symbolic gesture” of changing the sentence. Whereas Kac asserts that “it means that we do not accept its meaning in the form we inherited it, and that new meanings emerge as we seek to change it” (“Genesis”), the richness of his engagement with the literary informs the scientific imaginary of his “bacterio-poetic engineering” in a way that goes well beyond the claims

108  A Poetics of Biocybernetic Reproducibility that Kac himself makes for the fragility of “[t]he boundaries between carbon-based life and digital data” (“Genesis”).

The Limits of Biocybernetic Reproducibility: Bringing “Genesis” to Life In the introduction to a volume of essays collectively subsumed under the title Data Made Flesh: Embodying Information, editors Phillip Thurtle and Robert Mitchell write: The works in this final section of Data Made Flesh provocatively sum up one of the key assumptions of the volume as a whole: we have entered an era where signifying practice and embodiment are no longer conceptually or practically separate. This suggests, in turn, that “representation” is often a problematic strategy with which to engage embodied information. The mediums for these artists are living, metabolizing bodies; they are no longer representing life, but are creating life. As a result, we can no longer be comfortable using purely literary analysis to analyze information as the structure of the message (such as seen in recent narratological analyses of virtual environments); nor can we be content using psychoanalytical crowbars to pry open the identities of biological beings to read the codes of their behaviors. Instead, we must use biology in order to understand how our communicative gestures might come alive and give birth to new possibilities. This then reveals the most urgent message of the “informational mode of development”: once one recognizes the simulacrum as a productive (as opposed to derivative) element, then we stand like gods giving life to new bodies with every communicative gesture. (19) There is much to like in this account of biocybernetic reproduction, e­ specially the call to productively apply scientific methodologies to the analysis of the problematics of representation, as it manifests in the ­embodied practices of signification and communication. At the same time, there is a clear over-privileging of science as master trope or discourse here, beginning with an allusion to the limits of “purely literary ­analysis”—­whatever that might entail in the current moment of trans- or interdisciplinary studies—­ and culminating in a final (puzzling) flourish that would cast artists and critics as “gods giving life to new bodies with every communicative gesture” (19). This is, in essence, (a hyperbolization of) the thrust of the paradigm shift identified by W. J. T. Mitchell’s writings on biocybernetic reproducibility, and recalls Eduardo Kac’s rejection of metaphoricity in technopoetic, telematic, and transgenic artworks. In fact, the last section of Data Made Flesh, to which the editors allude in the above quote, includes essays by ­Bernadette ­Wegenstein (whose work is cited in the present chapter),

A Poetics of Biocybernetic Reproducibility  109 ­ atherine Hayles (who clarifies and expands upon some of the positions K she took in How We Became ­Posthuman), Steve Tomasula (in an essay titled “Gene(sis),” cited above), and Robin Held (who prominently features Kac’s artwork in a piece titled “Gene(sis): Contemporary Art ­Explores ­Human Genomics”). Kac’s own piece, “Transgenic Art Online”—which analyzes specific symbolic and biological features of ­“Genesis” in detail— is a key component of this section of Data Made Flesh. In this essay, titled “Transgenic Art Online,” Kac links the symbolism of the multifarious levels of code present in “Genesis” with the user’s potential to alter and create meaning in a very living, breathing manner (at least with respect to bacterial metabolism through cellular respiration): In the context of the work, the ability to change the sentence [“Let man have dominion…”] is a symbolic gesture: it means that we do not accept its meaning in the form we inherited it, and that new meanings emerge as we seek to change it. Employing the smallest gesture of the online world—the click—participants can modify the genetic makeup of an organism located in a remote gallery. This unique circumstance makes evident, on the one hand, the impending ease with which genetic engineering trickles down into the most ordinary level of experience. On the other, it highlights the paradoxical condition of the nonexpert in the age of biotechnology. To click or not to click is not only an ethical decision, but also a symbolic one. If the participant does not click, he allows the Biblical sentence to remain intact, preserving its meaning of dominion. If he clicks, he changes the ­sentence and its meaning, but does not know what new versions might emerge. In either case, the participant is implicated in the process. (261) Before unpacking the links that Kac establishes between the everyday experience of the Internet user (interacting remotely with the “Genesis” ecosystem), the ethics of biological (re-)programmability, and induced poetic-­genetic mutation in bacteria bombarded with UV light, additional description of the biocybernetic construction of Kac’s transgenic artwork is required. Following the creation of the Genesis gene, Kac—assisted by a team of bacteriologists—inserted the gene into plasmids, which are a ­variety of extrachromosomal DNA often employed as a vector in genetic engineering, especially in cloning and gene therapy. They are self-­replicating, provided that they possess an origin of replication site on the plasmid DNA, and are thus called “replicons.” As Kac describes, the diagram of the ­plasmid manufactured for “Genesis” includes the following features (Figure 4.3): The black circular arrow at the top of the plasmid indicates the direction of transcription (i.e., the process by which one strand of DNA is copied into a single strand of RNA). Shown in the illustration are:

110  A Poetics of Biocybernetic Reproducibility

Figure 4.3  Cloning of the Genesis gene in plasmids.

1) Promoter sequence (sequence of DNA where RNA polymerase binds on to begin transcription); 2) Multiple Cloning Site (part of the plasmid that has been engineered to accept the insertion of other sequences); 3) Cyan fluorescence sequence (sequence of DNA that codes for cyan fluorescent protein); 4) MCS with GENESIS gene (site where the Genesis gene was inserted); 5) Ampicillin resistance sequence (gene that codes for resistance to the antibiotic ampicillin); 6) Origin of replication site (site where the process of replication of DNA molecules originates, by one single strand being used as a template for the production of another single strand). (“Plasmid”) Two features of this plasmid are of particular interest. The first is the cyan fluorescence sequence, which codes for the production of an Enhanced Cyan Fluorescence Protein (ECFP), and is part of the plasmid incorporated into bacteria containing the Genesis gene. Kac also engineered plasmids with a yellow fluorescence sequence (which codes for the production of an Enhanced Yellow Fluorescence Protein, or EYFP); those bacteria with this alternative color-emitting property do not have plasmids containing the Genesis gene. As Kac explains, ECFP and EYFP are GFP (Green Fluorescent Protein) mutants with altered spectral properties. The ECFP bacteria contain the synthetic gene, while the EYFP bacteria do not. These fluorescent bacteria emit cyan and yellow light when exposed to UV radiation (302 nm). (“Genesis Info”)

A Poetics of Biocybernetic Reproducibility  111 The GFP also plays a central role in Kac’s masterwork “GFP Bunny,” which, as was previously mentioned, involved the creation of the transgenic rabbit named Alba, and encompassed the social and ethical dialogue generated by the work (Figure 4.4).11 As these two bacteria grow and colonies spread on the ampicillin-rich Petri dishes,12 mutations occur, either through horizontal gene transfer (conjugation) of plasmid material between bacteria, or as a result of spontaneous mutations. Kac anticipates the creation of new colors through mutations and reproduction, perhaps yielding bacteria that glow green under UV light. He describes three possible (fluorescent) scenarios involving “transgenic bacterial communication”: “1- ECFP bacteria donate their plasmid to EYFP bacteria (and vice-versa), generating green bacteria; 2- No donation takes place (individual colors are preserved); 3- Bacteria loose [sic] their plasmid altogether (become pale, ochre colored)” (“Genesis”). Overall, mutations may occur through this kind of “bacterial dialogical interaction, reproduction, or through UV irradiation by human interactors remotely accessing the installation via the Internet.”13 The evolution of bacterial colonies on display incorporates Kac’s principles of dialogical aesthetics, insofar as Internet users may increase the mutation rate in the bacteria’s genetic code by remotely irradiating the bacteria with UV light. UV irradiation produces mutations in the following manner: The principal effect of UV irradiation with which we are concerned is the production of pyrimidine dimers (commonly referred to as thymine dimers, although the effect can also occur with cytosine). Where two pyrimidine residues are adjacent on the same DNA strand...UV irradiation can result in the formation of covalent links

Figure 4.4  Bioluminescent bacteria.

112  A Poetics of Biocybernetic Reproducibility between them. These pyrimidine dimers cannot be replicated, and are therefore lethal to the cell unless it is able to repair the damage. It is the attempts to repair the damage caused by UV irradiation that can lead to mutagenic effects. (Dale and Park 61) As these mutations occur, the bacteria, in turn, emit visible light, which is displayed in real-time and represented in the large circular image that appears in the foreground of Figure 4.5. The texts flanking the bacterial colony are, appropriately, the Genesis gene (left) and the selected poetic-­ Biblical sentence, which gaze down upon the actual colonies embodying the multifarious strains of code. With respect to the results of the UV-­ induced mutations, Kac has accounted for the “life-as-data” paradigm present in the mutations to the bacterial genetic code by decoding the altered genetic sequence in an exercise of reverse translation—moving from nitrogenated bases to Morse code and back to the mutated poetic sentence. The final result of these mutations at the time when Kac’s poetic “sample” was taken—the end of the gallery show—reads as follows: “LET AAN HAVE DOMINION OVER THE FISH OF THE SEA AND OVER THE FOWL OF THE AIR AND OVER EVERY LIVING THING THAT IOVES UA EON THE EARTH” (“Genesis translated”). Some linguistic and biochemical clarifications will allow us to better understand the multi-stage translation of the original poetic sentence. Let us call the DNA sequence for the Genesis gene G′ (G prime), and the DNA code for the mutated sentence will be G″ (G double prime). The mutations that occurred as a result of plasmid exchange between bacteria or irradiation, then,

Figure 4.5  Genesis installation.

A Poetics of Biocybernetic Reproducibility  113 involved a total of six bases. The first mutation involved a change from thymine to cytosine, and is located, significantly, in the gene’s promoter sequence. This, in turn, might a­ ffect the rate of transcription and translation in future bacterial metabolism. The second group of mutations took place in the Genesis gene’s untranslated region, and resulted in a change from CGT to GCC (from ­coding for the amino acid arginine to alanine). With respect to G′, this mutation took place within the word “dominion,” changing its DNA coding from ­“TCCGTTTGTTCGTGTCGCCGTTTGTC” in G′ to “TCCGTTTGTTGCCGTCGCCGTTTGTC” in G″. The change in nucleotide sequence in G″ yields the following small change in the ­corresponding Morse code sequence, when working backwards to “decode” the DNA-Genesis gene alterations: from dot/letter space/dash (CGT) in G′ to letter space/dot/dot in G″. Therefore, while the mutation in DNA sequence evinces a change in the Morse code, no change is registered in the poetic sentence manifest in G″. This is biologically significant, and could result in further mutations dramatically affecting the bacteria carrying this mutated plasmid by way of conjugation or subsequent (induced or random) mutation. Nevertheless, from the standpoint of poetic syntax and semantics we might call this a “silent mutation,” demonstrating what from a genetics perspective is like a “wobble” (as part and parcel of the degenerate nature of DNA as code). But in the context of the present technopoetic inquiry, it might be understood in terms of something like différance, the neologism of sorts made famous by Jacques Derrida in his essay of the same title. Derrida made a deliberate, “gross spelling mistake” (3)—replacing différence with différance, which are phonetically identical in French—in order to deconstruct the speech/writing opposition that has troubled Western Metaphysics for thousands of years. This purely graphic alteration encompasses a non-concept that differs and defers in Derrida’s reading of structuralist linguist Ferdinand de Saussure’s understanding of language as a system of differences without positive terms. One might say, then, with respect to the differential encompassed by the silent mutation from CGT to GCC, that in G″ the concept of dominion demonstrates a genetic polysemia (as difference and deferral) that is not “expressed” through the vehicle of the poetic. The final group of mutations that occurred in the Genesis gene following UV irradiation and bacterial reproduction (plasmid exchange) involved the last few words in the biblical quote: transforming from “THAT MOVES UPON THE EARTH” to “THAT IOVES UA EON THE EARTH.” This mutation, which included the disruption of the integrity of individual words in the poetic sentence, only involved the alteration of a total of three total nucleotide bases. The substitution of M for I in the biblical quote reproduced above is rather straightforward, as it can be easily seen that the two thymine bases were modified to two cytosines, thus producing a change in the Morse code from two dashes to two dots (from the letter M to the letter I). The second

114  A Poetics of Biocybernetic Reproducibility mutation is more interesting, insofar as its single substitution of thymine for adenine cleaves a word in half and also changes two letters in a single move. The word “UPON” is coded via the following nucleotide sequence: ­“CCTGCTACGTTTGTC.” To first understand how the word is split in two, it is important to recall that adenine (A) codes for a word space in the Genesis gene. The word “UPON” is thus simultaneously broken in half with the introduction of adenine, which disrupts the integrity of the single word “UPON,” and also introduces the letters “A” and “E” in place of the letter “P.” These two biochemical changes, considered from a poetic perspective, confirm Kac’s assertion that “the ability to change the sentence is a symbolic gesture: it means that we do not accept its meaning in the form we inherited it, and that new meanings emerge as we seek to change it” (“GENESIS”). The mutation from “MOVES” to “IOVES” can be read in a visual manner, as the typescript chosen to display this message facilitates a reading that registers the slippage from “IOVES” to “LOVES,” thus introducing an element of lovingkindness to the larger message decrying authoritarian and colonial domination that Kac “programmed” into the Genesis project. The second mutation reaffirms the large scale of geologic time encompassed by both religious and scientific measures of time, insofar as the “EON[S]” of “THE EARTH” transcends the (individual) human and even, perhaps, the human species. This exercise in bi-directional translation is not without its dangers, or at least it conceptual fallacies. One must acknowledge that the ­unidirectional flow of information is a fundamental process in genetics, and the “reconstruction” of the mutated poetic sentence is erroneous in terms of biological function. But it does serve a technopoetic and symbolic function, and therefore is highly relevant to this exploration of the ways in which the poetic informs how “meaning is constructed in science” (“Transgenic Art Online” 262). As this chapter has demonstrated through its analysis of specific telematic and transgenic artworks, Eduardo Kac’s complex approach to biocybernetic posthumanism is ­informed by the shared meaning-making activities of natural, poetic, and scientific language, and is keen to build bridges between scientific and humanistic discourses in a way that does not proclaim the sovereignty of either. Whereas this discussion of Kac’s work focused on a technophenomenology of skin and the complexities of the question of translation, an especially troubling or perplexing issue remains as the present study seeks to situate this scientific strain of Latin American technopoetics in Latin American cultural criticism and media studies, and, indeed, in its geographical origin. That is to say, “what is Latin American about Latin American technopoetics and scientifically informed digital poetics?” The concluding remarks that follow this chapter will use Kac’s own theorization of the ways the poetic informs how “meaning is constructed in science” as a jumping-off point for some “grounded” remarks that seek to address the question of locating the Latin American in Latin American digital or technopoetry.

A Poetics of Biocybernetic Reproducibility  115

Notes 1 Wolfe is especially interested the question of making the invisible visible in Kac’s bioart, insofar as it raises our awareness of what is beyond the visible. He writes that “the use of GFP [Green Florescent Protein] in Kac’s work, particularly with the rabbit Alba in GFP Bunny, operates as a kind of feint or lure that trades on the very humanist centrality of vision that Kac’s work ends up subverting…”. (164) Here, Wolfe draws on Mitchell’s own brief remarks on Kac’s manipulation of the visual, concluding that “the whole point of the glow-in-the-dark rabbit of GFP Bunny and how it seizes on certain spectacularizing modes of human visuality is that the harder you look, the less you see” (165). 2 In holopoetry, poetry inscribed in a visual medium is displayed as a hologram, thus altering the temporality of the reading-encounter as well as the ontology of the poetic text. 3 Kac further clarifies the role of dialogism in electronic and media art in an essay titled “Negotiating Meaning: The Dialogic Imagination in Electronic Art.” Here, he argues that, “[d]ialogical telepresence events combine self and other in an ongoing interchange, dissolving the rigidity of these positions as projected remote subjects” (120). 4 It is worth noting that a fifth nucleobase, uracil (U), is present in RNA (a molecule that plays a key role—working in tandem with DNA—in protein synthesis), as it results from the breakdown of cytosine. Some organisms, however, possess uracil in their DNA, including select bacteria and bacteriophages. 5 The corresponding mRNA codon is TAC, which would be translated to AUG in tRNA. 6 In prokaryotes (single-celled organisms), AUG is the most common RNA start codon. 7 It is fruitful to compare Kac’s description of Morse Code as a binary system with Steve Tomasula’s remarks on the binary nature of “Genesis’” code: To translate this natural language into the language of the cell, the AGCTs of DNA, Kac used Morse Code as an algorithm. The dots and dashes of Morse Code easily translate into the 1s and 0s used by a digital computer to represent the alphabet—information in a form that can easily be sent around the globe or across the microscopic distances within an integrated circuit. ((GENE)SIS 250) However, the Genesis gene’s code is not at all binary in nature, as its translation principles involve coding for the move from one letter to the next and also coding for spaces between words. There is also an issue regarding punctuation, as I will argue below. 8 Francis Crick, who also is credited (along with James Watson) with the first elaboration of the double-helix structure of DNA, proposed that the “wobble” in the third base explained the lack of unique tRNA molecules for the 61 possible codons (plus three stop codons). 9 This “allowable mismatching” is absolutely vital to the relationship between DNA and tRNA: For many tRNA molecules, the codon-anticodon recognition is not absolutely precise; in particular, there is some latitude allowed in the matchup of the third base of the codon. A rather complex set of rules (the wobble

116  A Poetics of Biocybernetic Reproducibility hypothesis) has been developed to account for the extent of allowable mismatching. So some tRNA molecules are able to recognize more than one codon. The number of tRNA species required for recognition of the complete set of codons is thus considerably less than 61 (commonly between 30 and 40). (Dale and Park 29) 10 Recent guidelines on International Morse Code read as follows: 1.1.3  Punctuation marks and miscellaneous signs   Full stop (period) [ . ] .-.-.- - . . -    Comma [ , ] 2  Spacing and length of the signals 2.1  A dash is equal to three dots. 2.2  T he space between the signals forming the same letter is equal to one dot. 2.3  The space between two letters is equal to three dots. 2.4  The space between two words is equal to seven dots. (“International Morse code Recommendation ITU-R M. 1677–1”. itu.int. International Telecommunication Union. October 2009) 11 The 2008 Nobel Prize in Chemistry honored Osamu Shimomura, Martin Chalfie, and Roger Y. Tsien for their discovery and elaboration of the green fluorescent protein as a vital tagging tool in bioscience. The press release announcing the prize read as follows: The remarkable brightly glowing green fluorescent protein, GFP, was first observed in the beautiful jellyfish, Aequorea victoria in 1962. Since then, this protein has become one of the most important tools used in contemporary bioscience. With the aid of GFP, researchers have developed ways to watch processes that were previously invisible, such as the development of nerve cells in the brain or how cancer cells spread. Tens of thousands of different proteins reside in a living organism, controlling important chemical processes in minute detail. If this protein machinery malfunctions, illness and disease often follow. That is why it has been imperative for bioscience to map the role of different proteins in the body. This year's Nobel Prize in Chemistry rewards the initial discovery of GFP and a series of important developments which have led to its use as a tagging tool in bioscience. By using DNA technology, researchers can now connect GFP to other interesting, but otherwise invisible, proteins. This glowing marker allows them to watch the movements, positions and interactions of the tagged proteins. Researchers can also follow the fate of various cells with the help of GFP: nerve cell damage during Alzheimer's disease or how insulin-­ producing beta cells are created in the pancreas of a growing embryo. In one spectacular experiment, researchers succeeded in tagging different nerve cells in the brain of a mouse with a kaleidoscope of colours. (“The Nobel Prize in Chemistry 2008—Press Release”) Chalfie’s Nobel Lecture acknowledged the incorporation of the discovery of GFP into popular culture (referencing Ang Lee’s 2003 film “Hulk”) and into the art world, in his brief mention of Kac’s GFP bunny Alba (“GFP: Light Up My Life”).

A Poetics of Biocybernetic Reproducibility  117 12 Ampicillin-resistance genes are commonly used as selectable markers in plasmids in order to ensure the growth of ampicillin-resistant bacteria through replication. Therefore, nearly all bacteria that grow on the ampicillin-rich medium possess the desired gene. 13 Kac’s ancillary, multimedia project “Genesis” also involved the creation of what he called a “DNA Mixer,” which converted DNA sequences into music. Related artistic pieces (all created in 2001) include granite etchings of the tripartite coding for the Genesis gene (poetic sentence, Morse code, DNA sequence) titled “Encryption Stones”—a piece that evokes the famous Rosetta Stone—as well as granite carvings visually rendering the Genesis protein (“Fossil Fold”), giclee prints titled “The Book of Mutations,” and multimedia pieces displaying various phases of the Genesis project (“In our own image I” and “In our own image II”). The most suggestive piece in this series, however, is “Transcription Jewels,” which, according to Kac’s own description, is comprised of actual Genesis DNA (inside the genie bottle) and a gold cast of the Genesis protein. By displaying the emblematic elements of the biotech revolution (the gene and the protein) as coveted valuables, this work makes an ironic commentary on the process of commodification of the most minute aspects of life. (“Works from the Genesis Series, 2001”)

Concluding Thoughts on (New) Media and Mediation Locating the Latin American in Contemporary Technopoetics

In Toy Medium: Materialism and Modern Lyric, Daniel Tiffany writes that “[f]ew ideas are more deeply entrenched in Western society than the assumption that poetry and scientific materialism are antithetical modes of knowledge, having produced two disparate—and perhaps ­incommensurable—cultures” (12). Tiffany thereby evokes C. P. Snow’s influential “two cultures” topos in his discussion of the interpenetration of scientific and poetic imaginaries, in a book that puts into conversation a potpourri of physical and ephemeral phenomena, such as scientific laws, toys, cosmological structures, and poems. He postulates that scientific approaches to the world rely on images “that serve as models of unobservable phenomena,” since “the foundation of material substance is intelligible to us, and therefore appears to be real, only if we credit the imaginary pictures we have composed of it” (3). Modern science— physics in particular—depends on the preeminence of the (pedagogically motivated) image in the face of the (purportedly pure) concept, as Sean Miller has convincingly argued. In a powerful essay about string theory’s construction of scientific imaginaries, Miller draws on Michèle Le Doeuff’s notion of the philosophical imaginary—in which the image is subordinated to the concept—in order to claim that scientific realism also relies heavily on, but at the same time denigrates, the images employed to assist explanation of mathematical and conceptual reasoning. Bruno Latour’s work on what he calls “iconophilia” in the negotiation between artistic, religious, and scientific discourses is very germane to this discussion. Latour defines iconophilia as respect not for the image itself but for the movement of the image. It is what teaches us that there is nothing to see when we do a freezeframe of scientific and religious practices and focus on the visual itself instead of the movement, the passage, the transition from one form of image to another. (421) This “transition,” so to speak, involves mediation that is all too often ignored or at least minimized in scientific discourse, much in the way

Concluding Thoughts on (New) Media and Mediation  119 that Tiffany and Miller describe in their studies. As Latour avers here, a “vehicle” must be utilized to facilitate the transfer of information,1 and “it is always radically transformed from one medium to the next. More accurately, it pays for its transport through a heavy price in transformations” (425). The emphasis that Latour places on transport and the mutability of information in its immutability—since “some features have to be maintained in spite of the mobility provided to them” (426)—is highly relevant to the claims made in the present study regarding the relationship between mediation and interpretation in Latin American technopoetics. And, following Latour, the transfer of information as the transformation of information is a double-edged sword: “Fiction is no longer free under the pretext that it would be subjective or impotent, and science is no longer merely ‘accurate,’ because to be so it would also need to be unmediated, unsituated, and ahistorical” (428). Insofar as Latour’s analysis of the relationship between fiction and science invokes the problematic nature of the binary opposing these two modes of inquiry, his consideration of the mutability of information in its transport recalls the complexities of translation and translatability explored in the previous chapter’s discussion of Eduardo Kac’s transgenic project “Genesis.” Whereas Kac seeks to highlight the ways in which the poetic informs how “meaning is constructed in science” (“Transgenic Art Online” 262), the example of “Genesis’” problematics of translation shows just how complex the negotiation of science and poetics can be when considered in light of the e-poetic- and digital humanities-­inflected principle of coding as interpretation and mediation. This follows ­Tiffany, Miller, and Latour—as well as Loss Pequeño Glazier, Jay David Bolter and Richard Gruisin, Joanna Drucker, and Katherine Hayles—in their insistence on the transformative potentialities present in models and images, as well as the mutability of information as remediation or re-presentation. For critic Jesús Martín-Barbero, there is a specific link between the breaking or blurring of boundaries and limits and the disembedded nature of culture in our current media/mediated environment: The shattering of spatial and temporal boundaries which these are bringing about in the cultural field delocalizes knowledge: it delegitimates the boundaries between reason and imagination, knowledge and information, nature and artifice, science and art, expert knowledge and profane experience. And this, in turn, alters both the epistemological and the institutional status of the conditions of knowledge and the figures of reason in their connection with the new forms of feeling and the new patterns of sociality. (Lyotard 1984; Maffesoli 1990) (59) Martín-Barbero’s analysis provides an avenue through which we might consider another, no less important series of questions implicitly

120  Concluding Thoughts on (New) Media and Mediation proposed in Latin American Technopoetics: the problematic geo-­spatial coordinates of this book’s virtual textualities, which are designated nevertheless as “Latin American” in nature. That is to say, one might wonder as to what allows the designation of a technopoetic object as Latin American, in the context of a study that predominantly explores digital objects conceived and created in the age of the Internet (post-1995). Even more so, it must be acknowledged that Gustavo Romano left his native Argentina over ten years ago, Santiago Ortiz returned briefly to Latin America and has again taken up residence in California, Loss Pequeño Glazier has always called the United States home, and Eduardo Kac has lived in Chicago since 1989. In this way, in order to understand (and perhaps even justify) the designation of the multilingual, multimedia objects studied in this book as Latin American, the final remarks presented here are specifically attuned to the ways that work by these four techno-­ artists departs from a specific cultural cartography that is marked and transected by “the Latin American” in a very meaningful sense. In her recent book Place and Politics in Latin American Digital Culture, Claire Taylor argues the following: The internet…is at the same time territorially located, and goes beyond conventional territorial markers, definitions and borders. New forms of negotiation between the local and the global and between the virtual and the real are constantly being elaborated in net art, which leads to new ways of forming and understanding local, regional, and transnational locatedness. (6) While Taylor’s focus here is primarily on net art’s tendencies to “engage with particular place-based concerns and attempt to create temporary, tactically resistant re-territorializations online” (175), her study, overall, represents the most sustained and rigorous treatment of the topic of place in Latin American cybercultural studies. In Latin American Identity in Online Cultural Production, Taylor and co-author Thea Pitman carefully document the move from the utopian discourse inherent in early (1990s) conceptualizations of cyberspace as a democratic, global village, to a harbinger of globalized technocapitalism that tends to homogenize culture (destabilizing the nation-state as well as Westernizing local cultures), reinforce stereotypes, support multinational corporations, etc. 2 In a similar vein, Martín-Barbero describes the dissolution of the link between culture and nation in the following manner: What has been most critically affected by this process is the space of the national—both by the economic and technological globalization which is redefining the decision-making powers of national

Concluding Thoughts on (New) Media and Mediation  121 states, and by a contradictory and complementary politico-cultural revaluing of the regional and the local. For when it is disembedded from its national space culture loses its organic links with its territory, and with language, which is the very fabric or the work of the intellectual. (62) Taylor and Pitman also follow critics like Arjun Appadurai, who postulate the resistant nature of virtual technologies in the face of neoliberal or globalized information flows, and the case studies they present in their book tend towards a postnational and resistant praxis, which: aris[es] precisely through the very contradictions and tensions of the medium itself—that is, from the problematic, and unresolved tensions in online interaction between the local and the global, between expression uncoupled from a geographical specificity, and reterritorialization—­Latin American online culture plays upon these contradictions and tensions, and thus becomes a “postregional” Latin American cultural practice. Latin American cultural practice online, as “Latin American postregional practice” is thus a practice which works through the dismantling of the conventional conceptualizations of “Latin America,” all the while taking up, engaging with and reworking, tropes and discourses of “Latin American-ness”. (21) While it is not the primary thrust of the present study, I would argue that the artists studied in Latin American Technopoetics do articulate a specific praxis of “Latin American-ness,” insofar as they write from a positionality that is postregional in nature. There is, in fact, a striking insistence on questions of Latin American identity in technopoetic projects by Gustavo Romano, Santiago Ortiz, Loss Pequeño Glazier, and Eduardo Kac. I would like to analyze one particularly salient example of the “return of the Latin American” here, in order to gesture towards the ways in which these four artists end up thoughtfully engaging “tropes and discourses of ‘Latin American-ness’” (Taylor and Pitman 21). Gustavo ­Romano’s IP Poetry Project demonstrates an especially rich instantiation of place vis-à-vis the site-specific installations that Romano designed and implemented as part of the work. 3 The first example comes from “The Florida and Boedo Project,” a 2007 showdown between two sets of bots, who read works created specifically for the exhibition and which demonstrated particular literary-discursive characteristics. The texts by the “Florida bots” were meant to evoke the experimental writings of the avant-gardist Florida poets writing in the 1920s in Buenos

122  Concluding Thoughts on (New) Media and Mediation Aires, while the “Boedo bots” produced socially-committed work, as did their namesake writers—the bitter rivals of the Florida poets. Visitors to the installation—half of which was located above the entrance to the Spanish Cultural Center on Florida Street, whereas the other half was installed above the entrance to a literary bar on Boedo Street— could view the retro and futuristic poetic “battle” and thus “walk forwards into the past,” to pun Marshall McLuhan’s famous statement. As a point of contrast, the Cervantes Institute in Beijing hosted Romano’s “Tao Tech King” series in 2007, which substituted technopoetics— hence the “tech” moniker—for the “virtue” in the title of that profound work of Chinese philosophy: the sixth-century Lao Tse masterpiece, the Tao Te Ching. The koan-like, aleatory phrases utilized in this installation began with the maxims “Knowing the…” or “One becomes…” and the IP Poetry search function yielded rather fascinating poetic output, such as: Knowing the ozone one becomes a girl or boy. Knowing the heart of God one becomes their own terrorist. Knowing the true nature of the countryside one becomes a father. Knowing the future one becomes the other. And finally, in Romano’s “Robot Poet in New York Project,” presented at the Cervantes Institute in New York in 2008, the bots recited poems paying tribute to Federico García Lorca, whose Surrealist-­inspired critique of the cruel shock of modernity witnessed in the Big Apple in the late 20s/early 30s—titled Poet in New York—was published posthumously in 1940. Returning to the robopoetic framework that characterizes the generative poetics of the IPP, it is important to acknowledge that the programmer’s (site-specific) poetic maxims provide a locally inflected framework for the output, and the installations provide a backdrop of physical—yet subsequently virtualized and remotely-viewed—space upon which to compose poetry, amidst what Romano has called “the virtual arrangement of the collective human memory found on the internet” (IP ­Poetry Project 105). We might identify the production of identity-specific discourse by briefly analyzing the feedback loop that Romano creates between the physical site of the installation, the fixed poetic refrains of human composition and the aleatory “choreography” enacted by the bots, among other elements. In the case of the Beijing ­ estern exhibition, spectators were presented with the substitution of W

Concluding Thoughts on (New) Media and Mediation  123 technopoetics—which are nevertheless anticipated by the aleatory work par excellence, the I Ching—for an Eastern conceptualization of “virtue.” In Buenos Aires, virtual or live spectators watched the bots “walk forward into the past” in their posthuman poetic battle. In New York, there was a clear tension between Lorca’s scathing critique of ­modernity— vis-à-vis the city’s dehumanizing effect—and the haunting irony of the IP Poetry Project’s riffing on the Andalusian poet’s work through the machinic insertion of the hallmarks of the very capitalist system criticized by Lorca, and the recitation by silicon- (and not ­carbon-) based poets. The embeddedness of site-specific discourses and topoi from Latin ­American (and Spanish) literary culture in Romano’s IP Poetry Project, therefore, is part and parcel of the aleatory poetics espoused by this robopoetic masterpiece—a work largely conceived and executed outside the physical cartographies and confines of Latin American soil. R ­ omano’s (poetic and code) writing, then, is transected by “the Latin American” in a very significant way. His work, along with that of the other three artists discussed in Latin American Technopoetics, expands the “imagined community” of Latin American cultural production while it also makes a strong case for the increasing viability of an innovative scientific poetics currently gaining prominence in Latin American literary and media studies, digital humanities, and science and technology studies. In closing, I hope that the individual readings contained in Latin American T ­ echnopoetics—like their interdisciplinary nuts and bolts, concepts and images, quarks and quirks—are greater than the sum of their parts, insofar as they promote and even demand new ways of conceptualizing and analyzing both virtual and empirical textual objects. After all, while a rich conversation between the sciences and the arts has always existed, we have new tools and new motivation with which to approach the increasingly-­visible interconnectedness of scientific and humanistic discourses.

Notes 1 The centrality of the figure of transportation in Latour’s argument recalls the etymology of the trope of metaphor: Etymology: Of multiple origins. Partly a borrowing from French. Partly a borrowing from Latin. Etymons: French metaphore; Latin metaphora. < Middle French metaphore (c1275 in Old French as metafore; French métaphore) and its etymon classical Latin metaphora < ancient Greek μεταϕορά < μετα- meta- prefix + ϕορά carrying (< the o -grade of the stem of ϕέρειν to bear, carry: see bear v.1), after μεταϕέρειν to transfer. Compare Italian metafora (a1375), Spanish metáfora (1st half of the 15th cent.), Portuguese metáfora (15th cent.) (“metaphor”).   This is not to say that Latour limits the tropology of transfer to metaphor, but there is a marked dependence on tropes of analogy and substitution in his conceptualization of the image.

124  Concluding Thoughts on (New) Media and Mediation 2 I strongly encourage the interested reader to consult Taylor and Pitman’s work for a more complete account of these complex debates from a cultural and media studies perspective. 3 In the case of the other three artists whose work is analyzed in this book, we might also consider the following topics: Santiago Ortiz’s dialogue with the poetic tradition in Spanish and Portuguese in “Arboles de textos,” as well as his socio-political critique of neoliberalism in “bacterias argentinas,” Loss Pequeño Glazier’s sophisticated use of code-switching and his firm location of the virtual in exotic and often tropical locales (without falling into the traps of reductive or essentialist topoi, I might add), or Eduardo Kac’s particular “network locality” (Gordon and de Souza e Silva) as evidenced in registering Brazilian geo-spatial coordinates in “Time Capsule.”

Afterword Carlos Cociña and Luis Correa-Díaz’s Scientific Technopoetics (todavía in Print)

When faced with a totally new situation, we tend to attach ourselves to the objects, to the flavor of the most recent past. We look at the present through a rear-view mirror. We march backwards into the future. —Marshall McLuhan, The Medium is the Massage, 74–5

Whereas in the conclusion to Latin American Technopoetics I attempted a pun on media theorist McLuhan’s famous claim about the way we perceive the present—unlike the IP Poetry bots, who “walk forwards into the [literary] past”—this afterword explores the ways in which contemporary print poetry is intimately transected by the digital in its creation, inscription, and circulation. More specifically, in the case of Carlos Cociña’s scientific poetics, I analyze the complex gestures of remediation and appropriation present in Plagio del afecto (2009)—in both its version 1.0 as a book of print poems, and subsequently in its hypertextual manifestion at the website poesiacero.cl, which is Cociña’s online poetic repository. Luis Correa-Díaz’s exploration of cosmological and posthuman spaces, on the other hand, demonstrate a deep engagement with a rigorous scientific and digital poetics in what is ostensibly a very traditional book format—yet these print books prominently feature moments of “augmented reality” such as QR codes and links to YouTube videos, as well as references to a host of other techno-scientific products/ ideas that are commonplace in our current moment of “biocybernetic reproducibility.” What these two cutting-edge poets offer us, then, is a unique view of the concept of originality and the self in the digital age, an insightful analysis of humankind’s constantly-changing material and spiritual place in the universe, as well as a way in which scientific technopoetics takes new forms through the “old” medium of print. Carlos Cociña was born in Concepción in 1950 and has lived the vast majority of his life in Santiago, where he has worked for several literary and academic publishers.1 His most recent publication is a c­ arefully curated anthology of his poetic work, titled Poesía cero (2017), which begins with the renowned Aguas servidas (1981) and continues through

126  Afterword those digital and remediated poems included in his online repository, which is also titled “Poesía cero” (www.poesiacero.cl), as well as La casa devastada (2015). These are poems in which “se desplaza una bruma que es la misma que envuelve los límites que no se pueden cuantificar” [“a fog is displaced, which is the same one that envelops the limits that cannot be quantified”] (63), texts which revolve around a few fundamental natural elements: air, water, bones, trees, the night, insects, etc. 2 Nevertheless, Cociña’s poetry carries out a concretization of the formless in his exploration of the everyday world and language. In the first poem included in Poesía cero, titled “1. El primer fragmento (emisión oral primera) «Estructura de la mirada» (fragmento)” [“1. The First Fragment (First Oral Emission) «Structure of the Gaze» (Fragment)”], Cociña writes: El tacto desordena la textura y por poner la voz se desentraña la forma del agua. La tengo en mis manos. La amaso en mis manos. [Touch scatters texture and with the voice-over water’s form unravels. I have it in my hands. I caress it in my hands.] The tension he creates between writing and orality here, between form and the formless, introduces the logic of contradiction that consistently operates in Cociña’s poetry, in which the inalterable is that which changes and yet nevertheless persists or remains, in these texts filled with perceptions and intimations of continual breakdowns and interruptions. The notion of structure in these poems and prose poems is extremely precise: they often rely on spatial metaphors in order to construct their rhythm, as in the exactitude of measures present in “Descripciones y actos penitenciales. Acto II” [“Descriptions and Pentitential Actions. Act II”]. “Histórica relación (1A),” on the other hand, is crafted from aphorisms that recall Austrian philosopher Ludwig Wittgenstein’s writings on contemplation, language, and the meaning of words (vs. their implicit silence): Parece no ser posible seguir manteniendo actitudes contemplativas en el dilema de la escritura que se escribe a sí misma; llegar al límite de la página y del idioma no es buscar la palabra, pues ésta se encuentra en el lenguaje que nos sirve para callar el horror de los desmanes de aquéllos que desprecian al hombre por el hombre. Frente

Afterword  127 a ellos nos quedamos callados. Frente a ellos, quedarnos callados. Seguimos la duda o buscamos el significado de los términos que no callan el claro sentido de la palabra nacer, asesinato, muerte. (22) [It seems impossible to continue to maintain contemplative attitudes in the dilemma of writing that writes itself; arriving at the limit of the page and of language is not searching for the word, since the word can be found in the language that allows us to silence the horror of the outrages of those who scorn mankind for being human. In their presence we remain silent. In their presence, remaining silent. We follow doubt or seek the meaning of the terms that do not silence the clear meaning of the word to be born, murder, death.] Indeed, the evocation of the (infamous) final line of the Austrian philosopher’s Tractatus Logico-Philosophicus is quite clear—“Whereof one cannot speak, thereof one must remain silent” (7)—and thus we can see how the rigorous exploration of linguistic potentialties is a very prominent critical preoccupation in Cociña’s work as a whole. As Cociña argues in this complex poetic text, “la palabra es sólo el decir de realidades más allá de ella” (22) [“the word is solely the saying of realities beyond itself”]. It is worth inquiring if for Cociña—paraphrasing Borges’ brilliant short text “Del rigor en la ciencia” [“On Exactitude in Science”]— language is the map or the territory; in “Temporada (03)” [“Season” (03)], from the book 71 (originally published in 2004), language is a force that is simultaneously ephemeral and concrete: Un lenguaje reiterado en piedras labradas por tres mil años, en las tazas de las rocas, repite la constelación de escorpión en el equinoccio de invierno, cerca de canelos y olivillos junto al desierto, donde se produce el encajonamiento de una desembocadura. Es el código perdido del azar, el lenguaje escindido e imperceptible sonido de los rapaces nocturnos, que se ve en un ancho y transparente aletear de una columna de niebla. Las voces flotan en el aire, en el lenguaje secreto de las alas. (118) [A language reiterated in rocks carved over the course of three thousand years, in the bowls of the rocks reflects the constellation ­Scorpio in the invernal equinox, near cinnamon and olive trees adjoining the desert, where the encasement of the estuary is. It is the lost code of chance, the divided and imperceptible sound of the nocturnal predators, which can be seen in a wide and transparent flap of a column of fog. The voices float in the air, in the secret language of wings.]

128  Afterword If the material (re-)inscription of language in or on the rocks is coetaneous with “el lenguaje escindido e imperceptible sonido de los rapaces nocturnos” [“the divided and imperceptible sound of the nocturnal ­predators”]—and here it is clear that synesthesia is a privileged and prominent trope in Cociña’s poetry—words traverse or cross the abyss of the intersubjective encounter in minimalist texts like poem 28, also from the book 71: “Toda tu piel / En cada lugar / Extiende la mía” [“All of your skin / In each place / Extends my skin”] (87). Cociña’s poetry here recalls the words of recently-deceased Spanish novelist Juan Goytisolo: From the I to the I the distance is immense. A rope stretched across the void. How to bring together the extremes, compile the infinite dispersion of a life? Broken memory, vespertine light. Raw material or sign?3 Much like Goytisolo’s intra-/intersubjective reflection in this poem, in Cociña’s “De otra manera 23.3” [“Another Way” 23.3], he explores the distance between bodies in terms of energy: “El calor que irradia de las manos a un centímetro de otro cuerpo es similar al de las conexiones inalámbricas” [“The heat that radiates from hands one centimeter from another body is similar to that of wireless connections”] (134). This sentence demands to be read in terms of a techno-scientific ­poetics, since the perspective on poetic language is hardly limited to philosophy throughout his impressive body of work. Cociña’s scientific or technopoetics is remarkably sophisticated; in a poem titled “7A” (from the 1999 book Espacio de líquido en tierra [Liquid Space on Earth]), the concatenation and density of scientific and natural metaphors is remarkable: Cuando se produce la síntesis de las proteínas para la transmisión de los datos, en base cuatro, la doble hélice se genera en el número mágico de sus pares. Quizás allí acontece la fusión en los doscientos milliones de grados de las escamas de la mariposa. Veintitrés insectos y sus imágenes revolotean sobre sí mismos en el inicio de los vientos. (58) [When protein synthesis for the transmission of information takes place, in base four, the double helix is produced in the magic number of its pairs. Perhaps that is where the fusion of the butterfly’s scales at two million degrees occurs. Twenty-three insects and their reflections swarm upon themselves at the start of the winds.]

Afterword  129 The first sentence could well be from a genetics textbook, anticipating the appropriation of scientific texts that Cociña would later employ in Plagio del afecto [Plagiarism of Affect] (2009). The hypothesis or poetic speculation found in the second sentence, however, operates at the molecular level. It introduces into the poem a physical process described by classical mechanics—the transcription of DNA—along with chaos theory and the butterfly effect, which is the idea that in a dynamic system, the smallest changes can result in large-scale, system-wide effects. The “twenty-three insects”—that is, the 23 pairs of chromosomes in the human genome, which in fact are butterfly-like in their shape—exist at the intersection of classical and quantum worldviews and are poised at the brink of (metaphorical) flight. Similarly, in the poem “9B,” the laws of physics are classifed as “actos de fe” [“acts of faith”] (60): Desde el momento en que la luz es captada, la física tiene como respuesta sólo sus propios actos de fe. La música de las esferas adquiere sentido en la perseverancia de sus dogmas, y los sonidos de los mismos tienden al silencio cuando se evaporan en la estructura de las células que pertinazmente se reproducen. Una canción no tiene fin sino en su intepretación. (60) [From the moment when light is captured, physics has as its response only its own acts of faith. The music of the spheres acquires meaning in the persistence of its dogmas, and its sounds tend towards silence when they evaporate in the structure of the cells that stubbornly reproduce. A song has no purpose other than in its interpretation.] In the final sentence, Cociña (very nearly) translates the well-known ­ openhagen interpretation of quantum mechanics—in which the obserC vation of a system constitutes or constructs the reality of the system— into musical terms. It is, in the words of Oulipian Jacques Roubaud, an effort to “comport oneself toward language as if the latter could be mathematized” (“Mathematics in the Method of Raymond Queneau” 89), but perhaps more radically so. The insistent poetization of physics in ­Cociña’s body of work transposes poetry towards or into mathematics in a movement whose vibrations (of strings at the Planck length of 1.616 × 10 −37 meters, of the internal organs and bones, or in the landscape) and oscillations (in the interior spaces of consciousness/the brain and the landscape (of solitude) in poem “13A,” for example) display a desire to quantify the formless. In “Jardines (fragmentos)” [“Gardens (Fragments)”], Cociña writes: Caminos cuya huella sólo se vislumbra y muchas veces vuelve sobre sí misma. No hay selvas ni lejanías explanadas, sino suelo sobre el

130  Afterword cual se desplaza una bruma que es la misma que envuelve los límites que no se pueden cuantificar. [Paths whose footprint can barely be made out and which often turns upon itself. There are neither jungles nor raised distances, there is merely ground upon which a fog is displaced, one which is the same that envelopes the limits that cannot be quantified.] (63) This recalls the incessant, Sisyphean task undertaken by the eponymous protagonist Altazor in Chilean poet Vicente Huidobro’s avant-garde, anti-­epic, published in 1931: “Yo mido paso a paso el infinito” [“I measure the infinite step by step”] (Canto IV).4 There is another key aspect of Carlos Cociña’s poetic experimentation that is particularly relevant to the present study’s technopoetic focus. The question of the materiality of his poetic project is particularly salient in its “bookishness” and its escape from the auratic object of the book, insofar as Cociña has recently developed a strong online presence in his “Poesía cero” (www.poesiacero.cl) editorial project, which includes internet versions of his books A veces cubierto por las aguas ­[Occasionally Covered by the Waters], 71 (setenta y uno), Plagio del afecto [Plagarism of Affect], Espacios de líquido en tierra [Liquid Spaces on Earth], Tres canciones [Three Songs], and Aguas servidas [Served Waters]. With this incursion into an online interface through which to disseminate his literary work, Cociña joins the growing canon of ­Chilean digital poetry, which includes, among others, the “Orquesta de poetas” (digital and sound poetry, 2011), Luis Correa-Díaz’s ­Cosmological Me (2010) and clickable poem@s (transmedia poetry, 2016), René Orellana G ­ ómez’s Poemas digitales (visual-digital poetry, 2004), Martín Gubbins’ Feedback (sound poetry and digital “procedures,” 2014), and Gregorio Fontén’s Poema del terremoto [Earthquake Poem] (2010), as Carolina Gainza has analyzed in her research on the aesthetic experience of reading digital literature. In terms of the print version of A veces cubierto por las agua, in its multimedia iteration it is a hypertextual work in which the individual poems appear according to a randomizing algorithm, when the user “opens” the book and clicks through the interface. This electronic book was used as the basis of a series of performances by the “Orquesta de poetas”, who introduced sound elements into a remix of Cociña’s poetic works. The website for the Poesía Cero publishing house or platform classifies the innovative work Plagio del afecto as an online “libro en proceso” [“book in progress”] (2003–2005)— with 52 “afectos”—whereas the print version was published in 2009 by ­Ediciones Tácitas, featuring 53 “afectos”. In Plagio del afecto, the reader has no way of discerning exactly where Cociña has appropriated secondary texts of a scientific, literary, philosophical, or mathematical nature. Cociña provides a specific reference at the bottom of each text, but the

Afterword  131 quotes are incorporated into the poetic text in a surreptitious way, such that there is always a doubt regarding the line that separates the original from the copy. 5 Several of the “afectos”—7 and 8, for example—are indeed blank pages in their entirety, apart from the title and the vague indication that there is a nameless (phantom) reference of some sort: AFECTO 07 Ref. In the remediated, hypertext version of the book, the reader-user only has access to select texts: afectos one through six (inclusive), 15–19 (inclusive), 33–35 (inclusive), 44 and 45, and 50–52 (inclusive). The plagiarism or appropriation is therefore incomplete in this (digital) book that is also a literary palimpsest. As Cociña writes-transfers-appropriates-­ plagiarizes in “Afecto 2”: “Dinámica, autónoma, de afectividad restringida, con un comportamiento de secuencia al azar, como embudo plegado, de percepciones desordenadas, parecidas a los cristales estructurales, tiendes a la anulación. Su anchura y rugosidad es mi pasión” [“Dynamic, autonomous, of restricted affectivity, orderly behavior randomized, like a folded funnel, of disorganized perceptions, similar to crystalline structures, you tend towards cancellation. Its width and roughness is my passion”]. The acknowledged source of this text is a book titled Física biológica una nueva frontera [Biological ­Physics: A New Frontier], by the Brazilian-American scientist José Onuchic; Onuchic is a biochemist who studies complex systems by employing ideas from biology to better understand the laws of physics. In Cociña’s “Afecto 02”, the reader perceives the tension between dynamic and chance-based features of the system, which are opposed to the regular, orderly “cristales estructurados” [“crystalline structures”]. This is analogous to a larger poetic gesture employed by Cociña, one which seeks to understand a world filled with contradictions, in which “Todo era falso pero posible” [“Everything was false but possible”] (“Afecto 01”), “El cerebro simula la realidad” [“The brain simulates reality”] (“Afecto 05), and, even more profoundly, “En la inestabilidad del silencio, donde lo visible es una mínima fracción, la realidad se anula a sí misma” [“In the instability of silence, where the visible is a minimal fraction, reality cancels itself out”] (“Afecto 19”). If in Cociña’s poetry “Nada es lo que es, sino lo que aparece” ­[“Nothing is what it is, but rather what it appears to be”] (“Afecto 44”; 102), then we might consider the ways his work explores hypothetical worlds in which “la palabra es sólo el decir de realidades más allá de ella” [“the word is solely the saying of realities beyond itself”] (“Histórica relación 1A”). In the final poem included in the recent anthology Poesía cero— titled “Siempre he estado aquí” [“I have always been here”] (originally published in El Mito del Teniente Bello [The Myth of Lieutenant Bello] (2005))—, Cociña writes: “Así la ruta exacta lleva libremente a cualquier

132  Afterword otro lugar; no existe meta, sino horizontes de lo que creemos i­mposible” [“Therefore, the exact route freely gives way to any other place; there is no end, there are only horizons of what we believe to be impossible”] (147). This quasi-mystical space, in which Cociña seeks to create realities beyond any possible (lingustic) world, retraces Altazor’s path through the heavens; in the fourth Canto, Huidobro’s “anti-poet and mage” famously proclaimed that “Más allá del último horizonte / se verá lo que hay que ver” [“Beyond the final horizon / we will see what remains to be seen”].6 As is the case with the penultimate postulate in Wittgenstein’s Tractatus, the reader who wishes to remain true to ­Cociña’s poetic wager must “throw away the ladder, after he has climbed up on it” (6.54). However, Cociña writes against Wittgenstein, insofar as here one says that which may not be said, achieving the impossible in its precise uncertainty. This recalls Nicaraguan poet Rubén Darío’s famous modernista sonnet, “Yo persigo una forma” [“I Seek a Form”], in which the poetic subject “no hall[a] sino la palabra que huye” [“only finds the word that flees”], much like the careful reader of Cociña’s poetry explores language’s complex system, in which “Las cosas que no existen están en el origen de las palabras” [“The things that don’t exist are in the origin of words”] (“Proposición 31.1.1”). Chilean-American poet Luis Correa-Díaz’s recent work explores the limits of language and the materiality of the analog-digital divide. An accomplished poet whose career spans three decades, this pioneering researcher of Latin American e-literature is a Professor of Spanish at the University of Georgia (Athens) and an académico correspondiente in the US for the Academia Chilena de la Lengua. Correa-Díaz’s writings provide a unique perspective on the relationship between poetry, science, and technology. His nuanced literary project is situated on the brink of the “becoming-digital,” theorizing the reciprocal interpenetration between print and digital poetics in a very sophisticated manner. In a way, this Afterword grew out of a series of observations he made in a recent article titled “La poesía cibernética latinoamericana (todavía) in print: un recorrido desde los años 50 y 60 hasta finales de la primera década del 2000” [“Latin American Cybernetic Poetry (still) in print: an Itinerary from the 50s and 60s to the First Decade of the 2000s”] (and I take the tag “todavía in print” from his title). In this piece, Correa-Díaz raises an important criticism of Christopher Funkhouser’s book P ­ rehistoric Digital Poetry: La interpenetración de los efectos culturales y estéticos de lo new media o digital en el libro—categoría que Funkhouser no contempla en su estudio—es un fenómeno que no sólo podría ser calificado de pre-digital, puesto que recorre todo el espectro temporal de la existencia de la poesía electrónica o digital; recorrido que ocurre de forma paralela en la mayoría de los casos.

Afterword  133 [The interpenetration of the cultural and aesthetic effects of new media or the digital in ‘the book’—a category that Funkhouser does not consider in his study—is a phenomenon that might not only be considered as pre-digital, since it runs the whole gamut of the temporal existence of digital or electronic poetry, a journey that occurs in a parallel manner in the majority of cases]. (“La poesía cibernética latinoamericana (todavía) in print: un recorrido desde los años 50 y 60 hasta finales de la primera década del 2000” 58) Insofar as Correa-Díaz assures the reader here that “los libros no desaparecerán, algo que muchos celebrarán, pero lo que importa en este momento es esto: no escaparán tampoco a los efectos de las tecnologías digitales que los interpenetraran” [“books will not disappear, which is something that many will celebrate, but what is important here is the following: neither will they escape the effects of the digital technologies that intersect them”] (57), it is through his rigorous, yet playful poetic explorations of the fluid boundary separating the virtual world from lived experience that we most clearly see the interpenetration of such initially disparate-looking phenomena as pop culture, love poetry of several periods and in several languages, augmented reality, and cosmology. In Cosmological Me—which was published, as the author points out in the book’s introductory pages, in 2010, one year after the International Year of Astronomy—Luis Correa-Díaz elaborates a scientific ­poetics that spans the dizzying scales separating the micro from the macro, in a spirited attempt to locate the poetic subject’s place in the universe, among humankind, and in language. In the book’s preface, physicist Alberto Rojo attempts to sum up Correa-Díaz’s scientific poetics in the following manner: If poetry, as Octavio Paz suggests, fuses feelings and thoughts, then Cosmological Me is a microscopic peeking at the melted solid where feelings and thoughts preserve their atomism, but redefine their locations and alter their symmetries in the constant code-switching of a verbal chemistry that remains notationless.7 (16) The deft (yet occasionally defamiliarizing) linguistic code-switching between Spanish and English provides the book with a notable musicality; in this book qua techno-manifesto, Correa-Díaz practices “the ancient art of writing / small,” as he argues in “understanding nanopoetry,” calling for kindred “argonautreader[s]” to “resemanticize ourselves, such that this, too, will have its moment and cede / (the techno-future of the sciences, they say) / to the industry of verse: human nature” (31). The conversational tone of the texts included in Cosmological Me effectively

134  Afterword engages very traditional poetic topoi, such as love and solitude, yet frequently hints at a possible overcoming of the limits of an orthodox ­scientism through poetic intervention. Two clever thought experiments, undertaken perhaps with this goal in mind, include the following lines, from the poems “mi alma desertora in freefall” [“my traitor heart in freefall”] and “imago mundi,” respectively: …contemplating the possibility of launching myself into space, at my own expense and risk -gravity could be conquered by such a poetic act, wouldn’t you say? (43) …if the theory of the self-reproducing, inflationary universe were to convincingly paint a surprising landscape, with a cosmic tree growing exponentially in time, infinitely… (45) As we saw in Chapter 2 of the present study—vis-à-vis an analysis of S­ antiago Ortiz’s arboreal remediations of poems about trees—the fractal-­like nature of the linguistic system can in fact model the “surprising landscape” that Correa-Díaz describes here. After all, drawing on Katherine Hayles, Stephanie Strickland, and others, Correa-Díaz observes that “[l]a página fue siempre una pantalla y el lenguaje una herramienta para ver” [“the page was always a screen and language was always a tool for seeing”] (69). Or, as he writes in Cosmological Me, “the metaphor of the screen, predictably, / lives on” (“young ladies in mourning” 47). Nevertheless, with respect to the larger scientific poetics proposed in this work—and speaking with the ironic modesty that characterizes the poetic voice throughout Correa-Díaz’s writing (in a way that resembles Nicanor Parra’s own ironic interruptions)—the poet admits that astrophysics textbooks provide him with “endless / poetic material” as part of “the composition of this report” (59) during nighttime reading sessions, an assertion that, in truth, doesn’t do justice to the sophisticated techno-poetics presented in his innovative explorations at the interface of the scientific and the literary. In the final poems of Cosmological Me, Correa-Díaz introduces a specific multimedia element that is highly relevant to the current exploration of a scientific technopoetics in that zone of contemporary Latin American poetry “still in print.” The final “verse” of the poem “The End of Cosmology” is actually a link to a YouTube video for Pink Floyd’s song “Learning to Fly,” from the 1987 album “A Momentary Lapse of Reason.” As Eleanora Finklestein remarks in her introduction

Afterword  135 to Correa-Díaz’s next book, titled clickable poem@s (2016)—which prominently features links as well as QR codes, as we will see below— Correa-Díaz’s poetry is extremely contemporary, despite its insistent meditations on more traditional poetic themes: “Sí, el amor, same old thing, pero aquí y ahora, donde somos capaces de estar en varios lugares al mismo tiempo, en vivo o viajando a través de esos atajos entre realidades que, incluso en castellano, llamamos «links»” [“Yes, love, same old thing, but here and now, where we are capable of being in several places at once, live or traveling through those shortcuts between realities that, even in Spanish, are called ‘links’”] (8). Given that the initial appearance of links in Correa-Díaz’s verse is in a poem portraying “that event horizon where, without witnesses, / all the other galaxies will disappear / into oblivion” (70–1), the “atajos” that Finklestein describes are digital wormholes of sorts. The link, as it manifests in Correa-Díaz’s poetry, is a kind of “codework,” with a strong visual grammar that also includes, of course, the appearance of a YouTube video when the link is clicked or cut and pasted into a web browser. As in Chapter 3’s analysis of Loss Pequeño Glazier’s array poetics—through a Critical Code Studies approach—we might briefly consider the way that a scholar like Mark Marino applies critical hermeneutics to the interpretation of computer code, program architecture, and documentation within a socio-historical context. CCS holds that lines of code are not value-neutral and can be analyzed using the theoretical approaches applied to other semiotic systems in addition to particular interpretive methods developed particularly for the discussions of programs. (“Critical Code Studies”) The html links that Correa-Díaz begins to use in Cosmological Me and more consistently employs in clickable poem@s (2016)—as well as in the forthcoming Impreso en 3D (2018)—thus require more sophisticated analysis here. Clickable poem@s—a print book published by RIL Editores in 2016— is perched on the brink of “the digital” in its very title, since, in truth, the poems are not actually “clickable” (that is, materially localizable at a virtual domain), at least in the quotidian conceptualization of the term. Each poem possesses or contains one or more links to videos (often music videos) that may be accessed in one of two ways: either by retyping the html address into a web browser (on a smartphone, tablet, laptop, or desktop computer), or the reader-user can scan the embedded QR codes that accompany each link. Quick Response codes are, in essence, more sophisticated versions of the ubiquitous barcode found on consumables, since they contain more data than UPC barcodes. They are common in advertising, as they provide for near-instantaneous transfer of

136  Afterword contact information or website opening, for example. In Correa-Díaz’s poetic encryption of URLs through this form of augmented reality, the “clickable” nature of these elements is read and mediated through the necessary use of a QR Reader, an app readily available on both iOS and Android mobile operating systems (and also on larger devices, of course). Correa-Díaz’s literary inspiration for this specific technological intrusion into print poetry was a groundbreaking book titled Between Page and Screen (2012) by Amaranth Borsuk and Brad Bouse, a work that contains “inscrutable black and white geometric patterns that, when coupled with a webcam, conjure the written word.” Borsuk and Bouse’s use of the word “coupled” recalls Humberto Maturana and Francisco Varela’s autopoietic theory, discussed in Chapters 1 and 2 of the present study, but moreover, the required technological extension of the body and the eye most directly evokes media theorist Marshall McLuhan’s famous (yet vague) description of media as “any extension of ourselves” (7). The illegibility of the QR code to human eyes requires the use of a prosthetic techno-apparatus (a smartphone camera or a webcam) to render it readable, which extends human faculties and thereby seeks to compensate for the amputation that results from modernity’s traumas, following the logic of McLuhan’s seminal text. To return to the specificity of clickable poem@s’ “interpenetration” of the print and the digital, in this book Luis Correa-Díaz’s poetry deeply engages the extension of human faculties through techno-futuristic explorations. The thematic range of the elements included in this book moves rapidly from to Andrew Marvell to Mario Brothers’ Princess Peach, from quantum coherence to Whatsapp poetry, from Brad Paisley to Adam ­Zagajewski. The book therefore addresses what Correa-Díaz called “la pantallización de la cultura” [“the screening of culture”] in a recent interview with ­Carolina Gaínza (“Lo más bello sería crear un texto que fuera una especie de realidad virtual, en que se le permitiera al lector entrar en ese mundo del texto y caminar por él con sus pies” [“The most beautiful thing would be to create a text that were a kind of virtual reality, in which the reader could enter into the world of the text and walk through it on foot”]), and takes advantage of a poetics of “reading as multitasking” through prosthetic or “coupled” extensions, enabled by a multitude of potential consumer electronic devices. The techno-poetic “flavor” of Correa-Díaz’s poems is often directed to an absent lover, yet one whose absence is somewhat overcome through technological mediation. For example, in “ið,” he writes: desde que vi esa luz en tus ojos hago cosas curiosas, como, por ejemplo, y me río: acariciar tu breve nombre en el from del e-mail, oigo en cada letra, quiero creer, tu respiración… (22)

Afterword  137 [from the moment I saw that light in your eyes I do curious things, I eat, for example, and I laugh: caressing your short name in the email’s from line, I hear in each letter, I’d like to think, your breath…] Similarly, the reader hears of the mitigation of future absences amongst farewell kisses and a declaration that “«nos skypeamos»” at the “Int. Airport” (49).8 In the apostrophe “O Creator of the Universe,” however, Correa-Díaz draws on an unnamed brain scientist to postulate that: es como si Dios hubiera instalado una antena receptora en nuestro cráneo para sus mensajes…, también, creo podríamos imaginarnos con un software adentro –si ya la imagen no estuviera manida en otras analogías al uso que nos asemejan, sea cierto esto o no, a un computador-…, como si Dios hubiera … … … … … … … [fill in the blank with your own techno-poetic preference] … (42) [it is as if God had installed a receiving antenna for her messages in our head…, also, I think we might be able to imagine ourselves with a kind of software inside –if the image were not already overused in other analogies about our similarities to, were it true or not, a computer-…, as if God had … … … … … … … [fill in the blank with your own techno-poetic preference] …] There is a clear posthuman or cyborg imaginary at play in this technofuturistic postulate—or, as the poet observes in “Monimenta ­autoterapéutica—obviamente con sabor a mí” [“Self-help moniment—­ obviously my way”], some of his work tends towards “una suerte de sf / poetry” [“a kind of sf / poetry] (19). The call for the reader to “fill in the blank / with [one’s] own techno-poetic performance”—when taken in the context of the computerized brain receiving signals from a higher power—is less theistic and more tapped into the collective mind of generative poetics, in a way that evokes Gustavo Romano’s bots “composing” and reciting poetry in the IP Poetry Project (the subject of Chapter 1 of the present study) as well as Mexican poet Eugenio Tisselli’s PAC: Poesía asistida por computadora (www.motorhueso.net/pac/; 2006), among other net.art projects.

138  Afterword From a material standpoint, there is little the reader can do to fill in the blank, with respect to the larger debate regarding the supposed “interactivity” of a print text versus a digital one. The gestures towards transcending the limits of the book—without postulating the disappearance of print, as cited above—reach skyward in the as-yet unpublished “poema-drone,” about which Correa-Díaz stated the following (in an interview with Carolina Gaínza): Ahí yo intento que el poema sea un drone y el drone es un objeto no solamente mecánico, sino que digitalizado, está dirigido de forma satélito-digital. Entonces, esa es la propia experimentación, que no solamente emerge de lo tecnológico digital, sino también de lo tecnológico-científico. [There I try to make the poem into a drone and the drone is an object that is not only mechanical, it is, rather, digitized, it is controlled by digital satellite. That, then, is the experimentation itself, which does not solely emerge from the digital-technological, but also from the scientific-technological.] The idea of “engineering poetic objects” is not new—and Chapters 1 and 4 of Latin American Technopoetics explored several different approaches to very innovative computer, mechanical, and bioengineering poetic objects—­and in the poem he is discussing here, Correa-Díaz offers a call to future poets or future poetry through a reading-­rewriting-hacking of the second Canto from Chilean poet Vicente Huidobro’s Altazor: lanzar he a los aires este poema con la esperanza de que entre mis manos y la altura convertido sea en un drone, huidobriano el gesto, lo admito, un volantín con ojos, sí, para verte mejor, con un estéreo potentísimo para dejarte caer sobre el pelo y en papel picado ese canto II, que ahora reescribo exacto, pensando en tus uñas de pies, confundiendo con ello a ángeles y terrícolas por igual…; cuatro brazos con sus tantas hélices para no dejarte ir jamás de mí [I must launch into the air this poem hoping that between my hands and the skies

Afterword  139 it is changed into a drone, a Huidobrian gesture, I admit it, a kite with eyes, yes, to see you better with a very powerful stereo to release upon your hair in confetti form that second Canto, that I’m now rewriting exactly, thinking of your toenails, alongside it, confusing angels and earthlings all the same…; four arms with their many helices so that you can never leave me] In this remediation of Huidobro’s famous apostrophe, the poetic subject’s arms are the crossed blades of the drone, elevated above terrestrial landscapes and also encircling the loved one’s body; the imagined “kite with eyes” with which to look down upon the object of the poetic subject’s affection also features a “very powerful stereo” with which to serenade the lover. An even more powerful image resides in the techno-remediation present in the book’s eponymous poem, titled “impresos en 3D.” The poet inquires as to how his clickable poem@s would look if printed in 3D (or perhaps even experienced aurally through immersive, noise-cancelling headphones). This love poem goes a step further, as the poetic subject explores the possibility of printing his lover incarnate in the book: pero, sobretodo y por verdadero, si cuando termine ese scanning de solitario de amor no more y viera el resultado encontraría en el preciso lugar de tu nombre una de tus orejas, tus hombros, el diseño maestro de tu nariz, la huella de tus pies en la arena, lágrimas mías en tu ombligo, tus verdes senderos venosos hacia todos los alegres rincones de tu biología… [but, above all and truly, if when that scanning is finished alone from love no more and I were to see the result I would find in the exact place of your name one of your ears, your shoulders, the masterful design of your nose, your footprint in the sand,

140  Afterword my tears in your navel, your venous green paths leading to all of the happy corners of your biology…] Where the poet envisions turning word into “flesh,” he undertakes a kind of techno-poetic rewriting of a famous scene from the late fifteenth century prose work Cárcel de amor. In Diego de San Pedro’s medieval love story, the protagonist, Leriano, first tears up letters from his beloved, Laureola, then dissolves the paper in water, and finally ingests the solution right before his death: Pues tomando de sus dudas lo más seguro, hizo traer una copa de agua, y hechas las cartas pedaços echólas en ella; y acabado esto, mandó que le sentasen en la cama, y sentado, bevióselas en el agua y assí quedó contenta su voluntad. Y llegada ya la ora de su fin, puestos en mí los ojos, dixo: «Acabados son mis males». Y assí quedó su muerte en testimonio de su fe. (149) [Thus gathering that which was most certain from his doubts, he asked for a cup of water, and with the letters torn into shreds, he put them in the cup; after this, he asked them to sit him down on the bed, and after being seated, he drank the shreds up in the water and thus his will was done. And with his final hour upon him, he looked me in the eye, and said: “My troubles are over.” And thus his death was a testament to his faith.9] Correa-Díaz’s enamored protagonist also substitutes paper for flesh, but it is flesh that is not carbon-based, since it is created through a process of “additive manufacturing,” or 3D printing. His silicon lover emerges from the pages of the poem—from the materiality of language—”­completing” the poetic subject and coming to (virtual) life not in the face of death, as was the case in Cárcel de amor. This “word-made-flesh” cyborg lover— characterized as the poetic subject’s “media naranja” [“soulmate”] in the poem “i, the worst of all cyborgs” (from Cosmological Me)—indeed “holds, in just one of her icy kisses, the / chip that would make me work at 100% / capacity” (33). The remediation of this poetic being, in a way, does not take place in the movement from “page to screen”—from palabra or papel to pantalla—but is deeply marked by the way that a highly innovative poet and thinker has situated his challenging work at the interface between the analog and the digital, between the human and posthuman. What this look “backwards” to or through print has attempted to highlight, then, is that with Luis Correa-Díaz, we might locate “the last

Afterword  141 piece…of the standard / model of particle poetry” (“hunt for the higgs”) still in print. Similarly, in poetry by Carlos Cociña and Correa-Díaz, the careful technopoetic reader is consistently reminded that “la necesaria / simetría verbal no es diferente / en nada que la de una bella ecuación” [“the necessary / verbal symmetry is no different / at all from that of a beautiful equation”] (“hunt for the higgs”). Insofar as their scientific technopoetics encompasses and incorporates new forms and modalities in an ostensibly traditional medium—when compared to the poets and artists studied in previous chapters of Latin American Technopoetics, that is—the highly innovative approach to the interpenetration of the print and the digital in Cociña and Correa-Díaz is truly inspiring. Their innovative approach to science and poetry brings to light another experimental current in contemporary Latin American poetics while still firmly anchoring the materiality of (the vast majority of) their literary production in a technology that is over 560 years old.

Notes 1 An earlier version of my reading of Carlos Cociña’s poetry appeared as the introduction to an anthology of his work, titled Poesía cero (Santiago: ­Descontexto, 2017). 2 All translations from Carlos Cociña’s poetry are my own. 3 My translation. From Momentary Flows (in Astrolabe, from State of Siege, 1995). 4 My translation. 5 There is a long tradition of poetic appropriation in Chilean literature. Of particular note are Eduardo “Chico” Molina’s infamous public reading of a text presumed to be his own (but which turned out to be a translation of a chapter from Herman Hesse’s Demain (1945) and the posthumous publication of Juan Luis Martínez’s Poemas del otro [The Other’s Poems], which, as I discovered, was composed of unattributed translations of poems written by a Swiss-Catalan poet also named Juan Luis Martinez (without an accent mark). For more on this fascinating case of literary appropriation, see my books La última broma de Juan Luis Martínez: No sólo ser otro sino escribir la obra de otro (Cuarto Propio, 2014) and Juan Luis Martínez’s Philosophical Poetics (Bucknell UP, 2014), as well as a number of articles I have written on the topic, as the literary detective story developed over several years. 6 My translation. 7 The first edition of Cosmological Me is bilingual, with translations by Heather Cleary. All other translations from Luis Correa-Díaz are my own. 8 In Correa-Díaz’s forthcoming book Impresos en 3D, the poem “hummingbird.we” describes a romance initiated through Whatsapp exchanges (rather than via the traditional topos of love letters). 9 My translation.

Works Cited

Ahluwalia, Kavita B. Genetics. Delhi: New Age International, 2009. ProQuest ebrary. Web. 18 November 2015. Albright, Daniel. Quantum Poetics: Yeats, Eliot, Pound and the Science of Modernism. Cambridge: Cambridge University Press, 1997. Armantrout, Rae. “Metaphor or More?” Dossier Like a Metaphor: O ­ ngoing Relations between ‘Poetry’ and ‘Science.’ Ed. Gilbert Adair. March 13, 2012. ­Accessed January 4, 2017. . Bök, Christian. Interviewed by Stephen Ross. Wave Composition. June 5, 2011. Accessed January 4, 2017. . ———. “The Piecemeal Bard is Deconstructed: Notes Toward a Potential Robopoetics”. Object 10. Accessed January 4, 2017. . Bolter, J. David and Richard Grusin. Remediation: Understanding New Media. Cambridge, MA: MIT Press, 1999. Brown, J. Andrew. Cyborgs in Latin America. New York: Palgrave, 2010. Burns, Russell W. Communications: An International History of the Formative Years. London: The Institution of Engineering and Technology, 2004. Buzzettie, Dino and Jerome McGann. “Electronic Textual Editing: Critical ­E diting in a Digital Horizon.” Text Encoding Initiative. Accessed January 4, 2017. . Calvino, Italo. “Cybernetics and Ghosts.” The Uses of Literature. Trans. P ­ atrick Creagh. New York: Harcourt Brace Jovanovich, 1986. De Campos, Augusto. “Concrete Poetry: A Manifesto.” Originally published in ad – arquitectura e decoração 20 (November/December 1956). Trans. John Tolman. Accessed January 4, 2017. . Catanzano, Amy. “Excerpt from Quantum Poetics: Writing the Speed of Light.” Poems and Poetics: Blog of Jerome Rothenberg. January 3, 2012. Accessed January 4, 2017. . ———. “Metaphor or More?” Dossier Like a Metaphor: Ongoing ­Relations between ‘Poetry’ and ‘Science.’ Ed. Gilbert Adair. Jacket2. March 13, 2012. Accessed January 4, 2017. .

144  Works Cited Cayley, John. “The Code is not the Text (Unless it is the Text).” Electronic Book Review. September 10, 2002. Accessed January 4, 2017. . ———. “Science-Informed Readings.” Dossier “Like a Metaphor: O ­ ngoing Relations between ‘Poetry’ and ‘Science.’ Ed. Gilbert Adair. Jacket2. March 13, 2012. Accessed January 4, 2017. . Chalfie, Martin. “GFP: Light up My Life.” Nobel Prize Lecture, 2008. ­Accessed March 30, 2016. . Chamberlain, William. “Racter”. The UbuWeb Anthology of Conceptual ­Writing. Ed. Craig Dworkin. February 1, 2014. Accessed January 4, 2017. . Clarke, Bruce and Mark Hansen. Emergence and Embodiment: New Essays on Second-Order Systems Theory. Durham, NC: Duke University Press, 2009. Cociña, Carlos. Poesía cero. Santiago: Descontexto, 2017. The Complete I Ching. Ed. and trans. Alfred Huang. Rochester, VT: Inner ­Traditions International, 2004. ———. “Poesía cero”. Homepage of Carlos Cociña. www.poesiacero.cl. Accessed December 15, 2017. . Correa-Díaz, Luis. clickable poem@s. Santiago: RIL Editores, 2016. ———. Cosmological Me. 1st ed. Buenos Aires: El fin de la noche, 2010; 2nd ed. Clayton, GA: Valparaiso Editions-USA, 2017. ———. “La poesía cibernética latinoamericana (todavía) in print: un recorrido desde los años 50 y 60 hasta finales de la primera década del 2000”. New Readings 13 (2013): 57–73. ———. Impresos en 3D. Intro. María Angeles Pérez López. Granada: Valparaíso Ediciones, 2018. Correa-Díaz, Luis and Scott Weintraub. “Literatura latinoamericana, española, y portuguesa en la era digital (nuevas tecnologías y lo literario)”. Arizona Journal of Hispanic Cultural Studies 14 (2010): 149–55. ———. ed. Poéticas y poesías digitales/electrónicas/tecnos/New-Media en América Latina: Definiciones y exploraciones. Bogotá: Ediciones Universidad Central, 2016. Dale, Jeremy W. and Simon F. Park. Molecular Genetics of Bacteria. 5th ed. Hoboken, NJ: Wiley-Blackwell, 2010. Derrida, Jacques. Margins of Philosophy. Trans. Alan Bass. Chicago, IL: ­ University of Chicago Press, 1984. Dixon, Steve and Barry Smith. Digital Performance: New Technologies in ­Theatre, Dance, Performance Art and Installation. Cambridge, MA: MIT Press, 2006. Drucker, Johanna. SpecLab: Digital Aesthetics and Projects in Speculative Computing. Chicago, IL: University of Chicago Press, 2009. Fernández Mallo, Agustín. Postpoesía: Hacia un nuevo paradigma. Barcelona: Anagrama, 2009. “Fifty Questions for Eduardo Kac: An Interview.” Interview by Dominique ­Moulon. Eduardo Kac: Life, Light & Language/Eduardo Kac: La vie, la lumière & le ­langage. Enghien les-Bains, France: Enghien-les-Bains Art ­Center, 2011.

Works Cited  145 Fitzpatrick, Kathleen. “The Humanities, Done Digitally.” Debates in the Digital Humanities. Ed. M. K. Gold. Minneapolis: University of Minnesota Press, 2012. 12–15. Flanagan, Mary and Austin Booth, eds. Re: Skin. Cambridge, MA: MIT Press, 2005. ProQuest ebrary. Web. 19 October 2015. Fletcher, Heather. “Literatura cibercreativa: ¿qué lugar tendrán los tecnotextos en el futuro de las Humanidades? (El caso de Gustavo Romano y su proyecto de poesía IP)”. Arizona Journal of Hispanic Cultural Studies 14 (2010 [2011]): 335–48. ———. “El potencial literario: una perspectiva sobre dos proyectos digitales de Findelmundo.com.ar.” MA Thesis, The University of Georgia, 2011. Flores, Leo. “Digital Poetry.” The Johns Hopkins Guide to Digital Media. Eds. Marie-Laure Ryan, Lori Emerson, and Benjamin J. Robertson. Baltimore, MD: The Johns Hopkins University Press, 2014. 155–61. ———. “A Shifting Electronic Text: Close Reading White-Faced Bromeliads on 20 Hectares.” Emerging Language Practices 2, 2012. Accessed March 30, 2016. . Flusser, Vilém. Does Writing Have a Future? Intro. Mark Poster. Trans. Nancy Ann Roth. Minneapolis: University of Minnesota Press, 2011. Gache, Belén. Escrituras nómades. Gijón: Ediciones Trea, 2006. ———. “IP POETRY Y LOS ROBOTS PARLANTES: El hombre como máquina parlante y la sociedad como máquina”. IP Poetry. Badajoz: MEIAC (Museo Extremeño e Iberoamericano de Arte Contemporáneo), 2008. The IP Poetry Project. PDF. Accessed January 4, 2017. . Gaínza, Carolina. “Literatura chilena en digital: mapas, estéticas, y conceptualizaciones”. Revista chilena de literatura 94 (diciembre 2016): 233–56. ———. “Lo más bello sería crear un texto que fuera una especie de realidad virtual, en que se le permitiera al lector entrar en ese mundo del texto y caminar por él con sus pies”. Interview with Luis Correa-Díaz (abril 2017). Glazier, Loss Pequeño. Digital Poetics: The Making of E-Poetries. Tuscaloosa: University of Alabama Press, 2002. ———. Four Guillemets. Electronic Poetry Center. 2012. Accessed January 4, 2017. . ———. “Stringing Disturbances in Poetic Array Spaces: Reading by Close Reading.” Remediating the Social. Ed. Simon Biggs. Bergen: University of Bergen: ELMCIP, 2012. ———. White-Faced Bromeliads on 20 Hectares. Electronic Poetry ­Center. 1999. Accessed January 4, 2017. . Gold, Matthew K. and Lauren F. Klein, ed. Debates in the Digital Humanities. Minneapolis: University of Minnesota Press, 2012. Accessed January 4, 2017. . Goldsmith, Kenneth. Uncreative Writing: Managing Language in the Digital Age. New York: Columbia University Press, 2011. Gordon, Eric and Adriana de Souza e Silva. Net Locality: Why Location ­M atters in a Networked World. Chichester: Wiley-Blackwell, 2011. Goytisolo, Juan. El sitio de los sitios. Barcelona: Seix Barral, 2002. Gray, Christopher, ed. The Cyborg Handbook. New York: Routledge, 1995.

146  Works Cited Greene, Roland, ed. “Early Visual Poetry.” The Harvard Library Bulletin ­“Material Poetry of the Renaissance/The Renaissance of Material Poetry” 3.2 (Summer 1992). Ubuweb. Accessed January 4, 2017. . Haraway, Donna. “A Cyborg Manifesto: Science, Technology, and ­SocialistFeminism in the Late Twentieth Century.” Simians, Cyborgs and Women: The Reinvention of Nature. New York: Routledge, 1991. 149–81. Hayles, N. Katherine. Chaos Bound: Orderly Disorder in Contemporary ­Literature and Science. Ithaca, NY: Cornell University Press, 1990. ———. Electronic Literature: New Horizons for the Literary. Notre Dame, IN: University of Notre Dame Press, 2008. ———. How We Became Posthuman: Virtual Bodies in Cybernetics, Literature, and Informatics. Chicago, IL: University of Chicago Press, 1999. ———. My Mother Was a Computer: Digital Subjects and Literary Texts. ­Chicago, IL: University of Chicago Press, 2005. Heisenberg, Werner. Physics and Philosophy. Intro. Paul Davies. London: ­Penguin, 2000. Accessed March 30, 2016. . Huidobro, Vicente. Altazor; Temblor de cielo. Ed. René de Costa. Madrid: Cátedra, 2006. Hunt, David. “Eduardo Kac: Metaphor into Motif.” Accessed January 4, 2017. . “I ♥E-Poetry.” Leonardo Flores, University of Puerto Rico-Mayagüez. Accessed January 4, 2017. . Jones, Amelia. Body Art: Performing the Subject. Minneapolis: University of Minnesota Press, 1998. Cited in Bernadette Wegenstein. “Making Room for the Body: From Fragmentation to Mediation.” Joron, Andrew. “Magical Correspondences, Part 1 of 6.” Dossier Like a Metaphor: Ongoing Relations between ‘Poetry’ and ‘Science’. Ed. Gilbert Adair. Jacket2. Accessed January 4, 2017. . Kac, Eduardo. “A Positive.” Accessed January 4, 2017. . ———. “Art at the Biobotic Frontier.” Accessed January 4, 2017. . ———. “Art at the Biological Frontier.” Accessed January 4, 2017. . ———. “DNA Mixer.” Accessed January 4, 2017. . ———. “Genesis.” Accessed January 4, 2017. . ———. “Genesis translated.” Accessed January 4, 2017. . ———. “GFP Bunny.” Accessed January 4, 2017. . ———. Home page. Accessed January 4, 2017. . ———. “Natural History of the Enigma.” Accessed January 4, 2017. .

Works Cited  147 ———. “Negotiating Meaning: The Dialogic Imagination in Electronic Art.” Telepresence & Bio Art: Networking Humans, Rabbits, & Robots. Ann ­A rbor: University of Michigan Press, 2004. ———. “Rara avis.” Accessed January 4, 2017. . ———. “Time Capsule.” Accessed January 4, 2017. . ———. “Transgenic Art Online.” Data Made Flesh: Embodying Information. Ed. and intro. Phillip Thurtle and Robert Mitchell. London: Routledge, 2004. ———. “Transgenic Art.” Accessed January 4, 2017. . ———. “Works from the Genesis Series, 2001,” Accessed January 4, 2017. . Kirschenbaum, Matthew. “What is Digital Humanities and What is it Doing in English Departments?” Debates in the Digital Humanities. Ed. Matthew K. Gold. Minneapolis: University of Minnesota Press, 2012. Kozak, Claudia, ed. Tecnopoéticas argentinas: archivo blando de arte y tecnología. Buenos Aires: Caja Negra, 2012. Latour, Bruno. “How to Be Iconophilic in Art, Science, and Religion?” Picturing Science, Producing Art. Ed. Catherine A. Jones and Peter Gaison. ­London: Routledge, 1998. 414–40. Levine, George Lewis, ed. Realism and Representation: Essays on the Problem of Realism in Relation to Science, Literature, and Culture. Madison: ­University of Wisconsin Press, 1993. LeWitt, Sol. “Sentences on Conceptual Art.” First published in 0–9 (New York), 1969, and Art Language (England), May 1969. Accessed January 4, 2017. . Liu, Alan. “The Meaning of the Digital Humanities.” PMLA 128 (2013): 409–23. Lucie-Smith, Edward. “Eduardo Kac and Transgenic Art.” The Eighth Day: The Transgenic Art of Eduardo Kac. Eds. Sheilah Britton and Dan Collins. Phoenix: The Institute for Studies in the Arts, Arizona State University, 2003. Marino, Mark. “Critical Code Studies.” Electronic Book Review. 2006. Accessed January 4, 2017. . Martín-Barbero, Jesús. “Art/Communication/Technicity at Century’s End.” Trans. Hugh O’Donnell. Cultural Politics in Latin America. Ed. A. B. Jones and R. Munck. Basingstoke: Macmillan, 2000, 56–73. Mathews, Harry and Alastair Brotchie, ed. Oulipo Compendium. London: Atlas Press, 1998. Maturana, Humberto. “The Organization of the Living: A Theory of the ­Living Organization.” International Journal of Man-Machine Studies 7 (1975): 313–32. Maturana, Humberto and Francisco Varela. Autopoiesis and Cognition: The Realization of the Living. Boston, MA: D. Reidel Pub. Co., 1980 [1973]. ———. De máquinas y seres vivos: la organización de lo vivo. Santiago: ­E ditorial Universitaria, 1972. ———. The Tree of Knowledge: The Biological Roots of Human Understanding. Boston, MA: Shambala, 1987.

148  Works Cited McGann, Jerome. Radiant Textuality: Literature after the World Wide Web. New York: Palgrave, 2004. ———. “Texts in N-Dimensions and Interpretation in a New Key.” TEXT ­Technology 2 (2003). Accessed January 4, 2017. . McLuhan, Marshall. Understanding Media: The Extension of Man. New York: New American Library, Times Mirror, 1964. McLuhan, Marshall and Quentin Fiore. The Medium is the Massage: An ­Inventory of Effects. Prod. Jerome Agel. Berkeley, CA: Gingko Press, 2001. MediaLabMadrid. 2010. Accessed January 4, 2017. . “metaphor, n.” OED Online. Oxford University Press, February 2016. Web. 3 February 2016. Miller, Sean. “Imagining Braneworlds in String Theory Technical Discourse.” Discourse 29.1 (Winter 2007): 77–100. Mingers, John. Self-Producing Systems: Implications and Applications of ­Autopoiesis. New York: Plenum Press, 1995. Mitchell, W. J. T. “The Work of Art in the Age of Biocybernetic Reproduction.” Modernism/Modernity 10.3 (September 2003): 481–500. Montfort, Nick (@nickmofo). “Actually there Are 1017 Possible Sonnets of Queneau’s. You Can Choose Which of 10 Blank Lines You Want in 3 Slots.” March 14, 2015, 9:12 a.m. Tweet. Motte, Warren, trans. and ed. Oulipo: A Primer of Potential Literature. ­Champaign, IL: Dalkey Archive Press, 2007. “NETescopio”. Museo Extremeño e Iberoamericano de Arte Contemporáneo de Badajoz, España (MEIAC). Accessed January 4, 2017. . “The Nobel Prize in Chemistry 2008 - Press Release.” Nobelprize.org. Nobel Media AB 2014. Web. Accessed January 4, 2017. . Ortiz, Santiago. “Árboles de textos: el lenguaje vivo, el lenguaje vida. un caligrama autogenerativo y fractal”. 2005. Accessed January 4, 2017. . ———. “arte: la mínima letra”. a mínima 11 (2005). Accessed January 4, 2017. . ———. “bacterias argentinas”. 2004. Accessed January 4, 2017. . ———. “De la relación a la invención”. Historia natural (2004). Accessed ­January 4, 2017. . ———. “esferas: superficies esféricas de diálogo”. 2005. Accessed January 4, 2017. . ———. “gramatrama”. 2005. Accessed January 4, 2017. . ———. “Narrativa, vida, arte y código”. Artnodes (julio 2005). Accessed March 30, 2016. . ———. Página personal (versión en español). 2006. Accessed January 4, 2017. . ———. “palindromedario”. 2004. Accessed January 4, 2017. . ———. “redes metaconcientes”. a mínima 13 (2005). Accessed March 30, 2016. .

Works Cited  149 Queneau, Raymond. “Potential Literature.” Oulipo: A Primer of Potential ­Literature. Ed. Warren F. Motte. Champaign, IL: Dalkey Archive Press, 1998. Ramsay, Stephen. “On Building.” Accessed January 4, 2017. . ———. “Who’s in and Who’s out.” Accessed January 4, 2017. . Rivero, Alicia. “Heisenberg’s Uncertainty Principle in Contemporary Spanish American Fiction.” Science and the Creative Imagination in Latin America. Ed. Evelyn Fishburn and Eduardo L. Ortiz. London: Institute for the Study of the Americas, 2005. 129–50. Romano, Gustavo. IP Poetry. Badajoz, Extremadura: MEIAC (Museo ­Extremeño e Iberoamericano de Arte Contemporáneo), 2008. The IP Poetry Project. PDF. February 1, 2014. . ———. The IP Poetry Project. Accessed January 4, 2017. . Roubaud, Jacques. “Mathematics in the Method of Raymond Queneau.” ­O ulipo: A Primer of Potential Literature. Ed. Warren F. Motte. Champaign, IL: Dalkey Archive Press, 1998. San Pedro, Diego de. Cárcel de amor. Arnalte y Lucenda. Sermón. Ed. José Francisco Ruiz Casanova. Madrid: Cátedra, 1995. Schrodinger, Edwin. “The Present Situation in Quantum Mechanics.” Trans. John D. Trimmer. Originally appeared in Quantum Theory and Measurement. Ed. J. A. Wheeler and W. H. Zurek. Princeton, NJ: Princeton ­University Press, 1983. Accessed January 4, 2017. . ———. “What is Life?” Accessed March 30, 2016. . Strickland, Stephanie. “Born Digital.” 2009. Accessed January 4, 2017. . ———. “Quantum Poetics: Six Thoughts.” Media Poetry: An International Anthology. Ed. Eduardo Kac. Chicago, IL: Intellect Books, 2007. Taylor, Claire. Place and Politics in Latin American Digital Culture: Location and Latin American Net Art. London: Routledge, 2014. Taylor, Claire and Thea Pitman. Latin American Identity in Online Cultural Production. London: Routledge, 2013. Tiffany, Daniel. Toy Medium: Materialism and Modern Lyric. Berkeley: ­University of California Press, 2000. Thurtle, Phillip and Robert Mitchell, ed. and intro. Data Made Flesh: ­Embodying Information. London: Routledge, 2004. Tomasula, Steve. “GENE(SIS).” Data Made Flesh: Embodying Information. Ed. and intro. Phillip Thurtle and Robert Mitchell. London: Routledge, 2004. 249–57. “translation, n.” OED Online. Oxford University Press, December 2015. Web. 23 December 2015. Wegenstein, Bernadette. “Making Room for the Body: From Fragmentation to Mediation.” Re: Skin. Ed. Mary Flanagan and Austin Booth. Cambridge, MA: MIT Press, 2005. ProQuest ebrary. Web. 19 October 2015. Weintraub, Scott. “Autopoiesis y robopoética en el IP Poetry Project de Gustavo Romano.” In Poéticas y poesías digitales/electrónicas/tecnos/New-Media en América Latina: Definiciones y exploraciones. Ed. Luis Correa-Díaz and Scott Weintraub. Bogotá: Ediciones Universidad Central, 2016.

150  Works Cited ———. “Combinatoria, filogenética lingüística, redes de la complejidad científica: Especulaciones sobre los trabajos digitales interactivos de Santiago ­Ortiz.” Arizona Journal of Hispanic Cultural Studies 14 (2010): 299–319. “wetware, n.” OED Online. Oxford University Press, December 2015. Web. 23 December 2015. Whitaker, Randall. The Observer Web: Autopoiesis and Enaction. Accessed January 4, 2017. . Wittgenstein, Ludwig. Philosophical Investigations. Trans. G. E. M. Anscombe. Malden, MA: Blackwell, 2002 [1953]. ———. Tractatus Logico-Philosophicus. Trans. D. F. Pears and B. F. McGuinness. Intro. Bertrand Russell. New York: Routledge Classics, 2001 [1922]. Wolfe, Cary. What is Posthumanism? Minneapolis: Minnesota University Press, 2009.

Index

A Positive 12, 89, 93–95 Aarseth, Espen 15, 67–8 appropriation, poetic 8, 125, 129, 131, 141 “Árboles de textos” [“Textual Trees”] 11, 39–46, 68 Armantrout, Rae 8, 9 avant-garde/Modernism 6, 15, 16, 130 autopoiesis 10, 11, 12, 18–35, 54–63 “bacterias argentinas” [“Argentine bacteria”] 12, 37, 54–63, 70 Bible, The 97, 103–4 biocybernetic reproducibility 89–90, 93, 94–5, 101, 105, 108, 114 biological phylogenetics 52, 64 Bolter, Jay David 15, 40; see also remediation Borges, Jorge Luis 50, 86, 127 born-digital 3–4 Bök, Christian 1, 17, 22, 30–1 caligram 42–3 Calvino, Italo 17–8, 25, 32, 42 Catanzano, Amy 9, 87 Cayley, John 82, 86, 87, 96 Cociña, Carlos 125–132 cognitive science 4, 5, 11, 21–2, 27, 28–9, 54, 61, 63 concrete poetry 3, 6, 42, 84, 86 constructivism 38, 92 Correa-Díaz, Luis 125, 132–141 Critical Code Studies 76, 135 cybernetics 20, 32, 54 cyborg 27, 29–30, 35, 94, 95, 137, 140 Dawkins, Richard 52, 69 “design as a form of mediation” 13, 15, 46, 65, 102–3

dialogical aesthetics 90, 93, 95, 96, 111 digital humanities 2, 6–8, 15, 37–9, 67, 102–3, 119 digital poetry 1–6, 31, 73, 130, 132–3, 138; see also electronic literature, e-poetry, technopoetry Drucker, Joanna 11, 13, 37–9, 46, 51, 54, 66, 67, 102; see also speculative computing Einstein, Albert 77–9 electronic poetry (e-poetry) 3–6, 15, 31, 103, 113, 132–3; see also digital poetry, electronic literature, technopoetry “esferas” [“spheres”] 46–53 evolution 52, 63–4, 69 feedback loops 4–5, 16, 17, 23, 51, 57, 122 Fernández Mallo, Agustín 10 Flash (ActionScript) 40, 43, 68 Fletcher, Heather 27, 35 Flores, Leonardo 5, 35, 75–6, 87 Four Guillemets 12, 82–7 fractals 41–2, 68, 134 Funkhouser, Christopher 68, 132–3 Gache, Belén 11, 14, 22, 29–31, 32, 84, 88 “Genesis” 89–90, 95–114, 115–7 genetics 16, 49–50, 52–3, 54–65, 89–90, 92, 98–114 “GFP Bunny” 95, 111, 115, 116 Glazier, Loss Pequeño 5–6, 12, 15, 16, 71–88

152 Index Goldsmith, Kenneth 17, 31 Gödel, Kurt 39, 67 Grusin, Richard 40; see also remediation Hayles, N. Katherine 3–5, 8, 13, 15, 16, 20–1, 32, 33, 41, 103–4, 134 Heisenberg, Werner 9, 78 holopoetry 3, 115 Huidobro, Vicente 42, 130, 132, 138, 139 hypertext 3, 15, 67–8, 103; see also George Landow installation art 10, 18, 22–3, 24, 69–70, 91, 96, 111–2, 121–3 interactivity 31–2, 39, 50, 68, 69, 90–1, 138 Io Sono at Swoons 81, 88 IP Poetry Project 10–11, 17–35, 121–3 Kac, Eduardo 12–3, 16, 89–117, 119 Kozak, Claudia 2–3 language as a complex system 41, 101–2 Landow, George 15, 68–9 Laüfer, Milton 32 linguistics 52, 55 linguistic phylogenetics 51–3, 55, 63–4 Liu, Alan 8 Luhmann, Niklas 32 machine learning 27–9, 34–5 Martín-Barbero, Jesús 119–20 Martínez, Juan Luis 141 Maturana, Humberto 11, 19–22, 28–31, 32–3, 54, 60–1, 63, 136 McGann, Jerome 38–9, 103 memetic theory 52–3 memory 10, 18, 91–2, 95, 122 metaphor 8–9, 47, 54, 57–8, 62, 64, 72, 80, 82, 101–2, 105, 123 Miller, Sean 16, 118–9 Mingers, John 61, 63 Mitchell, W. J. T. 89–90, 95, 115 Morse Code 97–105, 107, 113, 115, 116, 117

networks 4, 16, 17, 20, 28, 46–65, 70, 92–5 neoliberalism 57, 121 Ortiz, Santiago 11–2, 36–70 Oulipo (Ourvoir de littérature potentielle) 42, 75 paradigm shift 18, 72, 77, 89, 108 phenomenology 28, 92–5 Pitman, Thea 13, 14, 120–1 poesis, poiesis 6, 19, 32–3 polysemy 53, 107, 113 posthumanism 66, 89–90 postregional cultural practices 13, 14, 70, 121 QR code 125, 135–6 quantum physics 8–10, 12, 71–88, 129; Copenhagen interpretation 77–78, 129 quantum poetics 8–10, 12, 71–88, 129 remediation 40, 42–3, 45–6, 86, 126, 131, 139, 140; see also design as mediation robot 17–35, 91, 93, 121–3 Romano, Gustavo 10–2, 17–35, 121–3 Science and Technology Studies 7–8 Schrödinger, Edwin 78–9, 104–5 scientific imaginaries 9–10, 96, 118–9 skin, poetics of 89–95 speculative computing 11, 37–9, 54, 102 Strickland, Stephanie 3–4, 71–3, 86–7 systems theory 11, 19–22, 28, 32, 61–3 Taylor, Claire 13, 14, 120–1 technopoetry 2–8, 13–14, 35, 120–1 telematic art 16, 89–95 “Time Capsule” 89–95 transgenic art 16, 89–90, 95–117 transcription (cell biology) 98–99, 106, 109–10, 113, 129 translation (language and literature) 95–117, 119 Turing, Alan 39

Index  153 “two cultures” argument (C. P. Snow) 118 Varela, Fransisco 11, 19–22, 28–31, 32–3, 54, 60–1, 63, 136 virus 50, 106 Watson and Crick 104, 115 Wegenstein, Bernadette 92–4

wetware 89, 95 Whitaker, Randall 22, 32 White-Faced Bromeliads on 20 Hectares 12, 73–82, 87 Wittgenstein, Ludwig 46, 126–7, 132 Wolfe, Cary 90, 115 YouTube 125, 134–5