Genetic Engineering: A Primer [1 ed.] 9781466577619, 9780415300070, 9781420055863, 9789057026324, 9780429102233, 9781134421794, 9780429528101, 9780429542800, 9780203305102, 9780367454906

Table of contents :

Building Blocks of Living Things. Matter and Living Things. Proteins. Nucleic Acid. How Living Things are Changed. Making and Altering Proteins. Altering Genetic Material in Bacteria. Genetically Engineering Bacteria. Viruses. Making Genetic Changes in Plants and Animals. Placing New Genes in Mammalian Cells. Genetic Engineering of Plants. Embryo Transfers and Cloning of Animals. How Genetic Engineering Helps Us. Gene Therapy and Disease. Other Applications for Gene Therapy. Biotechnology, Safety, and the Future. Glossary. Appendix.

Citation preview

Genetic Engineering

Genetic Engineering A Primer

Walter E. Hill The University of Montana Missoula, Montana, USA

Boca Raton London New York

CRC Press is an imprint of the Taylor & Francis Group, an informa business

A TA Y L O R & F R A N C I S B O O K

First published 2000 by Overseas Publishers Association This edition first published 2002 by Taylor & Francis Published 2019 by CRC Press Taylor & Francis Group 6000 Broken Sound Parkway NW, Suite 300 Boca Raton, FL 33487-2742 © 2002 by Taylor & Francis Group, LLC CRC Press is an imprint of Taylor & Francis Group, an Informa business No claim to original U.S. Government works ISBN 13: 978-0-41S-30007-0 (hbk) This book contains information obtained from authentic and highly regarded sources. Reasonable efforts have been made to publish reliable data and information, but the author and publisher cannot assume responsibility for the validity of all materials or the consequences of their use. The authors and publishers have attempted to trace the copyright holders of all material reproduced in this publication and apologize to copyright holders if permission to publish in this form has not been obtained. If any copyright material has not been acknowledged please write and let us know so we may rectify in any future reprint. Except as permitted under U.S. Copyright Law, no part of this book may be reprinted, reproduced, transmitted, or utilized in any form by any electronic, mechanical, or other means, now known or hereafter invented, including photocopying, microfilming, and recording, or in any information storage or retrieval system, without written permission from the publishers. For permission to photocopy or use material electronically from this work, please access www.copyright.com (http://www.copyright.com/) or contact the Copyright Clearance Center, Inc. (CCC), 222 Rosewood Drive, Danvers, MA 01923, 978-750-8400. CCC is a not-for-profit organization that provides licenses and registration for a variety of users. For organizations that have been granted a photocopy license by the CCC, a separate system of payment has been arranged.

Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used only for identification and explanation without intent to infringe.

Visit the Taylor & Francis Web site at http://www.taylorandfrancis.com and the CRC Press Web site at http://www.crcpress.com Every effort has been made to ensure that the advice and information in this book is true and accurate at the time of going to press. However, neither the publisher nor the authors can accept any legal responsibility or liability for any errors or omissions that may be made. In the case of drug administration, any medical procedure or the use of technical equipment mentioned within this book, you are strongly advised to consult the manufacturer's guidelines.

British Library Cataloguing in Publication Data

A catalogue record for this book is available from the British Library

Front Cover. Figure 3.8 DNA Replication

To m y w ife

Annette

and m y c h ild re n

CONTENTS

Preface

ix

Acknowledgm ents

xi

I

BUILDING BLOCKS OF LIVING THINGS 1 M atter and Living Things

3

2 Proteins

19

3 Nucleic Acids

34

II

HOW LIVING THINGS ARE CHANGED

4 M aking and Altering Proteins

59

5 Altering Genetic M aterial in B acteria

82

6 Genetically Engineering B acteria

103

7 Viruses

124

III MAKING GENETIC CHANGES IN PLANTS AND ANIMALS 8 Placing New Genes in M am m alian Cells

139

9 Genetic E ngineering of Plants

158

10 Em bryo Transfers and Cloning of Animals

173

viii IV

C ontents HOW GENETIC ENGINEERING HELPS US

11 Gene Therapy and Disease

187

12 O ther Applications for Gene Therapy

203

13 Biotechnology, Safety, and the F uture

219

G lossary

231

A ppendix

248

Index

252

About The Author

264

PREFACE

I w rote this book to help you appreciate the trem en d o u s pow er and potential th at is at our doorstep in the area of genetic engineering. I have started w ith som e very basic concepts so th a t we can keep on the sam e footing throughout the book. My idea is to share my awe and delight in the trem endous advances th at have been m ade in the biological sciences, w hich now allow us to transform living things. We have been show n fictitious accounts in books, movies, and television in w hich scientists have done som e bizarre things. Can we really recreate d inosaurs from th e ir ancestral blood? Can we clone replicas of fam ous people? Can we m ake tom atoes th a t can be picked ripe, b u t not soften on the grocery shelves? Can we cure genetic diseases by gene therapy? W hat are the p o tential h azards involved in these possibilities? These and sim ilar questions are issues th at we w ant to deal w ith in this book. I purposely designed this book to help those w ith little scientific background becom e conversant w ith the area g enerally called genetic engineering—the changing of the genetic inform atio n of living organism s by design. To u n d e rsta n d genetic engineering, we need to understand some of the living processes and the natu ral changes th at can and do take place. Just a little over 50 years ago, DNA was found to be the carrier of genetic inform ation. Before long it was u n d ersto o d how the in form ation was stored, coded, transferred, and tra n sla ted into living things. All the inform ation necessary to m ake an individual is contained in the DNA found in the original fertilized cell.

X

Preface

However, m any m echanism s exist by w hich portions of the DNA are tu rn e d on and off at specific tim es. This regulation controls the expression of genetic in fo rm atio n and is critical to o u r well-being. So we m ust learn m ore a b o u t DNA and the genes w ithin it to find out how to m odify it. We sta rt by looking at the chem ical m akeup of genes and proteins and w hat m akes them different or sim ilar. We th en study how genes are m ade and how proteins are m ade. Then, we are ready to learn how changes can be introduced into the genes. By m aking changes in the gene, im p o rtan t changes can then be m ade in the p lan t or anim al. B ut how can we alter genes? Genes are too sm all to see, except u n d e r the m ost pow erful m agnification. How do we cut them and insert different in fo rm ation into them . How do we m ake sure th at this inform ation is used at the rig h t tim e late r on? How can we ensure th a t faulty changes don't occur? The overriding challenge in m odem genetic engineering is to solve these problem s. In this way, it is hoped th at som e of the genetic m alfunctions th a t h u rt m ankind can be reversed. T here are definite lim its to the kind of changes th at can be m ad e ...a n d w here they can be m ade. We will discuss these in light of scientific lim itations as well as ethical and m oral im plications. We will also look at the potential for the future and the im pact th at all of these genetic engineering changes will have on our lives. I have placed key term s in bold-faced type to em phasize them . The glossary defines these term s m ore fully and allows you to define m ore clearly som e of these unusual term s. I have tried to include only th a t w hich is essential so as not to drow n you...only quench your thirst.

ACKNOWLEDGMENTS

I am indebted to a w hole host of individuals, w ho have tra in ed and n u rtu re d m e in the ways of science. To bo th professors and graduate students, I give my thanks. And special thanks to my editors, Alison Kelley and Sally Cheney, w ho have been p a tie n t and helpful beyond m easure.

I

BUILDING BLOCKS O F LIVING THINGS

1 MATTER AND LIVING THINGS WHAT YOU WILL LEARN IN THIS CHAPTER

• • • •

The attributes of a cell W hat living things are com posed of How elem ents and m olecules are bound together The kinds of biological m olecules

It takes little m ore th a n in tu itio n for us to tell w hen som ething is alive; yet, trying to define w hat life is can get very difficult. Is Is Is Is

a tree alive? a rock alive? w ater alive? a cell alive?

Let's take a living cell ap art and look at each part. Is the nucleus alive? Is the DNA [deoxyribonucleic acid] alive? Is the cell m em brane alive? So, w hat is life? Every substance is m ade up of the basic elem ents th a t are p resent a ro u n d us. Yet, clearly, elem ents are not alive, nor are m any of the substances that they make. A lthough it is difficult to define living things exactly, we can list characteristics th a t are found in all living things. The list 3

Genetic Engineering

4

m ay be quite long, b u t for o u r purposes, we will use four m ain characteristics to define living things. C haracteristics of Living O rganism s 1. 2. 3. 4.

Have structure or shape Can m ake and break dow n m olecules Can transform energy Can reproduce them selves

LIVING THINGS

To be defined as a living organism , the organism m u st m eet all four of the following criteria (see box). 1. 2. 3.

4.

Living organism s have structure or shape. M any of the stru c tu ra l features are due to special proteins th at have been m ade by the cells for th at very purpose. Living organism s can m ake and break dow n com p licated m o lecu les. This process is often directed by specialized proteins called enzym es. Living organism s tran sform en ergy from one form to another. They receive energy in the form of sunlight, food, and heat and change it into o th er form s, such as chem ical energy or m otion, w hich are m ore useful to the organism . Living things rep rod u ce th em selves. This m eans th a t the ch aracteristics of the p aren ts can be tra n sfe rre d to th eir ch ild ren —and th a t the children o r offspring can eventually reproduce them selves as well. In som e cases, as w ith the tadpole and the frog and w ith the caterp illar and the m oth, m ajor transform ations happen along the way.

All things on ea rth are m ade up of the m ore th an 100 elem ents, as show n in Figure 1-1. M any elem ents are rare, b u t som e are com m on. The e arth itself has m uch oxygen, silicon, alum inum , iron, and calcium and lesser am o u n ts of m any o th er elem ents. On the o th er hand, living things of the earth are com posed m ainly of carbon, nitrogen, oxygen, hydrogen, and a few o th er elem ents. Cells are the sm allest units contained in all living things. They come in various form s and kinds. Some cells are loners and exist only as a single and com plete entity. O ther cells are social and

Matter & Living Things

5

Figure 1-1

C hart show ing periodic table of the elem ents, eight p red o m in an t elem ents of the earth , an d eight p red o m in an t elem ents of living things.

can live only if they coexist w ith m ore of th eir kind. Som e cells have specialized functions. For instance, the function of som e cells is to m ake hair; these cells use m uch of th eir energy and m any cellular m echanism s prim arily to serve th at one function.

Genetic Engineering

6

O ther cells m ake m uscle protein, hem oglobin, fingernails, and so on. E ach cell follows a defined plan. And m ost cells also have to m ake other cells like themselves.

Multicelled Organisms L arger organism s are com posed of m ore com plicated cells, w hich are often organized in specific ways. Figure 1-2 is a diagram of a typical cell from a h igher organism . Note th at whole areas of specialization can be seen w ithin the cell. These specialized areas of cells are called organ elles, w hich can be th ought of as specific room s in a m an u factu rin g plant. For instance, the n u cleu s of a cell is the place w here the genetic plans (in the form of deoxyribonucleic acid [DNA]) are kept and d istributed. This is equivalent to the executive office suite in a m an u factu rin g plant. The m itoch on d ria are the furnace and pow er room s w here energy is m ade and distrib u ted thro u g h o u t the cell. The rib o so m es are the m an u factu rin g room s, w here proteins are m ade. The proteins are the products, m ade by using the plans distrib u ted by the nucleus and using the energy m ade by the m itochondria. We will discuss the ribosom es and th eir functions in m ore detail in C hapter 4. All the in fo rm a tio n n ecessary for each cell to “do its ow n th in g ,” as well as all o th e r th in g s the cell needs, is alw ays

Figure 1-2

A typical cell from a higher organism .

Matter 8c Living Things

7

p re se n t in th e DNA. B ut som e of it is n o t used u n til the rig h t tim e. So the DNA m u st c o n ta in tw o se p a ra te kinds of inform ation: •

•

In fo rm atio n dealing w ith what is to be m ade. This in fo rm ation m ust contain detailed in stru ctio n s for m aking each of the m any th o u san d s of different kinds of proteins th a t are present in an organism . In fo rm atio n needed to tell the cell when to m ake these p ro teins. Som e kind of an off/on (or dim m er) switch is essential, w hich the cell can use to regulate the am ount of a given type of protein to be m ade.

The various cells from larger organism s, all functioning in their ow n specialized way, initially cam e from one fertilized egg cell (Fig. 1-3).

Figure 1-3. F ertilization of an egg cell. Sperm cells attach to the egg cell, and one sperm is allow ed to d o n ate its genetic m aterial (DNA) to the egg cell. The egg cell is then fertilized and im m ediately beginning to grow and m ake new cells genetically identical w ith itself.

Single-Celled Organisms M any organism s are ju st single cells. Among the single-celled organism s are bacteria. B acteria live everywhere around us, yet are invisible except under a m icroscope w ith high m agnification. E ach tiny bacteriu m is roughly 10% of the size of cells from higher organism s; yet, each is certainly alive (Fig. 1-4).

8

Genetic Engineering

Figure 1-4

Typical bacterial cell. Note th at this structure is m uch less com plex th an th a t found in cells from hig h er organism s (see Fig. 1-2). Still, bacteria m aintain all of life’s essential functions.

M any processes th a t b acteria use to survive are the sam e as those used in higher organism s, except th a t they are simpler. Scientists have studied b acteria, since living processes can be studied in detail in these cells and can shed m uch light on the way these processes occur in us and o th er larger organism s. In addition, bacteria are especially useful as tools in genetic engineering because their DNA can be m anipulated easily. ELEMENTS AN D MOLECULES

If we were to break down the sim plest bacterium into various com ponent parts and then break those parts into fundam ental units, we w ould find th at the bacterium is com posed of atom s (the fundam ental unit of every elem ent) of various elem ents th at are bound and grouped together in specific ways. The atom s of each different elem ent have different num bers of protons and electrons. Protons are particles containing a positive charge (+) and are found in the nucleus of an atom (neutrons, which contain no charge, are also found here). Electrons are m uch smaller, have

Matter & Living Things

9

a negative charge, and circulate around the positively charged nucleus, m uch like satellites around our planet (Fig. 1-5). C ertain atom s like to group together. For instance, hydrogen and oxygen are elem ents seldom found as single atom s, but are com m only found in air as twins:

Figure 1-5

Typical stru c tu re of an atom show ing the nucleus, protons, and electrons.

Two or m ore atom s coupled to g eth er form a m o lecu le. The bonds th a t hold them to g eth er are show n as betw een the atom s. M olecules com posed of m ore th an one elem ent are called com p ou n d s. B ut elem ents, m olecules, and com pounds are not them selves living entities. They are ju st building blocks bonded together in m any ways to give a variety of products. For instance, two hydrogen atom s and a single oxygen atom bond together to form water.

Water L ets look at w ater m ore closely. It is sim ple in structure, but has fascinating properties. H ydrogen is flam m able and oxygen sustains com bustion, b u t bonded to gether they m ake water, a fire retardant! So it is w ith m any com pounds: W hen bonded together, they often becom e substances th a t have far different characteristics from those of the atom s or m olecules of w hich they are m ade (Fig. 1-6). W ater also has m any unusual properties w hen com pared w ith o th er liquids to w hich it should be sim ilar. F or instance, w hen w ater freezes, it takes up m ore space, w hich in tu rn m akes it float (as ice). W ater boils and freezes at a higher tem p eratu re

Genetic Engineering

10

Figure 1-6

A w ater m olecule show ing how hydrogen bonds to the oxygen. The hydrogen and oxygen atom s never line up, but are always at defined angles to each other

than o ther sim ilar com pounds (such as m ethane and am m onia). Perhaps m ost of all, w ater produces hydrogen-bonds (a very weak bond) w ith m any o th er com pounds, m aking w ater a great solvent. These unusual characteristics m ake w ater an ideal com pound for living things (Table 1-1).

Table 1.1 Unusual Properties of Water Compound ch nh

4 3

h 2o h 2s

Molecular Weight

Melting Point (°C)

Boiling Point (°C)

Heat of Vaporization (kJ/mol)

16.04 17.03 18.02 34.08

-182 -78 0 -86

-162 -33 +100 -61

8.16 23.26 40.71 18.66

BONDS

Bonds are the “glue” th at holds together the atom s from various elem ents to give all m atter substance and structure. If we were to analyze everything around us in atom ic detail, we would find w onderful m olecules and com pounds w ith intricate lattice structures com posed of atom s. These structures and their chem ical m akeup give all m aterial things a variety of sizes shapes, and other characteristics. W ithin these structures are several types of bonds with different functions. We will discuss these im portant bond types (covalent, hydrogen, and ionic) as well as a special interaction of great use in living systems (hydrophobic interaction).

Matter & Living Things

11

Covalent Bonds In water, hydrogen and oxygen atom s are tied to gether in w hat is term ed a covalen t bond. Covalent bonds are very strong, are found alm ost everyw here, and literally hold things together, giving significant stren g th to all stru ctu res. One of the significant properties of the four m ost com m on elem ents of living things—carbon, oxygen, hydrogen, and nitro g en —is a great tendency to form covalent bonds (Fig. 1-7). Covalent bonds are often called the "backbone" of m olecules because they are responsible for the prim ary organization of the m olecules. They are m ade w hen adjacent atom s share electrons, w hich allows the two nuclei to be bound closer together.

Figure 1-7

Covalent bonds. Note th a t these bonds can m ake various angles betw een the atom s, depending on w hich atom s are used.

Genetic Engineering

12

Hydrogen-Bonds A nother kind of bond plays a critical role in living system s—the hydrogen-bond (H -bond). H -bonds are form ed betw een a hydrogen atom and nearby oxygen, nitrogen, and som etim es sulfur. These bonds are relatively w eak and have a b o u t 10% of the strength of covalent bonds. But w hat they lack in strength, they m ake up for in num ber (Fig. 1-8). W ater tends to form n um erous H -bonds w ith o th er w ater molecules. These bonds often do not last very long, being broken and m ade quite rapidly. Generally, in water, ab o u t 85% of the w ater m olecules are hydrogen-bonded to neighbors. Breaking w eak H -bonds between w ater m olecules does not break strong covalent bonds within the m olecules. For instance, w hen ice is form ed, even m ore H -bonds are m ade, m aking a solid stru ctu re of im m ense strength (Fig. 1-9).

Figure 1-8.

Various kinds of hydrogen bonds (H-bonds).

Matter 8c Living Things

13

Figure 1-9

The structure of ice as it m ight occur in the frozen surface of a pond or river.

W ater can also hydrogen-bond to other m olecules, because it contains both oxygen and hydrogen, both of which are used in Hbonds. The great tendency of w ater to hydrogen-bond to alm ost everything gives it m any of the rem arkable characteristics. H-bonds are also found betw een nonw ater molecules and play a significant role in living system s, as we shall see shortly. Hbonds are im portant, not because of th eir exceptional strength, b u t because they do so m any different things and they are so plentiful. In addition, H -bonds can be m ade and broken easily, which allows a great variety of structures in living things.

14

Genetic Engineering

Ionic Bonds A nother kind of bond is form ed by the electrical attrac tio n betw een some molecules. Some atom s prefer to lose or gain negatively charged electrons, m aking them selves ions. By adding an electron, the atom becom es negatively charged. Losing an electro n gives a net positive charge to the atom . The electrical charges betw een oppositely charged ions attrac t each o th er and form a bond, called an io n ic bond. F or instance, a sodium ion (N a+) and a chloride ion (Cl ) readily form sodium chloride (NaCl), which is com m on table salt. The strong ionic bond holds the sodium and chloride ions together, w hich generates the new com pound. These ionic bonds are found in m any chem ical com pounds and are relatively strong forces in holding things together. Ionic bonds are found in biological m olecules as well, but are m uch less com m on th an H-bonds.

Hydrophobic Interactions A nother in teractio n betw een atom s and m olecules is very im portant and is really not a chem ical bond at all; still, it plays a central role in living things. Som e m olecules don't form Hbonds. We recognize som e of these as fats and oils, com pounds th at don't mix well w ith water. These portions of m olecules have a tendency to avoid w ater m olecules completely. To do so, they group together. This avoidance of w ater is called a hydrophobic (w ater-hating) interaction. H -bonds betw een solvent w ater m olecules and hydrophobic in teractio n s betw een oil m olecules are the reason why “w ater and oil don't mix." H ydrophobic in te rac tions are m ainstays in biological stru ctu res (discussed in m ore detail in C hapter 2). BIO LO G ICA L M ACROM OLECULES

In living th in g s, large, co m p licated s tru c tu re s (m a c r o m o le c u les) are m ade from sm aller m olecules. F or in stan ce, p lan ts use ca rb o n dioxide (C 0 2) an d w a te r to form c a rb o h y d ra te s (sugars). These su g a r m olecules are form ed from c a rb o n atom s com bined w ith hydrogen and hydroxide (OH) attached. A five-carbon su g a r w ould have the s tru c tu re show n in F igure l-10a. But the stru c tu re does not rem ain a linear string of carbons. Instead, the carbons form a ring-like stru ctu re, as show n in

Matter & Living Things

15

Figure 1-10 (a) The linear structure of ribose. (b) The cyclic structure of ribose and deoxyribose. These are both five-carbon sugars com m only found in genetic m aterial (RNA and DNA, respectively). N ature favors the cyclic stru ctu re m ore th an 99% of the tim e for these sugars

Figure 1-1 Ob. This sugar molecule, ribose, is a five-carbon sugar th a t plays a central role in both DNA and RNA (ribonucleic acid). As a m atte r of fact, RNA actually stands for ribo(se)nucleic acid, and DNA stands for deoxyribo(se)nucleic acid. The only difference betw een ribose and deoxyribose is that ribose has an extra oxygen, as show n in Figure 1-10b. These ribose (or deoxyribose) units, can be bound to ad d itional cyclic m olecules th a t have backbones m ade of both carbons and nitrogens. These m olecules are called bases. Their stru ctu res are show n in Figure 1-11. Bases can be joined to ribose (or deoxyribose) sugar, and w hen a p h o sphate group is added, we have n u cleotid es (Fig. 1-12). The five bases show n in Figure 1-11 are the fundam ental building blocks of bo th DNA and RNA. They are labeled A (adenine), G (guanine), C (cytosine), and T (thym ine), o r U (uracil) after the first letter of their nam e. The first four bases, A, G, C, and T, w hen a ttach ed to deoxyribose sugars, are found in DNA and are called d eo x y rib o n u cleo tid es (Fig 1-12). A, G, C,

16

Genetic Engineering

Figure 1-11 S tructures of purine and pyrim idine bases found in DNA and RNA. Note th a t each of the atom s in the cyclic stru ctu res is n u m bered. In Figure 1-10, the carb o n s in the sugars were also num bered. W hen they are p u t to g eth er into nucleotides (see Fig. 1-12), the sugar num bers are given a prim e (') to distinguish them from the num bers in the bases.

and U w hen attached to ribose sugars are found in RNA and are called rib o n u cleo tid es (Fig 1-12). DNA and RNA are nucleic acids th a t are m ade of long chains of such nucleotides. These nucleic acid m acrom olecules are critically im p o rta n t to all living organism s and will be discussed in m uch m ore detail in C hapter 3.

Matter 8c Living Things

Figure 1-12

17

S tru ctu res of the nucleotides used in RNA (rib o n u cleotides) an d in DNA (deoxyribonucleotides). N ote th a t the bases on the first th ree across are identical. Only the lack of oxygen on the 2' carbon of the sugar of the deoxyribonucleotides m akes them different.

18

Genetic Engineering

SUMMARY

Living things are complex structures of various elem ents bonded together in specific ways. Cells are the sm allest u nits of living things and contain highly specialized organelles to allow living processes to take place. Cells contain m any com plex stru ctu res called m acrom olecules, w hich are form ed from o ther m olecules and elem ents. These are held together w ith various bonds, such as covalent, hydrogen, and ionic bonds. One of these com plex m acrom olecules is deoxyribonucleic acid (DNA).

2 PROTEINS WHAT YOU WILL LEARN IN THIS CHAPTER

• • • •

The m akeup of a protein How proteins are put together How proteins provide structure to living things How chem ical reactions use proteins to m ake them go

Now th a t we have lea rn ed how ato m s and m olecules are held to g eth e r chem ically, we can tu rn to the larg er com plexes of m olecules (m acrom olecules) used in living system s. We used nucleic acids in C hapter 1 as an exam ple of the com plex s tru c tu res th a t can be b u ilt from relatively sim ple com pounds. Now, we in tro d u c e p ro te in s as the next m ajo r category of m acrom olecules. P roteins are the final p ro d u ct of alm ost all the genetic inform ation carried in a cell. As we will see in C hapter 3, genetic m aterial encodes all the in form ation needed to m ake the stru c ture of the proteins to be exactly w hat they need to be so th at they can perform their m any functions. P ro tein s are am azingly diverse, b o th in stru c tu re and fu n ction. P ro tein s com e in th o u sa n d s of d ifferent shapes and form s. They are m ore carefully designed a n d b u ilt th a n the finest m ansions. T heir intricate design and form allow them to do th e ir p a rtic u la r job and no other. P roteins are p a tte rn e d to allow them to w ork effectively and efficiently, using very little energy.

19

20

Genetic Engineering

Figure 2-1 Amino acids—the building blocks of proteins, (a) General stru c tu re of an am ino acid. R = any of the 20 different side chains, (b) Three of the 20 am ino acids com m only used in proteins.

21

Proteins A M IN O A C ID S: PROTEIN BUILDING BLOCKS

Proteins are m acrom olecules m ade up of lengthy chains of building blocks called am ino acids. Actually, 20 different am ino acids are used in proteins, all of w hich have a general stru c tu re as show n in Figure 2-la. This com m on structure is shared by all the am ino acids, but each has a specific sid e ch ain (labeled R) th at m akes it different (Fig. 2 -lb). The side chains of am ino acids are extremely varied. Som e are very acidic (they tend to lose a hydrogen ion [H +]). Som e are basic (they a ttra c t an extra H +). Som e dissolve easily in w ater (hydrophilic), and others act like oil in w ater (hydrophobic— w ater hating). Som e am ino acids have ring stru ctu res (arom atic). Two am ino acids have side chains containing sulfur, w hich gives decaying m eat its awful odor. S tru ctu res of all the am ino acids are given in the Appendix. PROTEIN STRUCTURE

Primary Proteins are m ade of long strings (long chains) of am ino acids, linked together w ith a very strong covalent bond (see C hapter 1), the p ep tid e b on d (Fig. 2-2). Before this chain of am ino acids folds up to give it stru ctu re, it is called a p o ly p ep tid e chain. The m any in tricate stru ctu res of p roteins are specified by the o rd er in w hich the am ino acids are placed in the polypeptide chain. This sequence of am ino acids in a polypeptide chain is referred to as the p ro tein s prim ary structure (Fig. 2-3).

Figure 2-2

S tru ctu re of a peptide bond w ithin a polypeptide chain

(arrow). This is the link betw een adjacent am ino acids. The bond form s

betw een the carb o n of one am in o acid an d the nitrogen of the next, form ing a chain of am ino acids (a polypeptide chain; see Fig. 2-3). This is a covalent bond and is very strong.

22

Genetic Engineering

Figure 2-3

An exam ple of a p o rtio n of a polypeptide chain. In a protein, the sequence of am ino acids linked together by peptide bonds is called the prim ary structure of the protein. (Amino acids shown here: Ala = alanine; Asp = aspartic acid; Met = m ethionine; Val = valine.

Secondary After the long chain of am ino acids has been m ade, each chain is folded in a p a rticu la r fashion according to the sequence of am ino acids. This is called the secon dary structure (Fig. 2-4b). This folding of the polypeptide chain is caused by in teractio n s betw een the am ino acids, generally hydrogen bonds (H-bonds), and by hydrophobic in teractio n s of the polypeptide chain w ith the environm ent surrounding it. Som etim es the initial folding of the polypeptide chain is in the form of a spiral-like stru c tu re called a helix. The folded polypeptide chain is called an alpha (a) h elix and is very com m on in m any proteins (Fig. 2-5). The helical stru ctu re predom inates in h air proteins and som e o th er stru c tu ra l proteins, and it is present to som e degree in m ost proteins. In hair, helical stran d s have a tendency to w ind a ro u n d each other, m uch like the stran d s in a rope, to give lots of strength to the w hole stru c tu re b u t retain great flexibility. Som etim es, disulfide (S-S) bonds form betw een the h air strands (fibers), w hich cause them to curl. W hen we get a h a ir perm a-

Proteins

23

Figure 2-4 The prim ary, secondary, tertiary, and quaternary structure of proteins, (a) The p rim ary stru c tu re is the sequence of am ino acids linked by peptide bonds, (b) The secondary stru ctu re is the folding of the am ino acids, (c) The tertiary structure is the coiling of the coils, and (d) the q u atern ary stru c tu re occurs w hen m ore th an one coiled coil is bound together. See text for details.

24

Genetic Engineering

Figure 2-5 Alpha (a)-helical stru ctu re found in proteins. Drawing (a) shows only the a-carb o n atom C*a of each am ino acid in a helical form. D raw ing (b) show s all the atom s in a helical backbone (N = nitrogen). D raw ing (c) show s the add itio n al atom s as well as the side chains (R) in the am ino acids. Note the hydrogen-bonds (H -bonds), w hich hold the am ino acids in the a-helical structure.

nent or use a curling iron, we are m erely breaking and rem aking some of the S-S bonds (Fig. 2-6). A nother very com m on p ro te in stru c tu re occurs w hen the am in o acid ch ain s ru n parallel w ith each o th e r for a sh o rt distan ce. These sheet-like s tru c tu re s (beta [p] sheets) often c o n ta in m any am in o acids w ith h y d ro p h o b ic side ch ain s (Fig. 2-7). At tim es, these p-sheet regions form cavities and areas in p ro te in s th a t are very hy d ro p h o b ic a n d a ttra c t o th e r h y d ro p h o b ic m olecules. These regions are also useful w hen p ro tein s m ix w ith the m em b ran es of cells, w hich are m ade up of fatty m olecules.

Proteins

25

Figure 2-6 D iagram show ing several am ino acids linked to gether w ith peptide bonds, w ith tw o of the side chains form ing a disulfide (S-S) bond, w hich gives the stru ctu re additional strength.

Tertiary W hen the folded regions of the am ino acid chain fold on th em selves, this is called the tertiary structure (Fig. 2-8). At this stru c tu ra l level, the helices and sheets are folded and kinked in specific ways, allowing various portions of the am ino acid chain to com e in co ntact w ith one another. This refolding of the helical and sheet-like stru ctu res often causes the p roteins to becom e very com pact and tight, w hich often helps them to keep out water. All the reasons for the folding of pro tein s are n ot yet understood, bu t it is clear th at the correct folding is critical to a particu lar p ro te in s function.

26

Genetic Engineering

Figure 2-7 The p-sheet stru c tu re of proteins. D raw ing (a) is a "ball and stick” stru ctu re show ing how the polypeptide strands have a sheetlike stru ctu re relative to each other. Drawing (b) shows a m ore detailed view of the way the side chains of the am ino acids in terdigitate w hen the sheets are layered, (ala = alanine; gly = glycine; ser = serine.)

WHAT PROTEINS D O

Proteins do lots of different things in a cell. The function of each protein depends on its stru ctu re, w hich in tu rn depends on the way in w hich the folding of the polypeptide chain occurs. And the folding of the polypeptide stru ctu res of all proteins depend on the sequence of am ino acids in the polypeptide chain. So the sequence of am ino acids critically determ ines the function of the protein.

Proteins

27

Figure 2-8 Different kinds of tertiary stru ctures of proteins. Drawing (a) show s a p ro tein w ith p red o m in an tly a-helical stru ctu re. Draw ing (b) show s a p o rtio n of a p ro tein co n tain in g m ainly p-sheet structure. D raw ing (c) is an exam ple of a p o rtio n of a p rotein th at has a m ixture of b oth the a-helical an d P-sheet stru ctu res. Som e proteins have p o rtions th at are m ore a-helical, and o th er portions have m ore p sheet.

28

Genetic Engineering

Enzymes By far the m ost im p o rta n t function of p ro tein s is to serve as enzym es. An enzym e is a very precisely m ade pro tein th a t causes chem ical reactio n s in the organism to h appen m uch faster th a n they w ould norm ally. In chem ical term s, these are called catalysts. The reason we need enzym es is to speed up (catalyze) the chem ical reactions th at take place. Enzym es can m ake the chem ical reactio n s proceed th o u san d s and even m illions of tim es faster than they norm ally w ould at body tem peratures. F or instance, w hen we eat food, enzym es cause the food to be broken dow n into su b stan ces th a t can be used by o u r body. Enzym es are specialists. The activity of an enzym e is a direct result of the precisely m ade protein stru c tu re th a t allows it to function very efficiently, b u t only for a very specific reaction or group of reactions. Enzym es are capable of recognizing and, w hen necessary, rejecting alm ost-identical stru ctu res th at are different only in the placem ent of a single carbon (C) or a hydrogen (H) atom . This am azing specificity has often been p ictured as a lock-key fit (Fig. 2-9). If the order of the am ino acids in the polypeptide chains is not exact, the specificity or activity of a p a rticu la r enzym e m ay be lost, w hich m ay kill the cell. If we m ultiply this required a c cu racy by the th o u san d s of p roteins th a t perform the m ultitude of tasks essential for life, we can get a glim m er of how critical it is th at the genetic m essage, w hich determ ines the ord er of the am ino acids, be kept exact.

Structural Proteins Proteins are also used for stru c tu ra l purposes. In o u r bodies, m uscles, tendons, and ligam ents literally hold o u r fram e together. In addition, ou r skin, hair, and fingernails all are p rim arily protein. Each protein is m asterfully designed and exactly m ade to provide the necessary function. For instance, ligam ents are m ade p rim arily of collagen , w hich is a trip le-stran d ed helical fiber. It takes m any of these triple-stranded fibers w ound around each o ther to m ake a tendon or a ligam ent (Fig. 2-10). The tensile strength (the am ount of pulling necessary to break it) of collagen is enorm ous; still, it can be broken, a fact to w hich m any football players and skiers can attest. Collagen has tensile stren g th per un it m ass far greater th an steel; yet, it is

Proteins

29

Figure 2-9 Lock-key analogy of enzym e function. That is, if two m olecules are to be bou n d together, the enzym e helps this reaction by fitting one reactan t m olecule into one site on the enzym e and fitting the o th er into an adjacent site on the enzyme. By bringing the two reactant m olecules together, p o sitioned in the rig ht way, the enzym e greatly im proves the rate of product form ation. The product is m ade of the two reactan t m olecules coupled together.

m uch m ore flexible. It even has portions of very flexible protein to provide additional stretching and bending power. Collagen is b ut one exam ple am ong m any of the diverse ways in w hich proteins can be designed and m ade for specialized purposes.

30

Genetic Engineering

Figure 2-10 D iagram of how collagen, a stru ctu ral protein, is m ade. Three procollagen a-helical stran d s are w ound together to give procollagen. The u n necessary ends of the procollagen are then cut off by a specific enzym e, leaving the tropocollagen strand. M any of these are then overlapped to g eth er in a long fiber to form collagen, a p o rtion of w hich is diagram m ed here.

Proteins

31

Transport Proteins T ransport of nu trien ts and oxygen is an o th er m ajor duty of p ro teins. One of the proteins studied in m ost detail in this are n a is h em oglob in , the c a rrie r of oxygen (Fig. 2-11). This am azing m olecule is m ade of four polypeptide stran d s and is able to

Figure 2-11 H em oglobin, the carrier of oxygen. H em oglobin is m ade of four sep arate p ro tein chains, two a chains and two p chains. In the deoxy (w ithout oxygen) form, the chains are positioned quite sym m etrically w ith a large hole betw een them in the m iddle. W hen oxygen is added (the little platform s an d balls show n), the su b u n its tilt about 15 degrees relative to each other, an d the hole in the m iddle becom es smaller. These slight changes in structure m ake it possible for hem oglobin to get oxygen from the lungs and take it to the cells and release it.

32

Genetic Engineering

carry four m olecules of oxygen. H em oglobin not only m ust pick up the oxygen in the lungs, but it m ust drop it off in the capillaries and the m uscles w here it is needed, and then tra n sp o rt carbon dioxide (C 0 2) back to the lungs to be expelled. The finely tuned m echanism th at allows this to happen has been studied over the last 60 years and is now un d ersto o d in great detail. N eedless to say, the precise stru c tu re of hem oglobin is critical. Any a lteratio n in its stru c tu re can have fatal consequences, as we shall see in C hapter 4.

Signal Proteins A nother m ajor p rotein function is m essenger service. An example of this is w ith insulin, w hich helps regulate blood sugar am ounts. It does this by telling m uscle and fat cells th at there is a supply of food (sugar) present and helps them to absorb this sugar. M any of o u r horm ones are proteins and specifically w ork to keep o u r body functioning by providing signals to various cells th a t enable o u r bodies to regulate tem p eratu re, activity, stress, pain, and other conditions.

Glycoproteins and Lipoproteins Finally, we should m ention th a t proteins are often coupled w ith sugars and fats to form complexes that have even m ore variability. P roteins coupled w ith sugars are called glycop rotein s, and these are am azingly diverse (Fig. 2-12). One of th e ir p rim ary functions is to serve as cell m arkers so th at various kinds of cells can be recognized. This is especially im p o rta n t to o u r im m une system , w hich has to d iscrim inate betw een “self” and “nonself” (foreign) cells. In addition, glycoproteins perform intricate functions w ith m em branes and signal pathw ays, w hich could be done in no other way. L ipoproteins are m ade of lipids (fats) and proteins and are prim arily designed to tran sp o rt fats in aqueous (water) system s, such as in ou r bloodstream . These fats are carried from o u r digestive system to cells to be used for food and for energy storage. The pro tein com ponent serves to provide a “shell” to interact w ith w ater and in w hich to hide the fats.

Proteins

33

Figure 2-12

Exam ples of two glycoproteins th at are form ed by sugar (glyco) units being attach ed to p ro tein chains th rough am ino acid side chains. These stru c tu re s are especially useful in cell wall and cell m em branes.

SUMMARY

Proteins come in m any varieties, sizes, and shapes and are m ade of 20 am ino acids. All am ino acids have sim ilar structures, but have different side chains, w hich give them specific properties. The am ino acids are linked together in the o rd er dictated by the genetic inform ation, into long chains called polypeptide chains. These polypeptide chains are folded into helical or sheet-like structures. Then these stru ctu res are often folded again to give the protein the exact structure it needs for its particular function. Proteins function as enzym es (catalysts), stru ctu ral elem ents, and signal devices. They can also be com bined w ith sugars to m ake glycoproteins (often used as m arkers for cells) and w ith fats to m ake lipoproteins (often used as transport device for fats).

3 NUCLEIC ACIDS WHAT YOU WILL LEARN IN THIS CHAPTER

• • • •

How deoxyribonucleic acid (DNA) was found, its structure, and why it is im portant How DNA m akes copies of itself How ribonucleic (RNA) is m ade W hat roles DNA and RNA perform

In the movie, Jurassic Park, the story line develops aro u n d fragm ents of DNA from preh isto ric dinosaurs th at were cloned and ultim ately develop into fully functional creatures of grand p ro portions. This is all supposed to result from using ju st some of the DNA from these extinct creatures. Could this really happen? Is it possible to use DNA from a living creatu re and get a new, identical living creature? W hat are the lim itations of this approach? To u n d e rsta n d this, we need to dig a bit into the storehouse of genetic inform ation, DNA, and find out how it tells cells w hat do. All the genetic in fo rm atio n for cells is contained entirely in the DNA. DNA, as noted in C hapter 1, is m ade of a long string of four deoxyribonucleotides, abbreviated by the letters A, G, C, and T (see Figure 1-11 for the com plete stru ctu res of the nucleotides). All the in fo rm atio n necessary to m ake com plete cells and bodies is contained in these long strings of nucleotides. So it seem s as if it m ay be possible to m ake a new dinosaur if we had all of its DNA. But we will discuss this in m ore detail in C hapter 10. 34

Nucleic Acids

35

A BRIEF HISTORY O F DNA

DNA has not always been know n to be genetic m aterial. A ctually in 1869, Jo h an n F riedrich M iescher discovered DNA and nam ed it n u clein , because it was isolated from the nucleus (central core) of cells. However, its function was com pletely unknow n and rem ained so for alm ost a century thereafter. It is in terestin g th a t only 3 years previous to M iescher s discovery, G regor M endel, an A ustrian m onk, was ju st com pleting his study of pea genetics and had deduced the fundam ental laws of genetics (the scientific study of heredity). M endel had carefully studied seven characteristics of pea plants (Fig. 3-1). To do so, he crossed plants having a certain form of one characteristic (e.g., a green seed) w ith o thers having a sim ilar, but different characteristic (e.g., a yellow seed). First, M endel w aited until the offspring plants had self-fertilized. Then he counted the num ber of offspring th at displayed each kind of a particu lar ch aracteristic. He discovered th at the ratios of the form s of the characteristics occurring in the offspring w ere the sam e for each of the seven characteristics—approxim ately 3:1. To explain his results, M endel po stu lated th at two factors control the ch aracteristics and th a t one factor dom inates the other. This laid the foundation for the theory of inheritance, but it was not well received. M endels idea th a t sex cells (eggs and sperm ) are able to tra n sm it these heritable characteristics was controversial. He shared his ideas w ith other scientists, but they did n 't have m uch faith in them at th a t tim e. Not until the early 1900s did scientists revisit the inh eritan ce problem s in plants and confirm M endels work, show ing th a t in h eritan ce factors w ere related to the po rtio n of the cells called ch rom osom es. C hrom osom es are m ixtures of nucleic acids and proteins found in cell nuclei. Even w ith this in fo rm atio n a b o u t in h eritan ce, however, M endels insightful discoveries and M iesch ers discovery of nuclein did not com e together. A lthough the chrom osom e was know n to co n tain nu clein —o r nucleic acid, as it cam e to be know n—early scientists th o u g h t th a t nucleic acids w ere not com plex enough to carry a lot of in fo rm atio n . To early investigators, it seem ed im possible th at such a biological m acrom olecule c o n tain in g ju st four different building blocks w ould be able to c o n tain m uch useful in fo rm atio n . They believed it w ould be like trying to w rite a book using four letters of the alphabet.

36

Genetic Engineering

Figure 3-1 M endels experim ent. (Fj = first generation of offspring; F2 = second generation.)

It was m uch easier, then, to suppose th a t proteins w ere carrying the com plex genetic inform ation. After all, proteins contain 20 different am ino acid building blocks, not just 4. And proteins were found in the nucleus of cells as well. So it seem ed logical

Nucleic Acids

37

th at proteins had m uch m ore capacity to carry the genetic inform ation, since 20 “lette rs” give m any m ore possibilities th an 4 would. Still, this turned out to be a w rong conclusion. In 1945 near the end of World W ar II, Oswald Avery, Colin MacLeod, and Maclyn McCarty, three scientists at the Rockefeller Institute in New York, show ed after a decade of careful experim entation that, by transferring only DNA, genetic inform ation can be taken from one strain of bacteria and given to an o th er (Fig. 3-2). This was the first solid evidence th at DNA, having only four nucleotides, actually contains genetic inform ation. The results of Avery, M acLeod, and M cC artys experim ents show ing th a t DNA was the genetic m aterial were startling, but the m essage didn't sink in to the scientific com m unity until m uch later. O ther experim ents w ere perform ed and o th er approaches were taken, each adding m ore proof. Early researchers didn't pay m uch attention to the structure of DNA, because it had been considered u ninteresting. M ost thought th a t all four of the nucleotides were placed in DNA in a constant, repetitive o rd er and in equal am ounts. However, in 1950, E rw in C hargaff discovered th a t the am o u n t of G equaled th at of C, and the am o u n t of A equaled th at of T (see next p a ra graph and Table 3-1). This was a critical piece of inform ation, w hich set the stage for the discovery of the stru c tu re of DNA and allow ed us to u n d e rsta n d how the genetic m essage it carried was tran sferred from DNA to DNA as cells reproduced them selves. Table 3.1 Ratios of Adenine, Thymine, Guanine, and Cytosine Obtained by Chargaff SPECIES

A

T

G

C

H om o s a p ie n s

31.0

31.5

19.1

18.4

D rosophila m e la n o g a ste r

27.3

27.6

22.5

22.5

Z ea m ays

25.6

25.3

24.5

24.6

N eu rospora c ra s sa

23.0

23.3

27.1

26.6

E scherichia coli

24.6

24.3

25.5

25.6

Bacillus subtilis

28.4

29.0

21.0

21.6

Note that the percentages of adenine (A) and thymine (T) in each species are similar, as are the percentages of cytosine (C) and guanine (G).

DNA STRUCTURE

As noted in C hapter 1, DNA is m ade of nucleotides, w hich are sugar m olecules w ith nitrogen-containing bases attach ed to

38

Genetic Engineering

Figure 3-2 The Avery, M acLeod, and M cCarty experim ent. Since the live n onvirulent cells w ould not kill a m ouse, w hat factor was tra n s ferred from the heat-killed virulent cells th at m ade the live nonvirulent cells kill mice? By isolating various fractions of the heat-killed cells, these scientists ultim ately isolated the DNA fraction as the fraction that was responsible for the transform ation of the nonvirulent cells into virulent cells. This w as the first tim e th at DNA was clearly show n to have the ability to genetically a lte r cells, suggesting th at DNA contained genetic inform ation.

Nucleic Acids

39

Figure 3-3 This is a d iagram of x-ray scattering from a fiber of DNA. W atson an d Crick used such a fiber p a tte rn to determ ine the stru ctu re of DNA. The helical stru c tu re is show n by the X -shaped p attern of the spots on the film. The d istances betw een the spots tell scientists how m uch distance there is betw een the nucleotides in the helical strands.

them . Of the four bases used in DNA, two are single-ring stru c tures and two are double-ringed. The single-ring stru ctu res are cytosin e (C) and th ym ine (T). The double-ring stru ctu res are a d en in e (A) and gu an in e (G). These stru ctu res are show n in Figure 1-12. W hen the sugar, the p h o sphate group, and a base are all bound together, we have deoxyribonucleotides. Using som e x-ray p attern s of fibrous DNA as a basis (see Fig. 3-3), Jam es W atson and F rancis Crick m ade a detailed m odel of the stru ctu re of DNA, w hich show ed it to be a doublestranded helix (Fig. 3-5). One of the key features of the m odel was th a t A-T and G-C bind together, m aking one stran d of the DNA complementary to the other. Thus, if one stra n d contains the sequence AGCT, the bases on the o th er stra n d w ould be TCGA. The bases on the

40

Genetic Engineering

adjacent stran d s are a ttach ed by m eans of hydrogen bonds (H-bonds). Figure 3-4 shows the structure of the paired bases.

Figure 3-4

S tru ctu res show ing base pairing (hydrogen-bonding) of adenine (A) and thym ine (T), and guanine (G) and cytosine (C). These base p airs are very close to identical distances across, m aking them ideal for attaching the two stran d s of DNA together.

The x-ray patterns suggested that the DNA strands were coiled in a helical (spiral) fashion (Fig. 3-5). The discovery of this double spiral, called a doub le helix, earned W atson and Crick a Nobel Prize and really kicked off the detailed study of genes. The doublestrandedness of DNA, together w ith the ability of each strand to be com plem entary to the other, was the key to understanding how genetic inform ation m ight be stored and reproduced. How are the nucleotides linked to gether in a DNA m olecule? The covalent bonding of the strand is not betw een the nitrogencontaining rings of the bases, b u t betw een the sugar m olecules th ro u g h the p h o sp h ate groups. This happens betw een the fifth

Nucleic Acids

41

Figure 3-5 Three rep resen tatio n s of the DNA double helix. N ote the presence of the m ajor groove and m in o r groove in the structure. W ater often binds in the m in o r groove. Also, note th a t the base pairs are alm ost p erp en d icu lar to the axis of the helix (low er draw ing). The sugar-phosphate backbone is on the outside, and the bases are located in the interior of the double helix.

carbon (5' carbon) of the deoxyribose sugar on one m olecule and the th ird carbon (3' carbon) of the next sugar (Fig. 3-6). Thus, each deoxyribose m olecule then has two p hosphate groups attached to it, one at the 3' and one at the 5' carbon. The

42

Genetic Engineering

Figure 3-6 The sugar-phosphate (phosphodiester) bonds th at link two deoxyribose or ribose sug ar u n its together. These bonds link large n um bers of the sugars together in a sugar-phosphate backbone m aking a DNA (or RNA) strand.

result is th at the phosphate group becom es the link betw een the deoxyribonucleotides. This covalent bond betw een the carbons on the sugars and the p h o sphate group is called a p h o sp h o d iester bond or linkage (see Fig. 3-6). REPLICATION

W hen cells are dividing, new DNA m ust be m ade. This is done by adding a single nucleotide to the end of a growing chain. This addition always occurs at the 3' end of the chain. So the new

Nucleic Acids

43

chain always starts out w ith the 5' nucleotide, and th en ad d itional nucleotides are added until it is finished. W hen we talk ab o u t the sequence of a chain of nucleotides, we always w rite it from the 5' end. The process of DNA m aking new DNA strands is called rep lication (Fig. 3-7).

Figure 3-7 The b irth of a stra n d of DNA. New nucleotide trip h o sp h ates are added to the 3' end of the grow ing chain. G row th is always in the 5' to the 3' direction. W hen the new nucleotide is added, the two extra p h o sp h ate groups are broken off, w hich gives the energy needed to m ake the new link betw een the new nucleotide and the 3' end of the growing strand.

44

Genetic Engineering

We now can see how a long chain of nucleotides m ight be put together in a ran d o m sequence. But how is a certain sequence specified? The genetic m essage is found in the sequence of nucleotides initially present in the DNA. This sequence m ust be specified in each of the new pieces of DNA w ith exactness. So there m ust be a m echanism by w hich the sequence of nucleotides in new DNA can be m ade to m atch th at of its parents w ith exacting precision. Here, the beauty of the doublestranded DNA m olecule com es into play. B ecause the two stran d s of DNA are com plem entary to each other, one stran d becom es a p a tte rn (tem plate) for the o th er strand. Then, w hen one stran d has an A, the o th er strand would have a T. Likewise, w here a G is present on one strand, then a C w ould occur on the o th er strand. Thus, if one stran d contains a series of bases 5' AGGCTTACC, the o th er m ust have 3' TCCGAATGG as its sequence. If we think in term s of the first sequence being a m aster coding strand, then it would specify the sequence of the com plem entary strand (Fig. 3-8). Therefore, one stran d of DNA can be used to m ake the o th er strand, w hich w ould have a m atching, yet com plem entary, sequence (see Fig. 3-8). To m ake new DNA for a daughter cell, the parent DNA strands are separated. E ach of them is used as a tem plate for a com plem entary strand, resulting in two identical m olecules of doublestranded DNA. This replication process is carried out by DNA polym erases, w hich are enzym es specially designed to read the sequence of bases on the tem plate stra n d and place a com plem entary base in th at order on the new strand. R eplication takes place very rapidly, and som etim es a w rong nucleotide is inserted. So o th e r pro tein s move along the DNA “p ro o fread in g ” the new stra n d for possible m ism atch es and fixing them . In this way, the genetic m essage is kept practically free from erro r—only m aking an e rro r once for every 10 billion nucleotides linked together! In o th er w ords, if this book w ere w ritten in DNA code, only one typographical e rro r w ould ap p ear in one lette r of one w ord o ut of 5000 different books this size. A nother im p o rta n t feature of the double-helical n a tu re of DNA is th a t the stru c tu re is “locked” in. This feature m akes the sequence contained in the DNA m olecule very stable and p re vents accidental changes. If one stran d is som ehow dam aged, the o th er stra n d can be used to rep air it, keeping the m essage the sam e. This m akes DNA an ideal m olecule in w hich to archive (store) genetic inform ation.

Nucleic Acids

45

Figure 3-8 DNA replication. Two new stran d s are m ade sim u ltan eously by special enzym es called DNA polym erases. The DNA is unw ound, and each of the paren t strands is used as a tem plate to make an identical copy of the com plem entary strand. The result is two double stran d s of DNA, ra th e r th a n ju st one. This process takes place every tim e a new cell is made.

Genetic Engineering

46

One final feature of DNA needs to be em phasized. Although it is easy to show two stran d s of DNA parallel on paper, the n a tu ra l form is helical. The tw isting of the stran d s of nucleotides causes DNA to look very m uch like a spiral staircase, w ith the steps being represented by the base-paired bases and the b a n n iste r region by the sugar-phosphate backbone. Som etim es, DNA takes o th er form s, m aking loops and bulges, but generally the W atson-Crick structure is found. The helical structure also m akes DNA convenient for p ack aging in the nucleus. The helical strands can be folded and tw isted back on each o th er to m ake it very com pact. DNA is a very long m olecule, so it has to be folded and refolded w ith great care to fit w ithin the cells. The helical structure is ideally suited for this purpose, because it is fairly flexible, yet com pact. The packaging in m ore com plex cells is often done by w rapping the DNA a ro u n d proteins, w hich allows the DNA to fold into tightly folded stru ctu res of pro tein and DNA called n u c le o so m e s (Fig. 3-9). Clearly, good packaging is essential, especially in a bacterium or virus, w hich has a lot of DNA.

Figure 3-9

S tructure of nucleosom es.

Nucleic Acids

47

DNA's stru c tu re is ideally suited for its purpose. The long series of nucleotides in a row allows inform ation to be coded by m erely changing the sequences of the letters, m uch like a fourletter alphabet. Because of the double-stranded n a tu re of its stru ctu re, genetic in form ation can be stored indefinitely. It can be reproduced w ith ease, repeating the genetic m essage th a t it o b tained from its ancestral DNA. In tu rn , it can replicate itself by tran sferrin g this sam e inform ation to its progeny (offspring) w ith great accuracy. However, if it is changed or m odified before it is replicated, th en the m odified in form ation is expressed and su b stan tial changes can be m ade in the proteins produced. We will discuss this m ore fully in C hapter 4 after we learn m ore about how the genetic inform ation is used. RNA

Ribonucleic acid (RNA) is a bit different from its cousin, DNA. It is m ade out of the sam e kind of bases as DNA, except th a t in place of thym ine (T), RNA uses uracil (U) (Fig. 3-10). In addition, the oxygen th at was m issing from the second (2') carbon of the ribose sugar in DNA is present in RNA. Therefore, the ribonucleotides have an O-H (oxygen bound to the carbon) group at 2' carbon on the sugar, w hereas the deoxyribonucleosides have a m ere hydrogen atom there (see Fig. 1-12). The oxygen atom is a lot larger th an the hydrogen atom , so the d iagram s we m ake don't always tell the whole story. RNA differs from DNA in its stru c tu re an d function. First, RNA is alm ost always single-stranded. A lthough two stran d s of RNA can jo in and form a d o u b le-stra n d ed stru c tu re , this seldom h a p p en s naturally. RNA w ould ra th e r stay singlestra n d e d an d fold th is single s tra n d back on itself in a variety of ways, giving d o u b le-stran d ed regions, loops, bulges, and o th e r in te restin g stru c tu re s. This helps p ro te c t the RNA from enzym es th a t chew it up. It also helps give som e p o rtio n s of th e RNA a specific fu n ctio n . Second, RNA is m uch less stable th a n DNA. P erh ap s this is because it is sin g le -stra n d e d —o r at least has regions th a t are. This m akes RNA m ore vulnerable to a tta ck by rib o n u clea ses, enzym es th a t specifically chew it up. In addition, the extra -OH group on the 2' carbon causes added chem ical activity. If the RNA doesn't have two strands, how is it m ade? It is m ade by a process called transcription, in w hich one stran d of DNA is used as a tem plate for the new RNA. T ranscription

48

Genetic Engineering

Figure 3-10

D ifferences in the stru c tu re of uracil (U), w hich occurs only in RNA, an d thym ine (T), w hich occurs only in DNA are show n. Note also the difference betw een ribose (only in RNA) and deoxyribose (only in DNA), w hich lacks an oxygen at position 2'.

occurs in a way very sim ilar to the way DNA replicates itself. The double helix of the DNA is opened up at a specific site, and one of the stran d s is copied in a com plem entary m an n e r by a special enzym e, RNA p olym erase. In this way, the genetic m essage, w hich is contained in the DNA, is tran sferred to the RNA (Fig. 3-11). Transcription differs from replication in two ways. First, tra n scription of RNA generally takes place on only one of the DNA strands (the tem plate strand), w hereas replication takes place on both strands at the sam e tim e. This is understandable because it is difficult to see how both DNA stran d s w ould be useful in m aking a m essage (although this is done in some rare cases).

Nucleic Acids

49

Figure 3-11 RNA tran scrip tio n . In this process, RNA is m ade from one of the DNA stran d s (the tem plate) and is carried out by an enzym e called RNA polym erase. In the process, the DNA is unw ound, and then w ound up again after the new RNA is m ade. The diagram shows mRNA (m essenger RNA) being m ade, the RNA th at carries the genetic message to be m ade into proteins.

Second, transcription also takes place m uch m ore slowly than replication and does not contain a proofreading step. It is m uch less im p o rtan t for the tran scrib ed RNA to be exact th an it is for the replicated DNA to be exact. This is because the RNA th at

50

Genetic Engineering

serves as the genetic m essage will be used only a few tim es and th en discarded. So, the effort needed to proofread is not w orth it. B ut tra n sc rip tio n is tightly regulated, w hich m eans th a t the am ount and kind of RNA th at are m ade are carefully controlled. This regulation is one way in w hich the organism determ ines how m any proteins of a certain kind are m ade. There are three m ajor types of RNA in a cell: m essenger RNA, transfer RNA, and ribosom al RNA.

Messenger RNA M essenger RNA (mRNA) is an exact copy of the genetic m essage on the DNA. It is tran scrib ed from the tem plate stra n d of DNA. The tem plate stra n d is called the negative (-) strand, because the mRNA is always the p ositive (+) strand. After the mRNA has been transcribed, it is attached to the ribosom es (see explanation under Ribosom al RNA and in C hapter 4), w here proteins are m ade. The mRNA carries genetic inform ation out of the cells nucleus (if it has one), w here it is used by the ribosom es as the m essage th at is translated into protein. In the case of highero rd er cells (eukaryotes; larger, m ore highly organized cells, w ith nuclei and o th er organelles), the RNA is som etim es p eppered w ith segm ents (introns) th a t are not to be translated. These in tro n s have to be rem oved before tra n sla tio n can occur. In addition, mRNA m olecules from eukaryotes always have a string of “A”s at the 3' end, w hich is called a “poly A tail.” Som etim es, especially in bacteria, the mRNA can code for m ore than one protein. mRNA generally has a sh o rt lifetim e. Once the m essage is tran slated on the ribosom es to w hich it attaches (discussed in C hapter 4), ribonucleases chop it into single ribonucleotides, allow ing these u n its to be recycled back into o th er RNA m olecules. This is one way in w hich the num ber of proteins in cells is controlled so th a t too m any copies of the sam e p rotein are not made. We can see th at mRNA is not just a long string of nucleotides. It folds back on itself in som e very com plicated structures. We are only just beginning to understand the purpose of this folding (Fig. 3-12).

Nucleic Acids

Figure 3-12

51

S tructure of a m essenger RNA (mRNA). Although singlestranded, RNA folds back on itself in a series of hairpin-like loops. Note th a t there are som e bases th a t "bulge” out and som e looped sections w ithin double-stran d ed regions. RNA stru ctu re can be very com plicated, even though it is m ade by a single strand.

52

Genetic Engineering

Transfer RNA Transfer RNA (tRNA) is a very sm all RNA m olecule, generally containing 75 to 85 nucleotides. The tRNA polynucleotide stran d is tightly folded and tw isted to give it a stru c tu re th at looks a little like a fat, upside-dow n L, as show n in Figure 3-13. tRNA is used as a shuttle service for am ino acids. There is at least one different tRNA for each of the 20 am ino acids. A special enzyme selects a tRNA for a specific am ino acid and then finds th at am ino acid and attaches the am ino acid to the tRNA. The tRNA then carries th a t am ino acid to the ribosom e and places it in the p ro p er position in a p rotein chain th a t is being m ade. These tiny RNA m olecules are very a b u n d a n t and have

Figure 3-13 Schem atic diagram of a tra n sfer RNA (tRNA) w ith an am ino acid attach ed . The ribbon rep resen ts the p h o sphodiester backbone. All tRNA m olecules have very sim ilar structures, but w ith subtle differences to allow them to receive only a p articular am ino acid.

Nucleic Acids

53

subtle differences in stru ctu re th a t allow them to be recognized by the enzym e th at attaches them to their specific am ino acid. In addition to its being a shuttle service, tRNA m ust have two unique characteristics. • •

It m ust have p a rtic u la r features of stru c tu re th a t allow an enzym e to a tta ch only a specific single am ino acid to it and no others. It m ust be able to identify the unique code for th a t am ino acid on the mRNA.

M oreover, the entire tRNA -am ino acid com plex m ust be able to a tta ch to a specific region on the ribosom e. So, tRNA, even though small, has several critical functions to perform .

Ribosomal RNA R ibosom al RNA (rRNA) is by far the m ost a b u n d a n t RNA in cells. It is found w ithin the massive structures called ribosom es. R ibosom es are m ade of one large and one sm aller su b u n it and are the factories in the cell in w hich new proteins are m ade. R ibosom es are com posed of rRNA stran d s and m any different proteins. Each ribosom al subunit has a long piece of rRNA. The RNA of the larger su b u n it is alm ost twice as large as th a t of the sm aller subunit. In addition, the large su b u n it contains a very sm all piece of rRNA (Fig. 3-14). rRNA contains lots of double-stranded regions and h airp in loops and bends. These are folded aro u n d the proteins in a p a rtic u la r way and provide binding sites for bo th the tRNA m olecules and the mRNA. It is not yet know n exactly w here all these sites are on the ribosom e, b u t it is clear th at rRNA has m uch to do w ith the p ro d u ctio n of new proteins, as described in m ore detail in C hapter 4. Som e regions of the rRNA in bacterial ribosom es are identical w ith those found in ribosom es from all o th er cells, including those from hum ans. This suggests th a t these p a rtic u la r regions are especially im p o rtan t in the structure or function of the ribosom es. It is interesting to note th a t m any an tibiotics th a t kill b acteria and o th er cells do this by attach in g to specific sites on the ribosom e and disrupting its protein-m aking function. We now see th at RNA com es in various sizes, shapes, and packages and is used in cells for m essenger and shuttle w ork and for helping in the com plex process of m aking new protein. A lthough RNA is tran scrib ed from the DNA and contains the

54

Genetic Engineering

Figure 3-14 The b acterial ribosom e. All living cells contain rib o som es—w here proteins are m ade. Ribosom es are m ade up of ribosom al RNA (rRNA) and proteins. As show n schematically, there are two different ribosom al su b u n its—sm all an d large. The sm all su b u n it (30S) has one stra n d of rRNA (16S; “S” refers to the size of these particles w hen d eterm in ed in a centrifuge) an d 21 different proteins, all bound togeth er in a very specific way. Similarly, the large su b u n it (50S) co n tains two pieces of rRNA (23S and 5S) and 32 different proteins. Both su b u n its are essential and w ork to g eth er to m ake the ribosom e function.

Nucleic Acids

55

base sequence specified by DNA, it is not the archive (storage place) of this genetic inform ation, b u t ra th e r helps in the process of tran slatin g the genetic m essage into protein. Only in RNA viruses does RNA have archival duties.

Viral RNA M any viruses contain RNA, not DNA. A n u m b er of these viruses cause influenza, com m on colds, som e kinds of cancer, and AIDS. The RNA w ithin these viruses not only has to provide the m essage to m ake the proteins th at the virus needs, but also m ay have o th er stru c tu ra l or functional duties. Viral RNAs fall outside of the mRNA, tRNA, and rRNA categories and are generally ju st term ed viral RNAs. SUMMARY

The sm all building blocks of DNA and RNA, nucleotides, are used to m ake long strings of nucleic acids. DNA contains A, G, C, and T and is alm ost alw ays found in a double-stranded, helical form . RNA contains A, G, C, and U and is alm ost always single-stranded. RNA has a great tendency to fold back on itself in h airp in loops and o th er com plex stru ctu res. The process w hereby DNA m akes m ore DNA is called replication. T ranscription is the process by w hich RNA is m ade from the DNA tem plate (-) strand. M ost RNA is found as m essenger RNA (mRNA), tra n sfe r RNA (tRNA), and ribosom al RNA (rRNA). Viral RNA is found in som e viruses, although m ost viruses contain DNA.

II

HOW LIVING THINGS ARE CHANGED

4 MAKING AND ALTERING PROTEINS WHAT YOU WILL LEARN IN THIS CHAPTER

• • • • •

How DNA m akes RNA How ribosom es m ake protein from the genetic m essage contained by the RNA How the num ber of proteins is carefully regulated How the exact sequence of am ino acids is needed to m ake functional proteins (changes do happen!) How harm ful diseases cause m any m utations

We have learned th at proteins have various stru ctu res, w hich allow them to perform specialized duties w ithin living system s (e.g., our bodies). We have hinted th at unless each am ino acid is placed at the precisely correct position in the protein, the pro tein is useless. So how are these am ino acids p u t in the correct sequence? And w h a ts this code we have been talking about? L ets find out. THE CENTRAL D O G M A

W hy do we have bo th DNA and RNA? S cientists in the 1950s asked this question in trying to unravel how genetic inform ation was used. Francis Crick developed a statem ent th at he called the Central Dogma: DNA transfers its genetic in form ation to RNA, w hich in tu rn transfers th at inform ation to proteins. 59

60

Genetic Engineering

So, proteins are the final receivers of the in form ation contained in the genes and do not tra n sm it inform ation back to nucleic acids. The big question is how this in form ation is transferred. To m ake useful proteins, each am ino acid building block has to be placed in a specified o rd er in the chain of am ino acids. Som ehow this placem ent m ust be specified by the DNA. But how is this done? To u n d e rsta n d this, we m ust revisit DNA and mRNA (m essenger RNA) in a little m ore detail. TRANSLATION

The Genetic C ode DNA is m ade of four nucleotides, A, G, C, and T. Just as with the letters of the alphabet, it is easy to see how these four letters can m ake a lim ited num ber of “w ords.” However, there are 20 different am ino acids in proteins and only four nucleotides in DNA. So in form ation stored in w ords m ade of a four-letter alphabet m ust be used to specify the precise o rd er of each of the am ino acids in the pro tein strands. To do this, the DNA uses the gen etic code. The genetic code uses three letters of the DNA four-letter alphabet in various orders to rep resen t each am ino acid. W hen tran scrib ed into mRNA, these th ree-letter sequences are called codons. Since four different letters in groups of three give m ore th an 20 possible codons (actually 64), som e am ino acids are specified by m ore th a n one codon. Also, three of the codons do not code for am ino acids at all, but are used to term in ate the m essage and stop synthesis (the process in w hich am ino acids are put together in polypeptide chains) of the polypeptide chain. As a result of using this three-letter code, the DNA m olecule has to have three tim es as m any building blocks as the p rotein for w hich it codes. The codons for all the different am ino acids are show n in Figure 4-1. The genetic code is alm ost com pletely universal; th a t is, the sam e three mRNA letters code for the sam e am ino acids in bacteria and in m an, and in all o th er species. Indeed, the whole process of tran slation , in w hich the DNA code is m ade into protein, is alm ost the sam e in all form s of life. In the translation process, the m essage contained in the mRNA (w hich was tra n scribed from the DNA) is tra n sla ted into a precise sequence of am ino acids, w hich in turn form the protein.

Making and Altering Proteins

61

Figure 4-1

Codons for all am ino acids. The codons are groups of three nucleotides found in the mRNA th a t specify a single am ino acid. (Abbreviations for the am ino acids are spelled out in the Appendix.)

The Process of Translation Attachm ent of mRNA to the Ribosome Let's find out how translation happens. First, the mRNA is m ade from the tem plate (-) strand of the DNA in the region th at codes for a protein. This region is called the gene. In this transcription process, the eukaryotic cells (m ore complex, higher-order cells) often produce mRNA th a t has extra p o rtions of RNA (introns). These introns have to be rem oved before the mRNA can actually be atta ch e d to the ribosom e (the large RNA p rotein com plex w here protein is m ade). After this is done, the mRNA is ready to be translated (Fig. 4-2). All mRNA m olecules sta rt w ith an AUG start co d o n n ear the 5' end of the chain (Fig. 4-3). The m essage continues in threeletter codons until it reaches one of the sto p c o d o n s (UAA, UAG, or UGA), w hich terminates the message.

62

Genetic Engineering

Figure 4-2

M essenger RNA (mRNA) processing. T ranscribed premRNA has excess m aterial (introns) th a t are rem oved to allow the m essage to be correctly translated into proteins.

Figure 4-3

A p o rtio n of m essenger RNA (mRNA) show ing the start (AUG) and the stop (UAG) codon. (A bbreviations for the am ino acids are spelled out in the Appendix.)

Making and Altering Proteins

63

Initially, the mRNA is b o und to the sm aller of the tw o su b u n its th at m ake up the ribosom e. Then, a tRNA m olecule is attached, bearing its precious load of a single am ino acid. As n oted in C hapter 3, the tra n sfe r RNA (tRNA) has earlier been joined to this am ino acid, not ju st to any of the 20 am ino acids. This joining of an am ino acid to the tRNA is a very specific reaction so th a t the right am ino acid is on the correct tRNA). The process is accom plished by a highly selective enzyme th at m akes sure th at both parties are right for each other.

Attachm ent of tRNA to the Ribosome and mRNA As m entioned in C hapter 3, the tRNA also m ust be able to identify the code on the mRNA th a t is specific for the am ino acid it carries. This takes place at the end of the tRNA m ost distan t from the am ino acid, the a n tico d o n region. The anticodon region contains three nucleotides th a t are com plem entary (ie, they all m ake base pairs) w ith the three nucleotides in the codon. Thus, if the codon sequence were 5'-CAG-3', the com plem entary anticodon on the tRNA w ould be 3'-GUC-5'. The first tRNA contains a three-letter sequence (CAU—the anticodon), w hich is com plem entary to the AUG start codon on the mRNA (Fig. 4-4). M ethionine is the only am ino acid th at has “th a t” anticodon, so it is bou n d to th a t tRNA. This tRNA, w ith its specific am ino acid is then hydrogen-bonded (see C hapter 1) th ro u g h its anticodon to the mRNA at the AUG site. After the tRNA is in place, the o th er (large) ribosom al subunit is brought into place w ith the sm all su b u n it containing the mRNA-tRNA com plex. It is the com plem entary base p airing (hydrogen bonding) betw een the mRNA codon and the tRNA anticodon th a t specifies exactly w hich am ino acid is to be placed in each position as the polypeptide chain is elongated. After the first tRNA finds its com plem entary codon on the mRNA and after both parts of the ribosom e are in place, another tRNA molecule, carrying its specific am ino acid, is then bound to the next codon on the mRNA. This places th at tRNA at a site next to the first tRNA already on the ribosom e. This tRNA m ust have an anticodon com plem entary to the next three bases on the mRNA and will be carrying the specific am ino acid belonging to th at anticodon. In this way, the mRNA specifies the sequence of tRNA molecules and the am ino acids they carry. By specifying the o rder of tRNA m olecules to be placed in the p ro p er position on the ribosom e, the mRNA precisely specifies the order of am ino acids in the growing chain of am ino acids.

64

Genetic Engineering

Figure 4-4 In itiatio n of p ro tein biosynthesis. The tran sfer RNA (tRNA) carrying the first am ino acid (M et) contains an anticodon (CAU), w hich is hydrogen-bonded to the AUG codon at the sta rt of the mRNA on the 30S ribosom al subunit as shown. (Met = m ethionine; Ser = serine; Phe = phenylalanine.)

Making the Polypeptide Chain Once the two correct am ino acids are next to each other, a bond (peptide bond) is form ed betw een the NH 3+ (am ino group) of the second am ino acid and the COOH~ (carboxyl) group of the first am ino acid (see Fig. 2-2). The peptide bond is an especially strong bond (covalent) (Fig. 4-5). After the peptide bond is form ed, the first tRNA, w hich has now lost its am ino acid, is displaced out of its ribosom e nest and

Making and Altering Proteins

65

Figure 4-5 A ddition of the next am in o tran sfer RNA (tRNA)-amino acid com plex an d form atio n of the first peptide bond. After the first am ino tRNA-amino acid complex is in place, the 50S ribosom al subunit is added, and an ad d itio n al tRNA m olecule w ith its attach ed am ino acid is added in the o rd e r p rescribed by the mRNA. A peptide bond is form ed betw een the tw o am ino acids. (Met = m ethionine; Ser = serine; Phe = phenylalanine.)

the tRNA carrying two joined am ino acids (dipeptide) is m oved over to the site w here the first tRNA had been (Fig. 4-6). Then a new tRNA, w hich has an anticodon com plem entary to the next three-letter codon on the mRNA, is bound to the ribosom e. Its associated am ino acid is placed n e a r the dipeptide. A nother peptide bond is form ed betw een am ino acid 2 and am ino acid 3, m aking a tripeptide, following w hich the vacant second tRNA m olecule is displaced.

66

Genetic Engineering

Figure 4-6 E longation of the polypeptide chain. After form ation of the first peptide bond, the initial tra n sfe r RNA (tRNA) falls off, and the next tRNA m olecule m oves over and an additional tRNA-am ino acid is added to the vacant site. The next peptide bond is form ed, and the process begins again. (M et = m ethionine; Ser = serine; Phe = phenylalanine; cys = cysteine)

This process is continued at a rate of up to 900 am ino acids p er m inute until the am ino acids are all a ttach ed in the ord er specified by the mRNA. B ecause the bond betw een the am ino acids is a peptide bond, the long chain is called a p o ly p e p t id e , as noted in C hapter 2. W hen folded into th eir final structure, polypeptide chains are know n as proteins.

The End of Translation At the end of each m essage, a stop codon appears and tells the ribosom e to quit tra n sla tin g (w ithout coding for a tRNA). Synthesis stops, and the newly form ed polypeptide chain is released from the ribosom e. The two ribosom al sub u n its then separate and prepare to start translating an o th er mRNA. D uring and shortly after the translation process (Fig. 4-7), the protein is folded into its proper secondary and tertiary structure. This folding is som etim es helped by o th er proteins, b u t m ainly

Making and Altering Proteins

67

Figure 4-7 T erm ination o t tran slatio n . At the end of the m essenger RNA (mRNA), one of three codons appears (UAA, UAG, or UGA), which signals the end of the m essage. No tran sfer RNA (tRNA) contains a n ticodons to these codons. They provide a signal to the ribosom e to release the final tRNA and to break the bond betw een the tRNA and the grow ing polypeptide chain, as illu strated here. (A bbreviations for the am ino acids are spelled out in the Appendix.)

68

Genetic Engineering

com es about because of the am ino acids th at have been placed in the polypeptide chain. In the next chapter, we will see th at the small changes in the order of the am ino acids in the polypeptide chain can m ake enorm ous differences in p rotein stru c tu re and function. REGULATION

One of the great classical w orks of m usic is D ukas' “The S o rcerers A pprentice.” As the story goes, the apprentice to the sorcerer learns how to m ake the broom s carry w ater for him , but he doesn't learn how to m ake them stop. A flood results and is abated only w hen the sorcerer retu rn s and brings the broom s into control. So it is with the m anufacture of proteins. Cells need to regulate or control the num ber and type of proteins made. This is not only because m aking unnecessary proteins is energetically taxing for the cell, but also because it diverts the cell's functions from making necessary proteins. How is this regulation accom plished? First, note th at only a sm all p o rtion of the DNA in a cell is actually used as a genetic m essage for mRNA. Som e of the rest of the DNA is used for regulatory purposes. Generally, there is a regulatory region next to the region of the DNA used as the gene (the p o rtio n th a t codes for the protein). In bacteria, this entire region—the m essage region plus the regulatory region—is called the operon (Fig. 4-8). The regulation (or control) region acts to control the am ount of mRNA th at is m ade. As previously noted, mRNA is often short-lived. So m ore mRNA of a given type produces m ore of

Figure 4-8 The operon is a u n it of DNA th at contains both a control (regulatory) and a m essage region. The control region is always on the 5' side of the m essage region. The control region regulates the am ount of m essage (mRNA) th at is tran scrib ed from the m essage region of the DNA.

Making and Altering Proteins

69

those proteins. By regulating the am ount of mRNA produced, the cell can control the n u m b er and type of proteins needed w ithin the cell. How does this regulation work? Several different m echanism s are at work to accom plish this. Two examples follow.

Regulatory Mechanisms Negative Regulation The enzym e th at m akes RNA from DNA, RNA polym erase, does not bind to the DNA at random , but carefully selects its startin g point. These startin g points are scattered thro u g h o u t the DNA and are found in the specific regions of DNA m en tioned above-con trol regions. The control region contains a site w here the RNA polym erase actually binds to the DNA next to the m essage p o rtion of the gene. This w orks like a “bookm ark ” to tell the RNA polym erase exactly w here to begin tra n scribing the m essage. But suppose som ething else were already bound to the region w here the RNA polym erase was supposed to bind. Then RNA polym erase w ould not bind and mRNA tra n scription would not take place (Fig. 4-9). The protein th at binds to the region w here the RNA polym erase should bind is called a repressor, and it totally prevents tran scrip tio n of the adjacent m essage region. If the organism needs m ore of the protein that is encoded by the message region, the repressor protein is pulled off th at position by a m olecule called an inducer. Once the repressor protein is rem oved, tra n scription begins, mRNA is produced, and the necessary protein is m ade. W hen enough enzym e has been m ade, the inducer is

Figure 4-9 R egulation in the control region. W hen a repressor p ro tein blocks the RNA polym erase binding site in the control region, RNA polym erase is unab le to a ttach to the DNA and can n o t m ake mRNA in the m essage region. No transcrip tion occurs.

70

Genetic Engineering

rem oved and the repressor retu rn s to its position on the DNA, stopping further m anufacture of the protein. Figure 4-10 portrays the classic exam ple of negative control m echanism . This enzym e is the la c o p e r o n , w hich controls the

Figure 4-10

The lac operon. This is a m ore detailed picture of the control used in a specific case—th at needed to digest m ilk sugar (lactose). The rep resso r p ro tein binds the control region, preventing binding of RNA polym erase. No tra n sc rip tio n occurs. W hen lactose is present, it acts as an in d u cer by binding to the repressor. W ith lactose bound, the rep resso r can n o t bind the control region of the DNA, so RNA polym erase binds there and initiates tran scription of the message (stru ctu ral) genes. One of the enzym es m ade, (3-galactosidase, breaks down lactose, which then cannot bind the repressor. So w hen lactose is present, enzym es to digest it are m ade. W hen lactose is not present, the enzym es to break it dow n are not m ade. This is an exam ple of negative regulation.

Making and Altering Proteins

71

digestion of lactose, a m ilk sugar. W hen lactose (a tw o-ring sugar) is present, it binds to the repressor, w hich causes the rep resso r to fall off the DNA. RNA polym erase can then bind to the site and m ake the mRNA. The mRNA is tran slated into p ro teins, one of w hich is an enzyme, (3-galactosidase, w hich attacks lactose. Lactose is broken dow n into two single-ring sugars, glucose and galactose, both of w hich can be used by the body for energy. W hen lactose is broken down, it can no longer act as an inducer, so the repressor binds the DNA again. This prevents the tra n sc rip tio n of the mRNA th a t produces the enzym e th at breaks down lactose. This sw itching process is repeated as often as needed and occurs generally w hen lactose is present. Som e people who are lactose-intolerant have faulty regulatory m echanism s. This results in too m uch lactose left in the body, w hich can cause pain and nausea. Although this regulatory m echanism is not used in all cases in w hich tran scrip tio n is regulated, it illustrates the kind of n eg a tive control th at the cell uses to m ake sure th a t only the proper am ounts of p rotein are m ade (see Fig. 4-10). This level of control is called tran scrip tion al control, because it occurs at the level of transcription.

Positive Control There is a n o th e r kind of regulation th at is really a p ositive control m echanism . In this case, one of the proteins m ade when the m essage is tran scrib ed m akes a p roduct th at binds to an inactive repressor m olecule and activates it. The activated rep resso r m olecule then binds to the control region. This p revents the RNA polym erase from binding and thus tu rn s off p ro duction of the product. So, in this case, the end p roduct of the transcription regulates the transcription process. A classic exam ple of positive control is the trp (tryptophan) operon (Fig. 4-11). The message region contains the m essage for five different proteins. One of the five proteins is an enzym e needed to m ake tryptophan, one of the 20 am ino acids. W hen o th er sources of try p to p h an dry up, the try p to p h an falls off the rep resso r and causes it to be unable to bind to the control region. The result is th at RNA polym erase binds and transcribes the needed mRNA, from w hich the enzym es needed for m aking tryptophan are translated. These enzymes help m ake tryptophan until there is enough and a little m ore. Then, the excess try p to phan binds to the rep resso r and allows the rep resso r to bind to the control region of the operon once again. This in tu rn pre-

72

Genetic Engineering

Figure 4-11

The trp operon. Excess try p to p h an (trp; one of the 20 am ino acids used in proteins) binds a repressor, giving it the ability to bind the control region of the operon. RNA polym erase cannot bind, and no fu rth er tryptophan is m ade. W hen there is a lack of tryptophan, the repressor does not have tryptophan around, and rem ains inactive as a repressor. RNA polym erase then m akes the m essenger (mRNA) necessary to m ake the enzym es th at m ake tryptophan. This is an exam ple of positive control.

vents RNA polym erase from binding and shuts dow n the m an u facture of tryptophan until it is needed again.

Other Kinds of Regulation There are m any o th er kinds of regulation of p rotein synthesis, m ost of w hich fall outside the scope of our discussion. However, a very im p o rtan t kind of regulation is the regulation of the tra n sla tio n of the mRNA itself. For instance, the n u m b er or kinds of tRNA m olecules can be strictly controlled, resulting in regulation of tran slatio n . The am o u n t of ribosom e p ro duction also greatly affects the am o u n t of tran slatio n . For instance, in

Making and Altering Proteins

73

fast-grow ing cells, ribosom es are produced very rapidly and in a b u n d a n t num bers. In addition, the kinds and stru ctu res of mRNA m olecules also regulate pro tein synthesis, since som e structures of mRNA are m ore easily “read ” on the ribosom e. R egulation of the am o u n ts and kinds of proteins in cells is very im p o rtan t. M uch energy and effort are p u t into regulation m echanism s so th a t all cellular functions take place in the correct order. Som etim es, cells m ake m istakes, w hich are very costly to the cell and to the body. For instance, m any kinds of cancer are really m anifestations of the cells inability to regulate its own affairs. Things get turned on and just don’t seem to stop. The result is overproduction of cells th a t are often not well form ed and do not function properly. MUTATIONS

W hat w ould happen if there w ere a change in one or m ore nucleotides in the regulatory region or in the m essage region of the operon? A m u tation occurs. From tim e to tim e, we see on TV grotesque hum anoids derived from Hollywood’s im agination. These beings, which bear little resem blance to anything living or dead, are called m utan ts. We are never told exactly w hat this term m eans. B ut we know th a t som ething in th eir genetic m akeup has gone awry. A m u tatio n occurs w hen there is a change in one o r m ore nucleotides in a gene or in the area of DNA th a t regulates tra n scription of the gene. In spite of the cells’ best proofreading and rep a ir efforts, m u tatio n s occasionally do occur. A n u m b er of factors—m any yet unknow n—can cause changes in sequence in the DNA. These m u tatio n s in tu rn m ay cause the mRNA to be faulty, w hich in tu rn causes the w rong am ino acid(s) to be placed in a protein. D epending on w hich am ino acid is affected, the change in the protein m ay not be noticed, m ay be dam aging to the protein, or m ay even be lethal.

Point Mutations A p oin t m u tation is a change o r su b stitu tio n in a single base, w here, for instance, an A m ight be su b stitu ted for a G. Such a su b stitu tio n m ay not be in the entire base; perhaps an atom or two are m erely rem oved from the base. F or instance, if we look at the structure of cytosine and uracil (see Fig. 4-12), we can see th at by m erely rem oving the am ino group (NH2) of cytosine and

74

Genetic Engineering

Figure 4-12

M utation betw een cytosine and uracil. If som e event (such as u ltraviolet [UV] light) causes the am ino group (NH2) to be rem oved from the cytosine and it is replaced w ith an oxygen, uracil is form ed. This often h appens in n atu re, b u t uracil does not belong in DNA and m ust be rem oved by special enzym es. If uracil is left in the DNA, tra n sc rip tio n gives codons w ith an A w here there should have been a G and results in a m u tan t protein.

attach in g an oxygen instead, a different base, uracil, is form ed. This happens frequently all by itself. As a result, DNA has a special enzym e to check for this change (rem em ber th at uracil does not belong in DNA). D am age to DNA is often caused by rad iatio n or chem icals. X-rays, gam m a rays, ultraviolet light, and various chem icals can cause m utations. No m atter w here we turn, som e food additive or chem ical th at we have relied on is show n to cause m u ta tions in the DNA. Even the way we cook our foods, such as frying or broiling at high tem peratures, can m ake substances th at cause m utations. These causative agents are called m utagens. The results of m utations can be m ild disorders, m ild chronic diseases, very severe diseases, aggravated disability, or death. T here are three different categories of point m utations: base substitution (m ost com m on), base deletion, and base insertion.

Base Substitution Only w hen a m u ta tio n occurs in a germ c e ll (an egg or sperm cell) can it be transm itted from parents to children. Possibly the m ost com m on m u tatio n is b ase su b stitu tion , in w hich one nucleotide is substituted for another. This produces a m issen se m utation or in som e cases a n on sen se m utation (Table 4-1).

Making and Altering Proteins

75

Table 4.1 Various Kinds of Mutations Residuenumber Normal ß gene

1

2

3

4

5

6

7

8

9

10

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCC Val His Leu Thr Pro Glu Glu Lys Ser Ala

(a) Missense mutation

GTGCACCTGACTCCTGTGGAGAAGTCTGCC Val His Leu Thr Pro Val Glu Lys Ser Ala

(b) Nonsense mutation

GTGCACCTGACTCCTGAGGAGTAGTCTGCC Val His Leu Thr Pro Glu Glu Stop

(c) Frameshift mutation G T G C A C C T G A C I U C C T G A G G A G A A G T C T G C C by deletion

(d) Reversion

Val

His

Leu

Thr| Leu deletion

Arg

Arg

Ser

Leu

GTGCACCTGACDCCTGAGGCAGAAGTCTGCC Val His Leu Thr| Leu Arg ^ Lys Ser Ala deletion insertion

Abbreviations for amino acids are spelled out in the Appendix.

Sickle Cell A n e m ia—A G e n e tic D isease

One of the m ost widely studied of the genetic diseases caused by a base su b stitu tio n is sick le c e ll anem ia. It affects ab o u t 1 in every 250 African A m ericans and norm ally causes death before age 30. Sickle cell anem ia is a disease th at m akes the red blood cell look like a crescent m oon (sickle cell), ra th e r th an having the plum p and round shape of a norm al cell (Fig. 4-13). W ithin sickle cells, the protein (hem oglobin) th at carries the oxygen from the lungs to the p eripheral parts of the body has been dam aged. H em oglobin contains four separate polypeptide chains of am ino acids. Two chains are identical, containing 141 am ino acids each. The o th er tw o are identical and contain 146 am ino acids. In sickle cell hem oglobin, the longer chains have a different am ino acid at position 6 com pared w ith norm al hem oglobin: N orm al hem oglobin

Sickle hem oglobin

76

Genetic Engineering

Figure 4-13 N orm al erythrocyte (red blood cell) and sickled ery th ro cyte. The shape change is caused by the change in a single am ino acid in the hem oglobin m olecules in the sickled cells

w here Val = valine, His = histidine, Leu = leucine, T hr = th re o nine, Pro = proline, Glu = glutam ic acid, Lys = lysine (6 of the 20 com m on am ino acids). Thus, sickle cell anem ia, which is fatal to thousands of Africans and African Am ericans each year, is the result of the substitution of a single am ino acid in two of the four long polypeptide chains of hemoglobin. This single change is caused by a m utation in the gene that codes for the larger chain in hemoglobin. From the inform ation we have ju st discussed about protein synthesis and looking at the codons shown in Figure 4-1, we can see th at in the gene, a single codon m ust have been changed from eith er a GAA or a GAG, w hich codes for the am ino acid Glu, to a GUA or a GUG, w hich codes for the am ino acid Val. This su b stitu tio n of a single nucleotide (A —> U) out of the 438 used by the gene to code this polypeptide chain causes a m u ta tion th at is ultim ately lethal to the individual.

Making and Altering Proteins

77

This single am ino acid change can alter the entire structure of the cells, as show n in Figure 4-13. How does this com e about? G lutam ic acid (Glu) is a negatively charged am ino acid and can hydrogen-bond w ith water. It is replaced by an am ino acid th at has no charge (Val) and is very hydrophobic (w ater-hating). Then at position 6, instead of a charged, water-loving side chain, there is a w ater-hating side chain. This region of the polypeptide chain is exposed to the w ater in the cell and, because of the change, now tries to hide from water. It does this by binding w ith a neighboring hem oglobin m olecule th at has a sim ilar hydrophobic patch. The result is th at the hem oglobin m olecules g a th e r to g eth er in large bunches and can't carry oxygen well at all. So the person who has this disease literally suffocates, because he or she cannot get oxygen out to the cells in the body. O ther G e n e tic Disorders

Sickle cell anem ia is but one of m any genetic disorders. In some of these disorders, the causes are know n, such as in sickle cell anem ia. Som e have been m apped to specific p arts of the hum an gen om e (hum an genetic m aterial found in the chrom osom es in all h u m an cells). The genes for o th er diseases have now been identified as well. For instance, cystic fibrosis, a devastating disease th a t afflicts 30,000 children and young adults in the U nited States alone, is caused by a genetic disorder. The gene responsible for this diso rd er has now been found on ch ro m o som e 7 in the hum an genome. Genes responsible for m any other genetic disorders have also been identified (Table 4-2). W ith alm ost any protein in any cell, the sam e scenario can be repeated. By changing a single am ino acid, the characteristics of the active sites of enzym es m ay be altered. In o th er cases, the stru c tu re of the entire pro tein m ight be changed. The result is th a t the m u ta tio n in the DNA m ay cause n onfunctional or only partially functional proteins to be m ade. In addition to m utations in the gene, m u tations m ay occur in the region of the DNA th at regulates the tra n sc rip tio n of the gene. In these cases, the prim ary sequence of the protein itself m ay rem ain unchanged, but e ith er too little or perhaps too m uch protein is m ade. This causes another set of problem s.

Bose Insertion and Bose Deletion A nother kind of m utation is that in which a nucleotide is deleted from the gene, o r a new nucleotide is inserted. It is possible that a m istake is m ade while the DNA itself is initially replicated and

Genetic Engineering

78 TABLE 4.2

Common Genetic Diseases*

Inborn Errors of Metabolism

Approximate Incidence Among Live Births

Cystic fibrosis (m utated gene unknow n) D uchenne m uscular dystrophy (m utated gene unknow n) G aucher's disease (defective glucocerebrosidase) Tay-Sachs disease (defective hexosam inidase A) Essential pentosuria (benign condition) Classic hem ophilia (defective clotting factor VIII) Phenylketonuria (defective phenylalanine hydroxylase Cystinuria (m utated gene unknow n) M etachrom atic leukodystrophy (defective arylsulfatase A) G alactosem ia (defective galactose-1-phosphate uridyl transferase)

1/1600 w hites 1/3000 boys (X-linked) 1/2500 Ashkenzi Jews, 1/75,000 others 1/3500 Ashkenazi Jews, 1/35,000 otners 1/2000 Ashkenazi Jews, 1/50,000 others 1/10,000 boys (X-linked) 1/5000 am ong Celtic Irish, 1/15,000 others 1/15,000 1/40,000 1/40,000

Hemoglobinopathies

Approximate Incidence Among Live Births

Sickle cell anem ia (defective /3-globin chain)

1/400 US blacks; in som e West African populations the incidence of heterozygotes is 2/5 1/400 am ong some M editerranean populations

/3-thalassemia (defective /3-globin chain)

*Although m ost of the over 500 recognized recessive genetic diseases are extrem ely rare, in com bination they represent an enorm ous burden of hum an suffering, as is consistent with m endelian m utations, the incidence of som e of these diseases is m uch higher in certain racial groups in others.

a nucleotide is left out or an extra one inserted. Such m istakes do occur, but only rarely (about 1 in 10 billion). However, even such a low rate of erro r has a m easurable effect on the m u ta tions th at occur.

Making and Altering Proteins

79

Insertion or deletion m u tan ts are alm ost always lethal, because they cause w hat is know n as a fram e-shift m utation. Recall how the genetic code is set up. There are codons th at each contain three letters, all next to one another with no spacer betw een them . So a deletion or add itio n of a single nucleotide will change every codon behind it. As an exam ple, look at this sequence in mRNA:

giving the am ino acid sequence:

w here Lys = lysine, Ser = serine, T hr = threonine, Pro = proline, Arg = arginine, Phe = phenylalanine. If we delete the fourth A, we have

w hich gives us:

w here Lys = lysine, Ala = alanine, Leu = leucine, Arg = arginine, Asp = aspartic acid, Ser = serine. This creates an entirely different sequence. Not only is the second am ino acid altered, but all of those that follow are altered as well. Almost certainly such a m u tatio n w ould lead to a protein th at will be enorm ously different from the native structure and this often causes death. However, there can also be a reversion, in w hich a base su b stitution retu rn s to the original base, or an insertion is com pensated for by a base deletion nearby, o r vice versa. In the latter cases, the fram e shift is reversed, and the rest of the p rotein is like the native protein. This often allows the organism s to continue w ith an alm ost norm al life cycle.

Neutral Mutations Som e m u tatio n s change only a single nucleotide into another, but the am ino acid for w hich it will code rem ains the sam e. For instance, CTA m ight be changed to CTG, but both of these code for Leu. These changes are then silent. If a m u tatio n occurs in

80

Genetic Engineering

w hich one am ino acid is su b stitu ted for a n o th e r b u t does not affect protein activity, it is called a n eutral su b stitu tio n or neutral m utation. From the exam ples in Table 4-1, we can see th a t som e m u ta tions m ay be very harm ful. However, a beneficial side to m u ta tions should be m entioned. In one-celled organism s and higher form s of life, the environm ent aro u n d them changes and som etim es becom es so harsh or changes so m uch th a t the norm al b acteria or organism s can n o t live. O ften m u tan ts have been form ed th at seem able to resist the negative effects of the new environm ent and can then live in the new surroundings. Som etim es the num bers and kinds of m u tatio n s increase as a result of the environm ental pressures. For these reasons, it is good to have som e m utations. Of course, one of the problem s stem m ing from m utations is th at some organism s are becom ing resistant to antibiotics and other drugs. SUMMARY

G enetic in fo rm a tio n th a t is sto red in the ch ro m o so m e is used to m ake p ro te in s of any type or v ariety th a t the cell needs. Once the need is a p p a re n t, the cell calls on th e DNA to p ro d u ce a piece of mRNA c o n ta in in g th e n ecessary in fo rm a tion. This mRNA is th en tra n s p o rte d to the rib o so m e, w here the tRNA m olecules b e a rin g c o rre c t am in o acids b in d to it in accordance w ith the genetic m essage c o n ta in ed in the mRNA. Peptide bonds are form ed betw een ad jacen t am ino acids, p ro d u cing a long ch a in of a m in o acids, the po ly p ep tid e ch ain . This ch a in th en folds in a specific m anner, an d a p ro te in is born! The m an n er in w hich the am o u n t of p rotein is regulated is very complex. There can be eith er a positive or a negative control system, or perhaps o ther types. It is im portant to realize th at the translating system is not always m aking all the proteins in a cell, b u t is lim ited to m ake those th a t the cell needs at a p articular time. There are two fundam ental ways in w hich the m anufacture of proteins in cells and organism s m ight be dam aged. First, m u ta tions m ay be present w hich cause the proteins th at are m ade to be unsuitable for their purpose. In these cases, severe disease or death m ay result. A m u tatio n m ay occur in the control region, or there m ay be a m u tatio n in the rep resso r m olecule. U nder these circum stances, the control of tra n sc rip tio n is dam aged,

Making and Altering Proteins

81

deregulating the cell. Such can result in diseases like cancer or p erh ap s diseases in w hich certain proteins are lacking alto gether. In either the case of m utation of the proteins, or dam age of the control m echanism s, severe problem s can result.

5 ALTERING GENETIC MATERIAL IN BACTERIA WHAT YOU WILL LEARN IN THIS CHAPTER

• • • • •

The com position of bacteria How bacteria exchange plasm ids and chrom osom al m aterial naturally How plasm ids can be extracted from bacteria and isolated How new pieces of DNA can be inserted into old plasm ids by “cutting” and “pasting” How plasm ids containing new DNA can be put back into bacteria

Up to this point we have learned about the way in w hich nucleic acids and proteins are m ade and how cells regulate these functions. O ur real purpose in this book is to discuss how to change the genetic info rm atio n th a t will result in changes in the p ro teins that are m ade or in the way a cell operates. Most often, this effort is directed tow ard changing a certain p rotein to m ake it functional. It is im p o rtan t th at we sta rt by m aking genetic changes in bacteria, because they are fairly sim ple living organism s. B acteria are p a rt of a large group of organism s called prokaryotes (single-celled organism s that don't have nuclei). We discuss bacteria and higher-order cells here because th eir functions are 82

Altering Genetic Material in Bacteria

83

relevant in genetic engineering. (However, a com plete discussion of all th eir functions w ould push us well outside the scope of this book.) In later chapters, we will discuss m ore complex cells, such as those from plants and anim als and those from hum ans. These cells are called eukaryotes. WHAT ARE BACTERIA?

B acteria are tiny living organism s of different sizes and shapes. They are found everyw here. Television ads often call them germ s, although this term is also applied to viruses. B acteria are single-celled structures, w hich are entirely capable of m ain ta in ing and reproducing themselves. They can be found living under the m ost difficult circum stances, such as in the hot ponds in Yellowstone Park and in therm al chim neys deep in the ocean, as well as in the cold glaciers of the m ountains. B acteria live on alm ost any kind of food and adapt well to diverse environm ents, including oil spills and m ine tailings. Although these u biquitous little creatures cause illness from tim e to tim e, b acteria are extrem ely useful to m ankind and essential for o u r well-being. For instance, bacteria help us extract energy m ake building blocks from the food we eat. W ithout those bacteria, we w ould not be able to use a lot of the food we eat. We need to look at them m ore closely, not only because they are im p o rtan t for life, but because they are especially im portant for genetic engineering purposes. B acteria contain all the com ponents and m achinery necessary for sustaining life and for reproducing them selves. They function in a m uch less complex m anner than we do, but the m ethod is there. So, bacteria are often used as the w indow s th rough w hich we observe the p attern s of living things. Moreover, they grow fast (with progeny born every 20 m inutes u nder good conditions) and econom ically, and, as yet, no one has loudly com plained ab o u t opening up and studying these creatures and using them to find out w hat life is all about. A typical bacteriu m is show n in Figure 1-4. C ertain portions are labeled to show som e of the organelles (specialized cells) necessary for the sustaining and continuation of life. In bacteria, the blu ep rin t of life—DNA—is found in the ch rom osom e. As previously discussed, this genetic inform ation is tran sferred through a m essage to the ribosom e m achinery in which proteins are m an u factu red according to the exacting specifications contained in the DNA blueprints.

84

Genetic Engineering

Chromosomes and Plasmids L ets talk a bit m ore about the chrom osom al m aterial of b acteria. Not m uch pro tein is associated w ith this DNA, certainly not as m uch as in eukaryotic cells. M ost of the tim e in bacteria, the DNA is found in a large circular, double-stranded form . The DNA in the chrom osom e contains a n u m b er of segm ents called gen es, each of w hich contain the code for a p a rtic u la r protein. For this reason, the chrom osom al m aterial in a cell is often called the gen om e (gene + chrom osom e). These genes w ithin the genom e w ere referred to in the last ch ap ter as “m essage regions” of the DNA. In addition to the m ain chrom osom e, a n o th e r type of DNA is often found in bacteria. This DNA is extrem ely useful for the well-being of the cells. It com es in sm all, c ircu lar stru ctu res called p lasm id s (som etim es dubbed m in ich rom osom es). Plasm ids co ntain certain highly specialized genes. Specifically, the sex factor of bacteria is found in plasm ids and also genes that code for antibiotic resistance. Plasm ids are of great interest to us, because they are fairly sim ple in stru c tu re and easy to extract from bacteria. Probably m ore im p o rtan t is the fact th at w hen plasm ids are isolated, we can alter them as needed (as we will show) and then reinsert them into the bacteria. The bacteria then treat these rein serted plasm ids as p a rt of them selves, and the plasm ids are duplicated as the cells divide. As already noted, w ithin som e plasm ids are regions of genes that give bacteria resistance to certain antibiotics. So if we were to look closely at a plasm id, we m ight find the organization shown in Figure 5-1, with areas that provide resistance to am picillin (Apr), and tetracycline (Tcr). The plasm id is an ideal structure for genetic engineers for two reasons: (1) it contains genetic inform ation used by the bacteria, and (2) the plasm id itself is not essential to bacterial functions. So, it is possible to m anipulate this DNA w ithout upsetting the bacteria. BRIN G IN G NEW DNA INTO OLD BACTERIA

How is m an ip u latio n of genetic m aterial in a b acteriu m to be done? Som etim es it happens naturally. For instance, from tim e to tim e bacterial cells go through a process called conjugation, in w hich they share genetic m aterial (Fig. 5-2). They becom e attached through a p ilu s (a hollow tube th at connects the cyto-

Altering Genetic Material in Bacteria

85

Figure 5-1

The genetic m ap of a plasm id show ing sites w here som e of the restrictio n enzym es (e.g., E c o R l , P s tl and B a m HI, discussed later in this ch ap ter) cut the plasm id. The arrow s w ith labels Tc1 and Apr indicate the regions th a t provide the bacteria w ith resistance to tetracycline and am picillin. This plasm id has 5400 bases (kb = kilobases, thousands of bases).

plasm of the two bacteria), and DNA is tran sferred from one bacteriu m to the other. D uring the conjugation process, a full plasm id o r m erely a piece of it m ay be tran sferred . In this way, bacteria can exchange resistance to antibiotics and o th er traits th a t will help them w ith stan d the rigors of th eir environm ent. At tim es, even portions of the b acterial chrom osom es are transferred as well. In addition to conjugation, plasm ids can som etim es be inserted into b acteria ju st by being present in the culture m edium . This is called p lasm id transfer. These plasm ids move into the b acteria through pores in the m em branes. Som e bacteria are able to do this m ore readily than others. Once inside, the plasm ids som etim es recom bine w ith the bacterial chrom osom e. At som e later tim e, the plasm id m ay be expelled from the DNA

86

Genetic Engineering

Figure 5-2 C onjugation briefly m ates b acteria, and, in the process, DNA from one b acteriu m is tran sferred to the other, as show n. Note th at a sex factor in a plasm id is tran sferred into a bacteriu m not containing th at factor. In this sam e way, antibiotic resistance genes as well as others can be transferred from one bacterium to another.

Altering Genetic Material in Bacteria

87

and form a sm all circu lar plasm id again. As it leaves, it m ay carry w ith it a po rtio n of the cellular chrom osom e, or it m ay leave a bit of itself behind in the chrom osom e. In e ith er case, the genetic in form ation of both the chrom osom e and the plasm id is altered. These kinds of genetic alteratio n s give b acteria the ability to adapt to environm ental stresses and changes, w hich give rise to the wide variety of b acteria found. In cases of an tibiotic resistance, the alteratio n s are acts of self-preservation for bacteria, but may present a problem for us. This is becom ing increasingly a p p a re n t as m ore varieties of an tib io tic-resistan t bacterial strain s are developing, w hich m ake diseases they cause h a rd e r to treat (e.g., tuberculosis) THE TOOLS O F GENETIC ENGINEERING

W henever free DNA is taken into bacteria from the surrounding environm ent, transform ation occurs. The ability to take in DNA thro u g h the m em branes varies betw een bacteria. Those th at readily allow DNA to en ter are called c o m p eten t cells. In n atu re, exchange of genetic info rm atio n occurs continually, through both conjugation and transform ation. Genetic engineering of a bacterium takes place when a bacterial chrom osom e or plasm id is changed by design. In this process, we actually decide w hat kinds of changes we w ish to m ake and th en go about the process of m aking them . If we can take som e DNA from plasm ids or o th er bacterial chrom osom es and m odify it in a know n m an n er and then put th a t DNA inside the cells DNA, we have th en caused a change to occur in the cells DNA. The easiest way to do this is to use one of the natural m ethods of tra n sfo rm atio n —plasm id transfer, as illustrated in Figure 5-3. In o rd er to engineer changes in DNA and insert the changed DNA into bacteria, there are several things we need to learn to do. The overall objective at this stage is to place a piece of new DNA in b a c te ria in o rd er to have the b acteria m ake a protein th a t they w ould n ot usually m ake. So we need to do the following: 1. 2. 3.

E xtract plasm ids from bacteria. Cut the plasm ids open in specific regions. Insert a piece of DNA into the plasm id.

88

Figure 5-3

Genetic Engineering

D iagram m atic overview of placing new DNA into a b acterium . First, the plasm id is opened at a specific site; new DNA is inserted into the gap and then bound to the plasm id. The altered plasm id is then placed into b acteria. The addition of the new DNA transform s the bacteria into bacteria having different characteristics.

Altering Genetic Material in Bacteria 4. 5.

89

Fuse (bond) the new DNA to the old DNA and close the plasm id circle. In sert the plasm id into the b acteria and have the b acteria m ake the new protein.

It sounds com plicated at first, b u t som e neat tools have been developed to help us do this well.

Electrophoresis If we are going to cut, insert, and glue pieces of DNA to one another, we need to be able to “see” the DNA. A lthough we m ight try to look at the DNA w ith an electron m icroscope both before and after the DNA was cut, this m ethod is slow and technically difficult and really does not have sufficient resolution to tell us if we cut the DNA at the right place. However, a neat technique has been developed by w hich DNA pieces can be “seen.” In this technique, we don't look at the pieces directly, but we can tell how long they are. This m ethod is called electrop h oresis. E lectroph oresis is one of the m ost useful techniques in all of genetic engineering. It uses electrical cu rren t to separate pieces of DNA having different lengths. To use this technique, we first m ake a p olym erized acrylam id e g el slab by p ouring a solution of acrylam ide betw een two glass plates. The edges of the plates have been sealed so the acrylam ide solution doesn't leak out before it sets, like gelatin. A crylam ide is a sm all m olecule, w hich, w hen p u t in the right solution, attach es to others like itself, m aking a long chain (polym er) of acrylam ide m olecules. This is com m only called polyacrylam ide. Before it polym erizes, acrylam ide is m uch like any other liquid solution. After polym erization occurs, it m akes a m icroscopic m esh of polyacrylam ide fibers. Before it sets, we place a special com b in the top to give notches in the top of the polyacrylam ide slab, w hich ends up looking like a castle wall. The notches are called w ells, and this is w here we p u t ou r sam ples (Fig. 5-4). The glass plates w ith the polyacrylam ide gel slab betw een are now placed in an a p p a ra tu s th at contains an u p p er and low er reservoir to hold salt solutions th a t tran sm it electrical cu rren t from a pow er supply (Fig. 5-5). Each DNA sam ple is placed carefully in a sep arate well. R em em bering th at DNA is negatively charged owing to all of the p h o sp h ate groups in the sugarph o sphate backbone, we p u t the positive electrode in the low er reservoir. W hen electrical voltage is applied, it causes the nega-

90

Genetic Engineering

Figure 5-4 D iagram show ing how polyacrylam ide gels are m ade. Two glass plates are slightly sep arated , and a solution of acrylam ide is poured betw een them . The solution polym erizes (like gelatin), form ing a mesh-like stru ctu re betw een the plates. A com b is used to create wells into w hich DNA sam ples can be placed. These gels are used to separate DNA pieces of different length. S m aller pieces move th ro u g h the gel faster because the longer pieces of DNA get tangled in the acrylam ide gel strands m ore readily than the sm aller pieces do.

tively charged DNA to be pulled dow n th ro u g h the gel tow ard the positive electrode. B ecause the gel is a m icroscopic m esh, the larger pieces of DNA move m ore slowly th an the sm aller ones because they keep bum ping into the polym erized acrylam ide on the way through. The result is th a t the DNA fragm ents are separated, w ith the sm allest fragm ents moving the greatest distance. L ets take a sam ple of w hole DNA (plasm ids w ork fine) and then the sam e DNA sam ple th a t has been cut w ith an enzym e.

Altering Genetic Material in Bacteria

91

Figure 5-5 A polyacrylam ide gel electrophoresis apparatus. The gel is still betw een two glass plates, w hich are then placed in a container that allows a solution to be on the top and bottom of the gel. E lectrodes are placed in the solution, and the DNA sam ple is placed in the wells. The electrical potential betw een the top and the bottom pulls the negatively charged DNA through the gel to the positive electrode.

Let's place these sam ples in adjacent wells in an electrophoresis ap p aratu s. Then we tu rn on the pow er supply and allow the voltage to pull the DNA thro u g h the gel. This w ould allow us to “see” how m any fragm ents of DNA w ere m ade upon cutting the DNA with the enzyme.

Stain Technique How do we "see” the DNA fragm ents in the gel? Actually, there are several ways to do this. The m ost com m on m ethod is to use a stain, w hich colors the DNA and not the gel. This m ay give us a pattern th at w ould look like th at in Figure 5-6.

Radioactive Technique A nother very useful way to see DNA is to use DNA th at has been m ade slightly radioactive. This can be done readily using a special enzym e th at su b stitu tes a radioactive p h osphorus (32P) for the p h o sp h o ru s on the 5' end of any DNA. Then, the radio-

92

Genetic Engineering

Figure 5-6 Diagram of a p attern from a plasm id th at m ight be found after cu ttin g the plasm id, electrophoresis, and staining. Note th at the plasm id fragm ents are both sh o rte r th an the plasm id itself and will move faster through the gel, w ith the shortest fragm ent being closest to the bottom of the gel. After electrophoresis, the gel is rem oved from the glass plates, and the gel is soaked in a solution containing stain. The ink-like stain binds only to the DNA and not to the gel itself, so the DNA shows up as dark bands.

actively labeled DNA is put in the slots in the gel, and the pow er supply is tu rn e d on. After a period of tim e, d uring w hich the DNA moves th rough the m icroscopic m esh of polyacrylam ide fibrils, the polyacrylam ide gel slab is rem oved from betw een the glass plates and placed on a piece of x-ray film. The film with the gel next to it (generally w ith a piece of plastic w rap m aterial betw een) is allow ed to rem ain in the dark for several hours to expose the x-ray film. W herever radioactivity is present, the x-ray film is exposed, leaving a black spot. So the sam e kind of p a tte rn appears a > th at w hich appears on the stained gel (Fig. 5-7). The electrophoresis technique gives us size inform ation on the DNA fragm ents produced w ith ou r scissors. These enzym e scissors are very specific for certain places on the DNA and will cut DNA now here else. They are called r e s t r ic t io n e n d o n u c le a s e s . The term “re stric tio n ” com es from th eir being restricted to

Altering Genetic Material in Bacteria

93

Figure 5-7 Visualizing DNA pattern s using a radioactive label. In this case, the DNA is labeled w ith a radioactive tracer (norm ally 32P), w hich travels w ith the plasm id or the fragm ents of the plasm id. After electrophoresis, the gel is rem oved from the glass plates, and the gel is then placed next to x-ray film in a h older and allowed to expose the film in the dark for a few hours. The film then shows the places where the DNA is in the gel. This technique is m uch m ore sensitive (th at is, can “see” m uch sm aller am ounts of DNA) than staining.

94

Genetic Engineering

specific places on the DNA. “Endo-” m eans they can cut the DNA anyw here betw een the ends (see section on C utting Plasm ids Open). Now th a t we have this neat tool at o u r disposal, lets retu rn to the bacteria. OBTAINING PLASMIDS FROM BACTERIA

We need to grow bacteria th at have usable plasm ids in them . We can obtain startin g cultures of special b acteria containing specific plasm ids from com m ercial supply houses. We can th en grow these b a cteria in a culture ju st like wild-type bacteria. They can th en be harvested and broken open to release the plasm ids. Once the cells are broken open, the DNA is separated from the rest of the cell m aterial, following w hich a solution of it is layered on top of a dense solution in a centrifuge tube. (A c e n trifuge is a m achine th a t can spin a rotor, w hich holds centrifuge tubes, at high speeds and cause the heavy m aterial to go to the bottom of the tube.) This tube is spun at high rates of speed in the centrifuge for several hours, during w hich the plasm id DNA separates from the chrom osom al DNA because its density is different from th a t of the chrom osom al DNA. These bands of DNA can be seen w ith ultraviolet light. We can then extract the b and of plasm id DNA by poking a needle into the plastic centrifuge tube and sucking it out w ith a syringe (Fig. 5-8). The plasm id obtained can be p recipitated (settled) out of the dense solution by using ethanol (alcohol), w hich causes all the DNA to clom p together. The precipitate is then redissolved in the a p p ro p riate solution, and we have the desired plasm ids in solution. There are o th er ways to isolate plasm ids, but for our purposes this one works ju st fine.

Cutting Plasmids Open Next, we need to find a pair of scissors to cut the plasm id exactly w here we w ant. We have already m entioned these scissors before. They are restrictio n endonucleases. The requirem ents are th a t the scissors m ust be very, very sm all, since we need to cut the p h o sp h o d iester bond (see C hapter 3) at a specific location. These tiny scissors have to have “eyes” of th eir own and actually pick the sites they will cut to allow us to distinguish individual nucleotides.

Altering Genetic Material in Bacteria

95

Figure 5-8 S ep aratio n of plasm id and chrom osom al DNA using the centrifuge. A dense solution of cesium chloride (CsCl) is placed in a centrifuge tube, and the sam ple co n tain in g DNA is placed on the top, after w hich the tube is spun for several hours. C hrom osom al DNA is less dense th an plasm id DNA, so they separate into two separate bands, w hich can be seen in ultraviolet (UV) light. The tube is then pun ctu red in the side w ith a syringe to remove the pure plasm id DNA.

F or instance, suppose one sm all section of the DNA looked like this: -AGGCTGGAATTCCGCTTA-TCCGACCTTAAGGCGAATAnd suppose th a t we w anted to split it right betw een the two “Ts” next to each o th er on the u p p er stra n d and the two neighboring “As” on the lower strand. M other N ature has come to the rescue. It turns out that one of the defense m echanism s th a t b acteria have against viral infection is a special set of enzym es th a t look for and cut invading, n o n bacterial DNA in very specific places. These enzym es, the restriction endonucleases, were discovered in the 1950s and isolated in the 1960s and later. Exactly how these enzymes find and cut these foreign DNA m olelcules is som ething to discuss a n o th e r day. However, over 700 kinds of restrictio n endonucleases have been discovered, and m ore are still being discovered. Each of these enzym es cuts DNA specifically at a unique site, w hich depends entirely on a p a rtic u la r sh o rt sequence of nucleotides in the DNA. L ets look at two examples.

96

Genetic Engineering

EcoRI The first restrictio n endonuclease th a t was discovered is called E c o R I. This enzym e was discovered in Escherichia coli (a bacterium ); hence, its nam e. EcoRI specifically looks for regions (recognition sites) in DNA th at have the sequence:

Once the recognition site has been found, the enzym e binds to th at region and then cleaves (splits) the DNA in a very specific way. The arrow s in Figure 5-9 a show w here the cuts will be m ade. Note th at the resulting DNA fragm ents have ends th at are overlapping, as show n in Figure 5-9b. Often these overlapping ends are called sticky ends, because they tend to hydrogen-bond to th eir c o u n te rp arts really well. M any of the restrictio n endonucleases m ake these sticky ends, but the nu m b er and sequences of nucleotides in the sticky ends are different, depending on w hich restriction endonuclease was used to cut the DNA.

Hpa I The other endonuclease that we will use for an exam ple is called H pa I. It will only cleave DNA that has the following sequence:

This enzym e recognizes only the sequence show n and binds to th at region of any DNA. Then cleavage occurs. Note th at in this case, the pro d u ct does not leave overlapping ends, b ut gives blunt or flush ends. See Figure 5-10 for an illustration of w hat a small piece of DNA cut w ith Hpal w ould look like. M any o th er restrictio n endonucleases also give blunt ends, each cleaving at a specific site having a different sequence. All the endonucleases th at we will discuss will give eith er sticky ends or blunt ends. Since there are over 1000 different enzym es to choose from (you can buy m any from a biochem ical supply com pany), you can choose just about any p articular sequence of DNA you w ant as a potential cleavage site and find an enzyme to cleave it there.

Altering Genetic Material in Bacteria

97

Figure 5-9 How restrictio n endonucleases (restriction enzym es) cut DNA. (a) A piece of DNA containing three recognition sites for a restriction enzym e. These are the blocks on the ribbon. A restriction enzym e binds only w here the specific sequences it recognizes occur. In this case, it has to be an GAATTC, as show n, (b) Once the restrictio n enzym e binds the recognition site, it cleaves betw een two specific n ucleotides—in this case betw een G-A. This fragm ents the DNA at this site, leaving overlapping (or sticky) ends. Each restriction enzym e recognizes and cleaves DNA in only those places th at contain a specific sequence of nucleotides th at the restriction enzyme recognizes.

98

Genetic Engineering

Figure 5-10 An exam ple of a piece of DNA cleaved by a restrictio n enzym e (H p a I) th a t recognizes the sequence GTTAAC and cleaves betw een the last T and the first A (in a 5' to 3' direction). The product is DNA th at has blunt ends.

INSERTING NEW DNA INTO PLASMIDS

The next step in engineering DNA is to pu t a new piece of DNA into a plasm id and p ut it into w orking ord er again. B ut w here do we get the new DNA? Possibly from som e o th er organism . But there are lim itations. Or, we could m ake the new DNA chemically. It is possible to buy chem ically synthesized DNA pieces th at co n tain up to 100 nucleotides. These pieces of DNA are m ade from individual nucleotides and coupled in an in stru m e n t th a t form s the p h o sp h o d iester bonds betw een the nucleotides. These nucleotides are placed in the sequence th a t you w ant. So, it is possible to go to biochem ical supply com panies and buy sh o rt segm ents of DNA having any sequence. T herefore, depending on w hat we w ish to do, we m ust eith er o b tain DNA from a n o th e r source or synthesize the pieces we need. If we are going to cut a piece of DNA from a n o th er source, we will have to know enough ab o u t th a t source to know the location of the appropriate restriction enzym e cleavage sites aro u n d the DNA we w ant. Suppose we knew th a t a po rtio n of the DNA looked like th a t show n in Figure 5-11. By using th a t restrictio n endonuclease CEcoRI), we w ould get the piece of DNA th a t we w ant and w ould know its size. So by ru n n in g the DNA fragm ents on an electrophoresis gel and using com m ercially available size m arkers, we should be able to identify the fragm ent we w ant (Fig. 5-12). W hen we have identified the b and (fragm ent) we w ant, the DNA can be rem oved from the gel by finely m incing the gel, dissolving the acrylam ide, and then precip itatin g the DNA out of the solution using ethanol. In this way, we can purify a p a rtic u lar band of DNA. The isolated DNA could be a gene for a protein, b ut for the m om ent it m ay be ju st any piece w ith a given sequence. If we

Altering Genetic Material in Bacteria

99

Example using restriction enzymes to isolate a piece of DNA. Two EcoRl sites flank the fragment of DNA to be isolated. By cleaving the DNA with EcoRI, the desired fragment of DNA is removed from the longer piece of DNA (only a portion of which is diagrammed). Using gel electrophoresis, the desired fragment can then be separated from the rest of the DNA. See text for details.

F igure 5-11

Figure 5-12 Electrophoresis pattern of fragm ents of DNA obtained by digestion of DNA using a restrictio n enzym e. In the left-hand lane is a set of m ark er DNA pieces, obtain ed com m ercially, w hich have know n lengths. By com paring the unknow n restrictio n fragm ents w ith the DNA m arkers, fragm ents of the size expected can be identified and then isolated by extracting them from the gel.

have isolated this piece of DNA, using EcoRI, we w ould have the following structure: AATTCTTAGTAAGGCC GAATCATTCCGGTTAA

100

Genetic Engineering

GLUING GENES TOGETHER

How do we attach this piece of DNA to another piece of DNA; or b e tte r yet, insert it into a plasm id? W hen we insert a piece of DNA into a plasm id, it is called an in s e rt. One of the im portant co nsiderations is th at both the insert and the plasm id pieces have ends that are com patible. For instance, it would be difficult to a ttach an insert containing b lunt ends to a plasm id c o n ta in ing sticky ends. The easiest way to see th a t the ends fit together properly is to use the sam e restriction endonucleases to cut out the insert and to cut the plasm id. Then we will have correct ends on both pieces. We now place both pieces of DNA into the sam e vial and then incubate for a sh o rt period. The sticky ends hydrogen-bond (an n e a l) together, and the new piece of DNA is inserted into the plasm id (Fig. 5-13). Even though the sticky ends are hydrogen-bonded, the covalent p h o sp h o d iester bonds are still not form ed. So we add an enzyme, called ligase, w hich m akes new phosphodiester bonds. Ligase is able to form the bond betw een the 3' and 5' ends of adjacent sugar m olecules, as show n in Figure 5-13. The product is called a ch im eric DNA, because it contains DNA from two sources. All this w orks as outlined in theory, but w hen we actually do the experim ent by placing both the cut plasm id and the DNA insert into the sam e vial and adding ligase, we can have a n u m b er of products. In som e cases, o u r DNA will be inserted as we w anted it to; in others, the plasm id will reattach its own ends. Som etim es the new pieces of DNA will attach to themselves. Initially, we w on't know w hich of the possible end-products have occurred. It could be anything from the original plasm id reform ed to a m ultiple insert placed in the plasm id. It will u ltim ately be necessary to separate these products, but it is m uch easier to do it later, after the plasm ids have been put into bacteria. For now, we ju st need to realize th at m any kinds of products are possible. If we use blunt-end restrictio n endonucleases for the experim ent, the gam e is m uch the sam e, bu t we don't need to w orry about the overlapping ends. However, the ligation (tying together) of the blunt ends generally takes m ore tim e and m aterial and often is less successful.

Altering Genetic Material in Bacteria

101

Figure 5-13. D iagram of cutting a plasm id and inserting a new piece of DNA. The DNA on the right could be the fragm ent we obtained by cleavage, as show n in Figure 5-11. By cutting the plasm id w ith the sam e restrictio n enzym e, sim ilar ends are form ed in the plasm id that are found in the fragm ent. By placing both the fragm ent and the cut plasm id into a vial and allow ing it to mix (incubate) for a while, the plasm id ends attach to the fragm ent as shown. New phosphodiester bonds betw een the fragm ent and the plasm id are form ed by using an o th er enzyme, ligase. See text for details.

102

Genetic Engineering

A final com m ent on the use of plasm ids for use in bringing new DNA into bacteria. Plasm ids can only “carry” so m uch DNA. If they becom e too large, the bacteria do not use them and the plasm ids will not be reproduced properly. So there is a lim it to the size of the insert that we can put into a plasm id. SUMMARY

B acteria are sim ple form s of life, grow fast, and are easy to m anipulate; yet they contain the essential ingredients for genetic experim ents because they have chrom osom es and plasm ids. They are excellent living system s to use for experim ental p u rposes. Plasm ids are tiny circles of DNA th a t can be tran sferred betw een b acteria eith er by the m ating of b acteria (conjugation) or by plasm ids being “picked u p ” from the surrounding m edium by b a cteria (transform ation). W hen e ith er of these processes takes place, the genetic in form ation in b acteria is altered from the original state. We w ould like bacteria to pick up pieces for DNA th a t we w ant them to have. So, we have to be able to extract plasm ids from bacteria, cut the plasm ids open, insert a new piece of DNA, glue the plasm ids back together, and put them back into bacteria. To “see” w hat we are doing, we use gel electrophoresis. Various enzym es are needed to help us. R estriction endonucleases cut DNA at specific sites, often giving sticky ends. Ligase is the enzym e th a t glues two pieces of DNA together. The reco n stru cted plasm id th en can be inserted into cells giving them and their progeny new genetic inform ation.

6 GENETICALLY ENGINEERING BACTERIA WHAT YOU WILL LEARN IN THIS CHAPTER

• • • • •

How to find the sequence of nucleotides in a piece of DNA How to insert a piece of new DNA at a specific location in a plasm id How to carry out colony screening and S outhern blotting techniques How to identify, by screening, the genetically engineered bacteria th at carry the insert of new DNA How to m ake gene libraries

W ith m ost of the tools we need in hand, we are now prepared to genetically engineer bacteria. The m ost direct way to do this is to isolate plasm ids, insert the new piece of DNA into the plasm ids, and insert the plasm ids into the bacteria. We do this by com bining m ost of the techniques we have learned thus far (see C hapter 5). In addition, we need to be able to learn the sequence of the DNA w ith w hich we are working. FINDING THE SEQUENCE OF DNA

W e're finally close to doing w hat we aim ed to do w hen we sta rte d this book—g e n e tic en gin eerin g. We will sta rt w ith 103

104

Genetic Engineering

bacteria in this chapter, and then move on to o th er living things in the chapters to com e. But we still have to discuss one m ore tool—seq u en cin g DNA. Sequencing DNA is the technique in w hich we identify the sequence of nucleotides in the DNA strand. Sequencing DNA was th ought to be very difficult, if not im possible, until the late 1970s. However, at th a t tim e two different approaches were developed to sequence DNA. We will look at the m ore popular approaches here.

Procedure First, we obtain a sam ple of DNA and m ake sure it is very pure. Then, the DNA stran d s are separated, and the sam ple of singlestranded DNA is split into four portions and placed in four tubes. DNA polym erase (the enzym e th a t m anufactures new DNA) is added along w ith the necessary nucleoside trip h o sphates to each tube to allow replication to occur. If we were to let this m ixture incubate, new DNA stran d s w ould be m anufactured, w hich w ould be com plem entary to the original stran d s put in. H eres the trick to sequencing. In ad d ition to all four nucleoside trip h o sp h ates (one of w hich—generally dATP—is ra d io active), we w ould add a dideoxynucleoside trip h o sp h ate (ddNTP) to each tube, a different one to each of the four tubes. The ddNTP is a nucleotide th a t can be used in DNA syntheses, ju st like a regular nucleotide (Fig. 6-1). But w hen it is put in the strand, no fu rth e r synthesis of th at stran d can take place because dideoxynucleosides lack the 3' -O H group, which is the “hook” on the sugar m olecule th at attach es to the next ph o sp hate-sugar groups. So the synthesis of th a t stran d stops right there. If we had added a dideoxy-adenosine trip h o sp h ate (ddATP), the synthesis of the stran d s in th at tube w ould stop at the position A w henever th at position was filled w ith dideoxy-A. Because all the regular nucleoside trip h o sp h ates are present as well, synthesis continues on m ost strands. But som e of the stran d s are shortened, having as th eir 3' end the radioactive dideoxynucleotide. So in the tube w ith the dideoxyadenosines (ddAs), we have fragm ents of various lengths, each of them te rm inating w ith a ddA at th eir 3' end. This is sim ilar w ith ddT, ddC, and ddG in each of the o th er tubes. Figure 6-2 shows the result we will get in each tube. The sam ples are then placed on an electrophoresis gel, each in their own lane, and electrophoresis is started. Each newly m ade

Genetically Engineering Bacteria

Figure 6-1

105

DNA synthesis in the presence of a dideoxynucleoside triphosphate (ddNTP). Ordinarily, synthesis of DNA occurs w hen a new nucleoside trip h o sp h ate is attach ed to the grow ing chain at the 3'-OH of the grow ing chain. W hen a ddNTP is added, the grow th of the chain stops, because there is no oxygen (see note in figure) to w hich a new nucleotide can bond.

106

Genetic Engineering

Figure 6-2 S equencing DNA using dideoxynucleotides. At top is the length of DNA we w ish to sequence by m aking a copy of it using DNA polym erase, (a) All the necessary nucleoside trip h o sp h ates (one being radioactively labeled) are added along w ith DNA polym erase, (b) In additional, a sm all am o u n t of a single dideoxynucleoside trip h o sp h ate (ddNTP) is added—a different one for each tube. DNA is synthesized in each of the four tubes in accordance w ith the tem plate, w hich is the DNA to be sequenced, (c) F ragm ents of the DNA are form ed, since som e of the synthesis is stopped because of the presence of the ddNTP. (d) The synthesis p ro d u cts (fragm ents) are put on a gel, and electro p h o resis is p erform ed to sep arate the fragm ents according to th eir length. Fragm ents differing in length by ju st one nucleotide can be separated. By looking at each lane and counting the num ber of nucleotides in the fragm ents in th a t lane, the position of each nucleotide in the unknow n DNA can be determ ined.

Genetically Engineering Bacteria

107

DNA fragm ent moves thro u g h the gel, faster or slower, depending on th eir size. The result is a gel p a tte rn th a t m ay look like the one show n in Figure 6-2. The gel p a tte rn can be “rea d ” by looking at the lengths of the fragm ents in each lane. If conditions are right, a fragm ent will be in one of the lanes at each step, w hich in tu rn indicates w hich base is at th a t p a rticu la r position in the DNA strand. In this way, it is possible to quickly learn the sequence of alm ost any piece of DNA. If the piece is too long to conveniently sequence, it m ay have to be fragm ented initially and each of the fragm ents sequenced. DNAs containing th o u san d s of nucleotides have been sequenced w ith this process. For our purposes here, it is im portant to know the sequence of the DNA we are going to insert into the bacteria. Often, this DNA is one th at contains the genetic m essage of the pro tein we w ant the b a cteria to m anufacture. We also w ant to m ake short DNA probes com plem entary to p ortions of this new DNA. So, sequences are im portant for us to have. STARTING THE ENGINEERING PROCESS

To engineer the genes of bacteria, let s sta rt by using b acteria containing a plasm id such as the one illustrated in Figure 5-1.

Engineering the Plasmid The plasm id in the figure has already been sequenced to show the various sites w here restriction endonucleases will cut (split) it, only som e of w hich are show n. Note th a t two regions of the plasm id are m arked Tcr (tetracycline-resistant) and Apr (am picillin-resistant). As noted previously, these are regions of the plasm id th a t confer resistance to the antibiotics, tetracycline and am picillin. R esistance in both cases m eans th at the bacteria will continue to grow in the presence of the antibiotic. For reasons th at will becom e apparent as we proceed, it is im portant th a t we cut this plasm id using Pst I, w hich cuts the plasm id in the Apr region (Fig. 6-3). We will use the opening in the Apr region to insert a new piece of DNA th at we have obtained either by chem ical synthesis or by cutting from a n o th e r piece of DNA. The m ethods by w hich this can be accom plished have been outlined in C hapter 5. It is im p o rtan t th at Pst I be used to cut the new DNA out of the original host or th a t the p ro p er “sticky” ends have been synthesized

108

Genetic Engineering

Figure 6-3 The plasm id show n in Figure 5-1, which has now been cut w ith P st I. Note th a t by cu ttin g it w ith this restriction enzym e, the am picillin-resistant region (Apr) is broken, m aking the bacterium carrying the broken plasm id sensitive to am picillin (ie, it will die if put in contact with the antibiotic am picillin).

on the synthetic DNA, so th at it will stick w hen placed with this cut plasm id (Fig. 6-4). We then take the solution containing the cut plasm ids and add the new DNA to the solution. We incubate this for a period of 1 to 4 hours at 16° C, so the pieces can find each other. The enzyme ligase is added, which will attach the new DNA insert to the plasm id DNA. The result is a plasm id th at has a new insert in it. The insert is bonded to the DNA w ith p h o sp h o d iester bonds, w hich we discussed in C hapter 5. It is now an integral part of the plasm id. Not all the plasm ids will contain the insert, because some just com bine w ith them selves, giving the original plasm id. O thers m ay have m ultiple copies of the plasm id or m ultiple inserts. We need to segregate these various form s later.

Getting Plasmids into the Bacteria The next step is to get the plasm id containing the insert into the bacteria. This can be done in several ways. We will m ention two here. One m ethod is to place bacteria in a m edium containing c a lc iu m s u lf a t e . W hen this is done, the pores in the cell m em branes open up, allow ing the plasm ids to en ter the bacteria. Calcium sulfate is one of several chem icals th at will w ork to enlarge pores in certain strains of bacteria, giving plasm ids relatively free entrance. A nother m ethod is to use e le c t r o p o r a tio n .

Genetically Engineering Bacteria

109

Figure 6-4 The use of Pst I to insert a fragm ent into a plasm id. The process is exactly the sam e as th at described in Figure 5-13, except that P st I is used. The reason we use Pst I is because this restriction enzym e cleaves the plasm id in the Apr region, w hich provides a way to identify w hich bacteria have the modified plasm ids present. See text for details.

110

Genetic Engineering

By subjecting cell m em branes to a high-voltage electrical field for a sh o rt tim e, the m em branes are tem porarily broken down, producing pores large enough for plasm ids to enter. After a period of tim e, the m em branes realign and close the pores. Using eith er m ethod, plasm ids can en ter the bacteria. Once this is done, all we need to do is let the b acteria grow on a Petri dish and look for the bacteria th at contain the new DNA. SCREENING THE BACTERIAL C OLONIES

How can we tell know w hich b acteria have the insert in th eir plasm ids? An im p o rta n t trick allows us to easily learn this. Rem em ber, plasm ids cam e about in n atu re to give cells added features, such as resistance to antibiotics. We have chosen a plasm id th at contains resistance to both am picillin and tetracycline. So, w ith the plasm id containing both the Tcr and the Apr regions, the b acteria w ould be able to grow on Petri dishes w ith n u trie n ts containing both tetracycline and am picillin. All bacteria th at did not contain the plasm id insert w ould die. If the plasm id inserted had been cut in the Apr region, as we w anted, it w ould d isru p t the am picillin resistance. The cell w ould then be susceptible to am picillin, giving an Aps (am picillin-susceptible) cell. Then, if we grew the b acteria on Petri dishes containing som e am picillin in the agar, we w ould kill all the cells th a t had o u r insert in them . This doesn't do us m uch good, because we w ould m uch ra th e r kill all cells except those th at contained the insert. So we need to do som ething different.

Replica Plating Suppose th at initially we grow the b acteria th a t we have tra n s form ed in a m edium containing tetracycline. We will spread the b acteria on agar on Petri dishes so th a t individual bacteria are p resent at certain places on the agar. On incubation, these b acteria grow into colonies. W hen this is done correctly, each colony comes from a single bacterium , as shown in Figure 6-5. Because the m edium contains tetracycline, all bacteria th at do not contain the plasm id will die, because only b acteria c o n tain ing plasm ids w ith a Tcr region will live. So we know th a t all these colonies contain b acteria th at contain the plasm id, b u t it could be eith er the original plasm id or one th a t we m odified. W hat we w ant to do now is m ake several copies of the colonies on the Petri dish. To do this, we take a piece of velvet, cut it into

Genetically Engineering Bacteria

111

Figure 6-5 D raw ing illustrating how an tibiotics work. B acteria grow on ag ar in Petri dishes in clusters called colonies. As the bacteria divide, they sp read outw ard from the original b acteriu m in an alm ost circular fashion. If an antibiotic is present, the bacteria die, unless they co n tain a plasm id w ith the resistance gene to th a t antibiotic. In this illu stratio n , tetracycline is p resen t in th e second Petri dish, and only those b acteria th at contain a plasm id w ith the Tcr region intact survive

a circle the size of the Petri dish, and then sterilize the velvet. By placing this sterile velvet on the original Petri dish, som e of the b acteria stick to it and can be tran sferred directly to o th er Petri dishes. We can then grow the b acteria on these Petri dishes. These new Petri dishes will have the sam e p attern of colonies as the original. This is called r e p lic a p la t in g (Fig. 6-6a). Suppose we m ake two replica plates of the original, one on agar containing am picillin and the o th er on agar containing tetracycline. By com paring the b acterial colonies, we can see those colonies th a t were not resistan t to am picillin and thus died. This tells us th a t the plasm ids in those bacterial colonies contained the plasm id th at contained an insert, since the insert destroyed the am picillin resistance p o rtion of the plasm id and m ade the bacteria susceptible to am picillin.

Isolating the Strains On the other replica plate, all the original colonies are grown, all of w hich have plasm ids inserted and som e of w hich are the m odified plasm ids. By taking sam ples of the bacterial colonies th at died on the Petri dish containing am picillin but lived on the tetracycline agar, we have isolated strains of bacteria th at contain our insert! This approach to determ ining which bacteria contain the insert is called s c r e e n in g (Fig. 6-7), and the a n tib iotic-resistant sections of the plasm id are called m a r k e r s.

112

Genetic Engineering

Figure 6-6 R eplica plating, (a) To m ake several Petri dishes w ith the bacterial colonies exactly the sam e on each, a piece of sterile velvet (or sim ilar m aterial) is used to lift off a p o rtio n of the b acteria from each colony and tra n sfe r them to a new Petri dish in exactly the sam e location as they were found on the original Petri dish. In this m anner, Petri dishes th at have identical p a tte rn s of colony grow th can be obtained, (b) Replica plating in which all the bacteria contain a plasm id (such as th at show n in Fig. 5-1) th at has both an am picillin-resistant region (Ap1) and a tetracycline-resistant region (Tc1).

We have now placed engineered DNA into a living organism ! W hen we put these bacteria in a culture flask, they will continue to grow and reproduce, replicating the plasm id DNA, w hich hopefully contains the DNA insert. But there is still a question. We know th at we have altered the plasm id in the Ap1 region, but we are not certain th at the insert we w ant is really there. We need to perform som e fu rth e r tests to m ake sure the insert is really there.

Genetically Engineering Bacteria

113

Figure 6-7 An illu stratio n of the com plete technique for inserting a piece of foreign DNA into bacteria and identifying (screening for) those b acteria th a t co n tain it. In this case, rab b it DNA and plasm id DNA are both cut with Pst I, incubated together, joined using DNA ligase and the plasm id solution mixed w ith bacterial (Escherichia coli) cells. To screen for b acteria th a t co n tain the plasm ids w ith the rab b it DNA inserted, som e of the b acteria are then tran sferred to Petri dishes th at contain tetracycline. Only b acteria th a t con tain plasm ids will grow on these. Replica plates are m ade from the Petri dishes on agar containing ampicillin and tetracycline. The colonies th at die on the am picillin contain plasm ids th a t have been cut in the Apr region, suggesting th at these b acteria m ight co n tain the new DNA. These colonies are identified by th e ir position and then rem oved from the oth er replica plate th at co n tains tetracycline only. The b acteria are then cu ltured and grown. A dditional screening, often by sequencing the plasm ids, is needed to certify w hich b acterial colonies have the rab b it DNA in the correct position.

114

Genetic Engineering

SCREENING DNA IN BACTERIAL COLONIES

Suppose that we use Petri dishes th at contain several colonies of bacteria th at contain the m odified plasm id. We know th at tra n sform ation has taken place by using the screening m ethod previously outlined. If we cut a piece of nitrocellulose pap er to fit in the Petri dish and place the paper against the bacterial colonies, we can lift off som e of the bacteria from each colony. By heating these bacteria on the paper, the bacteria are lysed (broken open) and the DNA w ithin them sticks to the paper.

Hybridization We now w ant to find out if o u r insert is contained w ithin any of the DNA m olecules on the paper. This m ay seem as if we are looking for a needle in a haystack, bu t the nucleotide sequence com plem entarity (ie, the fact th at A sticks to T, and G to C) of the DNA stran d s them selves com es to the rescue. Perhaps one of the m ost pow erful tools in genetic engineering is th a t of hyb rid ization or annealing. This term m erely m eans th at two com plem entary stran d s of nucleic acids tend to find each o th er and hydrogen-bond when they are in the same vial. W hether it is two stran d s of DNA th at have been denatured, thereby se p a ra ting the strands, or w h eth er it is a piece of DNA th a t is com plem en tary to a stra n d of RNA, the principle is the sam e. F or o u r purposes, we can design experim ents using this approach. As noted in C hapter 3, hydrogen-bonding betw een the two strands of DNA is responsible for the double-helical structure G to C, A to T). Although the hydrogen bonds (H-bonds) are relatively weak, num erous H -bonds provide substantial bonding betw een two strands of nucleic acids. So the design of the screening techniques that we will outline in the following section is based on the principle of bonding or hybridizing two strands of nucleic acids together because of their com plem entarity.

Making a Probe We first m ake a sh o rt piece of DNA th at is com plem entary to a p o rtion of the DNA th at we have inserted into the plasm id (Fig. 6-8). This short piece of com plem entary DNA is called a probe and should be able to hybridize to the portion of any DNA to w hich it is com plem entary, provided th at the stra n d of DNA is available for hybridization. H eating the double-helical DNA on the nitrocellulose p ap er breaks the H -bonds betw een stran d s and opens up the DNA in a p ro p er fashion. To be useful in this

Genetically Engineering Bacteria

115

Figure 6-8. H ybridization. W henever a new piece of DNA is hydrogen-bonded to a com plem entary piece of DNA, the pro d u ct is called a hybrid. S hort pieces of DNA can be synthesized chem ically w ith any desired sequence of bases in them . These new, sh o rt pieces can be added to existing DNA stra n d s an d hybridize w ith them in those locations in w hich they are com plem entary, as show n here. If the existing DNA is in double-stranded form , the new DNA can still hybridize w ith it, form ing a triple stran d . O ften the sh o rt DNA probes are m ade radioactive to allow identification.

search, the probe m ust be labeled, often w ith a radioactive label such as 32P (radioactive phosphorus). This will allow us to find the probe w hen we use it to search for DNA. The m inim um probe length needed for hybridization is about 10 nucleotides, b u t the size can vary, depending on h ybridization conditions. The longer the probe, the m ore stable the hybridization. Therefore, longer probes are generally used to ensure th at hybridization will take place. There is a lim it to this, because very long probes can interfere w ith h y bridization or p a rt of them can hybridize to the w rong regions of the target DNA. To ensure th at the hybridization is unique for the gene for w hich we are looking, probes of 20 to 25 nucleotides are generally used. The nitrocellulose p ap er containing the lysed colonies of bacteria is th en p u t in a plastic bag, and a solution containing the radioactively labeled DNA probe is also put in the bag. This probe has a sequence com plem entary to the sequence of the new DNA insert in the plasm id.) The bag is sealed, and the solution is swirled around. The nitrocellulose paper is then removed, and the solution is w ashed off to rem ove all probes th at aren't stuck to com plem entary DNA. The p ap er is dried and then placed on top of a piece of x-ray film and put in a light-tight container and allowed to stay there for a few hours (Fig. 6-9).

116

Genetic Engineering

Figure 6-9 The colony screening technique. This m ethod is designed to identify b acteria that con tain the new DNA (see Fig. 6-8). After the b acterial colonies are grow n, nitrocellulose paper is used to lift off som e bacteria from each of the colonies, giving a replica of the pattern of colonies on the dish. The nitrocellulose paper is heated to lyse the bacteria and separate the DNA strands. It is then put in a sealed plastic bag along w ith a solution contain in g a short piece of radioactively labeled DNA, w hich is com plem entary to som e portion of the inserted DNA. After mixing for a short tim e, the nitrocellulose paper is rem oved and w ashed and then placed on x-ray film. The film is exposed wherever the radioactive DNA probe has hybridized w ith the new DNA in the bacteria. In this way, the colonies of b acteria containing the new DNA are screened and identified.

Genetically Engineering Bacteria

117

The radioactive DNA probes will expose the x-ray film, causing a dark spot on the film w herever they are bound to the DNA of the plasm id insert. Thus, the p a tte rn of spots on the x-ray film will reveal w hich, if any, colonies of b acteria contain ed the new insert (Fig. 6-9). This is called the colon y screen in g techn iqu e. After the colonies th a t have the correct in sert are identified, these bacteria can be o btained from the original Petri dish and put in culture and substantial num bers of these engineered bacteria grown. Using some of these bacteria, the plasm ids could be isolated directly and the sequence of the plasm id determ ined to certify the absolute presence of the correct insert.

Screening Specific DNA Fragments (Southern Blotting) A nother way to identify a specific gene in a piece of DNA is to screen the DNA particles directly. E ach of the different bacterial colonies can be isolated, grow n up, and lysed, and the DNA in the b acteria extracted. This DNA is then cut, using one or m ore restrictio n endonucleases. The fragm ents are placed in an electro p h o resis gel ap p a ra tu s and sep arated according to size, as outlined in C hapter 5. B ecause DNA in the gel itself is not really available for h ybridization w ith a probe, a piece of nitrocellulose p ap er is placed on the gel and the DNA is “b lo tted ” out of the gel onto the paper. The p ap er is then heated to open the d o uble-stranded DNA fragm ents, after w hich it is inserted into a plastic bag and sw irled w ith a solution of radioactively labeled DNA probes. These probes are com plem entary to the piece of DNA th a t was inserted into the plasm id. Upon w ashing the paper and exposing the x-ray film, the radioactive label will expose the x-ray film at those sites w here it binds to the plasm id fragm ents containing the new inserts. This technique is called S ou th ern b lotting, nam ed after its inventor, Dr. E dw ard Southern (Fig. 6-10). P R O D U C IN G PROTEINS FROM GENETICALLY ENGINEERED BACTERIA

One of the m ajor purposes of engineering b a c te ria is to m ake large am o u n ts of a specific protein. Identical b acteria th at are replicating w ithout conjugation or any o th er m eans of altering their genetic inform ation are clon es. So w henever we take som e

118

Genetic Engineering

Figure 6-10 The S o u th ern blotting technique. This technique is very useful to identify fragm ents of DNA co n taining a know n sequence of nucleotides. The DNA is initially extracted from a cell and then digested using one o r m ore restriction enzym es. Gel electrophoresis spreads the fragm ents according to size. The DNA fragm ents are “pulled” from the gel by placing the gel on a platform w ith a piece of nitrocellulose filter p ap er above it. A bsorbent p a p e r is placed above the nitrocellulose p ap er to “pull" the solution an d DNA th ro u g h the gel and to the n itro cellulose paper. The result is a p a tte rn of the bands from the electrophoresis on the nitrocellulose paper. This is now heated and swirled in a bag w ith the radioactively labeled DNA probe, w hich is com plem entary to regions of the DNA fragm ents. The fragm ents containing the right sequence can be identified by placing the nitrocellulose paper on a piece of x-ray film and letting the radioactivity expose the film in the bands containing the probe.

Genetically Engineering Bacteria

119

b acteria and spread them a ro u n d on a Petri dish until there are only single cells left, the colonies th at grow from th at single cell are clones of the original bacterium . If there is a plasm id w ith an insert in the original bacterium , we th en have clones of a single, engineered bacterium . Suppose th a t the DNA we inserted into the plasm id is really the gene for a specific protein, such as insulin. Insulin is used to tre a t diabetes, so lots of insulin is used th ro u g h o u t the w orld. Although insulin from o th er sources, such as pigs, has been used to tre a t diabetes, it doesn't always w ork well. H um an insulin is highly desirable. So, suppose th a t the h u m an insulin gene is inserted into a plasm id and the plasm id is pu t into bacteria th a t are cloned. W hen th a t gene is tra n sla ted into p rotein (exp ressed ), the insulin we w anted will be m ade by the bacteria, as well as the usual bacterial proteins. M ultiple copies of the gene m ay be inserted as well, giving w hat is called a high copy num ber plasm id. This allows num erous identical proteins to be m ade by the bacteria. They literally becom e “protein factories.” So, we can harness bacteria to do our w ork for us. In principle, we should be able to take any piece of DNA w ithin reasonable size lim its and put it into bacteria. Therefore, if we w ere to take a gene th a t m akes any p ro te in we w ant, we could place it in a plasm id and in se rt th a t plasm id into b a c teria. Thus, we should be able to m ake en o rm o u s a m o u n ts of th a t p a rtic u la r p rotein. U nfortunately, it doesn't alw ays w ork th at way. T here are som e proteins, especially those used by hum ans, th a t bacteria do not m ake well. So we need to find other ways to m ake this process work. We will discuss this m ore in C hapter 8. M A K IN G GENE LIBRARIES

There is one final issue to discuss. We have m en tio n ed th a t we m ay need to o b tain a gene from n a tu ra l sources, b u t how do we go about doing this? At first, it seem s a form idable task. For in stan ce, in the h u m an genom e th ere are 23 chrom osom es, an d each c o n tain s m illions of nucleotides. How are we to find a gene for a c e rtain pro tein ? Again, let's use the p ro te in h o rm o n e in su lin as an exam ple. This p ro te in is m ade specifically by p an c re a s cells. S om ew here, in all the DNA co n ta in ed in the p an c re a s cells, the in su lin gene is b u ried . How do we proceed?

120

Genetic Engineering

Library of Genes W hat we really need to do is m ake available all the DNA in the p ancreas cells in a m an n e r th a t we could sort th ro u g h it w ith a probe, looking for the insulin gene. In essence, we need to create a library of bacteria, each one containing a sm all portion of the pancreas gene. To do this, we first get a pancreas cell line and then grow a large n u m b er of these cells in tissue culture. (We will discuss this technique in C hapter 8.) After that, we disru p t the cells and isolate th e ir DNA. Using a set of restrictio n enzym es, we th en cleave the DNA into fragm ents of sizes th at could be inserted into plasm ids. Plasm ids o btained from b a c teria are th en cut using the sam e set of enzym es, following w hich the plasm ids and the restrictio n fragm ents of the p a n creas cell DNA are incubated together. The fragm ents of pancreas DNA will anneal to the sticky ends of the plasm id DNA and can be ligated in place. M ost of the p an creas DNA fragm ents will be in co rp o rated into b acterial p lasmids. These chim eric p lasm ids (plasm ids w ith inserts in them ) are then transferred into bacteria, and the culture is grown. The result will be th a t n um erous b acteria w ith a great variety of plasm ids will be in the culture (Fig. 6-11). Ideally, all the DNA fragm ents from the pancreas cells should be found am ong all these bacteria. These b acteria are called a gene library of the cell chrom osom e because they house all the genetic in fo rm atio n found in th at cell line. Ju st like a library filled w ith books, the individual b a c te ria contain certain fragm ents of the p ancreas cell genetic info rm ation. B ut do we find the insulin gene? First, we grow colonies of b acteria containing the various plasm ids th at have inserts from the p ancreas cell DNA. These colonies can then be screened for the p articular gene of interest, using the techniques described previously. We w ould m ake a probe com plem entary to the insulin gene and th en use colony screening techniques (outlined earlier in this chapter) to find the b acteria th a t co n tain the insulin gene. Then, we take the bacteria containing the insulin gene, grow them , isolate th eir p lasm ids, and then purify the insulin gene from the plasm ids. This gene can th en be inserted into o th er plasm ids, rein serted into bacteria, and will th en be expressed in those b acteria giving— hum an insulin. Gene libraries from m any cell lines are now available, m aking a rem arkable resource. As the h u m an genom e is sequenced, m any ad d itional libraries are being m ade. This develops a

Genetically Engineering Bacteria

121

Figure 6-11 M aking a gene library. The purpose is to m ake a fam ily of b acteria th at each co n tain a single fragm ent of DNA from a given source and together contain all the fragm ents from the DNA source. In the exam ple, the com plete DNA from p an creas cells is cut up using a m ixture of restrictio n enzym es. This m ixture of restrictio n enzym es is also used to cut plasm ids th a t have been isolated from bacteria. The DNA fragm ents from the p an creas are then m ixed w ith the cut p lasm ids an d DNA ligase is added to com plete the process. The result is a large n u m b er of plasm ids co n tain in g various pieces of the pancreas DNA. These plasm ids are then inserted into bacteria by electroporation, a tech n iq u e th a t electrically opens pores in the bacteria. The b acteria th a t result will contain the plasm ids th a t in tu rn co n tain all the fragm ents of p an creas DNA inserts. Then, w hen a certain p o rtio n of p a n creas DNA is needed, the b acteria can be put on Petri dishes and the colony screening technique o utlined in Figure 6-9 can be used to identify the bacteria containing the portion of DNA needed.

Genetic Engineering

122

trem endous gene bank to be called on as needed. We will further discuss how these genes can be used in h u m an genes cells in C hapter 12. APPLICATIONS

Several genetically engineered proteins, notably insulin, in te rferon, and tissue plasm inogen activator (TPA), are being m ade by bacteria and are now sold in large quantities. The quality and qu an tity of these engineered pro tein s are high and the cost is low, com pared w ith earlier costs w hen they had to be extracted from tissue. For instance, the cost of interferon was enorm ous— about $10 m illion per gram before it was cloned. Now the cost is but a few hundred dollars per gram . H arnessing bacteria to produce proteins im portant to hum ans can be relatively inexpensive and extrem ely useful. However, there are lim itations, because genes of m am m als contain extra pieces of DNA (introns) and o th er alterations, w hich b acteria may not be able to translate. In these cases, it has becom e necessary to use m am m alian tissue culture to m ake the desired p ro teins. This will be discussed m ore fully in C hapter 12. N onetheless, the ap proach in w hich desired genes are cloned into b a cteria will continue to be an im p o rta n t application for genetic engineering techniques (Table 6-1).

Table 6.1 Genetically Engineered Pharmaceutical Products P rod u ct

Erythropoietin Hepatitis vaccine Human insulin Human growth hormone Alpha interferon Granulocyte colony-stimulating factor Tissue plasminogen activator Granulocyte-macrophage colony-stimulating factor Gamma interferon lnterleukin-2 Total

O rigin ator(s)

S a le s ($ B illio n s)

United States

World

Amgen, Genetics Institute Biogen Genentech Genentech, Biotechnology General Genentech, Biogen, Wellcome Amgen

600 260 245 270 135 295

1125 724 625 575 565 544

Genentech Immunex, Genetics Institute

180

230

50

70

15 5

25 20

2055

4503

Genentech, Biogen Immunex, Chiron

Genetically Engineering Bacteria

123

SUMMARY

G enetic engineering of b acteria m eans th a t we insert new DNA of a know n kind into b acteria after first sequencing the DNA. The m ethod allows us to read the sequence directly from an electrophoresis gel p attern . We can th en in sert the new DNA directly into a plasm id, using the right enzym es to cut open the plasm id and seal the new DNA in place. The new DNA is placed in a region of the plasm id th a t provides an tib io tic resistance to the bacteria containing the plasm id, and the modified plasm id is p u t into the bacteria. The an tib io tic resistance disappears, allow ing us to know w hich b acteria contain plasm ids w ith new DNA. Various m ethods are available to screen (isolate the b acteria w ith the right DNA) the bacteria. Colony screening allows us to grow colonies of b acteria and identify those th a t have the new DNA present. S o u th ern blotting is also a process by w hich we can extract the DNA from the b acterial colonies, fragm ent it, and test it to find out w hether the new DNA is present. W hen the new DNA is in the bacteria, we can grow enorm ous q u an tities of these bacteria, all of w hich co n tain the new DNA. These clones not only m ake new b acteria like them selves, but also m an u factu re proteins for th eir use. By adding num erous repeats of the new DNA, the b acteria then m akes lots of new protein, w hich could be needed by m an (such as insulin). Gene libraries are m ade to find the genes th a t will m ake p ro teins useful to m an, w hich can co n tain m ost of the genes from specific h u m an cells, such as the pancreas cells. Once located, the genes can be p rep ared and purified to allow them to be inserted into plasm ids and used to engineer bacteria.

7 VIRUSES WHAT YOU WILL LEARN IN THIS CHAPTER

• • • • •

How specific viruses attack specific cells How bacteriophage (phage) reproduce them selves How active phage can be reco n stitu ted from phage p ro tein and phage DNA How cosm ids can be used to bring new DNA into cells How to detect the presence of the new DNA in phage by m eans of screening techniques

Viruses attack all living things and often cause disease or even death. Viruses are really a stripped-dow n version of a living thing. They are not really alive, at least according to the definition we applied in C hapter 1. Viruses have som e of the tools needed to carry out functions of living things, but they depend entirely on o th er organism s to give them the pow er to do so. They are not able to m ake it on their own. A bacterial virus is called a bacteriophage (bacteria-eater) or, m ore often, phage. Som e viruses have m ore com ponents, b ut the sim plest have ju st a n u c le ic acid gen om e and a p ro tein covering. A schem atic p ictu re of a bacterial virus is show n in Figure 7-1. You can see DNA enclosed by a wall of protein. Viruses are generally tailored to use a p a rticu la r target cell as a h o st (an organism in w hich they can reproduce them selves). There are various categories of viruses—som e m uch m ore complex than others. The sim plest viruses, like the one in Figure 7-1, use b acteria as th eir hosts. T heir sole purpose in life is to find a p a rticu la r bacterium , a ttach to it, insert th eir DNA, and use the bacterial m echanism s to reproduce m ore phage. In this 124

Viruses

125

Figure 7-1 D iagram of a b acteriophage. This is a virus th at specifically attacks bacteria. The phage seem s to w ork like a syringe w ith w hich to in sert the nucleic acid genom e of the phage into the b acterium .

way, the phage doesn't have to carry aro u n d all the excess m achinery needed to reproduce itself. It borrow s the m achinery of the host cell. B acterial viruses are very im p o rta n t in genetic engineering because they contain genetic m aterial and because they know

126

Genetic Engineering

how to get it into the host cells. This m akes them ideal tra n s p o rters of genetic in fo rm atio n —even genetic in form ation th at has been placed there by us. The advantage of a virus over a plasm id is th a t the virus can carry larger genes th a n can the plasm ids, so they are m ore suitable for som e tasks. In addition, viral DNA is generally placed directly into the host c h ro m o somes, often in active regions. For this reason, we need to look a little closer at how a bacteriophage works.

THE LIFE CYCLE O F A PHAGE

Initially, a phage attaches itself to its p articu lar host bacterium , then inserts its DNA into the host in m uch the sam e way th a t a hypoderm ic syringe and needle are used to inject fluid into us. The phage DNA can do one of two things w ithin the bacterium , depending on the kind of host the bacterium is.

The Lytic Pathway In the first case, the phage DNA m ay ju st go a b o u t its business of getting its genetic m essage out and getting new viruses m ade. The viral DNA is also reproduced in m ultiple copies to m ake new DNA for the new virus particles. W hen new viruses are to be m ade, it uses the cells m achinery to m ake the viral proteins necessary for the new virus particles. The genetic inform ation used to m ake these proteins is encoded in the DNA th at the virus put into the cells chrom osom e. All the cells energy is used to m ake new phage particles, DNA and all. The result is that, after a little while, the phage has m ade m any copies of itself, norm ally from 100 to 200, and the cell walls break open, releasing the new phage. These new phage then go about looking for new cells to infect. The bacteria are in trouble! This process is called the lytic pathway of a bacteriophage and is diagram m ed in Figure 7-2. In this case, the DNA of the phage is used directly to m ake m ore phage. This reproduction of the phage causes m assive destruction of the bacteria in a very short period of tim e (hours), since each infected bacterium releases from 100 to 200 viral progeny as it is lysed (broken open). In higher-order cells and organism s, sim ilar processes occur w hen they are attacked by a virus, but reproduction takes m uch longer (days). Som etim es the host cells are not destroyed, but produce new viruses over a period of tim e and send them out one or a few at a tim e.

Viruses

127

Figure 7-2 The lytic pathw ay. New bacteriophage are produced as d iagram m ed, each of w hich is identical w ith the original phage. In a typical lytic cycle, about 100 to 200 new bacteriophage are produced.

The Lysogenic Pathway A second, m ore subtle, process by w hich phage can be produced is called the lysogenic pathw ay. In this case, the DNA of the phage is com bined w ith th a t of the b acterial chrom osom e as before. The viral DNA is placed in the bacterial chrom osom e w ithout the bacteria knowing it. This hide-and-seek game is very

128

Genetic Engineering

effective. Som etim es the viral DNA will stay in the bacterial chrom osom e for m any bacterial generations. The viral DNA is replicated along w ith the bacterial DNA in each generation until one day the following happens: Triggered by som e in d u cin g fu n ctio n (e.g., UV light) th a t stresses the bacterium , the viral DNA is activated and starts to m ake proteins and also m ore viral DNA—and the phage infection is on its way. This process is called the lysogen ic pathw ay (Fig. 7-3). It is this process th at is m ost useful to us in genetic engineering, because it provides a way to insert new DNA into the chrom osom e of a bacterium in a rath e r perm anent fashion. We should m ention here th a t the virus is not always accurate in the lysogenic process. Som etim es in the n a tu ra l process of getting its viral DNA out of the cell, it takes som e cellular DNA w ith it. Then, w hen it infects the next cell, it carries inform ation from the previous host w ith it. The new cell receives new b acterial DNA, w hich m ay give it additional m echanism s to ad ap t to new environm ental stresses. This is a n o th e r im p o rtan t way by w hich b acteria are able to adapt to the environm ent a ro u n d them . The process is called transduction. A lthough the lysogenic m echanism can spell doom for bacteria, it is very useful for genetic engineering, as we will shortly see. If we can som ehow get the virus to carry in som e extra DNA and insert this w ith its own DNA into the bacterial chrom osom e, then we can get a piece of new DNA into the DNA of the cell and let the cell do all the w ork of replicating the DNA. This is at the heart of w hat we wish to do in genetic engineering. It should be em phasized that only certain bacterial strains can becom e lysogenic, so the b acteria play an im p o rta n t role in the process. W hen a bacterium has received the phage DNA into its chrom osom e, it is called a lysogenic bacterium. There are a couple of ways in w hich viral DNA can be used to carry engineered pieces into the bacteria. In earlier years, scientists found that DNA could be rem oved and the virus altered and then reinserted. In m ore recent tim es, an o th er m ethod has been developed in w hich the coat is really not used. We will discuss each m ethod separately. PHAGE RECONSTITUTION A P P R O A C H

The first thing we need to do is extract the viral DNA and get it w here we can use it. This is easy because viruses like to get rid

Viruses

129

Figure 7-3 The lysogenic pathway. In this process, the DNA inserted by the bacterio p h ag e is actually placed in the chrom osom e of the b acteria an d stays th ere for an undefined p eriod of tim e. Cells containing phage DNA are called tran sfo rm ed cells. If these cells are induced by som e event (ultraviolet light does the trick), the phage DNA is excised from the bacterial DNA and the process of m aking new phage particles begins, as it did in the lytic process. The only difference is th a t in this case, th ere are som etim es p o rtio n s of the bacterial DNA th at get connected w ith the phage DNA, so the phage can actually carry bacterial DNA from one b acteriu m to another. F or o u r purposes, the im p o rtan t process is the ability of the phage DNA to insert its DNA into the b acterial chrom osom e.

130

Genetic Engineering

of th e ir DNA anyw ay and also because the DNA is not bound tightly in the virus. The virus particles are tre a te d w ith an enzym e th at breaks dow n the protein coat, and the DNA is then released into the solution. M any experim ents today use a w ell-characterized phage, the lam b d a p h a g e as the carrier, b ecau se its DNA is fully sequenced. So, once the p ro te in co at is rem oved an d we have selected a site in the lam bda phage DNA in w hich to in sert o u r piece of DNA, we use a re stric tio n en d o n u clease (enzym e) to cut open the phage DNA at th a t site. As w ith the p lasm id a pproach, we m ust be c e rtain th a t the new DNA to be in serted has ends sim ila r to th o se on th e cleaved phage DNA. We th en p u t o u r new DNA an d the en d o n u clease-o p en ed phage DNA together in a tube and bond them to each other, as outlined for p lasm id s in C h a p te r 6. Of course, no t all the DNA p articles will reco m b in e the way we w ant th em to, so we will have to screen the p ro d u c ts eventually as we did before. B ut for now, le ts assum e th a t the DNA is p u t in w here we th o u g h t it should be.

Rebuilding the Virus We now need to rebuild the virus. This is not as hard as it sounds. We can obtain viral gh osts—viral coats w ithout DNA in th em —by gently breaking the viruses open and rem oving the DNA. These ghosts (w hich have no DNA inside) are th en put w ith the new viral DNA, and new viruses are reform ed sp o n ta neously. It is even possible to extract ju st the viral coat proteins from in tact viruses and pu t these together w ith the DNA and form new virus particles. A lthough not all the viruses reform , som e do, and these are th en able to be used to insert o u r DNA into susceptible bacteria. There is one problem w ith this approach. The phage heads have a lim ited am ount of space available, and m ost of that space is taken up w ith the phage DNA. So the lam bda phage has been pared down by the rem oval of nonessential genes to m ake room for the inserts. In addition, the lam bda phage contains a single EcoRl site, w here an insert can be m ade. The phage DNA has now been engineered to the degree th a t unless it contains an insert, the DNA will not go back into the phage head. So only those pieces of DNA th at contain the insert (chim eric DNA) are reu n ited w ith a phage head giving virus particles (Fig. 7-4). Thus, DNA th a t is too sh o rt or too long will not be accepted by the phage ghosts. This provides a nice screening m ethod, since

Viruses

131

Figure 7-4 In sertio n of a chim eric DNA into a bacteriophage. Since bacterio p h ag e can hold only a certain am o u n t of DNA. (a) By m odifying the phage DNA and inserting new DNA of the pro p er length, the resulting chim eric DNA can be readily inserted into the phage ghost, (b) B ut if the DNA insert is not present, the DNA will not be taken in by the phage ghost. A phage ghost is the em epty phage (no DNA).

only DNA pieces of the correct size are able to form viable viruses, and these are the DNA pieces th at contain the inserts. The rebuilt viruses are then used to infect lysogenic bacteria so th at the new gene is inserted into the bacterial chrom osom e.

132

Genetic Engineering

The b acteria rem ain in the lysogenic state, carrying the new DNA w ith them . The im p o rtan t question is w h ether or not the inserted gene will be ex p ressed into a useful protein. As noted before, genes are expressed when there is a prom oter region (the region th a t starts the m essenger ribonucleic acid [mRNA] tra n scription) in front of them . If we are careful ab o u t w here the phage DNA is inserted into the plasm id or the bacterial chrom osome, we can then get our DNA to be expressed a little or a lot. One of the ways to m ake sure the gene will be tu rn e d on is to include a p ro m o ter region w ith the gene th at is to be inserted. Then, by “tu rn in g on" the p ro m o ter region, the gene is tra n scribed into mRNA, w hich is m ade into a protein. It is also possible to insert m any genes behind a p ro m o ter region. In som e cases, over 1000 copies of the genes of a single protein gene have been inserted into the bacterial chrom osom e. The b acteriu m then becom es a little factory for th at kind of protein, allow ing considerable quantities to be m ade inexpensively. C O S M ID A P P R O A C H

Although a phage will allow m ore new DNA to be inserted th an occurs w ith a plasm id, the phage is som etim es still not large enough to accom m odate large or m ultiple-copy genes. To allow even m ore DNA to be inserted into bacteria, the cosm id approach has been developed. A co sm id is a hybrid (cross) betw een a plasm id and viral DNA. It is really a plasm id into which has been inserted the DNA sequences needed to package the plasm id into a virus. These viral DNA sequences are called cos sites. The rem ainder of the plasm id can carry the new DNA and any o th er inform ation desired, b u t is still lim ited in size by the q u antity the phage can carry. However, m ore inform ation can be pu t into a cosm id, since very few phage genes are needed. These chim eric DNAs (those containing the insert) can then be purified by packaging them into phage heads. And they can then be used to infect bacteria. Because the cosm ids are p rim arily plasm ids, they en ter the bacteria and form plasm id-like structures w ithin the bacteria, which ordinarily do not enter the chrom osom e. They can be thus treated exactly as we have treated the plasm ids previously. The advantage is th at cosm ids can carry m ore inform ation th an the phage inserts norm ally do. Once inserted into the bacteria, the cosm ids are p e rp etu ated as plasm ids. Yet they can ultim ately be isolated and packaged back into phage particles by m erely adding the coat proteins of

Viruses

133

the phage, using a helper phage to insert the genes for the necessary p rotein into the bacteria. These new phage are extrem ely useful as vectors (carriers) to bring new DNA into bacteria. SCREEN IN G FOR VIRAL INSERTS

How do we find out w hich viruses have the correct inserts? As already noted, in som e cases we can m ake the selection based on size alone, because only those genom es w ith the inserts will fit in the phage head. In o th er cases, we m ay need to screen for the inserts. To do this, the phage are placed at specific, m arked locations on duplicate Petri dishes on w hich a “law n” of bacteria has been grow n. W hen this is done, the phage grow on the bacteria, leaving holes in the lawn called viral plaques. These are regions in w hich the bacteria are dead, but the viruses are num erous. Each plaque contains phage, b u t som e of the phage particles do not contain the correct DNA insert. How do we tell them apart? If we place a nitrocellulose p ap er on the agar in one of the replica Petri dishes, the phage stick to it. Then, we can w ash the paper in an alkaline solution, which will lyse (break open) the phage and d en atu re (break the hydrogen-bonds, etc) DNA th at was in the phage. The DNA rem ains stuck to the nitrocellulose filter paper. This entire process is show n in Figure 7-5. To identify plaques th at contain the new DNA, we perform the sam e steps as for the bacterial screening m ethod: We p u t the nitrocellulose paper in a plastic bag, swirl o u r labeled probe solution w ith the paper, w ash the paper, and use it to expose an x-ray film. The plaque or plaques containing the new DNA will show up as dark spots on the x-ray film. OTHER VIRUSES

There are num erous viruses know n, m any of w hich attack p rim arily eukaryotic (higher, m ore complex form s) cells. Each kind of virus replicates itself in specific ways. M any cause sickness and even death, since viral infection is often difficult to control once it starts. For exam ple, com m on colds are caused by viruses. Influenza is viral-induced. The AIDS epidem ic is caused by the h u m an im m unodeficiency virus (HIV). And all aro u n d the w orld, new viruses such as the Ebola virus, w hich caused m assive death in Africa, seem to be cropping up. And none of us

134

Genetic Engineering

Figure 7-5 Phage screening technique. First, a Petri dish is inoculated w ith b acteria all over it and allow ed to grow, giving a “law n” of b acteria. Phage th a t have received DNA inserts are then spotted at various locations on the bacterial law n. The phage are allow ed to grow, killing the b acteria an d pro d u cin g plaques (places w here the b acteria are killed by the phage infection). The viral plaques are lifted off by a n itro cellulose filter paper, after w hich the p ap er is treated w ith an alkaline solution th a t lyses the phage, releasing the DNA (w hich sticks to the paper in those locations). The p aper is then swirled w ith a radioactively labeled probe com plem entary to a portion of the DNA insert, and those plaques co n tain in g the in sert are identified. The phage containing the in sert can then be rem oved from the original Petri dish and used to infect m ore bacteria, producing enorm ous am ounts of phage.

Viruses

135

is u naw are of the enorm ous problem developing because of the HIV virus. Although m any viruses are pathogenic, m any (including HIV) have also been harnessed as tools in the genetic engineering effort. We will discuss this in m ore detail in the next chapter. SUMMARY

In this and the previous chapter, we have discussed two m ethods of bringing new DNA into b a c te ria —by using plasm ids and by using bacteriophage. Phage have som e advantage, because they can bring in m ore new DNA th a n plasm ids can. In addition, phage can have a life cycle (lysogenic) th at allows them to insert th e ir DNA into the b acterial chrom osom es, w here it is left for m any generations. This allows us to p u t new DNA into the phage and let the phage insert it into the bacterial chrom osom e. The result is th a t b acteria th en co n tain the new DNA, w hich, w hen it is expressed, m akes proteins th at are specified by the new DNA. This approach gives us an additional way (along w ith plasm ids containing new DNA) of harnessing bacteria to m an u facture proteins of use to m ankind. Som e pro tein s can be m ade using only cells from higher organism s. Using the sam e approach outlined in this chapter, we can use o th er viruses, w hich have been m odified to contain new DNA, to insert th at DNA into higher-order cells.

Ill

MAKING GENETIC CHANGES IN PLANTS AND ANIMALS

8 PLACING NEW GENES IN MAMMALIAN CELLS WHAT YOU WILL LEARN IN THIS CHAPTER

• • • •

How tran sfectio n (putting new DNA into m am m alian cells) is carried out How to screen m am m alian cells to ensure th at the new DNA is present How new DNA can be inserted into m am m alian cells using viruses as carriers (vectors) How to m ake com plem entary DNA (cDNA) libraries of certain cell lines

One of the nice things a b o u t b acteria is th a t they are easy to m anipulate and quick to grow. This in tu rn allows genetic tra n sform ation to occur easily. The grow ing process is m uch m ore difficult w ith plants and anim als th an w ith bacteria, because generation tim e increases and the com plexities are greater. However, in recent years, it has been possible to extract certain kinds of cells from anim als, including hum ans. Through careful m an ipulation, these cells can grow and divide in culture. This process is called tissu e culture. W hen cells are cultured in this way, they act a lot like bacteria and can be m an ip u lated using the tools we have previously described in C hapter 6 and 7, at least to som e degree. This has been a trem endous benefit to 139

140

Genetic Engineering

those w anting to w ork w ith the higher-order (eukaryotic) cells. One m ajor difference betw een a bacterial cell and a eukaryotic cell is th at very few plasm ids (see C hapter 6) exist in eukaryotes, so the process of altering the DNA happens m ainly in the c h ro m osom e itself. Why do we w ant to go to all the trouble of m anipulating eukaryotic cells, w hen b acteria are so m uch easier to m an ip u late? The answ er is th at bacteria, as good as they are, cannot be induced to express m any m am m alian genes. Som e m am m alian proteins are substantially m ore com plex th an those found in bacteria. Because of this, it is often necessary to harness eukaryotic cells to do the work. In addition, som e eukaryotic proteins have additional sugar units attached after proteins are m anufactured, w hich bacterial cells cannot do. In the final analysis, we w ant to learn to m anipulate h u m an cells, because we would especially like to engineer them in order to produce proteins th at w ould be useful to m ankind. An example of this is the m anufacture of tissue plasm inogen activator (TPA), a protein that will dissolve blood clots in patients who develop them . This protein was the first to be m ade th rough genetic engineering of anim al cells. Now, ra th e r th an having to isolate TPA th rough laborious and expensive extraction processes from an anim al source, cells containing the gene insert for this protein can be grow n in tissue culture, and m assive am o u n ts of the protein can be isolated and used. We will m ore fully discuss this and o th er exam ples later in this chapter. TRANSFECTION

It has been know n for years th at DNA in tissue culture m edium can be taken up by the cells of m am m als (this includes hum ans). The process by w hich this is done and inco rp o rated into the genom e of the cells is called tran sfection , the eukaryotic counterpart to transform ation.

Calcium Phosphate Method One way tran sfection happens is th a t DNA is carried into the cells w ith a bit of calcium phosphate. S im ilar to w hat happens in bacterial transform ation, the technique is to prepare a tra n sfection m ixture of the DNA sam ple and then add calcium p h o sphate. Special techniques have been developed th at allow up to 20% of the cells to be transfected.

Placing New Genes in Mammalian Cells

141

Electroporation Method Probably the m ost com m on m ethod of transfection is to use electroporation (see C hapter 6). As w ith bacteria, electro p o ration disru p ts the cell m em brane and opens pores th at allow DNA to enter. DNA pieces up to 150 kb long can be inserted in this way, w ith a m inim um am ount of preparation. The efficiency of this process is about 10% at m ost. In both this and the calcium phosphate approach, the DNA is inserted random ly into the cell. So a m ajor question is w h eth er the DNA is actually in co rp o rated into the gene, and, if so, is it in co rp o rated in a place w here it can be used. Because this m ethod is so easy to use, it is a very popular way to transfect m am m alian cells. M ARKING A N D SCREENING TECHNIQUES

Generating Thymidine-Deficient Cells As noted in C hapter 6, one of the challenges in genetic engineering any cell us to find out w hen the new DNA insert is actually in the cell. W ith bacteria, we were able to use the convenient antibiotic m arkers on the plasm ids. However, m am m alian cells don’t have plasm ids, so the question we m ust answ er is w hen we have put new DNA into the chrom osom es. Close on the heels of this question is w hether we have put it in a place w here it will be used to m ake proteins, w hich m eans it should be put behind a p ro m o ter region. To screen for the presence and the placem ent of inserts, it is necessary to develop som e ra th e r tricky ways to screen m am m alian cells. The problem of random insertion has plagued researchers for a long tim e, and they have expended considerable effort to develop suitable m arkers and screening techniques. There are now several ways in w hich the presence of the insert into the DNA of the cell can be screened. One of the m ost com m on is using the th ym id in e k in ase (tk) gene as a m arker. T hym idine kinase is an enzym e th at adds a p h o sphate group to thym idine (T is one of the four nucleotides), m aking thym idine m onophosp h ate (dTMP). This process of adding a p h o sp h ate group is called phosphorylation and is a necessary step in m aking dTTP (thym idine triphosphate), w hich is incorporated into DNA. Cells th a t contain the tk+gene can synthesize dTTP in this m anner, b u t it is not the m ajor pathway, so the cell does not have to use this m echanism . Cells have been discovered which are m utant in the tk gene, m aking them tk~ cells. These cells are unable to make

142

Genetic Engineering

thym idine kinase, w hich m akes it im possible for them to m ake dTTP. They can be isolated as outlined in Figure 8-1. M utant cells th a t lack tkr can be isolated by feeding the cultu re d cells brom odeoxyuridine (BrUdr), a derivative of u ridine th a t is also phosphorylated by tk. W hen B rU dr is phosphorylated by tk, it can be in co rp o rated into the newly m ade DNA. This causes the new DNA to becom e susceptible to ultraviolet light. So w hen cells are grow n on B rU dr and th en subjected to ultraviolet light, the cells th a t have B rU dr in th e ir DNA die. Those cells th a t have no tk (tkr ) live ju st fine, although they are rare. Once these tk~ cells are isolated, entire tkr cell lines can be grow n (see Fig. 8-1).

Using HAT Medium to Screen for Transfected Cells If norm al cells are grow n in a m edium containing hypoxanthine, am inopterin, and thym idine (HAT m edium ), the norm al synthesis of DNA is blocked by the am inopterin. Because thym idine kinase is p resen t (tk+cells), the cells will grow in the p resence of am inopterin because they can use the alternate pathw ay to m ake DNA. B ut if we try to grow tk~ cells in HAT m edium , they will not grow because they have no way to m ake DNA, since the norm al pathw ay is blocked by am inopterin. The a lte rnate (tk) pathw ay will not work, since the cells are m u ta n t in this enzym e (tkr). L ets take a tk gene from a norm al cell and ligate (tie) it to a new gene th a t we w ish to insert into a eukaryotic cell line. We th en use eith er calcium p h osphate o r electro p o ratio n to allow the new DNA to en ter tkr cells. Then, in the presence of the HAT m edium , only the cells th a t have the insert will grow, because they now have the tk gene. This can be confirm ed by analyzing the DNA and show ing th at the new tk gene is present in the cells th a t lived. This experim ent is show n in Figure 8-2. So, now we can use the tk gene as a m ark er to tell us w hen we have tra n s fected o u r cell line, since the cells th a t live should contain ou r new DNA insert. By ligating (attaching) any new DNA to the tk gene, it should be possible to introduce any new DNA gene of o u r choice into m am m alian cells. But it tu rn s out th a t we don't even need to ligate the new DNA to the tk gene, since by m erely adding the tk gene along w ith the gene to be inserted and a c a rrie r DNA (e.g., h a m ste r DNA) to the sam ple, the DNAs autom atically blended w ith the tk gene (Fig. 8-3). It was found upon sequencing that,

Placing New Genes in Mammalian Cells

143

Figure 8.1 Screening using brom odeoxyuridine (BrUdr). M utant cells th at lack tk 'c a n be isolated by feeding the cultured cells BrUdr, a derivative of uridine th a t is also phosphorylated by tk. W hen B rU dr is phosphorylated, it can be in co rp o rated into the newly m ade DNA. This causes the new DNA to becom e susceptible to ultraviolet light. So w hen cells are grow n on B rU dr and then subjected to ultraviolet light, the cells th a t have B rU dr in th e ir DNA die. Those th at are tk~ live ju st fine, alth o u g h they are rare, because they couldn't p u t the B rU dr into th eir DNA. Once these tk~ cells are isolated, entire tkr cell lines can be grown.

144

Genetic Engineering

Figure 8.2 Screening cells using the tk~ m arker. First, the tk gene is attach ed to the piece of DNA to be inserted into a cell. Then the chim eric DNA is in tro d u ced into the tkr cell line by electroporation. Cells con tain in g the tk gene will grow on the HAT m edium , but all others will not grow.

although these various pieces were integrated random ly into the chrom osom e, the newly inserted DNA is physically linked by the cell to the tk gene th at was added. So alm ost any new gene can be introduced into eukaryotic tissue culture cells sim ply by

Placing New Genes in Mammalian Cells

145

Figure 8.3 The process of inserting new DNA into a cell line. First, a DNA fragm ent containing the tk gene is mixed with a piece of DNA contain in g the DNA of choice (in this case a rab b it p-globin gene). By adding the DNA to tk~ cells (generally using electroporation) and grow ing the cells in HAT m edium (hypoxanthine, am in o p terin , and thym idine), only those cells into w hich the tk was inserted will grow. C ulturing various colonies of the tk + cells, the DNA from each is extracted, an d a S o u th ern blot is perfo rm ed to identify those colonies into w hich the rab b it P-globin gene was successfully transferred.

146

Genetic Engineering

including the DNA along w ith the m ark er and using calcium phosphate to incorporate the new DNA into the cell. But using this thym idine kinase m ark er does not always produce the right change, because the new gene can be pu t alm ost random ly into the chrom osom e of the m am m alian cells. It m ay o r m ay not be in a region w here it can be expressed into a protein. In addition, it m ay be placed in a position w here it causes m ajor changes in the m am m alian cells them selves. So, to get the new gene to be expressed, it is very desirable to add a prom oter region to the gene and the marker. This com bination of a new gene w ith a p ro m o ter region (and m arker) attach ed is called a con stru ct. This co n stru ct m ight look like th at illustrated in Figure 8-4. So, w hen the new DNA gene is p u t into a cell line, the gene will carry its own m echanism s to tu rn the new gene on and off. By using pro m o ter regions th at are stim ulated into activity only by specific chem icals, the process becom es even m ore highly defined. Once the new DNA insert is in the cell line, we can add the specific chem icals th at will stim ulate production of m essage RNA form the specific gene we inserted. This will then be used to m ake the protein th at was encoded in the new DNA gene. The final p ro d u ct of all this is a m am m alian cell culture th a t will be able to produce certain specific proteins, such as tissue plasm inogen activator, w hich can be used to help fight blood clotting. As noted earlier, in m any cases bacteria cannot m ake eukaryotic proteins, so the m am m alian cell culture approach is essential. VIRAL A PP R O A C H

M am m alian cells can also be tran sfo rm ed using viral vectors (carriers). Initially, it was h a rd to find a viral vector th at w ould work. However, a virus o btained from m onkeys, SV40, was found to w ork well and has been the w orkhorse of anim al cell transform ation for m any years. The SV40 genom e is a small circu lar double-stranded DNA of about 5.2 kb (kilobases) w ith m any restriction enzyme sites. This SV40 virus will go through a lytic cycle in w hich it rep ro duces itself w hen infected into cell lines developed from the African green monkey. However, in m ouse and h a m ste r cell lines, there is no lytic infection, bu t the viral genom e is inte-

Placing New Genes in Mammalian Cells

147

Figure 8.4 The m aking of a co n stru ct. To get inserted genes to tu rn on synthesis, a p rom oter region is placed next to the gene by cutting the plasm id next to the p rom oter region and inserting the new DNA gene of choice. The tk gene is added random ly into the plasm id as well. This en tire u n it can now be p u t into a m am m alian cell, using electro p o ration, as show n in Figure 8-3.

148

Genetic Engineering

grated into the host genom e as in the lysogenic cycle of phage in bacteria. Often the SV40 sequences are rearran g ed in such transform ed cell DNA. As w ith bacteriophage, there is a strict size lim itatio n as to how m uch DNA the virus can carry. It also m akes a difference as to w here the insert is placed in the SV40 genom e. Although a portion of the genom e can be replaced, the size of the insert m ust be essentially the sam e size as the extracted DNA. SV40 has been used successfully for a long tim e as a viral vector in m any different applications. However, because of the size lim itation and the problem th at often occurs w ith rearran g em en ts of the inserted DNA, o th er viral vectors have been sought.

Retroviral Approach Recently, researchers have turned to retroviruses to deliver new DNA into m am m alian cells (Fig. 8-5). R etroviruses have RNA (ribonucleic acid) as th eir genom e and m ake DNA out of th eir RNA once they have infected a host cell. The beauty of the retroviral system for o u r purposes is th at the new DNA is placed in an exact place in the chrom osom e of the host cell and is generally readily activated. So if we were able to put o u r new gene into the retrovirus, it should be expressed as well. However, this is w here it gets a bit sticky. First, retroviruses are often very infective to m an and o th er anim als. So it isn't a good idea to infect cells w ith an active viral agent th a t can infect m an or anim als. Second, there is still a strict size lim it on the viral genom e, and the add itio n of m uch new RNA is impossible. B oth of the la tte r problem s have been bypassed neatly by taking m ajor po rtio n s of the viral genom e out of the virus and inserting the new RNA in th at region. As this viral genom e is inserted into a cell, it is inserted into the host cell chrom osom e at the specific site w here the virus w ould ordinarily insert its genom e. Ordinarily, the virus w ould then go about m aking new viruses. However, if the construct we m ake replaces som e or all the viral coat proteins, no new viruses could be m ade. The m ajor problem is to m ake these viruses th at will infect cells properly, but not reproduce. The trick is to use p ackaging cells. These cells m ake the necessary viral coat and o th er

Placing New Genes in Mammalian Cells

149

Figure 8.5 The life cycle of a retrovirus. As w ith the lytic pathw ay of a bacteriophage, a retrovirus attach es to a cell and the genom e, in this case viral RNA, an d is in tro d u ced into the host cell. An enzym e called reverse tra n sc rip ta se first m akes a DNA copy of the viral RNA. Then, RNA polym erase is used to m ake m any m ore copies of the viral RNA. Som e of the viral RNA is tran slated into proteins, and the rem ainder is used in the assem bly of new retroviruses. In this case, the m ost cells m ay not be lysed, b u t will keep on p roducing and releasing retrovirus particles for som e time.

150

Genetic Engineering

proteins. So, by adding viral genom es to the packaging cell th at has the genes for proteins deleted, the new genes will be inserted in th a t region and the packaging cells will then m ake new virus particles th at contain a construct of the viral genom e. This construct will contain the new gene and p rom oter region. The virus th a t is produced is a crip p led virus in th at it cannot reproduce itself, but is nonetheless infective to o th er cells (Fig. 8-6). Packaging cells are designed to produce trem endous num bers of virus particles in about 2 days. The crippled viruses can then be used to tra n sfe r th eir p a rticu la r gene inserts to various m am m al cell cultures. W hen a virus carries new DNA into a cell, it is called a viral vector. A vector is any device or agent that can be used to insert new DNA into a cell. So, not only viruses, b ut phage and plasm ids are vectors. The retroviral ap p ro ach is a pow erful ap p ro ach to use to insert new genetic m aterial, since the crippled retroviruses place the new DNA in active regions of the host cell chrom osom e, which allows expression of those new genes. The retroviral vector ap p ro ach has been refined over the years to produce better and m ore specific packaging cell lines, m ore specific viral vectors, and increased p ro d u ctio n of the virus particles in the packaging cells. The retro v iru s of choice in recen t years has been the m ouse leukem ia virus (m urine leukem ia virus, MLV), w hich has been crip p led and m odified as ju st described. U nfortunately, like m ost retro v iru ses, this virus can only infect cells if they are dividing. This w orks fine in m am m alian cell cultures, bu t does not w ork well for gene tra n sfe r to living tissues in anim al cells th a t m ay not be actively dividing. It is in te restin g th a t very rec e n t success has been rep o rted using the h u m an im m u n odeficiency virus (HIV) as a crippled virus vector for nondividing cells. This a p p ro a c h will be discussed m ore fully in C hapter 11. We can see th at the possibilities of transfecting anim al cells are num ero u s and fall essentially in the sam e p attern s as the tran sfo rm atio n of bacterial cells. As noted earlier, if m ass p ro duction of a certain protein, such as tissue plasm inogen activator, is needed, because bacterial cells cannot be used for this purpose, transfected m am m alian cells are extrem ely useful and im p o rtan t to provide this im p o rtan t protein. The m ethod of choice to transform m am m alian cell cultures is the use of a viral vector.

Placing New Genes in Mammalian Cells

151

Figure 8.6 M aking crippled retrovirus particles th at can infect o ther cell lines. Initially, deletions are m ade in som e of the protein genes of the retroviral RNA. In the place w here the deletions occurred, new DNA co n tain in g a p ro m o ter can be inserted. The DNA co n stru ct is then in serted (by electro p o ratio n ) into packaging cells. Packaging cells rapidly encap su late the viral RNA genom e into virus particles and release them . The viral RNA genom e still lacks som e viral protein genes a n d contain s the new DNA. These crippled virus particles are then capable of infecting a new cell line, but cannot reproduce themselves.

152

Genetic Engineering

c D N A LIBRARY We w ould like to place a h u m an gene for a specific p rotein into a m am m alian cell culture. To do this, it is highly desirable to m ake a library of h u m an cell DNA so th at it will be available to sort th rough and look for certain genes. In C hapter 6, we learned how to m ake gene libraries for a pancreas cell (which is a cell derived from m am m als) by cutting it up into sm all pieces and puttin g these pieces into b acterial cells. As noted, gene libraries are w onderful sources if we w ant to get a lot of a certain gene (such as the insulin gene found in pancreas cells) But in C hapter 3, we learned th a t the chrom osom es from higher-order (eukaryotic) cells had m any pieces in them th at w ere not used as genes (introns). These in tro n s had to be rem oved from the pre-m essenger RNA before it could be used as m essage. So, it w ould be highly desirable to have a library c o n taining the m essenger genes only, w ithout all of the introns present, as were present in the library we previously discussed. Actually, this can be done quite well. All eukaryotic cells use mRNA (m essenger RNA) m olecules th at have a poly-A tail. If we take a eukaryotic cell line and d isru p t the cells, it is possible to “fish out" the mRNA m olecules by using an oligo-T colum n. An oligo-T colum n is filled w ith tiny glass beads to w hich are attached pieces of DNA containing only T (thym idine) residues. These stretches of T -T -T -T -T will find the A-A-A-A-A tail of the mRNA and stick to it with hydrogen bonds in a com plem entary way, as show n in Figure 8-7. The poly-A -containing mRNA m olecules can be w ashed off the oligo-T colum n using a salt solution. These mRNA m olecules co n tain the genetic codes of all of the proteins th a t the eukaryotic cells were m aking when they were harvested. The advantage of using these mRNA m olecules ra th e r th an the DNA genes is th at all unnecessary in form ation co n tained in the DNA in the form of introns has been rem oved, leaving only the genetic m essages. Using reverse transcriptase (an enzym e th at m akes DNA from RNA tem plate), a DNA copy of the mRNA can be m ade. By using a poly-T p rim e r (a sh o rt piece of DNA com plem entary to the poly-A tail of the mRNA), the DNA com plem entary to the mRNA can be m ade, w hich is called com plem entary DNA or cDNA. By adding poly-T and reverse transcriptase to the mRNA m olecules isolated from a given cell line, a m u ltitude of cDNA m olecules will be m ade, corresponding to the various mRNA m olecules in the cell line (Fig. 8-8). These cDNA

Placing New Genes in Mammalian Cells

153

Figure 8.7 Purification of m essenger RNA (mRNA). mRNA from eukaryotic (higher-order) cells always has a long string of As on the 3' end (a poly-A tail). Since this w ould be com plem entary to a series of T s, a colum n is m ade co n tain in g beads w ith a long string of T s (oligo-T) attach ed . W hen a solution co ntaining mRNA is poured th ro u g h the colum n m aterial, everything goes th ro u g h but the mRNA, w hich sticks because of the com plem entary base pairing betw een the As at the 3' end of mRNA an d the T s attach ed to the colum n m atrix. The mRNA can then be w ashed off w ith a salt (e.g., NaCl) solution.

m olecules contain the genetic m essage of the various proteins th at are being m ade by th at p articular cell line. The cDNA stran d s now can be inserted into plasm ids by adding the appropriate end groups and tying them into the plasm ids exactly as outlined in C hapter 5. The m odified plasm ids are th en inserted into bacterial cells and the culture of cells grown, giving a cDNA lib ra ry .

Screening cDNA Libraries The screening of cDNA libraries can be accom plished in exactly the sam e way as we did w ith the gene libraries, as discussed in

154

Genetic Engineering

Figure 8.8 D iagram show ing how reverse tran scrip tase works. First, we need an RNA tem plate and a prim er. The prim er is com plem entary to the 3' end of the tem plate. If, as show n in this example, the tem plate is m essenger RNA (mRNA), the 3' end is a series of As, so the p rim er can be an oligo-T (a series of T's). Upon adding the primer, reverse tra n scriptase, and the necessary ATP, GTP, CTP, and GTP, reverse tran scrip tase synthesizes a stran d of DNA com plem entary to the RNA tem plate.

C hapter 6. In this case, the DNA probe used w ould be com plem entary to a p o rtio n of the new gene sequence. This w ould identify any cDNA th a t co n tain ed th a t sequence. As previously noted, the advantage of this library over a gene library is th a t the cDNA library contains genes that can be transcribed directly into mRNA w ith o u t fu rth e r processing. This m akes them ideal for inserts into cells. By isolating a specific gene from a cDNA library, adding a p ro m o te r region to it, and inserting it into m am m alian cells and culturing them , im m ense am ounts of th at p a rticu la r p rotein will be m ade by the cells. The cells can then be harvested and the protein purified.

A P P L IC A T IO N S We now have at h an d a n eat arsenal of tools to use to harness cells to do w ork for us. We can isolate p a rticu la r genes from gene libraries and then, using the techniques we have discussed in the previous few chapters, insert these new pieces of DNA into the ap p ro p riate cells of ou r choice. It is im p o rtan t th a t these new pieces of DNA contain a gene for a protein we w ish to make. This ap proach has been used for m any different proteins and is being pursued for m any m ore. Table 8-1 lists a few of the

Placing New Genes in Mammalian Cells TABLE 8.1

155

Some Proteins Made Using Genetic Engineering

Protein

Use

H um an insulin

Treatm ent of diabetes

H um an grow th horm one

Treatm ent of grow th deficiencies

Interferon

Treatm ent of viral diseases

Tissue plasm inogen activator

Dissolves blood clots

E rythropoietin

Stim ulates red blood cell production

proteins th at have been m ade using genetic engineering tec h niques, which are now com m ercially available. Insulin, w hich is used to help control diabetes, has been m ade p rim arily from bacteria] sources. Tissue plasm inogen activator, a pro tein used to dissolve blood clots, has been m ade using both bacterial and m am m alian cultures. H um an interferons, at least som e of them , have been m ade using both bacterial and tissue cultures. Although these are know n to inhibit viral disease, their exact m echanism is not well un d ersto o d at this tim e. Som e of the interferons are glycoproteins (have sugars attached), so they m ust be m ade in m am m alian systems. All of these exam ples are proteins th a t are overproduced by genetically engineered b acterial or cell culture approaches, w hich allow us to produce large am ounts of proteins th at can be ad m in istered to prevent or control certain diseases. There are two m ajor advantages in using this approach, rath e r th an trying to isolate these substances from naturally occurring sources. First, the am ounts that can be m ade are alm ost unlim ited; yet, the cost is but a fraction of w hat it w ould cost to isolate the pro tein from a n a tu ra l source. Second, in all cases we can use the hum an protein. F or instance, insulin was isolated from pigs before it was genetically engineered into a bacterial strain. As a result, it was q uite expensive. But there were also a n u m b er of people who had adverse reactions to porcine insulin. So, w ith the developm ent of genetic engineering techniques, both problem s were addressed.

156

Genetic Engineering

In the case of h u m an interferon, it took over 5000 gallons of blood serum to produce 1 g of in terferon before it was genetically engineered in the early 1980s. This m eant th a t the cost of tre a tm e n t to patien ts was alm ost prohibitive. Now, it can readily be produced in gram am ounts for a fraction of the cost. These and o th er exam ples illustrate the pow er of the genetic engineering ap p ro ach to supplying p roteins th a t are critical in m edical treatm ents.

C O N C L U S IO N S We need to em phasize th a t th u s far, we are really establishing “pro tein factories” using tran sfo rm ed cell lines. A lthough it is less costly if b a cteria can be harnessed to provide various p ro teins, som e proteins have sugar units attached or other com plexities and need to have additional com ponents, w hich b acteria cannot readily provide. In these cases, anim al cell lines are used. In C hapter 11, we will talk ab out m any of these applications. This ap p ro ach is substantially m ore expensive th an bacterial cultures, bu t it is still m arkedly less expensive th an extracting proteins from other natural sources. So far in this book, we have developed an arsenal of tech niques th a t can be used to p u t new pieces of DNA into e ith er bacterial or anim al cells. In each case, we have learned ways to put the inserts into desired locations in plasm ids or genom es. We have also developed ways to find them once they are inserted. This is done by using m arkers to screen for the cell lines th at have been transform ed. The final proof is w hether the tran sfo rm ed cell lines actually m ake the new proteins w hose genes have been inserted.

SU M M A RY Although DNA can be inserted into m am m alian cells using eith er calcium p h o sphate or by electroporation, the placem ent of the DNA at the right spot in the chrom osom e of the cell is im p o rtan t. We m o n ito r w h eth er ou r new DNA insert is present in the cell using a tyrosine kinase {tk) m arker. This m ark er is a little like the antibiotic-resistant m arkers used in bacterial cells, in th a t w hen it is present, cells grow on a special culture m edium . By using cells th a t don't have the tk gene and then adding the tk gene w ith o u r new DNA, we can screen for the

Placing New Genes in Mammalian Cells

157

cells that have the tyrosine kinase m arker and the new DNA. The problem rem ains th a t even w hen the new DNA is inserted, it m ay not go to an active region of the m am m alian cells genom e and would not be useful. Viral vectors were developed to insert the new DNA into a correct region of the m am m alian cell genom e. By placing a p ro m oter region w ith the new gene, the gene can be turned on with specific chem icals added to the culture m edium . In this way, m am m alian cells can be cultured, the genes tu rn ed on, and specific proteins m anufactured for m edicinal use by m an. To obtain the desired genes, we need to m ake a library of the specific genes used to code for the proteins. By o btaining m essenger RNA (mRNA) m olecules from grow ing h u m an cells and reverse tran scrib in g the mRNA into com plem entary DNA (cDNA), a library of these cDNA pieces can be m ade by placing them into bacteria. We can then screen the b acterial cDNA library for a desired gene, isolate th a t b acterial strain, extract the cDNA fragm ent, and insert it, along w ith a prom oter, into the m am m alian cell line to produce the p rotein we desire to be m ade. This approach now is routinely used for a num ber of pro teins, w hich we will discuss m ore fully in C hapter 11.

9 GENETIC ENGINEERING OF PLANTS W HAT Y O U WILL LEARN IN THIS C H A PT E R • • • • • •

Som e historical m ethods of plant breeding and engineering How to o b tain and culture plant cells having no cell walls (protoplasts) How to put new DNA into plant cells How the leaf-disk technique is used to tra n sfe r new DNA into plant cells How to use viruses to transfer new DNA into plant cells How antisense nucleic acids are used to engineer plant functions

So far we have co n cen trated alm ost entirely on the ways and m eans to genetically alter bacteria and anim al cells, but we have said nothing about whole organism s, such as plants or anim als. Plants are becom ing a very fertile area in w hich to perform genetic engineering. For instance, a new variety of tom ato was in tro d u ced recently—the Flavr-Savr™ . This tom ato can be picked alm ost ripe from the vine, then shipped w ithout refrigeratio n and still rem ain firm and unspoiled on the g ro cers shelf for over twice as long as the typical green-picked tom ato. The Flavr-Savr™ was genetically engineered to have these qualities. 158

Genetic Engineering of Plants

159

How can we genetically engineer plants? Plants are com posed of cells, so we m ight assum e th at the sam e m ethods we have used w ith b acteria will w ork here. This is tru e in principle, b u t plan t cells all have a heavy cell wall th at m akes them pretty im penetrable to m ost of the techniques we have learned thus far. In addition, p lan t cells generally do not co n tain plasm ids or other nice features we have w orked w ith up to now.

H IS T O R IC A L M E T H O D S T here are several genetic engineering approaches to take w ith plants. And they have lots of advantages. Plants are easy to cross and often can be bred asexually. For th o u san d s of years, plants have been grafted and cross-bred, but in the last two decades or so, m any sophisticated variations have been introduced. In the past, w hen the goal was to introduce tra its such as disease resistance, two plant lines w ere sexually crossed to give first-generation hybrids. These hybrids were then crossed w ith the p aren ts until the desired tra its w ere present. This process was often tedious and was restricted to initial crossing of species th at were sexually com patible. Technologists who w ork w ith plants have one trem endous advantage over those w ho w ork w ith o th er organism s. It tu rn s out th a t m any plant cells are to tip o ten t, even m atu re plants. Such cells can be grow n in a m edium and then induced to produce plants from single cells. A to tip o ten t cell is one th at contains the full com plem ent of DNA, all of w hich is able to be used. In recent years, scientists have found ways to cause the cells of plants to grow in culture m edia, m uch like b acteria grow. C ertain cells can be isolated from plants. W hen they are placed in the right grow th m edium containing certain grow th h o rm ones, they continue to divide and grow individually. These cells th en can be treated w ith o th er horm ones, w hich cause them to differentiate into whole plants or portions of plants. This redifferentiating process can only happen w hen the cells have not been cu ltured long. That is, great, great, great g ran d d au g h ter cu ltu red cells are less likely to redifferentiate th an their grandparents. It is not certain w hat is lost as the cells grow older in culture, but it is know n th at early cultures w ork b e tte r and late cultures hardly work at all. This kind of tissue culture is very com m on in research and com m ercial laboratories today (Fig. 9-1).

160

Genetic Engineering

Figure 9-1 Overview of the way in which tissue culture can be set up. S tartin g w ith p o rtio n s of plants, sterilizing, w ashing, and trim m ing take place, after w hich the pieces of plant are placed in grow th m edium . The cells then m ultiply and som etim es even develop into plantlets. They are subcultured (transferred again) to produce tissue in culture. S eparation of cells into a cell culture can also take place.

Genetic Engineering of Plants

161

From such tissue culture processes, we can obtain m any clones of the original cells, each of which can then be redifferentiated and placed in culture. Again, w hen appropriate horm ones are added, w hole plants grow. E ach plant is derived from a single cell and are clones of one another. In this way, florists have grow n rare and exotic flowers in great num bers. For instance, m ost com m ercial orchids are grow n from cloned plants. As noted earlier, it should be sim ple to m odify the plant ch ro m osom e w ith a novel gene, w hich will then allow a new tra n s form ed cell line to com e about. But it is not sim ple at all, owing to the thick cell walls, w hich m ake insertion of new genetic m aterial very difficult (Fig. 9-2).

Figure 9-2 D iagram of a th in section of a generalized cell from a h ig h er plant. N ote especially the thick cell wall, w hich is not found in anim al cells.

162

Genetic Engineering

PR O T O PL A S T CULTURE T E C H N IQ U E S To try to get aro u n d the cell wall problem , scientists have learned how to rem ove the cell walls from plant cells, leaving a p lan t cell w ithout a cell wall. This cell w ithout a cell wall is called a protoplast. The protoplast is m uch m ore vulnerable to insertion of new DNA. The source of cells from w hich to m ake pro to p lasts can be a cell culture, callus, or a sterilized leaf (Fig. 9-3). Callus is ju st a

Figure 9-3 P rep aratio n of p rotoplasts. P rotoplasts a rt plant cells w ithout the thick cell wall. Cells can be o btained from am source. The addition of cellulase destroys cell walls, after which two ce' itrifugations sep arate the proto p lasts. The second cen trifugation steo is done in sucrose—a denser m edium th an w ater—so the protoplasts float.

Genetic Engineering of Plants

163

random m ass of cells th a t adhere to one a n o th e r in a culture m edium . Using cells from any of these sources, on the addition of cellu la se, an enzym e th a t destroys cell walls, the rem aining cells w ithout walls are the protoplasts. These are th en purified and isolated by centrifugation. If these protoplasts are placed in the p ro p er grow th m edium , they will propagate them selves wildly, and in so doing clone them selves. W hile they are in the p ro to p last stage, they can be kept sep arate or induced to fuse w ith each o th er o r w ith p ro to plasts from o th er plant cells. Using this approach, we can m ake hybrids of new and unusual sorts from otherw ise sexually incom patible cells. For instance, a “p o m ato ” is m ade by fusing tom ato and potato protoplasts. By using calcium ions or ethylene glycol, pro to p lasts can be induced to take up o th er com ponents in the grow th m edium , including pieces of DNA ordinarily unable to penetrate the plant cell wall. Although protoplasts can get new DNA directly in this way, the p ro d u ct of th at tran sfo rm atio n is not always p redictable, because the newly inserted DNA m ay not find its way to a productive point in the p rotoplast chrom osom e. A lthough the pro to p last culture techniques show prom ise, they have not yet been useful in pioducing viable new hybrid species th at can reproduce w ithout considerable crossing of the newly form ed plant w ith other plants.

G E N E T IC E N G IN E E R IN G A P P R O A C H E S W hat is really needed is to have the ab ility to in tro d u c e new genes into p lan ts in a site-specific m anner. F irst, as before, it is im p o rta n t to o b tain the useful genes in sufficient a m o u n ts to tra n s p la n t into a n o th e r org an ism . Second, it is n ecessary to in se rt these genes w here they can be expressed w hen needed. The first step in genetic e n g in eerin g is now easily done. We can use the tec h n iq u es we have previously lea rn ed an d grow im m en se a m o u n ts of DNA—even p lan t DNA—in b a c te ria to give p la n t DNA lib raries. These DNA or co m p le m e n tary DNA (cDNA) lib ra rie s can then be screen ed to id entify an d isolate th o se b a c te ria that have the needed DNA in th e ir plasm ids. These b a c te ria can then be grow n and the p lasm id s can be h arv ested from the b a c te ria u sin g the m eth o d s we have discussed.

164

Genetic Engineering

Agrobacterium tumefaciens Technique Putting new plant DNA into the plant cell in a position so th at it will be expressed properly is a n o th e r story. A m ethod of doing this has recently been found and developed and is now com m only used. A certain strain of bacteria from the soil, Agrobacterium tum e­ faciens , can infect certain types of plants. W hen this happens, crown gall tumors form (Fig. 9-4). These tum ors consist of plant cells th at have gone w ild—m uch like cancer cells in hum ans. It was found that agrobacteria insert a plasm id into the plant cells. This plasm id is called the Ti plasm id, w hich stands for “tum orin d u cin g /' W hen the ag ro b acteria infect the plant, the plasm id enters the DNA of the plant cells. This causes the p lan t cells to form crow n gall tum ors. These tum ors can be excised, put into culture, and grow n as callus there. This scenario is sim ilar to w hat we found in bacteria, in which a plasm id was inserted into a b acteriu m and tran sfo rm ed the bacterium in a specific fashion. We used the plasm id to transfer DNA of ou r choice to the bacteria, using the plasm id as a carrier. In a sim ilar fashion, it should be possible to use the Ti plasm id as a carrier for DNA of our choice, which can be used to transform plant cells. Because of its size, the Ti plasm id is difficult to m anipulate, but it has been possible, using several different methods, to insert new genetic m aterial into the tum or-inducing region of the plasm id. Initially, the genes for tu m o r induction are rem oved from the Ti plasm ids, leaving this region available for new DNA. Insertion of this modified plasm id no longer causes the crown gall tum ors to form, but does allow the new DNA to be inserted into the plant cell chrom osom e. This approach has been successfully used and is now in wide use to insert new genes into plants.

Use of Leaf Disks With Agrobacteria A technique of choice to place new DNA in plant cells is to use leaf disks. Small circles (about 1 cm in diam eter) of leaves are cut and infected with an Agrobacterium culture that contains a genetically m odified plasm id—one that has the new DNA in it. To find out w hether the new DNA has been inserted, an antibiotic resistance gene (e.g., a kanam ycin-resistant gene) is joined to the new gene as a m arker and is inserted into the plasm id (Fig. 9-5). The plasm ids are then inserted into the Agrobacterium , following w hich the leaf disks are infected w ith this genetically m odified organism . The leaf disks are then grow n on m edium

Genetic Engineering of Plants

165

Figure 9-4 Infection of plants by the soil b acterium A g r o b a cte riu m tu m efa c ien s causes a tu m o r to grow on plants, this tum or, called crown

gall, can be rem oved and the tissue ex tracted and put in cu lture in a solution contain in g an an tib io tic to kill the A. tu m e f a c ie n s . In culture m edium , the crow n gall tissue grows into a callus th at will produce cells th at can be grown in tissue culture as well.

lóó

Genetic Engineering

Figure 9-5 G enetically engineering a plant. Sm all disks are taken from the leaves of a plant we wish to genetically alter. The agrobacteria have previously been genetically altered to contain the gene we desire. This gene is placed in the Ti plasm ids just as we did w ith bacteria. Once infected w ith the A g r o b a c te r iu m , the leaf disk is then put through a series of grow th steps to produce the new plant. Note that the process is m uch m ore lengthy th an the process in b acteria because of the grow th tim es.

th at contains an antibiotic, such as kanam ycin. The cells th at are tran sfo rm ed by the Agrobacterium plasm ids will be k anam ycin-resistant and will grow spontaneously in the m edium . The nontransform ed cells will not grow.

Genetic Engineering of Plants

167

Note th at the leaf disk approach is only useful for some plants and is not universally applicable to all plants, especially cereal plants, such as wheat, soybeans, and other grains.

Inserting New DNA with Viruses It is also possible to use viruses to place new DNA into plant cells, as w ith m am m alian cells, w hich we discussed in C hapter 8. Two DN A-containing viruses, cauliflow er m osaic virus and gem ini virus, have been used for this purpose. However, every virus has lim itations w ith respect to the kind of plants they will infect, the a m o u n t of inserted DNA they can carry, and exactly w here they will insert th a t DNA in the p lan t cellular c h ro m o som e. Efforts are ongoing w ith these vectors, and som e successes are being realized. The m ain advantage is th a t these viruses can insert new DNA into cereal plants (such as w heat, oats, and rye), w hich agrobacteria cannot do. B ecause m ost plant viruses are RNA (ribonucleic acid) viruses, it m akes the process of viral transfer of genetic inform ation som ew hat m ore difficult th an w ith DNA viruses. B rom e m osaic virus and tobacco m osaic virus are prim e RNA virus candidates at this tim e. The m ajor problem is engineering the in sert to be placed in the viral RNA. RNA is m ore fragile th an DNA, w hich can be readily synthesized or obtained from o th er sources. Although RNA can be synthesized, the process is m uch m ore expensive and m uch less accu rate th an DNA synthesis. Generally, RNA is m ade using RNA polym erase, an enzym e w hich will m ake the RNA from a DNA tem plate. This added step produces an additional hurdle for the RNA virus approach. Tom ato golden m osaic virus has recently been developed as a vector. It has two single-stranded DNA m olecules in its genom e. These naked DNAs are invective to plants. By inserting new DNA into one of these and inoculating into plants w ith this virus, viral infection spreads the new DNA into the plant cells. The purpose of using the viral approach is to get the new DNA inserted into active sites w ithin the p lan t chrom osom es. U nfortunately, at this tim e no single virus w orks on all plan t species. Thus, there is still an ongoing search for the best viral vectors to use in the engineering of plant cells.

Direct Methods O ther direct approaches have been m ade to insert DNA directly into plant cells th rough the tough cell walls. A lthough these m ethods lose the specificity of the plasm id or viral approaches

168

Genetic Engineering

(the ability to place the DNA at a strategic site in the plant cell chrom osom e), they are very convenient and have w orked in num erous instances Insertion of DNA directly w ith a projectile gun has seen m oderate success. H igh-velocity m icroprojectiles deliver nucleic acids into in tact cells and tissues. Although m any nam es are used, this process is generally know n as the b io listic p rocess. In this approach, a heavy m etal—often gold or tu n g sten —is coated w ith a DNA plasm id or a mRNA (m essenger RNA) and then literally shot into the cells to be transform ed. Figure 9-6 com pares this projectile approach w ith the Agrobacterium approach to insert new DNA into plant cells. M ost often used w ith plan t cells, this approach is also useful w ith o th er cells, including m am m alian cells and even w hole anim als. This approach is direct and does work, but is still being im proved and will likely be m ost useful for specialized ap p lication. This is literally a “shotgun” approach, since the new DNA is not directed to a specific site in the plant cell chrom osom e. A nother direct ap proach is to m icroinject plant cells using a syringe. This can be done easily, although it is technically dem anding. However, up to 100 cells per h o u r can be m icroinjected by a com petent technician, w ith a high percentage of success. Again the tim e needed and cost involved m ake this technique relatively unlikely to be a com m ercial success in m ost cases.

A Different Approach—The Antisense Approach To this point we have been discussing ways in w hich new DNA can be inserted into p lan t chrom osom es. In this way, genes for b etter or different proteins can be added to the plant cells. But w hat if we w anted to tu rn off a gene for a certain enzyme? A way to do this is to genetically alter the cell so th at it p ro duces a piece of RNA th at effectively blocks the tran scrip tio n or tra n sla tio n of an undesired protein. It is called “an tisen se,” because it is com plem entary (antisense) to a “sense” stran d of nucleic acid found in the DNA or mRNA. For instance, in 1988, a research er rep o rted finding a way to sw itch off the gene th a t m akes harvested tom atoes mushy, allow ing vine-ripened tom atoes to be delivered to your door. Polygalacturonase (PG) is the enzym e involved in the softening of ripening tom atoes. Biologists blocked synthesis of this enzym e by inserting an “a n tise n se ” gene into the plants

Genetic Engineering of Plants

Figure 9-6

169

Two com m on m ethods for genetically alter plants. The

A g r o b a c te riu m m ethod is described in the text and in Figure 9-5. The

DNA particle gun m ethod uses m etal p articles th at have been coated w ith the DNA to be inserted. These particles are literally shot into plant cells, p en etratin g the cell walls. The DNA is taken up by the ch ro m o som e of the plant and, in som e cases, genetically transform s the plants, using the new genes th at have been inserted.

170

Genetic Engineering

Figure 9-7 The antisen se approach. A lthough it carries a curious nam e, this pow erful appro ach has already been used for a com m ercial p roduct—vine-ripened tom atoes th at don’t go soft. A polygalacturonase (PG) gene is inserted into a tom ato cell line. The PG gene makes a piece of RNA th a t is com plem entary to the m essenger RNA (mRNA), w hich m akes the PG enzym e. W hen the com plem entary (antisense) RNA binds to the mRNA, the ribosom e cannot translate the m essage, so the PG enzym e is not produced. It is the PG enzym e th at m akes tom atoes go soft.

(Fig. 9-7}. This gene blocked the site at w hich tran sc rip tio n of the PG gene w ould norm ally begin. The result is th at vineripened tom atoes reach the m arket firm and fresh!

Genetic Engineering of Plants

171

A P P L IC A T IO N S E ngineered bacteria are now used as antifrost devices for straw berries to allow year-around straw berry production. Although this is not a process w herein the bacteria tra n sfe r genes to the straw berry plants, the bacteria them selves are engineered to produce a product th at helps protect the straw berry plants. This has not been as successful as hoped, but it does allow additional grow th periods for the straw berries. M any plants now being tested contain added genes th at confer disease resistance to the organism . Cotton p lan ts resista n t to cotton bollw orm s, corn plants resistant to corn borers, tobacco, tom ato, and grape plants resistant to viruses th at infect them all have been tested successfully and should soon be on their way to the m arket. Inserts have been m ade using Agrobacterium organism s as well as other vectors and have been incorporated as p art of these strains. The m ajor problem in this developm ent is the release of genetically engineered organism s into the environm ent. But, there are inherent problem s. One app ro ach has show n p o tential problem s w ith gene m anipulatio n: the engineering of glyphosphate resistance into various crop plants. G lyphosphate is the active ingredient in som e herbicides (such as R oundup ® and Tum blew eed ®). By incorporating glyphosphate resistance into crop plants, the h erbicides can be used w hen the crops are grow ing, w ithout dam age to the crops. But M other N ature has found a way to tra n sfe r the genetic inserts from the plants into som e weeds, w hich are now resistan t to the herbicides. Prospective hazards of genetic engineering approaches are m ore fully discussed in C hapter 13.

C O N C L U S IO N S All the genetic engineering techniques discussed here show prom ise, and m uch effort is directed tow ard m odifying plants using all of them . The Agrobacterium ap proach is by far the m ost com m on at present. The grow ing activity in plant biotechnology is m ost likely due to the enorm ous m arket potential, the lack of severe governm ental regulations such as those governing the m an ip u latio n of h u m an genes, and the n a tu ra l ability of plants to do a lot of genetic engineering on th eir own. We can look forw ard to trem endous advances in the future in this area of genetic engineering.

172

Genetic Engineering

SU M M A RY Plant cells p resen t m ore problem s to the genetic engineer th an do anim al cells, m ostly because they are encapsulated in a heavy cell wall, m aking tran sferrin g new DNA a challenging process. One ap proach is to rem ove the cell wall entirely. The resulting cells w ithout walls—p rotoplasts—can receive new DNA directly through the cell m em brane. By using bacteria, plants can be infected w hen the bacteria insert plasm ids into the plant cells. By placing selected DNA into the plasm ids of these bacteria, this new DNA can be inserted into the infected plant cells, becom es p art of the plant cell ch ro m osom e, and can provide resistance to certain diseases or be used to produce new proteins. Viruses can also infect plant cells. By puttin g additional genetic m aterial into plant viruses, these viruses can be used as the m eans to tran sp o rt the new genetic m aterial into plant cells. The advantage is th a t viruses are careful to put the new DNA in active sites in the plant cell chrom osom e. O ther m ethods have been used to direct plant cell activity. A successful approach is to put in a short piece of new DNA, and, w hen it is tran scrib ed into RNA, the new RNA blocks the tra n s lation of some protein.

10 EMBRYO TRANSFERS AND CLONING OF ANIMALS W HAT Y O U WILL LEARN IN THIS C H A PT E R • • • • • • •

How fertilization norm ally occurs How eggs can be fertilized in artificial {in vitro) circum stances How new nuclei can be transplanted into o ther cells How new genes can be inserted into egg cells to m ake transgenic anim als W hat a “knock-out" m ouse is How “p h a rm ” anim als can be developed and used How genetic engineering can be applied in oth er ways in the agricultural world

W ith o u r arsenal of tools, we are now p rep ared to engineer w hole anim als. How do we go about doing this? We m ust first learn a bit about the way anim als start their existence.

THE B EGI NNI NG OF ANIMAL LIFE

Initially, an egg is fertilized by a sperm . Each of these germ cells carries half of the chrom osom e com plem ent of the m ature cells. 173

174

Genetic Engineering

W hen fertilization occurs, the egg for a short tim e has two pronuclei (each containing half of the total chrom osom es)—one from the sperm and one from the egg. These two pronuclei com bine to form the cells nucleus and give the cell the full com plem ent of DNA. A fertilized egg is called a zygote and is said to be totipoten t because it is not specialized and can give rise to an entire functioning organism . All portions of the DNA are available for use by the cell. As this cell continues to divide, a tim e com es w hen the daughter cells are no longer totipotent, and d ifferen tiation begins. D ifferentiation is the process by w hich genes are selectively expressed to produce specialized cells. Zygotes quickly divide repeatedly, form ing groups of cells of 2, 4, 8, 16, 32, and more. D uring this early stage, the cells are all totipotent. Ultimately, they form a blastocyst, w hich is really a large group of the rapidly dividing cells contained in a m em brane. The individual cells in the blastocyst are called blastom eres. In the early stages of division, it is possible to separate the individual cells to obtain m ultiple copies of the sam e cell. However, once they are separated, these cells are very difficult to sheath together in a blastocyst. N onetheless, it can be done. For instance, scientists in Scotland rep o rted th at they took cells from an em bryo, grew thousands of individual copies in the laboratory, and th en used these copies to produce a n u m b er of cloned sheep from ewes.

In v itr o Fertilization In a related process called in vitro (outside the living body) fertilization, a blastocyst is transferred to a surrogate m other. This process of fertilization is becoming m ore com m on in hum ans and anim als. In vitro fertilization does not necessarily involve m anipulation of the gene, but such transplants can occur after the gene has been m anipulated. This approach has becom e an im portant technique in anim al breeding and has substantial potential with hum ans as well. Techniques have recently been developed to separate male sperm from female sperm , allowing the anim al clones to be sexed in advance. Such a process should provide trem endous advantages to both dairy and beef farmers.

C L O N IN G A N IM A L S W hen we used the term “clone” before, we were referring to identical b acteria th at all had the sam e DNA. The sam e general

Embryo Transfers and Cloning

175

definition can be applied to anim als. W hen two anim als have identical chrom osom al m aterial, they are clones. Identical tw ins fall into this category, b u t we generally don't use the term for hum an twins. W hen we w ant to m ake clones of anim als, we go th rough the following process. First, we separate the cells of the anim al to be cloned in the early division stage. Then these individual cells can be grow n to the blastocyst stage and inserted into surrogate m others. The resulting progeny w ould be clones because the DNA w ithin the cells m aking up the progeny is identical.

Putting New Nuclei in Other Cells Suppose we w anted to have a w hite m ouse give b irth to black progeny. This can be done by taking the fertilized egg from the w hite m ouse and rem oving the two pronuclei. Then, if we had early blastom eres from a black m ouse zygote, we could rem ove the nucleus from one of the blastom eres and insert it into the fertilized w hite m ouse egg cell th at lacked the pronuclei. The fertilized egg can then be grow n to the blastocyst stage and inserted into the m o th er again. This could be done m any tim es w ith m any fertilized egg cells, and the resu ltan t black offspring all w ould be clones of each other. Even though the fertilized egg cells cam e from w hite m ice, the offspring all w ould be black. These are tran sgen ic mice, because the w hite m others have given birth to offspring w ith new DNA in them . The first experim ents using fertilized egg cells w ith new nuclei w ere done in 1952 w ith frogs' eggs. These eggs are very large com pared w ith m ost o th er eggs and are therefore fairly easy to m anipulate. It was found th at if nuclei were rem oved from zygotes th at had not gone through too m any divisions, cloning was direct and easily accom plished. However, as the cells becam e progressively m ore differentiated, the nuclei lost th eir capacity to replace the nucleus of the fertilized egg. In fact, adult frogs were not able to donate viable nuclei at all. S cientists have attem p ted sim ilar experim ents w ith som e degree of success in larger anim als such as m ice, rats, sheep, goats, and others. If the nuclei are rem oved from a very earlystage blastom ere of a donor anim al and then inserted into a fertilized, denucleated egg cell from a receptor anim al, the egg cell containing the new DNA could be m ade to live by grow ing it in culture to the blastocyst stage and then inserting this blastocyst into the u teru s of a recep to r anim al. This is difficult, tim econsum ing, and expensive, so this effort has been used m ainly

176

Genetic Engineering

for research purposes. If the efficiency and reproducibilty can be improved, cloning m ay becom e useful in anim al breeding. Note th at it is now possible to grow a goat from zygote to b irth com pletely outside the uterus. Although this ap proach is too expensive to be com m onplace, it could take place routinely in anim al breeding program s in the future. However, the science fiction specter of rows of developing identical children on shelves in an incubation facility, though technically possible, has enorm ous ethical problem s in the case of hum ans. T radition has held th at ad u lt anim al cells can n o t be used as donors of genetic m aterial because th eir cells have differentiated. However, in 1997, a sheep—one em bryo from 277—was cloned from cu ltu red u d d er cells from a 6-year-old ewe. This experim ent shocked the genetic w orld, since previous efforts had always failed. To do this, researchers starved the udder cells, forcing m ost of their genes to enter into an inactive phase. Then, w hen the u d d er cell nuclei were tran sferred to the eggs, the “inactivated” nuclei were activated and one of the 277 produced a healthy, living anim al—Dolly. Needless to say, the results w ith Dolly have caused a storm of experim entation as well as controversy, especially regarding the idea of h u m an cloning. The ethical co n sid eratio n s of h u m an cloning are enorm ous. Scientific societies and num erous o th er political and religious groups have spoken out on this issue. Scientists have agreed, in general, th at fu rth e r cloning experim ents will not be done on hum ans. Still, reports surface here and there of individuals or private concerns offering a cloning service for hum ans. It is too early to predict all th at will em anate from Dollys em ergence on the scene, but the future of cloning appears secure as protocol to develop identical cell lines for specific purposes.

G E N E T IC E N G IN E E R IN G O F A N IM A L S A lthough such m ass cloning of anim als is now a reality, the process of inserting new genetic m aterial into these anim als is an o th e r m atter. So far, we have only dealt w ith tran sferrin g nuclei from one cell to another. Is it possible to use som e of the techniques we have learned w ith bacteria, anim al, and plant cells and apply these techniques to changing the DNA in an entire anim al? The quick answ er is “yes,” but it is not straightforw ard.

Embryo Transfers and Cloning

177

In principle, the approach is to get new DNA into the nucleus th a t is to be p ut into the fertilized egg cell. Figure 10-1 show s such a technique. In this case, after fertilization takes place, we can insert new DNA directly into one or both pronuclei (one from the m ale and one from the fem ale) using a m icroinjection technique (see Fig. 10-1). This allows the DNA of the fertilized egg cell to be transform ed, though in a ran d o m fashion. N onetheless, new DNA is inserted, and the fertilized egg can then go about becom ing a whole organism . The problem is th a t it is not certain th at the DNA got into a place in the chrom osom e w here it will be effectively used. The technique is ra th e r random . Yet, once an anim al has the new DNA inserted in an effective place, it is possible to breed th at anim al and get the p articular trait into progeny as well.

Transgenic Mice—How to Make Them G enetic engineering of anim als has m ade im p o rtan t strides in recent years, especially in the developm ent of transgenic mice. The approach incorporates m any of the techniques we have p reviously discussed for bacterial and anim al cells. We will outline the m ethods used w ith m ice in som e detail, realizing th a t such approaches can be applied to other anim als as well. The first step is to grow some totipotent cells in tissue culture. This is now readily done with early-stage blastom ere cells, called em b ryon ic stem (ES) cells. These cells are grow n in culture m edium ju st like the m am m alian cell cultures discussed in C hapter 8. They are often derived from m ice having a different coat color, w hich provides a m arker th at we will use later. An insert into the ES cells from black m ice is m ade th at contains the new DNA gene we w ish to insert, a neom ycin-resistant region, and a lacZ region. The lacZ region codes for an enzym e th at cleaves a substance giving a blue stain. W hen the lacZ is present, the cells containing it are stained blue w hen X-gal (the stain substance) is present. Cells w ithout lacZ will not be blue. The new DNA can be delivered to the ES cells by m icroinjection, but is m uch m ore com m only placed in the grow th m edium and electroporation is then used to open the pores of the ES cells. The ES cells are then placed in a m edium containing neomycin, w hich allows only the transfected cells containing the neom ycin-resistant gene to grow. Those w ith the insert stain blue when X-gal is added (Fig. 10-2). U sing the la tte r a p p ro a c h , we can identify a n d isolate the tra n sfe c te d cells. It is also n ecessary to o b ta in blasto cy sts

178

Genetic Engineering

Figure 10-1

Overview of genetically engineering a m ouse. Using fertilized eggs, new DNA is m icroinjected directly into one of the p ro n u clei in the fertilized egg, bringing new genetic m aterial into the cell. Not all the DNA finds its wav into useful places in the cells chrom osom e. U sing DNA analysis, it can be d eterm in ed w h ether the DNA was inserted o r not. Once the DNA is p resent and the ap p ro p riate tra it is present, th at m ouse can be transferred to o ther mice through breeding.

from a w hite m ouse cell line. These blasto cy sts c o n ta in n u m ero u s cells e n c a p su la te d in a m em b ran e, as d escrib ed e a rlie r in th is chapter. The tra n sfe c te d cells are th en tra n s fe rre d to the blasto cy sts, a fte r w hich the blasto cy sts

Embryo Transfers and Cloning

179

Figure 10-2

T ransfection of a m am m alian line. First, we sandw ich the new gene betw een two m arkers (a construct), a neom ycin-resistant gene ( n e o ' ) and a la cZ gene. By grow ing the cells on neom ycin, those w ithout the co n stru ct will not grow. We then select for those th at received the entire construct by looking for blue colonies. W hen a cell is grow n on a m edium co n tain in g X-gal, the colonies th a t co n tain lacZ will turn blue.

are placed in to the u te ru s of th e su rro g a te m o th e r m ice (Fig. 10-3). From these engineered blastocysts com e chim eric m ice. A ch im eric m o u se has new genetic in form ation in som e of its cells. By inserting the transfected cells into the blastocyst, those cells becom e p art of the m ouse to be born. It is never certain which portions of the em bryonic m ouse will be derived from the tran sd u ced cells. But if the new DNA is found in the germ -line (egg or sperm ) cells, then the chim eric m ouse can generate other chim eric mice as well. The chim eric m ice in the experim ent outlined previously is generally black and w hite. The black-and-w hite coat color indicates th at these m ice contain the genetic inserts. By breeding

180

Genetic Engineering

Figure 10-3

Overview of p ro ced u re for m aking a transgenic m ouse. Cells from black m ice are transfected as outlined in Figure 10-1. These tran sfected cells are added to the blastocyst obtained from a w hite m ouse pair. The blastocyst is then inserted into the m o th er m ouse again. The offspring are chim eric mice, containing both black-andw hite coats.

these chim eric m ice w ith o th er chim eric mice, entire strains of m ice can be developed w hich contain certain new genetic c h a racteristics. These are transgenic mice and can be very useful for research purposes in m any ways. For instance, som e m ice strains can be bred w hich are m ore susceptible to certain kinds of cancer. Perhaps the m ost fam ous of these was the so-called on com ou se. This m ouse, produced at H arvard U niversity in 1988, was highly prone to b reast cancer.

Embryo Transfers and Cloning

181

The oncom ouse could be used to test various cancer-causing agents and to test breast cancer therapies. O ther mice have been developed w ith sim ilar propensities for other diseases as well.

Knock-out Animals One area of genetically engineered anim als th a t has becom e extrem ely useful is in the developm ent of m ice strain s w ith c e rtain genes “knocked o u t.” To m ake these, a faulty gene is in co rp o rated into a m ouse strain, as outlined above. The faulty gene is then tran sferred to the progeny and, th ro u g h cro ssbreeding, the stra in of m ice w ith a faulty (knocked-out) gene is m ade. These knock-out strain s provide im p o rta n t laboratory experim ental anim als, into w hich genetically tran sfo rm ed cells can be inserted to look for a resu m p tio n of the “knocked-out” function. F or instance, in one strain of m ice, the entire im m une system has been knocked out. This im p o rtan t finding has fostered additional experim ents in w hich strains of mice have been developed w hich lack m any genetic functions and even entire organs. In o th er cases, certain genes have been knocked out and replaced by m u ta n t h u m an genes, giving rise to m ice w ith certain genetic diseases, such as cystic fibrosis and D uchenne's m uscular dystrophy. In 1992, a stra in of m ice containing a “suicide gene” was developed. This gene p rom oted activity th a t destroyed the liver cells in the m ice. B ecause the im m une system is lacking, new h u m an liver cells could be inserted into these m ice, giving strains of m ice capable of m aking h um an livers. Clearly, the possibilities using the transgenic anim al approach are alm ost lim itless.

A P P L IC A T IO N S

Transgenic Animals—How They Are Used Anim als th a t have had new genes inserted into th eir germ line are called tran sgen ic anim als. M any such strain s of anim als have been and are still being developed. And m any problem s are yet to be solved in this arena. F or instance, m any transgenic anim als are sterile, susceptible to diseases, and not suitable for fu rth e r breeding. These problem s stem from the difficulty of getting the new genes into exact positions in the cell genome. As noted in C hapter 8, several approaches are being developed to

182

Genetic Engineering

allow the insertion of new DNA into m am m alian cells to occur at an exact site. C ertainly the ability to develop transgenic m ice and o th er laboratory anim als has dram atically increased the research possiblilties in disease-related areas. M any anim als such as knockout m ice are developed for research use only. Perhaps an even greater im pact is being felt in the agricultural comm unity.

Transgenic Farm Animals One w ell-publicized im provem ent is m ilk p ro d u ctio n in cows. The p itu ita ry gland in cows o rd in a rily secretes bovine so m a to tro p in (BST), a h o rm o n e th a t in d u ces cows to give m ilk. By in jectin g cows w ith BST, m ilk p ro d u c tio n can be in creased d ram a tic ally (up to a b o u t 25%). BST has now been cloned in Escherichia coli b a c te ria and p ro d u ced in com m ercial am o u n ts. This has greatly facilitated the pro d u ctiv ity in the d airy industry. B ut th ere is o p p o sitio n an d a general q u estio n as to w h e th e r such genetic eng in eerin g ap p ro ach es should be used in food p ro d u cts (to be discussed m ore fully in C hapter 13). A nother area of active research is developing anim al strain s th at are resistant to disease or infection p articular to the anim al species. For instance, chickens are susceptible to avian leukosis virus (ALV), a degenerative and often lethal disease. By inserting genes specific for the envelope of the virus into fertilized eggs, the chickens th a t developed show ed significant resistance to ALV. S im ilar experim ents w ith bovine leukem ia virus (BLV) are being perform ed. Som e efforts have not w orked well to date. Transgenic pigs, into w hich the gene for h u m an grow th horm one were placed, have not been robust. Often sterile and sickly, these anim als seem s to be m uch m ore sensitive to genetic alterations. On the o th er hand, inserts of sheep epiderm al grow th factor into sheep have m ade the shearing of the wool m uch easier.

Pharm Animals A nother entire line of experim entation is being carried out w ith farm anim als. As noted earlier in C hapters 6 and 8, som e p ro teins needed by hum ans cannot be readily produced by bacteria or p erhaps even m am m alian cell cultures. So, anim als have been adapted to produce certain proteins and horm ones used by

Embryo Transfers and Cloning

183

h um ans. Such transgenic experim ents have been m ade w ith cattle, pigs, sheep, and goats. The resulting anim als are term ed “p h a rm ” an im als—anim als th a t produce h u m an proteins in th eir m ilk o r blood. For instance, transgenic pigs can now produce hum an hem oglobin. A transgenic goat has been developed to deliver h u m an tissue plasm inogen activator (TPA) in its milk. H um an lactoferrin is now produced by cattle. M any o ther experim ental anim als have been o r are being developed using the versatile pow er of this approach.

Environment and Health Insecticides are also being developed using genetic engineering. A recent article in Science tru m p eted “Medfly T ransform ed— Official!" This an n o u n cem en t concluded over 10 years of research to transform the germ line of this pest. The medfly has cost the agricultural com m unity billions of dollars and has cost the w orld hu n d red s of m illions of dollars a year ju st to try to control its spread. The tran sfo rm atio n occurred by injecting em bryos of the m edflies w ith suitable genes. Although the process is now in place, th at actual transform ation of the medfly to a nonpest is yet in the future. Nonetheless, the critical genetic engineering c o m er has now been turned. O ther experim ents involving transgenic m osquitoes th a t will not carry m alaria and snails th at will not carry hum an parasites are u n d e r developm ent. These approaches are the sta rt of a radical new ap proach to solving som e environm ental and disease problem s. The future is very bright in these areas.

C O N C L U S IO N S It is possible to m ake transgenic anim als th a t have new genes in serted into th eir chrom osom es. This is done by genetically altering the early-stage cells and letting them grow into genetically altered whole anim als. R esearch anim als (notably m ice) th at lack certain genes can also be developed. Such genetic tra n sfo rm atio n of h u m an beings, though tec h nically feasible, dem ands m uch m ore discussion on ethical issues before it is allowed. Such a discussion is clearly essential, because the prom ise of clearing certain fam ilial lines of genetic disorders is im portant.

184

Genetic Engineering

SU M M A RY Only by changing the genetic m aterial in the nucleus of a fertilized egg will all the cells in an anim al co n tain the genetic changes. At this tim e, it is not possible to selectively change p o rtions of the DNA in a growing, fertilized egg cell. N uclear im p lan tatio n allows a new nucleus to be placed in a fertilized egg. This is technically difficult, but has been done in num erous cases, w ith the resu lt th a t num erous identical anim als can be clones. By separating the early blastom ere cells in an early-stage blastocyst, these cells can be grow n in culture. Then, by using electro p o ra tio n to allow new DNA to enter, new DNA can be inserted into som e of the cultured cells. These cells can th en be inserted into an en capsulated blastocyst, resulting in chim eric anim als. In som e cases, these anim als have sperm or egg cells th a t have been m odified w ith the genes as well. W hen these anim als are bred w ith each other, entire transgenic anim al lines can be developed. Transgenic anim als can be used to m ake new proteins, to grow new organs, and to be tested for m edical uses. D evelopm ent of these new transgenic anim al strains provides unique o p p o rtu n ities for m edical testing and production of new pharm aceuticals.

IV

HOW GENETIC ENGINEERING HELPS ÜS

11 GENE THERAPY AND DISEASE WHAT YOU WILL LEARN IN THIS CHAPTER

• • • • • • •

How to diagnose genetic disorders using DNA probes How gene therapy is used to treat genetic disorders How to change defective som atic cells outside the h u m an body How to change stem cells and other kinds of cells outside the h um an body How to target specific cells in the h u m an body for genetic changes How genetic diagnostic m ethods and treatm ents are applied How genetic m ethods are used to treat cancer

The reason why we got into this whole discussion about genetic engineering w as th a t we hoped it could help us medically. We have the tools needed to m ake changes in hum ans, but w hat kind of changes are w arranted? It is now possible to screen a new born baby or a fetus for genetic disorders using a num ber of different probes. The sequencing of the h u m an genom e, discussed in C hapter 12, seem s to be providing m ore new genes every week. As new genes are found and o th er genes are show n to ap p e ar in dam aged form , w hat can be done? First, lets discuss the diagnosis of genetic disorders.

187

Genetic Engineering

188

G E N E T IC D IS O R D E R S D iagnosis M any genetic diseases are already known. See Table 4-2 for a list of som e com m on genetic disorders and th eir incidence. Clearly, m any m ore could be m entioned. It is now possible to determ ine who has genetic diseases using some of the genetic tools th at we have learned. W ith am n iocen te sis or ch o rio n ic villi sam p ling, it is possible to w ithdraw fluid w ith fetal cells in it from the am niotic cavity of an expectan t m o th er (Fig. 11-1). By extracting and d isrupting the fetal cells, the DNA can be isolated. Then, it can be fragm ented by

Figure 11-1

A m niocentesis and chorionic villus sam pling techniques.

Gene Therapy and Disease

189

using a set of restrictio n endonucleases (enzym es). After this, the DNA can be ru n on an electrophoresis gel. As outlined in C hapter 6, the DNA is th en blotted onto paper, and the fragm ents are screened using probes th a t are specific for certain genes. The presence of an unusual gene signals problem s ahead. For exam ple, BRCA1 and BRCA2 genes have recently been found and sequenced. These genes are now th ought to confer susceptibility to b reast cancer in a sm all percentage of w om en. It should be possible to determ ine the presence of these b reast cancer-susceptibility genes in an u n b o rn child. In addition, norm al genes w ith m utations, w hich m ight signal a n o th e r genetic disorder, can be identified. In practice, the analyses are seldom carried out using the Southern blot m ethod outlined in Figure 11-2. Instead, the m ore com m on approach is to first attach a probe for a specific gene to a dipstick. The dipstick is dipped into the sam ple of disru p ted fetal cells in which the DNA is denatured. In this step, hybridization (bonding) betw een the probe on the dipstick and any com plem entary regions of the fetal DNA take place. Then, the d ipstick is rinsed and inserted into a n o th e r solution in w hich a probe containing a fluorescent label is found. That probe is com plem entary to an o th er portion of the target gene and will attach to it thro u g h hybridization. The dipstick is again rinsed and placed u n d e r ultraviolet light. If the gene is present in the fetal DNA, the dipstick will show it by fluorescing. This ap proach is called a hybridization san d w ich assay and is still being developed for m any different purposes (Fig. 11-3). The sandw ich assay can clearly be used to identify genetic disorders, but it can also be used to identify the presence of viruses and pathogens (eg, HIV). This approach and m any variations of it are being developed rapidly by m any com panies to allow genetic screening of individuals to occur. Needless to say, m any ethical problem s surface in this approach, because genetic inform ation of this n atu re w ould be useful to insurance vendors and others. We will discuss these and o th er ethical problem s in C hapter 13.

Treatment Once a genetic d isorder is found, w hat can be done a b o u t it? Actually, it w ould be nice to fix the genetic d iso rd er before conception so th at it w ouldn't exist. Although there are m any available m ethods to do this, it w ould be enorm ously difficult to

190

Genetic Engineering

Figure 11-2 Identification of a specific gene (gene X) using restriction fragm ents and Southern blot technique. See also Figure 6-10.

accom plish. This is because sperm is extrem ely difficult to m anipulate because of its size. The egg is m uch larger, b u t the problem of finding the correct gene, deleting the old gene, splicing in the right gene in the right place, and th en using th a t egg to produce children w ould be extrem ely expensive and difficult, if possible at all. The ethical co nsiderations dealing w ith changing a single individual, and all of his or h er progeny as well, have not been fully satisfied either. So, at this tim e, genetic m an ip u latio n of

Gene Therapy and Disease

191

Figure 11-3 The sandw ich assay. F or convenience, a dipstick is used, w hich has a sh o rt DNA probe bou n d to it th a t is com plem entary to a portion of the target gene. This dipstick is dipped into a solution of cells w hich have been d isru p ted so th at th e ir DNA is available to the probe on the dipstick. The dipstick is swirled for a short time, after w hich it is rem oved and w ashed. The dipstick is then placed in a solution th at has a n o th e r DNA probe, com plem entary to an o th er p o rtio n of the target gene. To this probe is attach ed a sm all, fluorescent m olecule. The d ip stick is sw irled, th en rem oved, and rinsed off. If the fluorescent probe sticks to the targ et DNA, th en by shining ultraviolet (UV) light on the dipstick, the dipstick will fluoresce. The presence of the fluorescence in dicates th a t the targ et gene is p resen t in the cell. This technique is being developed for an increasing n u m b er of genes.

192

Genetic Engineering

hum an germ cells (eggs or sperm ) is illegal.

Manipulation of Somatic Cells The o th er ap p ro ach to gene therapy is to treat som atic cells to rep air genetic disorders. Som atic c e lls refer to all cells th at are not germ (egg or sperm ) cells. Altering som atic cells can change certain cell lines, such as blood cells, b u t it will not change the entire organism . N or will such changes be tra n sm itte d to children. Genetic changes of this n atu re are allowed, b u t w ith strict regulation from the governm ent. Changes in som atic cells can be b ro u g h t about using one of two m ajor approaches: (1) gene m anipulation of cells outside the h u m an body o r (2) specific targeting of regions in the h u m an body, w hich m ay target a certain cell type, but ignore all others. We will discuss each of these.

G E N E M A N IP U L A T IO N O F CELLS O U T SID E THE H U M A N BODY The overall approach using gene m anipulation is to rem ove cells w ith defective genes from a patient, genetically m anipulate these cells to give them a correct gene, and retu rn them to the patient. This ap proach has generally been used for blood cells because they are easily available and transferable.

Stem Cell Manipulation All blood cells com e from a single type of cell, the stem cell, found in the bone m arrow. If we could tran sfo rm som e of these stem cells, it m ight be possible to fix som e genetic disorders of the blood. So how do we go about doing this? First, it is essential to isolate the stem cells. This has not been possible until recently, but now a few experim ents have taken place in w hich stem cells have been modified. This approach has seen the m ost success in very young people, since th eir stem cells are quite active. O lder p atien ts have less active stem cells. However, it is expected th at by using chem icals to stim ulate the activity of stem cells, such therapy m ay also be available in the future for older patients. At present, there is no concrete evidence th at any gene therapy involving stem cells is totally effective, although there is one clinical trial involving new born infants in w hich some success has been observed.

Gene Therapy and Disease

193

Figure 11-4 Stem cell m an ip u latio n . Stem cells are to tip o ten t cells from w hich all o th er blood cells are m ade. By changing the DNA in the stem cells, we can change th e DNA in all of the blood cells of an individual. Once the stem cells are isolated, new DNA can be in serted by electroporation, as we have outlined before (see Fig. 10-1). Transfected cells are identified and isolated and th en grow n to suitable n u m b er to be inserted back into the patient.

194

Genetic Engineering

The experim ental approach is to use the p a tie n ts own bone m arrow, isolate the stem cells, genetically alter the stem cells, and grow them in culture (Fig. 11-4). W hen there are a sufficient nu m b er of stem cells—and large num bers are needed—the altered stem cells are reim planted into the patient s own marrow. Ultimately, the challenge lies in m odifying the genetic inform ation in the cells them selves. As noted in C hapter 10, we have tools for m odifying m am m alian cells in culture. The m ost prom ising approach is to use a crippled virus particle to deliver the m odified gene to stem cells in the bone m arrow . The m ethods of choice involve viruses, but targeting the DNA exactly to active portions of the genom e rem ains a problem .

Manipulation of Other Cell Types In addition to stem cells, techniques to m anipulate o th er cells from the skin and m em branes, as well as the precu rso rs to m uscle cells (m yoblasts) are presently being developed. A num ber of gene therapy and gene transfer clinical trials are now ongoing, w ith m any o thers aw aiting approval. The crippled virus ap proach is the m ost actively used at this tim e, b ut is still often h am pered by an inability to always insert the new genes into functionally active regions of the genom e. This in tu rn results in m arginal yields of the needed proteins from the genetically altered cells.

T A R G E T IN G O F S P E C IF IC CELLS IN THE H U M A N B O D Y Two different approaches are possible for targeting cells: the organ-targeting approach and the cell-targeting approach.

Organ-Targeting Approach The organ-targeting ap p ro ach has been developed to som e degree, but still has room for im provem ent. In this procedure, vectors (carriers) bearing corrective genes are inserted directly into the tissue w here they are needed. F or exam ple, in p atien ts w ith cystic fibrosis, w hich im pairs the lungs, vectors carrying corrective genes have been introduced directly into the lining of the bronchial tubes. This procedure has been partially successful. Sim ilar approaches have been used for those w ith m uscular dystrophy and cancer tum ors. The m ajor problem that rem ains is targeting various organs in a safe and effective way. This is m ore pro n o u n ced w hen the

Gene Therapy and Disease

195

therapy takes place in the body. Because genes are inserted ra n dom ly into cellular genom es, they m ight d isru p t a tu m o r su p pression gene, w hich w ould norm ally p rotect the body against cancer. Thus, the use of a lip o so m e carrier (really ju st a lipidbilayer stru c tu re to hold nucleic acids) or o th er nonspecific carrier, w hich tends to insert genes random ly in various organs, is not considered ideal for treatm ents of cells w ithin the body. A lthough crippled retroviral vectors can be successfully used in som e cases, these vectors w ork only on cells th a t are actively dividing. R ecent experim ents have begun using crippled HIV as a vector to deliver genes to specific cells. This vector is able to insert new genes into nondividing cells, w hich m akes it m uch m ore versatile as a prospective vector for cells th at are not dividing, such as neurons. It has been show n to w ork in living organisms, giving it great prom ise. However, there is som e reservation about using even a crippled HIV vector, since there is a chance th at it m ight be able to spontaneously recom bine w ith o th er genetic m aterial and becom e virulent.

Cell-Targeting Approach In the organ-targeting approach, a vector was developed and placed directly into the tissue to be genetically altered. A nother approach, the cell-targeting approach, is to specifically target cells using vectors th a t will seek out and find only certain cells and deliver th eir nucleic acid only to those cells (Fig. 11-5). This technique is not yet being used for therapy, although good progress has been m ade in targeting specific vectors to specific cells. This is done by attach in g specific m arkers on the outside of the vectors. These m arkers are recognized by receptors on the target cells. The m ajor problem w ith targeting specific cells is finding a way to allow the insertion of the genes into the target cell. At present, although the vectors seek and bind to target cells, there is no reliable way to induce them to insert th eir m odified genes. The HIV vector discussed previously m ay provide an answ er to this problem , since it can be packaged in a coat th a t w ould contain specific m arkers. However, m uch m ore work needs to be done before this is fully developed. It is expected th at the delivery problem s will be solved in the n o t-too-distant future. Then, the ap proach of targeting specific cells w ithin the living organism should becom e very pow erful and offer trem endous potential in healing m any types of genetic diseases.

196

Genetic Engineering

Figure 11-5 Targeted cell therapy. A virus th at is specific for a certain cell line is modified by rem oving a portion of its DNA (see Fig. 8-6) and replacing it w ith a new gene th a t will kill the tu m o r cell. The altered virus p article is th en inserted into the bloodstream and seeks out the cell line (a tum or) for w hich it is specific. It attaches and inserts new DNA into the tu m o r cell, m aking a protein th at will kill the tu m o r cell.

A P P L IC A T IO N S O F D IA G N O S T IC A N D TREATM ENT A PPRO A CH ES DNA S c re e n in g Tests About a dozen com panies are now investing significant am ounts of m oney and tim e into developing diagnostics using the

Gene Therapy and Disease

197

h ybridization approach, in w hich certain genes are sought out and checked. The dipstick m ethod outlined earlier is becom ing very useful for screening for genetic variations. It is especially useful for identifying defective genes in fetuses. Such tests are som ew hat expensive and are not routine, but do provide a direct m ethod of testing for potential genetic disorders. The m ajor problem loom ing in this area is n o t technical, but ethical. How m uch DNA testing should be done, w hen should it be done, and how public are the results? These and o th er q u estions are discussed in C hapter 13.

Gene Therapy Table 11-1 sum m arizes the clinical trials on vectors of the N ational Institutes of H ealth (NIH) R ecom binant DNA Advisory C om m ittee (RAC). Over 100 trials are approved, b u t the approaches have both advantages and disadvantages. The m ajor problem still lies w ith the vectors. The m ost p o p u lar vector is the retroviral vector. A crippled version of a m ouse retrovirus has been loaded w ith th erap eu tic genes and TABLE 11.1

V e c t o r s in R A C - A p p r o v e d C l i n i c a l Trials

V ector

No. o f

P lu ses

M in u ses

C lin ica l Trials

V ira l R etro v iru s

76

E fficien t to tran sfer

S m a ll c a p a c ity

E a sy to m ak e

R a n d o m DN A in se r tio n D iv id in g by c ells o n ly R e p lica tio n risk

A d en o v iru s A d en o -a sso c ia ted

15

N o n d iv id in g c ells

Im m u n o g e n ic

P o ssib ly ta rg eta b le

R e p lic a tio n risk

1

N o n im m u n o g e n ic

S m a ll ca p a c ity

0

N o n im m u n o g e n ic

R isk s u n cle a r

H ard to m ak e

viru s H erp esv iru s

H ard to m ak e

N o n v ir a l L ip s o so m e s

12

N o r ep lic a tio n

L ow e ffic ie n c y

N o n im m u n o g e n ic N a k ed or particlem e d ia ted DN A

3

N o r e p lic a tio n risk

L ow ta rg eta b ility

N o n im m u n o g e n ic

L ow e ffic ie n c y

198

Genetic Engineering

used in 76 of the 106 trials approved to this date. A lthough this is the m ost efficient agent yet, the rates of tra n sfe r and expression vary enormously. The retrovirus is lim ited for use in rapidly dividing cells, so it will not target cystic fibrosis w here the target cells don't divide. The m ajor draw back is, as noted previously, th at retroviruses insert th eir DNA random ly into host DNA, posing a possible threat of cancer. A denoviruses have also been used w ith som e success. These viruses are DNA viruses th at can cause colds and conjunctivitis in hum ans. However, they have been successfully harnessed, in crippled form , to be used as vectors to tra n sm it new DNA into m am m alian cells. Adenoviral therapy has problem s in tra n sfe rring sufficient quantities of genes into p a tie n ts cells and a p p a rently causes an im m une response, m aking m ultiple applications less likely. This approach has been used m ainly in the effort to tra n sfe r the gene for cystic fibrosis (CFTR) directly into the bronchi or lungs of patients.

Case Examples In the sum m er of 1990, a research team from the NIH received perm ission to a tte m p t gene therapy on two girls, one age 4 and the other age 9 years. These children were born w ith a disease of the im m une system called severe com bined im m unodeficiency d isea se (SCID). This disease has been found to be caused by deficiency of the enzyme, adenosine deam inase (ADA). W ithout ADA, toxic chem icals accum ulate in the body The ap p ro ach involved in troducing the ADA gene into lym phocytes (white blood cells) rem oved from the patient. This was to be done by extracting the cells and exposing them to billions of crippled retroviruses carrying the necessary gene. The cells would then be rein tro d u ced into the patients. The experim ents were outlined in great detail, and perm ission was sought and granted from the necessary state and federal regulating agencies. After treatm ent, the girls im proved im m ediately, and soon they produced the required level of the ADA to allow them to function alm ost normally. In these cases, the governm ent required that, along w ith the gene therapy for the girls, a stan d ard tre a tm e n t be given in w hich polyethylene glycol-ADA (PEG-ADA) was adm inistered. The ADA enzym e is isolated from cattle and a ttach ed to PEG m olecules, w hich prolong the activity of the ADA in the body. This provides a short-term boost in the ADA, preventing for a tim e the buildup of the toxic chem icals.

Gene Therapy and Disease

199

PEG-ADA tre a tm e n t h ad been previously approved by the Food and Drug A dm inistration (FDA). After 3 years of tre a tm ent, m ore th an 50% of the circulating T cells in one patien t contained the new gene, and only 1% co n tained the T cells in the o th er patient. G enetic th erap y m ay have been w orking in one patient, but it is a not com pletely proven therapy. In 1993, a sim ilar effort was m ade w ith three ADA-deficient baby boys at birth. The aim was to target th eir stem cells by using um bilical cord blood injected w ith the ADA gene. Up to 10% of th eir circulating T cells now carry the healthy gene. The hope is th a t this grow th will continue w ith tim e. N onetheless, w ith these three boys, PEG-ADA is also being given. This is done because the physician felt it w ould be unethical to w ithhold it, since PEG-ADA was the previous FDA-approved approach. However, the am o u n t of PEG-ADA is being reduced because it was found th a t PEG-ADA keeps genetically incom petent cells alive and counters the effects of the gene therapy to a degree. It is hoped th at the PEG-ADA treatm ent can be elim inated entirely. If the tra n sp la n ted genes ultim ately su stain these three patien ts w ith o u t the PEG-ADA treatm en t, it w ould be the first solid dem onstration of gene therapy curing a disease. An effort in M arch 1996 was carried out to tran sfer a healthy gene to cure two young girls w ith C anavans disease, a pro g ressive illness th a t destroys the m yelin sh eath of nerves in the brain. The vector in this case consisted of a h u m an gene (for aspartoacylase, the m issing enzym e) coupled to an adenoviral plasm id (to insert the gene into h u m an DNA accurately) and a liposom e-polym er c a rrie r to carry the genetic m aterial to the deficient cells. The m aterial was injected directly into the brains of the two girls. Although this procedure was carried out in New Zealand, the researchers did m ost of the research in the U nited States before being transferred to New Zealand. All the required paperw ork to receive approval in both countries was done. Time will grade the perform ance of this approach.

The Promise of G ene Therapy In spite of the relative lack of reportable success at this tim e, m any clinical trials are being scheduled using gene therapy for genetic diseases, and m any m ore will be forthcom ing. In m ost cases, gene therapy offers the only possible p e rm an en t solution to their ailm ent. The shortfalls of som e of the techniques will be rem edied, and new techniques will provide additional strength to the procedures. There is little question th a t genetic therapy

200

Genetic Engineering

will becom e an increasingly active are n a in treatin g genetically induced disease.

Cancer Treatment Tumor-Infiltrating Lymphocyte—A Magic Bullet? T here are m any types of cancer, so a single a p p ro a c h will n ot solve all cancer-related problem s. In tum or-producing cancers, a lym phocyte called tum or-in filtrating lym p h ocyte (TIL) has been u sed as a w eapon ag a in st such tu m o rs. TIL is m odified w ith a re tro v iru s vecto r c o n ta in in g a gene for the tu m o r n ecro sis fac to r (TNF), w hich destroys c a n ce r cells. The TNFp ro d u cin g TILs are th en p u t in to the p a tie n t w ith the tu m o r and seek out the tum or, releasin g th e TNF in the p a tie n ts. S im ila r a p p ro a c h e s are being developed for o th e r kinds of cancer. This “m agic bullet” approach bodes well, not only for cancers, but o th er organ-specific genetic disorders. The m ajor problem rem ains th a t the targeting is not alw ays exact betw een the c arrier and the target cell, and the placem ent of the DNA in the targeted cell is random , ow ing to the retrovirus vector used. These problem s are expected to be m arkedly im proved in the near future.

A P E R S O N A L G L IM P S E A diary entry on August 25, 1989, of an 8-year-old girl w ith cystic fibrosis (CF) reads: “Today is the best day ever in my life. They found the Jean for Cistikfibrosis.” This “jean” had been looked for over m any years. In 1978, two researchers found the first genetically linked gene—one th a t traveled w ith the sickle cell disease. This finding led the way for the study of genes to diagnose disease. In 1982, scientists began looking for such linkages betw een gene m arkers and CF. Massive screening was carried out, using a large num ber of fam ilies w ho show ed the in h erited trait. C om bining this process w ith a com pany th a t had developed over 200 new m arkers, fu rth e r screening show ed th a t one of the m arkers was linked to CF. In 1985, o th er researchers found a n o th e r close m ark er on gene 7, b u t didn't know w h eth er the CF gene was flanked by these m arkers or was ju st nearby, finally, in 1986, it was show n th a t the m ark er flanked the CF gene, and the race was on. The

Gene Therapy and Disease

201

two m arkers were still 1.6 m illion basepairs (bp) apart, so there was room for hundreds of genes. Using overlapping fragm ents to determ ine the sequence would have taken 18 years (at th at tim e) to accom plish. But w ith som e luck and lots of hard work, researchers w ere able to fu rth e r isolate the area of the gene in ab o u t 1V2 years. Using cDNAs from chickens, m ice, and cows, they were able to locate the CF gene region and then the gene, m ade up of 27 fragm ents, betw een w hich were in tro n sequences. The CF gene was m ade of 250 kb (1000 bp), and p atien ts w ith CF lacked 3 bp. This deleted one of the 1480 am ino acids in the protein for w hich the gene coded. This w ork was published in Science on S eptem ber 8, 1989. For the 1 in 2000 children b o m each year w ith CF, there is now a greater hope for the future.

C O N C L U S IO N S Gene therapy has a prom ising future in helping m ankind w ith various genetic disorders. Clearly, it has m any possibilities for diagnosing as well treating genetic disorders of the blood. W ith o th er disorders, finding ways to insert new genes into the specific types of cells rem ains a challenging problem . N onetheless, increasing num bers of gene therapy treatm en ts have been approved on a trial basis because there are ju st not good alternatives.

SU M M A RY It is already possible to screen DNA to determ ine the presence of certain genetic disorders. Although universal screening presents som e ethical problem s, screening for individuals w ith disorders o r for fetuses w ith p o tential disorders is relatively stra ig h tfo rw ard. D ipstick assays are already in place to screen for an increasing nu m b er of genes. T reatm ent of genetic disorders rem ains the challenge. Som e genetic disorders, especially those of the blood, ap p ear to be very possible to treat. By changing the genetic m akeup of the stem cells, w hich m akes all o th er blood cells, and placing these back in the bone m arrow , genetic changes can take place perm anently. It is also possible to target certain types of cells for a genetic alteration. These m ethods are still developing. One kind of

202

Genetic Engineering

ap proach involves rem oving cells from the im paired person, genetically altering these cells, and returning them to the donor. A nother kind of approach targets specific cell types w ithin the body. In all cases, the challenge is still to get the new DNA into the rig h t place in the cell genom e, so th a t correct p roteins or enzymes can be m ade.

12 OTHER APPLICATIONS FOR GENE THERAPY W HAT Y O U WILL LEARN IN THIS C H A PT E R • • • • • •

How to m ap and sequence the h um an chrom osom e How to identify alleles on chrom osom es How to use restrictio n fragm ent length polym orphism s (RFLPs) to identify individuals W hat a variable num ber tandem repeat (VNTR) is and how it can be used to identify individuals W hat polym erase chain reaction (PCR) is and how it can m ake num erous identical copies of a strand of DNA How PCR can be used to am plify short tandem repeat (STR) units to identify individuals in forensic w ork

Up to now we have talked about how to p u t new genetic m a te rial in correct places in a chrom osom e. But we have really skirted the issue of how we can locate genes in h u m an cells. Now we need to face it squarely.

A B O U T THE C H R O M O S O M E As previously discussed, the genetic in form ation in a c h ro m o som e consists of a long, u n in te rru p te d stra n d of DNA, w hich 203

204

Genetic Engineering

contains m any genes. In higher-order cells, each chrom osom e can contain m any th o u san d s of genes. In hum ans, there are 46 different chrom osom es joined in 23 pairs. The am o u n t of inform ation contained in these chrom osom es is im m ense. To w ork w ith these chrom osom es, it is essential to m ap them , som ew hat like a road m ap, by showing the relative positions of the various genes or other interesting sites. In the last few years, there has been a w orldw ide effort to obtain the com plete sequences of chrom osom es of bacteria, yeast, mice, and hum ans. The trem endous progress in this arena predicts th at the tim e is rapidly ap proaching w hen com plete sequences of som e representative species will be available. Although the sequencing m ethods are straightforw ard in principle, sequencing such large am ounts of DNA, as in hum ans, involves a vast am ount of work. The shortest hum an genom e is 50,000 kb long. This m eans that about 4500 fragm ents of DNA in this one chrom osom e have to be sequenced and linked. The task is enormous! Yet, it has now been accom plished to some degree. The target date for the h u m an chrom osom e to be com pletely sequenced is the year 2005, b u t it is increasingly ap p a re n t th at this target m ay be hard to reach. By th a t tim e, the genom e sequence will be know n w ithin an accuracy rate of 99.99%. This is an am azing feat th at prom ises significant hope for prevention of genetic disease in the future. Already, while in the process of m apping the genom e, scientists have discovered thousands of new genes, som e th at lead to genetic susceptibilities to b reast cancer, lung cancer, aging, and p articip atio n in high-risk sports. In 1990, only a handful of genes w ere identified for various genetic disorders. Now over 5000 have been identified, w ith new discoveries alm ost daily. These discoveries prom ise great p o tential for solving som e of the critical genetic diseases in the future, because we will know the position and sequence of the genes involved. N otable am ong recently discovered genes are BRCA1 and BRCA2, which are found in familial-linked breast cancer patients. Although these genes are found in less than 10% of such patients, such a finding still provides a trem endous gain in the study of the effects of genetic transform ation on this dreaded disease. A nother gene th a t was recently identified is the gene th at causes W erners syndrom e, a rare genetic disease th at causes p rem atu re aging. Investigators located this gene on the short arm of chrom osom e 8 using genetic linkage studies. The suspect region was sequenced—650,000 bases—and the m utated region was discovered. The p rotein th at was found contains 1432

Other Applications for Gene Therapy

205

am ino acids and apparently functions to unw ind DNA in norm al cells. The m echanism by w hich aging is accelerated w hen this protein is dysfunctional is not presently determ ined.

D N A P R O F IL IN G There are m any related applications and tools o th er th an those used in genetic engineering th at have developed as a result of efforts to identify differences in DNA. One of these is DNA profiling o r typing (fingerprinting). The initial question was w h eth er DNA from various organism s could be used to identify the relatio n sh ip of one organism to another. By looking for organism s th a t are m ost closely alike, one m ight be able to d eterm ine the relationships am ong fam ilies of organism s and plants and o ther living species. To b e tte r explain how these relationships are determ ined, we need to go back to the w ork of G regor M endel. As M endel concluded his analysis of pea genetics in 1866, he recognized the gene as a “p articu late factor/' w hich passes unchanged from p aren t to progeny. He also recognized th at a specific gene could exist in alternative form s (called a lle le s) th a t determ ine som e particular characteristic, such as the color of a flower. W hen two chrom osom es are paired together, the chrom osom e pairs exchange pieces in a process called cro ssin g over, resulting in new unique chrom osom es, w hich contain traits of both chrom osom es (Fig. 12-1). These provide the genetic m akeup of an individual. It was po stu lated early, and has been confirm ed since, th at genes th a t are close to gether will not be broken a p a rt by crossing over as often as those th at are m ore distant. This tendency to rem ain together is called g en etic link age. So, the closer genes lie together, the fewer recom binant events occur betw een them . Conversely, genetic linkage can be taken as a m easure of physical distance betw een genes. By looking at this linkage, the ancestry of a given species can be determ ined w ith som e degree of exactness.

REST R IC T IO N F R A G M E N T LENGTH P O L Y M O R P H IS M S A nother ap p ro ach to assessing genetic differences can be m ade by looking at p a tte rn s m ade by restrictio n fragm ents. As we have discussed before, w hen a chrom osom al fragm ent is cleaved

206

Genetic Engineering

Figure 12.1 Crossing over. One of the several ways by w hich genes are exchanged in a cell. In this process, two adjacent chrom osom es exchange genetic in fo rm atio n by exchanging a portion of th eir genes. This allows for variatio n in the genetic m akeup of individuals. Note th a t genes th a t are physically close to each o th er w ould have a g reater tendency to stay to g eth er th a n those genes th a t are physically d istan t from one another. This is called genetic linkage.

Other Applications for Gene Therapy

207

by a certain restrictio n endonuclease (enzym e), fragm ents of specific sizes are m ade. These fragm ents are th en ru n on electrophoresis gels and give a p a tte rn of bands th a t depend on the length of the fragm ents. A p a rticu la r piece of DNA always gives the sam e resulting fragm ents w hen a specific restriction enzyme is used. But if there has been a m u ta tio n th a t affects one of the restrictio n sites, an altered set of fragm ents will appear. This v ariatio n in the fragm ent p a tte rn is called a restrictio n fragm en t len gth polym orphism (RFLP) (Fig. 12-2). RFLPs occur frequently enough in the h u m an genom e to be used for genetic m apping. The RFLP ap p ro ach can help us to discover w h ether certain people are related and to assess

Figure 12.2 R estriction fragm ent length polym orphism (RFLP). See also Figures 11-2 and 6-11. Differences betw een individuals occur often in som e segm ents of DNA. These are called polym orphic regions. R estriction enzym e digests of these regions produce various lengths of DNA. One of the ways by w hich this variation in length can o ccur is w hen a m u tatio n takes place th a t rem oves a restrictio n site, as show n here. In these circum stances, only one b an d appears in the gel p attern after the m utatio n , w hereas tw o ap p eared originally. Such differences in various regions of the DNA help identify certain individuals.

208

Genetic Engineering

genetically linked characteristics. The m ain benefit of the RFLP ap proach in genetic engineering is to narrow the search for a p articu lar gene to a defined region of the chrom osom e. If a p a rtic u la r tra it is know n to be in h erited w ith a know n genetic m arker, then it is necessary to obtain only the p o rtion of DNA w ith th at m arker in it and to perform the fu rth er assays to identify the gene. The RFLP m ap helps provide in form ation on the place to look. RFLP analysis is also com m only used to identify fam ilial relationships in anim als and plants. For instance, RFLP testing of families of wolves will indicate parentage and identify particular packs. S im ilar testing w ith m o u n tain gorillas, various bird species, fish species, and m any others has allowed geneticists to identify fam ilies or species containing certain traits. A nother use for DNA profiling is as a tool for “sleuthing,” th at is, to help ascertain w h ether a specific individual was involved in a crim e of som e nature. Ideally, to m atch individuals to one an o th e r o r to a tissue sam ple, we should sequence th eir entire genom e and look for variations. But w ithin the h u m an genom e, there are over 3 billion nucleotides. This m akes routine sequencing of h u m an DNA im possible as an analytical tool. So two ap p ro ach es—RFLP analysis and polym erase chain reaction analysis—are presently used, w ith m any variations on each, to allow suitable com parisons to be m ade.

RFLP Analysis Most regions of the hum an genom e vary little from one individual to another. But som e regions, w hich apparently are not used for stru c tu ra l or functional needs, vary greatly from person to person. These regions are p olym orp h ic (having m any form s) and are often unique to an individual. We can isolate and c h a racterize such polym orphic regions and then use them to identify an individual m uch m ore conveniently th an we can sequence the entire h u m an genom e. But we have to rem em b er th a t the region being analyzed is not entirely unique and th at there m ay be one or m ore individuals who have identical polym orphic regions. Som e polym orphic regions have recently been found to contain m ultiple identical sequences, w hich range from a few to about 60 nucleotides in length. The n u m b er of such repeating units varies substantially from individual to individual. At each end of these repeating u n its are identical flanking regions. So w hen a restriction enzym e is used on these flanking regions, the

Other Applications for Gene Therapy

209

length of the restrictio n fragm ent varies, depending on the n u m b er of repeating u n its present. This region of repeating, identical sequences is called a variable num ber tandem repeat (VNTR) (Fig. 12-3).

Figure 12.3

V ariable n u m b e r tan d em repeat (VNTR) regions. In som e polym orphic regions of DNA, segm ents are found w ith identical flanking regions (term ini), b u t variable num bers of identical sequences th at repeat over and over. All cells from a single individual contain a set n u m b er of these rep eatin g u nits. B ut the sam e region in a n o th er in d ividual m ay con tain a different n u m b er of repeating units. The diagram show s an exam ple of two individuals, one of w hom has 9 and the other 13 identical repeating u n its in a specific VNTR region. This region is excised from the total DNA using a specific restriction enzyme.

210

Genetic Engineering

Each VNTR region isolated from a single individual contains two fragm ents—one from each parent. These fragm ents are alleles. In som e cases, both fragm ents are identical in length, indicating th a t each p aren t donated a VNTR region having an identical n u m b er of repeat units. W hen a single restrictio n enzym e is used to cleave the DNA from a single individual, two bands usually ap p ear on the RFLP p attern . This is called a sin gle-locus pattern. A single-locus pattern from one individual usually differs from th a t obtained from a n o th e r individual unless the individuals are identical tw ins. To fu rth e r establish the difference betw een individuals, additional VNTR regions can be used. W hen m ore th a n one locus is used, the analysis is called m u ltilocu s analysis.

The Procedure So the approach to RFLP analysis is as follows. Initially, it is necessary to identify one of the highly variable regions in the genom e. Using a specific restriction enzyme, one can cleave out (separate) the region containing this VNTR region, run it on an electrophoresis gel, and then blot it over to nitrocellulose paper. Using the labeled DNA probe th at is com plem entary to the repeating sequence in the VNTR, the position of the VNTRc ontaining bands can be identified on the gel. The position of each band on the nitrocellulose pap er is p ro portional to the length of the VNTR, w hich in tu rn is determ ined by the num ber of repeat units in the VNTR (Fig. 12-4.) If we analyze a single VNTR region from two different individuals, two fragm ents of different sizes w ould ordinarily occur for each individual, as already noted. If the individuals were children of the sam e parents, their RFLP patterns could be identical or m ay differ in one or both of the bands. If a child were com pared w ith his o r h er m o th er o r father, one band should be the sam e and the o th er different, since one allele cam e from one parent and the other allele cam e from the other parent.

Identification by RFLP One identical RFLP p attern is not sufficient to identify a specific individual, but if four or five such VNTR regions (loci) are used, the probability th at the fragm ent lengths in all regions are identical becom es vanishingly sm all. Thus, a perfect m atch of the RFLP pattern s at four or five VNTR regions provides exceptionally strong evidence th at the DNA sam ples cam e from the sam e source.

Other Applications for Gene Therapy

211

Figure 12.4

R estriction fragm ent length polym orphism (RFLP) p attern from six different individuals (lanes 1-6). The n um ber of in ternal repeats is indicated on the right-hand side of the diagram . Note that each individual has two different lengths, one com ing from each of the two alleles (one from each p arent). All of these repeats com e from a single variable n u m b er tandem repeat (VNTR) region. If sim ilar p a tterns were analyzed from several VNTR regions, the com bined patterns for a single individual w ould differ from each o th er considerably, even though an occasional fragm ent w ould have the sam e length, as show n here for one of the fragm ents in lanes 2 and 5.

These RFLP p attern s w ere dubbed early on as “DNA fingerprints" because they w ere unique to individuals. By com paring p a tte rn s from an unknow n sam ple and various individuals, identification could be aided. For instance, RFLP p attern s have been useful in identifying relatives. A possible fam ily "DNA p o rtrait" using four VNTR regions (four loci) is diagram m ed in figure 12-5. Note th at each child derives one b and in each allele from the fath er and one from the m other. Identical tw ins have identical patterns. In 1994, the rem ains of Russian Czar Nicholas II and his family m em bers were identified by m eans of DNA profiling. This particular family was apparently m urdered in the Bolshevik revolution, and there was considerable question of identity of the children.

212

Genetic Engineering

Figure 12.5

R estriction fragm ent length polym orphism (RFLP) p a tterns from fam ily m em bers. F o u r loci (four variable n u m b er tandem repeat [VNTR] regions) w ere used in this analysis. Each child (Cj and C2) has an individual pattern, w ith the bands being identical with either father (F) or m o th er (M) bands. Identical tw ins (IT and C2) have identical p attern s. A n o n related individual (NR) has a p a tte rn th at doesn't m atch any of them , although there is one band of the sam e length.

RFLP analysis has also been very successful in determ ining the patern ity of children. The p a tte rn s are readily used to id en tify fathers, since half of the child's genetic pattern should m atch that of the father (Fig. 12-6). A nother grow ing use for RFLP analysis is the diagnosis of genetic disorders. As increasing num bers of genes for genetic disorders are being identified and sequenced, it is possible in m any cases to develop an RFLP analysis th at will indicate the presence of the genetic disorder. The m ethod by w hich this is done is outlined in Figure 12-7. In this case, a restrictio n enzym e th at cleaves the DNA in the region of the disabled gene is used, thereby discrim inating betw een a norm al individual and a diseased individual.

Forensic Profiling Although RFLP p a tte rn s can readily exclude relationships betw een individuals, identifying specific individuals exclusively is m uch m ore difficult. In forensic DNA work, such analysis can

Other Applications for Gene Therapy

213

Figure 12.6 P atern ity testing. Single-locus restrictio n fragm ent length polym orphism (RFLP) p a tte rn s show the p attern s provided by m other, child, and alleged father. In the p aternity inclusion pattern, the obligate b an d (OB) m atches th a t of the alleged father. The m ixture of the child and alleged fath er (C/AF mix) show s the two bands from the fath er and one from the m o th er and no others, providing strong evidence of paternity. In the p aternity exclusion pattern, the obligate band (OB) does not m atch th at of the alleged father, and the C/AF mix lane shows four bands, not three, providing strong evidence th at the alleged fath er is not the real father. A dditional loci could be tested to provide additional evidence.

yield p articularly com pelling evidence for such a m atch, bu t there is always a lim ited probability th a t tw o individuals m ay have identical RLFP patterns. Therefore, RFLP pattern m atches m ust always be couched in probability of m atch. The m ore polym orphic positions on the DNA th a t are analyzed, the m ore certain the m atch. A lthough such probability argum ents have been m ade in the cou rtro o m in the past and som e DNA evidence was not used as the result, today DNA RFLP p a tte rn evidence is generally

214

Genetic Engineering

Figure 12.7 Disease diagnosis. Som e genetic disorders can be identified using restrictio n fragm ent length polym orphism (RFLP) analysis. By identifying the region of the chrom osom e in w hich a genetic d iso rd er m ay occur, analysis of th at region using RFLP can provide evidence for the disorder. In the illustration, a single locus is used to identify p atien ts w ith a genetic disorder. N ote th at in such patien ts, certain b ands are identical w ith those obtained in norm al individuals. However, a band o r bands m ay be com m on to individuals w ith the genetic d iso rd er and m ay ap p ear at a different position than th at w hich would ap p ear in a p attern from a norm al person. This kind of DNA analysis is especially useful for infants and unborn fetuses.

accepted. This ap proach was m arkedly enhanced by the O.J. Sim pson trial, in which the DNA evidence was allowed, expertly presented, and show n to provide unequivocal m atches on the blood samples. RFLP analysis can also be used to identify pathogens of unknow n origin. For instance, a m ysterious disease started afflicting people in the “four c o rn ers” area of Utah, Colorado, Arizona, and New Mexico. W ith RFLP analysis techniques, the

Other Applications for Gene Therapy

215

disease vector was identified as a hantavirus, and ap p ro p riate steps were taken to diagnose and treat the illness.

Polymerase Chain Reaction—The Analysis Polym erase chain reaction (PCR) is a technique th a t has been developed in recent years, w hich allows scientists to m ake large am ounts of DNA identical with an original piece. For instance, if a very sm all am o u n t of a bodily fluid or cells is present, PCR allows the DNA in those sam ples to be m ultiplied m any tim es over, providing sufficient am ounts to analyze. This approach has becom e especially useful in forensic w ork and prom ises to be the m ethod of choice in all cases in the future.

The Procedure First, a small am ount of DNA is needed. Then, through sequence analysis, the sequence of the first 15 to 20 nucleotides at both ends are determ ined. Next, short pieces of DNA com plem entary to these regions are synthesized in great qu an tity (readily done w ith the chem ical synthesizers com m ercially available). These are called prim ers. Then, by adding a h eat-resistan t DNA polym erase (Taq polym erase) u n d e r carefully controlled conditions, new stran d s of DNA are m ade, w hich are identical to the region found betw een the two end regions to w hich the DNA prim ers were bound. F or exam ple, in the usual m ode of operation, the DNA, prim ers, and Taq polym erase are placed in a vial and heated to 94° C for 1 m inute to d en atu re the DNA (dissociate the two strands). The tem p eratu re is low ered to 55° C for 30 seconds to allow the two prim ers to anneal (bind to the end regions to w hich they are com plem entary) to the ends of the each strand of the target DNA. Then, the tem p eratu re is raised to 72° C for 1 m inute, d uring w hich tim e Taq polym erase m akes tw o new stran d s of DNA, each com plem entary to one of the original parent strands. The sam ple is heated again to denature (separate the strands of) the newly form ed DNA, and the cycle is repeated. Each tim e all of the newly m ade stran d s becom e tem plates for the next round of synthesis, resulting in over a m illion copies of the original DNA in a m atter of hours using 30 to 35 cycles. PCR is bo th rapid and convenient (Fig. 12-8). But Taq polym erase has no proofreading m echanism , so there is a g reater chance for e rro r in replication th an in living system s. Statistically, the e rro r rate is ab o u t 1 m istake of every 10,000 nucleotides synthesized. Although this e rro r rate is still low,

216

Genetic Engineering

Figure 12.8 Polym erase chain reaction (PCR). This technique allows a large am o u n t of DNA to be produced w hich is identical w ith the original DNA sam ple. The initial DNA is separated by heating, and prim ers th a t are com plem entary to eith er end are added and allow ed to anneal (bind) to th e ir com plem entary ends. DNA polym erase is added (Taq polym erase; it is h eat-resistan t), and this m an u factu res new DNA stran d s com plem entary to the original strands. The stran d s are then sep arated by heating, ad d itio n al prim ers are annealed, and DNA synthesis occurs again. This cycle is con tin u ed until enough DNA is m ade for analysis. See text for details.

Other Applications for Gene Therapy

217

m istakes m ade in the early periods of replication are am plified in the entire product, w hich m ay cause faulty inform ation to be generated. The great advantage of PCR is th at even a single piece of DNA from a single cell can be used as a test sam ple and will give sufficient pro d u ct for fu rth e r analysis. In addition, it is possible to use fragm ents of DNA from sam ples th a t m ay have been dam aged as tem plates, allow ing analysis in situ atio n s th at w ould otherw ise be im possible. A disadvantage of the PCR tech nique is th a t the longest DNA th a t can be am plified is no longer th an ab out 5000 bp. This lim its the size of possible regions of a single DNA th a t can be analyzed. RFLP analysis, on the o th er hand, is not so lim ited. To m ake the PCR app ro ach useful in DNA profiling, it is essential to identify a specific region of DNA and am plify this region. This region m ust be polym orphic (highly variable), yet have regions a ro u n d it (flanking regions) th a t rem ain constant. P rim ers th a t are com plem entary to these co n stan t flanking regions can be m ade and used in the PCR experim ent. It w ould be nice to use the VNTR regions th a t were used for RFLP analysis. The problem is th a t VNTR regions are too large to be am plified by the PCR technique. Recently, a n u m b er of short tan d em rep eat (STR) regions have been discovered, w hich contain repeating regions of 3 to 7 bp each. A lthough these are rep eated m ultiple tim es, the aggregate size is easily accom m odated by PCR am plification techniques. These regions can be amplified by PCR and then analyzed using essentially the sam e protocol as used w ith RFLP analysis. M ultiple STR sites are now being used, w hich provide a b u n d a n t info rm atio n for identification purposes. The PCR-STR approach for identification is now the m ethod of choice for alm ost all com m ercial laboratories, for the FBI, and for m ost state crim e laboratories. Clearly, the pow er of h y bridization of nucleic acids w ith probes to specific regions allows an elegant, rapid, and dependable technique to identify alm ost unique characteristics of the individual from w hich the sam ples em anated.

SU M M A RY M apping and sequencing the DNA in h u m an chrom osom es is a gigantic project, b u t is already paying dividends as new genes are being discovered. Diagnostic techniques are present and will continue to be developed. This will allow faulty genes to be

218

Genetic Engineering

identified. By identifying the positions of these genes, the possibility of genetically engineering cells to help alleviate som e hum an genetic disorders becom es m ore of a reality. In addition, the use of DNA as a “fingerprint” for identification purposes has blossom ed trem endously. R estriction fragm ents can be used to identify family m em bers readily. Such techniques are used not only for h u m an fam ilies, b u t to identify rela tio n ships am ong anim als and plants. RFLP analysis has been used in forensic w ork as well to help identify short tandem rep eat (STR) regions, a n u m b er of w hich have been discovered. Using this PCR-STR approach, the d o n o r of the sam ple tested can be identified w ith considerable certainty.

13 BIOTECHNOLOGY, SAFETY, AND THE FUTURE WHAT YOU WILL LEARN IN THIS CHAPTER

• • • • • • • •

Biotechnology—w hat it is and w hat is isn't How a p a te n t affects biotechnology ind u stries and universities How safe is genetic engineering W hat safeguards are in place to ensure the quality of genetically engineered products W hat the hum an genom e project is E thical considerations in genetic engineering How genetic engineering m ay affect the future The future of biotechnology

All th a t we have learned in this book is of little use to m ankind unless it can be applied and used. Along the way, we have m en tioned various applications, to w hich som e of the techniques have been applied. B ut the effort is m uch larger th an we have room to discuss. Ever since the m id-1970s, w hen the original reco m b in an t DNA w ork was m ade public, im aginative m inds and billions of dollars have been spent trying to bring to pass the dream of m anipulating genes for the good of m ankind. C om m ercial application of genetic engineering techniques falls into the broad category of biotechnology. B iotech n ology is 219

Genetic Engineering

220

defined as “any technique th a t uses living organism s or substances from those organism s to m ake or m odify a p ro d u ct and perform services, or to develop m icroorganism s for specific uses” (United States Office of Science and Technology). In a very broad sense, the m an u factu re of soy sauce, brew ing alcoholic beverages, and b read and bagel baking all could be included in this definition. However, generally w hen we think of b io tech n o logy, we th in k of processes th a t use genetic m ethods to in crem ent the usefulness of n atural organism s or to develop modified organism s in som e way. TECH N O LO G Y TRANSFER

Patents F or the ideas and techniques th at we have discussed in this book to m ake their way to the com m ercial m arket, a m echanism needs to be pu t in place to p rotect the inventor. P atents have been used for pro tectio n of inventors ever since the ratification of the C onstitution. A p aten t is a legal m onopoly on an idea or discovery, w hich provides the inventor w ith the right to use and m arket the discovery for 20 years to the exclusion of all others. The m ajor problem in the area of genetic engineering was th at it had long been held th at living things were not patentable. In the late 1970s, applications for various applications of genetic engineering were received and dism issed by the United States Patent and Trademark Office. The issue was litigated, and, in 1980, the United States Suprem e Court was brought into the foray when Dr. C harkrabarty tried to patent a genetically altered oil-eating Pseudomonas . The question was w hether it was naturally occurring. The Court ruled that it was not and therefore was patentable. This was the first tim e a living thing had been patented. The ruling was broadened in time, finally allowing genetically altered higherorder living organism s to be patented as well. Since th at tim e, p aten t rules, as they applied to altered living organism s (transgenic anim als) and to discovery (and m odifications) of portions of the h u m an genom e, have been refined. The following are m ajor tests for paten tab ility of a product or process: •

It m ust have novelty (that there was no previous finding like it).

Biotechnology, Safety, and the Future • •

221

It m ust not be obviou s (not obvious to a person fam iliar w ith the area). It m ust have utility (real usefulness in its application or design).

But should everything be patented? It is clear th at by using DNA recom binant techniques and applying the m ethods th at we have discussed previously, m any new, n o n n a tu ra l products and organism s can em anate. Recently, the N ational In stitu tes of H ealth (NIH) applied for paten ts for th o u san d s of cDNA fragm ents being used in the h u m an genom e m apping project. This caused no sm all stir w orldw ide, because it w ould, in essence, p a te n t the h u m an gene. Happily, the NIH w ithdrew th eir ap p lication. The P atent and T radem ark Office has since issued a statem en t indicating th a t such cDNA fragm ents w ould not be patentable. This was overturned in court and now cDNA fragm ents, a few at a tim e, are patentable. M ajor areas of the p a te n t regulations dealing w ith DNA and genetic engineering are still undergoing changes. N onetheless, to date, th o u san d s of p aten ts have been g ran ted w ith tens of th o u san d s m ore on the way. Even though this effort is m assive, the payoffs are m assive, too. B iotechnology is expected to be a $50 billion/year business enterprise in the U nited States at the tu rn of the century. IMPACT O N UNIVERSITIES

The intense effort to do applied research and to com m ercialize the resulting products has had an im m ense im pact on the u n iversity systems in the United States and increasingly throughout the w orld. M any universities have now established technology tran sfer offices, so th at patentable ideas by university investigators can retu rn som e profit to the universities. Faculty m em bers are u n d e r scrutiny to determ ine w h eth er the w ork they are doing has com m ercial value and, if so, w hat share the university will take. An ethical problem w ith faculty m em bers comes when they m ust decide w hether the research they are doing should be in the private sector or not or w h eth er they them selves should be in the private sector as well. So, in recent years, alliances have been form ed am ong universities, scientific researchers, and biotechnology com panies. To be successful, this alliance m ust be beneficial to all parties, so th at exciting science perform ed in the university can be developed

222

Genetic Engineering

into m arketable products. Getting the right mix is often difficult. There are m any successful examples and m any m ore failures. A lthough som e of these p a rtn e rsh ip s betw een industry and the universities are stim ulating increased research at universities, som e feel th a t the prim e purpose of universities—th a t of acquiring and dissem inating know ledge—is being eroded. R esearchers who struggle to m aintain basic research are finding it increasingly difficult to rem ain com petitive as m ore m oney is directed to applied research. In addition, colleagues and som etim es a d m in istra to rs m ake it clear th a t applied research in te rests would be m ore im portant to the university. Finally, note th a t there is no sm all financial incentive to pursue the route of applied research. A really successful idea can m ake m illionaires of the inventors. These num bers m ake university professors dizzy. W ith such financial incentives, scientific investigation will increase, w hich in tu rn will spin off into new businesses and o th er com m ercial endeavors. SAFETY

Two-edged sw ords cut both ways, and genetic engineering is a tw o-edged sword. N ot only can we dream of the m ighty effects on health and well-being th at genetic engineering prom ises, but we can also dream about the possibility of som e engineered organism going awry and becom ing uncontrolled in the environm ent. Scientists have considered in depth the possibility of such a thing happening.

The Birth of Guidelines W hen the pow er of DNA recom binant techniques (the insertion of new DNA into chrom osom es) was first envisioned in the early 1970s, m any scientists becam e concerned. To discuss these g argan tu an social concerns and to discuss w h eth er restrictio n s should be placed on reco m b in an t DNA research, 139 o u tsta n d ing scientists from 17 countries gathered at the A silom ar C onference Center near Monterey, California, in February 1975. For several days, scientists discussed th eir concerns and the prospects of recom binant techniques for the future. The discussion was intense and heated at tim es, w ith views being expressed on all sides of the issue. The results of the A silom ar conference and late r discussions were guidelines from the NIH. These cam e into being in 1976.

Biotechnology, Safety, and the Future

223

Shortly after, o th er national organizations, such as the E nvironm ental Protection Agency (EPA) and the D epartm ent of Energy (DOE), also created guidelines. Initially, these guidelines w ere so restrictive th at they essentially closed dow n som e areas of research. Later, as new, disabled strains of bacteria and viruses were developed, the guidelines were relaxed and som e of the restrictions were lifted, allowing research to move ahead. Over tim e, scientists have becom e m ore and m ore aw are of w hat m ay or m ay not p resent dangers eith er inside the lab o ra tory or in the environm ent. The result is that, although there are still som e strin g en t restrictio n s governing the use and developm ent of som e types of genetically altered species, m ost of these restrictions presently apply to organism s th at m ight be released into the environm ent. W ithin the controlled conditions of the laboratory, m ost experim ents are allowed, w ith only a few dem anding the totally restrictive environ m en t (a totally contained laboratory in w hich a person m ust com pletely change clothes on entering and also on leaving), w hich was once thought necessary for all types of reco m b in an t DNA work. M ost scientists view the risk of an outbreak of disease or an unm anageable organism as being very small. A strong argum ent for loosening governm ent restrictions is th a t M other N ature has been doing genetic recom binations for m illennia, and our efforts will likely do very little additional dam age.

Lingering Concern Som e people are concerned about allow ing genetically altered organism s into the environm ent. Present guidelines allow such a release only w hen it is proved th a t the organism will be com pletely safe. The safety of the organism s deals w ith the results of an accidental spill, accidental ingesting, or possible alteratio n s th a t w ould m ake it a noncontrolled species in the environm ent. A lthough no guidelines are foolproof, the NIH guidelines are sufficiently strict to ensure a wide m argin of safety. The NIH has established a R ecom binant DNA Advisory C om m ittee (RAC). This group m ust approve all gene th erap y experim ents and experim ents th at put genetically altered organism s into the environm ent and m ust set the stan d ard s for lab o rato ry safety in the handling of certain organism s. In addition, each university m ust have a local advisory com m ittee, w hich likewise m ust give perm ission for experim ents involving recom binant DNA. These safeguards provide independent observers to

224

Genetic Engineering

identify po ten tial pitfalls in experim ental procedure or unsafe protocols th at m ay be used.

Ethics In addition to safety, the problem of ethics loom s over the entire field of gene therapy. Are we changing the future by genetically engineering bacteria or other organism s? Is the benefit of trying to m ake things greater th a n the cost of the dam age th at m ay ensue? To w hat degree should we be allow ed to genetically change a h um an being? Is it desirable to try to genetically alter h u m an children? Can the d ata bank o b tained from the h u m an genom e project be used to screen future generations? W hat is to prevent e u g e n ics (destroying individuals of a genetically distin ct type) from occurring? Can an in surance com pany have access to a p e rso n s genetic profile? If an in fant is show n by m eans of genetic screening to be m entally or physically disabled, should the p aren ts be inform ed? These and o th er q uestions are being asked from m any quarters and generally have no right answer. It is in teresting to note th a t 5% of the budget for the h u m an genom e project has been allocated to determ ine the ethical, legal, and social im plications of the project. F our areas of ethical, legal, and social concern have been identified to date: 1. 2. 3. 4.

Privacy of genetic inform ation Safe and effective introduction of genetic inform ation in the clinical setting Fairness in the use of genetic inform ation Professional and public education

Each of these latter four issues has m any facets to be considered as we deal w ith genetic issues. We have discussed the safety of engineering of b acteria and o ther organism s. It should be reem phasized th a t in the process of m aintaining life, m uch nondirected reco m b in atio n of DNA takes place naturally. E specially w hen unusual environm ental stresses com e upon cells, the cells react by changing th eir genetic m akeup to m eet the challenges. This kind of a d a p ta tio n o r directed m u tatio n is constantly taking place aro u n d us. Even w ith an extensive am o u n t of directed genetic engineering, we are not likely to com e close to producing the am o u n t of a lteratio n th a t takes place naturally. From this standpoint, the future is constantly being altered, but m ainly by “n a tu ra l,” undirected m eans.

Biotechnology, Safety, and the Future

225

If we can alter b acteria and plants in such a way as to m ake life a little b e tte r for hum ans, we can certainly justify our involvem ent ethically in genetic alterations. However, as we move up the scale a bit, we sta rt to ru n into problem s. Testing w ith laboratory anim als has recently com e u n d e r the close scrutiny of anim al rights' activists. Do we as hum an beings have the right to subjugate lesser species to our som etim es inhum ane testing procedures? These questions are not yet answ ered com pletely. We clearly need to test some ideas and products on living beings before we use hum ans. B ut how m uch is essential and w hat guidelines should govern such testing are yet to be determ ined. The ethics as to w hether we should genetically change hum an beings them selves goes deep into the center of o u r cultural system . There are actually two levels of change th a t we should consider. (1) There is a change to individuals, using genetic engineering techniques to alter th e ir genetic m akeup, b u t in ways th a t will not affect th eir children. (2) There is the possibility of genetically engineering entire lines of hum ans, m uch like we have learned to do w ith transgenic anim als.

Changing or Adding Genes to Individuals to Cure a Genetic Disease We have show n th at it is possible to change the genetic m akeup of individuals, especially those w ith diseases of the blood. This can be done to a lim ited extent by altering the genetic m akeup of the bone m arrow stem cells. In these cases, only the individuals so treated are affected, not their offspring. The m ajor ethical concern is w hether it is right and p ro p er to devote the substantial resources necessary to develop such technology intensive processes for the benefit of ju st a few individuals. In o th er w ords, although the process of developing genetic engineering techniques to tre a t h u m an beings is intellectually satisfying, is the payback to the public sufficient to m erit the investm ent? W hile this q u estion can be raised for m any areas of science, it is tru e th a t genetic e n g in eerin g a p p ro a c h e s, at best, will provide tre a tm e n t only for relatively few of the sick an d d iseased th ro u g h o u t th e w orld. As the h u m an genom e p ro ject w as conceived and d iscu ssed at length, m any arg u m e n ts a g a in st the p ro ject p o in te d to th is very issu e—th a t th e e n o rm ous cost w ould benefit very few. Congress m ade the decision to p u rsu e th a t endeavor. Since C ongress re p re se n ts the

226

Genetic Engineering

A m erican publie, it can be argued th a t C ongress m ay feel th a t genetic e n g in eerin g of ind iv id u als w ould be a p p ro p ria te as well.

Genetically Altering Germ (Sperm or Egg) Cells W hat about fixing genetic problem s for entire fam ily lines, such as the hem ophiliacs? Are we justified in m aking the changes necessary to cleanse certain lines of genetic disorders? This problem is not resolved and is not likely be resolved for som e tim e. At present, a total m oratorium exists on any genetic experim en tatio n w ith h u m an cell lines. Still, it is clear, from the transgenic anim al success, th a t such an approach is feasible. However, both scientific and ethical questions rem ain. From the scientific standpoint, we know that certain disorders are caused by single m u tatio n s in a single gene. Yet, we also know th a t proteins often act in a coordinate m anner, fixing a problem in one place m ay create a problem elsew here. For instance, in som e transgenic anim al experim ents, notably in pigs, inserting a new gene often m akes the transgenic anim al sickly or sterile. H um ans are considerably m ore com plex, and the results are m uch m ore difficult to predict. Clearly, com plete scientific understanding is still lacking. The ethical side of genetic alteratio n of germ cells is even m ore com plex. How m uch do we change the future by altering the present? W ould a transgenic fam ily line retain all of the o th er beneficial characteristics th at were p resent before the engineering took place? W ho will m ake the decisions as to when germ cell alteratio n s are allow able? Is the cost to society as a whole w orth the benefit to a p articu lar family? These and m any other sim ilar questions rem ain to be resolved before such experim entation is allowed. The m o rato riu m on transgenic experim ents w ith h um ans is correct until the issues have been fully discussed and settled. Even w ith the m oratorium in place, genetic testing still has fundam ental questions to be resolved. One of these areas is the possibility of using genetic testing as a basis for eugenics, w hich is to control the h ereditary characteristics of h u m an s or o th er species.

Eugenics If genetic testing were to becom e m andatory, is it desirable to lawfully w ithhold rep ro d u ctio n rights from those w ho do note m eet societal standards? Even at this tim e, program s of m an-

Biotechnology, Safety, and the Future

227

dated abortion are being carried out in som e p arts of the world, based in p art on the genetic testing of the offspring. Should this be allowed? If so, to w hat degree? In w hat way will society be able to enforce a ruling in this area. Science fiction stories often tell of societies tailored th ro u g h genetic testing (and engineering) to breed only those w ho are m ost fit according to the sta n dards of th at society. The possible abuse of genetic testing m ethods by u n sc ru p u lous persons rem ains a real problem . In the U nited States, constitu tio n al safeguards will likely prevent significant abuse, b ut other nations and civilizations are not so governed. Therefore, it is essential to m andate safeguards internationally.

Genetic Screening G enetic Screening and Privacy W hat about genetic screening? Should an insurance com pany be allow ed free access to a p e rso n s genetic profile? Does this fall u n d e r the physician-patient privilege g ranted by law? It can be easily seen th at genetic screens can be used to exclude potential high-risk clients for insurance purposes. Is this proper? An arg u m en t could be th a t no genetic testing should be allowed. Still, this is u n fair to the offspring, since early d iagnosis m ay allow early and possibly m ore successful treatm en t of a genetic disorder. This issue is not resolved, b u t lines m ust be draw n to allow genetic screening w ithout a risk of becom ing uninsured. Steps are being taken to restrict access by insurance com panies, as well as to restrict the use of such inform ation. The issue of ju st how private genetic info rm atio n really is has yet to reach the Suprem e Court. WHAT O F THE FUTURE?

G enetic engineering, like com puter chips and lasers in the past, is an area of trem endous potential and virtually unlim ited possibilities. We know how to m ake genetic changes, b u t the u n d e rstanding of all of the com plex in terrelatio n sh ip s betw een genes and life is yet lim ited. In addition, ethical and m oral considerations may place lim itations on all th at m ight be done.

228

Genetic Engineering

The Future of Genetic Engineering as a Science Since DNA was first tran sferred by design into an organism and expressed as a protein, scientists have been quick to im agine the potential of the tool th at was discovered. Early experim ents were lim ited to b acteria and viruses, followed soon after by those on anim als and plants. As a diagnostic tool, screening genes is a pow erful and ac cu rate technique for diagnosing genetic disorders. This pow er will continue to grow and m ore and m ore genes are discovered. It is probable th a t w ithin the next decade, genetic screening of in d ividuals will becom e as ro u tin e as blood tests now are. There rem ains the issues of privacy and ethics to be resolved, bu t the technology needed to provide such tests will continue to improve. It is interesting to note th a t in so doing, all three areas— genetic testing, com puters, and lasers—will be brought into play. Efforts are presently underw ay to use a co m p u ter chip itself as the "dipstick" for genetic probes, w ith a laser used to identify the positive reactions. In the area of diagnosis, we can surely p red ict significant progress in the future. However, repairing genetic diseases will require a longer period to develop. For genetic disorders of the blood, there is significant hope for su b stan tial progress in the next decade. However, in the case of m any of the o th er genetic disorders, gene therapy will be considerably m ore difficult, m ostly because of the difficulty in targeting the new genes to the appropriate cells. Gene therapy is being used increasingly as a tool in cases in w hich no o th er rem edies exist. E xperim ental techniques are rapidly developing, w ith novel vectors being developed to help target the new genes. U nderstanding of how the gene works and is regulated is continuing to increase. So, the prom ise of effective gene therapy rem ains bright for the future. The developm ent of transgenic anim als for research and p h a rm aceutical purposes is a rapidly grow ing and prom ising area. For scientific research, the continuing developm ent of "knockout" m ice lacking specific genes is a pow erful tool for research. O ther lab o rato ry anim als having genetic alteratio n s th at allow them to be used for research purposes are rapidly being developed as well. And the p harm aceutical industry is investing su b stantially into the aren a of "pharm " anim als, w hich are genetically altered to supply needed proteins for h ealth-related

Biotechnology, Safety, and the Future

229

purposes. Such developm ents will continue to accelerate into the foreseeable future. In addition, rap id acceleration is occurring in the developm ent of genetically engineered anim als for food purposes, such as catfish w ith added grow th horm ones, chickens engineered for lean er m eat, and shellfish engineered to m axim ize grow th. These and m ore are presently in use or under developm ent, with m any m ore in the pipeline. The sam e acceleration is even m ore tru e in the area of plants. Increasing num bers of crop plants are being developed using genetic engineering to provide disease resistance and herbicide resistance and to carry genes for m ore rap id grow th. These genetically engineered p lan ts show great prom ise for ag ricu lture. A lthough it is necessary to go th ro u g h regulation and licensing to dissem inate genetically engineered organism s into the environm ent, these restrictio n s are designed to p ro tect the potential consum ers. In the long run, the future looks very b rig h t for increasing the n um bers and varieties of genetically engineered plants th at will be used as food products.

Biotechnology's Future The future for biotechnology com panies looks especially bright. A lthough m any com panies have experienced financial grow ing pains, there is co n tinued expectation th a t biotechnology will provide m any solutions to various challenges in the future. Billions of dollars are being invested to develop new and b e tte r products. Those having m edicinal applications are rigorously screened by the Food and Drug A dm inistration before they are licensed for use.

Various Uses for Genetic Engineering G enetically m odified organism s will certainly be harn essed to m any ind u strial uses, such as w aste clean-up, harvesting o th e rwise u n o b tain ab le oil reserves, and o th er im p o rta n t tasks. In addition, the varied conditions u n d e r w hich organism s grow (freezing tem peratures, extremely high heat, high pressures) will be used in providing stable enzymes and products th at can function u n d e r variable conditions in research and agriculture. An exam ple is the use of Taq polym erase (a high -tem p eratu re enzym e) used in the polym erase chain reaction (PCR) approach we discussed in C hapter 12. C onsiderable progress has also been m ade in o th er areas of genetic m anipulation. Animal breeding has been revolutionized

230

Genetic Engineering

by artificial insem ination and surrogate m other breeding. These standard procedures will be used in developing additional genetically m odified anim als for research and breeding purposes. M onoclonal antibodies have been developed using genetic engineering techniques. These antibodies are capable of d iscrim inating a single specific site on a com plex m acrom olecule and have show n them selves to be highly specific reagents in advanced diagnostic techniques. Using these am azing antibodies, we can literally “see” inside the h u m an body w ith great clarity. One of the m ore exciting areas in genetic engineering is th a t of nitrogen fixation. If various grain crops can be engineered to fix nitrogen (take nitrogen from the air and convert it to n itro gen products used by plants) out of the atm osphere to supply their needs in protein m anufacture, expensive fertilizers m ay no longer be essential. All the latte r applications, as well as m any th at are yet u n d iscovered, will undoubtedly affect our future. In m any cases they will m ake life a little better. Still, these techniques are not a p anacea. We cannot expect genetic engineering to solve social ills or disease induced by m alnutrition. We also m ust not expect genetic engineering to elim inate even the sim plest genetic diseases for som e tim e. N onetheless, the prom ise is there and if recent history is any indication, great surprises will aw ait us as we p u rsu e the research necessary to provide answ ers to the problem s ahead.

GLOSSARY

A acrylam ide m aterial popularly used in gel electrophoresis. agar a gelatin-like m aterial used in gel electrophoresis; m ore porous th an acrylam ide. allele a portion of a chrom osom e th at codes for certain traits. There are generally two alleles for the sam e trait in each chrom osom e—one from the father and one from the mother. Portions of alleles are often mixed together in the offspring. alpha h elix a helical secondary stru c tu re com m only found in the am ino acid chains of proteins. am in o acid s the building blocks from w hich proteins are m ade. In n a tu ra l proteins, 20 am ino acids are used (see Appendix for a com plete list and their structures). a m n io c e n te sis the process in w hich fluid is rem oved from the placenta for analysis. an n eal the process in w hich tw o com plem entary stran d s of nucleic acids are allow ed to associate and form hydrogen bonds betw een the strands. a n tico d o n the three nucleotides on the tra n sfe r RNA (tRNA), w hich are com plem entary to the three nucleotides on m essenger RNA (mRNA) th a t code (a codon) for a p a rticu la r am ino acid. 231

232

Glossary

archive the place w here inform ation is stored; in living things, norm ally DNA. arom atic a m olecular com pound th a t consists of carbon and other atom s and form s a ring structure. assay any kind of test to d eterm ine the presence or absence of som ething. atom the fundam ental u n it of an elem ent, com posed of a nucleus containing p ro to n s and n eu tro n s and su rro u n d ed by electrons. B (3-galactosidase an enzym e th a t breaks dow n lactose into two sugar m olecules—galactose and glucose. P sh e e t a zigzag secondary stru c tu re com m only found in the am ino acid chains of proteins. bacterial law n a Petri dish th at has the agar covered com pletely w ith bacterial colonies. b acteriop h age a bacterial virus; m any have a geom etrically shaped head unit, a tail, and appendages w ith w hich they attach to bacteria. bacteriu m a sm all, one-celled organism th a t contains all the necessary m achinery for life. base a cyclic structure containing nitrogen, carbon, and other elem ents. It is attached to a sugar m olecule to m ake a nucleoside or nucleotide, the basic building block of nucleic acids. base d e le tio n a form of m u tatio n in w hich a norm ally occurring nucleotide is deleted from a gene. base in sertio n a form of m u ta tio n in w hich an additional nucleotide is inserted from a gene. base pair the coupling of two com plem entary bases by hydrogen bonding. base su b stitu tio n a form of m u tatio n in w hich a new base is substituted for a norm ally occurring nucleotide in a gene. b iolistic process a process in which a projectile is literally shot at a plant cell. The projectile is covered w ith DNA, w hich is inserted into the cell as the projectile enters.

Glossary

233

b io sy n th esis the process by w hich a m olecule used in living processes is synthesized in living systems. b la sto cy st in early cell division, a spherical stru c tu re w ith a coat, containing num erous dividing cells as well as a fluidfilled cavity. b lastom ere a cell found in early cell division after fertilization of an egg. b lunt or flush en d s ends of both stran d s of the DNA th a t are the sam e length w hen DNA is cut using certain restrictio n endonucleases. See also sticky ends. bon d the ability of two atom s to hold together by sharing electrons or by using charge differences or o th er characteristics of the atom s. Bonds have different strengths, depending on the atom s bonded, the types of bond m ade, and the solvent in w hich the atom s are found. See also covalen t bond, disu lfid e (S-S) bond , hydrogen bond , io n ic bond , and p h osp h od iester bond. C calciu m su lfa te a chem ical com pound m ade out of calcium , sulfur, hydrogen, and oxygen, w hich helps open the pores of cells and allows DNA to enter. carbohydrate a general nam e for sugar m olecules of all kinds. catalyst a substance th at enhances the rate of a reaction, b ut is not used up in the process. catalyze enhance the rate of the reaction. cDNA com plem entary single-stranded DNA obtained by m aking a reverse transcript (DNA from RNA tem plate) from RNA. cDNA library a collection of b a c te ria containing fragm ents of DNA from an organism , w hich w ere o btained from reverse transcription of RNA. See also g e n e library. cen trifu ge an in stru m e n t th a t spins sam ples in tubes at high rates of speed; often used to separate biological m acrom olecules of different sizes. c e llu la se an enzym e th at attacks the bonds th a t hold cellulose together; often used to break dow n the cell walls of p lan t cells.

234

Glossary

c h im e r ic DNA DNA com posed of m a te ria l from tw o o r m ore sources, such as b a c te ria l/m o u se o r m o u se /h u m a n DNA. ch o rio n ic villi sam p lin g sam pling of the fluid from the chorionic villi in the placenta. ch rom osom e a u n it of the genetic m aterial of a cell. Som e cells, such as bacteria, have a single chrom osom e. O ther cells, such as hum an cells, contain 23 chrom osom es. cleave or cleavage the process by which a chain of am ino acids or nucleotides is severed or cut. clon e a cell or organism w hose genetic inform ation is identical w ith th at from w hich it was derived. co d o n a three-nucleotide segm ent of m essenger RNA, w hich uniquely determ ines insertion of a single am ino acid into a protein th at will be synthesized. collagen a three-stranded helical protein of w hich tendons and cartilage are m ade. colon y screen in g m ethod used to determ ine w hich bacterial colonies contain certain sequences of DNA. com b a device th a t is placed at the top of poured gel to p u t cavities or wells into the gel so th a t a sam ple can be placed in them . com p lem en tarity two stran d s of nucleic acid th a t have com plem entary sequences of nucleotides. com p lem en tary tw o nucleotides th a t base p a ir specifically. In DNA, A-T and G-C are com plem entary. In RNA, A-U and GC are com plem entary. c o m p le m en ta r y DNA (cD N A ) a s tra n d of DNA c o m p le m e n tary to RNA, generally o b ta in e d from it u sin g reverse tra n sc rip ta se . com p ou n d a m olecule containing tw o or m ore different kinds of atom s. con ju gation th a t act betw een b acteria th a t allows genetic m aterial from one bacterium to be transferred to another.

cos site s sequences of DNA needed to package plasm ids into viruses.

Glossary

235

co sm id ap p roach m ethod by w hich cosm ids containing p lasm ids are put into viruses, w hich in tu rn transfer the DNA to cells. c o sm id s plasm ids into w hich cos sites have been inserted, allowing the plasm id to be packaged into a viral coat. covalen t b on d a bond betw een tw o atom s form ed w hen they share electrons. crip p led virus a virus th at can n o t reproduce itself inside a host, generally because portions of the viral genom e have been rem oved. cro ssin g over the act in w hich DNA from one chrom osom e exchanges w ith DNA from a n o th e r chrom osom e, allow ing the exchange of genetic inform ation. crow n gall tum or a cancer-like grow th on a plant th at contains bacteria and plant cells, caused by infection w ith Ti (tum orinducing) plasm id from Agrobacterium tumefaciens. D deoxyribonucleotide the fundam ental unit found in DNA, containing a deoxyribose sugar, coupled to a p h osphate group at the 5' carbon and a nitrogenous base at the V carbon. deoxyribose a five-carbon sugar m olecule that contains only -H at the 2' position ra th e r th an the -O H group found in ribose; used exclusively in DNA. d ifferen tia tio n the process in w hich certain portions of the DNA are used to the exclusion of others, m aking specialized cells and organelles. d ip ep tid e two am ino acids coupled w ith a peptide (covalent) bond. disu lfid e (S-S) bon d a covalent bond betw een two sulfur atom s, often found in proteins betw een polypeptide chains. DNA deoxyribonucleic acid, a long chain of deoxyribonucleotides th at contains all the genetic inform ation needed by the organism . DNA p olym erase an enzym e th a t m akes new DNA from deoxyribonucleoside triphosphates using the parent DNA as a tem plate.

236

Glossary

DNA profilin g som etim es called fingerprinting, this technique is used to identify in d iv id u als having id en tical o r sim ila r DNA. d ou b le h elix the base-paired spiral stru c tu re th a t two stran d s of DNA ordinarily make. E electron an extrem ely sm all negatively charged particle, w hich is located around the nucleus of an atom . electro p h o resis a technique in w hich sam ples are m oved (pulled) thro u g h an acrylam ide gel (or som e o th er m atrix) using electrical voltage and current. electro p o ra tio n the process by w hich the pores in cell m em b ranes are opened using an electric field; generally used to insert DNA into cells. elem en t an atom containing a precise n um ber of protons, n eu trons, and electrons. energy the stuff th a t m akes processes go; generally com es in light, heat, m echanical, electrical, or chem ical forms. enzym e a biom olecule, generally a protein, w hich m akes a reaction or process go faster; often used to m ake or break chem ical bonds. eu gen ics the science of im proving genetic characteristics of the hum an, which, historically at tim es, has been accom plished by sterilization or killing people w ith assum edly negative gene pools. eukaryote a cell th at contains a nucleus, generally m ore complex th an a prokaryote, w hich contains no nucleus. eukaryotic a function or process belonging only to eukaryotes. ex p ressed or e x p ressio n the process by w hich a gene is expressed as a protein. The DNA m akes RNA, w hich m akes protein, the product of the genetic inform ation. F fram e-shift m u tation a deletion or ad d itio n of a nucleotide th at occurs in the gene, m aking all the following codons have the w rong three-letter sequence.

Glossary

237

G gam m a ray a high-energy beam of very short wavelength. g en e po rtio n of a chrom osom e o r piece of DNA th a t is used to code for a specific protein. gen e bank a database containing in form ation on the DNA sequence of genes. g e n e library a co llectio n of b a c te ria c o n ta in in g frag m en ts of DNA from an o rg an ism , w hich w ere o b ta in e d by fra g m en tin g th e DNA from a cell in th a t o rg an ism . See also cDNA library. g en etic cod e the three-base sequences th at specify the order of am ino acids to be placed in a polypeptide chain. gen etic linkage the coupling of genetic functions th at are close together on the chrom osom e. g e n e tic s the field of study in w hich the in form ation contained in the genes is transferred to the offspring. gen om e the entire collection of genetic m aterial in a cell, as in the hum an genome. germ c e ll a sperm o r egg cell th a t can n o t replicate itself and contains only half the chrom osom es of the parent cell. gh ost the protein coat of a virus w ithout the nucleic acid th at it norm ally encapsulates. g lycop rotein a m acrom olecule th a t has bo th a carbohydrate (sugar) portion and a protein, coupled w ith covalent bonds. H HAT m ed iu m a grow th m edium for cells th a t contains /zypoxanthine, am inopterin, and thym idine. helix a spiral form th at m ost nucleic acids take in solution. Two strands intertw ined becom e a double helix, as in DNA. hem oglobin a large protein, containing four polypeptide chains and carrying up to four oxygen m olecules from the lungs to the rest of the organism . high copy num ber plasm ids th a t ap p ear in high num bers in some cells. h ost a bacterium or a cell th at is specifically targeted by a virus.

238

Glossary

hyb rid ization the base pairin g of DNA w ith RNA or, m ore generally, of any nucleic acid strand w ith any other. hydrogen bond a weak bond form ed betw een a hydrogen atom and generally an oxygen or a nitrogen atom ; very prevalent in proteins and nucleic acids. h yd rop h ilic water-loving; hydrophilic m olecules are easily soluble in w ater and ten d to form hydrogen bonds w ith w ater molecules. h y d ro p h o b ic w ater-hating; h y d ro p h o b ic m olecules often avoid w ater by grouping together and will not form hy d ro gen bonds. h yd roph obic in tera ctio n s the grouping together of waterh ating m olecules th at helps to m ake proteins fold and to stabilize the folded structures.

inducer a m olecule th at helps initiate a specific reaction. insert a new piece of DNA th at is inserted into a n o th er piece of DNA. intron a p o rtion of the gene th a t is tran scrib ed into RNA, then rem oved before the RNA is translated. ion an elem ental atom th a t has e ith e r gained or lost one or m ore electrons and thus has a net charge. io n ic b on d a fairly w eak bond form ed betw een two oppositely charged groups.

lac operon the genomic unit that includes the regulatory regions as well as the structural genes for the lactose region of the genome. la cto se m ilk sugar com posed of tw o cyclic sugar stru ctu res (galactose and glucose). lam bda phage a specific bacteriophage th at attacks Escherichia coli bacteria. lig a se an enzym e th a t attach es two pieces of nucleic acid together, form ing a phosphodiester bond betw een them . linkage form ing bonds betw een m olecules.

Glossary

239

lip id containing fatty acids or other fat molecules. lip id bilayer the stru ctu re found in cell m em branes com posed of two layers of lipids, each w ith th eir hydrophilic groups pointing out and the hydrophobic lipid portions pointing into the m em brane. lip o p ro tein a lipid (fat) and a pro tein a ttach ed together by a covalent bond; often found in cell m em branes. lip osom e carrier a sm all vesicle m ade of lipid bilayers, such as a cell m em brane th at can carry nucleic acids or other m olecules into cells. lon g ch ain s am ino acids linked together in proteins (polypeptide chains); in nucleic acids, m ade of nucleotides linked together. lysis breaking cell m em branes open; done natu rally to release viruses a fte r they have rep ro d u c e d them selves w ith in the cells. ly so g en ic pathw ay after a bacteriophage infects a bacterium , the DNA from the virus is inserted into the b acterial ch ro m osom e and rem ains there until a lysogenic event occurs (often stim u latio n w ith ultraviolet light), at w hich tim e the viral DNA begins to m ake new viruses. lytic pathw ay after a bacteriophage infects a bacterium , the viral DNA is im m ediately used to m ake new viruses, w hich are released upon lysis of the cell m em brane. M m a cro m o lecu le a large m olecule com posed of m any sm aller m olecules and com pounds. m arker a substance used to see proteins or nucleic acids, as a stain or radioactivity on a gel. A m arker is also a p o rtion of DNA th a t can be identified for its function or nonfunction. Antibiotic resistance is a marker. m in ichrom osom e an o th er term for a plasmid. m issen se m utation any m utation producing a m isreading of a codon. m itochondrion the part of a cell th at transform s energy for the cell; the pow erhouse. m olecu le a substance containing two or m ore atom s.

240

Glossary

mRNA m essenger RNA; the RNA th a t carries the genetic m essage to the ribosom e. m u ltilocu s analysis typing DNA using probes to several alleles or VNTR or STR regions. m utagen anything that causes a m utation to take place, such as ultraviolet light. m utan t a cell o r organism containing m u tatio n s in the DNA. The results of the m u ta tio n are often seen as som e sm all or large tra n sfo rm atio n of cell or organism stru c tu re or function. m utation the substitution, deletion, or insertion of a nucleotide in genom ic DNA. m yoblast precursor of skeletal m uscle cells. N n eg a tiv e co n tro l an ex p erim en tal co n tro l designed to show th a t the exp erim en t is not w orking w hen it should not work. negative strand the strand of DNA used as a tem plate to m ake a com plem entary (positive) stran d of RNA to be used as a message. n eutral m u tation m u tatio n th at causes no a p p a re n t effect on protein structure or activity. novelty legal term used in patent law suggesting th at the invention is new and different from any other invention. See also obviou sn ess and utility. nu cleic acids long chains of nucleotides coupled by phosphodiester bonds. There are two types, deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). n u clein the early nam e given to the m aterial extracted from the nuclei of cells. n u c le o so m e stru c tu re s in w hich ab o u t 200 base pairs of DNA are w rap p ed a ro u n d p ro te in s (histones). N ucleosom es o ccu r all along a stra n d of DNA giving it a b eaded structure. n u c le o tid e a m acrom olecule containing a sugar (either ribose or deoxyribose), a phosphate group, and a nitrogenous base (see fig. 1-12).

Glossary

241

n u cleu s a p o rtio n of a eukaryotic cell th at is p a rtitio n ed by a nu clear m em brane and contains the genetic inform ation (DNA) of the cell.

O o b v io u sn ess legal term used in p aten t law to identify new ideas. If the invention w ould be obvious to a person w orking in the field, the idea is not patentable. See also novelty and utility. OH group hydroxyl group, often attached to carbon and other atom s. This little group helps m olecules becom e soluble in water. operon the nam e of an entire regulated region of DNA, consisting of a regulator region, a control region, and the codes for the proteins to be m ade. organ elle literally a sm all organ; applied to sm all functional units w ithin cells, generally. organ ism a com plete, living body—eith er one-celled such as bacteria or m ulticelled such as plants and anim als. P pack agin g as applied in this book, the act of puttin g the necessary parts into a virus. See also packaging cell. pack agin g c e ll a cell line th at is able to provide the m issing pieces to allow viruses containing inserts to be packaged into functional units. p aten t a legal assignm ent of exclusive rights to m arket an invention to the inventor for a period of 20 years. PCR see polym erase chain reaction. p ep tid e bon d a special nam e given to the covalent bond betw een the am ino group (NH) of one am ino acid w ith the carbonyl group (C=0) of the adjacent am ino acid. Petri d ish flat glass dish about 3 inches in diam eter w ith short vertical sides; generally filled w ith about V4 inch of agar upon w hich bacteria are spread and grow. phage bacteriophage, a bacterial virus.

242

Glossary

phosp h od iester bond the bond containing phosphorous w hich occurs betw een the 3' carbon of one nucleotide and the 5' carbon of the adjacent nucleotide in a nucleic acid. phosphorylation the act of placing a phosphate (P 0 3) group on an o th er molecule. p ilu s an extension p ro tru d in g from a b acteriu m by w hich it couples w ith a n o th e r b acteria and transfers genetic inform ation. p lasm id a m inichrom osom e; a sm all piece of DNA, norm ally circular, w hich is com m only found in bacteria and contains sex factors, antibiotic resistance genes, and other m aterial. p lasm id tran sfer the act of tran sferrin g a plasm id from one organism to another. p lu rip oten t descriptive of cells th at are not differentiated and can use all of th eir genetic m aterial. Sam e as totipoten t. p oin t m u tation a m u tatio n th a t occurs at a single base p air w ithin the DNA. polyacrylam ide gel polym erized acrylam ide, a gelatin-like substance used in gel electrophoresis. polym erase ch ain reaction (PCR) process in w hich the am o u n t of DNA is am plified by m aking m ultiple copies of the two strands. polym erization m aking long chains of m olecules out of fu n d am ental building blocks. polym orphic variations th at occur at specific allelic regions in the DNA causing differences in restriction fragm ents. p o lyp ep tid e ch ain chain of am ino acids linked by peptide bonds, generally containing betw een about 20 and 100 am ino acids. positive control a regulatory action that activates transcription. positive strand in double-stranded DNA, the positive stran d is the one th at contains the genetic message. p recip itate the substance th at com es out of solution upon adding certain chem icals to the solution; can generally be seen in the light, m aking the solution cloudy.

Glossary

243

prim ary structure the initial sequence of am ino acids or nucleotides in the polypeptide chain o r nucleic acid, respectively. prim er a sh o rt piece of DNA (or RNA) th a t is used by DNA or RNA polym erase to begin the process of replication or tra n scription or reverse transcription. probe a general term referring to anything th a t can bind a specific region of nucleic acid o r protein; generally a short piece of DNA com plem entary to a region of DNA or RNA. prokaryotes cells th at do not contain nuclei. p rom oter a region of the DNA th at binds RNA polym erase to initiate transcription. p ro n u cleu s the unfertilized nucleus in an egg cell or a sperm cell. Upon fertilization, two pronuclei m ay exist for a short period of tim e in the egg cell—one from the egg and one from the sperm . p rotein one or m ore polypeptide stran d s folded in a specific m anner to allow biological function. proton a positively charged particle w ithin the nucleus of an atom . p rotop last a plant cell from w hich the cell wall has been rem oved. R reco g n itio n site a site in the DNA containing a specific sequence of bases th at are recognized by a certain restric tion endonuclease. recom b in ation the process by w hich a different doublestran d ed segm ent of DNA com bines w ith the original chrom osom al DNA, inserting the new DNA into the chrom osom e. regu lation a general term dealing w ith the control of DNA tra n sc rip tio n and the resu lta n t expression of proteins through translation. regu lator region s regions of DNA th a t are used to control the activity of transcription and o th er control functions. rep lica p latin g m aking an exact duplicate of the colonies on a Petri dish by using a piece of sterile felt (or an o th e r sim ilar

244

Glossary device) to transfer portions of all the colonies from one dish to another.

r e p lic a tio n the process of m aking new DNA from p a re n t DNA. r e p r esso r a p ro te in th a t is used to tu rn off the tra n s c rip tio n process by b in d in g to the co n tro l reg io n of DNA, th ereb y n o t allow ing the RNA p o lym erase to in itia te tra n sc rip tio n . restriction e n d o n u cle a se an enzym e th a t binds to a specific region of DNA m olecules and cleaves (splits) them at a specific site w ithin or adjacent to the specific binding region; often called a restriction enzyme . restriction fragm ent the pieces of DNA th at result w hen DNA is cleaved w ith a restriction endonuclease. restriction fragm ent len g th polym orp h ism (RFLP) length variations in DNA fragm ents th at result from restrictio n enzym e cleavage of specific allelic regions in the DNA from different individuals w ith allelic variations. RFLPs are visualized on an acrylam ide gel and show DNA fragm ent length variations betw een individuals. restrictiv e en v iro n m en t a c h a m b e r or room designed specifically to re stric t the e n tra n ce or exit of any new m aterial. S uch a facility is used to w ork w ith highly toxic chem icals or viruses, such as HIV, w hich are extrem ely hazardous. retrovirus the general nam e for viruses th at co n tain RNA as their genome. reverse tran scrip tase an enzym e th a t m akes DNA from an RNA tem plate. reversion a m utatio n al event th at eith er reverses the original m u tatio n or com pensates for it at a n o th e r location in the genome. ribose a five-carbon sugar th at is used to m ake nucleic acids. ribosom al RNA (rRNA) the RNA found in ribosom es. RNA ribonucleic acid, a long chain of ribonucleotides covalently bound together. See also m essen g er RNA (mRNA), transfer RNA (tRNA), and ribosom al RNA (rRNA).

Glossary

245

S sa n d w ic h a ssa y a nam e ap p lied to an assay th a t uses a DNA p ro b e to ta rg e t a DNA sequence in an u n k n o w n piece of DNA, afte r w hich a labeled (w ith a fluorescent or rad ioactive label) p ro b e is b o u n d to a n o th e r region of the original DNA probe. screen in g a technique used to determ ine w h eth er a certain DNA sequence is present or not. See also colon y screening. secon d ary structure the helical tw isting or bending and turning of the chain of am ino acids or nucleotides. short tan d em rep eat (STR) sh o rt sequences (generally 3 to 7 nucleotides in length) th at are repeated m ultiple tim es adjacent to each other, flanked by uniform regions of DNA. sick le cell crescent-shaped red blood cells th a t contain m utant (sickle cell) hem oglobin. sick le cell anem ia the disease caused by the presence of sickle cell hem oglobin in the red blood cells. sid e ch ain the term applied to the different functional groups occurring on the alpha carbon of am ino acids. sile n t m u tation m u tatio n in the gene th at does not alter the function of the resultant protein. sin g le lo cu s an alysis typing DNA using a probe to a single allele or a single VNTR or STR region. so m a tic c e lls all the cells of the organism except the germ (sperm and egg) cells. S o u th e r n b lo t the tec h n iq u e developed by Dr. S o u th e rn in w hich DNA frag m en ts in ag aro se gels are tra n s fe rre d to n itro c ellu lo se p a p e r by p ulling them o u t of the gel using ab so rb e n t, b lo ttin g m ate ria l to wick the so lu tio n th ro u g h the gel. start cod on the first th ree-letter code in the string of codons th at code for a protein; ordinarily AUG. stem cell the pluripotent cell from which all other cells are made. sticky end an overlapping end on a strand of DNA com plem entary to the overlapping end on the o th er stran d of DNA; found w ith restriction fragm ents.

246

Glossary

sto p co d o n the codon th a t signals the term in atio n of tra n s la tion of a peptide chain; generally UAA, UAG, or UGA. syn th esize the act of m aking new products, eith er biologically or chemically. T Taq p olym erase a DNA polym erase (an enzym e th a t m akes DNA) derived from Thermus aquaticus , an organism th a t grow s in high tem p eratu re su rro u n d in g s (found in Yellowstone Park). This enzyme is used for the PCR process. tem p la te the stra n d of DNA or RNA used as a p a tte rn by DNA or RNA polym erase from w hich to m ake a com plem entary copy. tertiary structure the result of the folding of helical tu rn s or other turns of polypeptide chains into a function protein. th ym id in e k in ase an enzym e th at adds a p h o sp h ate group to thym idine, w hich is necessary for the m anufacture of DNA. H plasm id the tum or-inducing plasm id found in Agrobacterium tumefaciens, w hich can be inserted into plant cells. tissu e cu ltu re the process in w hich various eukaryotic cell lines are grow n outside the whole organism , m uch as bacteria are grown. to tip o ten t descriptive of cells th at are not differentiated and can use all of their genetic m aterial. Sam e as pluripotent. tran sd u ction tra n sfe r of a bacterial gene from one b acteriu m to an o th er by m eans of a bacteriophage. transcription m aking RNA, using RNA polym erase, using DNA as a tem plate. tran scrip tion al con trol the regulation of tra n sc rip tio n by various m eans to lim it or enhance the am o u n t of proteins produced. tran sfection the addition of new genetic m aterial to eukaryotic cells. Sam e as transform ation of bacterial cells. transform ation the addition of new genetic m aterial to b acterial cells. Sam e as tran sfection in eukaryotic cells. tran sgen ic an im al anim al containing new genetic m aterial in its germ cells.

Glossary

247

tran slation the process in w hich polypeptide chains are m ade according the coded in fo rm atio n in the m essenger RNA (mRNA). tRNA tra n sfe r RNA; a sm all RNA m olecule th a t carries an am ino acid to the ribosom e and places it in the p ro p er position in the polypeptide chain th at is being form ed. tum or-infiltrating lym p h ocyte (TIL) a cell line th a t has been genetically modified, w hich seeks out tu m o r cells. U ultraviolet (UV) light light having a wavelength sh o rter th an is visible, w hich can cause dam age to DNA. utility one of the legal term s used in paten t law suggesting th at the invention has a use th a t is new or different from any other invention. See also novelty and obviousness. V variable n um ber tan d em rep eat (VNTR) sequence of DNA th a t is repeated m ultiple tim es adjacent to each other, having identical flanking sequences in all hum ans. However, the n um ber of repeats varies, depending on the individual. vector a plasm id or a phage th a t is used to carry new genetic m aterial into a cell. viral p laque a region on a bacterial law n in w hich the bacteria have been lysed owing to the presence of phage. virus a vector th a t generally contains a p ro tein coat w ith a nucleic acid genom e inside. See also bacteriophage. W w ells the regions in an acrylam ide gels into w hich the sam ple is placed before electrophoresis begins. Z zygote a fertilized egg.

A p p e n d ix T h e a m in o a c id s Name

248

Abbreviation 3 letters, 1 letter

Alanine

Ala

A

Arginine

Arg

R

Asparagine

Asn

N

Aspartic acid

Asp

D

Cysteine

Cys

C

Appendix Name

249 Abbreviation 3 letters, 1 letter

Glutamine

Gin

Glutamic acid

Glu

E

Gly

G

Glycine

Q

Histidine

His

H

Isoleucine

lie

I

250

Appendix Name

Abbreviation 3 letters, 1 letter

Leucine

Leu

L

Lysine

Lys

K

Methionine

Met

M

Phenylalanine

Phe

F

Proline

Pro

P

Structure

Appendix Name

251 Abbreviation 3 letters, 1 letter

Serine

Ser

S

Threonine

Thr

T

Tryptophan

Trp

W

Tyrosine

Tyr

Y

Valine

Val

V

INDEX

A Abortion, m andated, 227 Acrylamide, 89 Acrylamide gel, polym erized, 89-92 Adenine base in DNA, 15-16, 39-40 Adenosine deam inase (ADA), 198 Adenosine deam inase (ADA) gene, 198-199 Adenoviral vector, 198 Adenoviruses, 198 A grobacterium tum efaciens and insertion of DNA, 164-167, 169, 171 Alleles, 205 Alpha helix structure of proteins, 22, 24, 27 in collagen, 30 Amino acids, 20-21, 36, 248-251 attached to tRNA, 52-53, 63-66 m utation of, 75-77 sequence of, 26, 59-60

side chain, 33 specification by codons, 60-61 substitution of, 79-80 A m inopterin blocking DNA synthesis, 142 Am niocentesis, 188 Ampicillin, resistance to, 107, 110-111, 113 Animal breeding, 229-230 and cloning, 174, 176 Animals genetically engineered, 229 and production of hum an proteins, 182-183 Annealing DNA, 100 Antibiotic resistance, 123, 166 transfer of, 85-87 Antibiotic resistant gene, 164, 166 Antibiotic resistant plasm id, 107-108 Antibiotics and rRNA, 53 Anticodon, 63-64 Antifrost devices, 171 253

254 Antisense gene insertion, 168-170 Apr (am picillin-resistant) region of plasm id, 107-109 Arom atic am ino acids, 21 Aspartoacylase, 199 Atoms, 8 Avery, Oswald, 37-38 Avian leukosis virus (ALV), 182 B /3-galactosidase, 70-71 B acteria, 7-8, 82-84 attach m en t by virus, 124-128 genetically engineered, 103-123, 171 and infection of plants, 172 and inserting DNA, 87-89 and inserting the plasm id, 108-110, 113 lysogenic, 128 and m anipulation of genetic m aterial, 84-87 and obtaining plasm ids, 94-97 and protein production, 117,119-122 replica plating of, 110-112 screening, 133-134 screening for engineered plasm id, 111-113 Bacterial colony, screening of, 114-117 Bacterial viruses, 124-126 Bacteriophage, 124-125 lysogenic pathw ay of, 127-129, 135 lytic pathw ay of, 126-127 Base deletion, 77-79 Base insertion, 77-79

Index Base pairing in DNA, 40-41, 63 Base substitution, 73-77 Bases, 15 Beta sheet regions of proteins, 24, 26-27 Biolistic process of DNA insertion, 168-169 Biotechnology, com m ercial application of, 219-230 Biotechnology com panies, 229 Blastocyst, 177-180, 184 form ation of, 174-175 Blastom eres, 174-175, 184 Blood cells, m anipulation of, 192-194 Blunt ends of DNA, 96, 98 Bonds, 10 covalent, 11 hydrogen, 12-13 ionic, 14 Bovine leukem ia virus (BLV), 182 Bovine som atotropin (BST), 182 BRCA1 gene, 189, 204 BRCA2 gene, 189, 204 B reast cancer susceptibility, 180-181, 189, 204 B reast cancer susceptibility genes, 189 Brom e m osaic virus, 167 B rom odeoxyuridine, 142-143 C Calcium phosphate and DNA insertion, 142, 146 and transfection, 140 Calcium sulfate for plasm id insertion, 108 Callus, 162-163, 165

Index C anavans disease, 199 C ancer and regulation of cells, 73 treatm en t of, 200 Catalysts, 28, 33 Cattle producing hum an lactoferrin, 183 Cauliflower m osaic virus, 167 cDNA, 39-40, 44-45, 152-154, 168, 170 patentability of, 221 screening, 114, 116 cDNA libraries, 152-154, 157, 163 Cell m arkers, 32 Cell-targeting approach, 195-196, 201-202 Cell wall heavy, 172 thickness of, 159, 161 Cells, 18 characteristics of, 4-6 differentiation, 174 Cellulase, 162-163 C entral Dogma, 59 Centrifuge, 94-95 Cereal plants and DNA insertion, 167 Chargaff, Erw in, 37 Chim eric anim als, 184 Chim eric DNA, 100-101, 130-131, 144 Chim eric m ouse, 179-180 Chorionic villi sam pling, 188 Chrom osom es, 35, 83-84 bacterial, 135 crossing over of, 205-206 and insertion of viral DNA, 127-129 sequencing of, 203-205 Cloning anim als, 174-176 bacteria, 117, 119-122

255 Codons, 60-61, 76 com plem entary w ith a n ticodon region, 63-66 Colds and viruses, 134 Collagen, 28-30 Colony screening technique, 114-117, 123 Comb in electrophoresis, 89-90 Com petent cells, 87 C om plem entary DNA. See cDNA Com pound, definition of, 9 Conjugation, 84-86 Construct, 146-147, 177, 179 Control regions, 69 of operon, 71-72 Cos sites, 132 Cosm id approach to DNA insertion, 132-133 Covalent bonds, 11 Crick, Francis, 39 Crippled virus approach, 150-151, 194-196 Crown gall tum ors, 164-165 Cystic fibrosis, 77, 194 discovery of gene, 200-201 gene transfer, 198 Cytosine base in DNA, 15-16, 37, 39-40 D D ecom position of m olecules, 4 D eoxyribonucleotides, 15, 17, 39 Deoxyribose, 47-48 structure of, 15 Diagnostics using hybridization assay, 186-197 Dideoxyadenosine triphosphate (ddATP), 104

256

Dideoxynucleoside triphosphate (ddNTP), 104-106 Dipeptide form ation, 65 Dipstick assays, 189, 191, 201 Disease resistant anim als, 182 Disease resistant genes, 171 Disulfide bonds, 25 in hair, 22, 24 DNA, 18, 34, 55 annealing, 100 in blood cells, 193 chim eric, 100-101 chrom osom al, 94-95 in the chrom osom e, 83-84 cleavage of, 94-98 history of, 35-37 insertion by retroviruses, 148-151 insertion in anim als, 177 insertion in plants, 164-169 insertion in plasm ids, 98-102 isolation and analysis of, 188-189 m utations in, 73-80 negative regulation of, 69-71 and plasm id insertion, 94-95, 107-109, 120-121, 123 probe, 114-117, 154, 189, 191 profiling, 205 and protein form ation, 7 and protoplast culture, 163 regulatory region of, 68-72 replication, 42-47

Index and ribose units, 15 screening in bacterial colonies, 114-117, 123,196-197 sequencing, 104-107 structure of, 37-42 synthesis, 104-107 tem plate for RNA, 47-48 and transfection, 140-141 transfer into bacteria, 84-87 transform ation of, 87-89 viral, 126-129 and viral vectors, 146, 148, 150 visualization of, 91-94 DNA construct, 151 DNA fingerprints, 211,218 DNA inserts, 142, 144-146 in em bryonic stem cells, 177-178 and tyrosine kinase marker, 156-157 DNA polym erases, 44-45, 104, 215-216 DNA prim ers, 215-217 DNA probe, 114-117, 154, 189, 191 Dolly, the cloned sheep, 176 Double helix structure of DNA, 40-41, 45-46 E Ebola virus, 134 EcoRl, 96, 98-99 Egg fertilization of, 7, 173-174, 184 genetic m anipulation of, 189-192, 226 Electrons, 8-9 and charges, 14 Electrophoresis, 102, 104, 106-107, 118

Index to separate DNA, 89-92, 98-99 E lectroporation, 108, 110, 144-145, 151, 177, 179, 184 and transfection, 141 Elem ents of the earth, 4-5 Em bryo transfers, 173-184 Em bryonic stem cells, 177-178 Energy transform ation, 4 Enzym es, 28. See also R estriction enzymes and decom position, 4 Ethics, 224-225 Eugenics, 224, 226-227 Eukaryotes, 50, 83 and gene expression, 140 F Fam ilial relationship identification, 207-208 Farm anim als, transgenic, 182 Fats, tran sp o rt of, 32 Flanking regions, 208-209 Flavr-Savr™, 158 Flush ends of DNA, 96, 98 Forensic profiling, 212-215, 218 Fram e-shift m utation, 75, 79 Frogs' eggs and cloning, 175 G G am m a rays and DNA dam age, 74 Gem ini virus, 167 Gene expression, 119, 132 Gene libraries, 119-123 Gene m anipulation of cells in the body, 194-196, 202 outside the body, 192-194, 202 Gene marker, 141-142

257 Gene therapy, 197-200 applications for, 198-199, 203-218 ethics of, 224-225 with stem cells, 192-194 and targeting cells, 194-199 Genes, 61, 84 in m am m alian cells, 139-157 Genetic code, 60 Genetic disorders, 75-78 diagnosis of, 187-189, 228 and genetic engineering, 225-226 and restriction fragm ent length polym orphism s (RFLP), 212, 214, 218 treatm ent of, 189-192, 201 Genetic engineering of anim als, 176-183 of bacteria, 107-110 com m ercial applications of, 219-230 future of, 228-229 of insecticides, 183 of m ouse, 177-181 tools of, 87-94 Genetic inform ation, storage of, 44, 47 Genetic linkage, 205-206 Genetic m aterial, m anipulation of, 102 Genetic screening, 189, 227-228 Genetics, laws of, 35-36 Genome, 77, 84 sequencing of, 204 Germ cells, 173 genetic m anipulation of, 189-192, 226 m utation of, 74

Index

258

G lutam ic acid in sickle cell anem ia, 76-77 Glycoproteins, 32-33 G lyphosphate resistance in plants, 171 Goat, transgenic, 183 G uanine base in DNA, 15-16, 37, 39-40 G uidelines on reco m b in an t DNA research, 222-223 H H air and helical structure of proteins, 22, 24 H antavirus, 215 HAT m edium , 142-146 Heavy m etal insertion of DNA, 168-169 Helical structure of DNA, 4 0 -4 1 ,4 5 -4 6 of proteins, 22 Hem oglobin, 31-32, 75-77 H em oglobinopathies, 78 High copy n um ber plasm id, 119 HIV, 134 HIV vector, 195 Host and viruses, 124-125 Hpa I, 96-98 H um an cloning, 176 H um an genom e project, 225-226 H um an im m unodeficiency virus (HIV), 134, 150 H um ans, genetic engineering of, 224-225 H ybridization of DNA, 114-115 H ybridization sandw ich assay, 189, 191 H ydrogen bonds, 12-13 in DNA, 40, 114

in the polypeptide chain,

22

in proteins, 24 H ydrophobic interactions, 14 of the polypeptide chain, 22 I Ice, 9, 12-13 In vitro fertilization, 174 Inborn errors of m etabolism , 78 Inducer, 69-70 Inducing function, 128-129 Influenza, 134 Insecticides and genetic engineering, 183 Inserts of DNA, 100-102, 148-151, 164-169, 177 screening of, 141-146 Insulin, 155 gene, 120 genetically engineered, 119-120 as a signal protein, 32 Insurance com panies and genetic screening, 227 Interferons, hum an, 155-156 Introns, 50, 61-62, 152 Ionic bonds, 14 Ions, 14 K Kanam ycin, 166 Knock-out mice, 228 Knock-out strain of anim als, 181 L Lac operon, 70-71 Lactoferrin, hum an, 183 Lactose and regulation of transcription, 70-71

Index

lacZ region, 177, 179 Lam bda phage, 130 Leaf disks, 164-167 Life, definition of, 3-4 Ligase, 100-102 Ligating, 142 Lipoproteins, 32-33 Liposom e carrier, 195 Living organism s, characteristics of, 4 Lock-key fit analog of enzymes, 28-29 Lysogenic pathw ay of bacteriophage, 127-129, 135, 148 Lytic pathw ay of bacteriophage, 126-127, 146 M M acLeod, Colin, 37-38 M acrom olecules, 14-17 M am m alian cells and gene expression, 139-157 M arkers of plasm id, 111 McCarty, M aclyn, 37-38 Medfly, transgenic, 183 Mendel, Gregor, 35-36, 205 M essenger RNA. See mRNA M ethionine, 63-64 Mice, transgenic, 177-181 M icroinjection ofDNA, 168, 177-178 Miescher, Johann Friedrich, 35 Milk production, improved, 182 M inichrom osom es, 84 M issense m utation, 74-75 M itochondria, 6 Molecule, definition of, 9 M onoclonal antibodies, 230 M osquitoes, transgenic, 183

259

mRNA, 50-51, 55, 80, 152-154 attachm ent of tRNA, 63-66 attachm ent to ribosom e, 61-63 negative regulation of, 69-71 regulation by RNA polym erase, 71-72 regulation of, 68-69, 72-73 M ultilocus analysis, 210 M urine leukem ia virus (MLV), 150 M utagens, 74 M utants, 73 M utations of DNA, 73-81 M yoblasts, m anipulation of, 194 N Negative stran d of DNA, 50 Neom ycin resistant gene, 177, 179 N eutral m utations, 79-80 Nicholas II and DNA profiling, 211 Nitrocellulose paper, 115-117 screening for viral inserts, 133-134 N itrogen fixation, 230 N onsense m utation, 74-75 N uclear im plantation, 184 Nuclei transfer, 175-176 Nucleic acid genome, 124-125 Nucleic acids, 15-16 com plem entarity, 114 Nuclein, 35 Nucleoside triphosphates, 104-106 Nucleosom es, 46

260

Index

Nucleotides, 15-17, 34 sequence of, 42-44 substitution of, 76-77 Nucleus, 6, 8-9

O Oligo-T colum n, 152-153 Oncom ouse, 180-181 Operon, 68-71 O rgan-targeting approach, 194-195 Organelles, 6 O rganism s m ulticelled, 6-7 single-celled, 7-8 Oxygen, tran sp o rt of, 31-32 P Packaging cells, 148, 150-151 Packaging of nucleus of DNA, 46 Pancreas DNA, 120-121 Patentability, 220-221 Patents, genetic engineering,

220-221

Paternity testing, 212-213 Pathogens, identification by RFLP, 214-215 Peptide bonds, 21-22, 80 form ation of, 64-66 in proteins, 25 Periodic table of elem ents, 5 Phage, 124 reconstitution approach to DNA insertion, 128, 130-132 and screening for viral inserts, 133-134 Phage DNA, 127-130 and rebuilding the virus, 130-131 Pharm anim als, 182-183, 228

Pharm aceutical products, genetically engineered, 122 Phosphate group in DNA, 41-42 Phosphodiester bonds, 42 breakage of, 94 form ation of, 100-101 Phosphorus, radioactive, 91, 93 Phosphorylation, 141 Pigs, transgenic, 182-183 Pilus, 84 Plants cross breeding of, 159 genetic engineering of, 158-172, 229 Plasm ids, 84, 126 and cDNA strands, 153 chim eric, 120 and DNA transfer into A grobacterium tum efaciens, 164-165 and electrophoresis, 92 insertion into bacteria, 108-110, 113 insertion of DNA, 98-102, 107-108, 120-121, 123,147 m arkers, 111 obtaining from bacteria, 94-97 transfer of, 85-89 and viral DNA, 132-135 Point m utations, 73-79 Poly A tail, 50 Polyethylene glycol-ADA (PEG-ADA), 198-199 Polygalacturonase, 168, 170 Polym erase chain reaction, 215-217 Polym orphic regions, 208-209

Index Polypeptide chain, 21-22, 33, 64-66, 80 release of, 67-68 Positive strand of RNA, 50 P rem ature aging, 204-205 Procollagen, 30 Prokaryotes, 82 P rom oter region, 132, 146-147, 157 Pronuclei, 174-175 Proteins, 19 biosynthesis of, 6-7, 60, 63-66, 80-81 folding, 66, 68 functions of, 26, 28-33 and genetic inform ation, 36-37 genetically engineered, 154-156 from genetically engineered bacteria, 117, 119 prim ary structure of, 21-23 production of, 6-7, 60 regulation of, 68-73 and ribosom al RNA, 53 secondary structure of, 22-25 signal, 32 structural, 28-29 tertiary structure of, 23, 25, 27 transport, 31-32 Protons, 8 Protoplasts, 172 preparation of, 162-163 Pst I, 107-109 Purines, 16 Pyrim idines, 16 R Radioactive technique to visualize DNA, 91-93 R ecognition sites, 96

261 R ecom binant DNA Advisory Com m ittee (RAC), 223-224 Replica plating of bacteria, 110-112 Replication, 42-47, 55 R epressor protein, 69-70 activation of, 71-72 R eproduction, 4 R estriction endonucleases, 92,94-99, 102, 130, 189, 207 R estriction enzymes, 85, 94-101, 118, 121. See also Enzym es R estriction fragm ent length polym orphism s (RFLP), 205-208 analysis of, 208-215 R estriction fragm ents, 205, 207-208, 218 Restrictive environm ent laboratory, 223 Retroviral vector, 197-198, 200 Retroviruses for DNA delivery, 148-151 Reverse transcriptase, 149, 152,154 Reversion of nucleotide, 79 Ribonucleases, 47 Ribonucleic acid. See RNA Ribonucleotides, 16-17 Ribose, 47-48 structure of, 15 Ribosom al RNA (rRNA), 53-55 Ribosom es, 6, 53-54, 80 attachm ent of mRNA, 61-63 attachm ent of tRNA, 63-66 and translation, 72-73 RNA, 47-50, 55 and ribose units, 15

262 RNA polym erase, 48-49, 69-71, 149, 167 and positive control, 71-72 RNA viruses, 167 S 30S subunit of rRNA, 54 50S subunit of rRNA, 54 Sandw ich assay, 189, 191 Sequencing DNA, 104-107 Severe com bined im m unodeficiency disease (SCID), 198 Sheep, transgenic, 176, 182 Sheep epiderm al grow th factor, 182 Short tandem repeat (STR) regions, 217-218 Sickle cell anem ia, 75-77 Side chains of am ino acids, 20-21 Signal proteins, 32-33 Single-locus pattern, 210 Snails, transgenic, 183 Som atic cells, m anipulation of, 192-196 Southern blotting of DNA fragm ents, 117-118, 145, 189-190 Sperm , genetic m anipulation of, 189-192,226 Staining in electrophoresis, 91-92 S tart codon, 61-62 Stem cells, 201 m anipulation of, 192-194 Sticky ends of DNA, 96-97 Stop codons, 61-62, 66-67 S tructural proteins, 28-30 Structure of living organism s, 4 Sugar m olecules, 14-15 Suicide gene, 181 SV40 virus, 146-148

Index T

Taq polym erase, 215-216, 229 Tcr (tetracycline-resistant) region of plasm id, 107-108 Technology transfer, 220-221 Tem plate of DNA, 44-45 Tensile strength of collagen, 28-29 Tetracycline, resistance to, 107, 110 Theory of inheritance, 35 Thym idine-deficient cells, 141-142 Thym idine kinase gene, 141- 142 Thym idine kinase marker, 142- 146 Thym idine triphosphate (dTTP), 141-142 Thym ine base in DNA, 15-16, 37,3 9 -4 0 Ti plasm id, 164, 166 Tissue culture, 139 of plants, 159-160 Tissue plasm inogen activator (TPA), 140, 155, 183 tk- cells, 141-145 tk gene, 147, 156 as a marker, 142 Tobacco m osaic virus, 167 Tom ato golden m osaic virus, 167 Tomatoes, softening of, 168, 170 Totipotent cells, 159, 177 Totipotent egg, 174 Transcription, 55 and m utations, 77 negative regulation of, 69-71 positive control of, 71-72 preventing, 168, 170 regulation of, 80-81

Index of RNA, 47-50 T ranscriptional control, 69-71 T ransduction of bacteria, 128 Transfection, 140-142 of m am m alian line, 177-180 Transfer RNA. See tRNA T ransform ation of DNA, 87-89, 102 Transgenic anim als, 184, 228 use of, 181-183 Transgenic mice, 175, 177-181 Translation of DNA code, 60-68 regulation of, 72 term ination of, 66-67 Transport proteins, 31-32 tRNA, 52-53, 55, 80 attach m en t to mRNA, 63-64 displacem ent of, 64-65 tRNA am ino acid complex, 65-66 Tropocollagen, 30 Trp operon, 71-72 Tryptophan, production of, 71-72 Tum or-infiltrating lym phocytes (TIL), 200 Tum or necrosis factor (TNF),

200

Tum or production, 164-165 Tyrosine kinase marker, 156-157 U Ultraviolet light and DNA dam age, 74 Universities and partnership w ith industry, 221-222 Uracil, 15-16, 47-48 and m u tan t proteins, 73-74

263

V Valine in sickle cell anem ia, 76-77 Variable nu m b er tandem repeat (VNTR) regions, 209-212, 217 Vectors in clinical trials, 197-198 DNA, 133 gene, 194-196 Viral coat proteins, 130 Viral DNA, insertion of, 128, 130-133 Viral genom e, 146, 148-151 Viral ghosts, 130-131 Viral inserts, screening for, 133-134 Viral plaques, 133-134 Viral RNAs, 55, 148-151 Viral vectors, 146-151, 157, 194, 197-198 Viruses, 55, 124-135 and DNA insertion in plant cells, 167 and plant cells, 172 W W ater and hydrogen bonds, 12-13 properties of, 9-10 W atson, Jam es, 39 Wells in electrophoresis, 89-90 W erners syndrom e, 204-205 X X-gal, 177, 179 X-rays and DNA dam age, 74 Z Zygote, 174-175

ABOUT THE AUTHOR

W alter E. Hill received his underg rad u ate education at Pom ona College and B righam Young University, grad u atin g from the latte r in 1961 w ith a B.S. Degree in Physics. G raduate w ork at the University of W isconsin centered on the physical structure of ribosom es, the p rotein factories of all cells. G raduating from W isconsin in 1967 with a Ph.D. in Biophysics, Dr. Hill continued his studies as an NIH Post-D octoral Associate u n d e r the d irection of Dr. K ensal Van Holde, at O regon State University, using the techniques of physical biochem istry of fu rth e r study rib o som e stru ctu re. As an A ssistant Professor at the U niversity of M ontana, Dr. Hill was aw arded an NIH Career Development Award to continue his studies of ribosom e stru c tu re and function. These studies have been continued w ith su p p o rt from the N ational Science F o u ndation and the N ational In stitu tes of H ealth over the last thirty years. D uring this period Dr. Hill has received num erous aw ards, including the Distinguished Scholar Award from the U niversity of M ontana, the Burlington Norther Distinguished Researcher Award and the Montana Academy o f Sciences Mershon Award for D istinguished Research. During this period he has served on m any review panels and study sections, reviewed num erous m anuscripts and grants, and published over 50 scholarly articles in scientific jo urnals, w ritten nine book chapters and edited two books on ribosom es. 264