Fundamentals Of Ecology, 3Rd Edn 0070083665, 9780070083660

Table of contents :
Cover
Half Title
The Authors
Title Page
Copyright
Dedication
Contents
Preface to the Third Edition
Preface to the First Edition
List of Symbols
1. Organism and Environmental Complex
1.1 Concept of Stress and Strain
1.2 Adaptation and Concept of Limiting Factor
1.3 Concept of Habitat and Niche
1.4 Scope of Ecology
1.5 Application-Based Study
Multiple Choice Questions
Short and Descriptive Questions
2. Systems Concept in Ecology
2.1 Systems Concept
2.2 Integrative Approach
2.3 Ecosystem
2.4 Functional Attributes of an Ecosystem
2.5 Primary and Secondary Production
2.6 Food Chain and Trophic Levels
2.7 Energy Flow in Ecosystems
2.8 Material Cycling
2.9 Homeostasis and Feedback
2.10 Development and Evolution of Ecosystems
2.11 Concept of Model and Ecosystem Modelling
Multiple Choice Questions
Short and Descriptive Questions
3. Ecosystems of the World and Distribution of Flora and Fauna
3.1 Terrestrial Ecosystems
3.2 Aquatic Ecosystems
3.3 Principles of Plant Geography and Animal Distribution
3.4 Floristic and Zoogeographical Realms
3.5 Principles of Dynamic Phytogeography
Multiple Choice Questions
Short and Descriptive Questions
4. Environment in Action
4.1 Concept
4.2 Climatic Factors
4.3 Topographic Factors
4.4 Edaphic Factors (The Soil)
4.5 Biotic Factors
4.6 Co-Evolution
4.7 Biological Clock
Multiple Choice Questions
Short and Descriptive Questions
5. Community Ecology
5.1 Concept of Community and Basic Terms
5.2 Community Structure, Composition and Stratifi cation
5.3 Community Function
Multiple Choice Questions
Short and Descriptive Questions
6. Population Ecology
6.1 Concept of Population and Population Attributes
6.2 Biotic Potential and Natality
6.3 Mortality, Survivorship Curves, Life Table, Age Structure
6.4 Concept of Carrying Capacity and Environmental Resistance
6.5 Population Growth Forms
6.6 Life History Strategy
6.7 Population Fluctuations
6.8 Population Interactions
6.9 Concept of Density-Dependent and Density-Independent Actionin Population Control
6.10 Human Population Growth
Multiple Choice Questions
Short and Descriptive Questions
7. Natural Resource Ecology
7.1 Concept and Classifi cation of Resource
7.2 Non-Renewable Resources
7.3 Renewable Resources
7.4 Conservation and Resource Management
Multiple Choice Questions
Short and Descriptive Questions
8. Pollution Ecology
8.1 Concept of Pollution
8.2 Air Pollution: Concept
8.3 Water Pollution
8.4 Solid Waste Pollution
8.5 Hazardous Waste and Toxic Chemicals
8.6 Soil Polution
8.7 Drug Abuse
8.8 Noise Pollution
8.9 Indoor Pollution
8.10 Pollution Due to Radiation
8.11 Bioindicators
8.12 Industrial Accidents
8.13 Provisions in the Indian Constitution and Environmental Laws
8.14 Environmental Laws in India and International Conventions
8.15 Environmental Management
Multiple Choice Questions
Fill in the Blanks
Short and Descriptive Questions
9. Environmental Toxicology
9.1 Toxic Chemicals and Defi nition of Toxicology
9.2 Toxic Chemicals
9.3 Factors Affecting Toxicity
9.4 Routes and Rate of Administration
9.5 Environmental Factors/Behavioural Factors
9.6 Effect and Response
9.7 Synergism and Antagonism
9.8 Basic Principles of Dose Response
9.9 Statistical Concept of Toxicity
9.10 Translocation of Toxicants
9.11 Mechanism of Toxicant Action
9.12 Biotransformation of Toxicants
9.13 Bio-accumulation of Pollutants/Xenobiotics
9.14 Antidotes
9.15 Toxicity Tests
9.16 Some Case Studies
Multiple Choice Questions
Short and Descriptive Questions
10. Molecular Ecology
10.1 Introduction:What is Molecular Ecology?
10.2 Systematics and Phylogenetics: Molecular Phylogeny
10.3 Genetics in Ecology: Genetic Markers
10.4 Advances And Dimensionsin Molecular Ecology
Multiple Choice Questions
Short and Descriptive Questions
11. Ecotechnology
11.1 Introduction
11.2 Environmental Biotechnology and Biotechnology Firms
11.3 Biotech Drugs
11.4 Traditional Knowledge and Traditional Medicine
11.5 Bioincubators: Biotechnology Firms
11.6 Bio-Safety
11.7 Ecotechnology for Eco Remediation
Multiple Choice Questions
12. Statistical Ecology
12.1 Introduction
12.2 Ecological Sampling
12.3 Sampling Distributions
12.4 The Binomial, Normal and Poisson Distributions
12.5 Species Richness
12.6 Niche Overlap Indices
Bibliography
Index

Citation preview

Fundamentals of Ecology Third Edition

The Authors Madhab Chandra Dash is presently Member, Environment Appellate Authority, Govt. of Orissa, and was earlier Vice Chancellor, Sambalpur University from 2001 to 2004. He was Chairman, Orissa State Pollution Control Board, Bhubaneswar from 1997 to 2001 and member of the Central Pollution Control Board, New Delhi. He did his postgraduation from Utkal University and obtained his PhD from Kananaskis Environmental Science Centre, and Department of Biological Sciences, University of Calgary, Canada. He has more than four decades of teaching and research experience. His areas of interest are Population Biology, Quantitative Ecology, Energetics of Soil Oligochaetes, Vermitechnology, Metamorphosis and Larval Energetics of Amphibia, Ecology and Conservation of Sea Turtles, Environmental Pollution, and Environmental Impact Assessment and Management. He is the recipient of Samanta Chandra Sekhar Award (1991) and Dr Pranakrushna Parija Samman (2006) for excellence in Life Sciences and Ecological Science Research and Life time contribution to Life Science Samman (2006) from Orissa Science Academy and Department of Science and Technology (DST) of Government of Orissa. Satya Prakash Dash did his BSc (Honours) and MSc in Life Science with fi rst class fi rst position from Sambalpur University on a National Scholarship, MSc in Molecular Genetics from University of Leicester, England on British Chevening Scholarship, and was awarded Amersham Pharmacia Biotech Prize for being the most outstanding student. He did MPhil from the University of Cambridge and PhD in Cell and Molecular Developmental Biology from University of East Anglia, England on International Scholarship. He was awarded the prestigious MBL, Woods Hole, and Massachusetts Scholarship for summer course on concepts and techniques in Modern Developmental Biology. He worked briefl y as a scientist in 2006 in the department of Cell and Molecular Biophysics of Kings College, London. His interests are in Stem Cell Research, Gene Cloning, Cell and Molecular Developmental Biology, Molecular Ecology, Bioethics, and Public Science and Technology Policy.

Fundamentals of Ecology Third Edition

Madhab Chandra Dash Member Environment Appellate Authority Govt. of Orissa

Satya Prakash Dash University of Cambridge, England

Tata McGraw Hill Education Private Limited NEW DELHI McGraw-Hill Offices New Delhi New York St Louis San Francisco Auckland Bogotá Caracas Kuala Lumpur Lisbon London Madrid Mexico City Milan Montreal San Juan Santiago Singapore Sydney Tokyo Toronto

Published by Tata McGraw-Hill Education Private Limited, 7 West Patel Nagar, New Delhi 110 008 Copyright © 2009, by Tata McGraw-Hill Education Private Limited No part of this publication may be reproduced or distributed in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise or stored in a database or retrieval system without the prior written permission of the publishers. The program listings (if any) may be entered, stored and executed in a computer system, but they may not be reproduced for publication. This edition can be exported from India only by the publishers, Tata McGraw-Hill Education Private Limited. ISBN (13): 978-0-07-008366-0 ISBN (10): 0-07-008366-5 Managing Director: Ajay Shukla General Manager: Publishing—SEM & Tech Ed: Vibha Mahajan Manager—Sponsoring: Shalini Jha Sr. Editorial Researcher: Smruti Snigdha Development Editor: Renu Upadhyay Jr. Executive—Editorial Services: Dipika Dey Jr. Manager: Production—Anjali Razdan General Manager: Marketing—Higher Education & School: Michael J Cruz Sr. Product Manager: SEM & Tech Ed.: Biju Ganesan General Manager—Production: Rajender P Ghansela Asst. General Manager—Production: B L Dogra Information contained in this work has been obtained by Tata McGraw-Hill, from sources believed to be reliable. However, neither Tata McGraw-Hill nor its authors guarantee the accuracy or completeness of any information published herein, and neither Tata McGraw-Hill nor its authors shall be responsible for any errors, omissions, or damages arising out of use of this information. This work is published with the understanding that Tata McGraw-Hill and its authors are supplying information but are not attempting to render engineering or other professional services. If such services are required, the assistance of an appropriate professional should be sought.

Typeset at Text-o-Graphics, B1/56 Arawali Apartment, Sector 34, Noida 201301 and printed at India Binding House, A-98, Sector-65, Noida, U.P. Cover Printer: India Binding House RZXYCRCFDLZYC

To Sovita

Contents Preface to the Third Edition Preface to the First Edition List of Symbols

1.

Organism and Environmental Complex 1.1 Concept of Stress and Strain 2 1.2 Adaptation and Concept of Limiting Factor 4 1.3 Concept of Habitat and Niche 9 1.4 Scope of Ecology 17 1.5 Application-Based Study 27 Multiple Choice Questions 27 Short and Descriptive Questions 30

2.

Systems Concept in Ecology 2.1 Systems Concept 31 2.2 Integrative Approach 32 2.3 Ecosystem 33 2.4 Functional Attributes of an Ecosystem 40 2.5 Primary and Secondary Production 75 2.6 Food Chain and Trophic Levels 95 2.7 Energy Flow in Ecosystems 103 2.8 Material Cycling 117 2.9 Homeostasis and Feedback 126 2.10 Development and Evolution of Ecosystems 128 2.11 Concept of Model and Ecosystem Modelling 129 Multiple Choice Questions 145 Short and Descriptive Questions 148

3.

Ecosystems of the World and Distribution of Flora and Fauna 3.1 Terrestrial Ecosystems 149

xi xv xvii

1

31

149

Contents

viii

3.2 3.3 3.4 3.5

Aquatic Ecosystems 161 Principles of Plant Geography and Animal Distribution Floristic and Zoogeographical Realms 172 Principles of Dynamic Phytogeography 173 Multiple Choice Questions 178 Short and Descriptive Questions 179

171

4.

Environment in Action 4.1 Concept 180 4.2 4.3 Topographic Factors 193 4.4 Edaphic Factors (The Soil) 194 4.5 Biotic Factors 205 4.6 Co-Evolution 209 4.7 Biological Clock 212 Multiple Choice Questions 218 Short and Descriptive Questions 219

180

5.

Community Ecology 5.1 Concept of Community and Basic Terms 220 5.2 Community Structure, Composition and Stratification 5.3 Community Function 236 Multiple Choice Questions 242 Short and Descriptive Questions 242

220

6.

222

Population Ecology 6.1 Concept of Population and Population Attributes 246 6.2 Biotic Potential and Natality 246 6.3 Mortality, Survivorship Curves, Life Table, Age Structure 248 6.4 Concept of Carrying Capacity and Environmental Resistance 252 6.5 Population Growth Forms 253 6.6 Life History Strategy 256 6.7 Population Fluctuations 260 6.8 Population Interactions 263 6.9 Concept of Density-Dependent and Density-Independent Actionin Population Control 272 6.10 Human Population Growth 272 Multiple Choice Questions 276 Short and Descriptive Questions 277

246

Contents

ix

7.

Natural Resource Ecology 7.1 Concept and Classification of Resource 278 7.2 Non-Renewable Resources 278 7.3 Renewable Resources 280 7.4 Conservation and Resource Management 330 Multiple Choice Questions 352 Short and Descriptive Questions 353

278

8.

Pollution Ecology 8.1 Concept of Pollution 354 8.2 Air Pollution: Concept 355 8.3 Water Pollution 393 8.4 Solid Waste Pollution 409 8.5 Hazardous Waste and Toxic Chemicals 417 8.6 Soil Polution 424 8.7 Drug Abuse 425 8.8 Noise Pollution 425 8.9 Indoor Pollution 430 8.10 Pollution Due to Radiation 430 8.11 Bioindicators 433 8.12 Industrial Accidents 434 8.13 Provisions in the Indian Constitution and Environmental Laws 439 8.14 Environmental Laws in India and International Conventions 443 8.15 Environmental Management 447 Multiple Choice Questions 450 Fill in the Blanks 452 Short and Descriptive Questions 453

354

9.

Environmental Toxicology 9.1 Toxic Chemicals and Definition of Toxicology 454 9.2 Toxic Chemicals 455 9.3 Factors Affecting Toxicity 457 9.4 Routes and Rate of Administration 458 9.5 Environmental Factors/Behavioural Factors 458 9.6 Effect and Response 459 9.7 Synergism and Antagonism 460 9.8 Basic Principles of Dose Response 460 9.9 Statistical Concept of Toxicity 463 9.10 Translocation of Toxicants 464

454

Contents

x

9.11 9.12 9.13 9.14 9.15 9.16

Mechanism of Toxicant Action 464 Biotransformation of Toxicants 466 Bio-accumulation of Pollutants/Xenobiotics 467 Antidotes 467 Toxicity Tests 468 Some Case Studies 468 Multiple Choice Questions 476 Short and Descriptive Questions 477

10.

Molecular Ecology 10.1 Introduction:What is Molecular Ecology? 478 10.2 Systematics and Phylogenetics: Molecular Phylogeny 479 10.3 Genetics in Ecology: Genetic Markers 485 10.4 Advances And Dimensionsin Molecular Ecology 487 Multiple Choice Questions 490 Short and Descriptive Questions 491

478

11.

Ecotechnology 11.1 Introduction 492 11.2 Environmental Biotechnology and Biotechnology Firms 11.3 Biotech Drugs 497 11.4 Traditional Knowledge and Traditional Medicine 497 11.5 Bioincubators: Biotechnology Firms 498 11.6 Bio-Safety 499 11.7 Ecotechnology for Eco Remediation 500 Multiple Choice Questions 514

492

12.

Statistical Ecology 12.1 Introduction 516 12.2 Ecological Sampling 516 12.3 Sampling Distributions 518 12.4 The Binomial, Normal and Poisson Distributions 12.5 Species Richness 525 12.6 Niche Overlap Indices 527

492

516

518

Bibliography

529

Index

557

Preface to the third Edition Great advances have been made in ecological sciences in recent years. Universities and academic institutions have changed the structure of the syllabi in Ecology, Environmental Science and Environmental Engineering courses, especially at undergraduate and postgraduate level. In view of this, the need of a new edition incorporating the latest trends was felt, albeit the fi rst two editions of this book have evoked good response from the students and teachers. The new edition is particularly well suited for a core paper on Ecology and Environmental Sciences. Molecular ecology has wide applications in understanding Evolutionary Biology with ecological perspective by the application of molecular biology and its tools. Their application to Conservation Ecology is also important and has immense potential. Ecotechnology deals with applications of ecological principles to (i) develop eco-friendly technology for eco-remediation, and (ii) solve environmental degradation problems for sustainable development. At present, this forms part of Ecology and Environmental Science and Engineering courses. Statistical Ecology has wide applications for ecological data analysis. Keeping the above in mind and based on suggestions received from students, teachers and reviewers; this book has been revised extensively to emphasise the latest developments in the fi eld. This up-to-date and comprehensive text deals with various facets and dimensions of ecology. An integrated interdisciplinary approach facilitates better understanding of the subject. Lucid writing style complemented with ample illustrations aids readers in enhancing their conceptual knowledge. Numerous Botany, Zoology, Chemistry and industry-oriented examples, case studies, diagrams, and photographs have been included in the text along with an extensive bibliography. New to the Edition

� � � � � �

Three new application-oriented chapters, namely Chapter 10 on Molecular Ecology, Chapter 11 on Eco-Technology, and Chapter 12 on Statistical Ecology, abreast with current trends. Chapter 9 on Environmental Toxicology enriched with useful examples. Detailed discussion on the provisions of the Indian Constitution and Environmental Laws. New data on World Climate Change, Global Warming and Urban Heat Island. Detailed coverage of the Ecology of Eastern and Western Ghats of India. New section on Principal Component Analysis as an ecological tool.

Preface to the third Edition

xii

�

Updated data in Chapter 7 on Natural Resource Ecology

�

Chapter-end question bank including multiple choice, short and descriptive questions

An interesting website, name of website accompanies the new edition. It offers valuable resources for both teachers and students. Among the many resources that you will be able to use as a reader of this book are sample chapters, articles and quizzes. Organisation

This book covers all major fundamentals of Ecology (Ecosystem and Components, Population Ecology, Community Ecology and Pollution Ecology), updated with most recent topics, well-supported by illustrations and exhaustive real-time statistics. Application-oriented chapters (namely Molecular Ecology, Eco-technology and Statistical Ecology) enable the reader to achieve the desired technical edge in the subject. Chapter 1 on Organism and Environmental Complex deals with Concept of Stress and Strain, Adaptation and Concept of Limiting Factor, Concept of Habitat and Niche, and Scope of Ecology. Chapter 2 on Systems Concept in Ecology covers important topics such as Integrative Approach, Primary and Secondary Production, Food Chain and Trophic Levels, Energy Flow in Ecosystems, Material Cycling, Homeostasis and Feedback, Development and Evolution of Ecosystems, and Concept of Model and Ecosystem Modelling. The section on Functional Attributes of an Ecosystem covers Diversity Index and Dominance Index, Evenness Index, Similarity Index and Association Analysis. Terrestrial Ecosystems, Aquatic Ecosystems, Principles of Plant Geography and Animal Distribution, Floristic and Zoogeographical Realms, and Principles of Dynamic Phytogeography are elucidated in Chapter 3 on Ecosystems of the World and Distribution of Flora and Fauna. Chapter 4 on Environment in Action addresses Climatic Factors, Topographic Factors, Edaphic Factors, Biotic Factors, Co-evolution, and Biological Clock. Chapters 5 to 8 provide comprehensive and updated information on Community Ecology, Population Ecology, Natural Resource Ecology, and Pollution Ecology. Chapter 9 on Environmental Toxicology explains Factors Affecting Toxicity, Synergism and Antagonism, Basic Principles of Dose–Response, Statistical Concept of Toxicity, Translocation of Toxicants, Mechanism of Toxicant Action, Biotransformation of Toxicants, Bio-accumulation of Pollutants/Xenobiotics, Antidotes, and Toxicity Tests. Chapter 10 on Molecular Ecology includes information on Systematics and Phylogenetics. Biotech Drugs, Bioincubators, Bio-Safety, and Ecotechnology for Ecoremediation are covered in Chapter 11 on Ecotechnology. The last chapter on Statistical Ecology covers Ecological Sampling, Sampling Distributions, The Binomial, Normal and Poisson Distributions, Species Richness, and Niche Overlap Indices. Acknowledgements

We would like to thank Prof. Niranjan Behera and Prof. P C Mishra of Sambalpur University for their valuable inputs in the preparation of the question bank. Prof. Firoz Ahmed and Dr Nisarga Sen and Dr MP Sinha of Ranchi University, Dr Sohan Giri of Orissa Pollution Control Board and Dr (Ms) Ullasini Sahani of Larambha College, Larambha, Sambalpur provided data (published/unpublished)

Preface to the third Edition

xiii

and photographs on aspects of Environmental Toxicology, PCA and Soil organisms. Dr Dillip Kumar Behera, Shri B N Bhol, Mr Sitikantha Behera, Shri P K Dhal, Shri Prakash Jena and Shri Chintamani Biswal of Orissa Pollution Control Board, Bhubaneswar helped in creating diagrams as well as computer work. We wish to record our appreciation and thank them for their unhesitating support. We express our gratitude to the Tata McGraw-Hill publishing team, specially Vibha Mahajan, Shalini Jha, Smruti Snigdha, Renu Upadhyay, Dipika Dey and Ms Anjali Razdan for their praise worthy initiatives andeffi cient management of the book. A note of acknowledgement is due to the following reviewers for their suggestions.

Mohan Das Ambat Cochin University of Science and Technology, Cochin, Kerala K B Reddy SGHR & MCMR College of PG Studies, Guntur, Arunachal Pradesh T C Bandhyopadhyay University of Burdwan, Bardhaman, West Bengal Apurba Ratan Ghosh University of Burdwan, Bardhaman, West Bengal A K Kandya Dr Harisingh Gour University, Sagar, Madhya Pradesh The logistic and emotional support given by Mrs Sovita Dash and Mrs Maria Kammerer provided impetus to complete this revision work. It is indeed a great pleasure to appreciate their contributions. We look forward to constructive criticism from students and teachers so that the present book can be further improved in future editions. Comments and suggestions for improvements may be sent to tmh. [email protected] (kindly mention the title and author name in the subject line). Madhab Chandra Dash Satya Prakash Dash

Preface to the First Edition Ecology forms a basic component of any undergraduate or graduate course in Biology and Environmental Sciences. In recent years spectacular advances have been made in this discipline. Recent emphasis is on studies regarding how natural systems respond to stresses, pollution stress being an important aspect. Populations and communities are continuously changing as a result of natural processes and human activities. In order to detect changes in communities and to understand the factors responsible for these changes, it is important to understand ecological monitoring methods. Also, many important developments have occurred in Production Ecology, of Decomposer Organisms, and Behavioural Ecology. The present-day ecologist uses the knowledge of statistical methods and computers for the analysis of multi-step processes involving many variables of natural systems. Modelling and systems analysis have therefore become important aspects of Ecological Studies. All these areas of study can be treated at different levels keeping the background of the students in mind. I have been teaching ecological principles and systems ecology for more than 28 years in various Indian universities, and have been associated with the framing and evaluation of ecology syllabi at different levels in many universities and institutes. I have felt the need for a book that presents not only the fundamental concept of ecology but also with the subject matter using an interdisciplinary approach. This book should bridge the gap between elementary texts and specialised works pertaining to the different aspects of ecology. It should meet the needs of undergraduate as well as postgraduate students of biology and environmental science, who want to go deeper into the discipline. I have adopted a holistic approach and tried to present modern ecological concepts by drawing examples from laboratory and fi eld experiments using adequate illustrations. The book comprises eight chapters. Chapter 1 carries a discussion on the relation between the Organism and its Environmental Complex. The Systems Approach to Ecology is taken up in Chapter 2. It is followed by a description of the Various Ecosystems of the World and the Distribution of Flora and Fauna. Chapter 4 pertains to the effect on organisms. The concepts of Community and Population Ecology are discussed in Chapters 5 and 6, respectively. The last two chapters deal with Natural Resource Ecology, concepts of Resource Recycling and Vermitechnology, Pollution Ecology and Bioindicators. I had very useful discussions with Prof. T Ramakrishna Rao of the University of Delhi on some aspects of life history strategies, and with Mr A B Mishra at Sambalpur University on aspects of deforestation and its impact on climate and ecosystems. I also had sessions with Dr B K Senapati, P C Mishra, A K Hota and B K Mohapatra on aspects of population ecology, and with Dr N Behara on aspects of community ecology. I am indebted to them.

Preface to the First Edition

xvi

I have spent considerable time on this project. Without the understanding and encouragement of my wife Sovita and the support of Satya Prakash, Kamal Kumar, Sharmila, Dalia and Papiya, this work would not have been completed. It is a pleasure to acknowledge their help. Madhab C Dash

List of Symbols The following symbols, abbreviations and units have been used in this book. nm μ (= μm) mm cm km ha μg mg g kg t ml 1 ppm °C K J kJ cal kcal n l (= L) Log 10 Loge p % N (= n) SD (= S) S2 SEM – X

nanometre micron (= micrometre) milimetre centimetre kilometre hectare microgram milligram gram kilogram tonne millilitre litre parts per million degree Celsius kelvin joule kilo joule calorie kilo calorie frequency wavelength logarithm logarithm (base e) pi percent number of observations standard deviations sample variance standard error of mean sample mean

10–9 m 10–6 m 10–3 m 10–2 m 10–3 m 10–6 g 10–3 g 10–3 g 10–3 kg 10–3 1

0°C = 273.2 K 103 J 1 cal = 4.184 J calorie 10–3 cal

2.303 0.4343 3.142

1

Organism and Environmental Complex

The environment of an organism has two components—abiotic and biotic. The first includes the atmosphere (air), hydrosphere (water), and lithosphere (soil). The abiotic components are characterised by physical and chemical factors such as temperature, rainfall, pressure, pH, the content of oxygen and other gases, and so on. These factors exhibit diurnal, nocturnal, seasonal and annual changes. The biotic components include all living organisms which interact with each other and with the abiotic components. The organism interacts with members of its own kind—intraspecific interaction, and with those of other species—interspecific interaction. Interactions may be in the form of parasitism, symbiosis, commensalism, intra or interspecific competition and prey—predator relationships. They may include feeding, courtship, reproductive and other relationships and are usually complex in nature. Interactions helpful to the organism are classified as positive while those harmful to it are termed negative. Interactions are very important for the survival, growth, reproduction and continuance of any species. An organism lives in a state of dynamic equilibrium with the environment. As the environment is in a constant state of flux, the organism has to make internal adjustments, in response to the external changes in one or more environmental factors (temperature, rainfall, relative humidity, oxygen content, pH, etc.), to be able to survive, feed, grow and reproduce. This adjustment is necessary for the continuity of its own life and the life of its own kind (species). The diversity in organisms is enormous and it has been achieved through the evolutionary process. An organism has two environments—external and internal. The internal environment is separated from the external one by a barrier in the form of a body covering or cellular membrane. The organism always tries to maintain a stable internal environment irrespective of the nature of its external environment. This is called homeostasis and is an important aspect of the evolutionary process. The mechanisms involved in it are called homeostatic mechanisms. Ecologists are faced with the challenge of understanding this organism environment complex and the strategies adopted by different species for their survival and continuance. Different species have different genotypes; a genotype is defined as the sum total of all genes possessed by an organism. Species differ from one another appreciably, exhibiting different strategies and homeostatic mechanisms in response to environmental changes and interactions, because they possess different genotypes. Each genotype expresses itself in the form of phenotypes, with regard to its structure and functions. Depending upon the variations in environmental conditions one genotype will have a number of phenotypes.

2

Fundamentals of Ecology

Organisms differ widely in their response to environmental flux. Some species are extremely sensitive to even slight environmental changes, while others have the ability to modulate their metabolic processes and cope with these changes. For example, salamanders reared in oxygen-deficient water develop larger gills in comparison to other members of the same species reared in oxygen-rich water. Among germinated seeds, the Graminae seeds are most tolerant to water loss, oil seeds are moderately tolerant, and legumes are the least tolerant. The germinated spores of liverworts and ferns are as intolerant to water loss as in legumes (Rabe 1905). The environment includes a number of factors and the interactions between them. An environmental factor is considered important if it has the following features: (a) it is operationally significant to an organism’s functioning and living processes, (b) it is effective some time during the life of an organism, and (c) it is ontogenically effective. Many environmentalists advocate a functional concept of the environment, which they think, is organism-directed, organism-timed, organism-ordered and organism-spaced. Mason and Langenbein (1957), and Vernberg and Vernberg (1970) have elucidated these concepts.

Fig. 1.1

The zones of tolerance and resistance for an organism with regard to environmental factors—a conceptual model

The total range of expression of an abiotic factor may be very wide. For example, temperatures ranging from below 0°C (polar water) to above 50°C (hot springs) exist in the environment. For each species, a certain sector of this range may be conducive to life. At either end of this sector or gradient there may be a point beyond which can organism is unable to survive. The broad middle sector of this gradient is called the zone of tolerance, zone of compatibility, biokinetic zone, or zone of capacity adaptation. The region at either end of the zone of tolerance is called the lethal zone, or zone of resistance. The transition points between these zones are called the upper or lower incipient lethal points (Fig. 1.1), and these are functions of sex, age, season, starvation, etc. This can be generalised for any environmental factor. These transition points vary from specie to specie and even within individuals of the same species. One can get to know the physiological diversity of a species by studying a number of members belonging to it.

1.1 CONCEPT OF STRESS AND STRAIN Ecologists agree that any environmental factor potentially unfavourable to organisms can be called stress. An organism’s ability to survive in a particular environmental complex depends upon its evolutionary history. Resistance to stress is defined as the ability of living organisms to survive and grow in the presence of unfavourable factors. If a body X exerts force on body Y, then Y must also exert a counter force on X. In Newtonian terms these two forces are termed—action and reaction. Taken together, they may be called stress. A

Organism and Environmental Complex

3

body remains in a state of strain if subjected to stress. The magnitude of stress can be measured as the force per unit area. The magnitude of strain is measured as the change in dimensions, such as length or volume, of the body. Each body has certain limits of continuing in a state of strain. A completely reversible strain is said to be an elastic strain. If it is partially reversible, then the irreversible part is called plastic strain or permanent set. The elastic strain produced by a body is proportional to the stress applied on it. Therefore, the modulus of elasticity (M) of the body is defined as M=

Stress Strain

A higher M implies more elasticity. A body is considered sensitive to a stress if little stress is required to produce a unit strain. 1.1.1 Biological Stress and Strain

The concept of stress in biology always involves the possibility of occurrence of an injury, implying that the strain is irreversible. All living organisms possess a barrier (cell wall, membrane, etc.) between the living matter and the stress, and usually their energy is expended in countering this stress. Biological stress may be defined as any environmental factor capable of inducing an injurious strain in organisms. Biological strain is not necessarily a change in the dimension of the organism. Organisms exhibit physical strain through hibernation or aestivation, or chemical strain through shift in metabolism. Tropical and subtropical earthworms generally aestivate in summer by forming distinct coils or remaining very torpid and also exhibit a distinct shift in metabolism (Dash, 1987; Dash and Senapati, 1980; Rao, 1984). When the strain is severe, the organism may suffer a permanent set (injury or death). Resistance of an organism to disease may be compared to elastic resistance. In biology, one normally studies injury or death (plastic strain), rather than elastic resistance. For biological stress or strain, time is a very important criterion, as death or injury is generally dependent on the duration of exposure to stress. Elastic resistance is a measure of the organism’s ability to reduce or prevent elastic strain (reversible) when exposed to a particular type of stress. Plastic resistance is a measure of its ability to reduce or prevent plastic strain (irreversible or injurious). In a living body, plastic strain increases with an increase in intensity of stress. The organism may repair the strain (injury) by expending metabolic energy. At times the strain is so severe or irreversible that the organism dies. For example, many Indian earthworm species undergo diapause (Plate 1) in summer when the soil moisture regime is below 7 g% and soil temperature is around 30°C or more. Recovery from diapause depends upon the duration of summer and these conditions. It also depends upon the physiological condition of the animal and the amount and rate of utilization of stored energy. If summer extends by a few days, the recovery percentage becomes very low. Stress resistance depends upon the (a) physiological state of the organism, more precisely the internal characteristics of the living system which encounters the stress and remains in a state of strain, (b) healing or repair mechanism which reverses the strain and (c) capability of the organism to adapt to the environment. Plate 1 Summer diapause in Indian earthworm, Octochaetona surensis showing distinct coil formation inside soil cavity. This is an adaptation to counter adverse environment conditions, such as very low soil moisture and high temperature. (photograph taken by Dr. B K Senapati).

4

Fundamentals of Ecology

1.2 ADAPTATION AND CONCEPT OF LIMITING FACTOR Responses of an animal or organism to fluctuating environmental factors can be considered as adaptive strategies for survival. Organisms exhibit habitat adaptations imperative for their survival. The environment acts as a selective force on an organism population, and organisms develop adaptive strategies which enable them to withstand environmental stress. For example, leaves of different plants and sometimes even those of the same plant show differences in structure (heterophylly), depending upon the external environmental conditions under which the plants grow. Usually the leaves on the upper half of the stem are different from those on the lower half. The higher the position of the leaf, the smaller are the cell dimensions and the greater are the number of stomata per unit surface area. Terminal leaves bear a thick network of vascular bundles and a thicker layer of palisade tissue. These anatomical differences are related to the physiological differences and are a form of adaptation. The upper leaves usually exhibit higher assimilation and intense transpiration. Another example is the availability of water and its association with a particular plant structure. Water is distributed unequally over the surface of the earth. Plants growing in deserts, where water supply is scant, are called xerophytes. These plants have adaptive mechanisms to withstand such dry conditions. Hydrophytes are plants which require a very moist habitat for their growth. Most plants grow in intermediate conditions, i.e. neither too dry nor too moist. These are called mesophytes. Xerophytes are usually dwarf-like shrubs or herbaceous plants in which the underground parts are many times larger than the aerial ones. Hence they have a small transpiratory surface. In many desert plants the leaves are modified into spines, as in cacti, and have a reduced assimilative function or none at all. The root system is spread very close to the surface, and absorbs moisture at night or during rainfall. The water is stored in the stem and used very slowly. The aerial parts and root system in hydrophytes and mesophytes differ greatly. These are examples of specific adaptations. Animals also show specific adaptations for food gathering, metabolism, reproduction, and so on. For instance, different types of teeth are found in lizards and mammals, bills of birds differ widely, mouth parts in insects and suckers in leeches are adapted to sucking, chewing, biting, siphoning, etc.; all these are morphological adaptations for food gathering. Each species has its own reproductive pattern and may have special parts concerned with reproduction. The primary objective of a species is to survive and reproduce for the continuance of its race. Even if the ambient temperature increases or decreases, some animals, such as birds and mammals (homeotherms) including man, maintain a constant body temperature. They are therefore called regulators and as they have wide homeostatic capabilities. But a majority of animals have limited homeostatic capabilities and their body temperature and functions correspond to changes in environmental temperature. They are called poikilotherms. For example, within a limited range of temperature, the rate of physiological processes is related directly to the ambient temperature. These poikilotherms are also called conformers (Fig. 1.2). Many organisms exhibit features in between those of conformers and regulators. For example, the egg laying mammals are heterotherms. Within the existing genome of an organism, variations in morphological and physiological adaptive responses to environmental stress may occur. These are called environmentally induced or non-genetic adaptations. An adaptation is considered to be genetic or stable if it has an evolutionary base. A stable adaptation usually develops in the course of evolution and is carried on from generation to generation. Non-genetic adaptation may not be stable and is physiological in nature. Prosser (1964) defines

Organism and Environmental Complex

physiological adaptation as any property of an organism which favours survival in a specific environment, particularly a stressful one. Acclimation studies, and the breeding and rearing of organisms in different environmental conditions provide an insight into understanding whether an adaptive mechanism is non-genetic or genetic. Physiological adaptations (non-genetic) are helpful to a particular individual in his lifetime whereas genetic or evolutionary adaptations help the species face competition, survive and reproduce. Fig. 1.2

5

Two generalised response patterns of an

Adaptations which give rise to plastic reorganism internal environmental factors to the fluctuating external environmental sistance in organisms and thereby prevent infactors jury by stress, are termed resistance adaptations by Precht (1958). Some adaptations not only prevent injury but also permit growth—these are called capacity adaptations by Precht. If elastic strains continue for a long period of time, they may result in injury or death. Precht pointed out that elastic adaptations had been thoroughly investigated in animals but plastic adaptations were largely left untouched. Levitt (1980) pointed out that the reverse was true for plants. Levitt’s (1980) environmental stress and stress—strain mechanisms are illustrated in Fig. 1.3. 1.2.1 Convergence and Divergence

Under similar environmental conditions, different species (unrelated species or taxa) exhibit similar features. For example, whale and fish belong to different taxa—the former is homeothermic and the latter poikilothermic. But they exhibit many common morphological features which are adaptations required for constant aquatic living. This is called convergent evolution and has come about through the process of natural selection. Individuals belonging to a particular taxon, as in reptiles or mammals, may adapt to different environmental conditions. Depending upon the demands of their environment they develop different adaptive features in the course of their evolutionary history. This is known as divergent evolution. Reptiles and mammals among vertebrates, and insects among invertebrates, are found in all types of environment and exhibit divergent evolution. Based on numerous observations, certain rules have been formulated regarding convergent and divergent evolution. Allen’s rule

Tails, bills, ears, etc., of animals are relatively shorter for a species in cooler regions of the range of the environmental gradient than in the warmer regions.

Bergmann’s rule

Races of species having a larger body size are generally found in the cooler parts of the range while those having a smaller body size are found in the warmer parts. This rule is applicable to both cold and warmblooded (poikilothermic and homeothermic) animals. Originally, this rule was applied only to different species within a particular genus, but is now found to have a wider applicability.

6

Fig. 1.3

Fundamentals of Ecology

Enviromental stress and stress–strain mechanisms

Gloger’s rule In homeothermic species, black pigments increase in warm and humid habitats and red and yellow-brown pigments in arid climates. These pigments are greatly reduced in cold climates.

A large body size and short appendages imply less surface area per unit volume of body and thus leads to a minimization of heat loss in cold climates. But a smaller surface area by itself does not provide sufficient reduction in heat loss to permit adaptation to cold climates in homeotherms. The ability of homeotherms to live in cold climates depends largely on an adaptive strategy which includes better insulation of the body surface, capacity for higher rates of heat production, greater ability to tolerate

Organism and Environmental Complex

7

cold temperatures at the tissue level and adequate food availability in the habitat (Kendeigh, 1969). The large body size and short appendages do not offer any specific advantages to poikilothermic animals with regard to heat balance. 1.2.2 Responses to Change in Environmental Complex

The initial response of any animal to a change in the environmental complex may be ecophysiological. For example, in cold-blooded animals a decrease or increase in air temperature may bring about a lowering or enhancement of the rate of metabolism respectively. But a decrease in the air temperature of the habitat may increase the rate of metabolism in warm blooded animals. It has been observed that very low temperatures stimulate nerve endings and produce shivering in homeotherms. Kendeigh (1969) classifies these responses into five types: (a) masking, (b) lethal, (c) directive, (d) controlling, and (e) deficient. Masking This refers to the modification of the effect of one factor by that of another. For example, a low RH (relative humidity) increases the rate of evaporation of moisture from the body surface, so that homeotherms are able to survive in very warm climates. Lethal An environmental factor may cause death, as, for instance, in extremely cold or hot conditions. Directive It refers to the environmental factor bringing about a definite type of orientation in the animal. For example many birds from temperate regions move southwards during winters and return in spring or summer for breeding. Controlling

Certain factors may influence the rate of occurrence of some physiological processes without entering into the reaction. For example, environmental temperature may greatly influence metabolism, secretion and locomotion in animals.

Deficient

The deficiency of an environmental factor in a particular habitat may affect the activity or metabolism of the animal. For example if oxygen is absent or present in very low partial pressure, it may curtail the activity of an animal or any aerobic organism. An environmental factor such as the temperature of the habitat may be classified as lethal in extreme conditions (very cold or hot), masking, as when cold conditions make for reduced consumption of food among poikilotherms, directive, as in inducing birds to migrate southwards in winter (searching for a more favourable habitat) or controlling when temperature affects the rate of metabolism. For any single factor, different organisms find optimal conditions of existence at different points along the range. Thus they segregate into different habitats. The threshold of an environmental factor is the minimum quantity of that factor required for the functioning of an organism. For instance, it may be the lowest temperature at which an organism remains active, or the minimum amount of soil moisture which permits earthworms to remain active. The rate of physiological processes increases above the threshold value of the factor until a maximum rate is reached. Above this rate, a decline in activity occurs. As already discussed, an environmental factor has a certain range within which the species remains active and performs all functions optimally. The activity of the species is curtailed at both the maximum and minimum levels of the factor.

Fundamentals of Ecology

8

The upper and lower limits of tolerance (Fig. 1.4) are the intensity levels of an environmental factor at which only 50% of the organism can survive (LD50). Species vary in their limits of tolerance to the same factor, and these limits are usually difficult to determine. The prefix steno means that an individual or a species population has a narrow range of tolerance, while the prefix eury means that it has a wide range of tolerance. Thus the terms Fig. 1.4 A generalised pattern for organismal distribution and activity in relation to environmental factors stenothermal and eurythermal with regard to temperature (Fig. 1.5), stenohaline and eurythermal in respect of salinity, and stenoecious and euryoecious in the context of habitat or niche have been developed. Table 1.1

Tolerance terminology Terminology

Environmental factors

Stenothermal—Eurythermal

Temperature

Stenohaline—Euryhaline

Salinity

Stenoecious—Euryecious

Habitat selection (niche)

Stenohydric—Euryhydric

Water

Stenophagic—Euryphagic

Food

Stenobathic—Eurybathic

Depth of water/habitat

Fig. 1.5

Steno-species exhibit a narrow tolerance zone while eury-species exhibit a wide tolerance zone

The distribution of plants depends upon (a) climatic conditions, (b) edaphic factors, (c) absence of excessive competition, and (d) adaptability of plants to changing conditions. Climatic conditions determine the range over which the growth of a species population can spread and edaphic conditions determine how well the plants flourish. Whether plants survive or perish depends upon the range of climatic conditions in which they grow. This is called the range of tolerance. For example, if a plant is habituated to a temperature of 30°C but can also survive at 20 and 40°C, then its range of temperature tolerance is 20 to

Organism and Environmental Complex

9

40°C. Every environmental factor has a range in which a plant can survive and grow. The tolerance ranges are based on physiological requirements. Since physiological processes are largely determined by the genes, the tolerance range for any species is ultimately determined genetically. Sexual reproduction brings genetic variety to a population and therefore a sexually reproducing population will usually have a wider tolerance range than a plant species which reproduces vegetatively. 1.2.3 Law of Minimum

An organism (micro-organism, plant or animal) is simultaneously subject to the influence of many environmental factors such as temperature, relative humidity, pressure, oxygen content, pH of the medium, etc. Some factors exert more influence than others. Justus Von Liebig (1840) developed the concept of the law of minimum by evaluating the relative role of these factors. The law states that an organism requires a minimum quantity of a particular nutrient for proper growth. For example plants will either not grow at all or exhibit poor growth if any nutritive component of the soil or air is deficient. The deficient nutrient makes the other nutrients metabolically inactive. If this nutrient is made available in the soil in soluble form, then the other nutrients also become active, and the plants grow properly. Blackman (1905) developed the concept of the limiting factor, which includes the deficient and controlling factors. He cited five factors which controlled photosynthesis, namely, the amount of carbon dioxide available, the amount of water available, the intensity of solar radiation, the amount of chlorophyll present, and the temperature of chloroplast. A deficiency of these factors will affect the process of photosynthesis, irrespective of the abundance of the other factors. Shelford (1952) pointed out that the limiting effect may be due to two or more interacting factors, otherwise called factor interaction. Too little or too much of a factor can be limiting. Thus the activity of an organism is limited or controlled by an essential environmental factor or a combination of factors in the least favourable quantity. This is the law of the minimum, developed originally by Liebig (1840) and elaborated upon by Blackman (1905), Taylor (1934) and Shelford (1952).

1.3 CONCEPT OF HABITAT AND NICHE Habitat refers to the place where an organism or a species population lives, for example, a pond is the habitat of zooplankton, phytoplankton and fish. Soil in a forest floor is the habitat of soil fauna comprising soil insects, their larvae and pupae, microarthropods, some molluscs, annelids, nematodes and protozoa and soil microflora comprising bacteria, fungi and actinomycetes. Habitats may be divided into many types such as terrestrial aquatic, aerial, arboreal and so on. A terrestrial habitat may comprise forest, grassland, agricultural land, tundra, desert and so on. An aquatic habitat may be fresh water, estuarine or marine, or subdivisions of these larger habitats. Air is the permanent or temporary habitat of many organisms. The area of a taxon or species refers to the total geographic range of its movement. The habitat of a species comprises the totality of the abiotic factors with which it interacts. The subdivision of a habitat is called a microhabitat. The specific environmental variable in the microhabitat is called microclimate or microenvironment. Joseph Grinnel (1917) coined the word niche to denote the microhabitats where the organisms live. He laid emphasis on the distribution of organisms and their structural peculiarities in relation to microhabitats. Thus he considered the niche to be a subdivision of the habitat and treated it as a disributional unit. Charles Elton (1927) regarded the niche as the fundamental unit of an organism

10

Fundamentals of Ecology

or a species population in the community. It centred around the collection of food, involvement in the intraspecific and interspecific competition, etc., by the organism. This concept of niche emphasizes the occupational state of a species. GF Gause, an ecologist said that no two species with the same ecological niche requirements can coexist. Niche requirement here mainly refers to requirement of food and environmental factors. Thus a niche is different from a habitat. In simple terms, the habitat refers to the place where an organism lives and niche to the activity (functional aspect) of an organism. In other words, habitat refers to the address and niche to the profession of the organism. Kendeigh (1974) considered the niche as a combination of the habitat and biotic interactions of a species for its survival and continuance in a community. For example, a lake is the habitat of all types of fish whose niches are different: (a) there may be herbivore, carnivore and omnivore fish depending on their food habits, (b) there may be surface, column and bottom feeders with regard to the distributional patterns, and (c) there may be other kinds of distribution depending upon environmental gradients, such as temperature or pH. Likewise the lake is also the habitat of many species of phytoplanktons but their distribution as regards depth and zone (shallow water zone, neritic zone, etc.) will vary depending upon their differential requirements of ecological factors, such as nutrients, temperature, silica concentration, availability of light, and so on. Thus the niches of organisms vary although their habitat broadly remains the same. Niches may be of different types depending upon the functional attributes of environmental conditions in which the organisms live and reproduce. This concept in its broadest sense includes abiotic and biotic variables and their interactions with organisms; in this case, it is called multidimensional niche. Types of niches

It is evident from the above discussion that the ecological niche may have three aspects, namely (a) spatial or habitat, (b) trophic, (c) multidimensional or hypervolume. The concept of ecological niche therefore has considerable significance in ecology in terms of the differences between species in the same physical space or at different places, or the same species at more than one location.

Spatial or habitat niche

As the name indicates, the spatial or habitat niche is concerned with the physical space occupied by an organism. It is broadly related to the concept of habitat, but differs from it, in the sense that while different species may occupy the same habitat, the activity of each organism may actually be confined to only a small portion of the habitat called microhabitat. O’Neill (1967) discusses the spatial niche giving many examples. He found seven species of millipedes in a maple forest. All species broadly occurred in the same habitat and were detritivores or fed on decomposed materials. Thus they belonged to the same trophic level. But detailed research revealed that each species dominated in its own specific microhabitat, which was different from the others. There were several gradients in the decomposition stage, from the centre of the log to the bottom of the leaf litter. These gradients were identified as distinct microhabitats, although the general habitat was the forest floor. A similar example is that of earthworms occupying agricultural fields, grasslands or forest floors (Dash and Senapati, 1981; Sahu, 1988). In Indian grasslands and agricultural fields some four or five species of earthworms (Lampito mauritii, Octochaetona surensis, Drawida calebi, Drawida willsi, etc.) are commonly found, but the microhabitat requirement of each species is different. Spatial niche separation has also been observed in different species of fungi. Sharma and Dwivedi (1972) found three species of fungi colonising the decaying parts of a fodder grass, Setaria gloucci. Although they occurred in the same general habitat their intensity of occurrence varied depending upon the intensity of fruiting on the upper internode of that grass. Thus the different internodes created different individual micro-habitats and harboured different species of fungi.

Organism and Environmental Complex

11

Trophic niche This refers to the trophic position (food level) of an organism. For example, in the Galapagos islands in South America, birds belonging to three genera, namely Geospiza (ground finches), Camarhynchus (tree finches), and Certhidia (warbler finches) are found. All these birds live in the same general habitat but differ in their trophic position. One of the tree finches Camarhynchus crassirostris has a parrot-like beak and feeds on buds and fruits. The other tree finches C. heliobates and C. pallidus) are carnivores and feed on insects of different sizes. The ground finches are seed eaters, and the beaks of different species vary according to the type of seeds they eat. Another example is of the two aquatic bugs, Notonecta and Corixa. Both live in the same pond but occupy different trophic niches. Notonecta is a predator While Corixa is a detritivore. Das and Moitra (1955) elucidated the concept of trophic niche and niche separation in some fishes. They classified Catla catla as a surface feeder as it feeds largely on zoo- and phytoplankton, Labeo rohita as a mid-feeder (column feeder) as it feeds largely on phytoplankton and algae and to a lesser extent on zooplankton, and Cirrhina mrigala, Labeo calbasu, and Punitus sophore as bottom feeders since they largely feed on rotten plant matter and to a lesser extent on plankton in the same aquatic system. Hypervolume niche or multidimensional niche The concept of hypervolume or multidimen-

sional niche was developed by Hutchinson in 1965. He recognised two types of niches—(a) fundamental and (b) realised. The fundamental niche is the maximum abstractly inhabited hypervolume, when the species is not competing with others for its resource. If a community is considered to be an aggregate of many environmental and functional variables, then each of these can be taken as a point in a volume of space of infinite dimensions, called the hypervolume or multidimensional space. But an individual or a species normally remains in competition (either interspecific or intraspecific or both) and thus under biotic constraints only a part of the niche is realised by the species. This smaller hypervolume occupied by a species is called the realised niche. Thus each species has a fundamental niche within a community to which it is adapted in the evolutionary process, but because of competition it occupies a similar niche, namely the realised niche. Figure 1.6 explains this concept. In it zone-C is the competing zone where due to competition, the reproductive success of each species, and hence its chances of survival are reduced. Individuals from populations with overlapping niches, which remain outside the overlapping

Fig. 1.6

Concept of ecological niche: niche overlapping and competition zone between populations (i) Fundamental niches of species A and species B are shown separately. Both are adjacent niches, there is no overlapping and hence no competition (ii) The fundamental niche of one species is within the fundamental niche of another species, leading to severe competition (iii) Niche overlapping occurs partially, leads to a moderate level of competition

12

Fundamentals of Ecology

competitive zone are likely to have a greater survival rate and reproductive success. Natural selection will tend to favour individuals lying in the non-competing zone, and the non-overlapping portions of the niche will also tend to increase in size relative to the overlapping portion of the niche. Let us consider the following example. Two species—A and B—of earthworms are able to survive and grow in dry soil. A and B can grow successfully if the soil water content is 5–8% and 7–10%, respectively, Thus, individuals of both the populations which live in the 7–10% soil water content zone will compete with each other for common resources, and their reproductive success may be less in this overlapping niche zone. It has been found that the amount of niche overlap is usually proportional to the degree of competition for a particular resource. Competition occurs only when a resource is in short supply. The following conditions may arise in respect of niche relationships. 1. Niches may be adjacent to each other but not overlap. 2. The fundamental niche of one species may be completely within the fundamental niche of another species. 3. In a majority of cases, the niches may overlap. In the first case, competition will be minimised since the niches are different. In the second case there will be severe competition for space, but the species may not compete for food if their trophic niches are different. For example, the black and the white rhinoceroses live in the same habitat niche in Africa but their trophic niches are different. The black rhino is a browser and feeds on woody plants while the white rhino grazes on herbs and grasses. In the third instance (overlapping niche) there will be an intense competition for space and food. In such a case either one of the species will leave the (niche separation) or remain subdued. Figure 1.7 explains the three situations. (Quantification of niche breadth and niche overlapping) Niche breadth (width) may refer to the habit niche breadth. The species that utilise a broad spectrum of the environment Fig. 1.7 Concept of fundamental are called habitat generalists. They usually have high niche niche and realised niche; A— fundamental niche of species breadth score. Some species are restricted in their distribution A; B—fundamental niche of and live in a narrow range of the environmental spectrum. species B; C—competition They exhibit low niche breadth score and are considered zone. Unshaded portions are habitat specialists. All other species are considered as habitat realized niches intermediates (Dash and Mohanta 1993). Niche overlap is a measure of the association of two or more species. In other words, how often any two species occurred together in a habitat or ecosystem. A high niche overlap value of two species indicate that they are found together more often than other species in a particular habitat. This indicates their similar habitat requirement and may also indicate competition if trophic niche/spatial niche is same and food/space is limiting. Niche breadth

Niche breadth of each species can be calculated using Levin’s (1967) formula: 1/Bj = SP2ij

where Bj is niche breadth of species j and Pij is proportion of ocurrences of species j in plot ‘i’.

Organism and Environmental Complex

Niche overlap

13

Horn’s (1966) formula can be used to calculate niche overlap scores of each

species: Ljk = 2 S Pij Pik /(SP2ij + SP2ik) where Pij is Proportion of occurrences of species ‘j’ in plot ‘i’, Ljk is overlap of species ‘j’ and ‘k’, and Pjk is proportion of occurrences of species ‘k’ in plot ‘i’. Hypervolume concept This concept is based on the relationship between a species and the environmental gradients. For example, if we measure the range of environmental temperature over which a particular species can live and reproduce and do the same for another environmental gradient like humidity, and then plot these relationships on a graph, we obtain an enclosed space representing the niche of the species. Since two environmental factors are considered, the niche is considered to be two-dimensional. It will be multidimensional if more than two environmental variables are taken into account. Since many environmental factors are closely related to each other and each organism interacts with many factors of the environment, the tolerance limit of each species is determined by taking into consideration all the interacting factors.

For example, temperature and relative humidity may be taken as two environmental factors and a particular population’s tolerance to these factors can be studied. Assuming these environmental factors to be independent, the population’s niche with respect to temperature and relative humidity can be shown in a two-dimensional box (Fig. 1.8A). But it is known that temperature and relative humidity are not independent of each other in respect of their biological effects. Tolerance to higher temperatures may be associated with an increase in relative humidity. Thus, the populations’s niche with respect to the interaction of temperature and relative humidity may be represented in a better manner by an ellipse (Fig. 1 .8B). If another variable, such as the availability of a nutrient is considered, then the tolerance to levels of available nutrient can be affected by the interaction of temperature and relative humidity. This niche shows three variables (Fig. 1.8C) or a three-dimensional figure. Since a large number of abiotic and biotic factors affect the functioning of a population, the niche is an n-dimensional hypervolume, an abstraction developed by G Evelyn Hutchinson of Yale University.

Fig. 1.8

Multidimensional or hypervolume niche: A—two-dimensional niche with independent variables; B—two-dimensional niche with interdependent variables; C—a three-dimensional niche

14

Fundamentals of Ecology

Most niche measurements involve plotting along at least two axes. The resulting graph covers a certain area along an axis called the niche width. A species with a large niche width is considered a generalised species (niche showing wide variability), while one with a narrow niche is considered more specialised and can form an indicator species for a particular environmental condition. Boughey (1969, 1971) coined the term empty niches for habitats having a number of resources which are not fully exploited by the communities living there. This phenomenon can be ovserved in some island communities. Gause’s competitive exclusion principle G F Gause (1934) conducted laboratory experiments on co-existence among closely related species of protozoa and on the basis of the results, he concluded that “No two specifies with identical niche requirements can co-exist”. This principle is known as Gause‘s Competitive exclusion principle. This is defined as ‘if two non-interbreeding species population occupy exactly the same ecological niche (niche overlap is complete or near complete), the competition will be so severe, that one species will lose in the competition and the loser species usually exhibits retarded growth and may either leave that niche or become extinct’ (Chapter 6). This notion was earlier expressed by Charles Darwin in 1859 and Grinnell in 1924. Gause explained this notion by conducting laboratory experiments. He concluded that as a result of competition two similar species rarely ever occupy similar niches, rather displace each other in such a manner that each species takes possession of certain kinds of food and modes of life in which the species has an advantage over its competitor. In the experiment Gause grew Paramecium caudatum and Paramecium aurelia in separate cultures containing bacteria as food and he also grew the two species together in the same culture medium and studied their growth pattern and competition (details given in Chapter 6).

In summary, initially both species of Paramecium grew in numbers but eventually Paramecium caudatum declined and became extinct. In his experiments Paramecium aurelia always won the competition between the two species. Thomas Park (1948, 54) conducted a series of laboratory experiments on two species of flour beetle, Tribolium confusum and T. castaneum and found that when they grew together, their survival depended on environmental conditions of temperature and relative humidity (Table 1.2). T. confusum always became extinct under warm (34°C) and high humidity (70% RH). T. castaneum always became extinct under cool (24°C) and drier conditions (30% RH). Under intermediate conditions of temperature and RH, the two species behaved differently. T. confusum always wins in low RH conditions and T. castaneum always wins in high temperature and high RH conditions, and the findings are so consistent that knowing the environmental conditions, the competition result could be predicted (Table 1.2). Earlier, Grinnell (1924) stated that “Each species has its own unique niche.” If two species occupied the same niche, one species would be bound to out compete the other, driving it to extinction or driving out from the niche. Two species may occupy separate n-dimensional hypervolumes and their activities may overlap considerably on each of the separate axes and each axe may represent an environmental variable called resource axes. Two species may overlap considerably on each of two resource axes but occupy almost distinct three dimensional niche hypervolume (Fig. 1.8). MacArthur (1958) conducted some field experiments on the population ecology of five species of warblers of the genus Dendroica having similar body size and beak length (Table 1.3) in the USA. These five species are mainly insectivorous. These warblers feed on firs (Abies) and spruces (Picea)

Organism and Environmental Complex

Table 1.2

15

T Park’s experiments on interspecies competition based on many replicates.

Environmental conditions

Flour beetles

Temperature in °C

% of times T. castaneum wins

% of times T. confusum wins

100

0

10

90

86

14

13

87

29

71

0

100

Relative humidity % 34° 70% RH 34° 30% RH 29° 70% RH 29° 30% RH 24° 70% RH 24° 30% RH

which were 50–60 feet tall. He classified the trees into six vertical zones, each approximately 10 feet high and MacArthur divided each branch of a tree into three horizontal feeding zones, i.e. a lichen covered base (B), a zone of old needles in the middle part of tree (M) and a terminal zone of needles and buds less than 1.5 years old (T). The time in seconds, each bird spent in each of the feeding zones was recorded and the data are given in Table 1.3. D. coronata fed most of the time at the base, D. tigrina fed at the terminal zone and other species at the middle zone. The feeding techniques were also different, i.e. D. virens fed on stationary insects found in the foliage, whereas others fed on flying insects. The warblers build their nest in branches of the trees at different heights. Thus, there was a clear tendency of niche segregation and avoidance of competition within the same tree. The five warblers occupy feeding niches which to a large extent are distinct (Table 1.3). Table 1.3 MacArthur’s warbler’s and their time spent in feeding zones Species

Mean beak length (mm)

% of time spent in the feeding zones while on the tree

Dendroica caronata

12.47

53—Feeding at the base

D. virens

12.58

53—Feeding at the middle

D. tigrina

12.82

84—Feeding at the terminal zones

D. fusca

12.97

63—Terminal and middle zones

D. castanea

13.04

44—Feeding at the middle zone

Many studies on the species coexistence and competition have been done in the field conditions and all these studies could show the importance of niche segregation for competition avoidance. It was

16

Fundamentals of Ecology

found that however closely related a group of organisms might be, niche differences would be found. MacArthur and Pianka (1966) discussed what might happen when many competitors invaded a habitat. In the presence of greater number of competing species, each species will restrict its search effort for food collection to a smaller part of the total habitat and the situation is called ecological compression (Fig. 1.9). In the reduced habitat, a full range of food items may be available and hence the range of food taken by a species is independent of the number of competing species present. If the inter-specific competition is relaxed, species should increase the range of habitats for food collection although the type of food taken may remain the same. It can be concluded that ecological compression might be a natural rule as several species of competitors occupy a habitat. Ecological compression means that the species should specialise in terms of habitats they occupy and this situation should lead to specialisation in food habits. This feeding habit specialisation may lead to niche segregation.

Fig. 1.9

Ecological compression hypothesis: The habitat resources of each species shrinks in the habitat as more species use the habitat. The range of food items taken by each species may remain constant and the hypothesis applies to short-term, non-evolutionary change (based on MacArthur & Wilson, 1967).

Studies of MacArthur and Pianka (1966) and Pianka’s (1975) work on communities with several lizard species showed the coexistence of a number of species with relatively narrow feeding niches and thus ecological compression as a rule occurs in nature. These studies largely deal with the mechanism of coexistence rather than Gause’s competitive exclusion principle. Resource partitioning When two or more species divide out a resource such as food and space for living and breeding, etc., resource partitioning may occur. As more species make use of a habitat, the share of each species in the same habitat shrinks (ecological compression) and hence competition among them may also start. This is otherwise known as compression hypothesis. Bell (1971) worked on grazing mammals in Tanzania. By analysing stomach contents of large herbivores like zebra (Equus burchelli), wildbeest (African antelope—similar to the size of a horse) (Connochaetes taurinus), topi (Damaliscus

Organism and Environmental Complex

17

korrigum) and Thomson’s gazelle (Gazella thomsoni), Bell found considerable resource partitioning among these herbivores in the same habitat. Zebra took a diet highest in cell-wall content. It has been observed that the larger a species of animal (adult female zebra weigh 220 kg), the poorer the quality of diet on which it can subsist because of its low metabolic rate, relative to its body size. The species that ate the highest quality diet (high protein and energy) was the smallest ruminant, the Thomson’s gazelle, that weighs only 16 kg as an adult female with high metabolic rate. The intermediate sized wild beest (adult female 160 kg) and topi (110 kg) ate food of intermediate quality in comparison to gazelles and zebra. Ecological equivalents Ecological equivalents are organisms which occupy the same or similar ecological niches in different geographical regions. These species may taxonomically be different, but they perform similar functions in different geographical regions. Example 1 A grassland ecosystem develops wherever there is a climate conducive to such development. But the grass and the herbivore species may vary from one grassland to another. The kangaroos (herbivore grazers) of the Australian grasslands perform the same functions as the bisons and pronghorn antelopes of the North American grasslands. Therefore they are said to be ecological equivalents.

1.4

SCOPE OF ECOLOGY

Ecology, a word derived from the Greek word Oikos, meaning house, has a wide scope. Broadly speaking, ecology is a study of the households of the planet earth. These households consist of nonliving matter, such as soil and water, and living organisms such as micro-organisms, plants, animals and man. Organisms depend upon each other for their survival, existence and continuance. Besides, living organisms depend upon the non-living (abiotic) matter found in their surroundings (i.e. the environment) for their functioning. The living body is made up of non-living matter. Thus, ecology is the study of the relationships of living organisms among themselves and with their environment. Ecology is a fascinating discipline because everyone is usually interested in knowing about his surroundings. Even a small child shows interest in the flowers, insects, mountains, plants and rivers in his surroundings. Ecology is concerned with the biology of organisms, populations, communities, etc., and their functional processes occurring in natural habitats like ponds, lakes, oceans and land. EP Odum, an American ecologist, defined ecology as the study of the structure and function of nature, which includes the living world. Charles Elton, a British ecologist, defined it as the study of scientific natural history. Andrewartha, an Australian ecologist, defined ecology as the study concerned with the distribution of organisms. Ecology, like physiology, embryology, genetics and evolution, is a basic division of biology and deals with the principles of survival; adaptability and reproduction common to all life on this planet. Ecology deals with organisms, populations, communities, ecosystems and the biosphere. Population is defined as a group of individuals of any one kind of organism. A community or biotic community includes all the populations of a given area, called the habitat. The community and the abiotic environment interact and function together as a system called the ecological system or ecosystem, a term coined by the British ecologist A.G. Tansley in 1935. The part of the earth where ecosystems operate is called the biosphere. But some natural ecological groupings of plants and animals based on regional climate and

18

Fundamentals of Ecology

soil types interact and produce a characteristic land community called biome. The term is now widely used to include aquatic communities also. The biosphere includes many distinct biomes such as tropical evergreen forests, tropical and temperate deciduous forests, taiga (needle leaf evergreen coniferous forests about 10 metres high), grasslands (prairies, plains, steppes, veldt), savanna, deserts, tundras, etc., and aquatic biomes like marine and large fresh water bodies. In other words, the biosphere is a narrow sphere of earth where the atmosphere (air), hydrosphere (water), and lithosphere (soil) meet, interact and make the existence of life possible.

Fig. 1.10

Concept of biological order—level of organisation and study. Microsystems like genetic and cell systems and microsystems such as community and ecosystems are visualised.

1.4.1 Components of Biosphere (1) Atmosphere The atmosphere is divided into four distinct layers (Table 1.4) (a) troposphere, (b) stratosphere, (c) mesosphere, (d) ionosphere/thermosphere, (e) exosphere, or the uppermost layer. The tropopause separates the stratosphere from the troposphere (Fig. 1.11). Troposphere It extends from the surface of the earth up to a height of 8 to 10 km at polar latitudes, 10 to 12 km at moderate latitudes and 16 to 18 km at the equator. In this layer the percentage concentration of different gases in air does not vary with an increase in height. But the water vapour content in air depends upon the weather; it decreases sharply with an increase in height as does the air temperature. The vertical temperature gradient of the troposphere is 5° per km in the lower troposphere, and 7° per km in the upper troposphere. However the upper region of the troposphere has a narrow boundary called the tropopause which has a constant temperature. The upper troposphere is almost transparent to the rays of the sun, which do not heat it very much in passage. Most of the solar energy is absorbed by the earth’s surface, and heat radiates from the lower troposphere to the middle and then to the upper troposphere. Hence there is a gradual decrease in temperature with height. Besides, the non-uniform heating of the ground surface produces ascending and descending air currents, which result in turbulence and mixing

Organism and Environmental Complex

19

Table 1.4 Major stratification of the atmosphere Strate

Altitude range

Temperature

Dominant chemical

(km)

range(°C)

species prevalent

Polar latitude

0–10

15–56

N2, O2, CO2, H2

Moderate latitude

0–12

Equator

0–18

– 56–2

O3, O2, O

Troposphere

Stratosphere Polar latitude

10–50

Moderate latitude

12–50

Equator

18–50

Mesosphere

50–85

– 2–92

O2, NO

Ionosphere/

85–500

– 92–1200

O2, O, NO

Thermosphere

of air masses vertically. The troposphere accounts for four-fifths of the entire air mass. The average pressure at the earth’s surface is 1,014 millibars (1 millibar 1/1000 bar, 1 bar = 1.019 kg per cm2, close to 1 atmosphere, 1.332 millibars = 1 mm of mercury). At an altitude of 5 km, the air pressure is half that at the surface, at 11 km it is 225 millibars and at 17 km it is only 90 millibars. Solar radiation causes water to evaporate from the earth’s surface. The bulk of evaporation occurs at the ocean surface, since oceans form more than two-thirds of the earth’s surface. Therefore the part of the troposphere over an ocean carries more moisture than that over a land surface. The mass of water vapour decreases rapidly with an increase in height. Stratosphere

This layer is free from clouds and aeroplanes usually fly in lower zone. Its thickness is about 50 to 55 km and it consists of a rich layer of ozone, which absorbs the harmful ultraviolet radiation from the sun. There is a serious threat to this layer now due to the harmful effect of gaseous pollutants. A big hole (thinning of the layer) has occurred in it, above the Antarctic region.

Mesosphere

This layer which begins after stratosphere exhibits further fall in temperature (Table 1.4). The decrease in temperature is due to decrease in absorption of solar radiation. The ozone concentration decreases rapidly with increase in height. Ionosphere

This layer, which begins after the stratosphere, contains several layers of ionised air. It reflects short radio waves, making telecommunication possible over long distances.

Exosphere

The air density is very low in this layer and outer space begins after it.

(2) Hydrosphere The oceans, lakes, rivers, streams, polar ice caps, water vapour, etc., form the hydrosphere. The water remains in solid (snow), liquid (water) and gaseous (water vapour) forms. (Elaboration in Chapter 3).

20

Fundamentals of Ecology

(3) Lithosphere The lithosphere or body of the earth was formed some 5–6 billion years ago. (Chapter 4). It has three main layers: (a) the earth’s crust, which is in the solid state and has a thickness of 16 to 50 km. It contains soil of thickness ranging from a few inches to a few feet, which is the abode of numerous organisms. (b) The mantle, which is about 2880 km thick and is made of hard rock containing iron and magnesium and forms about 84% and 67% of the earth’s volume and weight respectively. (c) The core, which is composed of high density solid material, mainly iron and nickel, with a temperature of about 8000°C.

The metabolic activities of organisms occur only in the few inches to few feet Fig. 1.11 Stratification of atmosphere—the troposphere of the earth’s surface containing the extends from the surface of the earth (8—10 km soil. This is formed by the interaction at polar latitude, 12 km at moderate latitudes and of the complex physical, chemical and 18 km at the equator). The troposphere contains biological processes of weathering of nitrogen, oxygen, carbon dioxide and hydrogen. The temperature decreases with altitude, averaging the parent rock, which provides the 0.6°C per 100 m (this is the lapse rate). About 80% of mineral substrate for soil formation. the mass of the atmosphere is contained in this zone. The decomposition of organic material, The tropopause exhibits a constant temperature mainly of plant remains by microregime. The stratospherë contains mainly ozone, which absorbs UV light. Water vapour is scanty. organisms and some invertebrate The mesosphere contains oxygen and oxides of animals also helps in soil formation. In nitrogen. The ozone concentration decreases with summary, the climate, vegetation, parent increase in height. The thermosphere is also called rock material and living organisms play the ionosphere, which is characterised by a rise in temperature related to the absorption of UV an important role in the formation of radiation by molecular oxygen and nitrogen. This soil and its profiles. In normal mineral zone extends up to 500 km soils the profile has three main horizons, usually termed the A, B and C layers. These horizons are differentiated by texture, physical structure, colour, porosity and nature of organic material, root growth and distribution of living biomass (Fig. 1.12). The A horizon includes the top soil containing organic material. The activity of soil fauna and micro-organisms is greatest in this horizon and plant roots grow abundantly in it. In some grasslands and agricultural soils the organic materials decompose faster and get mixed with the mineral layers. The organic matter content of the A horizon usually does not exceed 15% and after decomposition the finely divided organic matter called humus is mixed with mineral particles. However, the organic matter in coniferous forest soil occurs in various stages of decomposition and forms a separate zone called the O horizon. The B horizon is called subsoil and is more brightly coloured than the A horizon. Some soils may contain iron oxides in this zone and

Organism and Environmental Complex

21

look reddish or brown. This horizon may also contain clay. In poorly drained soils, waterlogging may occur and because of alternate reduction, mobilisation and reoxidation of iron compounds, the B horizon may appear grey in colour. The unchanged parent material (rock) forms the C horizon. Forests grow in regions where precipitation (rainfall) exceeds evaporation from the soil. Grasslands develop in regions where evaporation exceeds rainfall. In tropical and subtropical regions, heavy rainfall removes soluble constituFig. 1.12 Diagrammatic representation of three major soil types, each with three distinct zones.’ A—includes ents, particularly calcium, from the top top soil containing organic matter; soil biota activity soil through leaching. Calcium gets deis greatest here; B—is called subsoil and may contain posited in deeper layers and becomes iron oxides; C—is called the parent material (for available to trees, whose roots reach details, see text) these layers. In some grassland soils leaching may not occur and the nutrients become available in the top soil. In cold temperate regions, coniferous forests grow on a soil called Podzol, which bears a surface organic matter horizon called the 0 layer. The A horizon becomes thin and nutrients from it may leach to deeper layers and get deposited in the B layer. The B horizon may look brownish red or black in colour. Podzols are acid soils and are also called mor soils. In deciduous forests, the characteristic soil is brown forest soil. The A horizon in this soil consists of a mixture of well decomposed organic material and mineral soil which looks dark brown or black. This layer merges into the B horizon. The mixture of organic material and mineral material is called mull soil. Often soils which are in between mor and mull soils, and called moder soils, develop. In semi-arid regions under steppe vegetation, the soil profile consists of humified organic matter intimately mixed with mineral soil and the A horizon, which may be 30 to 60 cm thick, becomes blackish. Grass roots help in the formation of this type of soil, which is called Chernozem. In some cold and humid situations, decomposition occurs very slowly—the soil is leached and accumulation of organic matter occurs as peat. The soil is porous and depending upon the horizon and type of soil, the amount of solid particles and the soil texture (sand, silt and clay amount) vary, as does the pore space between the solid particles. In some soils the solid particles form 40 to 70% of the total soil volume—the pore space may be about 50% of the total soil volume in clay soils and about 30% in sandy soils. Pore space is usually less in arable land may be more than 50% in old grasslands. It is important for aeration, water holding and living space for many soil organisms. The texture of soil (Table 1.5) determines the pore space. Soil organisms include viruses, bacteria, actinomycetes, fungi, algae and protozoa, all classified as micro-organisms and invertebrate fauna which include protozoa, helminth and nematode worms, annelids, micro-arthropoda, other arthropods and molluscs. The average biomass of invertebrates in many Indian grasslands and pastures may be about 100 g live biomass per m2 (40 cm deep).

Fundamentals of Ecology

22

Table 1.5 Soil texture and particle size Soil texture and particle size (mm) Texture

Sandy

Sand

Silt

Clay

(2 to 0.05)

(0.05 to 0.002)

(80%

negligible

50%

. . . Var(Zp). Example 1

Sahani (2002) studied role of plantation forestry in reclamation of degraded tropical soil in Sambalpur district, Orissa, India. They found that on the basis of soil textural components, such as sand, silt, clay and soil water-holding capacity, the restoration period to reach both regenerating and natural forest stage varied from 24 to 35 years. The restoration period on the basis of soil bulk density, porosity and soil moisture data was calculated to be 30–67 years. However, when soil microbiological data were considered, the restoration period was calculated to be much longer that is 217–426 year to reach the natural forest stage. Even to reach the 30-year-old regenerating forest stage, the reclamatory period was calculated to be 101–253 years. They concluded that self-regenerating forest has far more reclamatory potential through secondary succession than the introduced exotic Eucalyptus plantation. The analysis further revealed that inspite of soil textural or physical improvement, Eucalyptus failed to improve soil microbiological characteristics appreciably and this slowed down the pace of soil reclamation under Eucalyptus plantation. Since microbiological parameters are of significance to soil biological fertility and stability, failure of exotic Eucalyptus plantation to improve upon these parameters in tropical soil questions the credibility of exotic Eucalyptus for reclamation of degraded tropical soil. Further, in order to view the differences among study sites, statistical analysis such as PCA (Ludwig and Reynolds, 1988) was made, using all original variables. The aim of the analysis was to discriminate different study sites on the basis of different soil parameters. By such analysis, it is possible to locate the position of different sites (Table 2.7 and 2.8) with respect to the position of natural forest and degraded barren site so that the progress of reclamation due to different plantations can be well reviewed. Different soil parameters (average values) considered as variables were (X1) sand, (X2) silt, (X3) clay, (X4) bulk density, (X5) porosity, (X6) water holding capacity, (X7) soil moisture, (X8) soil organic carbon, (X9) soil nitrogen, (X10) microbial biomass C, (X11) microbial biomass N, (X12) microfungal biomass, (X13) basal

Fundamentals of Ecology

52

soil respiration and (X14) microbial metabolic quotient. From the values of these variables, vectors and, finally, components (Z1–Z14) were calculated for each site. Components were ordered in terms of their Eigen values and percent of variances. The analysis revealed that components Z1 and Z2 explained the maximum variance, and their cumulative percent of variance was 91%. These two components were selected in order to discriminate different sites. Values of these components for eleven different sites are mentioned in the Table 2.8. Table 2.7

Eigen values and variance

Variables/ component

Eigen value

Per cent of variance

Cumulative per cent of variance

Z1

11.05

78.9

78.9

Z2

1.686

12.0

91.0

Z3

–1

6.87 ¥ 10

4.9

95.9

Z4

2.77 ¥ 10–1

2.0

97.9

Z5

–1

1.61 ¥ 10

1.1

99.0

Z6

7.58 ¥ 10–2

0.5

99.6

Z7

–2

5.15 ¥ 10

0.4

99.9

Z8

6.49 ¥ 10–3

0.0

100.0

Z9

3.59 ¥ 10–3

0.0

100.0

Z10

1.77 ¥ 10–4

0.0

100.0

Z11

2.47 ¥ 10

0.0

100.0

Z12

– 3.3 ¥ 10–14

–0.0

100.0

Z13

– 1.31 ¥ 10

–0.0

100.0

Z14

–1.16 ¥ 10-11

–0.0

100.0

Table 2.8

–12

–12

Values of components (Z1 and Z2) in different sites Site

Z1

Z2

1

6.7446

1.4387

2

–5.0387

1.6001

3

3.6166

0.9346

4

–3.6722

1.5064

5

–2.9409

0.3592

6

–1.0133

–1.6672

7

–0.5155

–1.5303

8

0.0842

–1.4126

9

0.7020

–1.3534

10

0.4861

0.0329

11

1.5471

0.0916

Systems Concept in Ecology

53

Figure 2.5 illustrates the discrimination of different sites on the basis of components Z1 and Z2. As evident from the Figure, the deforested barren site has sufficiently drifted away from the natural forest. Positions of 2- and 5- year-old Eucalyptus plantation sites were marked to be close to the barren site, and locations of these sites showed tendency of distancing from the barren site due to their little reclamatory role. However, positions of 10-, 15-, 20- and 30-year-old Eucalyptus plantation sites, though deviated away from the barren site, have not shown much reclamation in comparison to 10-year-old Teak and Gmelina plantation sites. Between the Teak and Gmelina, the later exhibited better soil reclamation than the former. The Figure further reveals the position of 30-year-old regenerating forest relatively close to the natural forest. This clearly shows that self regeneration of vegetation on a degraded land in tropics has relatively better reclamatory potential than that of plantation species.

Fig. 2.5

Principal Component analysis

Example 2

In one investigation by Swain and Dash (unpublished), the Z1 is called the principal component (1) conducted with respect to 12 month sampling in four study sites relating to the variables, such as species density, and indices, such as diversity, dominance and similarity, calculated from density data of amphibian populations observed at four sites, namely, irrigated paddy field (IPF), unirrigated paddy field (UPF), urban human habitation (UHH) and road side (RS) (Table 2.9). PCA was made with the help of SAS (1986) software programme under MS-DOS on IBM PC (Manly, 1989). PCA is included in most

54

Fundamentals of Ecology

statistical computer packages. Scatter diagram (Fig. 2.6) is plotted considering the PC value (principal component values), which explains very high (about 90%) cumulative percent of variance. Scatter diagram with respect to values, which exhibit segregation of different components (sites), is also helpful to understand the closeness of the sites to explain the result. Boundary area of each segregation has been made by comparing the location of respective principle component values belonging to a particular set of data of individual sites comprising the replicate. 2.4.7.1 Application of the Technique In this case, PCA is made using original variables by calculating the indices: (1) Shannon diversity index, (2) Simpson dominance index, (3) Species richness index and (4) Species density index. Eigen values, Eigen vector based on co-relation matrix indicated 74.1% variance with the help of PC1 (principal component 1) with respect to Z1 variables. With the PC2 value, 21.3% of the variance is explained. PC1 and PC2 cumulatively explain 95.4% of total variance. With the help of PC1, PC2 and PC3, cumulative percent of variance, explained about 99.5% variance, and individual explanation of PC3 with respect to percent variance accounted to 4.1% (Table 2.9 and Fig. 2.6). Preparation of scattered diagram indicated four distinct groups which are IPF, UPF, UHH and RS. From Fig. 2.6, it is being observed that the RS group overlaps with UHH and IPF group. On the right hand side, in the Figure, the IPF forms a separate group. From the above observation, it can be explained that some of the anuran species found in the IPF are not found in same abundance in the other regions due to their aquatic mode of life. But the other two groups, that is, UPF and UHH form two separate groups due to the presence of some specific species in those regions. The anuran species found in the RS overlap other Fig. 2.6 Relative assemblages of amphibian communities with respect to principal component axes (1&2) determined regions, namely, IPF and UHH, due on the basis of species diversity indices (Shannon Index, to migration, especially in breeding, Simpson Index, Evenness and density) at four sites season, and for foraging.

Systems Concept in Ecology

Table 2.9

55

Simple correlation matrix, descriptive statistics and per cent of variance with respect to Eigen Values based on 48 data of four experimental sites at Jyoti Vihar and Larambha field sites of Sambalpur district

1. Descriptive statistics Variable

Mean

Diversity

S.D.

N

Median

Minimum

Maximum

1.277

2.931 E-01

48

1.320

6.370E-01

1.697

Dominance

3.847 E –01

1.605 E -01

48

3.240E-01

2.230E-01

8.320E-01

Evenness

4.097 E –01

9.516 E -02

48

4.365E-01

2.010E-01

5.650 E –01

416.0

208.9

48

358.0

150.0

1.118 E +03

Density

2. Descriptive statistics Variable

Mean

S.D.

N

Median

Minimum

Maximum

PC 1

–8.951E-11

1.722

48

5.192E-01

–2.208

3.764

PC 2

–1.169E-10

9.230E-01

48

2.657E-01

–2.940

1.514

PC 3

2.115E-10

4.043E-01

48

4.757E-02

–1.889

6.428E-01

PC 4

–2.530E-11

1.440E-01

48

5.827E-02

–2.562E-01

3.009E-01

Evenness

Density

3. Simple correlation Variable

Diversity

Diversity

1.0000

Dominance

–0.8636

1.0000

Evenness

0.9776

–0.8775

1.0000

–0.2822

0.3280

–0.3321

Df = 11

at 0.05=0.553

Density

Dominance

1.0000 0.01 = 0.684

and 0.001=0.801

4. Eigen values/Eigen vectors based on correlation matrix Variable

Eigen values

Percent of variance

Cumulative per cent of variance

PC 1

2.964

74.1

74.1

PC 2

8.519E-01

21.3

95.4

PC 3

1.635E-01

4.1

99.5

PC 4

2.073E-02

0.5

100.0

Example 3

In this case, field experiments were conducted to study the effect of earthworm inoculation on tea (Camellia assamica) plant growth and production in South India (Giri, 2006). PCA was done using original data (variables) between the experimental sets by considering the physico-chemical and biological parameters. The physical variables considered for PCA were macroaggregate and for chemical variables were soil pH, electrical conductivity, total carbon, total organic

Fundamentals of Ecology

56

matter, total nitrogen and carbon: nitrogen ratio. The biological variables considered were shoot length, shoot weight, root length, root weight, number of leaves, number of rooting points, total plant length, total plant biomass, earthworm number and Earthworm biomass. Ten replicates, each from control set, and experimental set, were considered. Impact of control set without earthworm and earthworm inoculation

PCA was done between control set (with no organic input) and experimental set (no organic input but with earthworm inoculation). Table 2.10 shows the Eigen values/Eigen vectors based on correlation matrix indicating the percent of variance with respect to Principal component (PC). Figure 2.7 exhibits the scattered diagram showing the position of the experimental sets based on the correlation matrix. Table 2.10

Month

Per cent of variance with respect to Eigen values/Eigen vectors based on correlation matrix between the physico-chemical and biological parameters of tea cuttings with respect to control and only earthworm inoculation Principal component

Eigen values

Per cent of variance

Cumulative per cent of variance

Biological 4 months

6 months

8 months

Principal component 1

5.308

35.40

35.40

Principal component 2

3.537

23.60

59.00

Principal component 3

2.117

14.10

73.10

Principal component 4

1.344

9.00

82.00

Principal component 1

6.643

44.30

44.30

Principal component 2

3.687

24.60

68.90

Principal component 3

1.743

11.60

80.50

Principal component 4

0.938

6.30

86.70

Principal component 1

5.792

44.60

44.60

Principal component 2

3.557

27.40

71.90

Principal component 3

1.923

14.80

86.70

Principal component 4

0.941

7.20

93.90

Physical + Chemical 4 months

6 months

8 months

Principal component 1

5.439

77.70

77.70

Principal component 2

0.789

11.30

89.00

Principal component 3

0.498

7.10

96.10

Principal component 4

0.153

2.20

98.30

Principal component 1

5.858

83.70

83.70

Principal component 2

0.568

8.10

91.80

Principal component 3

0.315

4.50

96.30

Principal component 4

0.212

3.00

99.30

Principal component 1

5.663

80.90

80.90

Principal component 2

0.801

11.40

92.30 (Contd.)

Systems Concept in Ecology

57

Table 10 (contd.) Principal component 3

0.346

4.90

97.30

Principal component 4

0.105

1.50

98.80

Principal component 1

9.205

41.80

41.80

Principal component 2

3.864

17.60

59.40

Principal component 3

2.336

10.60

70.00

Principal component 4

2.072

9.40

79.40

Principal component 1

10.950

49.80

49.80

Principal component 2

3.872

17.60

67.40

Principal component 3

2.171

9.90

77.30

Principal component 4

1.734

7.90

85.10

Principal component 1

9.717

48.60

48.60

Principal component 2

3.942

19.70

68.30

Principal component 3

2.449

12.20

80.50

Principal component 4

1.334

6.70

87.30

Physical + Chemical + Biological 4 months

6 months

8 months

Source: S. Giri, 2006.

Physical and chemical parameter

PCA was done considering only the physico-chemical parameters. During 4-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 77.70% variance with respect to PC. With the help of PC2 value, 11.30% variance is explained. PC1 and PC2 cumulatively explained 89.00% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 96.10% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 6-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 83.70% variance with respect to PC1. With the help of PC2 value, 8.10% variance is explained. PC1 and PC2 cumulatively explained 91.80% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 96.30% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 8-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 80.90% variance with respect to PC1. With the help of PC2 value 11.40% variance is explained. PC1 and PC2 cumulatively explained 92.30% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 97.30% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. Biological parameter

PCA was done considering only the biological parameters. During 4-month-old experiment Eigen values/Eigen vectors based on correlation matrix indicated 35.40% variance with respect to PC1. With the help of PC2 value, 23.60% variance is explained. PC1 and PC2 cumulatively explained 59.00% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 73.10% is explained. Scattered diagram plotted against PC1 and PC2 showed two groups, which are overlapped at one end, indicating that there is difference between the two sets with similarity in values of some parameters. During 6-month-

Systems Concept in Ecology

59

old experiment Eigen values/Eigen vectors based on correlation matrix indicated 44.30% variance with respect to PC1. With the help of PC2 value 24.60% variance is explained. PC1 and PC2 cumulatively explained 68.90% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 80.50% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups, which are slightly overlapped at one end indicating that there is difference between the two sets with similarity in values of some parameters. During 8-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 44.60% variance with respect to PC1. With the help of PC2 value 27.40% variance is explained. PC1 and PC2 cumulatively explained 71.90% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 86.70% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. Physical, chemical and biological parameters

PCA was done considering only the physico-chemical and biological parameters. During 4-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 41.80% variance with respect to PC1. With the help of PC2 value, 17.60% variance is explained. PC1 and PC2 cumulatively explained 59.40% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 70.00% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 6-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 49.80% variance with respect to PC1. With the help of PC2 value, 17.60% variance is explained. PC1 and PC2 cumulatively explained 67.40% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 77.30% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 8-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 48.60% variance with respect to PC1. With the help of PC2 value, 19.70% variance is explained. PC1 and PC2 cumulatively explained 68.30% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 80.50% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups . . . indicating that there is difference between the two sets Impact of high quality organic matter input and earthworm inoculation

PCA was done between the set with high quality organic matter input and experimental set (high quality organic matter input and earthworm inoculation). Table 2.11 shows the Eigen values/Eigen vectors based on correlation matrix indicating the percent of variance with respect to PC. Figure 2.8 exhibits the scattered diagram showing the position of the experimental sets based on this correlation matrix. Table 2.11

Month

Per cent of variance with respect to Eigen values/ Eigen vectors based on correlation matrix between the physico-chemical and biological parameters of tea cuttings with respect to only high quality organic matter and high quality organic matter with earthworm inoculation Principal component

Eigen values

Per cent of variance

Cumulative per cent of variance

Biological 4 months

Principal component 1

4.978

33.20

33.20

Principal component 2

3.877

25.80

59.00 (Contd.)

Fundamentals of Ecology

60 Table 11 (contd.)

6 months

8 months

Principal component 3

2.207

14.70

73.70

Principal component 4

1.452

9.70

83.40

Principal component 1

7.682

51.20

51.20

Principal component 2

3.062

20.40

71.60

Principal component 3

1.827

12.20

83.80

Principal component 4

0.811

5.40

89.20

Principal component 1

6.902

53.10

53.10

Principal component 2

3.077

23.70

76.80

Principal component 3

1.305

10.00

86.80

Principal component 4

0.838

6.40

93.20

Principal component 1

5.493

78.50

78.50

Principal component 2

0.706

10.10

88.60

Principal component 3

0.422

6.00

94.60

Principal component 4

0.261

3.70

98.30

Principal component 1

3.356

49.70

47.90

Principal component 2

2.095

29.90

77.90

Principal component 3

0.900

12.90

90.70

Principal component 4

0.451

6.40

97.20

Principal component 1

2.893

41.30

41.30

Principal component 2

1.645

23.50

64.80

Principal component 3

0.925

13.20

78.00

Principal component 4

0.858

12.30

90.30

Principal component 1

9.111

41.40

41.40

Principal component 2

4.117

18.70

60.10

Principal component 3

2.657

12.10

72.20

Principal component 4

2.049

9.30

81.50

Principal component 1

10.630

48.30

48.30

Principal component 2

3.224

14.70

63.00

Principal component 3

2.524

11.50

74.50

Principal component 4

1.773

8.10

82.50

Principal component 1

7.950

39.70

39.70

Principal component 2

3.558

17.90

57.70

Principal component 3

2.347

11.70

69.40

Principal component 4

1.428

7.10

76.60

Physical + Chemical 4 months

6 months

8 months

Physical + Chemical + Biological 4 months

6 months

8 months

62

Fundamentals of Ecology

Physico-chemical parameter

PCA was done considering only the physico-chemical parameters. During 4-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 78.50% variance with respect to PC1. With the help of PC2 value, 10.10% variance is explained. PC1 and PC2 cumulatively explained 88.60% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 94.60% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 6-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 47.90% variance with respect to PC1. With the help of PC2 value 29.90% variance is explained. PC1 and PC2 cumulatively explained 77.90% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 90.70% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 8-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 41.30% variance with respect to PC1. With the help of PC2 value 23.50% variance is explained. PC1 and PC2 cumulatively explained 64.80% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 78.00% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. Biological parameter

PCA was done considering only the biological parameters. During 4-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 33.20% variance with respect to PC1. With the help of PC2 value, 25.80% variance is explained. PC1 and PC2 cumulatively explained 59.00% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 73.70% is explained. Scattered diagram plotted against PC1 and PC2 showed two groups, which is overlapped at one end indicating that there is difference between the two sets. During 6-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 51.20% variance with respect to PC1. With the help of PC2 value, 20.40% variance is explained. PC1 and PC2 cumulatively explained 71.60% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 83.80% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 8-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 53.10% variance with respect to PC1. With the help of PC2 value, 23.70% variance is explained. PC1 and PC2 cumulatively explained 76.80% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 86.80% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups, which are slightly overlapped at one end indicating that there is difference between the two sets with similarity in values of some parameters. Physical, chemical and biological parameters

PCA was done considering only the physico-chemical and biological parameters. During 4-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 41.40% variance with respect to PC1. With the help of PC2 value, 18.70% variance is explained. PC1 and PC2 cumulatively explained 60.10% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 72.20% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 6-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 48.30% variance with respect to PC1. With the help of PC2 value, 14.70% variance is explained. PC1 and PC2 cumulatively explained 63.00% of the total variance. With

Systems Concept in Ecology

63

the help of PC1, PC2 and PC3, cumulative variance of 74.50% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 8-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 39.70% variance with respect to PC1. With the help of PC2 value, 17.90% variance is explained. PC1 and PC2 cumulatively explained 57.70% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 69.40% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. Impact of low quality organic matter input and earthworm inoculation

PCA was done between set with low quality organic matter input and experimental set (low quality organic matter input and earthworm inoculation). Table 2.12 shows the Eigen values/Eigen vectors based on correlation matrix indicating the percent of variance with respect to PC. Figure 2.9 exhibits the scattered diagram showing the position of the experimental sets based on this correlation matrix. Physico-chemical parameter

PCA was done considering only the physico-chemical parameters. During 4-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 61.60% variance with respect to PC1. With the help of PC2 value, 24.60% variance is explained. PC1 and PC2 cumulatively explained 86.20% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 96.70% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating there is difference between the two sets. During 6-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 75.20% variance with respect to PC1. With the help of PC2 value, 13.50% variance is explained. PC1 and PC2 cumulatively explained 88.70% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 97.00% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating there is difference between the two sets. During 8-month-old experiment Eigen values/Eigen vectors based on correlation matrix indicated 39.00% variance with respect to PC1. With the help of PC2 value, 33.40% variance is explained. PC1 and PC2 cumulatively explained 72.40% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 83.60% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating there is difference between the two sets. Table 2.12

Per cent of variance with respect to Eigen values/ Eigen vectors based on correlation matrix between the physico-chemical and biological parameters of tea cuttings with respect to only low quality organic matter and low quality organic matter with earthworm inoculation

Month

Principal component

Eigen values

Per cent of variance

Principal component 1

4.447

29.60

29.60

Principal component 2

3.404

22.70

52.30

Principal component 3

2.579

17.20

69.50

Principal component 4

2.189

14.60

84.10

Cumulative per cent of variance

Biological 4 months

(Contd.)

Fundamentals of Ecology

64 Table 2.12 (contd.) 6 months

8 months

Principal component 1

6.778

45.20

45.20

Principal component 2

3.490

23.30

68.50

Principal component 3

1.769

11.80

80.20

Principal component 4

1.005

6.70

86.90

Principal component 1

5.730

44.10

44.10

Principal component 2

2.874

22.10

66.20

Principal component 3

1.923

14.80

81.00

Principal component 4

1.366

10.50

91.50

Physical + Chemical 4 months

6 months

8 months

Principal component 1

4.315

61.60

61.60

Principal component 2

1.722

24.60

86.20

Principal component 3

0.732

10.50

96.70

Principal component 4

0.171

2.40

99.10

Principal component 1

5.261

75.20

75.20

Principal component 2

0.948

13.50

88.70

Principal component 3

0.580

8.30

97.00

Principal component 4

0.164

2.30

99.30

Principal component 1

2.730

39.00

39.00

Principal component 2

2.336

33.40

72.40

Principal component 3

0.784

11.20

83.60

Principal component 4

0.544

7.80

91.30

Physical + Chemical + Biological 4 months

6 months

8 months

Principal component 1

7.144

32.50

32.50

Principal component 2

4.444

20.20

52.70

Principal component 3

2.850

13.00

65.60

Principal component 4

2.341

10.60

76.30

Principal component 1

11.030

50.10

50.10

Principal component 2

3.889

17.70

67.80

Principal component 3

2.057

9.30

77.20

Principal component 4

1.344

6.10

83.30

Principal component 1

6.886

34.40

34.40

Principal component 2

3.243

16.20

50.60

Principal component 3

2.497

12.50

63.10

Principal component 4

2.305

11.50

74.70

Biological parameter

PCA was done considering only the biological parameters. During 4-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 29.60% variance with respect to PC1. With the help of PC2 value, 22.70% variance is explained. PC1 and PC2 cumulatively explained 52.30% of the

Fig. 2.9

Ordination (PCA) of tea cuttings input operation experimental sets (low quality organic matter and earthworm inoculation) and months on the basis of physical, chemical and biological components.

Systems Concept in Ecology

65

66

Fundamentals of Ecology

total variance. With the help of PC1, PC2 and PC3, cumulative variance of 69.50% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups which are slightly overlapped at one end indicating that there is difference between the two sets with similarity in values of some parameters. During 6-month-old experiment Eigen values/ Eigen vectors based on correlation matrix indicated 45.20% variance with respect to PC1. With the help of PC2 value, 23.30% variance is explained. PC1 and PC2 cumulatively explained 68.50% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 80.20% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 8-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 44.10% variance with respect to PC1. With the help of PC2 value, 22.10% variance is explained. PC1 and PC2 cumulatively explained 66.20% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 81.00% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups which is overlapped at one end indicating there is difference between the two sets with similarity in values of some parameters. Physical, chemical and biological parameters

PCA was done considering only the physico-chemical and biological parameters. During 4-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 32.50% variance with respect to PC1. With the help of PC2 value 20.20% variance is explained. PC1 and PC2 cumulatively explained 52.70% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 65.60% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating there is difference between the two sets. During 5-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 50.10% variance with respect to PC1. With the help of PC2 value, 17.70% variance is explained. PC1 and PC2 cumulatively explained 67.80% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 77.20% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 8-month-old experiment Eigen values/Eigen vectors based on correlation matrix indicated 34.40% variance with respect to PC1. With the help of PC2 value, 16.20% variance is explained. PC1 and PC2 cumulatively explained 50.60% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 63.10% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. Impact of both high and low quality organic matter input and earthworm Inoculation

PCA was done between the set with both high and low quality organic matter input and experimental set (high and low quality organic matter input and earthworm inoculation). Table 2.13 shows the Eigen values/Eigen vectors based on correlation matrix indicating the percent of variance with respect to PC. Figure 2.10 exhibits the scattered diagram showing the position of the experimental sets based on this correlation matrix. Physical and chemical parameter

PCA was done considering only the physico-chemical parameters. During 4-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 59.40% variance with respect to PC1. With the help of PC2 value, 14.30% variance is explained. PC1 and PC2 cumulatively explained 73.70% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 84.20% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups, which are slightly overlapped

Systems Concept in Ecology

67

at one end indicating that there is difference between the two sets with similarity in values of some parameters. During 6-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 72.10% variance with respect to PC1. With the help of PC2 value 17.10% variance is explained. PC1 and PC2 cumulatively explained 89.30% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 93.30% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 8-month-old experiment Eigen values/Eigen vectors based on correlation matrix indicated 74.50% variance with respect to PC1. With the help of PC2 value, 13.60% variance is explained. PC1 and PC2 cumulatively explained 88.10% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 95.30% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating there is difference between the two sets. Table 2.13

Month

Per cent of variance with respect to Eigen values/Eigen vectors based on correlation matrix between the physico-chemical and biological parameters of tea cuttings with respect to only high and low quality organic matter and high and low quality organic matter with earthworm inoculation Principal component

Eigen values

Per cent of variance

Cumulative per cent of variance

Biological 4 months

6 months

8 months

Principal component 1

4.674

31.20

31.20

Principal component 2

3.804

25.40

56.50

Principal component 3

2.692

17.90

74.50

Principal component 4

1.341

8.90

83.40

Principal component 1

6.819

45.50

45.50

Principal component 2

3.456

23.00

68.50

Principal component 3

2.033

13.60

82.10

Principal component 4

1.292

8.60

90.70

Principal component 1

6.144

47.30

47.30

Principal component 2

2.617

20.10

67.40

Principal component 3

2.063

15.90

83.30

Principal component 4

1.067

8.20

91.50

Principal component 1

4.155

59.40

59.40

Principal component 2

1.004

14.30

73.70

Principal component 3

0.737

10.50

84.20

Physical + Chemical 4 months

6 months

Principal component 4

0.554

7.90

92.10

Principal component 1

5.050

72.10

72.10

Principal component 2

1.197

17.10

89.30

Principal component 3

0.285

4.10

93.30

Principal component 4

0.232

3.20

96.50 (Contd.)

Fundamentals of Ecology

68 Table 2.13 (contd.) 8 months

Principal component 1

5.218

74.50

74.50

Principal component 2

0.949

13.60

88.10

Principal component 3

0.505

7.20

95.30

Principal component 4

0.218

3.10

98.40

Principal component 1

7.246

32.90

32.90

Principal component 2

4.739

21.50

54.50

Principal component 3

2.867

13.00

67.50

Principal component 4

2.306

10.50

78.00

Principal component 1

11.550

52.50

52.50

Principal component 2

3.607

16.40

68.90

Principal component 3

2.085

9.50

78.40

Physical + Chemical + Biological 4 months

6 months

8 months

Principal component 4

1.385

6.30

84.70

Principal component 1

10.120

50.60

50.60

Principal component 2

3.068

15.30

65.90

Principal component 3

2.125

10.60

76.50

Principal component 4

1.457

7.30

83.80

Biological parameter

PCA was done considering only the biological parameters. During 4-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 31.20% variance with respect to PC1. With the help of PC2 value, 25.40% variance is explained. PC1 and PC2 cumulatively explained 56.50% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 74.50% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups, which is slightly overlapped at one end indicating that there is difference between the two sets with similarity in values of some parameters. During 6-month-old experiment Eigen values/Eigen vectors based on correlation matrix indicated 45.50% variance with respect to PC1. With the help of PC2 value, 23.00% variance is explained. PC1 and PC2 cumulatively explained 68.50% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 82.10% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating there is difference between the two sets. During 8-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 47.30% variance with respect to PC1. With the help of PC2 value 20.10% variance is explained. PC1 and PC2 cumulatively explained 67.40% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 83.30% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. Physical, chemical and biological parameters

PCA was done considering only the physico-chemical and biological parameters. During 4-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 32.90% variance with respect to PC1. With the help of PC2 value, 21.50% variance is explained. PC1 and PC2 cumulatively explained 54.50% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 67.50%

Fig. 2.10

Ordination (PCA) of tea cuttings input operation experimental sets (high and low quality organic matter and earthworm inoculation) and months on the basis of physical, chemical and biological components.

Systems Concept in Ecology

69

70

Fundamentals of Ecology

is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 6-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 52.50% variance with respect to PC1. With the help of PC2 value, 16.40% variance is explained. PC1 and PC2 cumulatively explained 68.90% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 78.40% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 8-month-old experiment, Eisgen values/Eigen vectors based on correlation matrix indicated 50.60% variance with respect to PC1. With the help of PC2 value 15.30% variance is explained. PC1 and PC2 cumulatively explained 65.90% of the total variance. With the help of PC1, PC2 and PC3 cumulative variance of 76.50% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. Biological parameter

PCA was done considering only the biological parameters. During 4-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 31.20% variance with respect to PC1. With the help of PC2 value, 25.40% variance is explained. PC1 and PC2 cumulatively explained 56.50% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 74.50% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups, which are slightly overlapped at one end indicating that there is difference between the two sets with similarity in values of some parameters. During 6-month-old experiment Eigen values/Eigen vectors based on correlation matrix indicated 45.50% variance with respect to PC1. With the help of PC2 value, 23.00% variance is explained. PC1 and PC2 cumulatively explained 68.50% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 82.10% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 8-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 47.30% variance with respect to PC1. With the help of PC2 value, 20.10% variance is explained. PC1 and PC2 cumulatively explained 67.40% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 82.10% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 8-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 47.30% variance with respect to PC1. With the help of PC2 value, 20.10% variance is explained. PC1 and PC2 cumulatively explained 67.40% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 83.30% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. Physical, chemical and biological parameters

PCA was done considering only the physico-chemical and biological parameters. During 4-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 32.90% variance with respect to PC1. With the help of PC2 value, 21.50% variance is explained. PC1 and PC2 cumulatively explained 54.50% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 67.50% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that there is difference between the two sets. During 6-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 52.50% variance is explained. PC1 and PC2 cumulatively explained 68.90% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 78.40% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating that

Systems Concept in Ecology

71

there is difference between the two sets. During 8-month-old experiment, Eigen values/Eigen vectors based on correlation matrix indicated 50.60% variance with respect to PC1. With the help of PC2 value 15.30% variance is explained. PC1 and PC2 cumulatively explained 65.90% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 76.50% is explained. Scattered diagram plotted against PC1 and PC2 showed two distinct groups indicating, that there is difference between the two sets. PCA with respect to all parameters (physical, chemical and biological) and input operation experimental sets

PCA was done considering the eight input operation experimental sets, i.e. (i) control set with no input, (ii) set with only earthworm application, (iii) set with only high quality organic matter application, (iv) set with high quality organic matter and earthworm application, (v) set with only low quality organic matter application, (vi) set with low quality organic matter and earthworm application, (vii) set with only high and low quality organic matter application and (viii) set with both high and low quality organic matter and earthworm application, with that of physico-chemical and biological parameters. The physical variable considered was macro-aggregate and chemical variables were soil pH, electrical conductivity, total carbon, total organic matter, total nitrogen and carbon: nitrogen ratio. The biological variables considered were shoot length, shoot weight, root length, root weight, number of leaves, number of rooting points, total plant length, total plant biomass, earthworm number and earthworm biomass. Ten replicates, each from all the sets, were considered. PCA of 8-month-old experiment was taken into account as it could give a clear picture of the effects shown both by the different individual inputs and their association with other input and earthworms. Eigen values/Eigen vectors based on correlation matrix indicated 35.80% variance with respect to PC1. With the help of PC2 value, 19.00% variance is explained. PC1 and PC2 cumulatively explained 54.90% of the total variance. With the help of PC1, PC2 and PC3, cumulative variance of 66.40% is explained (Table 2.14). Scattered diagram plotted against PC1 and PC2 showed two groups slightly overlapping at one end indicating that there is difference between the sets on the basis of with and without earthworm inoculation (Fig. 2.11). When it was tried to look into the effect of individual input operational set with that of the respective earthworm inoculated set, there was distinct segregation between the sets. It may be concluded that the organic input individually plays their role in plant production but with the association of earthworm their role is further enhanced. Table 2.14

Month

Per cent of variance with respect to Eigen values/Eigen vectors based on correlation matrix between the physico-chemical and biological parameters of tea cuttings with respect to eight input operation experimental sets Principal component

Eigen values

Per cent of variance

Cumulative per cent of variance

Principal component 1

7.167

35.80

35.80

Principal component 2

3.807

19.00

54.90

Principal component 3

2.310

11.50

66.40

Principal component 4

1.640

8.20

74.60

Physical + Chemical + Biological 8 months

Fig. 2.11

Ordination (PCA) of tea cuttings input operation experimental sets (high and low quality organic matter and earthworm inoculation) and months on the basis of physical, chemical and biological components.

72 Fundamentals of Ecology

Systems Concept in Ecology

73

For this PCA statistics, the parameters considered for tea cutting culture were (i) physical (macroaggregate), (ii) chemical (soil pH, electrical conductivity, total oxidisable carbon, total oxidisable organic matter, total nitrogen, nitrate, available phosphorus, available potassium, available calcium and carbon:nitrogen ratio) and (iii) biological (shoot length, shoot weight, root length, root weight, number of leaves, number of rooting points, total plant biomass, earthworm number and biomass) with respect to the eight numbers of different input operation experimental sets. Impact of set without (earthworm) and with earthworm inoculation

PCA was done between the control set (i.e. without different quality of organic matter input and without earthworm inoculation) and the experimental set (without different quality of organic matter input but with only earthworm inoculation). Scattered diagram was plotted considering the PC1 and PC2 which showed the position of the different sets based on the correlation matrix. Further, scattered diagram was plotted considering only biological, physical+chemical and physical+chemical+biological parameters. From the picture obtained (Fig. 2.7), it was observed that when biological parameter was considered, there was overlapping among the sets during 4-and 6-month-old tea plants but during 8-months there was slight separation. When physical and chemical parameter was considered, there was clear separation among the sets during all the months and similar result was also observed when all the parameters (physical, chemical and biological) were considered. It can be concluded that the individual contribution of earthworm towards physical and chemical parameters was more than the biological parameter in the input set where only earthworm was inoculated. But when all the parameters were taken together, the segregation between the input sets was significant, (also proved through two way ANOVA calculation) proving that the earthworm contributed significantly to the physical, chemical and biological parameters which overall increased the plant growth. Impact of high quality organic matter input and earthworm inoculation

PCA was done between the control set (i.e. with high quality organic matter input but without earthworm inoculation) and the respective experimental set (i.e. set with high quality organic matter input and earthworm inoculation). Scattered diagram was plotted considering the PC1 and PC2 which showed the position of the different sets based on the correlation matrix. Further scattered diagram was plotted considering only biological, physical + chemical and physical+chemical+biological parameters. From the picture obtained (Fig. 2.8), it was observed that when only biological parameters were considered, there was overlapping among the sets in the 4-and 8-month-old sets. But during 6 months, there was clear separation. When physical and chemical parameters alone were considered, there was clear separation between the two input sets during all the months and similar result was also observed when all the parameters (physical, chemical and biological) were considered. It can be concluded that the individual contribution of earthworm towards physical and chemical parameters was more than the biological parameter in the input set where high quality organic matter and earthworm was inoculated. But when all the parameters were taken together, the segregation among the input sets was significant (also supported through two way ANOVA), proving that the earthworm contributed significantly to the physical, chemical and biological parameters, which further induced the plant growth.

74

Fundamentals of Ecology

Impact of Low Quality Organic Matter input and Earthworm Inoculation

PCA was done between the control set (i.e. with low quality organic matter input but without earthworm inoculation) and the respective experimental set (i.e. set with low quality organic matter input and earthworm inoculation). Scattered diagram was plotted considering the PC1 and PC2 which showed the position of the different sets based on the correlation matrix. Further scattered diagram was plotted considering only biological, physical + chemical and physical + chemical + biological parameters. From the picture obtained (Fig. 2.9), it was observed that when only biological parameters were considered, there was overlapping among the sets in the 4-and 8-month-old sets. But during 6 months, there was clear separation. When physical and chemical parameters alone were considered, there was clear separation between the two input sets during all the months and similar result was also observed when all the parameters (physical, chemical and biological) were considered. Same result was obtained as observed with the set inoculated with high quality organic matter, which indicates that impact of the individual quality of organic matter (i.e. high or low) with that of earthworm association, the separation between the input sets was more or less similar. But overall, there was significant contribution to the plant growth to that of control set (without different quality of organic matter input or earthworm inoculation). Impact of both high and low quality organic matter input and earthworm inoculation

PCA was done between the control set (i.e., with both high and low quality organic matter input but without earthworm inoculation) and the respective experimental set (i.e., set with both high and low quality organic matter input and earthworm inoculation). Scattered diagram was plotted considering the PC1 and PC2 which showed the position of the different sets based on the correlation matrix. Further scattered diagram was plotted considering only biological, physical + chemical and physical+chemical +biological parameters. From the picture obtained (Fig. 2.10), it was observed that when only biological parameters was considered, there was overlapping among the sets in the 4-month-old sets. But during 6 and 8 months, there was clear separation. When physical and chemical parameters alone was considered, there was clear separation between the two input sets during 6 and 8 months except during 4 months but when all the parameters (physical, chemical and biological) were considered, there was clear separation between the sets. It can be concluded that when set applied with both high and quality organic matter and earthworm, there was more contribution to the physical and chemical and biological parameters by the earthworm which overall showed its impact on the plant growth to that of its respective control set (set applied both with high and low quality organic matter but without earthworm inoculation). PCA with respect to all parameters (physical, chemical and biological) and various input operation experimental sets

PCA was plotted during the 8 months taking all parameters (physical, chemical and biological) and the eight numbers of various input sets. It was observed that (Fig. 2.11) when all sets and parameters were taken together, there was a clear separation of the input sets with earthworm inoculation to that of input sets without earthworm inoculation. Meanwhile, the respective input set with or without earthworm inoculation showed clear separation in between them. This overall proves that earthworm contributes individually as well as the contribution is further enhanced when some organic matter is associated with it. PCA helps to arrive at these conclusions and, thus, PCA is considered an important statistical tool for ecological research.

Systems Concept in Ecology

2.5

75

PRIMARY AND SECONDARY PRODUCTION

2.5.1 Primary Production

Primary production refers to all or any part of the energy fixed by plants possessing chlorophyll. Productivity refers to the rate of production on a unit area basis. The total amount of solar energy converted (fixed) into chemical energy by green plants is called gross primary production (GPP). A certain portion of gross production (GPP) is utilised by plants for maintenance (largely respiratory energy loss) and the remainder is called net primary production (NPP), which appears as new plant biomass. Thus: GPP NPP + R (respiration) or NPP = GPP—autotrophic respiration (R). The biochemical formula that describes photosynthesis in green plants is H2O + CO2 + Solar energy Chlorophyll of plants

(CH2O)n + O2

Solar energy splits the water molecule, the hydrogen is used to reduce CO2 to CH2O in a complex biochemical process involving enzymes, and water is formed. Due to the spliting of water by solar energy, oxygen is released from water and not from CO2. The process is described in Figs. 2.12 A and B. Since it is a biochemical process, the theoretical maximum possible of primary production or photosynthesis can be estimated. Researches in photosynthesis indicate that the process of photosynthesis can operate with 20% efficiency, i.e. 20% of the input solar energy can be converted into chemical energy. It is now known that about 10 quanta of light are required to reduce one molecule of CO2. Ten quanta of light supply about 2176 kJ (about 520 kcal) of energy per CO2 molecule but one CO2 molecule stores about 439 kJ (105 kcal. Hence the quantum efficiency of a photosynthetic process is 20% (439/ 2176 = 0.2019). It is now known that

Fig. 2.12

The photosynthetic process (explaining the concept, and light and dark reactions) (From various sources)

Fundamentals of Ecology

76

the rate of photosynthesis increases with increase in light intensity up to 10 to 20% of full sunlight and then becomes independent of it. But the heating effect may inhibit photosynthesis after some time. This process is called light saturation and occurs very rapidly. In contrast to photosynthesis, light absorption by the leaves of C3 plants is directly related to light intensity. It is known that on an average sun leaves absorb about 80% and shade leaves about 65% of incident sunlight. Thus, the above calculation may be modified as follows: The overall photosynthetic efficiency is only 3.2% because leaves absorb 80% of the incident light and use 20% with an efficiency of 20% (0.20 ¥ 0.20 ¥ 0.80 = 0.032 or 3.2%). This is the efficiency for sun leaves. For shade leaves the efficiency is 0.20 ¥ 0.20 ¥ 0.65 = 0.026 or 2.6%. With the assumption that the solar energy input to vegetation averages about 20920 kJ/m2/day, the production process yields about 669 kJ/m2/day (20920 ¥ 0.032 = 669.55 kJ) for sun leaves and 544 kJ/m2/day for shade leaves. Plant biomass on the average contains about 16.74 kJ/g (4 kcal approx.) dry weight; thus 669.44/16.74 = 39.99 or 40 g dry weight/m2/day. is produced. For shade leaves this amount will be 544/16.74 = 32 g dry weight/ m2/day. In field conditions, the production may vary from 40 to 75 g/day/ m2. However, C4 plants (many tropical grasses including sugarcane) have a higher productivity due to lack of photorespiration. The grain, straw, stalks, roots, etc., harvested from a paddy field after a growing season comprise the net primary production. During the growing season, paddy plants spend energy in metabolism (respiration). This energy is fixed in photosynthesis and contributes to maintenance and hence does not appear as an increase in the weight of the plants. The above discussion indicates that primary production can also be defined as the accumulation of dry matter by autotrophic plants. The quantification of photosynthesis processes usually does not take the nutrient uptake into account—it should be clear that dry matter production (primary production) may be equal to photosynthesis with nutrient uptake. Primary production is of special importance in ecology, since it is the energy fixed by plants by converting solar energy into the chemical energy of food material that supports life in other trophic levels also. The objective of studying the primary productivity of a particular ecosystem is to obtain quantitative information about the amount of energy available for supporting life in that ecosystem. 2.5.2 Primary Production Process

The pigment system found in photoautotrophs is essential for the conversion of solar energy into chemical energy. These pigments may be of many types (Table 2.15) and their absorption peaks are Table 2.15

Chlorophyll types and their absorption peaks

Chlorophill types

Absorption peaks (nm)

Examples of plants in which they occur

Chlorophill a

435, 670 to 680

All green plants and algae

Chlorophill b

480, 650

All green plansts, but not found in blue-green, brown and red algae

Chlorophill c

645

Diatoms, dinoflagellates, and brown algae

Chlorophill d

740

Diatoms, donoflagellates and brown algae

Chlorophill e

Dinoflagellates, diatoms, etc

Bacterioviridin

750 to 760

Green sulphur bacteria

Bacteriochlorophill

800, 850 and 890

Autotrophic bacteria

Systems Concept in Ecology

77

also different. Chlorophyll a and b are found in all autotrophic organisms, except pigment-containing bacteria. Chlorophyll a differs from chlorophyll b in having a methyl group (—CH3) at the third carbon instead of an aldehyde group (—CHO) as in chlorophyll b. In addition, chlorophyll a is more soluble in methyl alcohol. Chlorophyll b is not found in blue-green, brown and red algae. The other species of chlorophyll (c, d, e) are found in diatoms, dinoflagellates, brown algae, etc. 2.5.3

Factors Important for Primary Production

The GPP of a plant is a function of physiological, biochemical, genetic and ecological conditions. The production efficiency in plants depends upon many factors, such as (a) the light intensity, (b) the quantum efficiency of light, (c) the leaf arrangement on the plants, (d) the leaf area index and (e) the type of plant (whether C3 or C4). Besides, many allometric relationships on leaf weight and canopy height, percentage light interception and height, age of a vegetation stand and leaf biomass, age of a stand and production, diameter at breast height and respiration/biomass ratio, leaf area index and productivity have been investigated by many workers and these relationships have been established (Figs. 2.13 A and B, 2.14 and 2.15 A and B). In a natural forest ecosystem, the major portion of plant leaf biomass is distributed in the midsection of the canopy. Since individual plants compete for maximum sunlight, the canopy structure becomes very important. Hence, the height of plants becomes important in a forest ecosystem. Light interception may therefore follow a typical relationship with canopy height. The ratio of a unit ground surface area to the surface area of the leaves above is called the leaf area index (LAI). LAI is also defined as the area of leaf surface exposed to sunlight over a specified area of the ground surface. An LAI of 4 to 5 is considered ideal for high net primary productivity of crop plants, but the maximum GPP (gross primary

Fig. 2.13(A)

Allometric relationships—related to primary productivity (relationships between light intensity and photosynthetic rate, maximum photosynthetic rate occurring at 20% full sunlight, maximum leaf biomass in the middle portion of the forest canopy and light interception by the canopy are shown (based on Vyas and Golley, 1975).

78

Fig. 2.13(B)

Fig. 2.14

Fundamentals of Ecology

Relationships between age of forest stand and leaf biomass, gross and net primary production are shown.

Allometric relationships between DBH (diameter at breast height) of trees and respiratory rate, tree biomass (both leaf and woody biomass) are shown (based on Vyas and Golley, 1975).

production) is attained with an LAI of 8 to 10 or even as high as 12 to 15. Thus the selection of genetically better varieties of crops in nowadays done so that the crop can leaf out quickly to achieve an LAI of 4, which is maintained up to harvest time. This selection procedure does not necessarily increase the total dry matter production of the whole plant, such as straw, stem, root, etc. but redistribution of

Systems Concept in Ecology

Fig. 2.15(A)

79

Relationships between LAI (leaf area index) and maximum gross photosynthesis are shown. Maximum net primary production of crops occurs at an LAI of 4 to 6 and maximum gross primary production in climax forests (natural ecosystem) occurs at an LAI of 8 to 10. GPP for gross primary production and NPP for net primary production. Maximum grain yield occurs at around five months of vegetative life (data from various sources).

production occurs so that more assimilates go into the formation of grains and less into other parts. Besides, this artificial selection procedure also helps in the production of a high grain-to-straw ratio. Considering these facts, Odum (1971) concluded that ‘nature maximises for gross production whereas man ‘maximises for net primary production’. Maintenance cost In tropical rain forests the maintenance cost of plants may go up to as high as 80% of GPP, whereas the maintenance cost of crop plants may be 20 to 30% of GPP. 2.5.4 Primary Productivity in World Sites

Fig. 2.15(B)

Relationship between intensity of sunlight, temperature and rate of photosynthesis in C3 and C4 plants. Rate of photosynthesis for unit leaf area is significantly higher in C4 plants in different sunlight and temperature conditions

Reviews of primary productivity in different ecosystems around the world have been published by Golley (1972), Lieth (1972 a, b, 1977), Coopland (1979) and others. Estimates of many Indian ecosystems are now available (Misra, 1972, Ambasht, 1988, Singh and Joshi, 1979, Dash et al., 1974, Senapati and Dash, 1981, Pradhan and Dash, 1984). These data are summarised in Tables 2.16 and 2.17.

Fundamentals of Ecology

80

Table 2.16

Annual estimates of primary production in dtfferent ecosystems Gross production

Ecosystem

(kg/m2)

(1012kg/ total area)

6.7

159.6

Temperature

4.3

Boreal

2.7

Grassland pasture

Net production (kg/m2)

(1012kg/ total area)

Total area (106 km2)

Average kJ per gram

2.0

48.0

24

17.57

26

1.3

7.8

06

19.25

27

0.8

8.0

10

19.66

0.9

31

0.5

18.0

40

16.74

Desert

0.12

3

0.07

1.8

25

16.74

Tundra

0.30

3

0.20

2.0

10

19.66

Cultivated lands

1.10

16

0.65

9.8

15

17.99

Snow and ice

0.0

0.0

0.00

0.0

13

0.00

0.30

2.0

0.00

1.4

07

16.74

96.8

150

Terrestrial: Forests Tropical and subtropical

and savanna

caps Other Total Terrestrial

267.6 (¥ 18,000 kJ)

(¥ 18,000 kJ)

Aquatic Open ocean

0.20

68

0.125

41

326

20.92

Costal zones

0.60

20

0.350

12

34.5

20.92

Estuaries

4.0

8.5

2.42

4.8

02

20.92

57.8

362.5

Total Aquatic

96.5 (¥ 20,920 kJ)

Total for Biosphere

364

(¥ 20,920 kJ) 154.6

512.5

Data collected from many sources, Golley (1961), Ovington and Heitkamp (1960), Cummins (1967), Woodwell and Whittaker (1968), Whittaker (1970), Odum (1971) and Lieth (1972, 1977).

The data suggests that tropical rain forests, estuaries and agriculture systems are the most productive. The net primary productivity of terrestrial ecosystems (grasslands and forests) is similar. The highest net primary production (42.3 t/ha/year) was found in the Heteropogon grassland at Varanasi and in some teak plantations. The rainfall pattern and the evaporation and precipitation ratio control the growth of vegetation. The net productivity in tropical ecosystems is almost double that of temperate terrestrial ecosystems (Rodin and Bazilevich, 1965). Net primary productions for most mature temperature zone forests in favourable climates range from 12 to 15 t/ha/year and 4 to 10 t/ha/year for many other forests (Woodwell and Whittaker, 1968). Leaf production ranges from more than 7 t/ha/year in tropical rain forests to 3 to 4 t/ha/year in many temperate-zone forests. In some Indian forests the leaf fall ranges from some 1 to 17 t/ha/year. A higher amount of leaf production in tropical sites may be due to a

Systems Concept in Ecology

Table 2.17

Net primary production at some Indian sites

Site

Dominant species

Annual net production (t/ha)

81

Source

Grassland/Pasture/Savanna Delhi

Heteropogon

13.4

Varshney (1972) (quoted by Ambasht,1988)

Varanasi

Heteropogon contortus

42.2

Singh (1972) (quoted by Ambasht, 1988)

(protected, moist) Varanasi

Heteropogon/Desmostachya (protected)

15.5

Misra (1980) (quoted by Ambasht, (1988)

Varanasi

Heteropogon cuntortus (grazed, stony)

15.4

Quoted by Ambasht (1988)

Varanasi

Heteropogon bothriochloa (protected)

13.8

Quoted by Ambasht (1988)

Varanasi

Desmostachya bipinnata (grazed)

8.3

Quoted by Ambasht (1988)

Varanasi

Aristida cyanantha (protected)

23.6

Quoted by Ambasht

(grazed)

20.1

(1988)

Varanasi

Vetiveria zizanioides

17.7

Quoted by Ambasht (1988)

Kurukshetra

Mixed

23.3

Singh (1970) (quoted by Ambasht, 1988)

Udaipur

Mixed

3.7

Vyas (1970) (quoted by Ambasht, 1988)

Jodhpur

Mixed

3.2

Vyas (1978) (quoted by Ambasht, 1988)

Sambalpur

Andropogon pumilus, Eragrostis viscosa (hill bottom), Cynodon sp. and some non-grass

6.6

Pradhan and Dash (1984)

Sambalpur

Cynodon dactylon (grazed)

9.75

Senapati and Dash (1981)

Eragrostis amabilis (protected)

8.0

Berhampur

Cynodon dactylon, Hygrorhiza sp. (protected)

Ujjain

Mixed

19.4 7.99—8.55

Dash et al (1974) Billore and Mall (1977) (quoted by Ambasht, 1988)

Forests Chakia, UP

Tectona grandis 13-year-old stand

10.61

Singh (1978) (quoted by Ambasht, 1988)

4.46

Singh (1978) (quoted by Ambasht, 1988)

(protected) (grazed (deciduous)

15.5

Misra (1970, 1972) (quoted by Ambasht, 1988)

Rajasthan

Tectona grandis (wood biomass)

21.1

Agrawal (1972) (quoted by Ambasht, 1988)

Udaipur

Erythrina (wood biomass)

31.7

Quoted by Vyas (1975) (Contd.)

Fundamentals of Ecology

82 Table 2.17 (contd.) Kalimpong Himalaya

Alnus nepalensis 1. 7-year-old stand

25.08

Sharma (1985) (quoted by

2. 17-year-old stand

19.73

Ambasht, 1988)

3. 30-year-old stand

18.74

4. 46-year-old stand

16.14

5. 56-year-old stand

12.99

higher temperature, longer growing season and greater amount of insolation. Leaf production may be about 30% of the above-ground NPP. Recent information indicates that the NPP due to roots may be considerable (up to 75%). The total dry weight biomass of above-ground parts in many mature temperate-zone forests in favourable climates may range from 300 to 500 t/ha and in less favourable climates from 50 to 200 t/ha (Woodwell and Whittaker, 1968). In terrestrial and aquatic ecosystems, great differences occur in plant sizes. This size difference causes considerable variation in the dry weight biomass per unit area in both ecosystems. For example, if the standing crop is 10 kg/m2 in a forest ecosystem, it will be about 5–10 g/m2 in an aquatic ecosystem. But productivity is very high in aquatic ecosystems. The 5–10 g/m2 plant biomass may synthesise almost the same amount as is manufactured by the 10 kg plant biomass/m2 of a forest ecosystem, in a given time. This occurs largely due to: (a) Different rates of metabolism. The rate of metabolism of 1 g of small phytoplankton in an aquatic system is much greater than the metabolism of 1 g of plant tissue in a forest. (b) In land plants the tissue is largely inactive woody tissue. Only leaves, which comprise up to 5% of the total plant biomass, are photosynthetically active. (c) The turnover time of phytoplankton is only a few days whereas that for trees is several years. Turnover is the ratio of the standing state of abiotic and biotic material to the rate of replacement of the standing state. For example, if the biomass of a forest is 15 kg/m2 and the annual growth increment is 1 kg, then the ratio 15/1 is called the turnover time (15 years). The turnover rate amounts to the reciprocal of the turnover time and in the example cited above it is 1/15. The turnover rate and turnover time provide us valuable information about nutrient cycling and the movement of chemicals in the ecosystem. 2.5.5 Relationship of GPP, NPP and Autotrophic Respiration

Many studies indicate that the GPP is about 1 to 5% of the solar radiation available. In C4 plants, this efficiency may increase to about 11%. The NPP is around 52 to 85% of GPP in many natural ecosystems. Respiration may account for some 15 to 48% of GPP (Table 2.19). In the river Ib, Kar et al. (1987) estimated GPP, NPP, and the respiration of phytoplankton by the dark and light bottle method over a period of two years—the seasonal averages are given in Table 2.18.

Systems Concept in Ecology

Table 2.18

83

GPP, NPP, and respiration by phytoplankton in river lb

Season

Productivity (gc/m3/day) (kJ/m3/day) GPP

Respiration

NPP

Rainy

1.70 (8.05)

0.95 (4.45)

0.75 (3.55)

Winter

1.60 (7.58)

0.20 (0.95)

1.40 (6.63)

Summer

0.75 (3.55)

0.30 (1.42)

0.45 (2.13)

Average

1.35 (6.40)

0.49 (2.28)

0.86 (4.12)

As per the photosynthetic equation, the relationship is as follows: C6/C6H12O6 (molecular composition), 72/180 (molecular weight). Thus 1.35 gc will be there in 3.375 g glucose (56.40 kJ of GPP) Accordingly NPP is 35.98 kJ and respiration 20.38 kJ. Table 2.19

The GPP, NPP and respiratory values of various ecosystems NPP

R

R

GPP

GPP

NPP

River Ib, India

0.64

0.36

0.56

Kar et al (1987)

Lake Mendota, USA

0.75

0.25

0.33

Juday (1940)

Cedar Bog lake, USA

0.79

0.21

0.26

Lindeman (1942)

Cornfield, USA

0.77

0.23

0.30

Transeau (1926)

Ecosystem

Perennial grass herb, USA

0.85

0.15

0.18

Golley (1960)

Old field, USA

0.52

0.48

0.92

Golley (1960)

Salt marsh, USA

0.23

0.77

3.34

Teal (quoted by Komiondy, 1978)

Prior to 1965, CO2 fixation through photosynthesis was believed to occur only through the Calvin cycle. In 1965, Kortschak, Hartt and Burr working on C14O2 fixation on sugarcane leaves observed that C4 dicarboxylic acid, malate and aspartate were the major labelled products. This finding was confirmed by Hatch and Slack (1966) of Australia and they elucidated the alternate CO2 fixation pathway. Some of these important C4 plants are sugarcane, maize and sorghum. In these plants CO2 fixation occurs more efficiently than in C3 plants. The net photosynthetic rate is also higher in C4 plants due to the lack of photorespiration. C4 plants have an efficient enzyme system (PEP carboxylase) which can absorb CO2 much more efficiently at low CO2 levels than C3 plants which have an RuDP carboxylase enzyme system. C4 plants are well adapted to growing with low water content, in the higher temperatures of the tropics and subtropics, and higher light intensities at which photosynthesis in C3 plants would have stopped (Hatch and Slack 1970). 2.5.6 Methods for Measuring Primary Production The harvest method The harvest method is the oldest one used to measure primary production. Farmers use it to estimate yields from their crop fields. It is used to estimate primary production in eco-

84

Fundamentals of Ecology

systems where a steady-state condition is never reached and in which herbivores do not remove much material, as in terrestrial ecosystems, particularly cultivated crop fields. In this method, efforts are made to prevent insects and other herbivores from removing grains from the crop field. At the time of planting seeds in the field, the rate of production remains zero, while it reaches a maximum at harvest time. This method measures the net primary production in one growing season taking the difference in the weight of seeds sown and the final harvested products, such as grains, straw, stem and roots. It is very simple to measure net primary production. The ecologist can remove the roots, stems, straw and grains either from a grassland or a cultivated crop field, periodically or after the growing season, to estimate the net primary productivity. The materials removed by herbivores are not taken into account and neither the energy spent by plants for their maintenance nor the GPP is measured. This method is extremely convenient for measuring the NPP in grasslands and crop fields, but there are some limitations to it. Oxygen measurement method (light and dark bottle method) There is a definite relationship between the oxygen evolved and the food produced in the photosynthetic process. Oxygen production can therefore be taken as a basis for determining primary productivity. In this method, pairs of water samples in sampling bottles of 125-300 ml capacity containing phytoplankton and some heterotrophs like zooplankton are usually taken from a known depth of an aquatic ecosystem. One of the paired sampling bottles is completely darkened to prevent photosynthesis but allow respiratory activity of the organisms. The other bottle is a light-transmitting glass bottle which permits photosynthesis to occur. The bottles are suspended at the desired water depth and allowed to incubate for a given period of time (say 4 to 6 hours). At the beginning and end of the experiment, the oxygen content of water is determined either by Winkler’s method (chemical method) or by the use of some electronic devices. The change in oxygen content in the light bottle can be fitted into the phdtosynthetic equation to determine the amount and rate of photosynthesis. By using oxygen depletion data from the dark bottle the respiratory oxygen consumption is determined. Thus by combining the results of the dark and light bottles, the GPP can be estimated. By this method, called the light and dark bottle experiment, the GPP, NPP and respiration are determined. Calculations

P=

LB - DB ¥F T

here P = gross photosynthesis (mgc/litre/hr), LB = dissolved O2 in light bottle (mg/litre), DB = dissolved O2 in dark bottle (mg/litre), T = incubation time, F = ratio of molecular masses of carbon and oxygen (0.375). Limitations

In this method, it is assumed that plant respiration is the same in both light and dark bottles. Many plant species exhibit differential respiratory rates under different light conditions. Besides, the presence of heterotrophs affects the respiratory consumption and thus the measurements are not accurate. The confinement of water in bottles also creates artificial conditions, due to the absence of water movement. However, the method is very simple, and is used by most laboratories in the world to measure the GPP, NPP and respiration.

Systems Concept in Ecology

85

Oxygen diurnal curve method In this method water samples from different depths of an aquatic ecosystem are collected frequently, say every two hours for a continuous period of 24 hours. Alternatively, an electronic sensor is used to record changes in the oxygen content in water continuously for 24 hours. Photosynthesis occurs during the day and not at night—thus day and night become comparable to the light bottle and dark bottle, respectively. From the changes in the oxygen content it is possible to determine the amount of oxygen left after respiratory consumption. Thus the primary production can be determined from the photosynthetic equation:

6CO2 + 12H2O

Chlorophyll Solar energy

C6H12O6 + 6H2O + 6O2

This method has the advantage of measuring the primary production in an aquatic ecosystem without disturbing the ecosystem. Light does not penetrate into the deeper parts of many lakes (deep lakes), preventing photosynthesis, and consequently the release of oxygen. Hence oxygen disappearance in deeper waters would indicate respiratory activity by consumers and decomposition activity by decomposers. The rate of oxygen disappearance is proportional to productivity. Thus this method helps us measure the net primary production of the entire lake community and also indicates the pollution status of the lakes. Since oxygen diffuses out of the body of water or into it from the atmosphere, a source of error is involved. Since this diffusion obeys physical laws, it can be corrected for. Carbon dioxide measurement method (enclosure method) In terrestrial ecosystems it is more convenient to measure CO2 changes than O2 changes. Productivity can be measured by enclosing a plant community in a transparent chamber and measuring the CO2 changes in it. Ecologists and plant physiologists have tried this method in herbaceous communities, crop systems and so on.

A large bell jar, a transparent tent or a box made of plexiglass, glass or transparent plastic is placed over the plant community. Air is drawn through the enclosure and the CO2 concentration in the incoming and outgoing air is measured by absorption on a KOH column or by the recently developed infrared gas analyser. It is assumed that any CO2 removed from the incoming air has been used in photosynthesis. Respiratory activity also goes on during the photosynthetic activity. If dark and light enclosures are used, the GPP and NPP can be measured. For details of the design of this experiment, one may consult the paper by Musgrave and Moss (1961). It is always difficult to enclose a community. However Woodwell and Whittaker (1968) have shown that simultaneous measurements can be made on separate small enclosures enclosing branches, trunks, shrubs and soil and the observations integrated to arrive at the final result. By measuring CO2 concentrations in incoming and outgoing air and using the photosynthetic equation the primary productivity can be measured. Limitations

The enclosed chamber usually heats up quickly unless a strong air flow is maintained. This strong air flow also changes the rate of photosynthesis in relation to the rate which occurs outside the enclosure. This method also creates some artificiality because of the enclosures.

Aerodynamics Method This method, in which also the CO2 concentration is measured, was originally developed by Huber (1952) and later used by many workers. The flux of CO2 above and within a community is periodically estimated by using CO2 sensors placed at intervals in a vertical gradient

86

Fundamentals of Ecology

from well above the vegetation canopy down to the ground level. By measuring the difference in CO2 concentration above and within the plants, the NPP can be estimated using the photosynthetic equation. This method has been used to measure photosynthetic rates in corps, grasslands and structurally simple communities. Woodwell and Dykeman (1966) used this method successfully in forests. It is analogous to the aquatic diurnal curve method. In this method, the community is not artificially enclosed. If CO2 is measured during the night, the total community respiration can also be measured. Corrections must be made for mass movement of air and for CO2 evolution from soil to obtain accurate results. pH method In aquatic ecosystems, the pH of water has a relationship with the dissolved CO2. The pH of water changes as CO2 from water is utilised in photosynthesis or released in respiration. CO2 changes the pH of the system through the formation of HCO3. This method involves the calibration of the relationship of CO2 and pH in the water before the pH is utilised to measure primary productivity. Naturally the photosynthetic equation is taken into consideration while calculating primary productivity. This method has the advantage of not disturbing the system. Radioisotope method Phosphorus—32 and Carbon—14 isotopes have been used to measure primary productivity. They can be used in a manner similar to the light and dark bottle method for measuring oxygen. Water samples are taken from a desired water depth and kept in light and dark bottles. A known quantity of C14 in the form of a bicarbonate, such as sodium bicarbonate (NaHC14O3), is introduced into the light and dark bottles, which are suspended in the water column for 4—6 hours. During the period of incubation, the stable CO2 and the unstable carbon (—HC14O3) are assimilated into carbohydrates and become part of the protoplasm of autotrophs. After the six-hour incubation period, the water samples are filtered and the filters containing the autotrophs are dried and placed in a counting chamber to determine their levels of radioactivity. In this way the amount of radioactive carbohydrate produced is known. Assuming that the uptake of radioactive carbon is proportional to that of stable carbon, calculations are made using the photosynthetic equation.

6C14 O 2 14 C6 H12 O6 = C6 H12 O6 6CO 2 In practice, the uptake of radioactive carbon and stable carbon may not be proportional and a correction factor may be required. Chlorophyll estimation method This method is based on the assumption that primary productivity is a function of the chlorophyll concentration of a plant. The determination of chlorophyll concentration in a leaf at different times can help predict the rate of primary productivity. 2.5.7 Secondary Production (Concept)

An understanding of the food chain and trophic relationship concepts are fundamental to the study of secondary production. The following energy flow diagram illustrates the concept of secondary production.

Systems Concept in Ecology

87

Thus secondary productivity refers to the net quantity of energy transferred and stored in the somatic and reproductive tissues of heterotrophs over a period of time. Some heterotrophs (consumers and decomposers) feed on net primary production and some on other heterotrophic organisms. Thus, productivity by heterotrophic organisms in the ecosystem is called secondary productivity. Secondary production is one of the interrelated processes in the energy flow mechanism. For energy flow and secondary productivity studies, two kinds of information, (a) a census of the members of a species population over a period of time, and (b) an estimate of the separate energy components for each population, are required. Secondary productivity is of great importance, since it serves as an index of significance of the population in terms of food resources available to the heterotrophic populations, including man, in the food chain. It involves the production of herbivores, carnivores and decomposer organisms. The secondary producers may be poikilothermic animals such as annelids, arthropods, fish, amphibia and reptiles, homeothermic animals like birds and mammals including man, or saprophytic organisms. But, in general, secondary production is a function of the amount of primary production in the ecosystem, the size and metabolism of heterotrophic organisms and the number of links in the food chains in an ecosystem. Herbivores graze and ingest plant materials. Part of this is egested and part is assimilated. The assimilated food (energy) is utilised for metabolism (largely respiration), growth and reproduction. A large portion of the assimilated energy dissipates as respiratory loss for maintenance of the body and other activities like food capture. The remaining part of the assimilated energy, after metabolic loss, is stored in somatic and reproductive tissues and is thus comparable to net production. The efficiency of energy utilisation varies from organism to organism and in the same organism it may vary between age groups. In general the assimilation efficiency (ratio of assimilation to consumption (ingestion) is much higher in homeotherms (about 70%) than in poikilotherms (about 30%). But poikilotherms in general are more efficient in secondary production, as their maintenance costs are very low (Dash, 1987, Dash, 1989, Engelmann, 1968). Tables 2.20 and 2.21 provide information on the utilisation of energy by poikilothermic and homeothermic animals. The secondary production in some poikilotherms may be about 70% of assimilation—of the total secondary production 95% is due to body growth and 5% due to reproduction (Dash, 1987). In homeotherms the maintenance cost is usually around 95% of assimilation and secondary production less than 5%. The secondary production by decomposer organisms in a detritus food chain is different from the herbivore and carnivore food chain. In the detritus food chain matter is recycled and microorganisms exhibit a high growth rate. The recycling and high growth rate efficiencies of microorganisms bring a high level of secondary production within the decomposer (saprovore) trophic system (Heal and Maclean, 1975).

Fundamentals of Ecology

88 Table 2.20

Energy utilisation and secondary production in poikilothermic and homeothermic animal populations (kJ/m2/Year)

Taxa

Habitat (trophic status)

A

P

R

R/P

Reference

Enchytraeidae

Woodland, U.K.

126.3

40.7

85.6

2.10

Phillipson et al (1979)

Enchytraeidae

Populus tremuloides

252.42

38.9

213.5

5.48

Dash and Cragg (1972)

Poikilothermic invertebrates

(Woodland, Canada) Enchytraeidae

Mixed deciduous forest, India

748

83.3

644.7

7.97

Dash and Nanda (unpublished)

Enchytraeidae

Moor, U.K.

645

130

515

3.96

Coulson and Whittaker (1978)

Enchytraeidae

Grassland, India

4.14

0.96

3.18

3.31

Thambi and Dash (1973)

Enchytraeidae

Sheep pasture, Australia

252

109

143

1.31

Hutchinson and King (1979)

Enchytraeidae

Canadian

14.9

8.1

6.8

0.84

Ryan (1977)

arctic

23.7

13.0

10.7

0.82

Enchytraeidae

Coastal tundra, Alaska

217.6

120.5

97.1

0.80

Maclean (1980)

Lumbricidae

Woodland, U.K.

277– 343

62–75

215–269

3.53

Phillipson et al. (1979)

Lumbricidae

Mixed deciduous, U.K.

747.2

93.3

653.9

7.0

Hale (1980)

Magascolecidae

Mixed deciduous India

937.28

251.4

685.87

2.72

Mishra and Dash (1984)

Lampito mauritii

Pasture,

1884.1

678.3

1205.8

1.78

Dash (1978)

(Oligochaeta)

India

Octochetona surensis

Pasture, India

1.85

Senapati and Dash (1981)

Grasshoppers

Herbivore

107.11

16.73

90.37

5.40

Odum et al. (1962)

Modiolus demissus

Filter feeding

234.30

71.12

163.17

2.3

Kuenzler (1961)

Herbivore

497.89

35.98

460.24

12.8

Mann (1964)

(ribbed mussel) Poikilothermic vertebrates Rutilus rutilus (roach) (Contd.)

Systems Concept in Ecology

89

Table 2.20 (contd.) Alburnus alburnus

Carnivore

665.25

615.04

12.8

Mann (1964)

2.89

Mohanty and Dash (1988)

(bleak) Rana tigrina

Stage 1

larvae (Amphibia)

1.8

0.38

1.10

0.94

0.26

0.62

28.03

0.50

27.48

54.8

Odum et al. (1962)

(mixed diet)

(kJ/g dry

Stage 2

weight/day)

(mixed diet)

2.38

Homeotherm vertebrate

Peromyscus pollonotus (field mouse)

Herbivore

Passerculus

Camivorous

15.06

0.17

14.85

88.8

Odum et al. (1962)

Carnivorous

2.32

0.05

2.27

41.8

Golley (1960)

(granivorous)

sandwichensis (Savanna sparrow) Mustela rixosa (least weasel) A = assimilation, P = production, R = respiration

Table 2.21

Estimation of consumption, production, respiration and R/P by heterotrophs (kJ/m 2/Year) per 418.4 kJ (100 kcal/m2/year) net primary production in a grassland ecosystem (calculated from Heal and Maclean, 1975)

Organismic system

Consumption

Production

Respiration

R/P

Herbivore System (i) Herbivore Vertebrates

104.60

1.05

51.25

48.8

16.74

2.68

4.02

1.5

Vertebrates

0.67

0.012

0.51

42.8

Invertebrates

0.71

0.17

0.40

2.35

570.60

228.24

342.35

1.5

63.40

5.07

7.60

1.5

Invertebrates

2.71

0.65

1.52

2.33

Vertebrates

0.17

0.004

0.139

33.47

Invertebrates (ii) Carnivore

Saprovore system Microbial Saprovore Invertebrates Carnivore

Fundamentals of Ecology

90

The R/P ratio for vertebrates in any system is much higher than that for invertebrates, microorganisms and larval forms of some vertebrates. Among the vertebrates, the R/P ratio is much higher in homeotherms than in poikilotherms. The work of Heal and Maclean (1975) shows the general pattern of secondary production in herbivore and saprovore systems. There is not much difference between the R/P ratios of vertebrate herbivores and vertebrate carnivores. Table 2.22 gives information on animal populations which provide meat and milk to man. Table 2.22

Animal Populations (million heads, 1986) (Singh, 1988)

Region/Country

Cattle

Buffalo

Pig

Sheep

Goat

Chicken

Asia Pacific

396

134

407

458

248

3,106

India

200

75

09

55

108

180

Rest of the world

876

05

416

688

244

5,818

Total

1472

214

832

1,201

600

9,104

Table 2.23

Meat and milk production of the world, 1986 (Singh, 1988)

Region/Country

Asia Pacific

Meat/Cattle

Meat/Buffalo

Meat/Pig

(kg)

(kg)

(kg)

7.1

6.9

57.0

Milk/cattle and buffalo (kg/year) 171

India

0.8

2.2

9.9

161

Rest of the world

51.0

45.4

74.4

489

There is a lot of scope for increasing meat and milk production in India as the average figures for India are much lower than the world averages. Another important source of meat is poikilothermic vertebrates, particularly fish and amphibia and invertebrates, especially annelids, crustaceae and arachnids, molluscs, etc. Table 2.24 provides information on secondary production of fish and some other animals. Many invertebrate animals live in the soil. Some half to one ton of animal tissue per hectare may be found in a fertile garden soil or rangelands or in some forest floors. This huge biomass has a turnover value of around 1 to 3 and can be tapped for human consumption through the fish and poultry food chain. The optimisation of secondary production in animals, to man’s benefit, will depend largely upon the understanding of the factors which control their consumption, assimilation and metabolism. Energy consumed (C) = Energy of egesta (FU) + Energy of metabolism (R) + Energy fixed (P) (See Pandian and Vernberg, 1987, for information on different animals.) 2.5.8 Secondary Productivity from Indian Ecosystems

Tables 2.22, 2.23 and 2.24 A and B provide information on meat, milk and fishery yields in India. This section will evaluate secondary productivity from Indian rangelands with reference to some vertebrate and invertebrate secondary producers.

Systems Concept in Ecology

Table 2.24A

91

Total marine fish landing in India (in tonnes) (Various Sources)

Fish Elasmobranchs Eels Cat fishes Chirocentrus Sardines Hilsa

1976

1977

1996

54,650

62,216

83,807

8296

12,997

20,603

43,540

53,504

86,755

10,368

11,909

21,975

269,262

215,854

101,677

16,324

18,840

38,710 (1994)

Acheviella

39,069

34,033

35,606

Thrissocles

17,660

9929

—

Other clupeids

57,164

41,458

49,255

Harpondon nehereus

87,075

85,236

—

Saurida and Saurus

5292

8525

—

Hemirhamphus and Belone

1169

2311

3607

304,401

298,929

524,101

Mackerel

65,497

62,136

168,092

Pomfrets

37,701

35,127

42,000

Tunnies

19,322

13,005

42,000 15,165

Flying fish, perches, Red mullets, Polynemids, Sciaenids, Ribbon fish, Caranx, Chorinemus, Trachynotus, Other Carangids, Coryphaena, Elacate, Leiognathus, Gazza, Lactarius, Seer fish, Sphyraena, Bergmaceros

Mugil

2388

2423

Soles

10,088

10,810

—

114,640

96,472

218,140

Non-penaeid prawns

76,787

73,992

91,543

Crabs and Crustacea

19,999

20,068

36,870

Panaeid prawns

Lobster Cephalopoda Miscellaneous Total landing (India)

Table 2.24B

2532

1217

2000

10,826

10,005

113,000

90,812

91,945

10,12,534

13,52,855

12,59,782

27,07,439

Total Fish Production in India (In lakh tonnes)

Year

Inland

Marine

Total

1984–85

11.03

16.98

28.01

1985–86

11.60

17.16

28.76

1986–87

12.29

17.13

29.42 (Contd.)

Fundamentals of Ecology

92 Table 2.20 (contd.) 1987–88

13.01

16.58

29.59

1988–89

13.35

18.17

31.52

1989–90

14.02

22.75

36.77

1990–91

15.36

23.00

38.36

1991–92

17.10

24.47

41.57

1992–93

17.89

25.76

43.65

1993–94

19.95

26.49

46.44

1994–95

20.95

26.92

47.89

1995–96

22.42

27.07

49.49

1996–97

22.83

28.57

51.40

Source: Handbook on Fisheries Statistics, 1996, Ministry of Agriculture, Fisheries Division Government of India, New Delhi.

A list of secondary producers in Indian rangelands is presented in Table 2.25. Among the vertebrates domestic cattle, goat, sheep, rodents, birds, lizards, snakes, frogs and toads, and among the invertebrates, grasshoppers, locusts, beetles (above ground) and earthworms (underground), ants and termites are the principal secondary producers (Dash, 1979). Many wild herbivores like deer, ungulates and their predators from the Canis and Felis species have been depleted because of hunting. Their ranges are now overgrazed by livestock. Grazing pressure by herbivores determines the floristic composition of vegetation and thus controls primary productivity. Rodents are usually the most abundant herbivores in Indian grasslands and cause deterioration of the ranges by overgrazing. A number of bird species, four to five species of lizards, and many species of snakes and amphibians are found in Indian rangelands. The food chain relationship is very complex. In terms of biomass, cattle are the most important group of Table 2.25

Secondary producers of importance in Indian grasslands Taxa

Taxa

Vertebrates

Invertebrates

Homeotherms

Poikilotherms

Domestic Cattle

Grasshoppers

Buffaloes

Locusts

Goats

Ants

Sheep

Termites

Rodents

Arachnids

Hyaena

Myriapods

Birds

Collembola

Poikilotherms

Mites

Lizards

Oligochaetes

Snakes

Nematodes

Frogs and toads

Protozoa

Systems Concept in Ecology

93

above-ground secondary producers, but rodents out number them and are also important because of their high consumption of vegetation. Whyte (1964) estimateda grazing pressure of 3.25 livestock (cattle, buffalo, and goat) per hectare in Indian grasslands. Senapati and Dash (1981) estimated that about 20% of the total net primary production (40% of the net above-ground production) was removed by cattle in some grasslands of Sambalpur. These grasslands are overgrazed. Range herbivores grow fastest during the period when green herbage is abundant and the nutritive value of shoots is highest (Gupta and Ambasht, 1979). Green herbage is more digestible than dry dead herbage. The secondary productivity of cattle in tropical grassland depends on the nutritive quality of forage and is also a function of this genetic quality of the breed, the nutritive quality of the feed, continuous control grazing, medical care and the living conditions of the animal. The abundance of invertebrate secondary producers depends upon the abundance and diversity of plant species and primary productivity. Oligochaetes form 80% of the total soil invertebrate biomass (about 100 g/m2) in Indian grasslands (Senapati and Dash, 1981). Nematodes, protozoans, ants and termites are found in large numbers, although their biomass in comparison to Oligochaetes or large herbivores may be smaller. The mean annual biomass turnover for invertebrates varies between one and three, but the turnover value is more than four times that for Oligochaetes, indicating that they are very important secondary producers in Indian grasslands. The average above-ground consumer biomass is 2.0g/m2 (range 0.9 g/m2 to 4.6 g/m2) and the underground consumer biomass is about 2 to 19 times greater than the former in temperate grasslands (Dyer, 1979). In Indian grasslands, the underground biomass is about 100 g live weight or little more/ m2 (10 to 20 g dry weight). Assuming 3.25 livestock per hectare (about 625 kg/ha), the underground consumer biomass will be twice the above-ground biomass. But with a turnover of 3, it represents a huge secondary producer resource to be tapped by man. Maintenance cost of invertebrate secondary producers In general, 55 to 75% of the assimilated energy is spent on maintenance. Temperature, moisture conditions of the habitat and the type of species determine the maintenance cost. The drier and hotter the habitat, the higher is the maintenance cost, irrespective of the species. The average maintenance cost of some earthworm species was found to be 6.48, 9.96, and 20.54 kJ/g dry tissue/month in the winter, rainy and summer seasons respectively in tropical pastures and grasslands (Dash, 1987). The maintenance cost varies seasonally and is three times more in summer than in winter. Mishra and Dash (1979, 1980) measured the oxygen uptake by earthworms within a temperature range of 10–40°C. The average range of oxygen consumption in different temperatures by worms of different sizes was estimated and the average Q10 (Van’t Hoff’s law) value for all classes of worms was calculated to be 1.82. An increase in temperature accelerates metabolic rate. Van’t Hoff stated that the biochemical reactions are approximately doubled by 10°C rise in temperature. This is expressed as Q10. The Q10 value was lowest at the highest temperature, indicating and adaptation of worms to temperature stress. This is interpreted as an energy conserving adaptation in relation to temperature stress in tropical climates (Dash, 1987).

The respiratory metabolism (Y) of Oligochaetes (earthworms) was regressed with bodymass (W) by a logn – logn approximation (Y = awb), where a and b are constants, indicating that the maintenance energy expenditure per unit body mass decreased with increasing body size. The slope value (b) per animal per unit time varied from 0.63 to 0.74 for Lampito mauritii, Octochaetona surensis and Drawida

94

Fundamentals of Ecology

willsi earthworms. For many other invertebrates the slope value is around 0.808 to 0.813 (Reichle, 1971, Ryszkowski, 1975). For tropical amphibian larvae the slope value varies from 0.50 to 0.60 (Mohapatro and Dash, 1990), Dash and Mishra, 1989). Hemmingsen (1960) made the generalisation that the standard metabolic rate be scaled to body size by raising it to the power 3/4. However, Rubner’s 1883 surface law indicated a value of 2/3—the slope values for earthworms and some amphibian larvae are closer to Rubner’s finding. The respiration and production (R/P) ratio is an important parameter in the representation of the metabolic status of an organism. It is 1.32 and 14.4 for many invertebrate plant feeders and invertebrate carnivores, respectively. The R/P ratio for many Oligochaetes comes to 2 (Dash, 1987), although its value may be between 1 and 3 for small enchytraeids and large Oligochaetes (Hutchinson and King, 1979). In European woodland, grassland and moorland conditions, on an average more than 80% of the assimilated energy is spent in invertebrate respiration (particularly by oligochaetes), whereas in tropical and subtropical conditions the comparable figure is 70%. The secondary production of Oligochaetes in tropical conditions is more than in temperate climatic conditions. 2.5.9 Production—Assimilation Efficiency and Secondary Productivity

The production—assimilation efficiency for three terrestrial arthropod populations ranges from 37 to 42% (Weigert, 1964) and this range of production efficiency may also be found in Oligochaetes and some other invertebrates. In mammals, this efficiency may be about 2 to 3% (Phillipson, 1966), Thus it would be advantageous to man if poikilotherms, especially annelids, were used as a source of animal protein for fish and poultry. Secondary production in many species varies significantly and seasonally with climate extremes. P/R ratios are the highest for soil invertebrates for tropical grasslands and in polar regions. In these extreme climates respiration is restricted by the severe environment and more energy is stored in secondary production so as to withstand adverse conditions. The relative amounts of energy actually being diverted to growth (Pg) and reproduction (Pr) have been calculated for a few species populations. Tanaka (1970) found for the collembola, Isotoma trispirata, that energy produced as tissues, eggs and exuviae were in the ratio 11: 6: 1. Saito (1969) provided Pr: Pg ratios for three species of isopods, namely Armadillidum vulgara, Porcellio scaler and Lipipolum japonicum and the ratios were 1: 10, 1: 11 and 1: 35 respectively. Ecological growth efficiencies (P/C) are generally less than 20% but the range is wide and displays no pattern according to taxa. In an Indian pasture site, Oligochaete tissue growth amounted to about 95% and cocoon production to about 5% of the total secondary production; thus the Pr : Pg ratio was 1:19. Of the total assimilated energy, some 20–28% was stored in worm tissue and about 2% was spent in reproduction. These invertebrates are a very good source of protein as their body tissue contains from 50 to 75% of it (dry weight basis). 2.5.10 Relationship of Secondary Production to Net Primary Production

Dash et al. (1974), and Senapati and Dash (1981) found that the secondary production due to soil invertebrates was about 5% of the net primary production of that site. They however measured the biomass and secondary production of Oligochaetes, which formed 80% of the faunal biomass. Thus the total soil faunal secondary production in tropical grasslands may be about 7% of the net primary production. The secondary production due to vertebrates, such as cattle, rodents and other consumers,

Systems Concept in Ecology

95

may also amount to 7% of the net primary production. Therefore, combined secondary production due to soil invertebrates and vertebrates in some Indian pastures and grasslands may account for about 10 to 15% of the net primary production. An estimate of net primary production (NPP) consumed by herbivores in different ecosystems around the world is given in Table 2.26. The data indicates that some 2 to 60% of NPP is consumed by herbivores. Assuming that 30 to 40% of the consumption is assimilated, a maximum of 24% of the NPP can be assimilated and assuming some 2% (for homeotherms) to 35% (for poikilothermic herbivores) of the assimilated energy is stored as secondary production, a theoretical maximum of 9% of the NPP car end up as secondary production. The field estimate of 10% to 15% of NPP stored as secondary production in some tropical grasslands is higher than the theoretical estimate. Table 2.26

Percentage consumption of NPP by herbivores in different ecosystems around the world

Ecosystem

% of NPP consumed

Reference

Ugandan grassland

60

Wiegert and Evans (1967)

Indian grassland

49

Misra (1968)

Indian grassland

20

Senapati and Dash (1981)

40

Senapati and Dash (1981)

(of above-ground parts only) Old field

12

Odum et al. (1962)

Old field

01

Wiegert and Evans (1967)

Meadow

25–30

Andrezejewski (1967)

Tanzanyika grassland

28

Wiegert and Evans (1967)

Silver spring

38

Odum (1957)

Cone spring

24

Tilly (1968)

Salt Marsh

08

Teal (1962)

Tropical forest

8.5

Misra (1968)

Temperate forest

40

Andrezejewski (1967)

Temperate forest

3.4–9.2

Kaczmarek (1967)

Temperate forest

1.5–2.5

Bray (1964)

Temperate forest

1.5

2.6

Reichle and Crossley (1967)

FOOD CHAIN AND TROPHIC LEVELS

2.6.1 Concept

Autotrophs convert solar energy into chemical energy stored in food material. The transfer of food energy from plant sources through a series of organisms forms what is called a food chain. A diatom may be eaten by a copepod which is eaten by a small fish, which forms the food source of large fish and so on. For example :

Fundamentals of Ecology

96

Scenedesmus boligues Æ Brachionus falcatus Æ Amblypharyngodon sp. (phytoplankton) (zooplankton) (a small fish) Æ

Wallago attu (a large fish)

Æ

Homo sapien (man)

This is a food chain which is observed in an Indian river. The following is an example of a food chain which occurs in an Indian pasture: Cynodon dactylon Æ Melanoplus dfferentialis Æ Bufo melanostictus (a grass species) (a grasshopper) (a toad) Æ

Zamenis mucosus (a rat snake)

In the two examples we find that the base of the food chain is formed by a plant which is grazed on by a herbivore, which is predated over by a carnivore, which may be eaten by another carnivore. Thus the arrangement is as follows: Plant Æ Herbivore Æ Carnivore1 Æ Carnivore2 In nature, food chain relationships are very complex, as one organism may form the food source of many organisms and so on. For example, grass may be grazed on by grasshoppers as well as rabbits or cattle and each of these herbivores may be eaten by many carnivores, such as toads, snakes, birds, or hyenas, depending on their food habits. Thus, instead of a simple food chain, we find a web-like structure called food web (Figs. 2.16 (a) and (b)). Organisms whose food is obtained from plants by the same number of steps are said to belong to the same trophic level. Thus, green plants occupy the first tropic level, called the producer level and plant grazers occupy the second trophic level, called the primary consumer or herbivore (plant grazing insects, rabbits, rodents, deer, cattle, etc.) level. Flesh eaters which eat herbivores form the third trophic level, called the secondary consumer or carnivore1 level (frogs, small fish eating zooplankton, etc.). The next trophic level is the tertiary consumer or carnivore2 which eat the flesh of herbivores and secondary consumers. Likewise, the trophic levels can be expanded taking the food habits of organisms into account. This type of classification emphasises function and not species as such. Charles Elton, the distinguished British ecologist, realised in 1927 that there must be a limit to the number of links in any food chain. By surveying many ecosystems and numerous food. chain relationships, he concluded that the number of links very rarely exceeds five, because in the process of energy transfer there is always loss of energy to the environment, in the form of heat. Thus the energy transfer mechanism between trophic levels determines the number of links in a food chain. As Charles Elton commented, ‘one hill cannot sustain two tigers’. The tiger, being a tertiary consumer, sits on top of the food chain. A hill, because of the limitations of primary production, may not contain many primary or secondary consumers. Hence a number of tigers will not get enough food in a small hill ecosystem. Therefore a small ecosystem cannot have many tertiary consumers or carnivores. 2.6.2 Types of Food Chains

In ecosystems such as a grassland, pond or lake, a substantial part of the primary production is grazed on by herbivores. Cattle and rodents are the main grazers in a grassland, while zooplankton are the main grazers in a pond or lake. Usually up to 50% of the net primary production is grazed on by these

Systems Concept in Ecology

97

Fig. 2.16(A)

Food chains in nature. A—food chain in a grassland; B—food chain in a pond; C—food chain in a forest. The base of the food chain is always formed by autotrophs (producers). The links are usually 3 to 5 and the arrangement is mainly, producer Æ herbivore Æ carnivore (P = producer, H = herbivore, C1 = carnivore order-1, C2 = carnivore order-2)

Fig. 2.16(B)

A food web shows the main food links and interconnection of many food chains. An organism may form a food source for many other organisms thus forming a web

98

Fig. 2.17

Fundamentals of Ecology

Grazing and detritus food chains. Grazing food chains are found in grasslands and aquatic ecosystems, and detritus food chains in forests. In a grazing food chain, some 20 to 30% of net primary production is usually grazed on by herbivores, while in a detritus food chain some 10% or less of net primary production is grazed on and about 90% passes through decomposers. The excreta and dead plant or animal biomass always pass through the decomposers in any ecosystem (P = producer, H = herbivore, C = carnivore)

animals in their respective ecosystems and the remaining 50% goes to the decomposer organisms as dead organic matter. Therefore, in these ecosystems, the food chain is herbivore based and herbivores are considered important consumers. This is classified as a grazing food chain (Fig. 2.17). In a forest ecosystem, the dominant primary consumers (herbivores) are the insects, which usually consume less than 10% of the net primary production. The rest (90%) is consumed later as dead plant material by the small detritus feeding animals, such as microarthropods, Oligochaetes and microorganisms like protozoa, fungi, actinomycetes and bacteria. The animals consume the detritus and process it in their gut by reducing it into small pieces and sometimes digesting it partially of fully, thus making organic materials available for bacterial and fungal attack. These macroorganisms also act as food for many soil animals. This food chain is classified as a detritus or decomposer food chain. The detritus food chain exists in every ecosystem and is very important for the circulation of materials. Even in a grazing food chain, the faeces and urine of grazing herbivores ultimately come to the decomposer pathway.

Since grazers remove living plant material, the intensity of grazing and the amount of plant material removed from the standing crop are important factors to be considered in range management. There must be a limit to direct grazing, because very rapid removal of plant material will either deplete the producers or reduce productivity. Besides the main food chain pathways, a parasitic food chain may operate in many ecosystems, although the food energy passing through it may not be considerable. Plant parasitic nematodes may consume a portion of the net primary production in grassland ecosystems. A parasitic food chain involves host parasite—hyperparasite links. In summary, three types of food chains (a) grazing, (b) detritus, and (c) parasitic operate in nature. 2.6.3 Significance of Food Chains

Food chain studies help understand feeding relationships and the interaction between organisms in any ecosystem. They also help us comprehend the energy flow mechanism and matter circulation in ecosystems, and understand the movement of toxic substances in the ecosystem and the problem of biological magnification. Certain harmful substances, usually ones not found in nature but introduced

Systems Concept in Ecology

99

by man, may get injected into plants and /or animals. These poisonous substances may not be broken down in the body or excreted easily and quickly. Instead, they accumulate in the tissues, and as the living organism eats more, the concentration of these substances increases and they pass from one trophic level to the next. Since man is an omnivore and has access to all trophic levels for food, he gets the toxic substances into his body in large amounts. Secondary and tertiary consumers located on top of the food chain also get the poison into their body. This phenomenon is called biological magnification (Fig. 2.18). It is now known that the body of an American, on the average, contains 11 ppm DDT

Fig. 2.18

Biological magnification of some pollutants (some metallic pollutants and pesticides are not biodegradable and are not easily excreted. These are deposited in higher concentration in the body of organisms of higher trophic levels through the food chain). The concentrations factor of DDT may be 1 in water, 800 times more in plankton, 11,600 times higher in inspects, 34,600 times higher in fish which eat these insects and 92,000 times higher in insects, 34,600 times higher in fish which eat these insects and 92,000 times higher in fish eating birds. Ultimately DDT comes to the human body through fish and birds

Fundamentals of Ecology

100

although the safe limit is only 0.2 ppm and in India the situation is not any better. Food web study provides information on biological diversity in an ecosystem also. 2.6.4 Methods for Studying Food Chains

Many direct and indirect methods are employed to study food chain relationships in nature. Gut content analysis Gut content analysis of animals is considered the most convenient method for analysing food chain relationships. In this method the alimentary canals of animals are opened and undigested food materials are taken and identified. In this way a gross analysis is made of the food habits of an animal and food chain relationships are drawn. This is a simple and convenient method. The gut content analysis of the Indian bull frog (Rana tigrina) (Table 2.27) indicates its diverse food source and the organisms on which it feeds. This method has the disadvantage that fluids and soft tissues cannot be distinguished in the gut of an animal, as these are easily digestible. Table 2.27

Gut content analysis of Rana tigrina, the Indian bull frog Total number of prey in gut contents of

Food item

Invertebrate

the Indian bull frog (n = 482) Number of prey

% of the total

450

93.75

Arthropoda

428

89.16

Class insecta

338

70.41

Coleoptera

70

14.58

Hemiptera

53

11.00

Isoptera

45

9.37

Hymenoptera

40

8.33

Diptera

34

7.08

Lepidoptera

25

5.20

Blattidae

22

4.58

Orthoptera

21

4.37

Odonata

18

3.75

Dermaptera

10

2.08

Class Crustacea

66

13.75

Class Arachnida

24

5.00

Class Oligochaeta

13

2.70

Class Gastropoda

9

1.87

30

6.25

23

4.79

Cypriniformes

6

1.25

Ophiocephaliformes

17

3.54

Class Amphibia

7

1.45

Vertebrate Class Pisces

Systems Concept in Ecology

101

Use of radioactive isotopes The use of radioactive isotopes like Phosphorus 32 in food items and then following their movements and detecting them by a GM counter is a good method to analyse food chain relationships. This method is accurate, although there is a possibility of radioactive contamination of the environment. It requires a radioactive isotope facility and its efficient management. Precipitin Test Dempster (1960) used this test to study the predators of the broom beetle, Phytodecta olivacea. He used caged rabbits which were inoculated with cell-free extracts of the broom beetle. Thus antibodies were formed in the rabbit’s blood. 50 ml of blood was then drawn from each rabbit, the blood cells and lipids removed and the resulting serum sterilised, freeze dried and stored in a refrigerator. Then a sample of possible predators of the broom beetle was collected. Smears of these animals were made by crushing either the whole animal or its gut contents on filter paper and drying them rapidly over phosphorus pentoxide. The smears were extracted for 24 hours in normal saline, centrifuged and the clear supernatant liquid used for testing. Then 0.2 ml of the extracts were drawn into a series of capillary tubes, followed by an equal volume of antiserum which had been prepared with distilled water. The tubes were examined after two hours in room temperature. The presence of the broom beetle in the gut of the predator was shown by the formation of a white precipitate of antigen and antibody at the interface of the two liquids. Besides these methods, direct feeding observation of an animal, whenever possible, provides important information on its food organisms. 2.6.5

Ecological Pyramids (Eltonian Pyramids)

The concept of ecological pyramid was developed by Charles Elton (1927) who noted that “... the animals at the base of a food chain are relatively abundant while those at the end are relatively few in number and there is progressive decrease in between the two extremes.” This is called a pyramid of numbers and was observed in animal communites in all types of ecosystems. On the basis of the number of organisms, the biomass of organisms and energy flow in organismic populations, three types of ecological pyramids are now recognised. These are: (a) Pyramid of Numbers (b) Pyramid of Biomass (c) Pyramid of Energy These ecological pyramids provide a common denominator for the comparison of different communites. Pyramid of numbers When plotted, the relationships among the number of producers, irrespective of their taxonomic position, primary consumers (herbivores), secondary consumers (carnivore-l), tertiary consumers (carnivore-2) and so on, in any ecosystem, forms a pyramidal structure called the pyramid of numbers. The shape of this pyramid varies from ecosystem to ecosystem. In aquatic ecosystems and herbaceous communities, the autotrophs are small in size and are present in large numbers per unit area. In a forest ecosystem the size of a producer is large and per unit area their density of population may not be so large. In grassland or aquatic ecosystems the numerous tiny autotrophs support a lesser number of herbivores (insects, cattle and zooplanktons respectively), which support fewer carnivores (Fig. 2.19). Hence the pyramidal structure is upright. In a forest ecosystem the number of producers per unit of space may be little but a greater number of herbivores are supported who in turn support a fewer number of car-

102

Fundamentals of Ecology

nivores. Hence the pyramidal structure is essentially upright, although in parasitic food webs we observe inverted pyramids because one primary producer may support numerous tiny parasites, which in their turn may support still more hyperparasites. Thus two types of pyramids of numbers are found—upright and inverted. The pyramid of numbers allows us to compare the number of herbivores supported by a given number of autotrophs, with the limitation that sometimes we compare diatoms with trees and ants with elephants. Hence it may not convey much meaning about the functional aspects of an ecosystem. Pyramid of biomass The difficulty faced in comparing disparate objects is removed to a large extent if the biomass of a trophic level is considered in place of numbers. Thus Fig. 2.19 Ecological (Eltonian) pyramids: Pyramid of numbers can be both upright and inverted, pyramid of biomass can we have the pyramid of biomass if also be both upright and inverted but the pyramid we plot the biomass of producers, of energy is always upright (see text for explanation) herbivores, carnivores, and so on (P = producers, PC primary consumers, SC = secondary (Fig. 2.12). The types (upright and consumers, TC = tertiary consumers). A parasitic food chain is also shown inverted) of pyramids of biomass are found. If a larger weight of producers support a smaller weight of consumers, an upright pyramid results. This upright biomass pyramid is found in most ecosystems. If a smaller weight of producers supports a larger weight of consumers, as in the English Channel and some aquatic ecosystems, an inverted biomass pyramid results. This situation is possible because of a differential rate of production at different trophic levels. The rate of production is higher and faster at the producer trophic level in these ecosystems than at the consumer trophic levels. For example, in a forest ecosystem many trees may live for one hundred years whereas the tiny diatoms in an aquatic ecosystem may live for only a few days. A tree may take 5–10 years to produce its first seed, whereas the diatom may take less than a day to reproduce. Thus a diatom may reproduce billions of times during 5–10 years, and if all this biomass were to survive, it would be heavier than a tree. The accumulation of biomass may be small but the production rate is much higher in the diatom based system. Therefore, the organic material produced per year in the English Channel is much more than that indicated by the biomass (standing crop data).

Systems Concept in Ecology

103

The pyramid of numbers and pyramid of biomass have their limitations because they provide information only on the quantity of organic material available at a particular time but not on the productivity and turnover time. In general the following differences exist between terrestrial, aerial and aquatic ecosystems. In terrestrial—aerial habitats, water and temperature may act as limiting factors for production and the rate of transfer of energy between trophic levels. Water and temperature are usually not limiting factors in aquatic ecosystems. Oxygen can be limiting at high altitudes and in aquatic ecosystems. Organisms in terrestrial—aerial habitats are exposed to greater environmental variability than the organisms of aquatic habitats. A considerably greater diversity of species in terrestrial ecosystems leads to a more efficient dissipation of energy than in aquatic ecosystems. Temperature variations are relatively smaller in aquatic ecosystems. The rate of respiration at rest in aquatic poikilotherms, is lower than in terrestrial poikilotherms. In terrestrial animals the respiration may also increase manifold during the period of activity. For example, in insects the respiration rate may go up by 50—200 times during flight. But the respiration rate of fish may increase only 4—5 times during movement. Thus energy dissipation is higher in terrestrial animals. This is interpreted to mean that the inverted biomass pyramid in aquatic ecosystems may be due to the slow dissipation of energy by animals, leading to a greater build up of consumer biomass. Pyramid of energy The pyramid of energy is drawn after taking into consideration the total quantity of energy utilised by the trophic levels in an ecosystem or in a unit area over a given period of time. Since the quantity of energy available for utilisation in any of the herbivore C1 and C2 trophic levels will always be less than its previous trophic level (according to the laws of thermodynamics, there will be loss of energy in each transfer), the energy pyramid will always be upright (Fig. 2.19). The energy units provide a unifying concept, a method of expressing the productivity of a trophic level in an ecosystem. The energy pyramid permits a comparison of the productivity of different trophic levels and between different ecosystems. The pyramid of energy is based on the rate of energy flow in different trophic levels and hence the difficulties encountered in the pyramid of numbers and pyramid of biomass are removed here.

2.7 2.7.1 Concept of Energy

Energy is the capacity to do work. Biological activity requires utilisation of energy, which ultimately comes from the sun. Solar energy is transformed into chemical energy by the process of photosynthesis—this is stored in plant tissue and then transformed into mechanical and heat forms during metabolic

ENERGY FLOW IN ECOSYSTEMS

Fundamentals of Ecology

104

activities. In the biological world, the energy flows from the sun to plants and then to all heterotrophic organisms, such as microorganisms, animals and man. Mechanical energy has two forms, namely kinetic energy or free energy and potential energy. The energy a body possesses by virtue of its motion is called kinetic energy, and is measured by the amount of work done in bringing the body to rest. Potential energy is stored energy and becomes useful after conversion into kinetic energy. All organisms require a source of potential energy, which is found in the chemical energy of food. The oxidation of food releases energy which is used to do work. Thus, chemical energy is converted into mechanical energy. 2.7.2 Sun as a Source of Energy

The sun releases energy by the nuclear transmutation of hydrogen to helium with a concomitant release of considerable radiant energy in the form of electromagnetic waves, involving a rhythmic exchange between potential and kinetic energy. The solar radiation extends from high-frequency short-wave X-rays and gamma-rays to low-frequency long-wave radio waves. Approximately 99% of the total energy remains in the region between ultraviolet and infrared wavelengths (from 0.136 to 4.0 m). The visible spectrum (Fig. 2.20) spreads over 0.38 to 0.77 m, involving about 50% of solar radiation.

Fig. 2.20(A)

The visible spectrum. It shows the total spectrum of solar radiation, which extends from high frequency, short wave X-rays and gamma rays to low frequency, long-wave radio waves. Approximately 99% of the total energy remains in the 0.136—4.0 nm wavelength and half of this remains in the visible spectrum (0.39—0.76 nm)

Only one fifty-millionth of the sun’s energy output reaches the earth’s outer atmosphere, at a constant rate referred to as the solar flux, which is defined as the amount of radiant energy of all wavelengths that cross unit area per unit time. The solar flux is about 8.368 J (2 cal)/cm2 mm. At a given place it varies diurnally because of the earth’s rotation on its axis. It varies seasonally with latitude because of the earth’s revolution around the sun and the inclination of the earth’s equatorial plane with respect to its orbital plane. About 42% of the solar flux is reflected back (33% from the clouds and 9% from dust) and about 10% of it is absorbed or diffusely scattered by atmospheric gases like ozone, oxygen, water vapour, etc. (Fig. 2.21). Thus about 48% of the total solar flux actually reaches the earth’s surface (Geiger, 1941). Of this 48%, a ‘considerable amount may be reflected back from light surfaces or from clear bright sand. The radiant energy absorbed in the troposphere is radiated outward in the infrared portion of the spectrum and some infrared radiation strikes the earth’s surface. The atmosphere, soil water, and the organisms on the earth’s surface receive solar radiation which includes infrared radiation. This

Systems Concept in Ecology

105

radiation heats up the earth, and affects the climate and soil-forming processes, and physiological processes like photosynthesis. Heat energy evolves during transformation of one form of energy into another, and when work is done. Metabolism, growth, reproduction and other activities of organisms involve energy transformations and heat production. In any process, heat may be evolved (exothermic or exergonic) or absorbed (endothermic or endergonic). Nitrogen fixation by nitrogen-fixing bacteria is an endergonic process and is always accompanied by the exothermic breakdown of organic substances. In this exothermic process energy is evolved, part of which is utilised by the endergonic process. In natural processes changes of one form of en-

Fig. 2.20(B)

Absorption of solar energy by photosynthetic pigments in the visible spectrum is greatest in violet, blue and red portions.

Fig. 2.20(C)

Solar radiation outside the atmosphere, particularly outside the troposphere. The solar flux is about 1.94 gcal cm2 minute and amounts to 13 ¥ 1023 gcal/year.

Fundamentals of Ecology

106

ergy to another (except heat) are usually incomplete, because energy conversion involves friction and heat production. Source of energy The ultimate source of food energy for heterotrophic organisms is plants which synthesise food with the help of solar energy and inorganic substances like nutrients, CO2 and H2O in a biochemical process called photosynthesis. The photosynthetic equation involves photoautotrophs.

6CO2 + 6H2O

Solar energy Enzymes etc. (Chlorophyll)

C6H12O6 + 6O2

Fig. 2.21

Solar energy input at earth’s surface at mid-day (based on Geiger, 1941 and Kormandy, 1978).

Some autotrophs, however, utilise energy released from oxidation processes for the synthesis of organic food. For example, Beggiatoa utilises the energy released from the oxidation of hydrogen suiphide, which is oxidised to elemental sulphur with the release of energy. Sulphur is oxidised to sulphate if H2S is exhausted. 2H2S + O2 Æ 2H2O + 2S + 126 kcal (527 kJ) and 2S + 3O2 + 2H2O Æ 2SO4 + 4H + 294 kcal (1230 kJ) The energy released in this oxidation process is utilised to reduce CO2 for the production of carbohydrate. 6H2 + 2O2 + CO2 + Energy Æ (CH2O)n + 5H2O Therefore, Beggiatoa is able to grow in the complete absence of organic substances as its energy source is inorganic materials. It is called a Chemoautotroph. In any ecosystem, however, photoautotrophs are the main producers and chemoautotroph are not very significant. 2.7.3 Laws Governing Energy Transformation

Energy transformation in ecosystems can also be explained in relation to the laws of thermodynamics, which are usually applied to closed systems. The first law of thermodynamics is the law of conservation of energy, which says that energy may be transformed from one form into another but is neither created nor destroyed. If an increase or decrease occurs in the internal energy (E) of the system itself, work (W) is done and heat (Q) is either evolved or absorbed. Thus DE The decrease in the internal energy of the system

=

W Work done by the system

+

Q Heat given off by the system

Systems Concept in Ecology

107

D refers to a change in quantity. The total amount of heat produced or absorbed in a chemical reaction, either occurring directly or in stages, always remains the same. This is called the specific law of constant heat sums, and is included in the first law. Example 4

1. 2.

Combustion (direct chemical reaction) C6H12O6 + 6O2 Æ 6H2O + 6CO2 + 673 kcal (2816 kJ) Two-stage reaction (Fermentation) (a) C6H12O6 Æ 2C2H5OH + 2CO2 + 18 kcal (75 kJ) (b) 2C2H5OH + 6H2O Æ 6H2O + 4CO2 + 655 kcal (2740 kJ) (a + b) C6H12O6 + 6O2 Æ 6H2O + 6CO2 + 673 kcal (2816 kJ)

This law recognises the interconvertibility of all forms of energy but does not refer to the efficiency of transformation or conversion. In ecological systems solar energy is converted into chemical energy stored in food materials, which is converted into mechanical and heat energy. Hence energy is not created or destroyed in ecological systems but is converted from one form into another. The second law of thermodynamics states that processes involving energy transformation will not occur spontaneously unless there is degradation of energy from a non-random to a random form. In man-made machines (closed systems), heat is the simplest and most familiar medium of energy transfer. But in biological systems it is not a useful medium of energy transfer, as living systems are essentially isothermal and there are no significant differences in temperature between different parts of a cell or between different cells in a tissue. Thus, cells are not heat engines. Heat engines The maximum work W derived from a heat engine is given by the equation W = q(T2 – T1)/T2, where q is the heat absorbed and T2 and T1 are the absolute temperatures of bodies of matter between which heat passes. T2 can be the temperature of steam entering the piston and T1 can be the temperature of exhaust steam after the expansion stroke. Thus, the maximum efficiency of performance can be derived from heat only if there is a large temperature difference between the intake and the exhaust. The higher the temperature difference, the more efficient is the heat engine. In living systems there is no temperature difference between component parts (cells and tissues), and thus heat is not converted into work. Therefore we have to look to the second law of thermodynamics to understand the working of living systems under isothermal conditions. Concept of free energy, enthalpy and entropy Free energy may simply be thought of as that component of the total energy of a system which can do work under isothermal conditions. All physical and chemical processes proceed with a decline in free energy until they reach an equilibrium where the free energy of the system is at a minimum.

DG = H – TDS where G = change in the free energy of the system H = change in enthalpy, which is a change in the amount of energy in the form of heat liberated or absorbed by the system during physical or chemical changes. S = entropy change of the system T = absolute temperature.

Fundamentals of Ecology

108

Thus a decline in DG is accompanied by an increase in TDS. These are equal if there is no heat transfer between the system and the surroundings. If a reaction proceeds with a decline in free energy, we call it spontaneous. The second law of thermodynamics explains the energy transfer process in an ecosystem. 2.7.4 Energy Transformation in Nature

Ecological energetics includes energy transformations which occur within ecosystems. The first step is to know the quantity of incident solar energy per unit area of the ecosystem. The quantity of solar energy entering the earth’s atmosphere is about 15.3 ¥ 108 cal/m2/year (1 cal = 4.184 J). But the average amount of solar energy per unit area per unit time actually available to autotrophs depends upon their geographical location. The amount of solar energy received per square metre in the northern hemisphere is given in Table. 2.28. Table 2.28

Solar energy received in different latitudes Latitude

kcal/m2

0—20

173 ¥ 104

20—40

163 ¥ 104

40—60

114 ¥ 104

60—80

73 ¥ 104

As much as 95 to 99% of this energy is lost from autotrophs in the form of heat of evaporation and sensible heat. The remaining 1 to 5% is used in photosynthesis for primaiy production. The transformation of solar radiation into the chemical energy of plant tissues confirms the laws of thermodynamics. 1.

Solar energy assimilated by photoautotrophs

= NPP (chemical energy)

+ R (heat energy of respiration)

2.

NPP eaten by heterotrophs (herbivores)

= Chemical energy of assimilation by herbivores

+ Chemical energy of faeces produced by herbivores

Consumption

= Assimilation

+ Egestion

3.

Chemical energy assimilated by herbivores

= Chemical energy of secondary production (growth and reproduction) of herbivores.

+ Metabolic energy loss by herbivores

4.

Chemical energy of secondary production of herbivores consumed by carnivores

= Chemical energy assimilated by carnivores

+ Chemical energy of faeces of carnivores

5.

Chemical energy assimilated by carnivores

= Chemical energy of secondary production (growth and reproduction) of carnivores

+ Metabolic energy loss by carnivores

This flow diagram shows that at each transfer, heat energy (random form) dissipates. Hence the energy transfer is not 100% efficient and there is degradation of energy from a non-random to a random

Systems Concept in Ecology

109

form (second law of thermodynamics). Each transfer and the end result confirms the first law of thermodynamics. Solar energy entering the system = Heat energy leaving the system 2.7.5

Lindeman’s Trophic–Dynamic Concept

Lindeman (1942) developed the trophic– dynamic concept, which created a lot of interest among ecologists (Fig. 2.22). According to this concept, the energy content (biomass, etc.) of any trophic level is denoted by lambda (L). In an ecosystem, there is more than one trophic level and hence subscripts are used to show the energy content of different tropic levels. For example L1, L2 and L3 represent the energy contents of producers, herbivores and carnivores respectively. In general terms, Ln is taken to indicate any one of these trophic levels. Hence if Ln is applied to herbivores, then Ln – 1 signifies producers and Ln + 1 represents carnivores. Energy is continuously entering and leaving trophic levels and we can therefore designate ln as the quantity of Fig. 2.22 Trophic dynamic concept of Lindeman (a diagramenergy entering a trophic level per unit of matic representation) time. Since organisms of the trophic level perform metabolic activity, a portion of the energy they receive (ln) is dissipated as heat. Besides, energy from one trophic level passes to another (say from ln to ln + 1). The loss of heat energy (R) per unit of time plus the energy that has passed per unit time to the next trophic level is denoted by l¢n. Thus the generalised equation expressing the rate of change of the energy content of any trophic level (Ln) is DLn = ln + ln¢ Dt Therefore the rate of change in the energy content of a trophic level is equal to the rate at which energy is received by that trophic level minus the rate at which energy is lost from it (since ln is always negative, a plus sign is used). From this analysis it is clear that a trophic level always remains in a dynamic state since it receives and dissipates energy. Therefore this concept is called the trophic dynamic concept. It raises a number of important questions. What if L2/L1 of one ecosystem equals that of another? What if L2/L1 equals L3/L2 in a particular ecosystem? How efficient is the energy transfer mechanism between trophic levels? Is there any relationship between the net production of trophic levels? Is ln/ln – 1 a constant? Solving these problems helps us understand the functioning of ecosystems and provides an insight into managing crop plants and farm animals for our use.

Fundamentals of Ecology

110

Lindeman used ln in an inconsistent manner. For the first trophic level, ln represents the rate of photosynthetic production as per Lindeman. For all other trophic levels beyond producers, ln represents the energy intake. The rate of photosynthetic production is not the same as the energy intake. Therefore, for the sake of consistency, ln should represent energy intake by producers also. 2.7.6

Ecological Efficiencies

Ratios between energy flow at different points along the food chain expressed as percentages are called ecological efficiencies and are of considerable importance. In general the production efficiency at the primary producer level (photosynthetic efficiency) is between I and 5%. The production efficiencies between secondary trophic levels vary between 10 and 20%. From studies based on laboratory populations of algae, Daphnia and hydra, Slobodkin (1959) suggested that the transfer of energy from one trophic level to the next is of the order of 10%, and this is termed gross ecological efficiency. Thus if there are 100 calories of NP at the producer level, only 10 calories of secondary production would be expected at the herbivore level, only 1 calorie at carnivore1 level and 0.1 calorie at carnivore2 (top carnivore) level. This is known as the ten per cent rule, originally observed by Lindeman (1942) and later elaborated on by Slobodkin (1959) and others. However, researches carried out to date in different ecosystems around the world indicate a range of 5 to 35% in gross ecological efficiency with apparently no consistency within a given ecosystem. The ecological efficiencies can be grouped in two categories: 1. Between trophic levels. 2. Within trophic levels (within the organismic populations in a trophic level). Some of these efficiencies are as follows. Lindeman’s Efficiency or Trophic Level Energy Intake Efficiency The various efficiencies may be represented by the following formulae: It /It – 1 It refers to ingestion at trophic level t and It – 1 refers to ingestion at trophic level t – 1 (previous trophic level).

Net primary production = Photosynthetic efficiency (usually 1 to 5%) Solar energy received

NPP/LA

=

At /At – 1

Tropic level assimilation efficiency. At refers to assimilation in a particular trophic level (say t), and At – 1 to assimilation in the previous trophic level. Trophic level production efficiency or gross ecological efficiency. P refers to net production in a particular trophic level (say t) and Pt – 1 to that in the previous trophic level. Utilisation efficiency. At refers to assimilation at a particular trophic level (say, t) and Pt – 1 refers to the net production at the previous trophic level.

Pt /Pt – 1 At /Pt – 1

Ratios within trophic levels

Pt /At, Tissue growth efficiency. P and A refer respectively to net production and assimilation in a particular trophic level or in a particular species population or organism. This efficiency varies from 5 to 60%.

Systems Concept in Ecology

Pt /It

At /It

2.7.7

Ecological growth efficiency (gross growth efficiency). P and I respectively refer to net production and ingestion in a particular trophic level or in a species population or in an organism. It varies between 6 and 37%. Assimilation efficiency. This efficiency varies in different trophic levels. In the herbivore trophic level it may be about 30% but for organisms feeding on highly nutritive food (carnivores), it may be 70 to 80% or more. It may be different for poikilotherms and homeotherms. Besides, in nature there is a tendency for an inverse relationship to exist between tissue growth efficiency and assimilation efficiency in animals (Fig. 2.23). It and At refer to ingestion and assimilation in a particular trophic level.

Energy Flow Models

Fig. 2.23

111

Relationships between tissue growth efficiency (G/A). ecological growth efficiency (G/I), and as’similation efficiency (A/I) in animal populations where G is tissue growth, A assimilation, and I is ingestion (based on Welch, H. 1968). Note: In general animals with a higher

assimilation efficiency have a lower Many ecologists have made energy flow studies growth efficiency in different ecosystems. Golley (1960) worked out the energy flow in a simple food chain, grass Æ mouse Æ weasel. The plants fixed 1% of the available energy and the weasel got a very small portion of it. The energy flow model of Lindeman (trophic dynamic concept) has already been discussed. One of the earliest energy flow models was given by Odum (1956), in which a community boundary was shown. Besides, flow processes (light and heat flows), import and export and storage of organic matter were also shown. The decomposer subsystem was dealt with separately. Another early model was that of John Teal (1957) who elucidated the energy flow mechanism in a temperate cold spring in the USA. Teal estimated that herbivores consumed 2,300 kcal/ m2/year, 208 kcal/m2/year were consumed by the next trophic level and the gross ecological efficiency was about 9%. Of the total 3,078 kcal/m2/year entering the spring, 2,185 kcal (71%) were dissipated as heat, 33 kcal (1%) were lost through emerging adult insects and 860 kcal (28%) were deposited within the spring (much of it washed out). Odum (1971) gave a simplified energy flow diagram (Fig. 2.24) explaining the energy flow mechanism. He also described a generalised Y shaped energy flow model involving grazing and detritus food chains (Fig. 2.25). The energy flow processes in herbivore-based (grazing) and detritus-based food chains are basically different. The difference in the two food chains lies in a time-lag between the direct consumption (grazing) of living plants and the utilisation of dead organic matter. In grazing food chains usually 30 to 50% of NP passes through the grazers, whereas in a detritus food chain about 80 to 90% of NP passes through as dead, organic matter. Bray (1961) calculated a photosynthetic efficiency of 7.9% for Picea omorika (conifer). Odum (1971) estimated a 5% photosynthetic efficiency for phytoplankton of Silver Spring in USA. Pradhan and Dash (1984) studied net primary production, its transfer functions and the efficiency of energy capture in a savanna type tropical hill ecosystem (Sambalpur, India). The maximum plant biornass was 592 g dry weight/m2

Fundamentals of Ecology

112

at the bottom and 332 g dry weight/m2 at the top of the hill. The annual net primary production was 654 and 338 g dry weight per m2 and of this 211 and 146 g dry weight/m2 were in the form of below-ground production at the bottom and top of the hill respectively. The turnover for the below-ground component was 0.82 at the bottom and 0.84 at the top. The transfer of the total net primary production to total disappearance was 51% at the bottom and 70% at the top. The annual efficiency of energy capture was 0.37% at the bottom and 0.19% at the top of the hill ecosystem (Table 2.30). Table 2.29

Photosynthetic efficiency of some plant communities (from Ovington, 1962, Heilmers, 1964, and Transeau, 1926)

Plant

Site

Days in leaf/ growing season

Photosynthetic efficiency

Scot pine

Britain

360

2.2 to 2.6

Sugarcane

Java

360

1.9

European beach

Denmark

164

2.5

Rice

Japan

150

2.2

Corn

USA

100

1.23

It is now known that in annual populations of plants, the photosynthetic efficiency is usually 1 to 5%. Man always tries to increase the photosynthetic efficiency in crop plants by putting in a lot of auxiliary energy, in the form of labour, machines, irrigation, pesticide, fertiliser, etc. In crop plants the

Fig. 2.24

An energy flow model in the ecosystem. A—shows the general flow process. There is a major loss of energy in each transfer. B—shows the order of magnitude of energy losses in each transfer (H = herbivore, C = carnivore, SP = secondary production).

Systems Concept in Ecology

Fig. 2.25

113

Y-shaped energy flow diagram in the ecosystem. It shows the gross and net primary production, secondary production at herbivore and carnivore trophic levels, import and export of organic matter and large respiratory losses at each transfer (based on Odum, H.T. 1956, Odum, E.P., 1971). SR = solar radiation, GPP = gross primary production, NPP = net primary production, R = respiration, PC = primary consumer, SC = secondary consumer, TC = tertiary consumer, D = decomposer, S = storage

Table 2.30

System transfer functions in different seasons for the bottom and hill top sites (Pradhan and Dash, 1984)

Compartment

Bottom

Top

W

S

R

Yr

W

S

R

Yr

TNP to ANP

0.62

0.78

0.73

0.68

0.00

0.00

0.57

0.57

TNP to BNP

0.38

0.22

0.27

0.32

0.00

0.00

0.43

0.43

ANP to SD

0.75

0.00

0.02

0.33

0.00

0.00

0.11

0.51

SD to D

0.85

0.00

7.75

1.05

1.01

0.00

1.24

1.06

ANP to D

0.65

0.00

0.13

0.35

0.00

0.00

0.14

0.54

L to LD

0.48

0.00

0.42

0.92

0.25

0.00

1.65

0.94

BNP to RD

1.25

21.5

0.02

0.91

0.00

0.00

0.00

0.96

TNP to TD

0.67

12.5

0.04

0.51

0.00

0.00

0.13

0.70

TNP = total net primary production; ANP = above-ground net primary production; BNP = below-ground net primary production; SD = standing dead; L = litter; LD = litter disappearance; RD = root disappearance; TD = total disappearance; W = winter; S = summer; R = rainy season; Yr = Year

Fundamentals of Ecology

114

photosynthetic efficiency is little more than 1 to 5%, while in C4 plants it is slightly more than in C3 plants (refer to Section 2.4.5). It has been possible to increase the photosynthetic efficiency to up to 30% in a unicellular alga, Chiorella, grown in mass culture with a low light intensity and requisite nutrient salts and carbon dioxide. Westlake (1963) has compared 31 different plant communities and concluded that the most productive communities on an annual basis occur in the tropics because of abundant rainfall, sunlight, etc. This information helps us understand energy flow at the producer level. 2.7.8 Energy Flow at the Population Level Animal Populations We shall follow the IBP terminology for energy-flow, to understand the energetics of animal populations (Pestrusewicz and Macfadyen, 1970). Here, C = A + FU, A = P + R, P = E + DB

where FU = egesta, faeces, and urine, A = assimilation, DB = Change in biomass (growth and reproduction), C = consumption, E = elimination (the biomass of individuals that have died or been killed), P = production, and R = respiration. Many workers have studied the respiratory metabolism of animal populations, as this component involves some 50 to 90% of their energy flow. In an early study, Macfadyen (1963) compared the total annual respiration of nine soil types and one of his important conclusions was that from the point of view of respiratory metabolism, small decomposers like enchytraeids, nematodes and microarthropods in mor soils have a function similar to that of large decomposers like earthworms, woodlice and millipedes in mull soils.

Fig. 2.26(A)

Energy and matter exchange relationships of an organism (open system) with the environment.

A study of the energetics of any animal population will ideally involve solving the whole energy equation (refer to Pandian and Vernberg, 1987). Dash (1987), Senapati and Dash (1983, 1981), and Dash and Patra (1977) have worked out the energetics of tropical soil oligochaete populations (Figs. 2.26 A, B and C). Mohanty and Dash (1988), Mohapatra and Dash (1989), and Dash and Mishra (1989) have worked out the energetics of three species of tropical amphibian larvae (Table 2.31). In general, in poikilotherms the oxygen consumption per unit body weight declines with increasing body weight. Besides, the respiratory rate varies from species to species because some species are more active than others and even exhibit differential activities during different life stages. Therefore, for the understanding of energy flow in each species population, it is necessary to combine population estimates with the respiratory rates of each species on an annual basis. The temperature regulates biochemical activities and since distinct seasonal changes in temperature occur, it is necessary to measure animal metabolism at different seasonal temperatures to make the data more realistic. Tables 2.20 and 2.21 summarise the energetics of some animal populations. It is evident that homeotherms use a greater portion of the assimilated energy in respiration than poikilotherms, since

Fig. 2.26(B)

A box type flow model showing relationships between plant production, grazing activity and oligochaete production (after Senapati and Dash, 1981).

Systems Concept in Ecology

115

116

Fig. 2.26(C)

Fundamentals of Ecology

A box type model of energy flow in the earthworm populations in grazed and ungrazed pastures.

they require a lot of energy for the maintenance of body temperature. In contrast poikilotheims utilise a greater portion of the assimilated energy to build their body tissues.

Systems Concept in Ecology

117

Phillipson (1966) points out that the gross and net growth efficiencies of cattle raised on grasslands for beef are 4.1 and 10.9% respectively. In many poikilotherms the gross and net growth efficiencies are 4–13 and 55–60% respectively. Thus it may be energetically economical to raise earthworms, daphnia, fish, amphibia, etc. rather than cattle for animal protein. The best way of producing animal protein is to utilise poikilothermic invertebrates in the fish and poultry food chain to produce fish and chicken protein and to choose animals with high growth efficiency. The growth efficiencies of young animals are higher than those of older animals. Hence, with respect to food production, it may be desirable to sacrifice the animal at the age of maximum growth efficiency. But reproduction is another important aspect which should be considered. Since in chickens the gross growth efficiency decreases markedly about four months after hatching, the broiler industry for chicken meat operates by sacrificing chickens after 3–4 months (Phillipson, 1966). However, chickens lay eggs at the age of 5–6 months, which means that egg laying starts when the growth efficiency is not at a maximum. Phillipson has compared meat production in steer and rabbits of equal biomass (1300 Ib) providing an equal amount of the same food. Although beef cattle and rabbits produce the same amount of meat (240 Ib) from 1 tonne of hay, but the rabbits do it in 30 days while beef cattle take 120 days. Hence rabbits are more efficient than beef cattle in terms of meat production. Table 2.31

Ecological efficiencies (as %) in tropical amphibian tadpoles (poikilothermic)

Species

A

R

P

P

R

C

A

A

R

P

premetamorphic stage

84.97

61.11

21.11

34.54

2.89

postmetamorphic stage

81.89

65.95

27.65

41.93

2.38

premetamorphic stage

89.02

70.00

7.48

10.78

9.27

postmetamorphic stage

93.77

62.50

10.77

17.39

5.75

premetamorphic stage

70.00

62.50

17.56

28.18

3.55

postmetamorphic stage

72.28

51.07

14.87

29.13

3.43

Rana tigrina

Polypedates maculatus (tree frog)

Bufo stomaticus (toad)

C = Consumption, A = Assimilation, P = Production, R = Respiration Note: They were fed on the same diet (mixed diet, boiled Amaranthus leaves, boiled goat meat, egg yolk). Rana and Polypedates are very active species and do not exhibit schooling, while Bufo does.

2.8

MATERIAL CYCLING

All organisms, from viruses (threshold of life), bacteria, plants and animals, to man, are composed of matter and require about 40 elements for their growth and life processes. The dominant constituents of this matter are hydrogen, carbon and oxygen. Nitrogen, phosphorus, potassium, calcium, sulphur, iron and magnesium are also among the most important elements required by organisms. Many elements and

Fundamentals of Ecology

118

their salts, called nutrients, are essential for life. Some elements and their compounds have an important role in the living protoplasm and are required in large amounts. These nutrients, called macro-nutrients, are carbon, nitrogen, oxygen, hydrogen, potassium, calcium, magnesium, sulphur and phosphorus. Some others, called micronutrients, are required in small amounts. These are iron, manganese, copper, zinc, boron, molybdenum, vanadium, cobalt, chlorine and sodium. Some elements, such as sodium, can act as both macro and micronutrients depending upon the species and its requirements. This matter goes on circulating between the organism and its environment in circular paths called biogeochemical cycles (bio refers to living organisms, geo refers to soil, rock, etc. and chemical refers to these elements and their compounds). These biogeochemical cycles are basically of two types. 1. Gaseous cycles like carbon (carbon dioxide), oxygen, nitrogen, etc. 2. Sedimentary cycles like sulphur, phosphorus, etc. To understand the functioning of the ecosystem, it is essential to understand these cycles. Because of heavy pollution, some of these cycles are not predictable any longer, and it is therefore even more imperative to understand them. The essential features of some of these cycles are discussed here. Gaseous cycles The elements have a main reservoir in the gaseous phase, which is very important in the cycle. The cycles of carbon, hydrogen, nitrogen, oxygen, etc. are classified under gaseous cycles. Water occurs in three phases, i.e. liquid, solid (as ice and snow), and gaseous (as water vapour). In the liquid phase it is vital for the existence of life on this planet. The gaseous phase is important for cycling, although the main reservoir is not the gaseous phase. The water cycle is therefore considered separately as Hydrological Cycle. Sedimentary cycle The elements classified under this cycle do not have a gaseous phase (an exception in the sulphur cycle). They are usually found in soil and sediments and cycle through soil, water and the organism. Sulphur has a gaseous phase in SO2 and H2S, but its resident time in this phase is very small. Plants usually take sulphur from the soil in sulphate form. Bacteria can use elemental sulphur. Some amount of sulphur always forms sediments. Hence sulphur is included in the sedimentary cycle along with phosphorus. 2.8.1 Hydrological Cycle

Water determines the distribution, structure and function of organisms in the ecosystem. It is the universal solvent and hence important for cycling of other matter in the ecosystem. It is also essential for photosynthesis. The total quantity of water present on earth is estimated to be 266, 070 G (G = Geogram = 1020 g) distributed as follows: Rocks Sedimentry rocks Oceans

250,000

G

2,100

G

13,800

G

Rivers and lakes

0.25

G

Polar ice caps

167

G

Water vapour

0.13

G

Systems Concept in Ecology

119

Annually, some 4.46 G of water falls as rain of which more than 75% (3.47 G) falls on oceans. Of the less than 1 G of rain that falls on land, very little is stored underground. The water cycle maintains a balance which has been disrupted by the recent activities of man (industrialisation and urbanisation leading to deforestation). Water is found in liquid, solid and gaseous forms. The water cycle (Fig. 2.27 A) on earth is maintained by certain physical processes and by forests and water bodies. 1. Water is elixir of life and without water life can not exist on this planet. Without water no living body can be formed. The body of living organisms contains 50 to 90% water. About 65% of human body is water. Fig. 2.27(A) The water cycle Water is an universal solvent. Hence the importance of water is obvious to everybody. An estimated 1500 million cubic kilometers of water in one form or the other is present in the biosphere. The available liquid water is found in rivers, streams, lakes and ponds etc. for human use. Solar energy causes water to evaporate from earth’s surface and move up as water vapour and condenses high up and in the regions having dense vegetation cover. Climatic conditions and gravity draws water back to earth. Thus the process involves evaporation, cloud formation, condensation and fall of water as rain etc. The sun meets the energy required for evaporation etc and the wind pattern and gravitational pull become responsible of bringing water back to earth. Normal physical processes are very important for the maintenance of water cycle in nature. Water cycle includes some basic steps as shown in Fig. 2.27 B. Man largely uses fresh water for personal and other purposes. Since oceans are the reservoir of salt water, the evaporation of this water by sun’s heat energy and subsequent precipitation on land help to meet the requirement of Man. 2. The precipitation falls on the

ground, on vegetation and on buildings etc. and part of the precipitation leaches through the soil and is collected as ground water by an impervious layer of rock or clay. Man also uses part of this ground water for agriculture, industrial and domestic purpose.

Fig. 2.27(B)

Precipitation and its flow and interconnections

120

Fundamentals of Ecology

3. Some of the precipitation runs down the drains and ultimately reach the rivers, ponds, lakes and

ocean. 4. Water from the ocean, rivers, ponds, lakes, and ditches etc. get evaporated by sun’s heat energy and plants also transpire huge amount of water through their leaves and plants collect this water from the soil. Water remains in the vapour form in the atmosphere and then it forms cloud and drift with the wind. This water vapour in the form of clouds meet cold air in the mountainous regions, above forests etc. and then water vapour in the cloud condenses and falls due to gravitational pull as rain.

In the last few decades, the amount of water that is fit for human consumption and utilisation has decreased and many water bodies have become polluted. Demand for use of water is increasing as the population is increasing with increased agricultural and industrial activity. Large scale deforestation has also detrimental effect on the water cycle. The large cities and urban—Industrial areas consume huge amount of fresh water, which affect the water cycle. Hence, water management has become one of the main concern of man today. 2.8.2 Carbon Cycle

Carbon is found as graphite and diamond in nature. It also occurs as carbon dioxide (0.03 per cent v/v) in the atmosphere. It shows great versatility in forming bonds with itself and with other elements. Because of the position of its electrons, an atom of carbon can form covalent bonds with hydrogen, oxygen, nitrogen, phosphorus, and other carbon atoms. It can form four such bonds at any one time and because of this versatility, the carbon atom is the principal building block of many kinds of molecules which make up living organisms. Hence the carbon cycle is essential for the existence and survival of life. Carbon dioxide has the unique property of absorbing infrared radiation, thus keeping the earth warm. But in recent times, because of extensive industrialisation, huge amounts of CO2 have been released into the atmosphere. This has resulted in an excessive absorption of radiation, leading to an increase in the atmospheric temperature. A greenhouse effect has been experienced which has affected the functioning of organisms adversely. The atmosphere is the source of CO2, which is utilised by plants in photosynthesis reduced to form carbon compounds. Some of these carbon compounds are oxidised during respiration and in the process energy and CO2 are released. CO2 is also teleased when some carbon compounds are decomposed by microorganisms. Fossils (of plant and animal origin) formed millions of years ago contain carbon compounds. These fossils (coal and petroleum) form the most important energy source for modem man and produce CO2 when burnt. Thus the CO2 cycle is maintained by the processes of photosynthesis, respiration, decomposition and fossil fuel burning (Fig. 2.28). Oceans regulate the CO2 content in the atmosphere and thus play a very important role. Sea water contains 50 times more CO2 than air. This is in the form of carbonates and bicarbonates. The CO2 dissolves in sea water to form carbonic acid which converts carbonates into bicarbonates, which are dissociated during photosynthesis to precipitate carbonates. H2O + CO2 Æ H2CO3 H2CO3 Æ H3O + HCO–3

Systems Concept in Ecology

121

HCO3– + H2O Æ H3O+ + CO3– – Sea water is alkaline and rich in calcium and accelerates carbonate deposition. It contains sodium chloride whose partial dissociation helps in the formation of NaOH, which gives about 24 parts per thousand alkalinity. In warm climates, greater salinity and alkalinity coupled with high temperatures favour the formation of coral reefs and thicker shells of molluscs. 2.8.3 Nitrogen Cycle

Nitrogen is an important structural component of many necessary comFig. 2.28 The carbon cycle pounds, particularly proteins. The atmosphere is the reservoir of free gaseous nitrogen and nitrogen compounds are found in the bodies of organisms and in the soil. But living organisms, except some nitrogen fixing bacteria, cannot use elemental nitrogen directly. It has to be converted into nitrate to be utilised by plants. The gaseous nitrogen of the atmosphere is converted into reduced (NH4+) or oxidised (NO3–) forms which are involved at one stage or another. The root nodule bacteria, some other bacteria and blue-green algae convert the gaseous nitrogen into nitrates soluble in water. Nitrates are taken up by plants, which utilise them in the synthesis of amino acids and proteins. Herbivores graze ‘over plants, consume the plant proteins and convert them into their tissues. The dead plant and animal bodies and their excreta and decomposed by various organisms and gaseous nitrogen is released. This cycling (Fig. 2.29) involves many stages. Nitrogen fixation The conversion of nitrogen into nitrates is called nitrification. Thjs conversion is done by two methods, namely (a) non-biological methods, such as electrochemical methods during thunderstorms and lightning—it has been estimated that about 35 mg of nitrogen is converted into nitrate per square metre per year by this method, and (b) biological methods involving microorganisms which convert gaseous nitrogen into nitrate. Among the Cynophyceae algae, the Nostocales are important nitrogen fixers. Species of Anabaena are both free living and symbiotic. The free living bacteria important for nitrogen, fixation and Azotobacter, Beijerinckia, Clostridium, Derxia and Rhodospirillium. The above mentioned bacteria are non-symbiotic forms. Rhizobium sp. are symbiotic bacteria which are very important nitrogen fixers.

Nitrogen fixation occurs in symbiotic association in the root nodules of leguminous plants. Similar symbiotic nitrogen fixing bacteria occur in association in the roots of Alnus, Araucaria, Casuarina, Ceanothus, Coriaria, Eleagnus, Hippophae, Phycotria, Pinus, Ginko, etc. It has been estimated that biological

Fundamentals of Ecology

122

nitrogen fixation in soil amounts to about 700 mg N/m2/year. In oceans, species of Anabaena and Gleotrichia are the nitrogen fixers. Ammonification Organic matter of plant and animal origin is decomposed by microorganisms in the soil, and in the process ammonia and amino acids are released. The ammonia may escape to the atmosphere or be retained in the soil, and under certain conditions may be oxidised into nitrates. Conditions such as low cation exchange capacity, alkalinity (high pH), high temperature and dryness favour the release of NH3 as gas into the air. The microorganisms responsible for ammonification are bacteria of the genus Bacillus (Bacillus subtilis and Bacillus mesentericus) and actinomycetes.

Fig. 2.29

The nitrogen cycle.

Nitrification Another group of microorganisms converts ammonia into nitrates in a process called nitrification. Nitrates are formed first, and then converted into nitrates. Bacteria like Nitrosomonas, Nitrospira, Nitrosogloea and Nitrococcus are responsible for the conversion of ammonia into nitrites. Subsequently, other bacteria such as Nitrobacter and Nitrocystis aid the conversion of nitrites into nitrates. These two steps involve energy yielding reactions.

NH3 + 1½O2 Æ HNO2 + H2O + 66 kcal KNO2 + ½O2 Æ KNO3 + 17.5 kcal The energy released in these two steps is utilised in carbon assimilation by bacteria. Denitrification The reduction of nitrates to nitrogen, ammonia or to some oxides of nitrogen also occurs in the soil, mainly in anaerobic conditions. Some iron and sulphur bacteria utilise the oxygen of nitrates for chaemosythetic ai.tivity, as detailed below. The bacteria responsible for denitrification are Bacillus cereus, Bacillus lichenformis, Pseudomonas denitrificans, Micrococcus, Achromobacter and Thiobacillus denitrficans.

C6H12O6 + 6KNO3 Æ 6CO2 + 6KOH + 3N2O + 545 kcal 5C6H12O6 + 24KNO3 Æ 30CO2 + 18H2O + 24KOH + 12N2 + 570 kcal (per mole glucose) S + KNO3 + CaCO3 Æ K2SO4 + CaSO4 + CO2 + N2 + 132 kcal (per mol S)

Systems Concept in Ecology

2.8.4

123

Oxygen Cycle

Oxygen is present in large quantities (20.95% v/v) in the atmosphere. It also occurs in the bound state in water and as oxides and carbonates in rocks. It has been estimated that about 1 tonne of oxygen (60,000 moles) is present per square metre of the earth’s surface. Plants in all ecosystems release about 8 moles of oxygen per year per square metre of the earth’s surface during photosynthesis. This amount of oxygen is utilised by plants and heterotrophic organisms in respiration, so that there is a balance between the amount of oxygen production and utilisation. Dissolved oxygen in water is the source of oxygen for aquatic life. Another phase of oxygen is the ozone layer of the outer stratosphere of the atmosphere which protects life from ionising short wave radiations (ultraviolet). A generalised oxygen cycle is given in Fig. 2.30. Fig. 2.30

2.8.5

The oxygen cycle.

Sulphur Cycle

The sulphur cycle is classified under sedimentary cycles. Sulphur occurs in a gaseous form, as H2S and SO2 and a solid form as sulphate, sulphides and organic sulphur in soil and in the body of living organisms. The residence time of sulphur in the atmosphere is very small and its main reserve pool is found in the soil. Plants get sulphur form the soil by the activity of sulphur bacteria, which can use elemental sulphur. Oxides of sulphur occur in the atmosphere because of the burning of fossil fuels and volcanic actions. Sulphur dioxide and hydrogen sulphide return to the soil as sulphate or sulphuric acid along with rain. Sulphur found in living organisms is essential for the synthesis of certain amino acids such as cystein, cystine, and methionine, the peptide glutathione, enzyme cofactors like thiamine, biotine, thioctic acid and certain vitamins. With the decay of dead bodies of organisms and plants, sulphur comes back to the soil. The sulphur cycle is shown in Fig. 2.31. The cycle integrates soil, air and water, and one part of the sulphur forms sediments. Sulphur is incorporated in plants as —SH in proteins, passes to heterotrophs through the food chain and is released to the soil through dead tissue and faeces. In the decomposer system, fungi like Aspergillus and Neurospora under aerobic conditions, and bacteria like Escherichia and Proteus in anaerobic conditions, are responsible for the decomposition of sulphur containing proteins. In anaerobic conditions and sediments, H2S is formed by sulphate reducing bacteria like Desulphonovibrio desulfuricans. This bacteria utilises the oxygen in the sulphate molecule to obtain energy and in turn reduce the sulphate in deep sediments to H2S gas. CH2NH2COOH + H2O + SO–24 Æ H2S + HS + HCO–3 + NH+4 In iron-rich materials, most of the H2S reacts with ferrous iron to produce FeS, which is black and insoluble. Some chemoautotrophic bacteria like Thiothrix, Thiobacillus, etc. occurring in water

Fundamentals of Ecology

124

Fig. 2.31

The sulphur cycle.

containing H2S oxidise H2S to S (elemental sulphur) and then S to SO4 if all the H2S in the water is exhausted. H2S + O Æ H2O + S + 32.5 kcal S + 3O + H2O Æ H2SO4 + 141 kcal Thiobacillus thiooxidans may convert sulphur into sulphuric acid in very low pH (usually less than 1). Thiothrix and Thiobacillus are colourless bacteria. But some photosynthetic bacteria like the green sulphur bacteria (Chiorobium sp.) and purple-sulphur bacteria like Chromatium sp. use H2S as a source of hydrogen to reduce CO2 to produce glucose. CO2 + H2S

Solar energy Bacterial chlorophyll

(CH2O) + S + H2O + Energy

Green bacteria oxidise H2S to sulphur and purple bacteria oxidise sulphur to sulphate. Some other nutrients, such as iron, copper, cadmium, cobalt, zinc, etc. become available on account of their reactions with sulphur. For example iron is precipitated as sulphide and becomes available to organisms. Holland (1978) and Bowen (1979) have elucidated the global sulphur cycle showing that the main sulphur reservoir pool of 4 ¥ 1018 kg occurs in soil and sediments, as against the reservoir pool in the atmosphere of 4 ¥ 1010 kg. 2.8.6 Phosphorus Cycle

Phosphorus forms part of the sedimentary cycle and is very important, being the energy carrier as ATP and part of the nucleic acids (DNA and RNA). It is not found abundantly in natural ecosystems.

Systems Concept in Ecology

125

Phosphatic rocks contain phosphorus, which reaches the soil by a weathering process, and then becomes available to plants. The phosphates (inorganic phosphates, mainly orthophosphate ions) are utilised by plants in metabolism and then passed on to heterotrophic organisms through the food chain. The decomposition of organic matter of plant and animal origin by microorganisms releases the phosphates in the soil and makes them available to plants once again. Phosphorus has no gaseous phase. However, it may be found in air as tiny solid particles. The water-soluble phosphate becomes available in aquatic ecosystems and is lost to the deep sediments of the oceans through runoff, from where its recirculation to earth is yet to be understood. However, some amount of phosphorus is returned to earth in the form of bird excreta (guano), fish excreta and dead fish. In recent years the excessive use of phosphate fertilisers to increase primary production, and the use of detergents in households and elsewhere, Fig. 2.32 The phosphorus cycle. has created pollution problems and the loss of phosphorus to oceans and other fresh water bodies. This is also one cause of the eutrophication of fresh water bodies. The phosphorus cycle is presented in Fig. 2.32. 2.8.7 Cycling of Other Elements

Many other elements, such as calcium, potassium, sodium, etc. have a similar pathway of cycling, involving the abiotic (soil, water, etc.) and biotic phases (living organisms and their decomposition). These elements usually cycle within the same ecosystem and in small quantities globally. Usually rocks are the reserve pools and the weathering process enriches the soil and water with these elements. However, the dust of these elements may be blown away by the wind and carried across ecosystems and some amount lost in the runoff to lakes and oceans and then to deep sediments. Table 2.32 represents the nutrient concentration in the leaf litter of some plants and Figs. 2.33 and 2.34 show the cycling of some minerals in a tropical deciduous Dalbergia sissoo forest of Kurukshetra, India (Rajvanshi and Gupta, 1985).

Fundamentals of Ecology

126

Table 2.32

Nutrient concentration (%) in the leaf litter of some plant species

Species

Calcium

Magnesium

Potassium

Sodium

Nitrogen

Dalbergia sissoo

1.02

0.96

0.25

0.07

2.23

0.025

Diospyros melanoxylon

1.90

0.51

0.57

0.05

0.56

0.008

2.10

0.69

0.90

0.10

0.61

0.02

Tectonagrandis

2.54

0.25

0.24

0.20

0.78

0.18

Terminalia arjuna

4.42

0.37

0.54

0.06

0.85

0.24

Terminalia tomentosa

3.73

0.54

0.40

0.06

0.93

0.52

Shorea robusta

1.03

0.36

0.26

0.05

0.71

0.41

1.58

0.48

0.59

0.08

0.81

0.50

1.85

0.56

0.75

0.06

2.26

0.25

Butea monosperma

Phosphorus

Data Source: Vyas and Golley (1975); Rajvanshi and Gupta (1985). L-leaves

Br-branches

B-boles

Tree layer 19.1 (6.3)

9.9

96 (50.1)

(2.6)

Flux in water & water-like Herb layer 9.9

3.5 (0.7) (5)

78.8

Br

4.3 (0.9)

9.9 Litter 24.3

(33.8) 119.8 (60.3) 63.9

(5) 69.1

(4.7)

(42.3)

23.7

B

(9.2)

34.9

Soil 1170 (900)

130.8 (66.3) Cycling of sodium and potassium cycling in tropical forest

Fig. 2.33

Cycling of sodium and potassium in a tropical deciduous Dalbergia sissoo forest (value kg/ha/year, values for sodium in parentheses) (based on Rajvanshi and Gupta, 1985).

2.9 HOMEOSTASIS AND FEEDBACK Environmental parameters exhibit variations, which may be diurnal, nocturnal, seasonal, annual, cyclic, regular or irregular. Living organisms or systems are subjected to these changing conditions. Hence living systems always try to maintain a constant internal environment within narrow limits, irrespec-

Systems Concept in Ecology

127

L-leaves Br-branches tive of external changes. This is called Flux in water medium homeostasis. At the organismic level this is well understood. Ecosystems, commuL 51.3 nities or populations consisting of liv35.2 (18.8) (11.2) Herb layer ing organismic populations also display 12 5.2 (1.9) stability, maintained by physiological, (42.5) 102.9 (8.4) genetic, behavioural and ecological ad22.3 Br 15 (6.1) aptations. 463.4 22.3 (15.6) (153.8) The rate of photosynthesis of a whole (15.6) Litter 66 242.7 47.6 crop field, grassland or forest may be (36.1) (88.9) less variable from year to year than that Boles (23.3) 70.2 of individual crop plants, grass or. trees 145.2 (101.6) within the ecosystem, because when one (32.6) individual or species speeds up its activiSoil 792 ties, the other slows down, leaving the 267.6 (378) average value more or less constant. Eco(106.5) systems are capable of self-maintenance Calcium-and magnesium cycling in and self-regulation. The system exhibits tropical forest three states (Fig. 2.35)—those of growth, balance and ageing. Change in state may Fig. 2.34 Cycling of calcium and magnesium in a tropical forest (Dalbergia sissoo) (value kg/ha year, values occur with respect to time or due to variin parentheses for magnesium) (based on Rajvanshi ations in environmental parameters. One and Gupta, 1985). form in which environmental variation is controlled in ecological systems is through feedback, which involves a process in which information on the effect of a process is fed back to the component and used to change the component behaviour (Fig. 2.36). If increased output results in increased input, the feedback is considered positive and the state of growth is achieved. For example, an increased number of females in a population results in a further increase of births and the population grows. If output and input are inversely related, negative feedbacks (ageing system properties) occur. But the balance of positive and negative feedbacks may generate a dynamic stability (balanced system) (Fig. 2.35). The feedback may not be instantaneous, since information takes time to travel over the network and there is a time lag before the feedback has any effect on the

Fig. 2.35

Positive feedback

Negative feedback

Balanced feedback

Growth system

Aging system

Balanced system

Three states of an ecological system (system behaviour in terms of change with time).

Fundamentals of Ecology

128

Fig. 2.36

A conceptual feedback model

system. This time lag, however, may result in oscillations in system behaviour. The oscillating system remains stable as long as oscillations do not exceed the limits defined for it. Thus, ecosystems operate through feedback interactions and homeostatic mechanisms (Fig. 2.32). If these interactions and mechanisms become weak or absent, the ecosystem function is damaged or destroyed.

For example, if extensive overgrazing, fire or an air or soil pollutant destroys a grassland and inhibits the growth of new grass, a chain of reactions may occur in the system. The insect herbivores feeding on grass will leave the system because of lack of food. With the absence of insects, frogs and toads which depend upon insects for food will leave the system and this in turn will have an impact on snakes feeding on frogs and toads, and so on. Homeostasis at the population level may not always be so evident. However, the size and rate of function of most populations tend to remain within certain limits because of the operation of these mechanisms. (See Chapter 6 for a detailed discussion). Patten (1974) has developed a theory of ecosystem stability with regard to energy and matter constraints. Stability involves (a) resistance to change, and (b) restoration of a near original state after the disturbance. The decay or extinction of ecosystems results from the curtailment of inputs of matter and energy. Ecosystems exhibit one free equilibrium state called the zero state, in which they are structurally stable and exhibit changes through adaptation. Ecosystems tend to attain non-equilibrium dynamics when perturbed by disturbances. Hence their orderly functioning depends upon the balanced interaction between the component parts and with the environment.

2.10

DEVELOPMENT AND EVOLUTION OF ECOSYSTEMS

Ecosystems are capable of self-development, which may include growth, repair and replacement. The concepts of succession, seral and climax community are included in ecosystem development and evolution. These aspects are dealt with separately in Chapter 5. Life began on this planet some three billion years ago. The atmosphere contained water vapour, ammonia, methane, hydrogen sulphide, and oxides of carbon. Oxygen was perhaps not available in free form and hence the first living organism may have been a heterotroph residing in a reducing atmosphere and collecting organic food synthesised by abiotic processes. The primitive autotrophs evolved at a later stage and gradually converted the reducing atmosphere into an oxygenic one through photosynthesis, which paved the way for the evolution of complex and diverse organisms through long geological ages. Thus, ecosystems containing well-defined biotic and abiotic components evolved. These ecosystems influenced and controlled the atmosphere by their activities and in the course of millions of years complex and diverse living systems evolved. Natural selection brought evolutionary changes at the species and subspecies level. It also influenced convergence, divergence, the coevolution process and the evolution of natural communities in relation to environmental conditions.

Systems Concept in Ecology

129

2.11 CONCEPT OF MODEL AND ECOSYSTEM MODELLING 2.11.1 Concept of a Model

An ecological system is a macrosystem where many complex interactions occur and various forces act and interact. However by studying and describing simplified versions which include the basic properties and functions, we can understand a large system. This simplified version of a real situation is called a model. A model mimics the real world, such that complex situations can be comprehended and quantified, and predictions made. A model of an ecosystem has the following components Fig. 2.37 Modelling ecosystems (see text for explanation) (Fig. 2.37). 1. Properties of the system called state variables. These variables are found within the system. Autotrophic plants and the number or biomass or herbivores and carnivores can be considered state variables. 2. Forces, which drive the system or keep it in working condition are classified as forcing functions. They are usually energy sources and external variables. 3. Flow pathways of energy and matter connect state variables and forcing functions with each other. 4. Interactions, State variables and forcing functions interact to generate, modify, enhance or regulate flows. Flow pathways and interactions include rare processes which can be described by mathematical equations. 5. Universal constants like gas constants, molecular weight, etc. Figure 2.37 is a generalised model which conceptualises the interactions of the component parts of an ecosystem in such manner that they can be easily comprehended. We may fit this model to a pond in which P1 are the phytoplankton which convert solar energy (E) into food energy. P2 may represent zooplankton which graze over phytoplankton and P3 may be an omnivorous fish which may consume either phyto or zooplankton. Thus the interacting function-I will have more than one possibility, as described in the following. 1. It may be a no-preference switch if P3 eats either P1 or P2, according to availability. In other words it does not have a definite preference. 2. It can be a constant percentage value if the diet of P3 is composed of, say, 70% animal matter and 30% plant material or vice versa, irrespective or P1 and P2. 3. It may be a seasonal switch if P3 feeds on phytoplankton during one season and animals during another. 4. I could be a threshold switch if P3 prefers one type of food and switches to another if the availability of the first is reduced to a low level. This example shows the extent to which a model can

Fundamentals of Ecology

130

help one comprehend an actual ecological situation. Although this is an informal chart model, it may be quantified and converted into a mathematical one by formulating equations for flows and interactions, so that predictions can be made. 2.11.2 Features of Ecological Modelling

Modelling uses the logic of mathematics. It begins with carefully defined entities and is a simplified representation of the system. There are four main types bf complexity in ecosystems, which render modelling difficult. These are non-linearity, interaction, feedback and discontinuity. Hence transformation of data is very often required. It is convenient to plot a scatter diagram of linked variables or transformed variables. For example, if a scatter diagram of logY vs X shows a linear relationship, the curve or relationship is exponential. If logY vs log X is linear, the relationship is geometric curve. It is convenient to use semilog or log-log graph paper. Table 2.33 gives equations for different types of curves. Table 2.35

ANOVA model of body mass of Bufo stomaticus tadpoles as a function of initial density.

Equation

Curve

Polynomial

1.

Y = a0 + a1X

Straight line

First order

2.

Y = a0 + a1X + a2X2

Parabola or Quadratic

Second order

3.

Y = a0 + a1X + a2X2 + a3X3

Cubic

Third order

4.

Y = a0 + a1X + a2X + a3X + a4X

Quadratic

Fourth order

5.

Y = a0 + a1X + a2X2 + a3X3 + a4X4 + ... + anXn

nth degree curve

nth order

6.

Y1 1 = Y a0 + a1X

2

3

4

Exponential log Y = log a + (log b)X = a0 + a1X

7. Y = abX Modifi ed Exponential = Y = abX + g 8.

Y = aXb

Geometric log Y = log a + b (log X)

Modifi ed Geometric = Y = aXb + g 9.

Y = pqbX

Geompertz log Y = log p + bX (log q) = abX + g

Modified Geompertz = Y = pqbX + h 10. Y =

1 ab X + g

or

1 = ab x + g Y

Logistic curve

Note: To decide which curve should be used, it is convenient to obtain scatter diagrams of transformed variables.

Linear relationship A linear relationship indicates a proportional or constant relationship between two variables. If the two variables are X and Y, the equation becomes Y = bX or Y = a + bX. The value of Y changes in proportion to any change in the value of X. Y can be the respiration of a poikilotherm while X can be the habitat temperature.

Systems Concept in Ecology

131

Non-linearity The exponential growth function of an organism X = X0ert, where X is the population density at time t, X0 is the population density at time t = 0, e is the base of natural logarithms, and r is a constant, indicates a nonlinear relationship between the variables, population density X and time t (Fig. 2.38). Exponential growth can only continue for a limited time in most ecological situations because an increasing population will exhaust a finite resource.

Thus a population settles down to some steady value, usually showing a regular fluctuation but sometimes exhibiting an irregular fluctuation or a decline. If the population settles to a steady state, the logistic growth function is

Fig. 2.38

Non-linear relationships (an exponential and logistic growth pattern for organisms)

Xt = X0 /(1 – Ke–rt), where K is the carrying capacity. Non-linear models of this kind are generally used for the study of growth of organismic populations. But Lieth (1972), 1977) has developed such models to show relationships between primary productivity and climate. For example, Y = 3000/(1 + exp (1.315 – 0.19 T) and Y = 3000(1 – exp (–0.00064 R) where Y is the annual dry matter production in grams per square metre, T is the average annual temperature in degrees Celsius and R is the average annual precipitation in millimetres. Using the two equations and accepting the minimum value when they provide different estimates, Lieth developed models to show the dry matter productivity potential of the world. Interaction Interaction between organismal associations and processes creates complexity. The effect of one factor may change the action of other factors. Interactions can be very complex and can include non-linear effects. The analysis of variance models (Tables 2.33 and 2.34) helps us understand interactions. Feedback If some of the effects of a process are carried to the preceding stage of the source to strengthen the effect or the system as a whole, it is called a feedback interaction (Fig. 2.39).

Fig. 2.39

Feedback interaction in the ecosystem (note the grazing and nutrient feedback which occurs in natural ecosystems)

Fundamentals of Ecology

132

The behaviour of ecosystems becomes difficult to predict because of many feedback loops which may be connected by variables by non-linear functions. Hence, the identification of feedback loops is important for modelling. Discontinuity Discontinuity is a type of complexity. A minor change in some variables may cause a major alteration in the behaviour of the system. Discontinuity is also associated with other forms of complexity, such as bimodality, hysteresis and divergence. When a system is characterised by two or more distinct states, it is said to exhibit bimodality or multimodality respectively. Discontinuity indicates that only relatively few observations lie between distinct states. Hysteresis occurs when there is a delayed response by a system to a changing stimulus. The response may be one path for the increasing stimulus and another for the decreasing one. Divergence is characterised by starting conditions which may ultimately lead to widely separated final states. For example, in population biology, starting conditions just above or below a threshold value may diverge to provide different final populations. 2.11.3

Model Symbols

System interrelationships can be represented by symbols. It is always helpful to provide diagrams for the organisation, description, and simplification of relationships being modelled. Forrester (1961) has developed symbols which are very helpful in modelling ecological systems. The driving variables are shown by circles, state variables by rectangles and the rate of change by valves (Fig. 2.40). Constants or parameters are denoted by continuous circles on a line. The flow of material and flow of information are shown by continuous and dotted arrows respectively. Odum (1972) has also developed symbols which represent system processes and mathematical functions. In Odum’s symbols, a forcing function (a source of matter or energy from outside the system) is depicted by a circle. Three types of state variables are distinguished. State variable representing massive storage, namely biomass, detritus, etc. are shown by a storage tank. Self-maintaining components (state variable) like animals and decomposers are denoted by hexagons. Producers like green plants (autotrophic state variable) are depicted by bullet-shaped symbols. The output from the forcing functions or state variables involves loss of energy, necessitating the use of sink symbols. These denote the energy which must be degraded into heat in biological processes like respiration and other aspects of metabolism. The work gate symbol is used to show feedback loops by which systems are regulated. Flow control symbols include lines, backforce, control switches, valves, junctions and monitoring transaction. Odum’s symbols, although more complex, carry more information than those of Forrester. Both groups of symbols are in use in ecological modelling (Fig. 2.40). 2.11.4 Mathematical Modelling

Mathematical modelling can be defined as a process involving the following steps: (a) The variables are identified, objectively defined be quantitative and measurable according to standard scales; (b) The interrelationships among these are described through mathematical equations or relations; (c) From the above mathematical relations, rigorous conclusions and predictions can be derived; and (d) The model explains some important aspects of the phenomenon being modelled.

Systems Concept in Ecology

Fig. 2.40

133

Symbols used in ecological modelling (A—symbols developed by Forrester, 1961, B—symbols developed by Odum, 1972).

It is clear that a mathematical model can become quite complex, because in most real situations (e.g. for systems), the number of variables are usually very large and their behaviour is complicated. Since a model imitates the phenomenon under study, i.e. explains at least its important features, there is usually a hierarchy of models of increasing complexity and generalisations starting with a simple, idealised model where most of the variables are ignored or assumed to be of a simple nature and those features are retained which are considered important. Some general features of a mathematical model are: (i) The model should be realistic and should. It usually involve a large number of variables, many of them random, because natural phenomena usually involve many sources of random variations. Also, the equations in the model are likely to be of complicated nature. (ii) It leads to predictions in many different situations, including those not observed before. (iii) It allows us to examine many “what if’ type of questions. Technically we say that any model contains parameters which can be varied and their effect on the behaviour of the phenomenon can be examined mathematically.

Fundamentals of Ecology

134 2.11.5

Model Classification

Models are conveniently classified into many categories, namely 1. Deterministic, which include dynamic and matrix models. 2. Stochastic, which include distribution models, analysis of variance (ANOVA) models, regression models and Markov models. 3. Multivariate, which include principal component analysis, cluster analysis, reciprocal averaging and association analysis, discriminant functions and canonical correlation. Some other models, such as optimisation, game theory, and catastrophic theory models, are used in specific situations—cletails have been discussed by Jeffers (1982), and Jorgensen (1986). Mathematical models can be classified according to various criteria also: (i) According to the field of study (e.g. mathematical models in ecology, medicine, pollution or models of alloys etc. which includes all of physics and a significant part of chemistry). (ii) According to the type of variables (e.g. discrete models, stochastic models etc.). (iii) According to the form of equations in the formulation (e.g. matrix models, differential equation models, linear models, graph theoretical models, Markovian models etc.). (iv) According to the method of solution (e.g. simulation models and computer-oriented models). (v) According to special characteristics in formulated models or the phenomenon modelled (e.g. large-scale models, system models, optimisation models, etc.). Deterministic models Such models are usually oriented towards deterministic solutions. The dynamic model of a system includes equations describing the operation of the components of the model as accurately as those of the real system. System operations can be described by linear and non-linear responses of components to controlling variables, including positive and negative feedbacks. Thus dynamic models exhibit great flexibility. To prepare a dynamic model, an ecologist can start with a simple word model to develop sets of system equations to define the system. He can then develop relational diagrams linking the state variables of the system, and subsequently express these relationships in mathematical form. Model formulation allows for the introduction of non-linearity and feedback, which are important features of ecological systems. It is difficult to make predictions on the basis of dynamic models and this limits their value. Dynamic modelscre oriented to deterministic situations. Since ecological systems show a wide inherent variability, dynamic models may not be always very useful for analysing them.

In a matrix model the mathematical aspects of model formulation get priority and hence the reality of the situation is usually sacrificed to some extent. Lewis (1942) and Leslie (1945) developed some matrix models as deterministic models to predict the future age structure of a female animal population from the existing known age structure, with assured rates of fecundity and survival. The population is first divided into age classes of equal interval, so that the age classes in which all surviving animals die is known. A matrix equation can represent this model. In the equation the numbers of different animals in various age classes at time t + 1 are obtained by multiplying the numbers of animals in these age classes at time t by a matrix expressing the appropriate fecundity and survival rates for each class. Predictions of changes in population age structure can be made on the basis of this model.

Systems Concept in Ecology

135

Prey predator systems, which may exhibit oscillations, can also be expressed by matrix models if information on population size and survival is available. Usher (1969) and Leficovitch (1965, 1966, 1967) have respectively applied matrix models to the understanding of management and harvesting of forests and insect pests of stored products. Dynamic processes like nutrient cycling and energy flow in ecosystems can also be modelled by the use of matrices (Fig. 2.41).

Fig. 2.41

Matrix model. A matrix is a set of numbers or symbols arranged in rows and columns. A—This is a 3 ¥ 3 (3 rows and 3 columns) matrix X. Each element in the matrix is called xij where the subscript i denotes the row position and j the column position. A matrix with only one row or column is called a vector. B—Matrix multiplication

Stochastic models Models which take probabilities into consideration are called stochastic models. They are useful in emphasising the variability and complexity of ecological systems (Fig. 2.42). Distribution, ANOVA, regression and Markov models are included under this category. Distribution models These models include the mapping of the spatial pattern Fig. 2.42 The concept of stochastic and deterministic models. of living orgamsms. The patterns are ilA stochastic model considers all aspects shown in the diagram while a deterministic model assumes lustrated in Fig. 2.43, which shows three that the stochastic input disturbance and random different distributions having the same measurement error are zero density. Each square contains the same number of dots, representing individual organisms, so that the density is the same in all three squares. The frequency is therefore dependent partly on density and partly on pattern. Figure 2.36 shows the uniform distribution, with the variance of the number of individuals becoming smaller than the mean number of individuals. The distribution of sedentary invertebrates in a lake bottom may be uniform. The terrestrial behaviour of mammals or birds may often produce a relatively uniform spacing. A regular distribution of this type may be described by the positive binomial probability distribution. The expected frequency distribution is given by N(q + p)k, where N is the number of sampling units, p the probability of any point in the sampling unit, q = 1 – p and k the maximum possible number of individuals a sampling unit can

136

Fundamentals of Ecology

include. Estimates of the parameters k, p and q are obtained from samples of the population. However the occurrence of a totally uniform distribution is not common.

Fig. 2.43

Organismal distribution models (see text for explanation).

Alternatively, a random distribution of individuals may occur. Here the probability of occurrence of an individual is constant and not affected by the presence of another individual. In random distributions each individual has an equal probability of being included in a sampling unit. Mathematically this is described by a Poisson distribution in which the mean number of individuals per sampling unit also equals the variance of the number of individuals from sampling unit to sampling unit. Thus the model is — — X = s2 or s2/X = 1. The probability of occurrehce of an individual is constant and is not affected by the presence of other individuals. If an organismal distribution is not random, other models of distribution, showing departure from randomness, may be considered. If the spatial distribution of an organism is — neither random nor uniform and the variance per sampling unit is greater than the sampling mean (s2/X > 1), the distribution is said to be patchy or contagious. A number of mathematical models are available for such irregular distributions. ANOVA (analysis of variance) models The linear and factorial ANOVA models are stochastic models of considerable scientific importance. The thodel assumptions are (a) that the effects are additive, (b) that the residual effects vary from observation to observation and distributed with zero mean and identical variance, and (c) that the residuals are considered normally distributed if tests of significance and estimated confidence limits are required. ANOVA models are powerful tools for analysing ecological data (Table 2.34).

Systems Concept in Ecology

Table 2.34

137

ANOVA of body mass of tadpole as a function of active space

Mean body mass (mg) : sample size in parentheses Active space per

Time

individual (ml)

(days)

63

7

70.3(10)

72.2(10)

71.9(10)

9

117.5(10)

120.9(10)

111.3(10)

11

153.0(5)

170.4(5)

153.8(5)

82

135

260

500

7

Replicate 1

2

85.5(10)

3

78.0(10)

81.2(10)

9

149.9(10)

133.3(10)

137.7(10)

11

199.0(5)

179.0(5)

182.6(5)

7

95.1(10)

96.4(10)

96.4(10)

9

170.6(10)

160.6(10)

172.7(10)

11

221.4(5)

212.6(5)

221.0(5)

7

111.9(10)

109.7(10)

118.4(10)

9

195.3(10)

192.4(10)

202.2(10)

11

239.6(5)

241.4(5)

250.2(5)

7

110.0(10)

103.7(10)

113.9(10)

9

173.1(10)

166.8(10)

170.7(10)

11

240.6(5)

225.0(5)

231.8(5)

Analysis of Variance MS

F

Active space

Source

df 4

27337.64

6834.41

2.34

Block

2

179.93

89.97

Active space ¥ Block

8

679.81

84.98

Error

30

100140.74

3384.02

Total

44

128338.12

2916.78

Principles of ANOVA Models

SS

p(0.05) Not significant

In many a situation there may be a need to test the significance of differences between three or more sampling means. Here, the scientist has to identify the different sources of variability. For example, there will be natural variability among experimental units. In statistical terms this variability is classified as ‘error’, which is not synonymous with mistake. Variability in biological species/units is natural, and basis of evolutionary process and this is expected. However, variability may arise due to experimental treatment called treatment effect between different groups. Hence, the scientist has to separate, assess and compare these two components, namely natural variability, treatment variability of the total variability. If the natural variability within the group is as great or greater than the variability between groups, the conclusion will be that the treatment effects are not significant. However, if the variability between groups due to treatment is significantly greater than the natural variability within the groups, the conclusion c n be that the treatments have a significant effect.

Fundamentals of Ecology

138

This is explained by a linear model: =+T+e X=X = where any individual measurement (X) consists of (1) the grand mean of all measurements (X ), (2) the treatment effect (T), and (3) the natural variability (error) effect. The error is randomly distributed. To increase the probability that the natural variability is randomly distributed, it is essential to adopt randomization procedures when assigning experimental units to different groups for treatment. Analysis of variance models can be one factor design, two factor design, randomised block designs, multi factor design models etc. In a two factor experiment with randomised blocks the model would be Xjk = m + aj + bk + Ejk where Saj = 0 and Sbk = 0. Here, m is the population grand mean, aj is that part of Xjk due to the treatment effects, bk is that part of Xjk due to block effects and Ejk is that part of Xjk due to chance or error. The assumption is that Ejk is normally distributed with mean 0 and variance s2 so that Xjk are also normally distributed with mean m and variance s2. The model for a two factor experiment with replication would be Xjkl = m + aj + bk + Yjk + Ejkl where subscripts j, k, l correspond to jth treatment, kth block and lth replication, respectively. As before m, aj and bk are defined and Ejkl is error term, while Yjk denote treatment block interaction effects. Xjkl are assumed to be normally distributed with mean m and variance s2. The total variation of all data can be broken up into between groups (rows) VR, within groups (columns) VC, interaction VI and random or residual error VE : V = VR + VC + VI + VE. Example 5 an analysis of a variance model Mahapatro and Dash (1987) performed two experiments to study the density effect on the growth and metamorphosis of Bufo stomaticus larvae (tadpoles) which were reared in a mixed diet, prepared by combining boiled Amaranthus sp. leaves, boiled egg yolk and cooked minced goat meat in a ratio of 5 : 1 : 1 respectively. From the third day after hatching, mixed food was supplied at the rate of 3 g per tray for each density up to the sixth day and the quantity was increased to 5 g from the seventh day onwards. Tap water was conditioned with sodium thiosulphate and was used as the culture medium. They performed to experiments. 1. In order to determine the effect of volume of water per individual, called active space, on growth and metamorphosis, ten tadpoles per tray were reared in polythene containers of four different diameters as well as in larger glass aquaria, each with three replicates. The water depth was maintained at 2.5 cm in all the containers so that the total volumes were 630, 820, 1350, 2,600 and 5,000 ml respectively. The mass of all the individuals of a replicate tray at one time was determined to ascertain the mean growth rate. 2. To analyse the density effect on larval growth and metamorphosis, populations of six densities (10, 20, 40, 80, 160 and 320 tadpoles per tray) were reared in polythene trays (26.5 cm diam.) with 2.3 litres of conditioned water, each with three replicates. The mass of ten tadpoles at one time was measured to determine the growth rate. The mean growth rate per individual was calculated from

Systems Concept in Ecology

139

the three replicates, and metamorphosed individuals (tadpole with at least one forehmb exposed) were removed from the experimental population. An ANOVA model (Morrison, 1976) was used to determine the main effect of active space adjusted for time on growth and metamorphosis and the main effect of initial density adjusted for the effect of time on growth and metamorphosis. The mean body masses on the seventh, ninth and eleventh days of growth were used in the ANOVA model (Tables 2.34 and 2.35). Table 2.35

ANOVA model of body mass of Bufo stomaticus tadpoles as a function of initial density.

Mean body mass (mg) : sample size in parentheses Initial

Time in

density

(days)

10

7

Replicate 2

3

90.1(10)

91.4(10)

86.4(10)

9

161.6(10)

168.3(10)

151.7(10)

11

209.4(5)

217.0(5)

195.8(5)

20

1

7

81.1(20)

78.8(20)

72.4(20)

9

137.8(20)

142.6(20)

128.6(20)

11

160.0(10)

178.8(10)

172.3(10)

40

7

72.1(40)

76.7(40)

63.6(40)

9

117.7(40)

123.4(40)

113.2(40)

11

143.3(15)

159.9(15)

154.3(15)

7

63.3(60)

60.5(60)

59.4(60)

80

9

92.2(60)

91.0(60)

97.3(60)

11

127.3(15)

127.9(15)

130.8(15)

160

7

42.9(80)

42.5(80)

43.0(80)

9

66.8(80)

66.2(80)

66.2(80)

11

89.4(20)

88.7(20)

89.4(20)

7

29.6(100)

28.0(100)

25.8(100)

9

41.7(100)

44.1(100)

41.4(100)

11

59.6(40)

58.5(40)

56.5(40)

320

Analysis of Variance Source

df

SS

5

73,562.99

14,712.6

Block (1, 2, 3)

2

261.00

130.5

Density ¥ Block

10

382.33

38.23

Error

36

56,450.95

1,568.08

Total

53

130,656.27

2,465.23

Density (10, 20, 40,

MS

80, 160, 320)

F

P

5.97

0.05), where M = body mass at metamorphic climax, AS = active space per individual and t = average time (days) for metamorphosis. Thus the weight at metamorphic climax was independent of the available active space, time being considered the covariate in the analysis. The mean body masses on the seventh, ninth and eleventh days of growth (Table 2.35) were used to examine the main effect of initial density adjusted for the effect of time. The analysis shows that the initial density had a significant effect on the growth of tadpoles. Multiple regression analysis with available active space as the covariate of initial density was done to find out the effect of active space on the growth of tadpoles on days 7, 9 and 11. The regression models were described by the equations: M = 67.9 + (– 0.134)N0 + (0.102)AS, (r2 = 0.99, F = 107.01, df = 2, 3, P < 0.001) M = 105.48 + (– 0.219)N0 + (0.263)AS (r2 = 0.97, F = 66.6, df = 2, 3, P < 0.005) and M = 139.91 + (– 0.267)N0 + (0.311)AS, (r2 = 0.98, F = 126.88, df = 2, 3, P < 0.001) for days 7, 9 and 11, respectively and where M = body mass per tadpole, N0 = initial density and AS = available active space per tadpole. The equations show that the rate of tadpole growth was dependent on initial density but did not increase with decrease in active space. The S-shaped growth curve showed a right-hand shift with crowding, which suggests that the growth rate of an individual was inhibited by the remaining members of the population (Fig. 2.44).

Fig. 2.44

Growth curve of Bufo stomaticus tadpoles.

Systems Concept in Ecology

141

The body mass at metamorphic climax was analysed by multiple regression model with time as a covariate of initial density. The regression line was described by the equation. M = 107.51 + (0–0.783) N0 + (7.149)t, (r2 = 0.89, F = 12.68, df = 2, 3, P < 0.05) This indicates that growth was dependent on initial density and was reflected in weight at metamorphosis but not on the time of metamorphosis, when time was considered the covariate of initial density. Mahapatro and Dash (1987) used other ANOVA models and a regression model to comment on the threshold size of tadpoles for metamorphosis and regarding the schooling of tadpoles (not discussed here). Regression models

The linear models of ANOVA are a type of regression model which can be

expressed as: Y = b0 + b1x1 + b2x2 + ... + bpxp where Y is a random variable distributed about a mean which is dependent on the values of the p variables x1 ... xp. The assumption is that these variables affect only the mean Y and the variance is constant. If tests of significance are to be made, then Y is assumed to be normally distributed. It is also assumed that the mean is regarded as a linear function of the x variables and there can be functional relationships between the x’s, so that ploynomial and non-linear functions are included. Mohapatro and Dash (1987) have used regression models to analyse ecological data, which has already been discussed. Markov models

In these models the basic format is of the matrix of entries which expresses the probability of transition from one state to another at a particular time. These models resemble matrix models with the additional provision that the sum of probabilities in the columns must be one. Thus Markov models can be considered as hybrids of matrix and stochastic models.

Multivariate models A variable is a quantity which may take any value from its domain. These values may be continuous as in measurements of weight and height, or discrete, as for the counts of individuals or counts of heads in a toss of coin. A variable is said to be random if it fluctuates in an unpredictable manner. The values of random variables can be counted or measured. In both cases we may replace our variable by a variate. The domain of a variate is a set of real numbers, denoted by x or y. If the variable is the haemoglobin content (g %) in the blood of a normal human being, then the corresponding variate will ordinarily be values between 10 g% and 16 g%. Thus a variate is a quantity which may take on any of the values of a specified set (domain) with a specified probability. In some ecological situations, models need to include the behaviour of more than one variate. These models are called multivariate models and the techniques involved in them collectively constitute what is known as multivariate analysis. Multivanate models broadly include two types, namely (a) predictive, and (b) descriptive models. Pearce (1969) has described various multivanate techniques. Principal component analysis, cluster analysis, reciprocal averaging and association analysis, discontinuous functions and canonical correlation are among the various techniques of multivariate analysis discussed by Jeffers (1982). 2.11.6 Process of Model Building

An ecological system represented in a model should be pragmatic in content and scope. The model must be quantitatively predictive, so that the future behaviour of the system is understood. Model building

142

Fundamentals of Ecology

requires (a) identification of state variables, (b) factors which influence the state variables, (c) processes which change the state variables, (d) identification of interactions and flow process depiction in graphical and mathematical terms, and (e) testing and validation of the model using an independent set of data. System’s range and objective The physical and functional boundaries of the system under investigation are prescribed and the objectives set in clear terms. Ecosystem modelling is costly considering the numerous variables involved and this may lead to constraints in the defining of initial boundaries and objectives to be achieved. Variables All relevant variables, whether forcing functions (driving variables) or state variables, are listed and quantified. Identification of flow processes and interactions All processes involving energy flow or matter cycling and interactions between the state variables are identified. Factors which affect these flow processes or interactions are noted. Functional relationship (a) Empirical quantity relations which relate each state variable to a set of exogenous and endogenous variables are quantified. Their initial, current and stepwise weighted summation values are noted.

A general equation for functional relationship is as follows (Patnaik, 1983). Yit = f [ x j , zk , ylo , Â Cmn X m , Â d pq z p , Â Â ers xr yvo ] n

q

v s

where x, y, and z are endogenous state and exogenous variables, c, d and e are constants, i, j, k, l, m, p. r and v are general indices and q and s are indices for time subperiods. The relation may be explicit or implicit, graphically or mathematically correlated and linear or non-linear. (b) Rate relations provide an insight into the nature of flow processes. They are of the following type: dyi = ( x j , zk , ylo , Â Cmn X m , Â d pq z p , Â Â ers xr yvo ) dt n q r s The expressions may or may not be integrable. Depending upon the objective, the detailed analysis can be expanded or restricted. If detailed analysis is no longer required, the unconnected remainder of the endogenous variables may be treated as exogenous, i.e. input variables. If expansion is required, the endogenous variables can be expanded in terms of the variables already present. Subsystem An ecological system which is generally hierarchic may be divided into many subsystems to reduce the number of variables and processes, and thus the complexity. Each subsystem is governed by its own processes and can be connected to other subsystems. The input to one subsystem can be the output to another. A subsystem can be further simplified by the formation of nested subsystems. Model complexity The simplest type of model is the regression model, which can deal with only two variables. Model complexity can increase along different directions. A larger number of variables

Systems Concept in Ecology

143

may be included to get closer to reality, and thus increase accuracy. The introduction of greater realism to bring about subsystem coordination, or inclusion of both stochastic and deterministic processes, increases model complexity. Estimation of functional relationships and parameters The experimental verification of functional relationships between various factors is rarely done because of the cost and time involved. Regression analysis helps us draw functional relationships, although it may not be ideal for non-linear, differential, or stepped relationships. In such circumstances the trial and error method of numerically analysing a sequence of observed values of the variables is more suitable. However, the estimation should be such that it covers the whole system, and not merely a part of it. Model testing and validation Models speak quantitatively about a system. No model is perfect. Validation involves studying the error distribution and observing if the errors are consistent. Subsystem validation may be undertaken first, if it is properly defined. Generalisation A good model has wide applicability. Although it is generated through observations on one particular ecosystem, it should be validated through observations on similar ecosystems.

Data for validation should be distinctly different from those used for estimation. If this is not possible, care must be taken to choose a set of data independently from all ranges for testing and validation. Error Source Error may be due to (a) errors in estimation, (b) errors in modelling, and (c) differences between model predictions and reality. Errors can be identified and minimised if different sets of data are used for parameter estimation and testing. Old data and updating Old data, if exhaustive and complete, could be used for validating models which are clearly defined, assuming there is no record of a discontinuity due to natural calamities. A model may be good, but in course of time the divergence between the actual and the predicted values of a variable increases as errors are different for different variables in the begin- fling and diverge differently in time. Hence the model data, constitutive equation and structure may be changed from time to time for a more accurate fit. Such changes can be brought about after a careful study of the sensitivity. Problem

The Leslie model is a popular one for studying the actual problem of a game (deer, sambhar, rabbit) reserve (20 ¥ 20 km) forest in India. It is at + 1 = Aat

(1)

at = (at0, at1, ..., at n) is the population’s age structure at time t, at1 being equal to the number of females alive at time t in the age group i to i + 1. at + 1 = a column vector similar to at but representing the age structure at time t + 1.

A=

f0

f1

fn - 1

fn

P0 0 0

0 P1 0

0 0 0 0 0 Pn - 1

0 0 0

Fundamentals of Ecology

144

A is a fecundity-mortality matrix where f1 is the number of females born at time t of mothers in the age group i to i + 1, who will survive up to time t + 1 and Pi = probability that a member aged i to i + 1 at time t will remain alive up to time t + 1. Equation (1) gives at + k = Akat after k periods

(2)

and A a = la

(3)

where l is an eigenvalue and a is the eigenvector associated with it. Since A is a non-negative irreducible matrix, the Peron-Frobenius theorem tells us that: (a) there is a l0 which has a vector with all elements non-negative (the model will always predict a non-absurd age structure), (b) l0 is the only such eigenvalue of A—the age structure is unique, (c) l0 is not less than any other latent root of A (numerical application is simple, and (d) largest row sum ≥ l0 ≥ smallest row sum and largest column sum ≥ l0 ≥ smallest colunm sum. A non-prolific breeder species may exhibit a fecundity-mortality matrix similar to the one shown below. Age in Years

0–1

1–2

2–3

3–4

4–5

5–6

6–7

0

0

0.19

0.44

0.5

0.5

0.45

0.87

0

0

0

0

0

0

0

0.87

0

0

0

0

0

0

0

0.87

0

0

0

0

0

0

0

0.87

0

0

0

0

0

0

0

0.87

0

0

0 0 0 0 0 0.87 0.8 for which l0 = 1.0986 > 1, which means the population can increase slowly. The intrinsic rate of natural increase (r) is defined as r = loge l0. The permissible harvesting (H) percentage is H = 100

l0 - 1 l0

A more prolific breeder species, such as rabbit, may display an A matrix of the form È0 Í1 Í 3 ÍÎ 0

9 0 1

2

12˘ 0 ˙˙ 0 ˙˚

2 -1 ] 2 A calculus model gives Nt = N0ert where Nt is the population at time t, N0 is the population in the beginning, r is the intrinsic rate of increase and e is the base of natural logarithm. for which l0 = 2, which gives a harvesting rate of 50% [ H = 100

Systems Concept in Ecology

145

The A matrix can be shown as a sum of two matrices. f0 0 A= � 0

f1 0 � 0

f3 � 0 � � � 0

0 fn P0 0 + 0 � � 0 0

0 0 0 0 0 0 0 0 P1 0 0 0 = F + P � � � � 0 0

where F represents the input of new members to the population and P represents the transition of members from one age group to another. The Leslie model can be used for modelling a variety of systems: 1. Spatial distribution of species 2. Plant populations 3. Animal populations (size grouping, population dynamics, prey-predator interactions, etc. 4. Seasonal and random environmental changes 5. Harvesting

MULTIPLE CHOICE QUESTIONS Choose the correct answer 1. Thermodynamically ecosystems can be considered as one of the following: (a) Exchange matter and energy with the environment and remain in dynamic steady state. (b) Exchange matter and energy with the environment and remain in equilibrium state. (c) Exchange energy but not matter with the environment. (d) Exchange matter but not energy with the environment. 2. In general stable and mature natural communities will have Shannon–wiener diversity index value between: (a) 0.1 and 0.3 (c) 0.6 and 0.9 (b) 0.3 and 0.5 (d) Always less than 0.6 3. 4.

5.

Leaf Area Index (LAI) of a climax tropical forest averages around: (a) 4–6 (c) 2–3 (b) 10–12 (d) 20–22 Ratio between energy flow at different points along a food chain expressed as percentage are called: (a) Ecological efficiency (c) Ecosystem efficiency (b) Energy efficiency (d) Habitat efficiency A natural ecosystem has the following component parts: (a) Producer, herbivore, carnivore and abiotic nutrient pool. (b) Producer, consumers, decomposers and abiotic nutrient pool. (c) Herbivore, carnivore, decomposers and abiotic components. (d) Plants, animals and microorganisms.

Fundamentals of Ecology

146

6.

Sampling of two aquatic habitats (X and Y) in a geographical region revealed the presence of twelve fish species which showed their occurrence as follows: (a) Total number of species recorded in both habitats : 12. (b) Species common to both the habitats: 4 (c) Species present in habitat ‘X’ but absent in ‘Y’ habitat: 3. (d) Species present in habitat ‘Y’ but absent in ‘X’ : 5. Species A B C D E F G H I J K L

7.

8.

9. 10.

11.

Occurrence in aquatic habitats X Y Present Absent Present Present Absent Present Absent Present Present Absent Present Present Absent Present Absent Present Absent Present Present Present Present Present Present Absent

Calculate the Sorensen’s coefficient of similarity between the two aquatic habitats and comment on their similarity. In which of the following, the principal type of food chain is grazing food chain? (a) Pond (c) Degraded land (b) Forest (d) Forest and degraded land In a parasitic food chain, pyramid of number is (a) upright (c) sometime inverted and sometime upright (b) inverted (d) unpredictable. In an aquatic system such as lake, pyramid of biomass is usually: (a) May be upright (c) Inverted (b) Always upright (d) Not predictable Which type of pyramid takes care of productivity and turnover of each trophic level? (a) Pyramid of biomass (c) Pyramid of number (b) Pyramid of energy (d) Pyramids of number and biomass Mark the correct statement. (a) Simpson’s index of dominance is weighted in favour of dominant species and Shannon’s index of diversity is in favour of rare species. (b) Shannon’s diversity index is weighted in favour of dominant species where as Simpson’s dominance index is in favour of rare species.

Systems Concept in Ecology

(c) (d) 12. 13. 14.

15. 16. 17.

18. 19.

147

Both Shannon’s index of diversity and Simpson’s index of dominance are weighted in favour of dominant species only. Both Shannon’s index of diversity and Simpson’s index of dominance are weighted in favour of rare species only.

Value of evenness index can never be more than (a) 1 (b) 2 (c) 0.5

(d) 0.1

Simpson’s dominance index shows a range of (a) 0 to infinity (b) 0–10 (c) 0–100

(d) 0–1

Which one of the following pyramids for a system can never be inverted? (a) Pyramid of biomass (c) Pyramid of number (b) Pyramid of energy (d) All pyramids. As per Slobodkin (1959), the transfer of energy from one trophic level to the next is of the order of (a) 10% (b) 5% (c) 50% (d) 20% Conversion of nitrate to nitrite / NH3 in the nitrogen cycle is called: (a) Nitrogen fixation (c) Nitrosification (b) Nitrification (d) Denitrification One of the following is the predominant food chain in a mature forest: (a) Grazing food chain (c) Parasitic food chain (b) Detritus food chain (d) Both parasitic and grazing food chains The ratio of a unit ground surface area to the surface area of the leaves above is called -----------Problem solving: (a) The following table provides data on the relative abundance of four bird species in two islands in Bay of Bengal. Calculate the Bray–Curtis and Morisita’s index of similarity between the islands and comment.

Table 1 Number of occurrence of each bird species are given in the table.

Table 2

Bird species

A

B

C

D

Island-J

45

120

08

12

Island-K

10

50

95

30

For calculation of Morisita’s index, data can be arranged as given below. Bird species

Island-J Xij

Island-K Xik

X

45

2025

10

100

450

B

120

14400

50

2500

6000

C

8

64

95

9025

760

D

12

144

30

900

360

After calculation check the answer: Bray-Curtis Index = 0.57 Morisita’s Index = 0.52

X

Xij Xjk

A

2 ij

2 ik

Fundamentals of Ecology

148

Points for making comment: (i) Maximum similarity can be one under same ecological conditions and zero under distinct dissimilar ecological conditions including availability of food etc. (ii) Significance difference if any can be calculated by statistical methods. 20.

Density of different species of earthworms in two grassland soils are as follows: Species

Site-1

Site-2

density

density

A

4

10

B

2

4

C

1

1

D

1

1

E

2

4

Calculate Simpson’s dominance index for the earthworm species in both the habitats separately and comment on the result.

SHORT AND DESCRIPTIVE QUESTIONS 21. 22. 23. 24. 25. 26.

What are the main characteristics of system concept in ecology? Enumerate. Will you consider an rocket carrying astronauts to space and revolving around the Earth and returning after some time as an ecosystem? Explain. Distinguish between consumers, detritivores and decomposers in a grassland and forest ecosystems. What is a micro ecosystem? Why these systems are used by scientists? What are the functional aspects of an ecosystem? Enumerate a stable system in ecological sense. Enumerate the relationship between species diversity, dominance and stability of the ecosystem.

3

Ecosystems of the World and Distribution of Flora and Fauna 3.1 TERRESTRIAL ECOSYSTEMS

Various types of ecosystems have developed due to the interaction of climate with parent rock material and the available flora and fauna. These ecosystems are broadly classified as terrestrial and aquatic. The major types of terrestrial ecosystems are forests, grasslands, savanna, deserts and the tundra. Of these, those occurring on a subcontinental or a large land area basis are often referred to as biomes, biochores or regions. The division lines of these biomes tend to be parallel to lines of latitude. Strikingly, the same type of biome is found within the same general latitudes. This is evident in the case of tundra and boreal forests in both the old and the new world. In mountains, however, the division lines between biomes are elevational rather than latitudinal. But biomes found at a given altitude also vary with latitude. The zone of Douglas fir-Ponderosa pine lies between 675 and 2,000 m in the Cascade Mountains of the Northwest but within 1,350-2,300 m in the central and within 1,650-2,700 m in the southern Sierra Nevada. This example indicates that a particular biome occurs at progressively lower altitudes at progressively northern latitudes. Besides, precipitation patterns are associated with wind patterns which are latitudinal. The temperature of the environment depends largely on the incident solar radiation, which is directly associated with latitudes. Thus latitude plays an important role in the distribution of terrestrial ecosystems. An altitudinal-latitudinal classification of vegetation is given in Table 3.1. 3.1.1 Forest Ecosystem Types: Tropical Rain Forests

Tropical rain forests grow in regions with plenty of moisture and heat, and no winter. They are found in tropical South America, namely the Amazon river basin, in the East Indies, South East Asia, in some parts of Africa and northwest Australia. The annual rainfall is around 200 to 225 cm and evenly distributed throughout the year. Temperature and humidity are high, as is productivity. There is a very rich floristic and faunistic composition in this ecosystem. A square kilometre may contain 200-300 different species of trees, a diversity unparalleled in any other ecosystem. The trees are about 25-40 metres tall and most of the plants are evergreen. Because of heavy rainfall, the soils are subjected to leaching.

Fundamentals of Ecology

150

Table 3.1

Altitudinal-latitudinal zonation of vegetation types

Latitudinal zonation

Altitudinal zonation in metres 0–1,000

0–20°

(tropical)

1,000–2,000

2000–4,000

4,000–6,000

Tropical

Subtropical

Temperate

subtropical

Temperate

arctic-alpine

40–60° (temperate)

temperate

arctic-alpine

—

—

60–80° (arctic antarctic)

arctic-alpine

—

—

—

20–40° (subtropical)

arctic-alpine —

A typical rain forest has many layers. The canopy is very well developed. Below the crowns of dominant trees develop several other strata of plants which can grow in the shade. The understory vegetation is fairly thick. Light is the limiting factor in these forests. The crowns of large trees are covered with epiphytes—non-parasitic plants that use trees for support. These epiphytic autotrophic plants have aerial roots which obtain the water they require from torrential rains, which occur almost daily. In South East Asia and the East Indies, orchids and ferns are the dominant epiphytes. Besides, in all tropical rain forests, lianas with roots in the ground and their leaves and flowers in the canopy of trees are found. In South American rain forests, the common epiphytes are orchids and bomeliads. The amount of net primary production may be as high as 30 tonnes per acre per year and the decomposition rate is also extremely high. The forest soil is rich in microorganisms and soil fauna. Termites are abundant. Since there is a huge wood biomass in these forests, the mineral reservoir is tied up in the tree biomass. Hence the availability of nitrogen and phosphorus in the soil is often limited. In India, patches of rain forests are found in Kerala, Assam and the Gandhamardan hills of Orissa. Here the rain forests are classified as follows: 1. Moist tropical forests such as the southern tropical wet evergreen forests found in Kerala and the Andamans, the northern tropical wet evergreen forests found in Assam and West Bengal, the northern semi-evergreen forests of Assam and Orissa, and the southern tropical semi- evergreen forests of the Andamans. 2. Montane subtropical forests, which include the northern subtropical broad-leaved wet hill forests of Assam and West Bengal, the southern subtropical broad-leaved hill forests of Orissa and Kerala and the subtropical pine forests of UP, Himachal Pradesh, Assam, Manipur, etc. The Chir forests of UP and HP are examples of this type of forest. 3. Montane wet temperate forests of Kodaikanal and Udagamandalam in Tamil Nadu and Kerala, the northern wet temperate forests of the northeastern region and West Bengal and the Himalayan moist temperate forests. Plate 2 shows some moist tropical Indian forests. Western Ghats The Western Ghats have very rich biodiversity and have been identified as a hot spot because of high level of diversity and also under considerable threat (Myers, 1990). The Western Ghats comprise of a chain of hills 1600 km long running parallel to the west coast of the Indian peninsula. The width varies from 5 km to 150 km and elevation rises up to 2800 m (Utkarsh, Joshi and Gadgil 1998).

The Western Ghats harbour 5500 species of flowering plants and 800 tree species. Forests form the natural climax vegetation over most of the Western Ghats. The distributions are governed by rainfall, slope factor, soil, grazing by herbivores and fire, biomass harvests and harvest of medicinal plants and plantations (Utkarsh, Joshi and Gadgil, 1998).

Ecosystems of the World and Distribution of Flora and Fauna

151

Lower elevation harbour great majority of biodiversity and higher elevations support restricted number of species. The formations as per Utkarsh, Joshi and Gadgil (1998) are as follows: 1. Evergreen forests comprising tall trees (25–30 m high) with erect, closed dense canopy covering ~ 95% of ground. About 90% or more trees belong to evergreen species. Barks of trees are smooth and large buttresses. Lianas, i.e. woody climbers are not uncommon. Undergrowth is devoid of herbaceous growth. Thorney species like Canes and Pandanus are common. 2. Semi-closed evergreen forests having trees 20–25m high, 80–95% canopy and 80–95% trees belong to evergreen species. A few herbaceous species are present. Lianas, especially Canes, are common. 3. Stunted evergreen forests having dwarf trees 10–15 m high with 80–95% closed canopy and >80% trees are evergreen. Trees often branch at the base and with a spreading canopy. Buttressed trees are rare or absent. Lianas are abundant. Shrubs like Strobilanthes with thin, haring leaves are found. Thorny species are not uncommon. Canes and Pandanus are rarely found. 4. Semi-evergreen forests having a mixture of tall evergreen deciduous trees 15–20 m high, 60–80% closed dense canopy and 40–80% trees are evergreen. Trees lack straight tall boles and with irregular canopy. Herbs are found in forest floor and profused growth of climbers, Lianas are common but Canes and Pandanus are rare. 5. Moist deciduous forests. Moderate height 10–20 m tall trees, closed but not very dense (40–70%) canopy. 0 to 40% trees are evergreen. The deciduous trees shed their leaves in January. Undergrowth with herbs. Weeds like Lantana or Eupatorium are found. Lianas are few and climbers are common. Thorny species are found. Canes and Pandanus are not found. 6. Dry deciduous forests having tall trees of 10–15 m high with 40–60% canopy. Evergreen and buttressed trees are not found. Lianas are not common but thorny species are common. Canes and Pandanus are not found. Good herbaceous growth and weeds may be very common. 7. Scrub/savanna are non-forest formation with shrub and grass undergrowth with a scattered tree canopy (0–40%). Trees are 5–15 m high. Deciduous trees are common. Lianas are absent. Thorny species, herbs and weeds are common. Scrubs/savannas are widely distributed over the Western Ghats and these formations have been created through human interference through harvests and fire. Endemically, %age varies from 2 in dry deciduous forests to 55 in closed, canopy evergreen forests. (Fig. 3.3 and Table 3.6) Tree density/ha varies from 191 in scrub/savanna, 243 dry deciduous, 276 moist deciduous, 302 semi-evergreen forests, 340 stunted evergreen forests, 365 semi-closed canopy evergreen forest, 418 in closed canopy evergreen forest. Medicinal trees form 28–39% in different evergreen, semi-evergreen forest formations and 53–81% in moist deciduous, dry deciduous and scrub/savanna formations. Evergreen forests occur only in Western Ghats, Northeast India and Andaman and Nicobar Islands and they deserve high priority of conservation. Dry deciduous forests with a restricted distribution may also be given high priority for conservation. 3.1.2 Temperate Rain Forests

Temperate rain forests are found in the same parts of India as tropical rain forests. The rain forests of the norhtwestern Pacific coast of North America are important wet temperate forests. They are also found in southern Chile, the west coast of New Zealand and Tasmania, southeastern Australia and northwestern

152

Fundamentals of Ecology

North America. Stormy winds and winter rainfall are important climatic features of these ecosystems. The amount of annual precipitation, including snow, may be about 350 cm in North America and 800 cm in New Zealand. Hence a cool climate prevails in these forests. The rain forests of North America are dominated by large coniferous trees like Douglas fir (Pseudotsuga menziesii) in the north and the redwood (Sequoia sempervirens) in the south. Apart from these the Sitka spruce (Picea sitchensis) giant arborvitae (Thuja plicata) and western hemlock (Tsuga heterophylla) are Common trees. In New Zealand the temperate rain forests are dominated by Kahikatea (Podocarous dacrydiodes) and rimu (Dacrydium cupressinum). The temperate rain forests are evergreen. Epiphytic bryophytes and miniature ferns are common here. Primary productivity is high and there is a large standing crop of woods. The limiting factor for productivity is the low mean annual temperature and the lack of certain nutrients in the soil. There is heavy precipitation and low evaporation. The decomposition rate is slow because of the cool climate. 3.1.3 Tropical and Subtropical Deciduous Forests

The climatic features of these forests (Plate 3) are warm summers, cold winters, and well spaced rainfall amounting to about 75 to 100 cm per year. The trees are deciduous and shed leaves. They are not closely spaced and do not include such a diversity of species as those in a rain forest. In India these forests possess important trees of genera such as Terminalia, Pterocarpus, Tectona, Dalbergia, Shorea and Acacia. These are very important timber trees. Primary productivity is high, as is the decomposition rate in the forest floor. Eastern Ghats The Eastern Ghats extends from Tamil Nadu in South India to Orissa and are also very rich in biodiversity. In Orissa the forests are Sal (Shorea robusta) dominated. However, other timber species like Teak (Tectona grandis), Kendu (Diospyros malanoxylon), Neem (Azadirachta indica), Terminalia sp., Mahua (Madhuca indica), Bel (Aegle marmelos), Jamun (Sizygium cumini), Ficus bengalinesis, Ficus religiosa, Butea monosperma, Michelia champaca, Pterocarpus marsupium are commonly found in forests. Some important wild animals of these moist deciduous and dry deciduous forests are the Asiatic Elephant (Elephas maximus), Indian Gaur (Bos gauras), Sambar (Cerves unicolor), Cheetal (Axis axis), Barking Deer (Muntiacus muntiak), Chowsinga (Tetracervus quadricornis), Hard-footed Barasinga (Cervus duranceli), Wild Buffaloes (Bubalus bubalis), Tiger (Panthera tigris), Leopard (Panthera pardus), Fishing Cat (Felis viverrina), Jungle Cat (Felis chaus), Large Indian Civet (Viverra fibetha), Indian Pangolin (Manis crassicaudata), Leopard Cat (Felis bengalensis), Otter (Lutra lutra) etc. The Avian, Reptilian, Amphibian and Fish fauna are also very rich. All the three species of Crocodiles (Crocodilus palustris, Crocodilus porosus) and Gharial (Gavialis ganjeticus) are found in the rivers of Orissa which pass through these forests. Python (Python molurus), Cobra (Naja naja), Monitor Lizards (Varanus salvator, Varanus bengalensis, Varanus flavescens) are found in these habitats. Similipal forest is unique for biodiversity. The Similipal forests (21°–28’ to 22°–08’ N Latitude and 86°–04’ to 86°–37’ E Longitude) stretches over 2750 sq. km. and form one of the mega diversity zones in the country. The total number of plant species comprise of 1012 species and 64 species of cultivated plants (Saxena and Brahman, 1989, Swain and Nanda, 1997). Besides, 93 species of Orchids are found in Similipal (Misra, 1997). The dominant plant species is Shorea robusta in the over wood, Mallotus philipinensis in the middle storey. Cyperus rotundas is dominant in the ground flora. The fauna comprises of 44 species of mammals, 231 species of birds, 29 species of reptiles (Patro and Panda, 1994).

Ecosystems of the World and Distribution of Flora and Fauna

Table 3.2

153

Total forest basal area of trees in different world sites

Forest

Locality

Dominant species

Total forest basal area (m2/ha)

Central Himalayan forests: Sal forest

Ranibagh

Shorea robusta

63.15

Sal-chir-pine-tun forest

Dogaon-Dolmar

Shorea robusta

42.43

Chir-pine-mixed

Kalona

Pinus roxburghii

69.49

Chir pine forest

Champhi, Sattal

Pinus roxburghii

30.24

Rianj oak forest

Maheshkhan

Quercus lanuginosa

83.78

Another seven sites

Khurpatal-NainiTal, Kilbari

Pinus/Quercus

30.24–62.36

Enchantment Lakes basin,

Unidentified

0.13–39.89

Tsuga diversfolia

64.00–81.00

Mount Ontake and Mount Full, Japan

Abies vettchii

51.00–65.00

Oak forest—east-facing slope

North Dakota, USA

Quercus macrocarpa

40.00

West-facing slope

North Dakota, USA

Q. macrocarpa

32.60

Oak forest

North-eastern North Dakota, USA

Q. macrocarpa

24.90

Oak forest (45-50 yr old)

Minnesota, USA

Q. ellipsoidalis

26.50

Broadleaf forest

Subalpine forests: Subalpine communities.

Washington, USA Tsuga/moss communities

Yatasugatake and Chichilu Mountains, Japan

Abies/herb communities Temperate forests:

Oak-hickory forest

Central Missouri, USA

Quercus sp.

22.30

Mixed oak forest

Belgium

—

21.20

Oak forest (38-45 yr old)

New York, USA

Quercus alba, Q. coccinea

15.60

Steward wood

South-western Wisconsin, USA

Quercus sp.

24.14

Silent Valley

—

102.71

East Kalimantan, Indonesia

—

10.73

Deciduous forest

Chandra Prabha

Anogeissus latifolia

17.99

(fenced)

Sanctuary, Varanasi, India

Tropical forests: Tropical rain forest

Upland forest, Kerala, India Kerangas forest

(Contd.)

Fundamentals of Ecology

154 Table 3.2 (Contd.) (Open)

Chandra Prabha Sanctuary,Varanasi, India

15.20

Dry deciduous forest

Chakla forest, Varanasi, India

Shorea robusta

12.80

Dry deciduous forest

Chakla forest, Varanasi, India

Shorea robusta

30.62

Moist deciduous forest

Angul-Talcher,

Shorea robusta

22.49–50.25

(coal belt) (seven sites)

Orissa, India

Three degraded sites

Angul-Taicher, Orissa, India

Shorea robusta

3.29–11.46

(Data from many sources-based on Singh & Singh, 1987. Angul-Talcher Area-own data).

3.1.4 Temperate Deciduous Forests

It is believed that these forests (Plates 4 and 5) occupied the whole of the northern hemisphere several million years ago. Glacial ice and the droughts of the Pleistocene era divided it into three main parts, namely (a) eastern North America, (b) western Europe, and (c) eastern Asia. It is believed that due to severe glaciation, the west European portion became poorer floristically than the other two. These deciduous forests usually have five layers: (a) an over-story of deciduous trees with crown tops about 15 to 55 metres above the ground, (b) another deciduous tree stratum with crown tops around 6 to 12 metres above the ground, (c) a shrub layer up to 3 metres high and usually evergreen, (d) a herbaceous layer with rhizomes and bulbs and largely spring perennials, and (e) a moss and lichen layer grown on rocks, fallen logs and sometimes tree trunks. The common trees are beech (Fagus), tulip (Liriodendron), hemlock (Tsuga), buckeyes (Aesculus), basswood (Tilia), maple (Acer), oak (Quercus), hickory (Carya), and Aspen (Populus). The net primary productivity is about 3 to 5 tonnes per acre per year. Low temperature, the lack or excess of certain minerals, and, in some parts, aridity, are the limiting factors. Flowering is confined to the short spring season. Important consumers are the deer, fox, bear, bobcat, wild turkey, and so on. 3.1.5 Montane Coniferous Forests

Mountain slopes are usually covered with forests or woodlands. High mountains extend vertically through more than one climatic zone and hence the vegetation is distinctly marked off. In the northern hemisphere, these vegetational zones are usually dominated by cone bearing trees, such as pines, spruce, firs, hemlock, etc. Deciduous trees dominate in many Asian mountains, while in North America and Europe these mountains are covered with coniferous trees. The forests ranges from wet and snowy conditions in Europe and North America to cool dry conditions in Asian countries. In North America, the usual climatic gradient on any high mountain range is from warm and relatively dry near the base to colder, more snowy, wetter and more windy higher up. In very high mountains, the crest may be too cold and windy to bear trees, and here there is a timberline. Above the timberline, an alpine environment prevails and plants of low height grow. Billings (1965) has described this zonation in the mountains of Arizona, USA. Such zonations exist in the Himalayas on the Indian side also. In the western Himalayas

Ecosystems of the World and Distribution of Flora and Fauna

155

of Jammu and Kashmir, Himachal Pradesh and UP and the eastern Himalayas of Assam and Arunachal Pradesh, subalpine forests dominated by trees of such species as Abies, Pinus, and so on occur at altitudes of 2,900 to 3,500 metres, while alpine scrub forests are found at altitudes of 3,600 metres and more. These scrub forests bear the broad-leaved Betula utilis. Montane coniferous forests are characteristic of the North American mountains. Many subalpine areas in the Rocky mountains are now occupied by lodgepole pine forests. Table 3.2 provides data on total basal area of trees in different world sites. 3.1.6 Boreal Coniferous Forests

These ecosystems are otherwise called the great north woods and lie between the 45th and 57th north latitudes. The climate ranges from moderate to extremely cold. Precipitation occurs mostly in summer. Common plants are the white spruce (Picea glauca), balsam fir (Abies balsamea), red pine (Pinus resinosa) and white pine (Pinus strobus). Soil is characteristically acidic and mineral-deficient. Precipitation is high and evaporation low. The subsoil is permafrost. A Boreal forest has four layers, namely an evergreen tree layer with tops of the crowns some 12 to 22 metres above the ground, a shrub stratum which is less than 2 metres high, a herbaceous stratum including ferns and a low moss and lichen layer. The important consumers are the moose, beavers, rodents and black bears. Primary productivity is lower than other forest types. In Eurasia these forests are called Taiga forests. 3.1.7 The Chapral Ecosystem

These ecosystems occur in Chile, California, USA, Western Australia and in some places around the Mediterranean Sea where the summer is dry and moist and rain falls in winter. The vegetation is composed of small trees and large shrubs that bear small, evergreen, thick and succulent leaves containing a waxy material on their surface. The herbs have thick underground stems which can withstand the dry summer. The consumers are mainly rodents and reptiles. 3.1.8 Tropical Savanna

In the Savannas, trees grow far apart and tall grasses and shrubs usually grow between them. In other words, tropical Savannas are grasslands containing patches of trees here and there. These ecosystems cover large areas in South America, Africa and India. Some Savannas are arid, with scattered thorny trees. Most of this region has arisen as a result of the climate but some has evolved from the destruction of rain forests by man. The climate here is characterised by warm and rainy, cool and dry, and hot and dry periods in a year. The primary productivity of a tropical savanna is very high and since the primary producers are largely tall grasses, a large number of herbivores are found in these ecosystems. In Africa, the savanna is grazed on by big animals like elephants, zebras, rhinoceroses and antelopes. Lions and leopards are the common carnivores. The decomposition process is very rapid because of the warm climate, and the soil contains large populations of decomposer organisms. In India, the savannas is dominated by grasses and sal trees and the consumers are cattle, rodents, insects, jackals, hyaenas, etc. The Indian savannas are grouped under six categories:

Fundamentals of Ecology

156

1.

2.

3.

4.

5.

High savanna Such a region constitutes open stands of low branching trees usually 2 to 3 metres tall. The commonly found trees are Syzigium cerasoideum and Emblica officinalis. The common grasses are Imperata, Saccharum spontaneum, Ophiuras and Vetiveria. High savanna may be found in the Brahmaputra valley. Moist sal savanna, which occurs in the Gangetic Plain and consists of open sal (Shorea robusta) forests with tall grasses. The common grasses are Imperata cylindrica, Themeda arundinacea, Cymbopogon nardus, Erianthus and Apluda. Low alluvial savanna woodland, which occurs in the Gangetic plain and on riverine flats. The soil is sandy and alluvial and contains patches of clay in depressions. The commonly occurring trees are Dalbergia sissoo, Butea monosperma, Albizia, Adina cordifolia and Zizyphus mauritiana. The common grasses are Saccharum procerum, Arundinella, Themeda gigantea, and Erianthus sp. Dry savanna which is found in Punjab, Haryana, Bihar, Orissa and eastern Tamil Nadu and is characterised by trees which stand far apart, singly or in small groups. The common trees are Acacia lenticularis, Emblica officinalis, Gardenia turgida, Crotalaria hirta and Pterocarpus marsupium. The grasses found in abundance are Themeda triandra, T. quadrivalves, Apluda mutica and Arundinella setosa. Saline alkalina scrub Savanna, which occurs throughout the IndoGangetic Plain. The common trees are the Phoenix sylvestris, Acacia sp. Tamarix sp., Calotropis procera, C. gigantea and Kochia indica. In Assam, scattered pine trees occur over thick grasses.

3.1.9 Grassland

Grasslands (Plate 6) flourish in temperate regions. They are called prairies in North America, steppes in the Eurasian region, pampas in Argentina, puszta in Hungary and veldt in South Africa. The vegetation is dominated by grasses, legumes and composites. In the regions with high precipitation, grasses grow to about 2 metres in height. In drier regions, the grasses become shorter. In this century, these grasslands have been used by man for the cultivation of wheat, corn, etc. The net primary production in prairie grasslands may go up to 3 tonnes per acre per year. Tall grass prairies are dominated by Andropogon sp. and buffalo grass (Buchloe dactyloides). Flowering herbs and many kinds of composites are also common. The precipitation (P) to evaporation (E) ratio (P/E) is less than one in grasslands. The chernozem soils or black earths of the tall grass prairie are among the richest in nutrients, and the most fertile in the world. Leaching is considerably low. Organic matter accumulates in the upper portion of the soil and the soil pH may vary from neutral to alkaline. The consumers are herds of bison and other hooved mammals. Grasslands occupy about 20% of the earth’s land surface and are of three types, namely, (a) Tropical, (b) temperate, and (c) alpine. Tropical grasslands are situated 20 degrees away from the equator and the rainfall varies from 40 to 100 cm. Tall grasses rise to a height of about 1.5 to 3.5 metres. The tropical grasslands of Africa abound in ungulates, deer, antelopes, giraffes, lions, and so on. Temperate grasslands usually occur in the centres of continents, where rainfall is about 25 to 75 cm per year. They are found in Europe, Asia and North America. Alpine grasslands occur at higher latitudes. They are of the meadow type and many flowering herbs grow side by side here. In India eight types of grasslands are found (Bharucha, 1983)—they are listed in Table 3.3.

Ecosystems of the World and Distribution of Flora and Fauna

Table 3.3

157

Indian Grassland types

Type

Distribution

1. Ischaemum

Associated with black soil. Occurs in Maharashtra, southwestern UP, western MP, western Andhra Pradesh, Tamil Nadu and Karnataka

2. Dichanthium

Associated with sandy loam soils. Occurs in Haryana, Punjab, Rajasthan, eastern UP Karnataka, West Bengal, Bihar, Orissa, northern AP, Kerala, Maharashtra and Tamil Nadu.

3. Phargmitis saccharum

Associated with marshy areas. Occurs in the Terai areas of UP, Assam, Bihar, Sunderbans and the Cauvery delta.

4. Bothriochloa sp.

Associated with paddy (rice) growing tracts.

5. Cymbopogon sps.

Occurs in the low hills of the Western Ghats, Vindhyas, Satpura, Aravali and the Chhota Nagpur plateau.

6. Arundinella bengalensis

Occur in the high mountains of the Western Ghats, Nilgiris, lower Himalayan areas of Himachal Pradesh, Punjab, UP, Bihar and Assam.

7. Arundinella sp.

Associated with temperate climate. Occurs in Himachal-Pradesh (upper parts) Punjab, Jammu and Kashmir, West Bengal, and Assam.

8. Deschampsia sp.

Associated with temperate alpine climate. Occurs in the alpine and subalpine regions of Kashmir, eastern Punjab, Himachal Pradesh, UP, West Bengal and Assam, at heights over 2000 m.

Grasslands of savanna-type ecosystems have developed in many regions of India, particularly on the Western Ghats, east of the Western Ghats and west of the Eastern Ghats due to the clearing of forests and other destructive human activities. Above 600 m in the Western Ghats, where the rainfall is more than 375 cm, Andropogon pumilus or Heteropogon contortus dominated grasslands have developed. West of the Eastern Ghats, Eragrostis amabilis dominated grasslands have developed. Low rainfall grasslands (rainfall between 25–125 cm) have developed east of the Western Ghats, below 600 m, and these grasslands are dominated by Heteropogon contortus, Apluda varia, Lophopogon tridentatus, Aristida funiculata, Cymbopogon sp. and Themeda triandra. 3.1.10 Deserts

These ecosystems are either barren or with scanty vegetation consisting mainly or thorny bushes. Most deserts of the world receive some rain every year but it is not uniform. In places which do not receive rains for several years, the ground may appear absolutely barren; however, there is a light green covering of annuals just after the rains, on the rare occasions when they occur. Deserts are classified as warm (hot) and cold (temperate): The hot deserts are the Sahara in northern Africa, Kalahari in southern Africa, and Thar in India. The deserts of Mexico, Atacama in South America, and the Australian deserts (central and western Australia) are also hot deserts. The deserts of California and Arizona, although situated close to the temperate zones, may be classified as warm deserts. The deserts of Iran and Turkey, the Gobi desert of Mongolia and some deserts of Argentina are classified as temperate or cold. Desert climate is characterised by scanty vegetation, low rainfall amounting up to 25 cm and confined to about 50 days annually, clear skies, hot days and extremely cold nights. The soil is rocky and encrusted with sand or salt. Arid lands comprise atleast 1/8th of the land surface of the globe. More than 300 million people depend

158

Fundamentals of Ecology

for raising their livelihood on these arid lands. These arid lands are characterised by (1) long periods without precipitation, (2) extreme temperature conditions. Hence, arid lands imposed considerable restraints on the flora and fauna which inhabit there. The major part of the desert areas lies between 15º and 40° latitude in both the hemispheres. However, in some areas it may extend up to 55° N latitude. Since arid lands occurred over a wide range of latitudes and in the major wind and pressure belts, it is not convenient to generalise the weather system of deserts. However, three reasons are ascribed for the cause of aridity and these are; 1. Separation of the regional from oceanic moisture sources, usually by topographical barriers or distance. 2. Formation of dry, stable air masses, which register convective air currents. 3. Lack of storm systems. The mechanism for upward movement of air creating unstable convergent conditions may be necessary for precipitation. Some of the important individual deserts are; 1. Kalahari – Namib (South Africa) 2. Sahara (Northern Africa) 3. Somali – Chalbi (Northern Africa) 4. Arabian desert (Western Asia) 5. Iranian desert (Western Asia) 6. Thar desert (Western India and Eastern Pakistan) 7. Turkistan desert (Central Asia) 8. Australian desert 9. Atakama and Peruvian (South American and North American deserts). 10. Gobi desert (Mongolia) Climate, Flora and Fauna Deserts usually receive less than 50 mm of rain per year. Primary productivity is very low in deserts. The few places where water is available are used to grow date palm, barley, cotton, millet and so on. Since the rainfall in deserts is irregular and unpredictable, some plants survive as ephemeral and some of them complete their life cycle in few weeks. Some of these ephemerals take advantage of sudden rains and gear their life cycle of germinating, growing, flowering and seeding within 30 days. Other plants may survive as perennial. Some plants called geophytes usually avoid drought by surviving as underground bulbs and above-ground parts are produced after heavy rain. Succulents like cacti or euphorbia in Africa exhibit adaptation to survive above ground through out the year. These adaptation are (i) thick cuticle, (ii) sunken stomata, usually open in the night to minimise loss in transpiration, (iii) possession of a milky sap which does not evaporate easily. Most of the cacti and euphorbias have lactenis through which this milky sap flows, and (iv) a low surface area to volume ratio etc.

The Thar desert, which is known as Indian desert, is a transition zone between major wind belts. This zone of Western India and Eastern Pakistan produces moderate amounts of winter precipitation in the winter on western part. The eastern part of desert receives some rainfall during monsoon period. Summers are very hot and winters are warm in this desert. Thar desert consists of gently sloping plain protection by sand dune and low barren hills. The soil is sandy, medium and fine textured surface and

Ecosystems of the World and Distribution of Flora and Fauna

159

the salinity is high with occurrence of sand dune. Vegetation of Thar desert is influenced by edaphic conditions. Trees and shrubs are more common on open soils. The vegetation of the hot arid zones including the Thar desert in India includes sand, gravel and rock communities. Satyanarayan (1963) has divided the vegetation into five types, viz. a) Mixed xeromorphic thorn forests having (1) the co-dominant Acacia senega—Anogeissus pendula communities. (2) Euphorbia caducfolia community. b) Mixed xeromorphic woodland or wooded desert. This type is dominated by thorny species. The main species are Salvadora oleoides, Prosopis cineraria, Acacia leucophloea, Acacia nilotica, Zizyphus numularia, Cassia auriculata, Calotropis procera and other species. Salvadora oleoides and Prosopis cineraria community is the climatic community of the plains of western Rajasthan. c) Dwarf semi-shrub desert: This formation contains dwarf trees, usually not exceeding 3.5 m high. Common species are Salvadora persica, Tamarix dioica and Acacia nilotica spp. Indica. d) Psammophytic scrub desert includes Psammophilous species like Calligonum poligonoides, Panicum turgidum, Acacia jacquemontii, Cotalaria burhia, Cyperus arenarius, Lasiurus sinducus. The tropical plant community of the North West desertic region is Calligonum poligonoides and Panicum turgidum. e) Succulent halophitic desert formation is otherwise Alekli flat or ‘Ranm’. The dominant species are Haloxylon salicornicum, Suaeda fruticosa, Salsola foetida, Cressa cretica. Besides shrub species like Tamarix dioica and Salvadora persica are also found. Salinity has restricted development of definite community structure. However, at places Suaeda fruticosa-Aeluropas lagopoides and S. fruticosa—Zygophyllum simplex communities can be recognised. They also have the capacity to dry up without stopping the activities vital to life. In the rose of Jericho (Anastatica hierochuntica) found in desert areas of the Middle East, the leaves drop off and the branches roll up into a ball to protect the pods as the fruit matures. The plant then gets detached from the soil and the ball rolls along the ground to be blown by the strong wind. If the ball reaches a wet place, the branches uncurl and the seeds germinate. Some desert plants bear roots of great length. The roots penetrate deep into the soil in search of ground water. The desert melon (Acanthosicyos horridus) has roots about 12 metres long. The aerial parts contain a short woody stem, green branches with thorns, and rudimentary leaves. The giant cactus of Arizona (Carnegiea gigantea) and pincushion cactus are some of the common cacti of North American and South American deserts. Since water and food are scarce in deserts, animals face very adverse situation. Day is hot and night is cold, and sand makes movement difficult. Animals living in deserts exhibit adaptations (Schmidt– Nielsen, 1983). The animals are locusts, desert rats and camels. Many mammals die if 14% of their body water is lost. But desert animals like camel can tolerate a loss of 30% of body water content. Under dehydrated conditions most of the mammals do not eat but camels in this condition also eat at normal rate. Besides, camels can drink water one fifth of their weight in ten minutes. Camels exhibit an extraordinary adaptation to temperature. If there is shortage of water, the body temperature of a camel fluctuates by as much as 7°C (Schmidt–Nielsen, 1983) and by this way, the camel saves water, which would otherwise have to evaporate to make its body cool. The thick fur of a camel insulates its body from the sun and loss of water. Besides, the hooves are splayed and help walking on sand and the hump stores fat and provide energy and water on being respired at the time

160

Fundamentals of Ecology

of need. The Arctic-Alpine deserts do not support any plant life. Antarctica and Greenland are devoid of plants. However, some animals like the polar bear (Thalarctos maritimus) and the emperor penguin (Aptenodytes forsteri) are found in Arctic and Antarctica regions. 3.1.11 Tundra

The word tundra means marshy plains and they lie north of 60° N. The Tundra is treeless, arctic, and barren but for some grasses, sedges, lichens, rocks and water. The ground surface is spongy, uneven or hummocky as a result of freezing and thawing. The land is poorly drained. At a depth of a few inches, the soil is permafrost, which is the ultimate line for plant roots to reach. The climate is characterised. by very low temperature (maximum of 10°C on any day in the warmest month), low precipitation and permafrost. The arctic tundra is the true tundra, where very few species of grasses and sedges grow. Bilberries, dwarf huckleberries, low flowering herbs and lichens also grow here. The characteristic arctic tundra plant is the reindeer moss (Cladonia). The net primary productivity is extremely low. The consumer animals are dipteran flies (black flies), mosquitoes, other insects, and migratory birds in summer. Besides, the caribou, musk ox, arctic hare, arctic fox and lemming are important mammalian consumers. Tundralike areas, called the alpine tundra, are also quite similar to some arctic tundra but the land is better drained, and permafrost is absent. The growing season in the alpine tundra is longer. The transition between the alpine tundra and boreal forest is rather abrupt, while that between the alpine and arctic tundras is gradual. 3.1.12 Mangroves

Mangroves are salt tolerant plant species of tropical and subtropical intertidal regions of the world—The term ‘mangrove’ is derived from the Portuguese word ‘Mangol’. Mangrove ecosystems (Plate 7) are distributed all over the world. Man- groves are plants of tropical regions but the mangroves of west Africa and America are different from those of east Africa, Asia and Australia. The former comprise only four species while the mangroves of eastern Africa include twenty-one. Mangroves look like bush land or high forests. Halophytes growing in the muddy swamps of the estuaries of tropical and subtropical regions and sea coasts inundated by rivulets and tides form mangroves. These are dense forests of low trees, especially adapted to (a) fixation, (b) respiration, (c) vivipary, (d) migration, and (e) xeric characters. Mangroves exhibit some peculiarities—their stilt root system (Plate 7) bears pneumatophores, which is an aerating system, and the leaves possess a distinct aqueous tissue. Also, after the flowering season, green pods hang from their branches, a phenomenon associated with reproduction. The green pods are the radicles of a small fruit, indicating the extra seminal development of the embryo while the fruit adheres to the tree. This is an example of vivipary. Mangrove trees usually attain a height of about 8 metres, but some may grow up to as high as 20 metres. Indian mangroves are found all along the west and east coasts. A marked feature of the leaves of Indian halophytes is the presence of glandular hair. In India the mangroves are well developed in the Sunderbans of West Bengal, Bhittar Kanika of Orissa, the Andamans and the west coast. Typical plant associations are Avicennia officinalis, Avicennia alba, Aegiceras majus, Aegialitis rotundfolia, Acanthus ilicfolius, Acanthus volubillis, Kandelia rheedii,

Ecosystems of the World and Distribution of Flora and Fauna

161

Bruguiera caryophyloides, Sonneratia griffithii and Carapa obovata. Glandular hairs on the leaves are well developed in Avicennia officinalis, Avicennia alba, Aegiceras majus and Acanthus ilicifolius. (Chadha & Kar, 1999). Mangroves are highly productive ecosystems. Plant and animal diversity is very rich. The net primary production is usually high. The terrestrial consumers are snakes, lizards, turtles, jackals, wild boars, hyaenas, tigers and so on. In the Bhittar Kanika sea coast of Orissa adjacent to the mangroves exists the largest sea turtle (Lepidochelys olivacea) rookery. Every year 300,000 to 500,000 female turtles come to the sea beach (mass arrival—arribada) in late December—January and again in March—April to lay about 50 million eggs (Dash and Kar, 1990). Secondary productivity and decomposition activity are also very high in these ecosystems. Mangroves stabilise coastal land mass and are land builders. They act as barrier to protect the hinter land against cyclone and tidal surges. They provide the breading and spawning ground of many varieties of commercial fishes. Mangrove ecosystems provide habitat for crocodiles, water monitor lizard and many other reptilian fauna in Orissa, India. The mangroves are now threatened due to human activities including prawn culture in some area of Orissa coast.

3.2

AQUATIC ECOSYSTEMS

An aquatic ecosystem is distinguished from a terrestrial one on the basis of its salt content. Such ecosystems occupy about 70% of this planet. Aquatic ecosystems play an important role in the cycling of chemical substances and influence the growth and activities of terrestrial ecosystems. They are classitied into three categories, namely (a) inland waters (ponds, lakes, springs, rivers, etc.), called fresh water, (b) ocean waters (salt water), and (c) estuarine waters, not as salty as ocean water but more so than fresh water. Of the total water resource available on this planet, some 97.2% are found in the oceans and only 2.8% are inland waters, including snow. Inland waters Water found on the surface of the land in rivers, streams, lakes, ponds, artificial constructions, and so on is called inland water. Inland water habitats are grouped into (a) lentic habitats or standing water, and (b) lotic habitats or running water. 3.2.1 Lentic Water

These include ponds, ditches and lakes, where water remains confined. In these water bodies, three zones are recognized, (Fig. 3. 1A)—(a) the littoral zone, a shallow water region with light penetration to the bottom, (b) the limnetic zone, the open water zone to the depth of effective light penetration, and (c) the profundal zone, the deep water and bottom area, which is beyond the depth of effective light penetration. In the littoral zone, mesophytic plants or herbs like Marsilea, Polygonum and Rumex, and phytoplanktons are found. The rooted plants project their leaves above the water for photosynthesis. Sedges may be found in this region. Diatoms form the major portion of the phytoplankton. The consumers of this region are pond snails, dragon fly nymphs, damsel fly nymphs, rotifers, bryozoans, hydra and flat worms. Snails feed on plants and midge larvae feed on detritus. The rotifers, cladocera, daphnia, copepods, etc. usually feed on phytoplankton. In the littoral zone, diving beetles, hemipterans, frogs, turtles and water snakes are also found. The limnetic zone includes floating hydrophytes such Lemna, Utricularia, Wolffia and Ceratophylum and submerged hydrophytes such as Hydrilla, Vallisneria and Zannichelia. The

162

Fundamentals of Ecology

phytoplankton of this zone consist of diatoms and dinoflagellates. Hydrophytes and phytoplankton are the primary producers of this zone. These producers exhibit a marked seasonal variation in their population, which is correlated with changes in environmental factors, such as temperature, pH of water, availability of nutrients and of dissolved gases, and their biological characteristics. Sometimes very high densities of populations called blooms occur— these are highly correlated with the availability of nutrients. The consumers of the limnetic zone are zooplankton, fish and so on. Cladocera like Bosmina and Sida and copepods like Cyclops Fig. 3.1 (A) Three zones of lentic water (see text for description), and Diaptomus usually form the (B) Thermal stratification in a lentic water body zooplankton community and exhibit (temperate region lake) daily vertical migration and seasonal population changes. Fish which feed on plankton and large carnivorous fish feeding on small fish are found in this zone. The profundal zone is characterised by a near absence of light, and hence producer organisms are not found here. The consumers either depend upon detritus for their food or on other consumers of the littoral and limnetic zones. Flat fish, crabs, prawns, midge larvae, etc. are found in this zone. Ponds are small water bodies in which the littoral zone is usually large and the limnetic and profundal zones are small or absent. Temporary ponds, which dry up during summer, are found in the rainy season. Hence these temporary ponds harbour communities which can survive the dry periods in a dormant stage. Besides, many consumers migrate to permanent water bodies at the onset of the dry season. Distinct stratification with regard to temperature and other parameters does not occur. In lakes, the littoral zone is usually small while the limnetic and profundal zones are large. Therefore lakes become thermally stratified in summer and winter. A marked seasonal change occurs with regard to dissolved gases and heat vertically in the lake. In summer, the surface water becomes warmer than the column and bottom waters, and as a result only the surface water circulates. It does not mix appreciably with the cold water and as the temperature rises in summer, a distinct temperature gradient develops between the surface and the bottom waters, and a zone called thermocline (Fig. 3.1B) develops between these zones. The surface warm water is called epilimnion and the colder bottom water hypolimnion. In winder the temperature of epilimnion drops until it is the same as that of hypolimnion. The water of the entire lake starts circulating and oxygen is uniformly distributed. In summer this does not happen. If the surface water cools below 4°C, it expands, becomes lighter and freezes, followed by winter stratification. The ice cold epilimnion prevents circulation. In spring the surface water temperature rises

Ecosystems of the World and Distribution of Flora and Fauna

163

to 4°C and above, the water melts and circulation starts. This situation is not so well marked in tropical and subtropical region lakes but it occurs in the lakes of temperate regions (Plate 8) like North America, North Europe and Eurasia. The lakes of the world are broadly grouped as (a) clear water lakes, and (b) brown water lakes. Brown water lakes have high humus and humic acid content in water. Clear water lakes are again grouped into three categories, namely (a) oligotrophic, (b) eutrophic, and (c) mesotrophic. Oligotrophic lakes are poor in nutritive material but the distribution of gases in different zones is more or less equal. Oxygen is usually not a limiting factor. The lake bottom contains some organic detritus and there is some decomposition activity. Eutrophic lakes are very rich in nutrients and oxygen becomes a limiting factor for fish. These are polluted lakes and help the growth of microorganisms. An intermediate type of lake with regard to the above features is said to be mesotrophic. 3.2.2 Lotic (Running) Waters

Rivers, creeks, brooks, streams, etc., form running water systems. The velocity of water current is important in these systems. The speed of the current varies in different sections of the rivulet, river or stream. The speed of water slows down as these running water systems reach the plains. Many rivulets combine to form a river, whose bed becomes wider and volume of water increases. Organic matter and sediments accumulate in river beds and the water is exposed to sunlight, which in most rivers may penetrate up to the bottom. There is no clear demarcation between littoral, limnetic and profundal zones, which usually do not exist. As the rivers approach the sea, there is greater sedimentation and accumulation of salt. During the rainy season, because of runoff and washout, the water becomes muddy and sunlight may not penetrate to the bottoms of rivers and streams. The region where the river meets the sea is usually surrounded by swampy land and forms a delta. These swamps favour the growth of mangrove plants and such waters harbour crocodiles, fish and a very vigorous growth of phyto- and zooplankton. Streams usually exhibit two habitats, rapids and pools. The organisms found in each of these are different. The soft and continually shifting bottom of pool areas harbours smaller benthic organisms and burrowing forms and the upper slowly moving water is favourable for plankton and nektons. In rapids, the water current becomes a limiting factor and the planktonic forms remain at the mercy of the water current—however, fish, turtles, and so on do occur. In the rapids, animals generally possess suckers or hooks to remain attached to rocks. Most animals show streamlining of the body (rounded in front and tapering behind) to offer minimum resistance to water current. The producers in lotic waters are the phytoplankton, and the consumers are the zooplankton (herbivores), insects, fish, turtles, water snakes, and some other animals. In India many running water ecosystems, such as the Ganges, Yamuna, Brahmaputra, Narmada, Mahanadi, Kaveri, Krishna, Godavari, etc. form a lifeline for the people as they provide water for drinking and irrigation, food, a medium for transport, and so on. 3.2.3 Ocean Waters (Marine Ecosystem)

The oceans of the world cover about 70% of the earth’s surface and they occupy a volume 15 times greater than that of the land. The oceanic environment is very different from that of inland waters, the major difference being the chemical composition of waters. Sea water is a very dilute solution of many mineral substances derived from the earth’s crust. The mineral content of sea water is 35 parts

164

Fundamentals of Ecology

per thousand, or 3.5%, minerals. Sodium chloride alone is present to the extent of about 10.5 parts per thousand of sea water. The salts of sodium, potassium, magnesium, calcium, sulphur, boron, barium, strontium, silicon, etc. constitute the minerals of sea water. Chlorine occurs to the extent of about 19 parts per thousand and the salinity of ocean water varies with depth. There is some latitudinal difference also. The salinity is highest at 30° N and 30° S latitudes (called the horse latitude). In the red sea the salinity is 45 parts per thousand of sea water because of a high rate of evaporation and little inflow of fresh water. In the Baltic sea, the salinity is only 10 parts per thousand because of a massive inflow of fresh water. The temperature of surface sea water varies from 0°C in the arctic and antartic seas to about 28–30°C in the equatorial waters. Temperature controls coral reef formation and phytoplankton and zooplankton densities. The oceanic environment is divided into three divisions depending upon biological and abiotic features. These divisions are: (a) the open sea or pelagic environment, (b) the benthic environment or ocean depths, and (c) the coastal waters. Figure 3.2 represents the ocean environment diagrammatically. Coastal water The ocean basin has the form of an inverted hat. A gently sloping continental shelf extends from the coast line Fig. 3.2 The oceanic environment and its stratification. to about 160 km. The angle of descent then changes abruptly and becomes a steep slope called the continental slope. The continental slope levels off with the ocean floor, called the abyssal plain, at a depth of several thousand feet. The sea floor from the shore to the edge of the continental shelf forms the littoral zone, which includes a narrow intertidal belt between the high and low tide lines. The sea floor beyond the littoral zone and along the continental slope and abyssal plain forms the benthic environment and the open water that fills the ocean is divided into neritic pelagic and oceanic pelagic zones. Sunlight can penetrate up to 50 metres in the littoral zone. This vertical zone through which light can penetrate is called the photic zone. Because of tide action, there is always a lot of upwelling of nutrients in coastal waters. Beyond the intertidal zone there is the spray zone, where some halophytes grow. If the coastal waters contain rocks, a luxuriant growth of algae (brown, red and green) occurs and because of good nutrient circulation (upwelling), there is appreciable primary productivity. Barnacles, limpets, chitons, starfish, crabs, etc. are found abundantly in this zone. A luxuriant growth of sea weeds, namely Fucus, Laminaria, Postelsia and Lessonia occurs in this zone. Here, living forms are exposed to salt water tide action, and then to sunlight and air. During low tide they are exposed to air and sunlight alone. The living organisms in the sea are classified into (a) plankton, (b) nekton, and (c) benthos. Plankton

Hansen (1937) coined the term plankton to apply to minute floating organisms, usually found in surface waters, whose movement depends upon the direction of water currents. Depending upon their size, they are classified into three categories:

Ecosystems of the World and Distribution of Flora and Fauna

1.

2. 3.

165

Nannoplankton, which are less than 0.06 mm in diameter. Most of them are phytoplankton (diatoms, silicoflagellates, coccolithophores, unicellular algae, etc.). Bacteria and many protozoa are included in this category. Microplankton, which are less than 3 mm and more than 0.06 mm in diameter. Small diatoms and dinoflagellates are included under this category. Macroplankton, which are larger than 3 mm in diameter. They include mysids, salps, euphasids, jellyfish, etc. Plankton are also classified on the basis of their nutritional requirements, as phytoplankton, which are autotrophic and zooplankton which are holozoic.

Nektons Larger crustacea, molluscs, fish, turtles, sea birds and mammals form the nekton of the sea. Fish like herring, sardine, anchovy, etc. are important, since they are largely plankton feeders and form part of man’s diet. Some fish exhibit schooling (aggregation) behaviour and some others migrate seasonally. Most surface dwellers lay their eggs on open water and do not attend to them, while bottom dwelling fish usually lay their eggs on the bottom and attend to them like fresh water fish. Many birds are active swimmers and surface dwellers, and feed on fish and other organisms. Seals, porpoises, dolphins and whales together form the mammalian fauna of the sea. They feed on plankton, fish, sea turtles, etc. Benthos

Benthos are the bottom dwellers and consist of sessile forms, such as limpets, chitons, mussels, oysters, sponges, corals, hydroids, anemones, some worms, bryozoans, crabs, lobsters, some echinoderms, flat fish and some other fish. They also include burrowing forms. The creeping forms are called epifauna, and the burrowing forms infauna. Open sea or the pelagic environment The primary producers of this zone are the diatoms, unicellular and multicellular algae, dinoflagellates, etc. which form the phytoplankton. The vertical distribution of phytoplankton depends upon the penetration of light so that photosynthesis can occur. They can be distributed up to a depth of 70 metres. The neritic pelagic zone extends up to the end of the continental slope, from where the oceanic pelagic zone spreads. In the oceanic pelagic zone the photic zone may extend up to 250 feet, beyond which is the aphotic, permanently dark zone. The Benthic Environment or Ocean Depths Ocean depths are cold, dark and devoid of producer organisms. The organisms living here exhibit unique adaptations, because of enormous water pressure, dark conditions, detritus and carnivore food chains. Usually, water pressure does not cause problems if organisms have no air space or lacunae filled with air or any other gas. Then the pressure distribution becomes equal on all sides of the organism. Such organisms are either black or red in colour and have very sensitive eyes, or receptors. Some of them exhibit bioluminescence. In some the body becomes flat and the eyes move to one side. Such organisms are called benthos. Some fishes of the oceanic depths are Macropharynx longicaudatus (which lives 3,500 metres below the water surface), Gigantactis macronema (2,500 metres below) and Malaeostus indicus (1,500 metres below the surface). Some deep- sea fish have a swim bladder to counteract gravity. Benthos are either detritus feeders or carnivoies. Apart from fish, echinoderms, molluscs, worms, and so on are also found at the bottom of the sea. 3.2.4 Wetland Conservation Definition Wetlands include a variety of habitats, which may be natural or man made areas of water or marsh that could be lotic or lentic. Wetlands range from peat bogs to mangrove forests, from fresh

Fundamentals of Ecology

166

water ponds and marshes to flood plains, riparian swamps, shallow lakes, brackish water lagoons, estuaries, salt pans, coastal salt marshes, coral reefs etc. Paddy fields and fish ponds are man-made and man-managed wetlands. Wetland types The wetlands can be conveniently classified into three categories: 1. Marine and coastal wetlands These may include (i) shallow coastal waters, (ii) subtidal beds, (iii) rocky marine shore as in part of west coast, (iv) estuarine waters, (v) coral reefs, (vi) intertidal mud, sand or salt pans/flats as in Ganjam district of Orissa, (vii) mangrove swamps as in Sunderban or Bittarkanika of Orissa, (viii) Brackish water lagoons like Chilika lake, (ix) Fresh water lagoons and marshes in coastal areas. 2. Inland wetlands (fresh water wetlands) These may include (i) rivers, (ii) streams, (iii) inland deltas, (iv) riverine flood plains, (v) freshwater lakes, (vi) freshwater ponds, (vii) freshwater swamp forests, (viii) swamps, (ix) alpine and tundra wetlands, (x) freshwater spring oases, (xi) geothermal spring wetlands. 3. Man made wetlands These wetlands may include (i) water reservoirs, dams, barrages, (ii) ponds for bathing, temple purpose etc. (iii) fish ponds, (iv) salt pans, (v) mining pools, excavation pits, (vi) irrigated land, arable farm land, rice fields, ditches, (vii) canals, (viii) wastewater treatment oxidation ponds, sewage farms etc. In India some 58.2 million hectares of wetlands exist (total are 329 million hectare) (Table 3.4). Besides, 28,000 km of rivers and their tributaries and 113,000 km of canals and irrigation channels and 0.17 million ha of coral reefs exist (Indira Gandhi Institute of Dev. Research, Sustainable Wetlands, 1999). Table 3.4

Wetlands in India Type

Area in million ha

Paddy fields

40.9

Fish culture area

3.6

Capture fishery area

2.9

Mangroves

0.4

Estuaries

3.9

Black waters

3.5

Impoundments

3.0

Total area

58.2

The Indo-gangetic flood plains are the largest wetland systems in India. The system extends from river Indus in the west to the river Brahmaputra in the east. It includes the major rivers like Ganga, Jamuna and the Himalayan thals (wetlands), Terai and Indogangetic plain. India has 7500 km of coastline, vast inter-tidal areas, lagoons and mangroves of Sunderban of West Bengal, Bhittarkanika of Orissa, Andaman and Nicobar islands. The Himalayan lakes include the pangong Tso, Tso Morari, Chantan, Noorichan, Chushul and Hanlay marshes of Ladakh and Zanskar. The Dal, Anchar, Wular, Haigam, Malgam etc. lakes of Kashmir valley and Nainital, Bhimtal and Naukuchital lakes of Central Himalayas.

Ecosystems of the World and Distribution of Flora and Fauna

167

The Eastern Himalayas have numerous lakes in Sikkim, Assam, Arunachal Pradesh, Nagaland, Manipur and Meghalaya. Utility of wetlands Human beings depend upon bio-diversity (plants, animals and microorganisms) for their survival and many people in countries of developing economy depend on bio-diversity available in their immediate environment for food, fodder, fuel and fibre. The bio-diversity found in wetlands is very large. They may be microorganisms, fungi, algae, flowering plants, crustaceans, molluscs, fish, turtles, birds and mammals. World’s major civilisations in India, China, Egypt, Rome and Greece developed and flourished near rivers and other wetlands. The economic benefits that man gets from wetlands may be listed as (i) water supply, (ii) food, fodder, fuel, timber etc. (iii) transport, (iv) commercial fisheries, (v) agriculture and seasonal flood plain farming, (vi) Industrial and urban development, (vii) tourism, (viii) water sports, (ix) culture and heritage development, (x) wildlife habitat and conservation.

The ecological functions and benefits are many: (i) bio-diversity, (ii) water cycle maintenance and hydrology, (iii) flood control, (iv) shore stabilisation, (v) bio-geochemical cycle functioning, (vi) carbon sequestration, (vii) climate stability etc. Wetlands are highly productive. Wetland plants, such as Phragmites sp., Arundo donax, Cyperus papyrus and water hyacinths are the most productive species. Mangroves are as productive as tropical rain forests. Many wetland plants like mangroves are used as timber and fuel woods and some are used as human food (rice, lotus, water chestnut, makhana, fodder and fuel (grasses), fibre (jute, cane, cat tails). Among animals prawn, crabs, frogs, turtles, ducks and many other animals are used as human food.

Many wetlands have developed in urban areas. The examples are Bhoj lake in Bhopal, Hussein Sagar lake in Hyderabad, Masunda lake in Thane, Sagar lake in Sagar, Dal lake in Srinagar etc. These wetlands serve various purposes to the local people and are of tourist attraction. Wetlands are threatened Human activities threaten wetlands. The following anthropogenic activities have directly or indirectly affected wetlands. 1. Development of Agriculture, forestry and urban centres. 2. Road and railways construction. 3. Cutting trees and mangroves for human uses. 4. Use of water for irrigation, industrial and domestic purpose. 5. Aquatic pollution due to municipality sewage, agriculture practices (pesticides and fertilizer), industrial effluents, and consequent infestation with aquatic weeds and eutrophication. 6. Degradation of watersheds and increased siltation of wetlands due to deforestation on the banks and nearby places. 7. Over fishing and non-maintenance of fish stock. 8. Grazing by domestic livestock. 9. Recreational activity, tourism and excessive water sport.

Because of urban sprawl many wetlands have been converted into bus stands, human habitats, playgrounds, recreation areas, wastelands etc. Mangroves along the west-coast and rice fields in eastcoast have been converted into pans for salt manufacture. Prawn farming in the shore areas and adjacent areas of Chilika lake in Orissa has threatened ecology of Chilika.

Fundamentals of Ecology

168

Since wetlands are under threat and under stress due to anthropogenic activities, many species of animals, which depend upon wetlands for their survival are disappearing. These are: (i) Siberian crane, (ii) Indian wild buffalo, (iii) Barasingha, (iv) Fishing cat, (v) Gangetic dolphin, (vi) Dugong, (vii) Dalmatian pelican, (viii) Indian darter, (ix) Gharial, (x) Estuarine crocodile, (xi) Great Indian onehorned rhinoceros, (xii) Brow anthier deer, (xiii) Green turtle and many others. Some mangrove trees like Sundari (Heritiera minor) have become endangered. Wetlands are reclaimed by filling with urban solid waste including construction wastes. Coastal wetlands are affected by oil spills. Wetland conservation Ramsar convention The convention on wetlands of international importance especially as Water Fowl Habitat was held on 2 February, 1971 in Ramsar, a small town near Caspian Sea in Iran by the representatives of 18 countries. The conference recognised the importance of wetlands as “habitats supporting a characteristic flora and fauna, especially water fowl” and a “resource of great economic, cultural, scientific, and recreational value” and the need for their conservation with “coordinated international action.” The provisions of the convention came into force in December, 1975 after seven countries formally accepted it. Till today, 118 countries have joined the convention and they have designated 1014 wetlands covering 72.7 million ha. India joined the convention in-October, 1981 and designated (i) Lake Chilika (Orissa), Keoladeo National Park (Rajasthan), as first two Ramsar sites and later on 23 March, 1990 four sites, Sambhar lake (Rajasthan), Loktak lake (Manipur), Harike lake (Punjab), Wular lake (Jammu & Kashmir) were included to the Ramsar list. The Ramsar sites in India with their areas are given below. Site Chilika lake, Orissa

Area in hectare 116,500

Loktak lake, Manipur

26,600

Wular lake, Jammu & Kashmir

18,900

Harike lake, Punjab

4,100

Keoladeo National Park, Rajasthan

2,900

Sambhar lake, Rajasthan

2,873

Lake Chilika: Location: 19° 28¢ — 19° 54¢ N, 85° 06¢ — 85° 35¢ E 0-2 m above MSL, 50 km SW of Puri. Area extends to Khurda districts and Ganjam districts, and 116,500 ha (1165 sq km). It is a coastal lagoon, separated from the Bay of Bengal by a sand bar.

The lagoon receives fresh water from 35 rivers, rivulets on northern and north eastern sides and the sea water enters into the lagoon during tide through its mouth on the east. The salinity of lake water varies greatly. The major ecological divisions are (i) Northern sector, (ii) Central sector, (iii) Southern Sector, and (iv) Outer channel. The depth of water varies from 0.38 to 4.2 metres depending on the location and season. A number of islands with good vegetation cover and some with human settlement are found inside the lake. Bio-diversity of the lake The lake houses 43 species of phytoplankton, 22 species of algae, and 150 species of vascular plants. The fauna comprises of 61 species of protozoa, 29 species of platyhelminthes, 37 species of polychaetes, 28 species of brachyura, 30 species of decapoda, 136 species of

Ecosystems of the World and Distribution of Flora and Fauna

169

molluscs, 225 species of fishes, 37 species of amphibia and reptiles, 156 species of birds including 38 species of waterbirds, and 18 species of mammals. Some one million water fowl visit the lake in winter. The unique species of fauna are the Irrawaddy dolphins, Chilika crab (Scylla serrata), the pearl spot fish (Etroplus suratensis), the prawns (Paeneus monodon and P. indicus). The characteristic plants are submerged macrophytes and large algae (Gracilaria sp.). Phragmitis karka is a characteristic plant of Nalabana. (Plate 9.) Environmental problems of Chilika

The problems can be summarized as (i) siltation, (ii) changes in salinity and macrophyte infestation, (iii) choking of the mouth, (iv) commercial prawn farming along the periphery, and (v) pollution. Keoladeo National Park (Rajasthan) Location:

27° 13′N, 77° 32′E near Bharatpur, 50 km west of Agra, 174 m above MSL.

The area of the park is 2873 ha and about 1000 ha inundated. The park receives water from a series of inter-connected impoundments and surrounded by scrub and grassland. In 1956 the park was declared as a Bird sanctuary. Since 1985, it is designated as World Heritage site. The wetlands in the park attract 330 species of water fowl and the park houses a number of flora and fauna. It is known as the only over wintering area of the Siberian cranes. Sambhar lake (Rajasthan) Location:

The lake is located 26° 52′–27° 02¢ N, 74° 54′–75° 14′ E, 360 m above MSL, 60 km west of Jaipur. The area of the lake is 19000 ha. This is a large salt take surrounded by sandy, saline flats and dry thorn scrub. The lake dries up in summer. During rainy season two rivers drain into this lake. The site is the wintering ground for flamingos and other water birds.

Environmental problems of Sambhar lake Deforestation, grazing in the catchment and water harvesting are major human activities, which affect the ecology of the lake.

Loktak lake (Manipur) Location:

The lake is located near Imphal, 24° 30¢N, 93° 49¢E, and 765 m above MSL. The water area of the lake is 28,890 ha. The lake is characterised by thick floating decaying vegetation, weeds and soil mats, locally called ‘Phumdis’. The lake earlier received water from river Manipur and it was constructed into a permanent lake by constructing a barrage. The lake is multi-purpose and is used for irrigation, electricity generation and fishing. The lake is wintering ground for ducks and other water birds. Siltation and pollution are major environmental problems. The shallow southern part of the lake is the habitat for the endangered Brow antler deer.

Wular lake (Jammu & Kashmir) Location:

The lake is located in the basin of river Jhelum at 34° 16¢N, 74° 33¢E, 1530 m above MSL. The area of the lake is 18,900 ha. The lake is characterised by extensive marshy areas, floating vegetation, particularly Trapa (water chestnut) and the lake is surrounded by willow plantations.

170

Fundamentals of Ecology

The lake supports fishery and is a major source of water for irrigation and domestic use. Common water fowls like teals, ducks, pochards, coot, geese and swans use the lake for wintering and staging. Tree farming and agriculture are major activities in the peripheral areas. Silting is the major problem. Harike lake (Punjab) Location: This lake is located in the confluence of Beas and Satluj rivers at 31° 13¢N, 75° 12¢E, 225 m above MSL. The area of the lake is 2800 ha and earlier the area was 4100 ha.

The lake serves as the head water for Indira Gandhi canal and is characterised by dense floating water hyacinth which covers 70% of the lake. There are 13 islands in the lake. Reeds, cat tails and lotus are abundant. Tamarix dioica tree is common. It is wintering, staging and breeding site for water fowls (ducks, geese, swamps, cranes, coots, herons etc). Indian otter is found in the lake. Silting is the major problem. Wetland conservation strategy The objectives of wetland conservation strategy centers around; 1. Prevention of loss and restoration of wetlands. 2. Conservation and collaborative management. 3. Sustainable use.

The action plan for National Wetland Strategy is; (i) Protection of wetlands. (ii) Preparation of inventory and prioritisation. (iii) Planning, managing of wetlands and monitoring water and environmental quality. (iv) Participation of stakeholders in decision making process. (v) Amending of Legislation for better and effective protection and management. (vi) Capacity building in government and other institutions. (vii) Inter-ministerial responsibilities and inter-sectoral coordination. (viii) Creating awareness among public, government and other agencies. (ix) International cooperation. (x) Research. The laws enacted in India that promote wetland protection are listed below. 1. The Indian Fisheries Act, 1857 2. The Indian Forest Act, 1927 3. Wildlife (Protection) Act, 1972 4. Water (Prevention and Control of Pollution) Act, 1974 5. Territorial Water, Continental Shelf, Exclusive Economic Zone and Other Marine Zones Act, 1976 6. Water (Prevention and Control of Pollution) Cess Act, 1977 7. Maritime Zone of India (Regulation and Fishing by Foreign Vessels) Act, 1980 8. Forest (Conservation Act), 1980

Ecosystems of the World and Distribution of Flora and Fauna

9. 10. 11. 12.

171

Environment (Protection) Act, 1986 Coastal Zone Regulation Notification, 1991 Wildlife (Protection) Amendment Act, 1991 National Conservation Strategy and Policy Statement on Environment and Development, 1992.

In spite of these enactments there is no clearly defined national policy for wetland conservation. Many international coventions since 1933 have given emphasis protection of wetlands. 1. London Convention (1993) on Preservation of Fauna and Flora in their natural state. 2. Ramsar Convention (1971) on wetlands, especially on water fowl habitats. 3. Natural Heritage Convention (1972) dealing with the protection of the World Cultural and Natural Heritage. 4. CITES (1973) Convention on International Trade in Endangered Species of Wild Fauna and Flora. 5. MARPOL (1973/1978) Convention for the Prevention of Pollution From Ships. 6. Bonn Convention (1979) on Conservation of Migratory Species of Wild Animals. 7. United Nations Convention on the Law of the Sea (1982) (UNCLOS). 8. Convention on Biological Diversity (CBD) (1992/1993). The environmental laws and international conventions are good instruments for developing wetland conservation strategy.

3.3

PRINCIPLES OF PLANT GEOGRAPHY AND ANIMAL DISTRIBUTION

In this chapter we have already discussed some aspects of plant and animal distribution in different ecosystems. Darwin’s work on the origin of species and his ideas on evolutionary process completely revolutionised biological thinking. Then Mendel’s work on plant breeding and genetics and Dc Vries’ theory of mutation helped us understand the evolutionary process better. The concepts of species population, ecology and genetics have helped us understand plant geography and animal distribution. The influence of climate, soil and other factors on plant distribution was studied in depth and the biome concept developed. Phytogeography or plant geography deals with the various conditions responsible for the existence of different types of vegetation. These conditions are of three types, climatic, edaphic, and biotic. Plants require water, light, heat, and nutrients for their growth and development. Hence climatic factors are very important for their distribution. In the equatorial region, there is a luxuriant growth of forests because of heavy rainfall and abundant sunshine. Such thick forests exist in the Amazon and Congo basin and the East Indies. Proceeding from the equator to the tropics (23.5°), rainfall decreases and hot and dry forests develop. Further away, we find regions with warm temperate, cool temperate and cold climates leading to permafrost at the poles. These regions are associated with a specific type of vegetation, as already discussed. Plants require various nutrients, which they get from the soil. The soil may be rich or poor in these nutrients and its structure may vary (sand, silt, clay) from place to place. These factors are responsible for the growth of different types of plants. Biotic factors like grazing, parasitism, decomposition and the availability of some consumer organisms determine the type of flora and plant growth.

Fundamentals of Ecology

172

3.4

FLORISTIC AND ZOOGEOGRAPHICAL REALMS

The world is divided into six floristic and zoogeographical realms with regard to the ,nature of flora and fauna distributed in them. These realms differ in terms of the richness of flora and fauna. The realms (Bharncha 1983) are (a) holarctic (b) palaeotropic (c) neotropic, (d) capensis, (e) notogaeic, and (f) antarctic. The holarctic realm extends along the land mass of the entire northern hemisphere and includes the greater part of Asia (Arabia, India, IndoChina), the whole of Europe, Mediterranean Africa and North America including Mexico. The palaeotropic realm includes the peninsulas of South Asia, nearly the whole of Africa excluding the Mediterranean coastal region, and the islands of East Indies. The neotropic realm includes Mexico, Central America, the West Indies and the greater portion of South America (except some portions in Chile and Patagonia at the extreme south). Capensis includes a very small area in the south-west of Africa. This area is extremely rich in flora. Various species of the Proteid family, many ephemerals, aroids and lilies are found here. They bloom in winter and die in summer. The notogaeic realm includes the Australian mainland and Tasmania. Some primitive mammals (the egglaying duckbilled platypus and pouch-bearing kangaroos), and some flightless birds such as the emu and cassowary are found here. The peculiarity of Australian flora is the absence of succulents corresponding to the cacti of America and Euphorbias of Africa and the presence of Acacia aneura and chenopodiaceae (Kochia sedifolia) in desert areas. Various species of Eucalyptus occur in areas of high rainfall. The Antarctic realm includes the southern parts of Chile and Patagonia, the land mass of Antarctica and the south island of New Zealand. The study of the geographical distribution of biological species relating to the geological, evolutionary, climatological, geographical, biological reasons for the distribution is called biogeography. Another classification of the biogeographical regions of the earth has been made by Pielou, 1979 and Muller 1980. As per the scheme the regions are: 1. Nearctic: This includes the whole of North America (Canada and USA). 2. Palaearctic: This region includes the whole of Eurasia (Europe, part of Asia including China, Mongolia, Japan). 3. Neotropic: This includes Mexico and the whole of South America. 4. Afrotropic: This includes the whole of Africa except the northern most part of Africa. 5. Indo-Malayan: This region includes Indian subcontinent, South-East, Asia. 6. Australasian: This region includes Australia, New Zealand, Fiji. 7. Antarctic: This region includes the whole of Antarctic region. 8. Oceanic: This includes islands and oceanic regions of Pacific Ocean. The Nearctic and Palaearctic harbour the tundra and boreal forests and animals associated with this region. This Neotropic, Afrotopic and Indo-Malayan are very rich in biodiversity (Table 3.3) having tropical rain forests. The Southern portion of Palaearctic and northern and north-western part of IndoMalayan biogeographic region harbour the arid Zones (deserts and semi- deserts). Most of Afrotropic and Australasian regions include savannah. On the basis of the amount of rainfall and temperature regimes, the world is divided into nine climatic zones:

Ecosystems of the World and Distribution of Flora and Fauna

1.

2.

3.

4.

5–8. 9.

173

The equatorial zone, which extends to about 10 degrees north and south of the equator. The zone experiences very high rainfall distributed all over the year and is uniformly warm, having an average temperature of about 25–27°C. It is the hot and humid zone. The tropical zone, which extends between latitudes 10 and 25 degrees on either side of the equator. The zone experiences high rainfall, usually confined to the hot months. The daily temperature varies more than in the equatorial zone. The subtropical dry zone, which lies about 25–30° away from the equator. This area experiences little rainfall and the temperature varies from very hot in the day to very cold at night. Most of the hot deserts of the world are located in this zone. The zone of winter rains, which lies along latitudes 40 degrees north or south of the equator. The area experiences a dry and hot climate in summer, and is wet and cool in winter. This represents the Mediterranean region with scerophyllous vegetation, which include scrubby, woody plants with hard, evergreen and often broad leaves. The under-story vegetation includes grasses and herbaceous flowering plants. This type of vegetation is called maquis in Italy and chaparral in California. Temperate zones which experience cool and wet summers, mild to very cold winters and include warm temperate, typical temperate, arid temperate and boreal or cold temperate climates. The arctic zone, which experiences a short summer with continuous sunlight and a cold, sunless winter. Precipitation is slight but distributed throughout the year. These climatic zones have distinct floral distributions. Table 3.5 shows the floral zones on an altitudinal gradient in the tropical zone.

Table 3.5

Tropical floral zones on an altitudinal gradient

Height (metres) above sea level

Floral zones *

0 to 600

Palms and bananas

600 to 1,250

Tree ferns and figs

1,250 to 1,900

Myrtles and laurels

1,900 to 2,600

Deciduous trees

2,600 to 3,800

Conifers

3,800 to 4,450

Alpine shrubs

4,450 to 5,050

Alpine herbs

Above 5,050

Permanent ice and snow

*after Bharucha (1983)

3.5 PRINCIPLES OF DYNAMIC PHYTOGEOGRAPHY Lawrence (1954) summarised the data on the biological, geographical and geological aspects of phytogeography, based on the works of Good (1937, 1953), Mason (1936), Wulff (1943) and Cain (1944). He elucidated 13 basic principles related to phytogeography on the basis of (a) Environment, (b) plant responses, (c) migration of flora, and (d) the climax concept.

174

Fundamentals of Ecology

3.5.1 Principles Environment 1. Climate is the primary environmental factor influencing the nature of flora of any region. Some other environmental factors like type of soil and biotic conditions are considered secondary to the climate in the development of the flora of a region. 2. The climate of the earth has undergone tremendous changes in the past and therefore understanding the development and evolution of any regional flora will largely depend upon acquiring a knowledge of the past climate of that region. 3. The earth has gone through many geological changes and hence the relation between land and sea has varied considerably. This fact has a bearing on the development and evolution of flora in different regions of the earth. The sea also influences the land in many ways and thus has its effects on the climate of a region. 4. Edaphic factors such as soils (their origin, physicochemical nature, depth, texture, moisture content) also control the nature of vegetation of a region. 5. Biotic factors like plant association, parasitism, role of domesticated and wild animals and the role of man have important bearings on the evolution of the flora of a region. 6. The climate, soil conditions and biotic factors of a region operate in an integrated fashion and regulate the development of flora and the stability of communities. Plant responses 1. The distribution and evolution of plants in any region are dependent on their ecological tolerances. 2. The genetic makeup of the species largely determines its tolerance in a range of environmental conditions. 3. The different life cycle stages of a species have different tolerance levels. Migration of flora 1. Floral migrations have occurred due to land movement, glaciation, other environmental factors and human activities. 2. The successful migration of flora involves the transport of popagules from one place to another and its successful establishment at the new site. Perpetuation and evolution of flora 1. The perpetuation of flora largely depends upon migration, tolerance and evolution in the new habitat. 2. Natural selection plays an important role in the evolution of the flora of a region.

These phytogeographical studies have brought forth important concepts in plant distribution, such as age and area theory, endemism, centre of origin, plant migration, barriers, and so on. 3.5.2 Age and Area Theory

Willis (1922) proposed that the area of distribution of a plant species is directly related to its age. According to this theory, a species with a large area of distribution evolved much earlier than a species

Ecosystems of the World and Distribution of Flora and Fauna

175

with a small one. Willis drew examples from several species of Coleus growing on plains and hills in Sri Lanka. This theory has not been widely accepted, as the spread of a species cannot be considered the only factor determining its age. It also ignores the ecological, genetic and evolutionary aspects, which influence the spread of a species. 3.5.3

Endemism

Definition:

Species which are spread over a wide area or in different ecological conditions are said to be cosmopolitan. Some of them, called endemics, are restricted in their distribution to a small region and may be associated with particular habitat conditions. This phenomenon of restricted distribution associated with some geographical or ecological factors is called Endemism.

Some young species may show a restricted distribution but cover large areas in course of time. This is called expanding or progressive endemics. Some old species may be restricted to a small region because of a severe decline in their population, a phenomenon termed contracting or retrogressive endemics. A species may be restricted to a narrow region at present but might have shared a wide distribution in the past. This situation may be due to geological, geographical or climatic changes and is called relic endemism, as the species is a relic of the past. For example, ginkgo bioloba has a very narrow area of distribution now, but paleobotanical evidence shows that the species existed over much wider areas several millions of years ago. Regions experiencing abrupt changes in climate may harbour endemics. The Alps in Europe possess two hundred endemics (Wulff, 1943). Endemics constitute 66, 82 and 72% of the plant communities of isolated regions like Madagascar, Hawaii, and New Zealand respectively. Among endemics, some species exhibit very localised distribution and are called local endemics. Sometimes mutants appear and vanish without being able to compete with parental species, and are called pseudo endemics. In the Himalayas, some 28% (3,169 dicot species) of all the dicots are endemic (Chatterjee, 1939). Some of the endemic tree species of India are Ficus religiosa, Ficus benghalensis, Aegle marmelos, etc. The oil crop Sesamum indicus is endemic to India. In Western Ghats of India endemically % of tree species varies from 2 to 55 in different formations (Fig. 3.3) and Table 3.6. 3.5.4

Centre of Origin

It is believed that for every taxa, there is one region where it came into existence. Likewise, some areas might have given rise to many species. These regions are therefore called the centres of origin. Plants evolved much earlier than man. Paleobotanical evidence helps us arrive at conclusions on the centre of origin. It has been accepted-that cinchona, tomato, and tobacco originated in South America. Cotton and chilly originated in Central America. Lichi (Litchi chinensis), tea (Camellia sinensis) and brinjal (Solanum melangena) originated in China. India is the centre of origin of many crop plants like rice (Oryza sativa), sugarcane (Saccharum officinarum), and gram (Cicer arietinum). 3.5.5

Barriers and Plant Migration

In nature the migration of flora from one place to another is aided or obstructed by many factors. The main agencies for plant migration are (a) wind, (b) water, (c) animals (grazing activity), (d) birds (seed eaters), and (e) man. Besides, plants have their own mechanisms for the dispersion of seeds.

Fundamentals of Ecology

176

Fig. 3.3

Percentage of Endemicity varies from 2 to 55 in Western Ghats (Based on Utkarsh, Joshi and Gadgil, 1998). 1. Closed canopy evergreen forest, 2. Semiclosed canopy evergreen forest, 3. emievergreen forest, 4. Stunted evergreen forests, 5. Scrub/Savanna, 6. Moist deciduous forest, 7. Dry deciduous forest

Table 3.6

Select endemic plant species of Western Ghats found in Kerala. (From Prasad et al, 1988). Species

Actinodaphane bourdillonii

Species Aprosa bourdillonii

Actinodaphane tadulingam

Aspidopterys canarensis

Anaphalis travancorica

Astergamia macrocarpa

Anaphyllum wightii

Atuna travancorica

Antistrophe serratifolia

Bentinckia condapanna

Aphyllorchis Montana

Blepharistemma membranfolia

Apollonias arnottii

Calamus travancoricus

Capparis fusifera

Desmos viridWorus

Ceropegia beddomei

Dysoxylon malabaricum

Ceropegia decantiana

Elaeocarpus venustus

Ceropegia spiralis

Eugenia discfera

Ceropegia thwaitesii

Euonymus angulatus (Contd.)

Ecosystems of the World and Distribution of Flora and Fauna

Table 3.6 (Contd.) Chilochista pusilla

Exacum travancoricum

Cinnamomum riparium

Garcinia indica

Cinnamomum travancoricum

Glycosmis macrophylla

Claxylon anamalayanum

Glypopetalum grandflorum

Cleistanthus travancoricus

Gymnostachyum 1atfolium

Coleogyne mossiae

Habenaria barnesii

Crotalaria bidiei

Habenaria multicaudata

Crotalaria clarkii

Humbultia decurrens

Crotalariafysonii

Indigofera constricta

Crotalaria travancorica

Indobanalia thyris(folia

Cryptocarya beddomei

malabarica

Cyclostemon macrophyllum

Janakia aryapathra

Cyclostemon malabaricum

Jerdonia indica

Cynometra travancorica

Kanjaram paighatense

Dalbergia malabarica

Kunstrela keralense

Debregessia ceylanica

Lasianthus dichotomus

Desmodium dolbforme

Loesnerilla bourdillonii

Memeceylon lawsonii

Phenophyllum lawsonii

Memeceylon talbotianum

Piper barberi

Milletia rubiginosa

Podocarpus wallichianus

Milusa nilighirics

Poeciloneron indicum

Miquellia dentate

Polygala ramaswamii

Morinda reticulata

Rawolfia beddomei

Murdonia juncoides

Salacia beddomei

Myristica falua

Sonerila nemakadensis

Myristica malabarica

Strobilanthus lawsonii

Niligirianthus lupinus

Symplocos macrocarpa

Niligirianthus nilgherensis

Syzygium travancoricum

Niligirianthus asper

Tholtea dinghoui

Niligirianthus heyneanus

Toxocarpus palghatensis

Niligirianthus urceolaris

Vannila wightiana

Oberonia chandrasekarnii

Vateria macrocarpa

Ophiorizzha brunonsis

Vernonia anamallica

Ormosia travancorica

Vernonia bourdilloni

Orphea unWora

Vernonia bourneana

Osbeckia lawsonii

Vernonia peninsularis

Otonephelium stipulaicum

Willisia selaginoides

Peucedanum anamalayensis

Zeylandium johnsonii

177

178

Fundamentals of Ecology

The barriers to plant migration are the occurrence of (a) land features, (mountain ranges, etc.), and (b) oceans. The climate also plays an important role in obstructing migration. Many plants have specific requirements of photoperiod and temperature conditions and therefore cannot be effectively established in new regions. Some biotic factors like the selective eating of plants by animals and man and the specific association of organisms (Mycorrhizae, pollination, etc.) may also act as barriers for plant migration.

MULTIPLE CHOICE QUESTIONS Choose the correct answer 1. In a deep lentic aquatic system, the water zone beyond the depth of effective light penetration is called: (a) Profundal zone (b) Littoral zone (c) Limnetic zone (d) All the zones 2. The light compensation level in a lentic water demarcates: (a) Profundal from littoral zone (c) Littoral from limnetic zone (b) Limnetic from profundal zone (d) Profundal from sediments. 3. The order of different layers with respect to thermal stratification of deep lentic water body from top to bottom is: (a) Epilimnion–Thermocline–Hypolimnion (b) Hypolimnion–Epilimnion–Thermocline (c) Epilimnion–Hypolimnion–Thermocline (d) Thermocline–Epilimnion–Hypolimnion 4. The division lines of biomes are based on: (a) Altitude (b) Latitude (c) Mountain ranges (d) Temperature zones 5. A particular biome may occur progressively lower altitude at progressively: (a) Northern latitudes (c) Tropical latitudes (b) Southern latitudes (d) Subtropical zones 6. Tropical rain forests grow in regions with: (a) Plenty of moisture, heat and no winter. (b) Plenty of moisture, cool and mild winter. (c) Plenty of moisture in the form of snow, cool and mild winter. (d) Plenty of moisture, cold climate and severe winter. 7. One of the following vegetation type occurs in tropical latitude (0–20°C) in 3000 metre altitude. (a) Subtropical (b) Temperate (c) Arctic–alpine (d) Tropical 8. The Western Ghats chain of hills run parallel to the: (a) East Coast of Indian Peninsula. (b) Southern Coast of Indian Peninsula. (c) West Coast of Indian Peninsula. (d) Himalayan mountain range in north.

Ecosystems of the World and Distribution of Flora and Fauna

9.

10.

11. 12.

13. 14.

179

Match the column ‘A’ with ‘B’. Column ‘A’ Column ‘B’ (i) Canada (a) Oceanic (ii) New Zealand (b) Indo-malayan (iii) South East Asia (c) Nearctic (iv) China and Mongolia (d) Australarian (v) Pacific islands (e) Palaearctic The zone that extends between latitude 10 and 25o on either sides of the equator is: (a) Subtropical zone (c) Tropical zone (b) Equatorial zone (d) Temperate zone Organisms living on the bottom of the sea, lake and deep water bodies are called: (a) Benthos (b) Nekton (c) Nanoplankton (d) Macroplankton One of the following is a Ramsar site in India. (a) Chilika lake (c) Similipal (b) Vakra Nangal Dam Reservoir (d) Western Ghat The dominant vegetation on the banks of rivers and near the sea coast in Bhittar Kanika area of Orissa is called -------------------. Chironomid larvae are classified as ------------------ in water bodies.

SHORT AND DESCRIPTIVE QUESTIONS 15. 16. 17. 18. 19.

Discuss the reasons for identifying the Western Ghats as a hot spot of biodiversity in the world. Distinguish between different Savannas. Discuss the forest basal areas in tropical, temperate, sub alpine and central Himalayan forests and draw conclusion on plant species and plant growth. What are mangroves? Give an account of Indian mangroves and their adaptability. Write brief notes: (a) Arctic tundra (b) Adaptive features of camels to desert climate (c) Differences between littoral, limnetic and profundal zones of lentic water bodies. (d) Differences between different planton groups citing examples of each category. (e) Ramsar sites in India. (f) Endemism and some endemic plants of India.

4

Environment in Action 4.1

CONCEPT

Environmental factors, which may be climatic such as rainfall, humidity and temperature, topographic, such as altitude, slope, direction of mountain ranges, etc., edaphic, such as soil and nutrients, or biotic, such as competition, prey-predator relationship, parasitism, etc., bring marked distributional, structural and functional changes in organisms. To grow and perform all activities, inaluding reproduction, an organism requires a harmonious relationship with its immediate environment. The difference between the vegetation of a desert and a rain forest or the diversity of consumers between them indicates the role of environmental factors on the distribution and survival of organisms in different ecosystems. These environmental factors exhibit diurnal, seasonal, annual and cyclic variations which the organism is subjected to. Hence it develops strategies to cope with these changes in the environment (refer to Chapter 1). Some of the more important environmental factors are discussed here. They are grouped under five categories.

4.2

CLIMATIC FACTORS

These factors include precipitation, temperature, humidity, wind and light, all also classified as physical factors. The climate of a region depends upon them. A variation in these factors affects the distribution and lifestyle of organisms. 4.2.1 Climate

The global climate is influenced by air currents, ocean currents, snow covers, land mass etc. The latitude, altitude and availability of large water bodies influence the climate of a region. The climate of a region determines soil formation and food production. The atmosphere does not allow all incoming solar radiation to strike the earth surface. Nearly 15— 20% of the total solar energy received in the upper most layer of the atmosphere gets absorbed by water vapour, oxygen, ozone and dust particles. Due to this absorption of solar radiation the air becomes

Environment in Action

181

warmer. About 20% of the radiation is reflected back into the space by clouds. Besides clouds also absorb about 3% of solar radiation. About 6% of solar radiation is back scattered by air molecules. Ultimately about 55% of the incoming radiation reaches earth surface and of this 4% is reflected back. Thus 51% of solar radiation, which reaches earth surface, gets redistributed in the atmosphere by conduction and convection. When earth surface is heated warm air rises up and cool air comes down and gets heated up. Hence the temperature on lower altitudes is always higher than the temperature at the higher altitudes. Air Currents Air moves vertically as well as horizontally. When a part of the air becomes warm, its density becomes low and thus it becomes lighter. The warm, lighter air with low density, moves upward. This warm air also carries moisture and therefore forms clouds in the upper atmosphere.

The horizontal movement of air is called wind and this horizontal movement is not easily understood. Due to an unequal heating of earth surface as solar energy does not reach every where on earth surface in a uniform way and due to differential absorption, scattering and reflection in the atmosphere, differences in air pressure in the atmosphere occur. Air moves from areas of higher pressure to areas of lower pressure causing formation of wind. The areas of the earth receiving solar radiation at right angles with the sun on the overhead are heated more than those areas where radiation is at an inclination. Besides the heating of sea surface and land surface are different. Ocean surface does not change its temperature quickly while land areas get heated or cooled quickly. During the day the air above the land gets warmed up and expands and air above the ocean does not show much change. In the process the air above the land moves towards the ocean at higher altitude and there is a movement of air mass from sea towards land at the lower altitude. This creates a kind of air circulation in which in lower altitude air moves from sea to land and in higher altitude air moves from land to sea. The unequal heating of the different areas of earth leads to air circulation on a global scale. To explain global air circulation several models were proposed. At present three cell circulation model for each hemisphere of the earth is considered to be very useful in understanding air circulation process (Fig. 4.1). In this model there is a zone between equator and about 30º latitude which shows flow of air towards equator. In the upper part of the atmosphere (beyond 30° latitude) ai flows towards poles. In this zone trade winds, viz. North-East Trade wind and South-East

Fig. 4.1

Global circulation of air (proposed three-cell circulation model.) (From Indira Gandhi National Open University Pub. 1991Environment)

182

Fundamentals of Ecology

Trade wind are created. At the edge of this zone, towards 20° N and S latitudes to 30° N and S latitudes, the atmosphere remains calm and these latitudes are called Horse latitudes, because sailing ships were often calmed for long period at these latitude and horses transported in the ship as cargo often died of hunger and thirst. In the zone 30° to 60° latitudes the air flow is pole ward and the winds have a westerly component. These winds carry the excess heat from the equatorial region towards the poles. In the zone beyond 60º latitude air flow easily occurs from pole to the equator and they form polar easterlies. These air currents transfer the heat from one air to another and also control the precipitation. Ocean Currents Ocean tides bring regular movements of the water caused by the pull of the moon and the sun. Besides, there is another movement of ocean water called ocean currents. These currents are like rivers of water flowing through the ocean and taking water from one region to another region. The patterns of these ocean currents are determined by major patterns of atmospheric circulation and land masses around. These ocean currents influence temperature of the adjacent land areas. For example, the North- Atlantic Drift or otherwise called movement of warm ocean currents to pole- ward keeps winter temperature in western part of the Europe warmer than they should be as per their geographical locations. Westerly winds in these areas carry the heat towards land. In the tropics and middle latitudes cold ocean currents flow in summer. For example Benguela current flows in the ocean near the western coast of Southern Africa. This current brings down the temperature in the tropical region. Another current which shows oscillations of 4–7 years cycle occurs in eastern pacific and is called El Nino.

El Nino is the periodic warming of the pacific ocean water that lead to extremes in weather. According to scientists, high pressure in the eastern pacific sends winds blowing towards west. These winds push water about a half a meter higher around Indonesia and Australia then it does off the coast of Peru. When the pressure drops and the trade winds slacken the water sloshes back down hill to the east. The sloshing sends waves across the ocean like ripples in a pond. These waves in turn push down on the thermocline, a layer of cooler water that normally mingles with the warmer water at the surface. As the thermocline sinks to greater depths, the mixing stops and temperatures at the sea surface rise and El Nino begins. El Nino is called Christ Child, because of the fishermen of Peru observing warm sea water during Christmas time in western pacific, called it the little one or the Christ Child. When the wave first hit South American coast some reflect back like sound bouncing of a wall. These waves make the western pacific warm. When the reflected wave reach Asia they re-bounce again. This double bouncing inverts their effect and instead of depressing the thermocline these twice reflected waves bring cool water from deeper oceans of the sea and dilutes the warmer liquid at the sea surface causing a temperature drop in the eastern pacific and this decrease in temperature is called La Nina. Hence for every Nino there is a Nina. These climate cycles seem to involve both atmosphere and ocean. Warming of the sea (El Nino) destroys the marine food chain and brings heat waves in some part of the world and becomes responsible for the outbreak of infectious diseases even in higher latitudes. It changes ocean currents and direction of atmospheric winds. In 1982–83, El Nino caused worldwide destruction. In 1997–98 El Nino cycle, the summer heat was the highest of the century. Europe’s climate is different than North America or Asia in the same latitude. In Europe the cold and dry winds that blow eastward across the North Atlantic from Canada somehow is warmed up by the east bound gulf stream which brings warm water flowing north from tropics and merging into the north Atlantic current. This warm water flows up the Norwegian coast with a westward breakage warming Greenland. This ocean current keeps northern Europe about 9–18°C warmer in the winter

Environment in Action

183

than comparable latitudes elsewhere. The North Atlantic current is something very big and comparable with the flow of about 100 Amazon Rivers. This current acts as a salt conveyor that extends through the southern oceans into the pacific. ∑ Huge amount of seawater sink at known down-welling sites every winter. This annual flushing is important—if it fails for some years the conveyor belt stops moving. ∑ Surface waters are flushed regularly. They sink twice a year carrying the load of atmospheric gases downward. Water density changes with temperature. Water is denser at 39°F. ∑ A lake surface cooling down in autumn will eventually sink into less dense, because warmer water below, mixing things up. Seawater due to salt content brings a complicated situation. Water that evaporates leaves its salt behind-the resulting saltier water is heavier and sinks. ∑ The excess salt is flushed from surface water has global implications. Salt circulates, evaporation up north causes to sink and carried to south by deep currents. If too much fresh water is added to ocean it would bring imbalance in sea currents also—lot of evaporation will cause surface water saltier and the water will sink to considerable depth-affecting the current. ∑ The cold dry winds blowing eastward off Canada evaporate sea-surface water in North Atlantic and leave behind their salt. In winter the heavy surface water sink en masse, flow south and the same thing happens in Labrador sea between Canada and Southern top of Greenland. ∑ Salt sinking in Nordic seas cause warm water to flow much farther north. This is called Nordic sea heat pump. ∑ The salt sink in Nordic sea affects the salt conveyor belt and becomes global. The monsoon climate in South-East Asia, specially India, is largely influenced by ocean currents in Indian Ocean, Bay of Bengal and Arabian Sea and the wind patterns in this region. The monsoon rains are the lifeline for South-East Asian countries and particularly India, as monsoon controls the agricultural system in India. Regional climate Seasonal changes in climate are due to the revolution of the earth around the sun. When the earth moves around the sun, its axis always points towards the North Star or the Pole Star in the Northern Hemisphere. Because of this reason the North Pole tilts towards the sun, leading to winter in the Northern hemisphere. Converse will be the case in Southern Hemisphere and therefore, the summer in Northern hemisphere will coincide with the winter in Southern Hemisphere and vice versa. Besides, the angle of sun’s rays reaching the earth is also responsible for change in weather. When sun is directly overhead, .the sun’s rays directly hit the earth. With lowering of the angle, sun rays spread over greater area, and the intensity of sun rays decreases. All these situations affect the seasonal variation in climate.

There are many regional factors, which may affect local climate. These regional factors may be the vegetation cover, topography, elevation, presence of water bodies etc. Altitude, also affect the climate of a place. Since temperature drops by 5–6.5°C per kilometre rising height in the lower part of the atmosphere, a place situated at an altitude of 2000 metres will be cooler by about 10–13°C than a place at the same latitude at sea level. The differences in seasonal variation in climate and regional differences in climate affect the distribution, structure of flora and fauna.

184

Fundamentals of Ecology

4.2.2 Precipitation

Precipitation includes all moisture that comes to earth in the form of rain, snow, hail and dew. The water cycle is discussed in Chapter 2. Hutchinson (1957) pointed out that the total precipitation of the world was about 4.46 ¥ 1020 g per year and of this amount 0.99 ¥ 1020 g fell on land and the rest on oceans. Precipitation occurs as a result of the cooling and condensation of water vapour at high altitudes. The low temperature at high altitudes cools the air, which gets saturated and loses its water holding capacity. As the temperature starts falling, the water vapour condenses and falls as rain, due to gravity. Precipitation falls as hail, snow or rain, depending upon the environmental conditions. In winter the ground temperature falls and hence atmospheric vapour gets condensed as dew or frost. Of all these forms, water is the most important for the maintenance of life on this planet. The body of living organisms contains 50–90% water. 65% of the human body is water. We sweat to keep our body cool and also get rid of some waste products in the process. Nutrients and oxygen are transported to different organs of the body by blood, which is largely composed of water. Scientific data indicate that life first appeared on earth, in water, in the form of simple, single-celled organisms. When the amount of water in the body goes down by even 2%, we feel thirst. A greater drop, say 5%, can cause a dry tongue and mouth and shrinking skin. A drop of 10–15% can cause severe dehydration and may be fatal. Some unusual properties of water make it an ideal medium for living organisms. Some of these properties are: 1. The specific heat of water is 1 cal, which is much higher than that of many solvents like ethanol (0.58), methanol (0.6), acetone (0.53), ethyl acetate (0.46) and chloroform (0.23). The specific heat of a substance is the amount of heat required to raise its temperature by 1°C. The fundamental unit of heat, the gram calorie, is the quantity of heat required to raise the temperature of I g of water from 15 to 16°C. The high specific heat of water ensures that the process of heating up water is slow and this has considerable biological significance. Hence water is capable of keeping the body temperature of a living organism relatively constant. 2. The heat of vapourisation of water is also high. The latent heat of vapourisation is defined as the amount of energy absorbed per gram of water vapourised at its boiling point, at standard pressure (standard pressure is the atmosphere). It takes about 540 and 596 calories per gram of water vapourised at its boiling point (100°C) and at 0°C respectively. This high value helps living organisms to keep their body temperature constant, because a large amount of heat can be dissipated by the vapourisation of water. 3. It has high latent heat of fusion (80 cal/g, compared to those of ethanol (25 cal), methanol (22 cal) and acetone (23 cal). This property of water helps stabilise the biological environment. A gram of water must give up 80 times as much heat in freezing at 0°C as it did on having its temperature lowered from 1–0°C just before freezing. The heat released by water on freezing is a major factor in decreasing the actual lowering of the temperature of a body of water in winter. 4. Water has high surface tension and a high dielectric constant. These properties make it an excellent solvent for biological purposes. 5. Water achieves its maximum density at 4°C. It expands on solidifying and its density reduces. This phenomenon has a lot of ecological significance. If ice were heavier than liquid water, it would sink—this would mean that aquatic ecosystems like oceans, lakes and ponds would freeze

Environment in Action

185

from the bottom up. Once frozen this way they would be extremely difficult to melt. This situation would not be conducive to the existence of aquatic life. Since ice is less dense, however, the warmer liquid water falls to the bottom of any aquatic ecosystem and the ice floats on top. The top layer can receive heat from the external environment, which can melt the top ice in summer. Living organisms like fish stay in the bottom water. Role of water in the ecosystem The availability of water in an ecosystem affects the distribution, growth and activities of organisms in it. The amount of rainfall and evaporation and their ratio determines the type of vegetation growing in an ecosystem. The average annual rainfall of India is about 117 cm, the highest in the world. However, great contrasts occur between the different regions in India with regard to rainfall. The average annual rainfall in Assam and the north-east is about 250 cm. In Cherrapunji in Meghalaya, the annual average is 1,100 cm, whereas in Jaisalmer it is only 20 cm. The distribution of rainfall over India depends largely on the position of hills and mountains and the forest cover. The monsoon winds strike the Western Ghats from a southwest direction and shed most of their water on the windward side. Bombay is on the windward side and receives 200 cm of rainfall annually during the monsoon while Pune on the leeward side receives only about 75 cm. If the rainfall to evaporation ratio is zero or less, deserts develop. Grasslands develop when the ratio is more than 0.2 and less than 1, and forests develop if it is more than 1 (around 1.6 to 2). Depending upon the availability of water and distribution of rainfall during the year, the world has been divided into different vegetation regions, such as tropical rain forests, temperate rain forests, cold temperate deciduous forests, cold temperate coniferous forests, savanna, grasslands, tundra, deserts, etc. We have already discussed them.

The scarcity or abundance of water brings about adaptations in living organisms. Plants growing where water is available in plenty are classified as mesophytes. Plants growing in water are called hydrophytes while animals that live here are said to be aquatic. Some plants can grow in ecosystems where water is scarce and where the day temperature is very high. These plants are called xerophytes and the animals living in these conditions are called desert animals. Hydrophytes and aquatic animals and their adaptive features Aquatic plants include: (a) floating hydrophytes, (b) submerged hydrophytes, and (c) amphibious plants. Free floating hydrophytes are unattached but may have submerged roots. They include the minute surface floating or submerged plants having a reduced assimilatory thallus with very few roots or no roots, such as Lemna, Wolffia, and plants like Salvinia and Ceratophyllum whose reproductive organs are not submerged, but either floating or aerial. Free floating plants may also have submerged roots which are well developed—these plants include Eichhornia crassipes, Pistia, Hydrocharis, etc. Submerged hydrophytes include Hydrilla, Najas, Elodea and Vallisneria. Tenagophytes are amphibious plants—they grow in water bodies as well as in waterlogged soil.

These hydrophytes grow in hydric conditions and hence exhibit the following general features. They possess poor mechanical, absorbing, conductive and protective tissues. But they have an extensive development of air spaces in the tissues. Roots are either absent or poorly developed (they may not have root hairs, root cap and vascular tissue). They are generally fibrous and adventitious, when present. The stem is weak, slender and spongy. In some it is like a horizontal rhizome covered with mucilage, while it may be hard, as in Nelumbo. The aerial leaves may be broad but the submerged leaves are thin, long or ribbon shaped. Figure 4.2 shows some typical hydrophytes.

186

Fundamentals of Ecology

Aquatic animals in general exhibit a head, body and tail compressed into a streamlined form. The head is subconical or slightly rounded and the body is perfectly compressed, with fins often reduced to thin keel-like lines. This streamlined body helps in faster locomotion. Many fish possess a hollow organ filled with air or gas, called the swim bladder, which is largely hydrostatic. In some ancient fish the function of the swim bladder might have been respiratory. Aquatic animals include fish with gills, sea turtles, mammals such as whales, and many others. There are also amphibious forms and many birds which visit water bodies for the collection of food.

Fig. 4.2

Some typical hydrophytes: A—Eichhornia crassipes showing inflated petiole and root pockets; B—Lemma paucicosta showing roots without root hair and thallus-like fronds; C—Pistia stratoides showing short stolon, adventitious roots and compact stem, D—Hydrilla verticiliata showing small leaves arranged in whorls, E—Hydrocharis morusranae; note the shape of the leaves.

Xerophytes and desert animals and their adaptive features Xerophytes grow in conditions of very dry air, high temperature, strong winds, high transpiration rate and evaporation higher than precipitation. The soil is very dry and porous. The chief adaptations involve increased water absorption by roots, storing of water and retardation of transpiration.

Trees may go very deep in search of water and have extensive root hairs to absorb it. The roots of plants like Calotropis procera, Ficus and Acacia may go as deep as 10 to 16 metres and may reach the water table. Hence these plants survive in desert or arid conditions even if the transpiration rate is higher. The storage of water is facilitated mainly by modifications of leaves, as in Mesembtyanthemum, or modification of stems, as in cacti like Opuntia. Sometimes water is stored in roots, as in asparagus. Some xerophytes are called succulents because they possess thick, fleshy water storage organs. Reduced transpiration is achieved by decreasing the leaf surface, as in Casurina and Asparagus, or by modifying the leaves into spines and barbed bristled, as in cacti, or by having thick, leathery, heavy cuticle bearing leaves with well developed hypoderma to reduce transpiration, as in Calotropis procera. Figure 4.3 shows some xerophytes. Desert animals depend upon plant sap or on the blood of their prey to satisfy their water requirements. It is not known whether the skin of desert animals is hygroscopic but that of some desert lizards can absorb water at a much faster rate if they are put in water. Desert animals like camels have stomachs which are divided into many cavities for storing water. Most desert animals are nocturnal and burrow deep into the soil in the daytime to avoid excessive heat and dryness. They have nostrils directed upwards, which may be protected by complicated valves, or reduced to pinholes. The ear opening

Environment in Action

187

is either small or protected by scales. They eyes may be overhung by head shields as in some desert snakes. These features are associated with burrowing and observed in desert snakes like typhlops. The camel has large eyes guarded by long eye lashes and located high on the head. Desert animals are usually grey, brown or red, matching with the colour of the sand or rock. Desert reptiles are venomous—even the desert spider is poisonous enough to kill a small vertebrate like a lizard or a rodent. Desert animals move much faster than other land animals, since they have to travel long distances in search of food and water. 4.2.3 Temperature as an Environmental Factor

Within a limited range of temperature, the rate of chemical (biochemical) reactions double with every 10°C rise in temperature. This is known as Van’t Hoff’s rule. Thus temperature exerts a profound influence on the physiological activities of organisms. Every physiological function has temperature limits—an optimum Fig. 4.3 Some typical Xerophytes: A—Opuntia temperature at which the physiological activities are at showing phylloclades (succulent a maximum, a minimum temperature at which they are stems) and spines; B—Euphorbia at their lowest, and a Maximum temperature, which is tiruculii showing caducous leaves; C—Acacia nilotica showing stipular the highest temperature limit that can be tolerated by spines and bipinnate leaves bearing the organism. Organisms differ in their tolerance limit small leaflets to extreme temperatures. Most organisms perform their activities in a temperature range of 4–45°C. They also carry out their physiological and biochemical activities in this temperature range of the habitat. This range of temperatures is therefore called the biokinetic zone. Based on temperature tolerance, animals are classified as eurythermal (wide temperature tolerance) or stenothermal (narrow temperature tolerance). Physiological effects of temperature Temperature influences physiological processes like chemical reactions, gas solubility, mineral absorption in plants, water uptake in organisms, transpiration, assimilation, respiration, growth, and germination in plants, and distribution, migration, aestivation, hibernation, encystment, reproductive activities and so on in animals. Organisms also exhibit morphological, ecological and physiological adaptations to extremes of temperature. Physiological processes and biochemical reactions Enzymes control biochemical reactions. Enzymatic action is temperature dependent. Usually most enzymes are inactivated above 35 to 40°C, while below 10°C enzymatic activity is at a minimum. We have already discussed Van’t Hoff’s rule. In plants, temperature directly or indirectly affects photosynthetic activity. Transpiration increases with increase in environmental temperature as does the rate of respiration. Oxygen and carbon dioxide solubility are also influenced by temperature. In plants low temperature facilitates the solubility of these gases, a large

188

Fundamentals of Ecology

amount can be held in the sap of plant cells. Low temperature favours nitrogen fixation and increases carbohydrate reserves. However, prolonged low temperatures may be injurious to plants. Nutrients remain tightly bound to the soil at low temperatures and plants spend more energy to absorb them. Temperature also influences the ability of roots to absorb water. Low temperatures can limit water uptake, since the viscosity of water doubles as the temperature drops from 25 to 0°C and water gets more tightly bound to the soil. Optimum water absorption by plants usually occurs around 25 to 30°C. In temperate zones, organisms, particularly animals, exhibit maximum growth during summer. Some zooplankton, such as rotifers and daphnia, produce parthenogenetic eggs under normal conditions and sexual eggs meant for fertilisation when the environmental temperature increases. The rate of development of the eggs of Echinus and most invertebrate animals is increased almost twofold for every 10°C rise in temperature between 3 and 35°C. Temperature, along with humidity and light, controls pigmentation in animals. Animals in a hot climate are usually darker. Organisms employ various methods to avoid unfavourable temperature conditions. In some animals, a hard covering, the cyst, develops around the body using which they overcome unfavourable thermal conditions. Microorganisms (bacterial spore or fungal spore) and many invertebrate animals also exhibit this phenomenon. Many animals exhibit hibernation at very cold temperatures. Poikilothermic animals undergo hibernation and become lethargic. They do not consume food and their metabolic activities are reduced to a great extent. Amphibians burrow in the soil to avoid cold temperatures. At very high temperatures many animals exhibit aestivation, which refers to their dormant condition in summer. Earthworms, snails, bugs, beetles, lung fish and even some higher animals undergo aestivation. Some earthworms form a distinct coiling (Plate 1.1) during summer while some others migrate deep into the soil or become very torpid. Birds migrate to avoid unfavourable thermal conditions. Many species of birds from colder European and Russian climates migrate southward to India in winter and return to their homes in spring and summer. This is also related to hormonal changes in the body. Temperature related morphological adaptations Desert plants usually have whitish or greygreen leaves and stems because these colours reflect the sun rays and thus limit heat absorption. They also possess a thick waxy layer of cuticle covering around the leaves for the same reason. Many cultivated plants, such as beans, tomatoes and onions, possess a cutin layer which partially protects them from possible damage due to heat. The arrangement of leaves is also important. Leaves oriented vertically towards the sun absorb a minimum amount of solar energy and remain cooler than those exposed to the sun at right angles. Turning a leaf 10° away from the perpendicular to incident light reduces heat absorption by about 15%. High temperature also causes many disorders in plants. Excessive high temperature may cause loss of chlorophyll and consequent chiorosis of leaves, or leaf scorch due to heavy transpiration. Very high temperatures at the soil surface may produce stem lesions or heat cankers and small plants may die. Fruit scalding and water core (watery appearance or water accumulation in the core of the fruit) occur in many fruits owing to high temperatures. Levitt (1980) has discussed the nature of adaptation in plants to high and low temperatures in detail. Distribution of plants and animals on a temperature gradient. We have already discussed the flora and zoogeographical realms and the latitudinal and altitudinal distribution of plants. These distributions are based on temperature gradients as we move from the equatorial region to tropical, subtropical, temperate, alpine and Arctic regions. The formation of coral reefs is associated with warm temperature conditions. Many molluscs, like Portlandia artica and Pecten groenlanicus, prefer very low temperatures

Environment in Action

189

(around 0°C) and are not found in warm climatic conditions. But the sea urchin, Echinus esculentus, and the gastropod, Urosalpinx cinerea, attain their maximum size in warmer waters. Precipitation and temperature are very closely interrelated and exert their combined influence on the distribution of organisms. The annual precipitation is around 25 cm in both deserts and the tundra, but their temperature regimes are quite different. As a result, there is a great variation in the diversity and distribution of flora and fauna in the two regions. Vernalisation Temperature plays a role in the flowering process in some plants. Vernalisation is defined as the method of inducing early flowering in some plants by pretreatment of their seeds with very low temperature. Chourad (1960) defines vemalisation as the acceleration in the flowering process in some plants in response to chilling.

In many plants, apart from the photoperiod, the environmental temperature influences the initiation and development of reproductive organs. In annuals, light is important for flowering and temperature is a secondary factor. But prolonged exposure to cold temperatures in winter is required for flowering in biennials. The majority of biennials do not flower but grow vegetatively indefinitely if not exposed to cold winter temperatures. In these plants flowering can be induced by cold temperatures and exposure to the required photoperiod. Example

Hyoscyamus niger has two types of plants. One is annual, the other biennial, Both are longday plants and if exposed to short-day conditions will grow vegetatively. The biennial type can be induced to flower if ten-day-old seedlings are vernalised.

Many scientists have tried to understand the mechanism of vernalisation. Devernalisation (removal of vernalisation effects) can be done by exposing vernalised seeds (or plants) to high temperatures, air containing more than 20% CO2 or an atmosphere of nitrogen. The vernalisation process requires oxygen and water. Dry seeds are usually not vernalised. Lang (1965) postulated that a hormone called vernalin is produced on the meristematic short apex of the embryo due to cold treatment, which is responsible for flowering. His hypothesis is as follows: Low temperature Æ Thermoinduced conditions Æ Vernalin Æ Florigen (flowering) However this hypothesis has now been contested, as vernalin is a precursor of gibberellins and under long dry conditions turns into it (Chailakhyan, 1968). 4.2.4 Light as an Environmental Factor

Sunlight is the ultimate source of energy for the biological world. Light is a narrow band of visible radiant energy comprising wavelengths of 390–760 nm (0.39–0.76m) If visible light is passed through a prism, the following spectrum of seven different colours is seen (Table 4.1). The short wavelength and invisible ultraviolet radiation is below the visible range and has a wavelength range from 10 to 390 nm. The longer wavelength and invisible infrared radiation lies on the far side of the visible range. The wavelength range of infrared radiations is 760 to 10,000 nm. Light while interacting with chlorophyll-containing leaf surfaces behaves like small packets of energy called quanta or photons, each of which contains energy equivalent to Planck’s constant (1.58 ¥ 10–34 cal/s)

Fundamentals of Ecology

190

Table 4.1

The visible spectrum Colour

Violet

Wavelength (nm) (1 nm = 10–9 m)

*Photon energy (1 electron volt = 23.08kcal/mole of photon)

390

71.54 kcal

Blue

430–470

65.54 kcal

Blue green

470–500

62.54 kcal

Green

500–560

59.54 kcal

Yellow

560–600

53.54 kcal

Orange

600–650

47.54 kcal

Red

650–760

42.70 kcal

*Approximate values, calculated from Smith and Hana Walt (1969)

times the velocity of light (3 ¥ l010 cm/s) divided by the wavelength. Thus the energy content of a photon is inversely proportional to its wavelength. Ultra-violet radiation has damaging properties but most of it is absorbed by the ozone, which forms a distinct layer in the stratosphere. Oxygen also absorbs some of it. The ozone layer absorbs infrared radiation from 760–1200 nm also. Infrared radiation beyond 1200 nm is absorbed by water vapour, CO2 and ozone. Chlorophyll is the dominant light-absorbing pigment found in green plants. It converts photon energy into chemical energy in a process called photosynthesis. It is now known that red rays with a wavelength of 600–760 nm induce greater elongation and development of plant tissues than other visible rays. There is a minimum survival light intensity for each species of plant, below which more food substrate is burned in respiration than produced by photosynthesis. Variation in the duration of light exposure also affects plant growth. The photoperiod which is the difference in the relative duration of daylight and darkness, influences stem elongation, flowering, fruit growth and other physiological processes in plants and animals. Plants are divided into three groups depending upon the day length required for the induction of flowering: 1. Short-day plants These flower if the light exposure is for less than a critical duration of about 14 hours and the dark period is continuous, e.g. some tropical plants like Nicotiana, Chrysanthemum and Xanthium. 2. Long-day plants These require a day length of more than 14 hours, often 15 to 16 hours. 3. Day neutral plants These plants are not sensitive to day-length and bloom regardless of the photoperiod. Light is not only responsible for photosynthesis, it also plays an important role in transpiration and stomatal functioning (opening and closing). Intense light promotes a high rate of transpiration and may cause dehydration of protoplasm. Dehydration disrupts colloidal structures and many suppress photosynthesis by impairing enzyme activity. The photoperiod also affects the structure of vegetative organs, growth, germination, pigmentation, nutrition requirement and even susceptibility to parasites. In some seeds a single exposure to light may be sufficient to induce germination, while for some others many daily exposures may be required. Day

Environment in Action

191

lengths are constant with latitude in any given season and hence the photoperiod provides a reliable index of the time of year. Daylight at the equator is about 12 hours throughout the year, but as one proceeds towards the poles, it becomes progressively shorter in winter and longer in summer. Since flowering is regulated by day length, a short-day plant cannot reproduce near the equator and only in spring can long-day plants flower and reproduce near the poles. Some animals are winter breeders (short day length) whereas others are summer breeders (long day length). Light affects the developmental process in many fish and in silk moth. A strong correlation exists between the reproductive cycles of some marine animals and the lunar cycle. A biological rhythm of maximum and minimum activity may occur once or twice in every lunar month. If the rhythm occurs once in 30 days, it is called lunar and if it occurs once in 15 days, it is called semilunar. The spawning of a fish, Leuresthes tenuis, occurs in a semilunar cycle. The spawning season is from February to August in the coasts of California. The fish lays eggs in sand only on the three or four nights following each full or new moon, and spawning occurs for a one- to three-hour period immediately after high tide. Eggs develop in two weeks and hatch, and the tide washes them in again. Trouts which normally spawn in December can be induced to lay their eggs in August by artificially changing the day length. The snail, Lymnaea palustris, lays eggs in a 13½ hour-long day length and do not lay eggs in a shorter day length (11½ hour). Light affects locomotion in animals and has an effect on the eye size of marine animals. Marine animals living at a depth of 500–3,000 metres have much larger eyes than those inhabiting surface waters. 4.2.5 Bioluminescence

Biological production of light occurs in some bacteria, fungi and animals. Light production in animals is the result of chemi-luminescent reactions, in which substrate reactants are expelled outside, where the actual reactions for light production occur. This is called extracellular luminescence. In higher animals extracellular luminescence organs occur in glands which secrete outside. But in protozoa and microorganisms, the luminescence is intracellular, since the light producing granules are dispersed in the cytoplasm. Two organic compounds, lucferin and lucferase are secreted by the light gland found in many animals like Cypridina. These organic compounds react with oxygen in a water medium to produce light. luciferin + luciferase + oxygen Æ light + luciferase + inactive product This reaction occurs in water for aquatic animals. In other organisms, only oxygen is required, not water. Bioluminescence has some selective advantages for organisms living in dark places and might have some value in prey- predator relationships. We have discussed some environmental physical factors. Some important chemical factors are oxygen and carbon dioxide. 4.2.6 Oxygen as an Environmental Factor

A supply of free oxygen is necessary for most forms of life. Aerobic organisms require it for getting energy through oxidative processes. Air contains about 21% oxygen and water usually contains about 4 to 10 ml oxygen per litre. In air, oxygen is abundantly available, except at higher altitudes. Therefore in

192

Fundamentals of Ecology

high altitudes (mountains), the respiratory activity of animals is increased significantly. Mammals react strongly to this change, particularly when the partial pressure of oxygen falls below 50% of its value at sea level. Because of their high oxygen requirement, they cannot remain at high altitudes for a long time if the partial pressure of oxygen is 45% below that at sea level. Oxygen acts like a stress factor at high altitudes. Water contains dissolved oxygen, which does not combine chemically with water itself. Animals living in water utilise this dissolved oxygen for their respiration and metabolic processes. These aquatic animals have developed a variety of adaptations which help them get their required oxygen from water. In many animals the skin acts as a respiratory surface. In most of them gills are present, which are extremely vascularised. The respiratory pigment draws oxygen from water. The metabolism of some of these animals is so low that a small oxygen supply is sufficient for them. Certain species possess special respiratory pigments which help the animals get oxygen at very low partial pressure. For example, the Chironomid larvae inhabiting the muddy bottoms of ponds and lakes contain a type of haemoglobin which becomes 95% saturated under a partial pressure of oxygen equivalent to only 10 mm Hg. At this partial pressure the mammalian haemoglobin is 1% saturated. 4.2.7 Carbon Dioxide as an Environmental Factor

Air contains 0.03% of carbon dioxide, which is essential for photosynthetic activity. CO2 forms carbonic acid when mixed with water and therefore the amount of carbon dioxide present in water determines its pH. The pH of water determines the distribution of organisms. Sea water contains 3.5% salt and usually 47 ml CO2 per litre. The concentration of CO2 in water may also influence the orientation, movement and respiratory activity of organisms. At higher concentrations of CO2, the rate of respiratory movement in some molluscs and arthropods increases. Fish living in tropical swamps with water heavily charged with CO2 are found to possess a specially adapted type of blood, which is not much affected by CO2 concentration in the environment. An increase in CO2 content in the blood of animals usually causes a decrease in the oxygen carrying capacity of haemoglobin. It is now known that fish are sensitive to CO2 concentration in water. They usually choose streams containing a lower amount of CO2, given an option. 4.2.8 pH as an Environmental Factor

The hydrogen ion concentration as measured on the pH scale (0 to 14) runs from acidic to neutral to basic. A pH of 7 is considered neutral (distilled water), more than 7 (up to 14) alkaline and less than 7 (down to zero) acidic. The pH of water and soil determine the distribution of organisms. The pH of estuarine water usually varies between 7.3 and 9 and that of sea water between 8 and 9. The pH of fresh water varies from acidic to alkaline (6.5 to 10.5). Sea water is very stable with regard to pH while in estuarine water the pH may vary depending upon the relative quantities of fresh water and sea water constituting it. pH can be a deciding factor in aquatic ecosystems as regards the distribution of organisms. Large-scale industrialisation and the discharge of effluents to water bodies change the pH of water and create serious problems for fish and other aquatic organisms. Many species of earthworms are sensitive to soil pH. Their distribution in soil is dependent on soil pH conditions. For example, in European soils Lumbricus rubellus exists in soils down to pH 3.7 to 3.8, L. terrestris in soils down to pH 4.1 and occasionally lower, and Allolobophora longa in soils down to pH 4.5 (Satchell, 1967). Among tropical earthworms from India, Lampito mauritii is distributed in soils with a wide range of pH, from 5.5 to 7.5, but perionyx millardi is usually found in soils with pH of 5 to 6.5 and Octochetona surensis in soils with a pH of around 6.0. An industrial effluent either with high acidic pH or with high alkaline

Environment in Action

193

pH discharged to a water body (pond, river, lake) can bring severe disturbance in the system causing high mortality of fish and aquatic life.

4.3 TOPOGRAPHIC FACTORS These factors include the altitude, slope, exposure and direction of mountain chains, which affect climatic factors and the distribution of organisms. The altitude exerts an inJ1uence on the climate of a region, as it affects insolation, rainfall and temperature regimes and thus influences the distribution of vegetation, as discussed in Chapter 3. The absorption of solar and incident radiation is reduced at higher altitudes because the air is clearer and rarer. There is a progressive fall in air temperature as we go higher up. For every 100–270 metre rise there is a fall of 1°C in temperature up to 1,500 metres above sea level—after this the fall in temperature is more rapid. This temperature fall is more rapid on the leeward side of a mountain than on the windward side; for instance, the fall in temperature in the Nilgiri hills is 1°C for every 100 metre rise on the leeward side and 122 metre rise on the windward side. The rate of fall of temperature varies with season also. With the fall of air temperatures, soil temperatures also decrease and this affects the activity of plants. It may reduce the absorption of water and minerals. Wind action is also greater at higher altitudes. Altitude also affects rainfall, since a high land mass intercepts moisture-bearing winds. The atmospheric pressure is 760 mm Hg at sea level. The partial pressure of oxygen is approximately one-fifth (about 160 mm Hg) of the atmospheric pressure. As we climb up a mountain, the atmospheric pressure as well as the partial pressure of oxygen go on decreasing. Since oxygen is thinner at higher altitudes, it becomes a stress factor for many animals, particularly mammals. 4.3.1 Slope and Direction of Mountain Chains

The slopes of mountains have a pronounced effect on the incidence of solar radiation, rainfall, wind velocity and the temperature of the region and thus influence the climate of the area. In India, all southfacing slopes are in general exposed to more solar radiation than north-facing slopes. North-facing slopes are generally cooler than south-facing ones. It has been calculated that a slope of 10 to the north is equivalent to a 113 km shift to the north in respect of solar climate on a level surface. East- and westfacing slopes receive equal amounts of sunlight, but in the former, the angle of incidence of the sun’s rays is greatest in the morning hours when the air is cool and the dew has not fully disappeared, while in the latter the sun’s rays become scorching as the air is already heated up, causing a desiccation effect on the environment. The amount of rainfall depends upon the leeward and windward slopes. Soil erosion depends upon the availability of vegetation, and intensity and amount of rainfall on the slopes. These factors determine the vegetation pattern in mountain slopes and also the distribution of consumers. The directions of mountain chains or ranges act as wind barriers and affect the climate. Moisturebearing winds may not be able to cross a mountain range and may discharge rain near it. The far side of the mountain may not get much rain and develop into an arid zone. The Himalayas act as great barriers for moisture bearing sea winds—therefore the ocean side of the land in the northeastern region and the Gangetic delta get good rains. The absence of a high land mass may be one of the reasons for the development of desert conditions in Rajasthan. Hence mountain ranges have a significant effect on the growth of vegetation and agriculture and the distribution of animals.

Fundamentals of Ecology

194

4.4

EDAPHIC FACTORS (THE SOIL)

These factors include the structure, formation and characteristics of different soils. Soils provide mechanical anchorage to plants and hold water and mineral ions on which plants depend for their nutrition. They provide a substrate for the activities of microorganisms and animals, which may amount to about 1 tonne of biomass per hectare of garden soil. Soil is the shallow upper layer of the earth’s crust, whose initial characteristics depend upon the parent rock material and whose later development depends upon the climate, topography and vegetation. It is that part of the earth’s crust in which plants are anchored and nutrients released from dead organic matter by a variety of organisms for utilisation by plants. Soil is made up of substances existing in solid, liquid and gaseous states with colloidal particles of organic and inorganic origin. The soil contains the top soil, which may be of different colours depending upon the type of humus and mineral materials present. Roots of herbaceous plants and other small plants are also found here. The top soil is followed by the subsoil, which contains the roots of most plants, humus and minerals—the proportion of clay here is usually more than in the top soil. The subsoil is followed by loose rock and finally the bedrock (parent rock material.) Soil formation Soil is formed from the parent rock material (bedrock) by the process of physical, chemical and biological weathering. Physical weathering is caused by various climatic factors.

River currents, water and gravity produce shearing. Water and high temperature cause corrosive humidity and bring about unequal expansion and contraction of rocks, facilitating their breakdown. Rock-pulverising glaciers, low temperatures and water grid rocks. The freezing water expands in rocky crevices and breaks rocks. Wind action also causes the sculpturing of rocks. River water fragments and grinds rock chips and stones into sand and smaller forms. Chemical weathering This involves the breaking down of complex compounds by the carbonic acid present in water and by acidic substances derived from the decomposition process of organic matter is soil. The hydrogen ions of acid solutions displace the alkali (sodium and potassium) and alkaline earths (calcium and magnesium) in the silicate minerals. The main end products of the chemical weathering of rock chips, stones, etc. are silica, clay inorganic salts and hydrated oxides. Hydrolysis, hydration, oxidation and reduction are the chemical processes which bring about these changes. This weathering is considered very important, as it causes irreversible changes in rock constituents. Biological weathering involves the decomposition process by which organic materials are broken down, and leads to humification and mineralisation. Soil invertebrate animals, particularly oligochaetes and microarthropods, consume this orgaiic matter and process it in their gut, facilitating the action of microorganisms. In the process of decomposition, acidic substances are produced, which help in the weathering of rock fragments. Humus is formed and it mixes with clay, sand and silt to form soil. In the beginning it was perhaps formed in patches and helped small plants take root and grow. Then more organic matter was added to the soil, more of which was formed, leading to the formation of soil layers. 4.4.1 Soil Profile

If a soil core sample is taken and studied in the laboratory, some distinct layers can be identified. The depth and constituent parts of these layers vary within a particular soil type, as well as in different

Environment in Action

195

soil types. In general a vertical section of the soil shows three to four horizons, designated A, B, C, and D. Each horizon is further divisible into sub-horizons, which are distinct in some soils and not so distinct in some others. The development of the soil profile depends upon the climate, topography and type of vegetation. Horizons are described in the following (Fig. 4.4). Horizon A It is the top soil, very rich in organic matter content, dark in colour and of light texture, marked by intense biological activity. This horizon can be divided into five sub-horizons. A00 is the surface layer of the top soil and consists of a recently fallen litter layer comprising leaves, twigs, etc., which are undecomposed, intact and individually identifiable. The A0 layer contains partially decomposed Fig. 4.4 Soil horizons of three types of soils (see text for description) organic matter, which is in the (based on McEkevan, D.K 1968). process of losing its identity due to the decay and decomposition process. Both of these sub-horizons (A00 and A0) may not be present in some soils or may appear to be one horizon. The A1 layer is a dark layer containing abundant organic matter and abundant mineral content. The A2 layer is light coloured and may not contain many minerals. The A3 layer is a transitional layer merging with horizon B. Horizon B This horizon forms the subsoil and is made of light brown compactly arranged fine soil particles. It contains a lot of clay, organic colloids and water. Biological activities are less intense in the A horizon. This horizon is subdivided into three sub-horizons, namely B1, B2 and B3. B1 is a transitional layer between A and B. The B2 layer shows maximum accumulation of silicate, clay mineral, iron and organic matter. The B3 layer is also a transitional layer but closer to B. Horizon C This horizon is composed of gleyed layers containing accumulated CaCO3 and CaSO4. Long roots of big plants reach this horizon. Horizon D This contains parent weathered rock material without any biological activity. Horizons C and D may not be separated from each other. Very often CaCO3 and CaSO4 deposits are found in the B3 horizon, which is followed by the parent rock material (Horizon C). Therefore, rather than four horizons, sometimes only three are shown (Chapter 1). Figure 1.9 shows soil profiles.

196

Fundamentals of Ecology

4.4.2 Physical Properties of the Soils

These properties are the soil texture, soil structure, soil pore volume, permeability, penetrability, cohesion, and plasticity. Texture Soil contains particles of different sizes, which are very important for the determination of the water holding capacity and for aeration. The water holding capacity and aeration determine the type of vegetation that can grow. Mineral particles are classified as coarse sand, fine sand, silt and clay (Chapter 1). Soils contain these particles in different proportions and are accordingly classified as sandy, silty or clayey. Sandy soils contain loose particles of mica, felspar and quartz and have very little water holding capacity because they are porous and get heated up quickly during the day. Their organic matter content is usually less. Xerophytic plants like cacti, croton (Codiaeum sp.), some Euphorbias, Saccharum munja, Arundo donaxu, Festuca sativa, etc. can grow in this soil. The silt soil is further divided into three categories, namely (a) silt loam, which contains less than 50% sand, 50% silt, and less that 20% clay, (b) silty clay loam, which contains less than 30% sand, no clay and silt from 50 to 80% and (c) silty clay, which contains less than 20% sand, 50–70% silt and 30–50% clay. Silt soil has better water holding capacity, and with some humus it is good for the growth of plants. Clay soil is divided into sandy clay (sand 50–70%, silt 10–15%, clay 30–50%) and clay loam (20–50% sand, an equal amount of silt and no clay). Clay soil with more than 50% clay is very cohesive. It has the maximum water holding capacity but poor aeration. In rainy seasons, such soil becomes waterlogged while during droughts it becomes very hard. It is not good for plant growth as it is, but when mixed with sand and humus it is ideal. There is another type of soil called loam soil, which consists of sand, clay, silt and humus. It is best for plant growth, since silt and clay make it a good holder of water, sand makes it porous and humus provides nutrients. This soil is divided into (a) loamy sand with 80–85% sand, and no clay, (b) sandy loam with 50–80% sand, clay absent, and (c) sandy clay loam with 50–80% sand and 20–30% clay. Normal loam soil contains 30–50% sand, an equal amount of silt and less than 20% clay. Some soils called calcareous soils, consist of 90–100% CaCO3 and CaO and a negligible amount of humus and nutrients. Plants called Calcicoles with xerophytic features grow in this soil. Some soils are rich in sodium chloride and are called saline-alkali soils—they support xerophytic vegetation called halophytes. Soil structure and composition Soil contains organic and inorganic colloids, electorlytes, organic matter, soil organisms, and so on. Some soils are well drained while others are not. Similarly, some get easily aggregated while others do not.

Soil contains sand, clay and silt in definite proportions, as discussed under soil texture. Beside soil particles, the soil contains mineral nutrients which are important for plant metabolism and growth. These elements are also essential for maintaining the osmotic balance and absorbing ions from soil solutions. They are divided into two groups: 1. Macroelements or macronutrients which are required in large amounts and include carbon, hydrogen, oxygen, calcium, nitrogen, phosphorus, sulphur and magnesium. The plant cell wall and cell membranes are made up of carbon, hydrogen, oxygen and calcium. Plant proteins contain nitrogen, phosphorus and sulphur, and chlorophyll contains magnesium. 2. Microelements or micronutrients, which are required in small quantities but often play a regulative role in development, metabolic functions and enzymatic action. These are potassium, iron, manganese, zinc, boron and molybdenum: Potassium increases resistance to plant diseases and is regulatory in function. Manganese is required for the synthesis of chlorophyll, and zinc for the

Environment in Action

197

formation of auxin. Boron affects plant growth and molybdenum is required for nitrogen metabolism in higher plants. Soil also contains organic matter and humus. These organic substances increase soil fertility and act as a food substrate for microorganisms and soil animals. Humus is the dark amorphous portion of the organic matter which has lost its structure through decomposition. Partially decomposed organic matter is sometimes called raw humus and a thick layer of dark amorphous organic matter is called duff or mor, which is very distinct and does not mix with mineral soil. Humus may mix intimately with mineral soil, in which case it is called mull humus or mull soil. Some of the general properties of humus are: 1. Colloidal—containing mineral nutrients and auxins. 2. pH is usually on the acidic side but can be different in mull soils. Due to its acidic nature it combines with soil bases and prevents the leaching of base salts. 3. It is soft, porous and increases aeration of the soil. 4. Its carbon-to-nitrogen ratio varies, which indicates the degree of its incorporation into the soil. In some soils like peats and bogs, the humus content is very high, sometimes approaching 100%. Soils with good organic matter content support growth of different types of plants and luxuriant vegetation. Soil Water Plants absorb water containing organic nutrients and minerals from the soil through their roots. The amount of soil water available to plants depends upon the type and properties of the soil.

The source of soil water is rain, which percolates downwards, penetrates into the deeper layers of the soil and gets absorbed by roots. Rainfall, water percolation and penetration and some other factors control soil moisture and ground water levels. The water table contains free water, having sufficient space for its movement and is usually underlain by a rock stratum. The slope determines the depth of the water table. The water surface is located deeper at the top of the slope and nearer to the surface of the slope lower down, and may emerge as a spring dissecting the slope. In a flat land without a discharge point, the soil may be saturated with water up to the surface. The water table can rise up by capillary action to the upper strata of soil. The capillary fringe lies above the water table and is defined as that part of the soil to which water can rise from the water table. The rising of water depends upon soil texture and structure. For example, the capillary fringe may be about 3 metres for clay soils and zero for gravel. Sandy and other types of soils have capillary fringes, between zero and 3 metres. The soil moisture zone above this fringe is called the aeration zone and its moisture content is determined by field capacity, which is defined as the amount of water retained in the soil after the draining of water by gravitational pull. Clayey soils have higher field capacity than other soils, due to greater capillary porosity. Field capacity can be measured by saturating a soil sample and allowing it to drain down for two day without evaporation. The moisture content is determined by the oven dry weight, which gives the field capacity value. Hydroscopic or imbibitional water is the water held in the form of a very thin film around the surface of soil colloids and particles. Capillary water refers to the water held in the capillary pores of the soil, retained against the gravitational force due to adhesion and cohesion. The water holding capacity of soil refers to the total moisture retained due to field capacity, hydroscopic water and capillary water. This can be measured by tensiometers and pressure membranes, which work on the principle of moisture flow equilibrium between a wet porous cup and the surrounding soil in which the cup is buried. Nylon, fibreglass or gypsum blocks with electrodes are used and the electrical conductance of the soil is measured. Variations

198

Fundamentals of Ecology

in moisture content change the electrical conductance of soils. Neutron probes are used now-a-days to determine the soil moisture content. In another simple method, small circular boxes with perforated bottoms are filled with soil and allowed to get thoroughly saturated with water. The soil filled boxes are kept in a bigger container with water, which then enters from below. Excess water is subsequently allowed to drain out and the moisture content is determined by the oven-dry method. Gravitational water is the water present in soil pores of non-capillary sizes (pores of diameter larger than 0.05 mm). This usually drains out if the underlying strata are permeable. Water drained down to the deeper layers due to the gravitational pull and stored as ground water is usually not available to plants. The amount of water available to plant roots for absorption is called chresard, while the total amount of moisture available in the soil is called holard. Another convenient and useful method of expressing soil moisture is by the logarithm of capillary potential or pF on a 0-to-7 scale for the entire range of moisture levels. A pF of 0 refers to a water saturated soil and one of 7 to an oven-dry condition. pF = 2.7 represents the level at moisture equivalent, which is defined as the percentage of water that a saturated soil can hold against a centrifugal force equal to 1000 times gravity for half an hour. pF = 4.2 represents the permanent wilting percentage and pF = 5.5 represents the air-dry level. At the same pF, the actual moisture content is higher in a clayey soil than in a sandy soil. Sometimes the soil cannot supply water to plants at a sufficient rate to maintain turgor, and the plants wilt. The permanent wilting point refers to that soil moisture content at which the soil cannot supply enough water to plants to maintain turgor and the wilting coefficient refers to the percentage of water which remains in the soil when permanent wilting is attained. Soil water forms the lifeline of soil organisms and exerts an influence on plants. A good growth of microorganisms and soil invertebrate populations occurs in soils containing adequate moisture. In dry soils their populations density is usually reduced and many of them produce spores, cysts, and so on. Water is the solvent for organic nutrients and minerals in soil and therefore its content regulates the physiological, morphological and anatomical features of plants. The greater development of sclerenchyma, xylem tissue and phloem tissue in xerophytes is due to water scarcity. Soil air, found in soil pores, contains a greater amount of CO2 than atmospheric air. It also contains oxygen. The oxygen and nitrogen ratio is the same as that of atmospheric air. However, the relative proportion of CO2, O2 and nitrogen differs from soil layer to layer, depending upon the availability of pore space. Soil air circulation depends upon diffusion. It is an important edaphic factor which determines the types of microorganisms, soil animals and vegetation that grow in the soil. It affects crop growth and brings about morphological, physiological and anatomical changes in plants and animals. Soil temperature is also important in affecting the distribution and growth of microorganisms, animals and plants. There are seasonal, altitudinal and latitudinal variations in soil temperature. The soil temperature influences root growth, the ability of roots to absorb nutrients, and the movement of organisms. Pore Volume We have already discussed capillary and non-capillary pore spaces, which contain air and water. In any good soil, both types of pores and their volumes should be equally represented. Some other physical properties of the soil are permeability, which refers to the infiltration capacity of soils, penetrability, which refers to the cementation of soil on drying, cohesion, which refers to the surface tension of a water film in soil, and plasticity, which refers to the resistance of soils to deformation.

Environment in Action

199

4.4.3 Chemical Properties

Soil solutes are partly organic and partly inorganic compounds, usually soluble in water. The sources of these solutes are organic matter, parent rock and chemical reactions that occur around soil roots. The substances are usually in the form of bicarbonates, nitrites, nitrates, chlorides and sulphates of sodium, potassium, calcium, iron, aluminium and boron. The colloidal particles of both clay and organic matter behave like acid radicals. The total capacity of soil colloids to hold cations is called the cation exchange capacity and is expressed as milliequivalents per 100 grams of soil. The cation exchange material reflects the mineral fertility of the soil, since the cations are contained in a form in which they are easily leached out by water and available to plant roots. Acids formed by the water and CO2 present in the soil exchange their hydrogen for bases from the exchange complex and combine with liberated acid radicals to form soluble bicarbonates, which are absorbed by plant roots. The presence of organic matter in soil helps to improve the base exchange capacity, which determines fertiliser application. Among the cations, calcium is most abundant in soils. Its quantity may be twice that of potassium, sodium or magnesium. Soils containing large amounts of bases are either alkaline or neutral and those containing predominantly hydrogen ions are acidic. Calcium has greater replacing power on soil colloids than magnesium, potassium and sodium. Hence flocculation of clay colloids is favoured by the strongly absorbed calcium cations, which give stability by forming good crumb soils. But soils saturated with sodium cations remain deflocculated and are not stable. The osmotic pressure of the soil solution also plays an important role in the absorption of nutrients by plants. In India, acidic soils (pH 4–5.9) favour the growth of Quercus dilatata while soils which are slightly acidic (pH 6 to 6.5) favour Cedrus deodara forests. Betula alnoides, Acer caesium and Rhododendron arboreum plants also grow well in acidic soils. Acidic soils are deficient in calcium and magnesium. Plants like Tainarix diocia and Tamarix aphylla increase soil alkalinity. Highly acidic soils are harmful to beneficial soil animals such as earthworms, and check the activity of ammonifying and nitrifying bacteria, thus blocking nitrate formation and reducing soil fertility. In general, plants do not grow well in highly acidic soils. Some plants can grow well in neutral, alkaline and acidic soils. These are Casuarina equisetfolia, Lantana camara, Bauhinia vahlii and some others. Dalbergia sissoo grows luxuriantly in neutral conditions and can grow well in slightly acidic and slightly alkaline soils. Highly acidic soils can be reclaimed by adding carbonates of calcium or magnesium or both, by adjustment of the base exchange capacity by adding organic material, or by liming (adding fine power of limestone or dolomite). Highly alkaline or saline soils are also devoid of vegetation, and are highly unproductive. These soils are formed because of the presence of an impervious subsoil, which restricts the downward movement of water and enhances the accumulation of soluble salts in the upper layers. Besides, salts are accumulated in the soil if the water table is high and the topography is basin shaped. They are reclaimed by adding gypsum (CaSO4), because sulphur converts sodium and potassium carbonates into sulphates and thus lowers the pH: The addition of organic matter also helps, since it increases the nitrogen status in the soil and changes the soil structure. The drainage system can be improved so that salts are leached down to greater depths. Plants which can grow in alkaline soils should be planted so that they can use the salt content of the soil. These plants are Acacia, Tamarix, Zizyphus, Prosopis, and so on. Some salt tolerant herbs like Chenopodium album and Beta vulgaris can also be grown for the reclamation of these soils.

Fundamentals of Ecology

200 4.4.4 Soil Organisms

Soil organisms (Table 4.2 and Figure 4.5) include microorganisms, such as bacteria, actinomycetes, fungi and algae, and soil animals, such as protozoa, helminth worms, nematodes, annelid worms (enchytraeids and earthworms), collembola, mites, insects and their larval forms, pupae, arachnids, other arthropoda, gastropods, etc. Some mammals and birds use the soil for various purposes. They play an important role in determining the physical and chemical properties of soil, soil fertility and so on. Earthworms and termites play a significant role in soil formation. Earthworms may burrow 2 m into the soil, make numerous transverse burrows and produce wormcasts by eating the soil and soil organic matter. These casts are very rich in nitrogen and mineral substances and increase soil fertility. The burrows facilitate aeration and increase water-holding capacity. Dash and Patra (1979) measured 77 tonnes of dry weight of earthworm cast production per hectare per year in an Indian grassland site. Edwards and Lofty (1972) have estimated that earthworm cast production ranges from 2 to 247 tonnes per hectare per year in different world sites. This is equivalent to bringing up layers of soils between 1 and 5-cm-thick to the surface every year. In addition, a large amount of soil is deposited in burrows as casts. Thus, the soil turnover provides a stone-free layer about 15 cm deep on the surface. Earthworm Table 4.2

Soil fauna diversity in India

Taxa

Echiura Chilopoda

Total no. of species

Endemic species

Geographical distribution

(World)

(India)

127

43

12

Coastal areas

3,000

156

NA

South India, N.E. India, Mumbai, Gujarat, Bihar, UP, HP and Orissa.

Diplopoda

7,500

162

NA

Orthoptera

17,250

1,750

200

Dermoptera

2,000

320

—

Almost all over India

Embioptera

200

33

14

Discontinuous distribution Himalayas, Gangetic plains, Barkuda Island, Eastern Ghats, Western Ghats).

2,000

253

170

Almost entire India

Hemiptera

NA

6,500

1,335

Neuroptera

5,000

335

262

Coleoptera

8,00,000

15,500

3,113

Mecoptera

350

15

—

Isoptera

Diptera

1,00,000

6,093

2,132

Trichoptera

7,000

812

649

Annelida

12,000

1,000

—

Source: ZSI, Kolkata and other sources.

Almost entire India

Restricted distribution: Eastern Himalayas, Western Himalayas, Peninsular India. Himalaya, Desert, Peninsular India, Insular ecosystem Widespread distribution Eastern India, UP, Maharashtra Widespread Himalayan and Peninsular India. Widespread

Fig. 4.5

Food Web in a Decomposer Community (After Dindal, 1990)

Environment in Action

201

202

Fundamentals of Ecology

casts contain more water-soluble aggregates than the surrounding soils (Nijhawan and Kanwar, 1952, Guild, 1955). A soil rich in aggregates remains well aerated and drained. Soil aggregate formation is of immense importance to soil fertility. An increased amount of nitrogen has been reported in soils where earthworms had been reared or were present in large numbers. This increase in the amount of nitrogen may be due to the decay of bodies of dead soil animals, due to nephridian excretion by earthworms or by mucus secretion. It has been estimated that the body of a single adult dead earthworm can yield as much as 30 mg of nitrogen. On the basis of this estimate, a population of 2 million earthworms per hectare in a tropical grassland would yield the equivalent of about 60 kg of nitrogen per hectare (Dash, 1978). The C/N (carbon/ nitrogen) ratio of freshly fallen litter is around 25 for elm, 28 for ash, 38:1 for lime, 42:1 for oak, 44:1 for birch, 54:1 for rown and 91 for Scots pine (Wittich, 1953). Plants cannot assimilate mineral nitrogen from soil unless the C/N ratio is of the order of 20 or less. Earthworm activity brings down the C/N ratio in the soil (Table 4.3, 4.4 and 4.5). Table 4.3

Relationships between decomposition and major ecosystem processes

Table 4.4

Relationships between soil invertebrate behaviour and soil physical process

Environment in Action

Table 4.5

203

Influences of soil biota on soil processes in the ecosystem. Nutrient cycling

Soil structure

Microflora

Catabolise organic matter, mineralise and immobilise nutrients in aggregates

Produce organic compounds that binds agreements, Hyphae entangle particles unto aggregates

Microfauna

Regulate bacterial and fungal populations after nutrient turnover

May affect aggregate structure through interactions with microflora

Mesofauna

Regulate fungal and microfaunal populations, alter nutrient turnover, fragment plant residues

Produce faecal pellets, create biopores, promote humification

Macrofauna

Fragment plant residues, stimulate microbial activity, redistribute organic matter and micro-organisms

Mix organic and mineral particles, create biopores, promote humification, produce fecal pellets

Dash (1978) has reported that under laboratory conditions, earthworms are able to bring down the C/N ratio of the soil from about 22 to 15 within 25 days. Their feeding activity is enormous. Satchell (1967) calculated that a temperate deciduous woodland had a leaf fall of 3 tonnes/ha/year and earthworms consumed it in about 3 months (27 g of leaf litter per day). They are the most important soil animals in fragmenting and incorporating forest litter in soil in the tropical forests of Nigeria (Madge, 1966). Soil organisms disturb the soil, modify its structure, increase its fertility, form soil aggregations, help in the formation of humus and so on. Nitrogen-fixing bacteria and blue-green algae fix atmospheric nitrogen and increase soil Fig. 4.6 Major Biological Systems of Regulations in Soil fertility. All these organisms help in (Lavelle, 1984) the maintenance of nutrient cycles in the soil (Figs 4.5 and 4.6). Microbes form a vibrant living community in the soil contributing to a number of nutrient transformations and ecosystem functioning. They are involved in organic matter decomposition, N2-fixation, solubilisation and immobilisation of several major and minor nutrients (Alexander, 1971). Microorganisms play important role in soil structure maintenance, plant growth promotion through secretion of hormones and soil-borne disease control. The diversity and richness of soil microorganisms are huge and subject of interests to scientists over the years. But till today, much is yet to be is known on the complex living biota in the soil and their biophysical, biochemical functions and interactions in the soil ecosystem. But during the last 50 years, many beneficial effects of microbes in temperate and tropical soils have been discovered. We have been making use of microbes for improving productivity in agriculture, industry and pharmaceuticals, and they are used in biotechnology. With growing awareness on agro biodiversity conservation and management, interest has emerged on understanding soil microbial and faunal biodiversity.

Fundamentals of Ecology

204

Microbial Diversity One cubic meter of soil may house many hundreds of species of bacteria, actinomycetes, fungi and algae. The distribution of microorganisms in a typical soil profile is given in Table 4.6. The numerical dominance of bacteria is evident from this table. In terms of significance, each group has its unique contribution to the nutrient cycles and in the food chain and as source of useful chemicals like antibiotics, vitamins and enzymes. Table 4.6

Distribution of microorganisms in various horizons of the soil profile Organisms/g of soil (x 103)

Depth (cm)

Aerobic bacteria

Anaerobic bacteria

Actinomycetes

Fungi

Algae 25

3–8

7,800

1,950

2,080

119

20–25

1,800

379

245

50

5

35–40

472

98

49

14

0.5

65–75

10

1

5

6

0.1

135–145

1

0.4

–

3

–

Source: Alexander (1971)

The estimated and described number of species of bacteria, fungi, algae and viruses are described in Table 4.7. Compared to number of estimated species, the described number of species are few. The data indicate the dominance of fungi in the estimated and described species. Table 4.7

The estimated and described numbers of species of different groups of microorganisms Number of species

Group Algae Bacteria Fungi

Estimated 60,000

Described

Per cent of total estimated

40,000

67

30,000

3,000

10

15,00,000

69,000

Viruses

1,30,000

5,000

Protozoa

1,00,000

30,000

4.6 3.84 30

Source: Hawksworth and Mound (1991).

Two parameters are considered important while evaluating the significance of microorganisms in soil, i.e. abundance and diversity. While abundance may increase or decrease over short periods of time in response to management practices and inputs, diversity is a more complex attribute and reflects a state of quasi equilibrium. Diversity is more important for understanding the functional significance of microorganisms at any site. High variation can be found in abundance between different soil types, seasons and land use patterns. Microbial biomass is often used as a more reliable parameter to assess abundance and their importance in soil. The population and biomass levels of major groups of organisms in a typical soil profile (0–25 cm) are given Table 4.8 and 4.9.

Environment in Action

Table 4.8

205

Number of soil microorganisms in cultivated soils of high fertility Abundance (no./g)

Live biomass (kg/ha)

Bacteria

Group

104–109

300–3,000

Actinomycetes

8

10 –10

800–1,600

Fungi

104–106

500–5,000

Algae

10 –10

7–300

Protozoa

104–105

50–200

5

2

4

Source: Miller (1990).

Table 4.9

Distribution of microorganisms in arid soils of Western Rajasthan, India in relation to rainfall

Organism

Population in different soils (No./g dry soil) Jaisalmer (90 mm)

Barmer (120 mm)

Jodhpur (270 mm)

Pali (400 mm)

Bacteria (¥ 105)

0.22

0.75

12.10

32.67

Fungi (¥ 103)

0.20

3.50

6.80

33.00

Actinomycetes (¥10 )

0.04

0.90

48.30

122.70

Azotobacter (¥ 103)

0.01

0.28

3.90

110.00

Nitrosomonas (¥ 102)

0.02

1.10

2.00

5.40

4

Source: Rao and Venkateswarlu (1985)

4.5

BIOTIC FACTORS

All organisms in the ecosystem also interact among themselves. Some of these interactions occur between the individuals of a species population (intraspecific) and some between different species populations (inter specific). Some of these interactions or associations are favourable to both interacting populations, some may be favourable to one species population and not to the other, and so on. All these interactions form the biotic factors. Symbiosis This is an association of two different species for mutual benefit. The two species depend metabolically upon each other. The participating species are called symbionts. Example 1

Woodroaches and termites, which eat wood, harbour certain species of flagellate protozoa in their gut. Although woodroaches and termites eat wood they cannot digest the cellulose present in it, since they do not have cellulase enzyme in their guts. The flagellates secrete cellulase and hydrolyse cellulose to glucose, which is utilised by woodroaches and termites. Besides, the flagellates ferment the glucose to acetic acid, CO2 and hydrogen. These substances only nourish the flagellates, and the acetic acid is absorbed by the tissues of termites and woodroaches and used up in respiratory metabolism.

Example 2 Similar relationships exist between ruminants (cattle, sheep and deer) and protozoan ciliates which inhabit their rumen. Ciliates perform the same function as flagellates do in the gut of termites.

206

Fundamentals of Ecology

Example 3 Some aquatic animals, such as hydra, sea anemones, jellyfish and corals, harbour dinoflagel-

lates in their body. The animals provide carbon dioxide (as a respiratory byproduct) to the dinoflagellates (containing chlorophyll) for photosynthesis, which in their turn produce growth stimulating factors for marine animals. In this relationship both partners benefit. Example 4 A symbiotic relationship exists between Rhizobium bacteria and leguminous root. The bacteria get protective space to live in and derive readymade food from the leguminous roots. The legumes on their part receive fixed nitrogen in usable form to manufacture protein. Example 5

Several tree roots get infested with fungal hyphae either on the surface (ectotrophic) or inside, between the cells of roots (endotrophic). The fungi get their food from the roots of the trees and in turn supply water and minerals, which they absorb from the soil, to them. This association is called mycorrhizal association, a form of symbiosis. Such associations between fungi and some conifer roots have been found to be essential for the successful growth of conifers.

Commensalism In this association, one species is benefitted while the other is not harmed (either benefitted or remains neutral). The physiological dependence is minimal to nil. The participating members are called commensals and this association is called commensalism. It can be of different types, namely ectocommensalism, endocommensalism and inquilism. Example 1 The relationship between the hermit crab and the sea anemone is an example of ectocommensalism. The crab uses the gastropod (mollusc) shell as a portable shield and the sea anemone remains primarily attached to the crab or gastropod shell. The sea anemone eats the leftover food of the crab, which is protected from its predators by the stinging cells of the sea anemone. The sea anemone is called the ectocommensal and the crab the substrate organism. Example 2

In endocommensalism, the commensal resides within the substrate organism. The primary source of nutrition of the commensal is the food material accumulated by the substrate organism. Opalina, a ciliated protozoa, occurs in the intestine of toads, which are the substrate organisms. Opalina is the endocommensal. There is no damage to the toad, although Opalina is benefitted.

Example 3

Inquilinism is a special type of commensalism in which one organism, called the inquiline, shares the nest or burrow of another. This is common in terrestrial insects and marine animals. The crab, Scleroplax sp. dwells in the burrow of the shrimp (Callianassa) without causing damage to it.

Example 4

Some algae and fungi join together to form another life form, called lichens. The algae manufactures food through photosynthesis, which the fungi utilise. The fungus protects the algae from drying up and both organisms together colonise tree barks, rocks, and so on. This is called mutualism, a type of commensalism.

Parasitism This association involves two different species (a parasite and a host)—one organism (the parasite) is benefitted while the other (host) is harmed. The parasite gets its nutritional requirements from the host and often causes harm to it. The well adapted parasite devours just enough of its host’s body or resources to meet its requirements, since killing the host would ultimately endanger its own survival. As Charles Elton put it, a parasite lives on the host’s income while a predator lives on the host’s capital. Parasites usually devastate and this devastation regulates the population levels of plants and animals. Some of them reside temporarily or permanently on the host’s body surface and may penetrate its body

Environment in Action

207

tissue to derive their nutritional requirements. These are called ectoparasites (e.g. bed bugs, fleas, mosquitoes). The hosts are animals and man. Some other parasites, called endoparasites, spend at least part of their life cycle within the host’s body, e.g. the malarial parasite (Plasmodium), roundworm, tape worm, etc. Some parasites are called facultative parasites because they can live as parasites as well as free living organisns (e.g. larvae of nematodes or certain flies of the genus Chrysomya and Calliphora, which can have a free living existence in decomposing organic matter, or as endoparasites in the body of some animals). Some parasites are called obligate parasites, because they cannot live outside the host’s body. They may have more than one host. The above descriptions mainly include animal-animal parasitic associations. Parasitic relationships can also be between plants and plants, and plants and fungi. Common angiospermic parasites are Cuscuta, Orobanche, Balanophora and Striga. Cuscuta is a stem parasite. Its stem twines around a large variety of hosts and pierces their tissues by haustoria. Orobanche, Balanophora and Striga are root parasites Orobanche affects the yield of mustard and brinjal, and is parasitic to the roots of Solanaceae, Cruciferae, and Gramineae plants. Fungi, such as rusts and smuts, are parasitic to many crop plants and reduce their production. Some are obligate parasites because they cannot live without their hosts. Some others can live as saprophytes in the absence of hosts and are therefore termed facultative saprophytes. Epiphytism Epiphytism is another type of biotic association. Epiphytes grow on other plants but do not derive their food from them. They are common in tropical and subtropical humid climates and get their moisture and nutritional requirements from rain. Besides, they store water in their special root tissue, called velamen. Plants belonging to the families Bromeliaceae, Dischidia (Asclepiadaceae) and some species of Ficus orchids, lichens and mosses are epiphytes. Lianas are woody plants which have roots in the ground but climb up with the support of other trees and reach the top of the canopy. They do not derive their nutrition from these trees, but require their support for climbing up.

There are some other types of plant and animal relationships which are considered important factors in regulating their populations. Carnivorous plants Plants like Utricularia, Drosera, Dionaea and Nepenthes are common insectivorous plants. They have specialised structures to trap insects, and usually digest the soft parts by their enzymes. Nepenthes, the pitcher plant, which is common in the forests of Assam and Orissa, has a folded leaf lamina modified into a pitcher-like structure with a lid, which regulates the entry and exit of small insects. Utricularia is an aquatic insectivorous plant containing bladders, which are part of leaves. Zooplankton entering the bladder get trapped and digested. In Drosera and Dionaea, the leaves are covered with hairs and tentacles. Small insects get entangled within structures and are digested. Competition Competition occurs between individuals of the same species and between different species of plants to obtain water, light, mineral nutrients, and so on in a forest or grassland ecosystem. These are respectively termed intraspecific and interspecific competitions. They occur in animals also. These associations have been discussed in detail in Chapter 6. Pollination, seed and fruit dispersal Most seed plants depend upon butterflies, wasps, moths, beetles, etc. for the transfer of their pollen to the stigma. Many higher animals are also involved in this process. Recent works indicate that there is a strong relationship between some plants or flowers and some specific pollinating insects. Were it not for pollinating animals, pollination would not have occurred in many plants and seeds would not have been formed. Many animals, such as reptiles, birds and mammals,

208

Fundamentals of Ecology

including man, help in the dispersal of seeds. They may carry fruits over long distances, eat the fleshy parts and throw the seeds, thus helping in their dispersal. Seeds or fruits of Xanthium, Achyranthes, etc. bear hooks which get attached to the body of grazing mammals and get dispersed. Grazing and scraping as biotic Factors In grasslands and forests, grazing by cattle and wild herbiovers has a significant effect on the composition, structure and physiognomy of the vegetation. Heavy grazing reduces photosynthetic parts more rapidly than the rate of replacement and hence severely affects plant composition. Some plants are resistant to grazing or are not preferred by grazers while some others are consumed more. Another indirect effect of grazing is on soil erosion. The decreased shoot cover ultimately affects root growth and exposes the soil surface to. erosion due to rain and runoff water. In a pasture with Cynodon dactylon and Eragrostis amabilis as dominant grass species, Senapati and Dash (1981) found that a grazing pressure of 1.3 livestock/acre caused the accumulation of a higher proportion of plant biomass (68%) underground compared to 46% in an ungrazed (protected) pasture. Plant diversity was more in the grazed plot and about 18% of NP was removed by grazing. Grazing stimulated higher secondary production by soil invertebrate animals, particularly oligochaetes, but it also increased mortality due to hoof action and trampling.

Ambasht (1974) has pointed out that grazing involves the large scale consumption of seeds, due to their high nutritive value, which results in poor successive crops, unless the plants adapt to vegetative propagation. Rats selectively remove seeds from grasses and store them in their burrows in large quantities. Man acts as a biotic agent by helping in the dispersal of seeds and fruits and introducing new plants. He also causes deforestation and afforestation, removes litter and wood, and introduces pollutants. Forest fires Forest fires occur mainly due to the activities of man but sometimes by lightning or friction between trees close by, due to their constant rubbing together or strilcing. This is common in coniferous forests. Man bums forests for habitation, for agriculture, for the construction of roads, to improve the quality of forage, to bum litter, or due to carelessness. Forest fires maybe (i) Ground fires, which are usually due to the burning, of litter and organic matter. This type of fire is dangerous as it destroys the entire forest, although trees with thick barks and barked roots may survive. (ii) Surface fires, which are caused by fallen twigs and leaves, and have distinct flames unlike ground fires. Such fires usually destroy ground flora and the bases of trees rapidly. (iii) Crown fires, which may occur in densely populated forests. The tree tops catch fire, which spreads from crown to crown and can destroy the entire tree and forest.

Forest fires destroy valuable organic matter containing organic carbon and nitrogen. Sometimes the burning of undecomposed litter provides ash and permits seedlings access to mineral soil, thus helping in their growth. Fires may help regeneration by providing a good seed bed. They also burn weeds and therefore restrict the competition for seeds of useful plants. In Orissa, people usually burn litter in summer to get a better produce of Kendu leaves (Diospyros melanoxylon) used for the preparation of local cigarettes (bidis). Burning changes the composition of trees and affects the climate (forests intercept rain, provides humus and organic matter and control the temperature regime; the dense canopy does not allow sun rays to strike the ground directly and provides shade). Trees in forests susceptible to fires develop a fireresistant bark and foliage. In the Australian Eucalyptus, a tubular swelling called

Environment in Action

209

lignotuber develops near the tree base after the crown is lost in a fire. This tuber bears latent buds which sprout into new shoots after the fire. Fire is an important ecological factor for various reasons. Used in a controlled way, it can be utilised to burn raw humus to produce ash. This practice can raise the pH value of the soil. Fire is used to burn undesirable organic debris, which harbours parasitic fungi and bacteria. Sometimes controlled burning is necessary to clear old forests for new plantations. Fire-tolerant, economically valuable species of trees are grown with fire-sensitive plants—controlled burning helps burn the latter and allows the farmer to grow better due to added minerals and reduced competition. Likewise, controlled fires at regular intervals can be used to. eliminate useless shrubs and promote the luxuriant growth of fire-tolerant forage grasses, such as Cynodon and Cenchrus.

4.6

CO-EVOLUTION

The term co-evolution was first introduced by Erlich and Raven in 1964 white describing the relationship between caterpillars and the host food plants. Coevolution was considered as a subset of a broader general evolutionary relationships, called community evolution between species in communities, where genetic information exchange between different species is absent or minimum. Co-evolution is defined as the evolutionary relationships that occur between two or more species in response to the evolutionary pressures they exert on each other. A pair-wise or one-on-one co-evolution occurs if only two species are involved which are ecologically very closely associated. The two species evolve in response to the each other’s evolutionary requirement. One species evolves particular characteristics and the other species then evolves compatible characteristics in response to this. The first species, in turn, then evolves characteristics in response to the second and so on. Examples of such relationships are butterfly caterpillars and their host plants, bees and the plants they pollinate and ants residing on acacia trees. A diffuse co-evolution is one where more than two species co-evolve together. Examples of diffuse co-evolution include mammalian grazers and grassland plants, predators and prey relationships. Co-evolutionary relationships can be mutualistic if the species benefit from the association as in case of symbiosis. Such extreme close association leads to complex inter-connected lifecycles wherein both species cannot survive without the other. However, co-evolutionary relationships can be antagonistic, where one species has a harmful effect on the other, for example, a predator on its prey or a parasite in a host. Such antagonistic relationship leads to a phenomenon called arms race, a term used to describe the counteracting characteristic that one species develops to negate the deleterious effect of the other species. The characteristics that evolve can be chemicals in forms of poisons or antitoxins or they may be mechanical such as stronger claws or spines. A pair wise co-evolution involves step by step change in two species and such species need to be associated in the same community for a span of time that allows evolution to occur. Thus it requires certain stability in the community. Because tropical ecosystems have highest species diversity (greater stability), therefore, they are the areas where there is the highest occurrence of co-evolved species. Poisonous and distasteful animals are very often brightly colored like bees, wasps etc. The bright coloration is a kind of warning to the predators not to eat them. Sometimes two different species have

210

Fundamentals of Ecology

same color patterns in one geographical area. For example, two poisonous butterflies species of Amazon basin, viz. Heliconius erato and Heliconius melpomene belonging to one geographical area have similar wing patterns. This convergence of patterning in poisonous insects is called Mullerian mimicry. Because of the same wing patterns the birds only have to learn one wing pattern to associate it with distastefulness and hence they kill fewer insects and hence the insects benefit. The birds also benefit in a way that they catch fewer poisonous insects in learning what to avoid. The effect is so conspicuous in tropics that the same species of butterfly can look completely different in different areas of forest if the warning patterns are different in the two areas. Insects, which are not harmful and are edible, converge on warning coloration, using it as a disguise to evade predation. This is called Batesian mimicry. Batesian mimics are in an advantageous position till the population of poisonous animals, which the mimics resemble, remains high in the area and thus they are protected from predation. The ant-acacia co-evolution Ants as a group form many mutualistic relationships with plants. Janzen in 1966 was the first to describe the features of one-to-one co-evolution between acacia and ants. One common example of such relationship is the association between the ant species Pseudomyrmex ferruginea and the tree Acacia cornigera.

The queen ant locates a young acacia seedling that has not been colonized previously. Acacia, during their growth produce swollen stipules at the bases of leaves. The queen initially cuts a hole in the swollen stipule and takes out the parenchyma leaving a hollow cavity where she ultimately deposits her eggs. The tree also provides food by secreting nectars from foliar nectaries and from modified tips of leaves called Beltian bodies, which are rich in proteins and lipids. The colony of ants grows rapidly and as many as 30,000 worker ants may stay in a single acacia tree within three years of colonization. These workers start attacking insects and other acacia-eating herbivores. Moreover they clear areas around the tree of any other plants. In the absence of ants, acacia will be over run by leaf-eating insects and their survival will be at stake. These acacias do not produce chemicals, which can be poisonous to grazers. Thus, presence of ant colony in these acacias (called ant acacias) helps protect the plants. This association is profitable to them that instead of producing structurally and biochemically expensive protective mechanisms, they divert the energy for growth. Besides, due to ant association, these acacias are able to compete favourably in denser and wetter habitats than other acacias, which have not coevolved with ants (Chapman and Reiss, 1992). Chapman and Reiss (1992) have described diffuse co-evolution where more than two species are involved. In a biotic community all species interact in some form or other. Herbivores graze a variety of plants and in general plants have developed mechanisms like development of thorns, tough leaves, distasteful chemicals and toxins to reduce or avoid herbivore grazing pressure. An insect herbivore species feeding on many plants might have to evolve tolerance to a number of different food sources. Diffuse co-evolution, as in pair-wise co-evolution, can be mutualistic or antagonistic. They have narrated that Dinosaurs were the most diverse and dominant group of consumers in mesozoic. They had adapted to a wide range of life styles: aquatic (fresh water and marine), flying, terrestrial etc., and herbivory and carnivory. Dinosaurs became extinct by the end of cretaceous. During cretaceous a group of unspecialized mammals mainly living in trees were present. But these mammals diversified in early tertiary and occupied aquatic, terrestrial, caves and aerial habitats. Their food habits ranged from herbivory, scavenging to carnivory to predation of living animals.

Environment in Action

211

During tertiary, the temperate regions became coolers and drier, and the vegetation cover gradually changed from forests to grasslands. Herbivores started eating grasses instead of leaves of trees. With the change in vegetation pattern, the mammals had to move from forest areas to grassland areas and faced predation problem more intensely. In forests, herbivores used to avoid predators hiding under dense tree cover and in grasslands this was not possible. Agility and fast running became essential. The predators which largely depended on ambush and stealth in the forests had to change the hunting technique of running, chasing the prey. Besides, group hunting became more profitable than solitary hunting as the herbivores of the plains increased in size. Many herbivore species also lived in groups. The group or pack hunters were the wild dogs, hyenas, wolves and lions. Cheetah, leopards and tigers are usually solitary hunters. These necessities resulted in evolutionary changes both in herbivores and carnivores. Many of the bodily changes that occurred in both herbivores and carnivores were identical as the purpose was to increase running ability. The limbs became longer and thinner, toe bones shortened, tendency for loss or reduction of outside toes, especially in herbivores, and bones (metatarsals) behind the toes lengthened to add length to the legs. Limb joint movements became restricted and thus the agility in paws and limbs was reduced except for running movements (Bakker, 1983). However the agility in paws and limbs of carnivores was not reduced as the paws are required to grip prey while catching, holding, killing and eating it, and the paws are also used for digging dens. The ratio of length of metatarsal to femur length (M: F) is considered as very important for running and speed. Bakker (1983) has analysed the data from fossil records (Fig. 4.7) of ungulate herbivores and mesonychid carnivores. For short distances carnivores are able to run faster than their herbivore prey. This has been attributed to their diet, for which they have streamlined body, lighter body weight and strong leg muscles. Fig. 4.7 The metatarsal to femur ratio for herbivore and carnivore increased throughout tertiary as they Cheetah is an ideal example and can run evolved to be faster runners indicating a co153 km/hour for a short distance. These evolutionary relationship between prey and predator changes in metatarsals to femur ratio is (based on Bakker, 1983). a co-evolutionary relationship between the prey and predator. The prey has constantly evolving strategies to escape from the predator and the predators are evolving new strategies to catch them. 4.6.1

Flowering Plant: Insect—Pollinator Relationship

Many flowering plants are entomophilous: plants attract insect pollinators by producing flowers with nectar. The insect benefits by obtaining nectar as food while visiting the flower and plant benefits from the insect visit by obtaining pollen from another plant facilitating cross fertilization. The insect visit to the flower may be a function of amount of nectar present in the flower, colour of the flower and morphometry of the flower. The insect collects pollen on its body while visiting the flower and rubs this pollen on the stigma of another flower when it visits and if the flowers belong to the same species cross fertilization can occur. This relationship is complex and has co-evolved.

212

Fundamentals of Ecology

From energetics and cost benefit point of view, the plant would ensure pollination at the minimum cost producing as little pollen and nectar as possible. On the other hand the insect pollinator would maximize the visit to the flower by collecting more nectar per unit time and per visit. Thus theoretically different flowers compete themselves in inviting insect pollinators. Another situation may be by producing flowers at different times of the year, plants can avoid such type of competition. In another situation different flowers because of the quality of the nectar they produce and colour of flower may attract different insects, particularly Lepidoptera and Hymenoptera. These options have been observed in tropical and sub-tropical forest ecosystems. It has also been observed that Anemophilous angiosperms (plants that usually get pollinated through non-insect/animal pollinator) produce much more pollen than Entoniophilous angiosperms. In Anemophilous plants usually pollen movements occur by wind and therefore wind direction and distribution of plants in an area are important factors. These plants usually tend to grow close together in forest stands to ensure pollination. Another interesting phenomenon is the pollination in Chinese gooseberries (Actinidia chinensis) or in tomato flower, which require a special type pollination called buzz pollination. An insect visiting the flower buzzes loudly (produces sound) and the vibrations of the buzz shakes dry pollen out of the male flower and the pollen falls on the body of the insects or bee. Since honeybees cannot produce buzz sound, they cannot be utilized to pollinate gooseberries or tomuto plants. The large Bumble be species (Bombus sp.) which produces buzz sound are ideal for bringing pollination in these species. Specialized co-evolution might also occur depending upon the specialization of the plant and the insect that visits it. These informations have important bearing on crop productivity and introduction of new crops in new places. Chapman and Reiss (1992) have described all these options.

4.7 BIOLOGICAL CLOCK It is now known that all organisms measure time. One of the features of life is the regular occurrence of the same physiological processes. This periodicity often coincides with the diurnal rhythm of the 24-hour day-night cycle of the earth. A rhythm is a recurring process which is wavelike in character, because maximum and minimum states appear at identical intervals of time. The time taken between two maxima or two minima is called a period or cycle and consists of two phases, a rise and a fall in the biological process. For example, a natural diurnal cycle consists of a light and a dark phase. The amplitude is the range of fluctuations from an average value. In many diurnal animals, the rate and amount of respiration are highest in the light phase (day time) and lowest in the dark phase (night time). An average respiratory value can be calculated from the data of the two phases, the deviations in respiration during day and night representing the amplitude of the diurnal rhythm. Some ecological processes exhibit diurnal, tidal, lunar and seasonal variations, called ecological rhythms. Physiological rhythms refer to functional processes which usually occur in the body of an organism having very short cycles. For example, the periodic variation in the state of a chlorophyll molecule in green leaves is a short cycle. Another example is stimulation and inhibition in the nerve centres of man or animals. Some biological rhythms depend upon either exogenous or endogenous stimuli and persist as long as the stimulus continues. Exogenous rhythms can be the contraction of voluntary muscles of animals, or the movement of plants or animals towards or away from a source of stimulation. An exogenous stimulus (factor) can bring quiescence in a living system, which may lose its

Environment in Action

213

ability to return to the active state in the prolonged presence of the stimulus. However, the living system can return to an active state if the exogenous stimulus is made shorter or removed. In endogenous ecological rhythms, the duration of the cycle deviates from the 24 hour one within the framework of a relatively constant environment. In animals, ecological rhythms usually have a 23–25 hour cycle while in plants from 23–28 hours. These rhythms are called circadian rhythms (in latin circa means about and dien means day). Endogenous rhythms are usually synchronised with those of the corresponding external cycles. The external conditions which regulate the duration of cycles and phase positions are called synchronisers or time cues. Light is a universal synchroniser. Feeding times in many mammals can act as time cues, although they are considered as weak stimuli of circadian rhythms. 4.7.1

Light as Universal Synchroniser

Although visible light rays are not electrically charged, in chemical reactions they excite molecules which then interact with other molecules. The following biological processes are associated with light of wavelength 390 to 760 nm. 1. Photosynthesis and photomorphogenesis 2. Growth of plants towards light 3. Variations in life processes due to the rhythms of light and darkness 4. Vision 5. Oriented movements in animals towards or away from light. 6. Bioluminescence Normally the human eye responds to light rays from 390 to 760 nm. This can be extended to a range of 310 to 1,050 nm under artificial conditions. Wavelengths longer than 1,100 nm do not contain enough energy to stimulate the human eye and shorter wavelengths (less than 310 nm) destroy the protein and nucleic acid molecules. Many homeotherm animals with normal vision do not ordinarily respond to ultraviolet or infrared rays, since their retinas are not stimulated. They also do not properly distinguish between the different colours of the visible spectrum. Dogs, cats, hamsters and opossums are colour blind, while horned cattle cannot identify red light. Horses, deer, sheep, pigs and squirrels cannot distinguish spectra close to red and green. Non-human primates can distinguish colours as well as man. Some insects see ultraviolet radiation. In sea water, green and blue rays penetrate deeper than red rays. Hence photosynthesis in deeper waters occurs with blue and green rays, which are absorbed by the brown and red pigments of red algae (phyllophora). The red and blue-green algae use pigments of phycocyanin and phycoerythrin for photosynthesis. Each plant performs photosynthesis best in complementary colours e.g. green pigment for red rays, brown pigment for green rays, and red pigment for blue rays. Photosynthesis is a function of the illumination, a variation in the amplitude of which is a function of the earth’s rotation, altitude, season, presence or absence of clouds and dust, and so on. Illumination is measured in lux or foot candle. On foot candle is 10.7 lux. One lux is equal to one lumen per square metre. A lumen is equal to 1/620 Watt. Most organisms respond to moonlight, particularly on a full moon, which has an illumination of 0.25 lux in cloudless weather. Synchronisers or time givers may be in the form of unitary signals (light flashes in darkness), gradually varying illumination, and sudden transitions from light to darkness or darkness to light. Organisms

214

Fundamentals of Ecology

never experience days and nights of the same length because of latitudinal differences. For example, at the equator the day is 13 minutes longer than the night. Days in summer and nights in winter are usually longer. Some biological processes exhibit recurring patterns in a 24-hour period. Laboratory experiments carried out on organisms subjected to 12 L : 12 D (12 hours of light alternating with 12 hours of darkness) exposure periods in otherwise constant environmental conditions indicate that a diurnal organism remains active during the light interval and a normal nocturnal organism becomes active in the dark phase of the 24-hour cycle. Some organisms may exhibit maximum activity in a very short period at a specific time of the day or at a specific time of the light period. The illumination part is important in the 24-hour cycle. Although rhythmicity in an organism is genetically determined, the organism adapts or adjusts its activity-rest rhythm to the altered times of light and darkness, which may result from a rapid eastward or westward translocation of the organism to different longitudes (Prosser, 1973). Physiological measurements of factors such as body temperature, oxygen consumption, blood sugar level, locomotor activity, etc., in organisms exhibit variations with the daily cycle. These daily rhythms are called circadian rhythms which are now considered synonymous with a solar day and 24hour cycle. In the 24-hour solar cycle, temperature is an important ecological factor. The pattern may vary from one day to another. In many animals deprived of variations in their phase-setting periodic light and temperature regime, the rhythmic solar day patterns may continue, but cease to exhibit 24-hour periodicity. The recurring cycles may become slightly longer or shorter than 24 hours and the activity time may shift in accordance with the local clock time to generate a rhythmic cycle of a period slightly different from 24 hours (usually less). This loss may be compensated for at later times by the production of a rhythmic pattern longer than 24 hours. These rhythmic patterns do not have any fixed relationship to the clock hours of the day and are hence termed free running. In diurnal vertebrates with free running periods shorter than 24 hours and nocturnal vertebrates with periods more than 24 hours, the shorter and longer cycles are correlated to the brightness of the illumination. 4.7.2 Diurnal Rhythms in Plants and Animals

Earlier in this chapter we discussed long-day, short-day and day-neutral plants. The flowers of Dogrose, Chicory and Poppy open up at 4 to 5 am, the flowers of lettuce at 7 am and those of Cott’s foot at 9 to 10 am. In some plants, the flowers open up before the break of dawn and in some others with the onset of dusk (as in the evening primrose, scented tobacco, Hesperis, Matronalis, and many of the pink family). When a flower closes up, it does so to protect its inner organs from the cold of the night and against extra moisture. In the day, flowers open up for pollination under most favourable conditions. Sleep in the plant is a periodic change in the position of the organs (petals and leaves). These phenomena are called nyctinastic movements (Emme, undated). Leaf movements are usually associated with rhythms of illumina. In the diurnal rhythms, the animal activity stage consists of small cycles of flitting, flying, running and rest. Animals are divided into two groups on the basis of their movement and immobility, which are measured as a coefficient of activity, i.e.

Environment in Action

Coefficient of activity =

215

hours in motion/day hours of immobility/day

In one group the value of this coefficient is less than one and in the other it is more than one. Predatory animals like spiders, preying mantis, tigers, and so on have developed an operative rest, which means the state of the animal in the waiting period for prey. The maximum motor activity of lizards, chickens, pigs, and so forth occurs in the daytime, whereas that of frogs, certain snakes, many mice, bats and owls occurs at night. Some animals, such as the Baltic salmon, sturgeons, the common grass mouse and the meadow mouse are active both in the day and night. If there is one alternation of activity and rest period in a 24-hour rhythm, it is termed a monophasic rhythm, if there are two alternations, it is said to be diphasic and with more alternations of activity and rest, it is called a polyphasic rhythm. Pigs have 14 phases of sleep a day and cows between 3 and 42. Some animals like Mus musculus, which is a nocturnal small mammal, pass from nocturnal habits to diurnal habits and back again. They exhibit two peaks of maximum activity, the longer one at night and the shorter one in the daytime. In a 26-hour cycle of light and darkness, the mouse becomes active when light is switched on, thus behaving like a diurnal animal, but in a 21-hour cycle the onset of activity is moved towards the dark phase and the mouse behaves like a nocturnal mammal. In both cycles, mice have the small overall duration of the active phase. Birds search for food during most of the day and before sunset they fly off either in groups or singly to the nesting site, which may usually be from 1 to 20 km from the feeding site. At dawn they take off again. The summer activity of all birds in the north of Sweden diminishes after 7 p.m. and reaches a minimum between 10 and 11 p.m. Then it gradually increases, reaching a maximum between 2 and 3 a.m. This summer diurnal rhythm is not so evident on overcast days. It is now known that all birds which spend the summer in the north have night sleep (Emme, undated). 4.7.3 Lunar Related Rhythms

The lunar day of 24 hours and 50 minutes is associated with rhythmic variations in environmental factors, particularly for marine organisms of the littoral intertidal zones. The rotation of the earth in relation to the moon usually displays two high and two low oceanic tides every day, whose occurrence differs from one geographic region to another. These tides also exhibit semimonthly or monthly changes in their diurnal patterns. The activities of littoral organisms usually follow the tidal pattern in an adaptive manner. Fiddler crabs display maximum activity during a low tide phase while green crabs and barnacles exhibit maximum activity during high tides. Laboratory experiments with green flat worms collected from the tidal environment show that they continue to follow the tidal periodicity of rising to the sand surface over a low tide phase and descending over a high tide phase. Many studies indicate that littoral animals like protozoa, crustacea and molluscs gear their activity to tidal rhythmicity. The breeding rhythm phase relative to the moon phase in some marine animals appears to be determined by the phase angle between the time of day of the high and low tides on the specific beach (Prosser, 1973). 4.7.4 Annual and Other Rhythms

There are annual rhythmic patterns in rainfall and temperature regimes. The annual pattern of variations in reproduction, growth, morphological and physiological changes, animal migration, etc., although

216

Fundamentals of Ecology

species-specific, are strongly correlated with the rhythmicity in environmental factors. Annual changes in the photoperiod affect the breeding pattern. Since circadian cycles are related to dawn and dusk, it is believed that organisms can differentiate between changing photoperiods, with the circadian system as a reference clock. 4.7.5 Mechanism of Biological Clock

The origin of life was associated with the rhythmicity of biochemical processes. In the beginning, the chemical processes that occurred in water, atmosphere and soil were of an isolated and non-recurring type and therefore molecules were formed and disappeared and new ones arose. But the protoplasm of living organisms exhibits constancy of structure because of the biosynthesis of the same type of molecules. Thus, the self-recurrence of chemical cycles occurs in a living system. This is possible because of the ability of nucleic acids to replicate themselves and to control biosynthesis of proteins. Thus the basic rhythm was associated with the self-replication of the DNA. In the course of evolution, DNA evolved the biological clocks regulating duplication, cell division, diurnal rhythmicity of metabolic processes and finally the activity pattern of organisms. Biological clocks exhibit the ecophysiological integrity of the DNA—cell-organism and the evolutionary mechanism through heredity has brought stability to these clocks. Intracellular clock It has been hypothesised that the diurnal rhythms of all unicellular organisms and multicellular plants and animals are due to intracellular clock mechanisms. For example, a small piece of the intestine of a mammal will exhibit the diurnal rhythm of contraction, peristalsis, phases of muscular relaxation and reduced peristalsis if kept outside the body in a nutrient medium. Another example is the diurnal rhythm of turgor pressure in plant cells and growth, which is seen in isolated whole and halved leaf joints, in strips of leaf blade and in other pieces of plant tissue kept in a nutrient medium. It is hypothesised that the intracellular clocks are located in the nucleus of the cell and can be compared to a spring, which is tightened in one phase and gradually released in another without ever reaching a zero level. Thus oscillatory motion occurs between the winding (tension) and unwinding (relaxed) phases. The winding of the spring requires energy, which is received in plants from reactions initiated by light and in mammals from oxidation and reduction reactions. Many biochemical studies indicate that in the spring model, the winding phase corresponds to the synthesis of RNA enzymes and the unwinding phase to the breakdown of proteins in the cytoplasm. This hypothesis may work well in the case of unicellular organisms, but in the case of multicellular and complex organisms various processes occur simultaneously in different tissue and organ systems. Thus it is thought that a central mechanism may operate through the genes-hormones-organ systems. Central mechanism The coordination of internal processes and environmental parameters in plants is achieved by a complex system of excitations. The receptors are the roots, tips of coleoptiles, and shoots and plasmic growths in the outer walls of the cortical tissue. Parenchymatous tissues and sieve tubes of phloem transmit the excitation and control signals. The excitations are transmitted by hormones. Cell division, growth, and the flowering of plants depend upon hormones which are produced in the growing points. Thus the growth rhythmicity is related to cell cycle divisions at the sites of germ cell accumulation. The photosynthesis rhythm is connected with leaves, and by changing the intensity of incident light, it is possible to set up different rhythms in two leaves situated opposite each other. The absorption of water and minerals is related to the rhythmicity of the root system. Therefore it appears that plants

Environment in Action

217

do not have any central mechanism for governing diurnal rhythms, which is done by cells of different tissues and organs. In most invertebrate animals, particularly arthropods, the rhythms are correlated to neurohormonal systems. It has been observed that in the mulberry silkworm, Bombyx mori, the pupae do not develop for as long as three months if the cerebral ganglia (brain) are removed but optimal temperature and photoperiod conditions are maintained. But if the brain from a caterpillar, butterfly or another pupae is implanted, the pupae of Bombyx mon change into a butterfly within three weeks. In insects, the brain, suboesophageal ganglion, corpora allata, prothoracic glands and corpora cardiaca secrete hormones which control the growth and development and regulate the activity of other glands. The hormone of corpora allatum controls moulting. It is now known that in Periplaneta americana, a brain centre controls the diurnal rhythm of locomotor activity. The cockroach is a typical nocturnal animal—if it is kept in constant darkness or in continuous light, the monophasic rhythm disappears by the fourth or the sixth day. It then exhibits a polyphasic rhythm (it becomes active for a 24- hour period with small intervals). Certain cells or suboesophageal ganglion liberate a hormone which ensures a diurnal activity rhythm. Higher vertebrates possess the most complex physiological mechanisms of diurnal rhythm. Many scientists attach great significance to the rhythmical activity of adrenal glands. The activity of the gland increases in the predawn period and reaches a maximum in the middle of the activity phase. More adrenalin secretion is associated with locomotor activity. The removal of the adrenalin glands reduces the amplitude of the diurnal rhythms in the mitosis of skin cells, eosinophil formation, and phospholipid metabolism in the liver of small mammals. A diurnal rhythm exists in the formation and secretion of corticosterone. The adrenal function is regulated by the pituitary-hypothalamus route, which controls a number of activities, including the regulation of body temperature, in higher vertebrates. A diurnal rhythm exists in the activity of neurosecretory cells of hypothalamus and in the secretion of pituitary hormones. Changes in the photoperiod also act through the hypothalamus-pituitary route on all endocrine glands. A unique event is the annual migration of birds. Spring commences in the third week of March in California. Around 19th March every year, swallows return to California from their winter home in South America. The northern birds usually fly southward in winter to avoid extreme cold and return to their northern homes in spring. Research indicates that fat deposition on the body of birds precedes migration, as fat provides energy for distant migration. Migratory birds deposit fat on their body twice a year, since they migrate twice (once in autumn and again in spring). There is an internal clock which depends upon the day length, which affects the sexual cycles through the endocrine system and prepares the birds for fat deposition. The state of reproduction in birds has three phases, namely (a) preparatory, (b) progressive, and (c) active. During the preparatory phase, the bird makes a comparison of the actual lengths of day and night and conditions are geared to winding the clock. In the progressive phase the internal clock is wound up, and in the active phase sexual activity begins. All these activities are associated with the secretion of hormones and hormones action at the right time. Thus the central regulation of rhythms in higher vertebrates is largely done by the hypothalamus— pituitary complex, which is genetically controlled and influenced by environmental factors such as photoperiods. Understanding biorhythms is important, as their control can boost milk, meat, and fat production in cattle, wool output in sheep and help in the control of insect pests. Understanding them may help man’s activities in space, enhance longevity, and reduce the occurrence of diseases.

218

Fundamentals of Ecology

MULTIPLE CHOICE QUESTIONS Choose the correct answer 1. Which type of soil is considered better for plant growth? (a) Sandy (b) Silty (c) Clayey (d) Loam 2. Which cation is most abundant in soil. (a) Calcium (b) Magnesium (c) Sodium (d) Potassium 3. For reclamation of alkaline or saline soils, following substance can be used. (a) Gypsum (c) MgCO3 (b) CaCO3 (d) Both CaCO3 and MgCO3 4. Which animal helps to bring down C/N ratio in soil faster? (a) Soil mites (b) Soil collembola (c) Earthworms (d) Soil nematodes 5. Which relationship is classified as mutualism? (a) Lichens (c) Endocommensalism (b) Ectocommensalism (d) Inquilinism 6. The capillary fringe for one of the soils is highest. (a) Clayey (c) Sandy (b) Gravel (d) Both sandy and gravel. 7. Maximum amount of water, a soil can hold in its pore space after excess water is drained away is called: (a) Field capacity (c) Soil moisture balance (b) Soil hygroscopy (d) Wilting point 8. The zone of ‘winter rains’ lies along latitudes: (a) 40o north or south of the equator. (b) 25o to 30o away from the equator. (c) 10o to 25o on either side of the equator. (d) Below 10o north & south of equator. 9. The trade winds circulate between: (a) 30o north to 30o south latitude from equator. (b) 30o north to 60o south latitude from the equator. (c) Between 30o & 60o north latitude from equator. (d) Between 30o & 60o south latitude from equator. 10. What is weather? (a) Daily changes in atmospheric meteorological condition of an area in the troposphere. (b) Daily changes in atmospheric meteorological conditions of an area in the troposphere and stratosphere. (c) The general meteorological characters of a place during a year in the troposphere. (d) The general meteorological characters of a place during a year in the troposphere and stratosphere. 11. Water which has never been a part of the hydrosphere is called. (a) Meteoric water (b) Juvenile water (c) Ground water (d) Surface water

Environment in Action

219

SHORT AND DESCRIPTIVE QUESTIONS 12.

13.

14. 15. 16. 17. 18. 19. 20.

21. 22. 23.

24. 25.

Write notes on ecological importance of: (a) Symbiosis (b) Communalism (c) Carnivorous plants (d) Forest fire (e) Pairwise co-evolution (f) Diffuse co-evolution (g) Circadian rhythms (h) Rhythms in animals (i) Intracellular clock. Write explanatory notes on: (a) EL Nino (b) La Nina (c) Europe’s climate in the same latitude is different from Asia. (d) Hydrophytes (e) Why Calotropis and Acacia plants are considered as xerophytes? (f) Vernalisation (g) Bioluminescence (h) Why mammals breath at a faster rate in higher altitude than of sea level? (i) Halophytes (j) Soil texture (k) Soil pF (l) Permanent wilting point. Discuss the role of precipitation as an important factor for plant growth and distribution. Discuss ecological adaptive features of xerophytes citing examples. Discuss temperature related morphological adaptations in biota. Discuss light as an ecological factor affecting activities of plants. Explain how topographic factors act as important ecological aspect of the distribution of flora. Why soil is important? Give an account of characteristics of soil horizons & profiles. Explanatory notes on: (a) Vernalisation (b) Bioluminescence (c) O2 stress in high altitudes (d) Soil water (e) Role of soil animals. What is symbiosis? Enumerate the definition with suitable examples. Define commensalism and distinguish between ecto, endo commensalism & inquilism. Write notes on: (a) Epiphytism (b) Parasitism (c) Grazing as a biotic ecological factor (d) Forest fire (e) Flowering – Insect Relationship (f) Biological clock. Discuss co-evolution as an evolutionary process of great ecological significance. Discuss Biorhythms & its relationship to light.

5 5.1

Community Ecology CONCEPT OF COMMUNITY AND BASIC TERMS

A population consists of organisms of a particular species and has characteristics like natality, mortality, age structure, growth, dynamics, and so on. But when several populations share a common habitat and its resources, they interact among themselves and develop into a biotic community or simply, a community. Thus a community is a larger unit than a population, since it includes more than one species population. Microorganisms, plants and animals population sharing a common habitat and interacting among themselves develop into biotic communities. A biotic community has its own characteristics. Animal populations sharing a common habitat and interacting among themselves form an animal community and plant populations of an area form a plant community, but the concept of biotic community includes all populations of living organisms of a common habitat, ranging from a tract of forest to the whole of the forest, from a small pond to a large lake, and so on. The biological potential of each species population determines a tolerance range for environmental conditions, as described in Chapter 1. The range of environmental conditions which a taxon can tolerate is called its ecological amplitude. The composition of a biotic community in any habitat is dependent upon the prevalence of environmental conditions in that habitat and the ecological amplitude of species populations, Therefore, the climate and other a biotic and biotic conditions of a habitat determine the type of community which survives and develops. The organisms of a community usually exhibit trophic (feeding) relationships among themselves. They also interact in sharing the space and there may be interactions at a reproductive and behavioural level. Animal populations differ in their trophic requirements and therefore a particular plant community may be associated with a particular animal population. Many biological activities of plants, like periodicity, phenology, etc. are strongly associated with animal activities and vice versa. Very few studies are available on the biotic communities of any ecosystem, although extensive literature is available on different aspects of plant, animal and microbial communities separately. A biotic community exhibits certain characteristics, such as diversity, dominance, density, composition and stratification. We have observed that out of the many species that occur in a community, very few exert a major controlling influence on the community by virtue of their density (number), biomass

Community Ecology

221

or other activities (Chapter 2). All major biotic communities have producers, consumers (herbivores and carnivores) and decomposers. Within these trophic classifications, some species populations exert more influence than others in the community because they control a higher percentage of energy flow. Senapati and Dash (1981) have found that grasses are the dominant producers in a grassland community of Orissa, India, and that cattle and earthworms are respectively the dominant populations among the above- ground and below-ground animal consumers. This study was based on the amount of primary and secondary productivity, and energy flow, in a grassland community. The removal of a dominant species by human activity brings about a series of changes in a natural community. Each community has its spatial limits. Sometimes the boundary between two communities may be very sharp (such as one between a forest and a lake) or gradual as between a forest and a grassland). This transitional zone or junction zone between two or more diverse communities is called ecotone. The ecotone harbours a community (called an ecotonal community) including organisms of each of the overlapping communities and, in addition, organisms peculiar to it. Generally, the number of species and their population densities are greater in the ecotone than in the communities flanking it. The occurrence of increased diversity and density of organisms at the ecotone is due to the edge effect of two distinct communities. Human settlement creates ecotonal communities. If man settles in a forest, he reduces the forest to scattered small areas interspersed with grasslands, agricultural lands and other open habitats. If he settles in the plains, he plants trees around his habitation. Thus, by his activities, man creates on ecotone—some of the original organisms of the forest and plains survive in the man-made forest edge and many species of insects, birds and mammals often increase number in these zones. Types of communities Larger Table 5.1 Latitudinal and altitudinal classification of units of an area with distinct climatic forest communities conditions and similar vegetations form biomes or biochores or forLatitude Altitude (metre) Forest communities mations or provinces. Altitude and 0-20° 0 to 1,000 Tropical latitude create differential temperature 1,000 to 2,000 Subtropical and humidity regimes and, along with 2,000 to 4,000 Temperate rainfall, determine the broad features 4,000 to 6,000 Alpine-Arctic of a biome (see Table 5.1). On the 20-40° 0 to 1,000 Temperate basis of latitude, Good (1953) has 1,000 to 2,000 Subtropical given a classification of forest biomes > 2,000 Alpine Arctic which form separate communities in the tropical belt. 40-60° 0 to 1,000 Temperate Communities are also classified >1,000 Alpine Arctic on the basis of their water and light 60-80° In all attitudes Alpine Arctic requirements and other environmenand Antarctic tal conditions. In terms of the general growth, composition, shape, etc. of vegetation, and organisms associated with them, communities may be classified as forests, deserts, grasslands, tundra, and so on, or as hydrophytes, mesophytes, xerophytes, heliophytes, and so forth. A community is dynamic since it changes over time. This dynamic nature is reflected in the succession of organisms in a habitat. A series of changes results in the development of a relatively stable community, which maintains its structure and influences the climate of the area. Such a stable and mature community

Fundamentals of Ecology

222

is called a climax community, while communities of successional stages are called seral communities (Clements, 1916). Although these two concepts are applied to plant communities, they have their own association of consumers and decomposers and may be considered as biotic communities. Table 5.2 provides information on some community characters of seral and climax communities. Table 5.2

Some community characters of seral and climax communities Community character

Seral community

Climax community

1. Two or more species are dominant in maximum canopy coverage

Associes

Association

2. Single dominant species in the community

Consocies

Consociation

3. Local variation in dominant and subdominant communities

Locies

Lociation

4. Subdominant species belong to levels of life forms lower than the dominants

Socies

Society

Seral and climax communities are indicated by suffixes -ies and -alion respectively.

5.2

COMMUNITY STRUCTURE, COMPOSITION AND STRATIFICATION

Communities may be small, consisting of few species populations in a small space, or large, comprising several species populations in a large area. Charles Elton (1927) observed that the communities of certain British rivers included 131 species of invertebrates, in addition to fish, amphibians, populations of algae, protozoa, bacteria and rooted aquatic plants. On the other hand, he found a community on sandy beach consisting of only five species of invertebrates. A meadow on clay near Oxford, England included 93 species of invertebrates in the soil and on above-ground vegetation. Dash and his coworkers (1980, 1981, 1984) studied the composition of biotic community in some tropical pastures from Sambalpur, India and found that it consisted of 22 grass and other herbaceous species (primary producers), 5 species of earthworms, 25 of testate protozoa, 15 of nematodes and 7 of microarthropods. Dash and Guru (1980), and Dash and Pradhan (1984) found 9 species of grasses and other herbaceous species, 1 of earthworm, 11 of testate protozoa, and 16 of nematodes in a tropical hill ecosystem of Sambalpur, India. In the river lb (one site), the community consisted of 1 species of rooted plant, 32 of photoplankton, 20 of zooplankton and 7 of fish (Kar et al., 1987, and Dash et al., 1988). These studies indicate that a biotic community may be composed of very few to very many species. Besides, there are many genera in a large community consisting of one species only (80-90%)—extremely few genera consist of more than one. Since the species of a genus may have more or less similar requirements of environmental conditions, in a particular habitat they will be competing for resources. During the course of evolution, this competition has eliminated all but very species from each genus represented in a biotic community in an area. Community structure, composition, shape, and so on are called qualitative features. The measurement of density, frequency of occurrence, coverage, height, and growth represent the quantitative features. The study of species diversity is an essential component of community study. For animal communities, a study of age structure and growth patterns is important while for plant communities, floristics, study

Community Ecology

223

of taxonomy, life forms like herbs, shrubs, climbers, trees is important. Since seasonal changes occur in the appearance of plant structure and growth, periodicities and phenology are important commurity parameters. Another important feature is the sociability or the nature of grouping or the associate is of individuals of different species. Vertical stratification is a characteristic feature of biotic communities. The simplest stratification includes two strata, (a) an upper euphotic zone consisting mainly of autotrophs and (b) a lower consumer and decomposer zone consisting mainly of heterotrophic organisms. Of course these two strata can be divided into many substrata, which increase the habitats and microhabitats for different organisms. Stratification also helps in niche separation. Increased habitats and niche separation reduce competition and thus enable a large number of species to occupy a community. In Chapter 3, stratification in aquatic ecosystems has been discussed. Vertical gradients in environmental factors, such as the availability of sunlight, the temperature, and so on bring about a recognisable stratification in water bodies, particularly in marine ecosystems and deep water lakes. Stratification in communities is also observed in terrestrial ecosystems. In a tropical evergreen forest, distinct layers of canopy, crown and understorey vegetation are observed. The forest floor also consists of leaf litter (L layer), a partially decomposed leaf litter layer (F layer), a humus layer, and so on (discussed in Chapters 1 and 5). These layers are associated with different organisms, as each stratum provides a different type of habitat. The stratification helps in the segregation of niches. In a grassland community, the euphotic zone consists of the herbaceous stratum consisting of grasses and other herbs as producers, and rodents, cattle and insects as consumers. The subterranean stratum consists of different layers of soil containing litter, humus, mineral fraction of soil, plant roots and organisms, such as bacteria, fungi, protozoa, microarthropods, insect larvae, pupae, oligochaetes and molluscs. Most small organisms are found in the top 10 cm of the soil. Oligochaetes can burrow deeper, as can amphibians, reptiles (particularly snakes) and rodents. Thus a stratification in the distribution of organisms can easily be seen in a grassland community. 5.2.1 Qualitative Features of the Community

Ecologists generally use christen Raunkiaer’s classification (1934) of plant life forms. Raunkiaer recognised that plant growth is limited by unfavourable environmental conditions and depends upon the ecological amplitude of the species. Keeping these facts in mind, he considered the position and degree of protection to the perennating bud during adverse environmental conditions as the principal features of plant adaptation to climate. On this basis he classified higher plants into five major life form classes (Fig. 5.1), namely (a) phanerophytes (P), (b) chamaephytes (Ch), (c) hemicryptophytes (H), (d) cryptophytes (Cr), and (e) Therophytes (Th). Phaneropbytes These plants may be trees, shrubs or climbers. They are found mostly in tropical regions and decrease progressively from the tropics to the temperate to the polar regions. In these plants, the growing buds are not well protected. They are located in upright shoots much above the ground surface. Phanerophytes are usually divided in to four sublife forms depending upon the height of mature plants. These are (a) trees more than 30 metres tall, called megaphanerophytes, (b) trees between 8 and 30 metres tall, called mesophanerophytes, (c) trees between 2 and 8 metres high, called microphanerophytes, and (d) shrubs less than 2 metres high, called nanophanerophytes.

Fundamentals of Ecology

224

Fig. 5.1

Raunkiaer’s plant life forms: A—Phanerophytes, B—Chamaephytes, C—Hemicryptophytes, D—Cryptophytes, E—Therophytes. The parts shown in solid black usually withstand adverse environmental conditions.

Chamaephytes In these plants the buds are located close to the ground surface or up to maximum height of 25 cm. Chamaephytes commonly occur in high altitudes and latitudes, e.g. Trifolium repens, found in temperate North America. Hemicryptophytes In these plants, the perennating buds are protected under the surface soil. The plants are usually biennial or perennial herbs and grow in cold climatic regions. In the warm season the growth of aerial parts is marked. Cryptophytes In these plants, the buds are usually buried in the soil or in bulbs and rhizomes where food is stored to withstand long periods of adverse climatic conditions. They are also called geophytes. Therophytes These are annual plants and produce flowers and seeds in the favourable season. They survive adverse conditions in seed form and are found in dry, hot or cold environments. In any plant community, the ratio of the life forms of different species in terms of their numbers or percentage is called the phytoclimatic or biological spectrum. These ratios also indicate the nature of climate prevailing in a particular region. For example, a higher percentage of chamaephytes would indicate a cold climate, whereas the occurrence of higher percentage of therophytes would imply long dry seasons. Evidently, the occurrence of more or less similar biological spectra in different regions would suggest similar climatic conditions in those regions.

Table 5.3

Raunkiaer‘s normal biological spectrum for phanerogamic flora

Life forms

% Occurrence

Phanerophytes

46

Hemicryptophytes

26

Therophytes

13

Chamaephytes

09

Raunkiaer (1934) prepared a normal biological spectrum for the phanerogamic flora of the world and found the following percentage values of different life forms (Table 5.3). The biological spectrum of any natural ecosystem can be studied and compared with Raunkiaer’s data and from this some insight can be obtained into the type of climate of the area. Raunkiaer’s study was based on a large number of natural undisturbed

Community Ecology

225

habitats. In recent times, however, the biological Table 5.4 Community classification on the spectrum of any habitat has been affected by human basis of leaf size activities, such as like agriculture, grazing, scraping, Community type Leaf size (mm2) deforestation, fire, pollution, and so on. Consequently, Leptophyll 25 one has to be very careful while comparing different Nanophyll 225 ecosystems and drawing conclusions. Raunkiaer also classified plant communities into six Mierophyll 2,025 types on the basis of leaf size (Table 5.4). Each leaf size, Mesophyll 18,225 from the second type onwards, is nine times larger than Macrophyll 164,025 the preceding type. Megaphyll >164,025 Besides these classification procedures for plant communities, six plant community components are generally used for structural description (Dansereau, 1957). These components are (a) life form, (b) plant size, (c) function, (d) leaf shape (e) leaf texture, and (f) canopy cover. In each of these six components, six categories have been identified. Dansereau also used notations and symbols. The subgroups for life form components are (Fig. 5.2):

Fig. 5.2

Dansereau’s notations and symbols for plant life form components.

226

Fundamentals of Ecology

T trees, F = shrubs, H = herbs, M = bryophytic forms, E = epiphytes, L = lianas. The following notations are used for the three main sizegroups of plants: t = tall, m = medium, and I = low height Four subgroups are used for functions: d = deciduous, s = semideciduous, e = evergreen, and j = evergreen succulent or evergreen leafless. Six subgroups are identified for the leaf shape: n = needle or spine, g = graminoids, a = medium or small, h= broad, v = compound, and q = thalloid. Four subgroups are identified for leaf texture: f = filmy, z = membranous, x = scierophylls, and k = succulents The canopy cover is divided into four subgroups: b = barren, i = discontinuous, p = intufts or bunches, and c continuous 5.2.2 Phenology (Temporal Behaviour or Time Relations)

The life history of a plant species involves seed germination, vegetative growth, flowering, fruit formation,, seed maturation, leaf fall, seed dispersal and death. A study of the date and time of occurrence of these events is called phenology. Environmental factors influence the phenological behaviour of a species population. These phenological events can be recorded diagrammatically (Fig. 5.3) monthwise and seasonwise and provide valuable information. Such a diagram is called a phenogram. Braun-Blanquet

Fig. 5.3

A phenogram records phenological events. phenological events of three Indian herbaceous species are given.

Community Ecology

227

(1932) devised a classification to describe the health of a plant species (vitality or vigour), as indicative of its capacity to complete its life cycle. He devised four classes: 1. Class 1—Well developed plants having the potential to complete their life cycle 2. Class 2—Vigorous plants which can spread vegetatively 3. Class 3—Feeble plants which spread vegetatively and fail to complete their life cycle 4. Class 4—Plants occasionally appearing from seeds and usually represented by very low population densities. Plants belonging to Classes 1 and 2 usually dominate any plant community. Braun-Blanquet (1951) classified plants into five classes on the basis of their sociability or gregariousness, meaning their ability to grow in clumps or singly depending upon their life form, vitality, competitive ability, habitat conditions, and so on. Vegetative propagation usually favours gregariousness. The five classes are, Class 1—shoots growing singly, Class 2—plants growing in small groups, Class 3—plants growing in small scattered patches, Class 4—plants growing in large patches, and Class 5—pure populations of plants covering large areas. Interdependence, which is another community feature, includes inter and intraspecific competition, parasitism, symbiosis and commensalism, all of which have been discussed elsewhere in this book. 5.2.3 Quantitative Characteristics of Communities Frequency The dispersion of species population in a community varies due to soil conditions, seed dispersal mechanisms, grazing and other biotic factors. Raunkaier (1934) classified the species in a community into five frequency classes by studying more than 8,000 frequency distributions—his generalisations are given in Table 5.5 The frequency is expressed as a percentage (Table 5.6) and is estimated from the following relationship No. of quadrats in which species A occurs % frequency of species A = ¥1 Total no. of quadrats examined

The relative frequency (RF) is determined by the use of the following formula (data collected using the quadrat method) No. of quadrats containing a species R.F. of the species = ¥ 100 Total no. of occurrences of all species or No. of quadrats containing a species ¥ 100 Sum of frequencies of all sppecies Since environmental conditions vary, the frequency values differ in different communities. Raunkaier observed the following relationships between different frequency classes: A = 53, B = 14, C = 9, D = 8 and E = 16. He generalised his findings in the law of frequency, which showed that > A>B>C =D C > D> B. This does not confirm Raunkier’s law. Hence it indicates a disturbed community.

figure. From the intersection point of the baselines, pegs represented by numbers 1, 2, 3, ... are set in both directions at equally spaced intervals until the edge of the area is reached. Five-metre intervals are convenient for use in shall habitats. From these pegs on the baselines, the offsets to the edges of the area are measured. Each offset remains perpendicular to the baseline. In this way the entire area is divided into small squares, each outlined by the pegs. A reference to the baseline pegs provides the relative position of any square, marked out. The squares outlined in the figure are designated A6X1 and A5X4 respectively. Pegs can be left in the field if the study is of a long duration. Floristics and faunistics include a systematic examination of the habitat, taxonomic identification, Fig. 5.5 Mapping of habitat: baseline-and-offset classification and listing of organisms. Plants can method (see text for explanation) be preserved and a herbarium library maintained. Animals are either pinned, stuffed, or preserved and kept in a museum. Sampling techniques Vegetation sampling is usually done either by the transect or by the quadrat method. In the transect method, the sampling plot or plots are transected by lines (line transect) or by belts (belt transect). Lines are drawn in the plot and samples taken along these lines. In a large ecosystem, such as a forest, the line transect may have considerable width (belt transect). These transects can be drawn keeping any special features of the ecosystem in mind. On hills or raised habitats the transects are conveniently drawn between two points at different altitudes or between the hill top and hill bottom. In a study involving a forest community, vertical stratification can be done so that the vertical distribution of the canopy and root system of species populations along a line can be studied. This is referred to as

Buteamonosperma

Cleistanthuscollinus

Diospyrosmelanoxylon

Gardenia turgida

Holorrhenaantidysenterica

Ixoraparvflora

3.

4.

5:

6.

7.

8.

Density (No./ha)

Total % frequency

TBA for all species

TBA for a species

Total density (No./ha)

Relative basal area = RBA =

Relative Density = RD =

6

4

2

4

10

2

10

10

1

10

6

1

10

1

50 2500

770

30

20

20

1200

10

50

180

20

550

40

50

240

60

40

20

40

100

20

100

100

10

100

60

10

100

40

(No./ha)

%

10

Density

Frequency

3

45

35

30

180

15

15

18

12

25

18

30

67

6

(Mean Basal Area) cm2/tree

MBA

¥ 100 Example for A. indica

¥ 100, Example for A. indica

TBA

100

10

7.792

5.195

2.597

5.195

12.98

2.597

12.98

12.98

1.298

12.98

7.792

1.298

12.98

1.298

RF

¥ 100 = 0.094

¥ 100= 1.298

255470

150

1350

700

600

216000

150

750

3240

240

13750

720

1500

16080

240

(Total Basal Area) cm2/ha

¥ 100 = 1.6

255470

240

2500

240

¥ 100, Example for Azadirachta indica, RF =

No. of quadrates in which species occurs

% Frequency

Terminaliatomentose

Woodfordiafruticosa

13.

14.

Relative frequency = RF =

Terminaliachebula

Terminaliabelarica

11.

12.

Shorearobusta

10.

Mimosa himalayan

Buchnanialanzan

2.

9.

Azadirachtaindica

Tree species

2.0

1.2

0.8

0.8

48.0

0.4

2.0

7.2

0.08

22.0

1.6

2.0

9.6

1.6

RD

0.058

0.528

0.274

0.235

84.55

0.058

0.294

1.286

0.094

5.382

0.282

0.587

6.294

0.094

RBA

Quantitative features of a forest community (calculations are done from 10 quadrates, each 10 m x 10 m)

1.

No.

Serial

Table 5.9

9.85

6.923

3.671

6.23

145.53

3.055

15.274

21.466

2.192

9.674

9.674

3.885

28.874

2.992

(RF+ RD+ RBA)

IVI

234 Fundamentals of Ecology

Community Ecology

235

bisect sampling, and involves the measurement of community stratification both in air and soil. Bisect sampling helps us understand the nature of competition and coexistence among members of communities, with regard to getting space, nutrients and light. Ecosystems may cover very large areas and it is not always possible to study them entirely. Therefore small sampling units or areas, called quadrats, are chosen for study.. A quadrat may be square or rectangular according to its usefulness and convenience. The size of the quadrat varies with the type of organism to be studied. For small plants like lichens, mosses and liverworts, or animals like earthworms distributed in patches, small quadrats of area 25 ¥ 25 cm are useful. In grasslands, quadrats of three sizes have been found to be useful, depending upon the growth of grasses and their dispersion. These quadrats are 25 ¥ 25 cm, 50 ¥ 50 cm and 100 ¥ 50 cm. In forest ecosystems, quadrats of area 10 ¥ 10 m or bigger are usually taken, since trees are large and grow apart from each other. For enumerating soil animals such as protozoa, nematodes, collembola, microarthropods, enchytraeids, circular samplers (a type of quadrat) of smaller sizes are chosen (usually 20-40 cm deep). At any time the number of sampling units or quadrats should cover not less than 5 to 10% of the sampling plot for vegetation analysis—for soil animals this may depend upon their distribution, density, and so on. The quadrats may be of different kinds, such as (a) a list quadrat for listing the occurrence of species, (b) count quadrat to enumerate the density of a species population in a community, (c) chart quadrat to make a model of species distribution on the graph paper, or (d) permanent quadrat, for accurate periodic charting by the use of photography is to study seasonal vegetational changes in a particular area. The minimum size of the quadrat is usually determined by the species-a reacurve method. The size of the quadrat is very important as too small or too large a quadrat may not be representative of the community. The procedure is to lay a quadrat of small area on the sampling plot and record the occurrence of the number of species. We then go on increasing the quadrat size, simultaneously recording the number of species, as shown in Figs. 5.6 and 5.7. Then plotting quadrat size (area) as the independent variable (x-axis), and the occurrence of the number of species, as the dependent variable (y-axis), the minimum quadrat size can be determined. As the quadrat size goes on increasing, so does the number of species in the initial stages. Then the curve takes a horizontal shape, indicating that the species number does not increase even if the quadrat size is increased. The point where, the curve flattens is joined

Fig. 5.6

Different quadrat size (see text for explanation)

Fig. 5.7

Species area curve (see text for description) (see Chapter 12)

Fundamentals of Ecology

236

with the x-axis to find out the minimum quadrat size corresponding to the occurrence of the maximum number of species. This method is very convenient for vegetation as well as soil animal population analysis. In a plant community having different strata of vegetation, the quadrat size differs for each of the life forms. Therefore each stratum needs to be sampled separately in its own way. When quadrats of different sizes are used for different strata in the same community, they are called nested quadrats. For sampling animal populations from the soil, quadrats of different sizes may be required for different groups (Murphy, 1968). Quadrat sampling is usually done randomly or in a set pattern, Many books (Simpson, 1960, Greig-Smith, 1964, Southwood, 1966, Misra, 1968, Michael, 1982) deal exclusively with quantitative methods used in the analysis of the community or ecosystem. Recently satellite remote sensing techniques are used to survey large animal populations (Current Science, 1998).

5.3

COMMUNITY FUNCTION

The community is a dynamic system, which changes over time. In this section we discuss community dynamics, including successional patterns. 5.3.1 Dynamics and Succession

Communities mare made up of populations, which interact in many ways and influence their development over time. Ecological succession involves an orderly process of community changes, which are directional and hence predictable. It involves a modification of the physical environment, culminating in the establishment of a stable community. A sequence of temporary communities replace one another in a given site, thus bringing about changes in the physical environment, which in its turn determines the pattern of succession. The transitional series of communities which develop in a given area are called sere or seral stages, while the final stable and mature community is called the climax. Ecological succession is therefore community-controlled although the environment determines the successional pattern. Succession is of two types, primary and secondary. Primary succession begins on a sterile area (an area not occupied previously by a community), such as a newly exposed rock or sand dune where the conditions of existence may not be favourable initially. The first stage is called nudatlon or exposure of the new surface, followed by the arrival of propagules, or seeds from a neighbouring region, a process called migration. The next stage is the germination of the seeds or propagules, depending upon environmental conditions. This is followed by the establishment of the seedlings, called ecesis, which is followed by full-scale colonisation. Colonisation by successive offspring and new migrants help increase the population, a process called aggregation. Plants or autotrophic organisms which are the first to colonise and aggregate are called pioneers. Primary succession refers to autotrophic succession, which begins in a predominantly inorganic environment. Secondary succession refers to community development on sites previously occupies by well developed communities—the site may be rich in nutrients and survival conditions favourable. Examples are the types of succession that occur in cutover forest or abandoned croplands, where the environment is both inorganic and organic-based. Another type of succession occurs on a fallen log or an aquatic ecosystem loaded with sewage. Here the environment is predominantly organic and heterotrophic organisms usually dominate. This type of succession is called heterotrophic succession. The ecological succession that we will discuss in this chapter is primary succession.

Community Ecology

237

Example of ecological succession A good example is the hydrarch succession or hydrosere (Fig. 5.8) in which a pond and its community are converted into a land community. In the initial stage, phytoplankton are the pioneer colonisers. They are consumed by zooplankton and fish. Gradually these organisms die and increase the content of dead organic matter in the pond. This is utilised by bacteria and fungi, and minerals are released after thedecomposition. The nutrient-rich mud then supports the growth of rooted hydrophytes such as Vallisneria, Ceratophyllum, etc. in the shallow-water zone. The hydrophytes die and are decomposed by micoorganisms, thus releasing nutrients. Besides, some dead organic matter lies in the mud, gradually reducing the margin of the pond, which is occupied by species whose leaves reach the water surface and roots remain in the mud. Nelumbo nucfera, Trapa sp., Monocharia sp., etc. grow in these conditions. Gradually the water depth in the pond decreases due to evaporation and the deposition of organic matter, Fig. 5.8 Hydrosere: A = initial stage, B = intermediate stage, and the concentration of nutrients increases. Free floating plants C = establishment of a delike Lemna, Pistia and Woffla increase in number because of the ciduous forest (see text for high nutrient availability. Gradually their dead parts fill up the detailed description) pond bottom, which gets raised. The pond becomes a swampy ecosystem. The reed swamp species invade the pond and are gradually replaced by mesic communities as the water depth is reduced greatly. Gradually land plants invade. In association with the changes in water depth and vegetation, the aquatic fauna also change and ultimately gets replaced by land animals. Natural water reservoirs may be found in some Plateaus and Valleys. Hydrosere arising in these aquatic environments usually leads to the establishment of deciduous forests. Climax formation of trees like Salix has been reported in low lying lands in some parts of Kashmir (Ambasht, 1988). A possible trend of succession in the aquatic environment is as follows:

Climax Community Open Scrub land

Deciduous forest Ø

Terrestrial communities Ø Mesic communities Ø Reeds and Sedges Ø Free floating and rooted plants Ø Rooted and aquatic plants Ø Phytoplankton Ø Pond ecosystem

238

Fundamentals of Ecology

In Indian upland plateaus, the climax woody species consist of Diospyros, Butea and Zizyphus and the ground vegetation of Eragrostis, Sporobolus, Bothriochloa, and so on. In lowlands and valleys which provide a mesic environment, the climax vegetation consists of Terminalia, Ficus, Sterculia, Salix, etc. The other ground vegetation may consist of reeds, sedges, Vetiveria and Andropogon. Xerosere or xerarch succession begins on exposed parent rocks (lithosere) or dry sand (psammosere). The pioneer plants are lichnes, mosses and Selaginella, which help in soil formation by accelerating erosion. In course of time, grasses, annuals and herbaceous vegetation grow on the soils deposited on rocks. Later the mixed woodland species, Ficus, appears. In saline areas, the sere is called halosere. 5.3.2 Laboratory Model of Succession

The field examples considered earlier were extremely complex situations where many factors acted simultaneously. The succession was directional, resulting in the modification of the environment, which brought forth new situations and ultimately the evolution of a stable community. Raman Margalef designed a laboratory model to study succession with a view to bringing out the principles involved in it. Margalef (1968, and quoted by Odum, 1966) maintained an old culture of phytoplankton and zooplankton (diatoms, green algae, dinoflagellatess, rotifers) in his laboratory and measured their biomass, productivity, respiration and green and yellow pigments (green corresponds with chlorophyll a, measured at a wavelength of 665 nm and yellow with pigment measured at one of the old culture, ecological succession was set in motion. The biological parameters cited above could be measured in the successional stages. Alternatively, new cultures representing successional stages and the old culture (if fresh culture medium was not added) representing the climax stage, could be used. The characteristics of the old culture (climax stage) were: 1. Variety of species of plankton 2. Variety of plant pigments, and a high ratio of pigments measured at 430/665 nm 3. A low ratio of net production (P) to biomass (B) 4. The ratio of gross production (P) to community respiration (R) i.e. the P/R ratio tended to 1. The characteristics of the successional stages (new cultures) were: 1. Species diversity was comparatively low, one or two species of phytoplankton generally being dominant. 2. The pigment ratio (430/665 nm) was low (around 2) whereas in the old cultures the ratio was between 3 and 5. 3. Gross production exceeded community respiration and the P/R ratio was more than 1. 4. The ratio of net production to biomass (P/B) was higher. The young cultures are thought of as pioneer stages and successional stages and the old cultures as the climax stage. Heterotrophic succession can be studied in the laboratory if some amount of hay (paddy straw) is boiled and the solution left for a few days. Heterotrophic bacteria grow first, and if some pond water containing small animals, such as protozoa and rotifers, is then added to the hay solution, a succession of species occurs for about a month or so. This is a heterotrophic succession. The culture runs down after a

Community Ecology

239

few months if fresh nutrient is not supplied. Since no autotrophic organism is present, the culture is not self- sustainable even for a short duration. The heterotrophic organisms utilise the nutrients supplied and perform metabolic activities. They die as soon as the nutrients are used up. 5.3.3 Trends in Succession

While analysing field examples and laboratory models, we observe some distinct structural and functional changes which occur in the process of succession (Figs. 5.9 and 5.10). Changes can be grouped as follows: 1. Species composition A change in species composition occurs. The change occurs fast in the beginning and then more gradually. 2. Species diversity Some plant species which were present in the initial stages may not be found in an advanced stage of succession. However, in the climax stage there may be more kinds of autotrophs and heterotrophs than in the earlier seral stages. 3. Density and biomass of organisms There is usually a marked increase in the number (density) of organisms in older cultures or ecosystems. The number may decline in the older stages but in the climax stage the biomass structure remains very high. The total biomass gradually increases and reaches a maximum in the climax stage. 4. Heterotroph population The number of species usually goes on increasing as the food chain relationships become more complex in the climax stage. 5. Chlorophyll Green pigments go on increasing during the early phase of primary succession. The ratio of yellow/green pigments remains around 2 in the early stages and increases to 3 to 5 in the climax stage. Pigment diversity also increases.

Fig. 5.9

Trends in succession (P = community production, R = community respiration) (based on Odum, H.T., 1956)

Fig. 5.10

Successional trends with regard to some functional attributes (see text for description). (based on Kira and Shidei, 1967)

240

Fundamentals of Ecology

Functional changes 1. There is a progressive increase in the amount of living biomass and dead organic matter. There is an increase in gross as well as net primary production in the initial and seral stages. Thus there is more biomass accumulation, gradually reaching a huge biomass structure in the climax stage. 2. The community respiration increases but the P/R ratio remains more than 1 in the seral stages. The huge living biomass respires a lot in the climax stage and the P/R ratio equals 1 (P/R = 1). Thus in the early stages P > R and in the climax stage P = R. 3. The food chain relationships become more complex as succession proceeds. These field and laboratory examples indicate that the stability of the climax community is associated with the high species diversity, large accumulation of living biomass and complex food chain relationships. The complexity of the climax community increases the number of ecological niches and of routes of energy flow through the system. These attributes make the climax community more stable. In Chapter 2, the relationship between dominance and diversity has already been established. The data presented in Chapter 2 indicate that productivity increases from the poles to the tropics, and this increase is associated not only with environmental characteristics, such as higher incident solar radiation, higher amount of rainfall and high relative humidity, but also with higher species diversity in the tropics. In other words, it may mean that a climax tropical forest is more stable than a temperate climax deciduous forest, and so on, 5.3.4 The Climax Concept

Many theories have been put forward to explain the climax concept. The monoclimax theory Clements (1916) was of the view that, in a given climate, the successional stages (seral stages) will ultimately end up as climatic climax vegetation. If this be true, succession is a progressive phenomenon. The emphasis is on the fact that only one type of climax vegetation develops. This is called the monoclimax theory. But some communities like prairies with grassland climax in the southern part of Canada and northern part of the USA possess shrubs and forest patches in low areas in the mesic belt as stable vegetation. Ecologists supporting the monoclimax theory argue that this vegetation is postclimax. But others feel that the postclimax concept is confusing. It has also been observed that different types of stable vegetation occur within the same climatic belt. Yet other plant ecologists consider this vegetation preclimax. Preclimax vegetation is that which has not reached the climax stage due to the prevalence of some adverse climatic, topographic and edaphic environmental conditions (Misra, 1974). Due to human activities, such as cutting, fire, grazing, and so on, the successional process may be checked and the community may not reach the climax stage. However, some sort of stable vegetation may develop under such circumstances. Such vegetation is called disclimax or postclimax. The polyclimax theory Looking at the occurrence of several types of climax vegetations in Europe, Braun-Blanquet (1932) proposed the polyclimax theory, which states that there may be climatic climax, edaphic climax and biotic climax depending upon the situation in which the climax vegetation has developed. Therefore the succession may not always be progressive. In course of succession, a community with larger life forms like forests may be degraded and patches of grasslands may occur within them (retrogressive succession).

The two theories cited above explain the climax concept from the structural viewpoint. Ecologists have recently started looking at the problem from the energetics point of view, since energy drives all functions in a community or in the ecosystem. Researches in ecological energetics and related aspects

Community Ecology

241

(Fosberg, 1965, 1967, Margalef, 1968, Lieth, 1968, Odum, 1969, Pandian and Vernberg, 1987) have led to the development of another theory, called the information theory, to explain the concept of climax community. Information theory The community is considered a thermodynamic unit. It receives energy from the sun and converts it into chemical energy, performs its activities and dissipates heat energy. In the seral stages, the dissipation energy is usually less than the input energy—therefore there is more of net production, and the community grows. In the stages, the species diversity is low and the food chain relationships simple, but in course of succession the total information in the community increases. This means that the food chain relationships become more complex and the possible interactions between individuals, species and materials increase. In the climax community the input energy more or less balances the output energy (particularly dissipation energy), which makes for negligible net primary production. We have already discussed some of these aspects in the laboratory model of succession. In summary, the information theory takes energy parameters into account and differentiates the seral stages or seral communities from the climax community. It becomes meaningful if we compare everything in terms of the energy budget, a functional approach to the study of ecological succession. 5.3.5 Time Factor In Ecological Succession

The establishment of a climax community through primary succession on sand dunes or recent, lava flows takes about 1000 years. Secondary succession on abandoned agricultural land or a cut-over forest site in a moist temperate climate and a tropical climate may take 200 and 100 years respectively for the establishment of a mature forest. Secondary succession in grasslands may take about 50 to 60 years to reach a climax grass stage. Odum (1966) describes four stages for abandoned croplands in central and western North America to reach a climax grassland stage. These are (a) 2–5 years of annual weed stage (b) 3–10 years of shortlived grass stage, (c) 10–20 years of perennial grass stage, and (d) the climax grassland stage reached in some 20 to 40 years. In recent times, man and some natural events such as storms and climatic cycles, have interfered with the natural process of ecological succession. If a longer duration is required for completion of the sere, there is every likelihood of any of these factors interfering with this process. Therefore, long- term succession may not be directional and predictable. 5.3.6 Significance of Ecological Succession

The principles and trends of ecological succession indicate that seral stages are more productive, although comparatively less stable. The climax community is mature and stable with greater biological diversity, larger biomass structure and balanced energy flow and is able to buffer the physical environment. This community provides man with food, fuel, fodder, medicine, and so on, and is able to control the climate and keep a balance with regard to biogeochemical cycles. It is considered a multiple use system. Since the P/R ratio in such a community is 1, there is not much net primary production for harvesting. The fast growing human population needs a huge amount of food and other materials. Therefore man has to look for high net primary productive systems, which means he must have early successional stages as a source of food. Crop fields are highly productive systems because man puts in a lot of auxiliary energy into them—these systems are comparable to successional stages. But, for human survival, a balance must be maintained between the stable, mature, climax systems (life supporting systems) and the highly productive successional systems.

Fundamentals of Ecology

242

MULTIPLE CHOICE QUESTIONS Choose the correct answer 1. As per Raunkaier’s law frequency, five different frequency classes (A, B, C, D and E) in a natural undisturbed community exhibit one of the following relationship: (a) A < B > C £ D < E (c) A < B < C £ D > E £

5. 6.

7. 8.

£

4.

£

3.

£

2.

(d) A > B > C £ D < E (b) A < B > C £ D < E Which one of the following life forms can be termed as geophytes: (a) Hemicryptophytes (c) Therophytes (b) Cryptophytes (d) Microphanerophytes Life forms that are commonly found in high altitude area are: (a) Therophytes (b) Phanerophytes (c) Cryptophytes (d) Chaemophytes One of the following theory explains that succession may not always be progressive. (a) Polyclimax theory (c) Information theory (b) Monoclimax theory (d) Climatic climax theory In seral stages of community succession, P/R ratio is: (a) > 1 (b) 2500

>2500

1650 AD

0.50

65

1650

1650

1800 1850

200 1.10

1900 1930

295 2.04

80

1950

375

1971

555

1974

1000 (Estimated)

40

26 (Estimated)

Fundamentals of Ecology

274

Fig. 6.16(A)

Projected human population growth to the year up to 1985 (World Total).

From an estimated 200 million people in 1800 AD in India, the population grew to about 295 million in 1900 AD, to 375 million in 1950, 555 million in 1971, 684 million in 1981 and now in 1996, it stands about 900 million. It may swell to about one billion by 2000 AD. Hence, there is now immense pressure on the land to produce more for the growing population of India. Since there is a maximum limit to the agricultural etc., productivity, we do not have any alternative but to check the population growth.

Demography Demography is the statistical study of human population. Let us tak.an example of a small town where 1000 people originally lived. In one year 22 babies were born, 3 babies died, 1 old man died, 2 persons moved away from the town and 3 persons moved into the town. At the end of the year the population of the town would be: Population in the beginning of the year 1000 Babies born during the year +22 Babies died during the year –03 Fig. 6.16(B) Projected human population growth to the year 2100 AD (Industrially more developed Other death during the year –01 contries taken together). Number of persons moved away from the town during the Year –02 Number of persons moved into the town during the year 3

Population at the end of the year 1019 From the numbers given above: The birth rate was:

22 Number of birth ¥ 100% = 2.2% ¥ 100% = 1000 Original Population

The death rate was:

4 Number of birth ¥ 100% = 0.4% ¥ 100% = 1000 Original Population

Immigration rate:

Emigration rate:

3 Number move into the town ¥ 100% = 0.3% ¥ 100% = 1000 Original Population Number of persons moved away ¥ 100 Original Population

=

2 ¥ 100% = 0.2% 1000

Population Ecology

Growth rate (entire population)

275

19 Change in Population ¥ 100% = 1.9% ¥ 100% = 1000 Original Population

These demographic data tell us what has happened during one year. But it does not tell us about the future. But the future can be predicted from the growth rate assuming the growth rate will remain same in future. For prediction, the error factor will be reduced if the growth rate is known for a number of years and the age distribution of the population is known. More births will occur if there are more young people in the population and alternatively more death would occur if more old people are there. Health care, education, medical facilities, clean environment are some of the factors which can influence the growth rate in the population. Depending on these factors the age pyramids in different human societies (industrially developed, undeveloped etc.) exhibit different patterns. Sex wise age pyramids The stable age pyramid is bell shaped, the expanding age pyramid is triangular and the diminishing age pyramid is urn shaped. The age distribution of human populations in industrially developed and developing countries are different types (Fig. 6.17). As the medical facilities become increasingly available, people become conscious of advantage of small family etc., the age pyramids go on changing. The growth curve also will ultimately stabilise and behave like S-shaped curve. But unless serious efforts are made and family planning education reaches the masses, it will be tremendous difficult.

Fig. 6.17

Age-Sex pyramids for three countries, (A) India, a rapidly expanding population (B) France a Stable Population (C) Germany, a declining population (UN Demographic Year Book 1984).

Family Planning Family Planning programmes provide educational and medical services which help couples to choose their family size (how many children to have) and when to have the children. Such programmes vary from society to society but it primarily includes sex education, information on methods of birth control, distribution of contraceptives, and informations on sterilization and abortion. Government organisations usually give these services with no charge or with minimum charges. Birth rates in most of the human cultures have dropped because of family planning methods. Family planning has become very successful in China, Indonesia, Singapore, committed leadership, wide availability of contraceptives easy availability of family planning services and local implementation methods and use of media to spread sex education etc.

276

Fundamentals of Ecology

The common methods of birth control in human-populations are (i) preventing pregnancy by sterilizing females and males if they do not want any more children. (ii) The use of oral contraceptives by females. These oral contraceptives are called pills. (iii) Use of intrauterine device (IUD) by the female. This is a good method of preventing pregnancy for women who do not like the pill or sterilization. This IUD method is considered good as it has few health risks. (iv) Use of condoms by males is also a good method for prevention of pregnancy. Condoms also provide protection against sexually transmitted diseases like herpes. Acquired Immuno Deficiency Syndrome (AIDS), Gonorrhea etc. (v) Other less popular methods are use of diaphragms, spermicides, spermicide-impregnated sponges etc. Breast-feeding also is considered important in controlling fertility, reducing infant mortality, etc. Abortion is legal in many countries. It is another method of terminating pregnancy but it may not be very popular.

MULTIPLE CHOICE QUESTIONS Choose the correct answer 1. Human Survivorship curve in general is: (a) Straight line type (b) Stair step type (c) Highly concave (d) Highly convex 2. What will be the nature of survivorship curve if more or less same percentage of mortality occurs at each age class? (a) Convex type (c) Diagonal straight line type (b) Concave type (d) Stair step type 3. In a population, most of the individuals are found in pre-reproductive and reproductive age groups. What will be the nature of age pyramid? (a) Expanding (c) Diminishing (b) Stable (d) Both expanding and diminishing 4. A population experiences moderate to high birth rate and low death rate with high median age. What is the type of age pyramid? (a) Type-I (Broad base and gentle slope) (b) Type-II (Old-fashioned beehive) (c) Type-III (Narrow base) (d) Type-IV (Bell shaped) 5. If population growth pattern model (K - N ) dN = rN dt K where N = existing population in a specific ecosystem, K-maximum population that can exist with regard to space and food. If in an ecosystem, N = 90 and K = 100 then the carrying capacity will be: (a) Not been substantially realised (c) Nearly realised (b) Moderately realised (d) Not realised at all 6. Potassium dichromate is used in the estimation of chemical oxygen demand of water samples as an ————————————— agent.

Population Ecology

277

SHORT AND DESCRIPTIVE QUESTIONS 7.

8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21.

Write explanatory notes: (a) Exponential growth (b) Sigmoid growth form (c) Carrying capacity (d) Biotic potential (e) r and K selected species (f) Regular oscillations (g) Distinguish between Inter and Intraspecific competition. (h) Density dependent growth rate and growth curve. (i) Role of social behaviour as a mechanism of population control in animals. What is biotic potential? Relate it with natality, mortality of a species in natural condition. What is survivorship curve? How many type of survivorship curves are observed in different animal species populations and human societies. What is a Life Table? Construct a life table for a Zooplankton species with convex type of survivorship of curve. Give an account of human age structure of different societies and discuss it’s significance. Give an account of basic pattern of population growth curves and distinguish between a logistic and exponential growth curve. Explain a logistic model of growth forms and using crowding in the habitat as an ecological factor. What is sigmoid growth pattern? Discuss role of density (crowding) on the nature of growth curve. What is population fitness? Explain the ecological factors that do not allow the intrinsic rate increase to be fully realised. Discuss the characteristics of r and K selected species population and their ecological significance. Discuss population fluctuations and reasons behind that. Discuss predation as an inspecific interactions and its ecological significance. Discuss intraspecific interaction and its ecological significance. Discuss Wynne Edward’s hypothesis that social behaviour in animals is an important ecological factor to control density of populations in a habitat citing examples. Write explanatory note: (a) Density-dependent factors in population control. (b) Age – sex pyramid in Human societies. (c) Common methods of birth control in human beings.

7

Natural Resource Ecology 7.1 CONCEPT AND CLASSIFICATION OF RESOURCE

A resource is a means for satisfying human and social requirements in a given space and time. Resources are basically of two kinds: (a) renewable and (b) non-renewable. Some resources, such as plants (crops, forests, etc.) and animals (milk and meat producing) are replaced from time-to-time because they have a life-cycle and a continuous harvest is possible. These resources are said to be renewable; examples of such resources are wild life, aquatic life, pastures, and forests. Some resources do not have a life-cycle but can be recycled. These resources, like water, are also classified as renewable. Resources which are not regenerated because they do not have a life-cycle or are not recycled, are termed non-renewable. Mineral deposits are formed slowly over millions of years and once used cannot be regenerated, for example, fossil fuels, such as petrol and coal. Since the formation of soil takes thousands of years and is not renewable in the lifespan of many generations, it is thought of as a non-renewable resource. These resources provide food, fodder, fuel, medicine and clothes for man and hence sustain life on this planet. Natural resources are also classified as (a) inexhaustible and (b) exhaustible. Resources which are usually not changed by man’s activities and are abundantly available and expected to be available for millions of years, are said to be inexhaustible. Solar energy, atomic energy, wind power, power from tides and so on are classified as inexhaustible. Renewable resources can also be classified as inexhaustible because they can be managed properly and renewed. Resources like coal, petrol, and so forth are classified as exhaustible because their deposits on this planet are finite. Renewable resources such as plants and animals become extinct if not managed properly. They are maintainable. But purely exhaustible resources like fossil fuels and some minerals are nonmaintainable.

7.2

NON-RENEWABLE RESOURCES

The following are some important non-renewable resources.

Natural Resource Ecology

279

7.2.1 Mineral Resources Minerals are natural substances mined from the Earth by man. Mineral resources include all inorganic and organic substances derived from the Earth. A number of minerals, such as iron, copper, aluminium, coal, petrol, etc., are essential for our industries. Man has been using minerals since the dawn of civilisation. He used stone implements and stones for the construction of pyramids and clay bricks to build houses. As civilisation progressed, he learnt the use and manufacture of iron implements. Iron and steel are used for the manufacture of machinery, houses, automobiles, ships, rail tracks and so on. Other metals, like copper, lead, manganese and zinc, are now used for various purposes. Minerals usually occur as ores, combined with many other substances. These ores are first processed to get rid of impurities and then the minerals are extracted. These industries depend upon the large-scale use of petroleum, natural gas and coal. India has a thriving mining industry with mineral sector contributing about 3% of gross domestic product. The number of minerals mined in India is more than eighty and can be grouped into (i) fuel minerals like coal, petroleum, natural gas, lignite, (ii) metallic minerals like iron ore, chromium ore, bauxite, etc., and (iii) non-metallic minerals like lime stone, dolomite, phosphorite, clay, etc. Fuel minerals contribute 88% of the total value of mineral production (coal 42%, petroleum 33%, natural gas 10.5% and lignite 2.5%). The metallic and non-metallic minerals account for 6% each of the value of the minerals produced. India possesses about one-fourth of the world’s iron-ore deposits located largely in Jharkhand and Orissa. It now produces more than 50 million tonnes of iron ore annually. It has been estimated that India has about 1,250 million tonnes of bauxite deposits, located in Jharkhand, Chhatisgarh, Orissa and Gujarat. Aluminium is extracted from bauxite. About 80 million tonnes of manganese deposits are also found in India with Orissa as the leading producer state. Out of 193 million tonnes of chromite deposits, about 140 million tonnes are found in Orissa. Copper deposits are scanty and found in Jharkhand, Bihar and Rajasthan. Gold deposits are meager; India also has good reserves of uranium and thorium in Jharkhand, Bihar and Rajasthan. These are important for the generation of atomic energy. India is rich in some thirty-five minerals. About 6% of the value of minerals production is due to metallic minerals. It has been estimated that the coal reserves of India amount to about 86,000 million tonnes. At present, more than 575 coal mines are present in India. Annual production is more than 400 million tones, and consumption is more than 500 million tonnes. In 1998–1999, some 300 million tonnes of coal was mined. The annual production of petroleum is more than 10 million tones, and our reserves are located in the valleys of the Brahmaputra, the deltas of Cauvery, Krishna, Godavari and Mahanadi rivers, coastal areas of Kerala, Andhra, Orissa and offshore sites near Mumbai and so on. The world’s oil deposits are found mainly around the Persian Gulf. About 60% of the world’s oil reserves are located in south-west Asia and the main countries that produce oil are Kuwait, Saudi Arabia, Iran, Iraq and USA. The largest producer of oil is Russia and the largest consumer is the USA, although it has only 7% of the world’s total oil reserves. India mined some 170 million tonnes of nonfuel minerals in 1994–1995. 7.2.2 Land Resources

Land is the most precious resource, since it is put to diverse use by man. India with a land area of 32,88,000 km2 which is about 2.4% of the world, supports 16% of the world’s population. Land is now under great pressure due to the increase in population. There were about 238 million people in India in 1901 and are now about 1,200 million. The per capita land resource available now in India is less than

Fundamentals of Ecology

280

0.30 ha, in comparison to about 0.8 ha in China and about 8.3 ha in the erstwhile USSR. With the present rate of population growth, the per capita land resource in India may be reduced to 0.25 ha or less in very near future. About 44% of our land is used for agriculture, 23% is covered with forests, 4% is used for pasture and grazing fields, 8% for housing, agro forestry, industrial areas, roads and so on. Fourteen percent is barren and about 8% is used for miscellaneous purposes (data source -Indira Gandhi National Open University Publ.). However, the recent forest policy of Indian Government envisages 33% of land under forest cover. The rapid increase of urbanisation and migration of population from rural area to towns and cities has created many problems. It has led to the utilisation of agricultural land for housing, construction of office buildings, industries and so forth. Land-use policies are, therefore, very important for any country, particularly India. The rational use of land resources is possible only by adopting an integrated land-use policy, which involves prevention of land misuse and reclamation of degraded and under-utilised land, wasteland, fallows, etc. Reclamation of abandoned mines and brick kilns may yield some much required land. Sharma (1987) suggests: 1. The establishment of a sound database through scientific survey of all land resource taking the village as a unit and apportioning land for both short- and long-term requirements for agriculture, forestry, grazing, water bodies and fisheries, human settlements, roads, industries and so on. 2. That land should be suitably evaluated and classified on the basis of soil type. 3. That there should be legislative control of land use. 7.2.3 Soil Resources

Soil supports the life system and is formed through the combined action of parent rock material, climate, weathering process, vegetation and the decomposition process. Soil formation is an extremely slow process, taking thousands of years. Soil is, therefore, practically a non-renewable resource. It is important in that it stores water and plants, which provide us food, fodder, fuel, medicines and fibres grown on it. The type of soil varies from place to place—we have already discussed the different types of soils found in India. This resource is now threatened because of large-scale deforestation and erosion of the topsoil by wind action, floods and water flow. 7.2.4 Non-renewable Oceanic Resources

At a depth of 4,000–5,000 m below sea level, mineral nodules are found. These are mainly sulphides of cobalt, nickel, copper and iron and manganese oxides. These resources are now being exploited. Besides, natural oil and gas deposits are also found below the oceanic floor and are now tapped by digging offshore wells. Some important minerals like monozite (used for the generation of atomic energy), gold and platinum deposits are found in the sea bed or sea sands.

7.3

RENEWABLE RESOURCES

Renewable resources are of conventional types, such as forests, crops, other plants, wildlife and aquatic resources, and non-conventional, such as solar energy, wind energy, wave and tidal energy, biogas, atomic energy and so on. These resources can also be grouped as water resources, energy resources, agriculture, rangelands, forest resources, wild life, aquaculture, etc.

Natural Resource Ecology

281

7.3.1 Water Resources

We have already discussed the importance of water in the cycling of materials. Water is needed for daily use by organisms, for irrigation, navigation, industrial use, electricity production and domestic use. Of the total water resource of the Earth, 97.3% is salt water and the rest fresh water. This 2.7% amounts to about 1.4 billion km3 of water. Of this, about 77.2% is permanently frozen, 22.4% occurs as ground water and soil moisture, 0.35% is found in lakes and wetlands and 0.01% in rivers and streams (World Resources, Basic Books, New York 1986). The total volume of ground water found in underground reservoirs, called aquifers, is estimated to be 42.3 ¥ 1010 m3. At present, about 25% of the ground water is being used by man. Agriculture uses the maximum amount of water in the world. This amounts to about 73% and leads to a lot of pressure on ground water. Excessive use of ground water depletes aquifers, lowers the water table and may lead to salinisation, water logging and alkalinisation of soils. As the population goes on increasing, so do agriculture and industrial activities. Thus, there is considerable demand for water resources. It has been estimated that the fresh water needs (drinking and food) of a person are about 2.7 l per day (1,000 l per year or 1 m3 per year). As per the present population of the world, 6 billion m3 or 6 km3 of water is required per year. This does not include the water requirement for other purposes. The total water requirement by 2000 AD was about 3,500 km3 per year and an equal amount might have been affected by pollution. Ambroggio (1980) estimated that about 9,000 km3 of fresh water is available from the settled areas of Earth, an amount which does not include runoffs. Therefore, there is not much threat to this resource at present. But the distribution of fresh water is not uniform in all countries and the pattern of use also varies. Therefore, there is a scarcity of fresh water in many parts of the world. The use of ground water at rates higher than those at which it is recharged should be avoided. Water pollution should be avoided and steps taken to store runoff water. India receives about 3 trillion m3 of water from rainfall, which amounts to about 105–117 cm annually. This is a huge water resource and the largest in the world. But almost 90% of this precipitation falls between mid-June and October. Fourteen major river systems, such as the Ganges, Narmada, Brahmaputra, Mahanadi, Cauvery, Krishna and Godavari, account for 85% of surface flow and share 83% of the drainage basin. They serve 80% of the total population. There are about 100 medium and minor rivers. The storage capacity is 3.65 million m3. Of the total annual precipitation, India utilises only 10%, which may increase to about 26% by 2025. The ground water is also not well tapped. We need to apply improved technology to increase water harvesting and storage capacity and ground water utilisation. Of the total water used in India, 92% is for irrigation and 8% for industrial and domestic use (Sharma, 1987). The Central Ground Water Board has estimated that the available ground water in India is 210 billion m3 and the annual utilisation potential is about 42.3 million ha, only one-fourth of which is used at present. However, the ground water availability is not adequate in provinces like Tamil Nadu and Andhra Pradesh. Due to large-scale deforestation and monsoon failure, there is a regular occurrence of drought in Kalahandi and some other districts of Orissa, Karnataka, Rajasthan and Maharashtra. The supply of drinking water in Indian villages is not adequate. There is no organised water supply in many villages and even in some small towns. Although there is a lot of precipitation in India, sufficient care is to be taken to manage this water efficiently.

Fundamentals of Ecology

282 7.3.2

Energy Resources

Non-renewable energy resources, such as oil, gas and coal, account for about 90% of the world’s commercial energy requirement (petrol 45%, natural gas 20% and coal 25%). They are now in short supply and also generate a huge amount of environmental pollutants when burnt. The conventional sources of energy are mainly: (1) Biomass or dried organic matter These are, however, renewable sources of energy. Fuel wood consumption provides about 43% of the total energy consumed in all developing countries taken together but this amounts to about 14% of the total energy production of the world. Fuel wood demand in India was about 150 million tons in 1985 and this has doubled in 2005 AD. As natural forests are depleted, they will be able to provide 50–75 million metric tons and the rest of the demand will have to be met with fuel wood plantations, which require lot of effort and sound management strategy. (2) Fossil fuels Fossil fuels are non-renewable source of energy, although these are still forming very slowly as compared to their consumption. Table 7.1 provides information on the production and reserve of fossil fuels. Table 7.1

Production and reserve of fossil fuels in the world

Fossil fuel

Reserve

Production per year

Life span years

Coal

27,350 billion tons

>2,730 million tons

Oil

356.2 billion tons

>2,888.0 million tons

120

Natural gas

6,00,000 billion m

>1,250 billion m

450

3

3

1,000

Here, we shall discuss renewable energy resources. Could (1969) gave the concept of demographic quotient (Q), which is defined as Q=

Total resources available Population density ¥ per capita coonsumption

If the value of the quotient goes down, so does the quality of modern life. The demand for energy doubles every 14 years, and in modern times, energy consumption is taken as an indicator of a country’s development. India, with about 16% of the world’s population, consumes only about 2% of the world’s energy production, while the USA with 6.25% of the world’s population, consumes 33% of the world’s energy production. The nature of energy consumption varies. In India, 80% of the population depends upon dung, wood and agricultural waste as the main energy source. Due to the indiscriminate felling of trees, forests have been depleted and fuel wood has become scarce. Cattle dung, which could have been used for agriculture, is used as fuel. Hence, non-conventional renewable resources are essential for India. Solar energy It is the sole source of energy for the biological world. Plants utilise solar energy in photosynthesis for the production of food. Millions of years ago, forests were buried, and were converted into coal and oil under great pressure and temperature. This fossil fuel is in reality the sun’s energy.

In recent times, technologies have been developed to trap solar energy for generating electricity and for cooking. Solar energy is converted into electricity with the help of a photocell. Since India receives

Natural Resource Ecology

283

abundant solar energy, it is advantageous to develop photovoltaic devices to harness this energy. In India with an average of 250 clear sunny days in a year, such systems have proven viable and cost-effective. The efficiency of conversion of sunlight into electrical energy is up to 15% at the present level of knowledge of photosensitive materials and technology. Advances in molecular biology and nanoscience may provide promise for a break through. At present (2005), Japan, Germany and Spain generate, respectively, 2,422 MW, 1,500 MW and about 50 MW energy from solar source. India’s target is 150 MW installed capacity by 2007. Wind energy Windmills convert wind energy into mechanical energy for raising water from wells and rivers to the ground surface. Alternatively, wind energy can be converted into electricity to supply a small town or village. Windmills are in use in many countries, notably Holland. At present wind energy accounts for more than 50% of the 8,000 MW energy produced through renewable sources in India. This has great potential in India, as there is a long seacoast. In 2005 wind energy generation in Germany, Spain and USA was, respectively, 18,428 MW, 10,027 MW and 9,149 MW. Wave and tidal energy Waves and tides can be converted to electrical energy. In many hilly regions of India, flourmills are run by water energy. Hydroelectric power is generated if a natural or artificial waterfall is created to turn a turbine (comparable to a pedal wheel) rotating fast. Areas where rivers flow into the sea experience waves and tides, and electricity can be generated thereby. India, having a large coastline and major river systems and mountain ranges through which these rivers flow, has immense potential for generating electricity from waves and tides. Geothermal energy In hot springs, we find superheated steam. In India, there are forty-six hydrothermal areas where the water temperature exceeds 150oC. These hot springs can be utilised to generate electricity. The superheated steam can be used to run machines, turbines and so on. Biogas Cattle dung is used to produce biogas. India has 185 million cattle, 61 million buffaloes, 45 million sheep, 97 million goats, 1 million horses, 1 million camels and 1 million other livestock. These animals produce a huge quantity of dung, which can be utilised for biogas production. Water hyacinth, hydrilla, duck weeds and algae can act as supplements for production of biogas. Besides cooking, biogas can be utilised to produce steam, which can be used to run machines and turbines for generating electricity. Left-over slurry can be utilised as manure. India has appreciable potential for biogas energy (see Environment and Resources-4, Foundation Course in Science and Technology, Indira Gandhi National Open University, New Delhi, 1989). Sharma (1987) mentions that some 1,000–1,500 million tonnes of wet animal dung is available per year in India, and at a 66% collection rate, 22,425 million/m3 of biogas can be produced. The slurry can produce 206 million tones of organic manure per year, equivalent to 1.4 million tonnes of nitrogen, 1.3 million tonnes of phosphate and 0.9 million tonnes of potash as fertilisers. At present, the amount of dung production is much more. There are about 6.1 lakh biogas plants in India now. Biomass Energy Some conventional energy resource, such as biomass fuels (wood, etc.), are also renewable. The principal energy sources for rural India are as follows: The present (1990s) firewood demand in India is more than 200 million tonnes and increased to about 350 million tonnes by 2005. The biomass energy source is discussed under forest resources.

Fundamentals of Ecology

284 Table 7.1A

Energy sources for rural India

Source

Percent of the total energy consumed

Renewable Wood

68.5

Animal dung

08.3

Others

03.4

Non-renewable

Biomass, such as firewood, agricultural residue, bagasse, crop stalks, coconut shells, waste from agro based industries and animal dung, can be used to produce power. Direct burning of these wastes is inefficient and leads to pollution. If these wastes are combusted in a gasifier at low oxygen and high temperature, these can be converted into a gaseous fuel called producer gas. This gas, although has a lower calorific value compared to natural gas or liquefied petroleum gas, can be burned with high efficiency and without emitting smoke.

India generates 600 million tonnes of agricultural residue per year. These wastes can generate 79,000 MW Coal 02.3 of power if all of this waste is gasified (SPAN, 2006). This energy will form more than 60% of the total power available in India from all sources. It is feasible to set up a biomass based power plant of 10–20 MW in every village block, consisting 100 villages. Oil products

16.9

Atomic energy Atomic reactors are utilised to harness energy from the atom in a controlled manner. Nuclear reactors produce heat, which is used to produce steam. One kilogram of natural uranium (written as U238) generates energy equal to that generated by 35,000 kg of coal. In India in 1984–1985, the nuclear energy capacity was only less than 3% of the total installed power generating capacity. The present programme (1990s) aims to generate 10,000 MW of installed nuclear capacity by the year 2000. This is an important energy source for the future. Nuclear Power Status in the world

∑ ∑ ∑

∑ ∑ ∑ ∑ ∑ ∑

An hour of coal-generated 100-W electric light creates a half-pound of atmospheric carbon, a bucket of ice makes a third of a pound, an hour’s car ride 5 pounds. A Massachusetts Institute of Technology study forecasts that worldwide energy demand could triple by 2050. Finland has ordered a big Nuclear Power reactor specifically to meet the terms of the Kyoto Protocol on climate change. China’s new nuke plants will be 26 by 2025 and this is part of a desperate effort at smog control. The United States should be shooting to match France, which gets 77% of its electricity from nukes. Belgium derives 58% of its electricity from nukes, Sweden 45%, South Korea 40%, Switzerland 37%, Japan 31%, Spain 27% and the UK 23%. France, where nukes generate more than three-quarters of the country’s electricity, is privatising a third of its state-owned nuclear energy group. The 103 reactors operating in the United States pump out electricity at more than 90% of capacity, up from 60% when three mile Island made headlines. So atomic power is less expensive than it used to be, but could it possibly be cost-effective? What is a rapidly carbonising world to do? The high-minded answer, of course, is renewables and nuclear energy.

Source: SPAN: 2005 and 2006 and other sources.

Natural Resource Ecology

Table 7.1B

285

World nuclear power status

Country

Reactors operable, June 2003

Reactors under construction, June 2003–2006 No. of units

Capacity MW (e)

Nuclear electricity Generation, 2002

No. of units

Capacity MW(e)

Billion kWh

Nuclear share (%)

Argentina

2

935

5.4

7.2

Armenia

1

376

2.1

41.0 57.0

Belgium

7

5,728

44.7

Brazil

2

1,855

13.8

4.0

Bulgaria

6

3,538

20.2

47.0

Canada

12.0

14

9,998

6

3,598

71.0

China

8

6,002

26

26,350

23.5

1.4

Czech Republic

8

3,472

18.7

25.0

Finland

4

2,656

21.4

30.0

France

59

63,293

415.5

78.0

Germany

19

21,141

162.3

30.0

Hungary

4

1,755

14

2,503

8 1

950

53

44,153

3

3,696

1

950

2

1,900

India Iran Japan Korea, North Korea: Republic of SK Lithuania

18

14,870

2

2,370

12.8

3.7

3,728

17.8

3.7

313.8

39.0

113.1

39.0

12.9

80.0

Mexico

2

1,310

9.4

4.1

Netherlands

1

452

3.7

4.0

Pakistan

2

425

1.8

2.5

Romania

1

655

1

655

5.1

11.0

30

20,790

6

5,575

130

15.0

Slovak Republic

6

2,672

18

65.0

Slovenia

1

679

5.1

41.0

South Africa

2

1,842

12

5.9 26.0

Russia

Spain Sweden Switzerland Taiwan UK Ukraine USA Total: Source: ANSTO and IAEA.

9

7,495

60.3

11

9,450

65.6

46.0

5

3,170

25.7

40.0

6

4,384

27

2,682

13

1,195

103

95,523

439

35,9392

2

2,600

2

1,900

58

50,687

33.9

21.0

84.1

22.0

73.4

46.0

7,881

20.0

2,574

16.0

286

Fundamentals of Ecology

7.3.3 Forests as Renewable Resource

Forests constitute 90% of the global biomass. These are natural ecosystems dominated by trees. About a third of the world’s land surface is covered by forests, of which tropical forests constitute about 50%. Forest ecosystems are great resources, since they provide habitat for wild life, fuel wood, fodder, fibre, fruit, herbal medicines, timber and several raw materials, which are primarily used in wood-based industries, including paper and pulp industries. Forests regulate climatic conditions, such as rainfall, humidity and temperature regime, of the area and protect the soil and landscape from wind and erosion. Thus, they have three broad functions: (a) productive, (b) regulative and (c) protective. The productive function involves the transformation of solar energy into plant biomass and ultimately to animal and human biomass through the food chain. Forest products, such as wood, fruit, resins, latex, fibre, and essential oils, are produced directly or indirectly by photosynthesis. A climax forest may account for 400 ton of dry matter per he, equivalent to about 22 to 156 ¥ 1010 cal ha. The large animal biomass may account for about 1,000 kg/ha. The regulative function includes absorption, transformation of radiant energy into plant biomass, absorption, storage and release of carbon dioxide, oxygen, water, and mineral nutrients. These cycles, in turn, (particularly the water cycle and gaseous cycles) regulate the climate and the quality of environment. The protective function includes the protection of the soil and land surface from wind and rain action. Soil erosion leads to low fertility, since the rich soil is washed away. Nutrient cycling involves the uptake of nutrients by plants, storage in plants and other organisms and the subsequent return to the soil through urine, excreta and dead organic matter. A large amount of mineral substances are stored in the vegetation, particularly in tropical forests. It has been estimated that some 2–53 ton of minerals per ha are accumulated in tropical forests. The long-term stability of the forest ecosystem depends upon the input and output of nutrients. Importance of forests to human society The diverse functions of forests can be stated as follows: 1. Forests provide timber, firewood, nuts, fruits and seeds, medicinal plants, etc., to man (productive function). Forests shape natural environment by influencing such factors as temperature, humidity and precipitation (regulative function). 2. Forests shape natural environment by influencing such factors as temperature, humidity and precipitation (regulative function). 3. Forests shape the soil environment by affecting its composition, structure, the chemical properties, water contents, etc., and play an important role in bio-geo-chemical cycles (regulative function). 4. Forests check soil erosion by obstructing currents of water or air. Roots of plants bind soil particles together in larger lumps preventing erosion (protective function). 5. Forests influence flood conditions by intercepting surface runoffs, infiltration, evaporation, etc. which is helpful in water retention by the soil and in recharging ground water resources (protective function). 6. Forests help in public health protection by reducing contaminants of the environment. Forest soils and vegetation acts as an effective sink for a number of pollutants (protective function and regulative function).

Natural Resource Ecology

7.

287

Forests provide suitable habitats for a number of plant and animal species. They help in maintaining a broad genetic base from which future strains and varieties could be developed (resource and protective function).

Nearly 22.7% of the total land area of India (328.8 million ha) is occupied by forests, amounting to about 74.8 million ha. However, analysis of satellite photographs indicates that the forest cover may now only be 14% (11% closed forests and 3% degraded woods). Five million ha of forests in Asia are lost every year and millions of ha are degraded by improper use. In India, 1.5 million ha of forests are lost every year. It has been estimated that since independence, India has lost about 45 million ha of good forests, of which only 6 million ha have been replaced (Sharma, 1987). The principal factors for deforestation are an increase in human population and livestock and consequent increased demand for timber, fuel wood and grazing. Urbanisation and industrialisation are important factors causing the destruction of forests. Other important causes are the construction of roads and mining activities. The construction of hill roads, particularly in the Himalayan region, has destroyed many forestlands. One estimate shows that some 6,83,672 ha of land were under mining activity in 1973. Mining activities are still continuing in many states in full swing—the bauxite, coal, iron, chromite ore mining in Orissa and neighbouring states is a case in point. Wood consumption worldwide amounts to more than 3.2 billion m3. Of this total, some 46 and 54%, respectively, are consumed by industry and as firewood. The corresponding figures for developed countries are 84 and 16%, while for developing countries the trend is reversed, most of the wood being consumed as firewood. In India, fuel wood production was 212.6 million m3 in 1983, about 23% higher than the figure for 1973 (FAO year book of forest products, Rome, 1985). Paper industries consume a huge amount of bamboo, which is now in short supply in peninsular India. Paper mills now depend upon supply from Arunachal Pradesh (Sharma, 1987). The Himalayan mountain areas amount to 12,49,000 km2 which form about 38.4% of India’s land resource. Deforestation is now a major problem in the Himalayan regions. It has caused soil erosion and other damage. Besides, a number of industries have come up in this region as raw materials are easily available. The growth of industries has also caused air and water pollution. No detailed survey on the rich wealth (fauna, flora, minerals, water resource, etc.) of Himalayan ecosystems has been made. Mishra and Dash (1984) analysed the trend of deforestation and its causes, and the effect of deforestation on climate in the Sambalpur district of Orissa, India. A comparative study of Survey of India topomaps of 1929 and land satellite imageries in False Colour Combination of 1975 indicated a loss of 43 and 46% of reserve forest around Sambalpur and Jharsuguda, respectively, besides other forest types in a radius of 32 km. Deforestation is found to be an accelerating process, with the rate of loss more during 1970–1975 and 1960–1970 than in 1950–1960, from a semilogarithmic trend curve between 1929 and 1975. The semilogarithmic trend fits the hypothesis that after 1950 the implementation of developmental projects and rapid urbanisation has led to rapid forest loss (Table 7.2). Average rates of deforestation between 1950–1960, 1960–1970 and 1970–1975 were compared through slope factors and it was observed that the rate of deforestation was higher during 1970–1975 than in the earlier two periods. The rate of deforestation at Sambalpur was, respectively, about three and ten times faster during 1960–1970 and 1970–1975 compared to 1950–1960.

Fundamentals of Ecology

288 Table 7.2

Reserve forest clearance around Sambalpur and Jharsuguda (32 km radius) during 1930– 1975. Sambalpur Area in the square miles

Site no.

Name of the reserved forest

1929

1975

Loss

1.

Lohra

55.36

39.39

15.97

2.

Ligrakud

0.35

—

0.35

3.

Jamra

6.82

0.78

6.04

4.

Laxmidungri

1.27

—

1.27

5.

Budharaja

0.21

—

0.21

6.

Motijharan

0.25

—

0.25

7.

Chandidungri

6.67

3.27

3.40

8.

Lambaidungri

5.12

2.80

2.32

1.93

—

1.93

9.

Lamdungri

10.

Tabloi Deogaon

11.

Junapall

12.

Jujumorabhoipali

13.

Basiapara

14.

Kendrapat

15.

Bandher

16.

Jaduloisinghgunjhara

17.

Dumerchuamundher

18.

Brahmanidungri

19.

Kusamura

20.

Kulcher

21.

Chandmunda

22.

Charbahali

23.

Parasalikhamar

24.

Maghpal

25.

Tabla

26.

Badramo

27.

Sangramalba timura

28.

Ushakothi

29.

87.77

51.22

36.55

16.42

9.03

7.09

24.81

24.60

0.21

71.49

38.30

33.19

0.89

0.78

0.11

52.42

35.03

17.39

Jharghatgarpati and Kilasoma

13.01

10.76

2.25

42.96

10.28

32.68

30.

Bingipali

31.

Ghehamura

32.

Laumaljunaan

2.79

—

2.79

33.

Mahulabhanja

7.29

5.60

1.69 (Contd)

Natural Resource Ecology

289

Table 7.2 (Contd) 34.

Lapanga

1.86

0.47

1.39

35.

Kushaloi

8.17

1.09

7.08

36.

Pandri Total:

1.30

1.30

409.07

234.70

174.46

—

233.10

133.13

99.97

Jharsuguda 1.

Balchuan

2.

Rampur Zam

3.

Hemgiri

4.

Gandghora

5.

Katabaga Kankani

6.

Amdama

7.

Kushaloi

8.

Belsara and Gumbhardihi

3.29

2.49

0.80

9.

De Oh and Satparlia

11.37

8.23

3.14

10.

Lapanga

11.67

4.92

6.75

11.

Mahulabhanja

7.29

5.60

1.69

12.

Barhamujida Zam

12.72

4.68

8.04

13.

Budelkani and Firingibahal

4.94

0.68

4.26

14.

Malipara

11.22

2.51

8.71

15.

Khardihi Zam

1.65

0.34

1.31

16.

Dhengurjore Zam

5.54

1.21

4.33

17.

Jharghatgarpati and Kilasoma

13.01

10.76

2.25

18.

Binjipali and Ghichamura

49.22

27.71

21.51

19.

Bagdihi

8.98

0.58

8.40

20.

Bagopada and Khoigure

5.98

0.17

5.81

21.

Pandri

1.30

1.30

—

381.28

204.31

Total:

Loss rate

Sambalpur

176.97

Jharsuguda

Per year (square miles)

3.88

3.93

Per month (square miles)

0.32

0.33

Per day (hectares)

2.75

2.78

Per hour (hectares)

0.11

0.12

Percentages of total land area 1929

33

30

1975

19

16

43

46

Percentages of total forest area lost (1929–1975) Source: Mishra and Dash (1984).

Fundamentals of Ecology

290 Table 7.3

Comparison of climatic data at Sambalpur

Rainfall

1871–1950(80 years)

Mean(cm) SD(cm)

165.1

Coefficient of variation (%)

9.47

Highest annual rainfall as % of mean

14.6

Lowest annual rainfall as % of mean

140

57

1940–1976 (37 years)

155.97

39.98

25.63

142.59

65.15

1977–2000 (24 years)

135.45

21.59

15.94

135.84

70.14

Temperature 1876–1950(75 years) 1940–1979 (40 years) 1977–2000 (Estimated)

Meanmax (oC)

SD

Coefficient of variation

Mean min. (oC)

32.87

1.00

1.1

21.06

0.91

1.3

32.74

1.08

3.29

20.83

2.98

0.143

37.1 (Summer42–51)

SD

Coefficient of variation

26.2

Relative Humidity

Mean

SD

Coefficient of variation

Mean

SD

Coefficient of variation

1940–1976(37 years)

68.56

At 8.30 hours 6.57

9.59

53.29

At 17.30 hours 4.26

8.00

1990–1997 (7 years)

64.83

Rainy days

Average No. of days

SD

Coefficient of variation

1940–1976(37 years)

69.20

13.01

18.81

1977–2000(24 years)

15,000

Mammals

> 372

Gymnosperms

> 64

Birds

> 1,200

Pteridophytes

> 1,022

Reptiles

> 399

Bryophytes

> 2,584

Amphibians

> 205

Lichens

> 1,600

Fish

> 1,693

Fungi

> 23,000

Molluscs

> 5,000

Algae

> 2,500

Insects

> 60,000

Natural Resource Ecology

∑ ∑ ∑ ∑ ∑ ∑ ∑ ∑

∑

~ 47,000 plant species, ~ 81,000 animal species (Identified by BSI and ZSI). 4.2% of total geographical area (329 Million ha) earmarked for in-situ conversation. Two hundred and seventy-five centres of ex-situ wildlife-zoos, deer parks, aquaria, etc. Four hundred and forty-eight wildlife sanctuaries and 85 national parks. Thierty-three botanical garden. five world heritage sites. Project tiger/project elephant/project rhino. National Bureau of Plant Resources Centre (NBPGR), National Centre of Animal Genetic Resources (NBAGR), National Bureau of Fish Genetic Resources. NBPGR has 1,63,155 accessions of agri-horticultural crops-collections.

305

Table 7.15

Insitu conservation

1.

National parks

95

2.

Wildlife sanctuaries

500

3.

Biosphere reserves

12

4.

Tiger reserves

28

5.

Mangrove areas

15

6.

Coralreef areas

04

7.

Ramsar sites

07

8.

Wetland areas

17

9.

World heritage sites

05

10. Protected Areas

597

(Enviro news, October, 1998, November, 1998 and other sources and some recent data.)

Quantification of Biodiversity Quantifying biological diversity, understanding their association and similarities between ecosystem, communities or mapping of regions with regard to resource availability, utilisation pattern and biodiversity distribution are very important for conservation of biodiversity and their sustainable use. Some of the publications (Ludwig and Reynolds, 1988, Patil and Johnson, 1997) help the scientist to use appropriate techniques for the quantification of biodiversity. For calculating diversity, dominance and evenness indices, similarity indices and association analysis or Principal component analysis, the text of this book is useful. The paper by Patil et. al., 1997, elucidating the echelon concept is also useful for understanding biodiversity patterns. Action Plan (Remedial Measures) As per the constitution of India (Article 51A(g) introduced by the 42nd amendment), it shall be the duty of every citizen of India to project and improve the natural environment including forests, lakes, rivers and wild life and to have compassion for living creature. In 1974, the Water (Prevention and Control of Pollution) Act was enacted and then the Water Cess Act, 1977 was enacted. Water is in the State list. The Air (Prevention and Control of Pollution) Act, 1981 (Article 253 of the Constitution, Prevention and Control of Pollution) was enacted. Air is in the union list. Later in 1986, the Parliament passed a comprehensive Act called the Environment (Protection) Act to address all aspects of the problems of pollution and environmental degradation and then the Public Liability Insurance Act, 1991 was enacted. Besides, many regulations have been made for the protection of human environment in India. The Wild Life (Protection) Act, 1972 and Forest Conservation Act, 1980, the Biodiversity Act, 2002–2003 are legal instruments. Government or non-government organisations have not taken up these studies in an organized manner. Some work has been done by the universities and other research and educational institutions and department of forests but these are to be documented (SOE, 2006). Although Zoological Survey of India and Botanical Survey of India conduct this work but the work is so huge, lot of efforts are to be made. This situation prevails in many states. Hence, we have to urgently think of (i) setting biotic resource inventory for every state, (ii) identifying the endangered, vulnerable, rare and threatened species

306

Fundamentals of Ecology

and ecosystems, (iii) identifying disease causing organisms, vectors etc., and devising methods for their eradication or control in the context of environmental management, (iv) biotic salvage operations for ecosystems and threatened species populations, and (v) creating trained man power for taking up ecosystem analysis especially from the biological damage control point of view and for sustained yield point of view. The problems are extremely complex. Understanding the principles of ecology and systems analysis will be suitable to develop appropriate strategies for environmental management. Considering the complexities of the problems, an integrated approach involving several disciplines like forestry, wild life, environmental science, environmental engineering, etc. depending upon the problem at hand will be ideal to plan and manage the environmental problems and achieve desirable success. Biodiversity consideration is very important in environmental management as any developmental project may cause severe damage to them. The scientific research and the scientists particularly in the developing countries shall have to take more social responsibility to solve these problems because the existing management strategies in many of these countries are based on an inadequate base of scientific information. An educated citizen, government official and managers should be able to understand the meaning of biodiversity with regard to genes, species, populations, ecosystems, biomass, landscapes, etc., and they have to appreciate a holistic view of the systems keeping short and long-term benefits to mankind in view. They should be able to appreciate the uniqueness of the ecological patterns of an area and natural processes that maintain the pattern. They should be able to define the boundaries of that pattern as it help them to know the ecological requirements of a taxa. Biodiversity is the key to maintain ecological patterns and diverse trophic niches. All these can be considered as maintenance of ecological order. Man is an integer of nature and his activities affect ecological patterns. Hence, the disturbance processes are to be understood and impact assessments are made on both long-term and short-term basis. Since biodiversity is linked to human survival, the question arises—who are we to destroy or even deplete biodiversity and in the process interfere with evolutionary process? Since every species is a masterpiece and has a role to play in the ecosystem and brings stability to the system and has so much to contribute to man for its survival and living, should not we be compassionate for biodiversity conservation for the sake of continuance of man on this planet? World Trade Human rights, Traditional knowledge on alternate medicine and other aspects are linked to biodiversity. Biodiversity conservation requires sustainable management of the environment. We have to give top priority to hot spots pockets of wild nature like the Silent valley, Chilka lake, Western Ghats, Eastern Ghats (Similipal, Gandhamardan, etc.), Himalayan mountain ranges and coastal mangroves areas (i.e., Bhittarkanika) that contain rich biodiversity and high concentration of endangered species. For this we require commitment not only from the scientists and technocrats, but also, from political parties and people at large. Environmental laws like the Forest Act, Wildlife Act, Water Act, Air Act, Biodiversity Act etc. are important instruments to protect environment. Environmental education and awareness creation through media, newspapers, workshops, seminars, performing arts, etc. are also important tools. 7.3.5 Wild Life and its Protection

Wild life is considered a renewable resource, and hence, its management is important if we desire a sustainable yield. Man has killed millions of wild animals for various reasons and destroyed forests for timber, firewood and other purposes. During the last 2,000 years, about 100 species of mammals and 88 of birds have become extinct. Now, on the average, one mammal and one bird species become extinct every year. The Indian subcontinent includes about 1,200 species of birds and 400 species of

Natural Resource Ecology

307

mammals, and 15,000 of flowering and 31,000 of non-flowering plants. The diversity of Indian wild animals constitutes a great national resource. Common Indian mammals are the Macaca mulata, Semnopithecus entellus, Panthera tigris, Hyaena, Canis aureus, Melursus ursinus, Lutrogale perspicillata, Hystrix leucura, Elephas maximus, Bubalus bubalis, Boselaphus tragocamelus, Rusa unicolor nigra, Axix axis, Tetraceros quadricornis and Manis crassicaudata. The national bird is Pavo cirstatus. India has rich bird fauna and migratory birds come from northern Europe in large numbers during winter to aquatic ecosystems in India. Three species of crocodiles are found in Indian rivers. These are the marsh crocodile or mugger (Crocodilus palustris), the estuarine crocodile (Crocodilus porosus) and the gharial (Gavialls gangeticus). The monitor lizard, Varanus salvator, is also common in India. The sea turtle, Lepidochelys olivacea, lays eggs on the Orissa coast and some other coasts in India. The amphibian, fish and invertebrate fauna are also very rich. These wild animals form an important resource because they provide (a) food (meat), (b) skin (leather footwear), (c) are used in research as experimental animals and for education, and, (d) are used for recreational purposes. The niche requirements of these animals are different. The International Union for Conservation of Nature (IUCN) and its species survival commission have published two volumes on animals, which are in danger of extinction. This is the Red Data Book, which lists 277 mammalian and 321 bird species as endangered. The following factors are mainly responsible for depletion of wild life in India: (i) Destruction of habitat due to expanding agriculture, urbanisation and industrialisation. (ii) Poaching by man for meat, skin, sport, etc. (iii) Competition from domestic livestock and transmission of diseases from them. (iv) Overgrazing by domestic animals. (v) Export of some species. Before independence, the main cause of depletion of wild animals was hunting by man. The Indian cheetah (Acinonyx jubatus venaticus), the one horned rhino (Rhinoceros sandaicus) and the Sikkim stag (Cervus elaphus wallichi) have become extinct in their natural habitats. Among birds, the mountain quail (Ophrysia superciliosa) has become extinct. The most threatened mammals, birds and reptiles in India area: Mammals Hanuman langur (Presbytis pileatus), lion tailed macaque (Macaca silensus), white boowed gibbon (Hylobates hoolock), lion (Panthera leo persica), leopard (Panthera pardus), golden cat (Fellis temmincki), lynx (Felix lynx), Indian wolf (Canis lupus pallipes), sloth bear (Melurus ursinus) and many others. Birds

The Great Indian Bustard (Choriotis nigriceps) and the white winged wood duck (Cairina acutalata).

Reptiles

Monitor lizard (Varanus salvator), the three species of crocodiles and the Himalayan Newt (Tylototriton verrucosus).

Amphibia

The viviparous toad, Indian Salamander.

India’s large geographical size and variety of climatic and habitat conditions have given rise to great biological, particularly, floral diversity. The ten largest Indian plant families with their number of genera and species are given in Table 7.16.

Fundamentals of Ecology

308 Table 7.16

The eleven largest plant families with their genera and species (based on Jain, 1990)

Family

No. of genera

No. of species

Average number of species per genus

Poaceae (Gramineae)

225

1,225

5.44

Asteraceae (Compositae)

161

754

4.62

Orchidaceae

145

990

6.82

Fabaceae (Papilionaceae)

123

775

6.30

Rubiaceae

90

495

5.5

Acanthaceae

84

379

4.5

Euphorbiaceae

74

419

5.6

Lamiaceae (Labiatae)

68

393

5.7

Scrophulariaceae

66

356

5.39

Brassicaceae (Cruciferae)

64

182

Cyperaceae

24

449

2.84 18.7

Four factors have contributed to endemism in Indian flora (Jain, 1990). These are: (a) High mountain barriers. (b) Oceanic barriers (Arabian Sea, Bay of Bengal and Indian Ocean) influencing the whole of India, particularly the southern region. (c) Arid conditions in the western part. (d) Humid tropical conditions in the peninsular and northeastern regions. Threat to flora The main factors threatening flora are: (a) natural events, such as earthquakes, floods, landslides and competition and (b) man-made events like habitat destruction by mining activities, deforestation, grazing and so on. It is estimated that 10% of the flora of the world is endangered. Of the 15,000 species of flowering plants, about 20% (3,000 species) are under varying degrees of threat. A few hundred taxa have become extinct. Species of the Orchio genus, Coelogyne albolutes Rolfe, Coelogyne assamica, Lind and Reich and C. treutleri Hkf. have become EXTINCT in India. The Botanical Survey of India have prepared four Red Data Books for plants. About 450 plant species have been identified as endangered, rare or threatened in India. A list of some common trees and some endangered rare and threatened plants of India are given in tabular form. Biosphere reserves have been established for conserving Indian flora.

The following measures should be taken for the conservation of wild life in India: 1. Protecting the natural habitat of wild animals and controlled killing with regard to the carrying capacity of the natural habitat. 2. Water sources such as streams and waterfalls in natural habitats should be properly managed and guarded carefully for the benefit of wild life. In summer, these water sources become particularly important. 3. Threatened species should be allowed to breed and live comfortably in game reserves, sanctuaries and national parks. Near extinct species should be maintained in zoological parks. 4. Poaching should be completely banned in sanctuaries/ game reserves.

Natural Resource Ecology

5. 6. 7. 8. 9. 10. 11. 12.

309

Social forestry mainly deals with monoculture of trees. Polyculture of trees in forests should be practiced, since it helps diversified wild life. Trees in forests should not be cut frequently and heavily. Light cuts at regular intervals are desirable. Controlled burning increases forage and preserves organic matter in the soil. Areas may be burnt by rotation and burning may be done in blocks with unburnt areas in between. Artificial salt licks are necessary for animals for their health and growth, and should be provided in natural habitats and sanctuaries. Grazing by domestic animals near forest zones or inside forests should be regulated so that wild animals are not adversely affected. Wild animals should not be allowed to come in contact with domestic animals frequently as there is danger of spread of diseases from the domestic animals. Cultivation near sanctuaries should be banned so that the effects of pesticides and human interference are minimised. The public should be made aware of the importance of wild life conservation.

Table 7.17

Some common trees of subtropical zone of India

Family Anacardiaceae

Species

Utility value

Buchanania lanzan

Fruits edible

Mangifera indica

Fruits edible

Anacardium occidentalis

Fruits edible

Semicarpus anacardium

Medicinal value

Anonaceae

Anona squamosa

Fruits edible

Apocynaceae

Holarrhena antidysenterica

Medicinal value

Nerium oleander

Medicinal value soil binder

Cassia auriculeformis

Fuel wood

Cassia fistula

Medicinal

Tamarindus indica

Fruits edible

Terminalia belarica

Medicinal

Terminalia chebula Terminalia tomentosa

Medicinal, fruits edible by deers and wild herbivores, timber wood and silkworm rearing.

Terminalia arjuna

Medicinal and timber yelding.

Caesalpineae

Combretaceae

Convolvulaceae

Ipomoea crassicaulis

Dipterocarpaceae

Shorea robusta

Timber, medicinal

Ebenaceae

Diospyros melanoxylon

Fire wood and fruits edible

Diospyros sylvetica

Fire wood

Cleistanthus collinus

Fire wood and housing

Euphorbia jivulea

Fencing

Bridellia retusa

Timber and firewood

Euphorbiaceae

(Contd)

Fundamentals of Ecology

310 Table 7.17 (Contd) Dalbergia sissoo

Timber

Dalbergia latifolia

Timber

Gramineae

Dendrocalamus strictus

Housing, agril, implements

Lytheraceae

Woodfordia fruticosa

Fencing, housing and medicinal value

Lagerstroemia parviflora

Timber and firewood

Strychnos nux-vomica

Edible fruits by horn bill

Alangium salvifolium

Fruits edible by birds and animals

Malvaceae

Hibiscus rosasinesis

Ornamental flower

Meliaceae

Azadirachta indica

Medicinal value and pesticidal value

Movaceae

Ficus bengalinesis

Shelter plant

Ficus glomerota

Fruits edible by birds

Ficus religiosa

Shelter plant, fruits edible by birds

Atrocarpus lakocha

Fruits edible

Acacia nilotica

Wood, soil binder

Acacia oenophloea

Fruit edible by wild animals

Acacia aureculiformis

Wood

Albizzia lebbek

Timber, wood, housing

Psidium guava

Fruits edible

Eucalyptus terricornis

Timber, wood

Sizygium cumini

Fruits edible

Borassus flabellifera

Fruits, seed edible; Leaf used for housing

Phoenix acaulis

Housing, fruits edible

Phoenix regia

Housing, fruits edible

Cocos nuciferae

Fruit edible, leaf housing

Butea monosperma

Housing

Moringa oleifera

Edible leaf, fruit

Zizyphus jujuba

Fruit edible, fencing

Zizyphus oenophlia

Fruit edible, fencing

Morinda tinctoria

Dye is extracted from root.

Ixora praviflora

Fuel

Rutaceae

Aegle marmelos

Medicinal plant, fruits edible

Sapotaceae

Madhuca indica

Flower, fruit edible

Urticaceae

Strebulus aspera

Leaves used by carpenter

Verbenaceae

Lantana camara

Fencing

Vitex nigundo

Medicinal, fencing soil binder

Tectona grandis

Timber

Fabaceae

Loganiaceae

Mimoseae

Myrtaceae

Palmaceae

Papilionaceae

Rhamnaceae

Rubiaceae

(Source: Own study in Orissa and based on TK Bose, P Das and GG Maiti, 1998, Trees of the World, Regional Plant Resource Centre, Bhubaneswar).

Natural Resource Ecology

Table 7.18

311

Number of species belonging to different plant groups, in Amarkantaka, M.P. Plant groups

Number of species

Angiosperms

864

Gymnosperms

17

Pteridophytes

25

Bryophytes

16

Fungi

41

Algae

6

Lichens

3

Total

Table 7.19

Sl. No.

972

Density of trees on three topographical gradients in the 10 forest ranges of Amarkantak area, Madhya Pradesh

Forest Range

Density of trees per hectare Plateaus

Slopes

Plains

Total tree density/ha

1.

Achanakmar

(42) 1,560

(47) 1,349

(52) 1,571

4,480

2.

Amarkantak

(24) 1,274

(24) 1,354

(25) 1,269

3,897

3.

Belgahna

(29) 742

(36) 918

(41) 1,051

2,711

4.

Karanjia

(31) 963

(32) 980

(29) 845

2,788

5.

Khudia

(47) 823

(45) 853

(40) 828

2,504

6.

Khurdi

(21) 1,201

(26) 964

(16) 662

2,827

7.

Kota

8.

Lamni

9.

Lormi

10.

Pendra

(32) 934

(43) 1,504

(51) 1,912

4,350

(31) 1,157

(38) 1,074

(27) 1,524

3,755

Totally plain area (16) 588

(44) 1,920 (22) 937

(19) 1,159

2,684

In brackets are the number of species. After Kandya and Prasanth (2007)

Table 7.20 Sl. no.

The first ten largest plant families of Amarkantak area, M.P. Number of species

Number of Genera

1.

Poaceae

Family

110

56

2.

Leguminosae

83

38

3.

Asteraceae

66

49

4.

Cyperaceae

36

9

5.

Acanthaceae

33

17

6.

Lamiaceae

24

14

7.

Malvaceae

24

9 (Contd)

Fundamentals of Ecology

312 Table 7.20 (Contd) 8.

Scrophulariaceae

23

11

9.

Rubiaceae

21

15

10.

Euphorbiaceae

20

12

After Kandya and Prasanth (2007)

Table 7.21 Sl. No.

Endemic tree species observed in Amarkantak, M.P. Endemic tree species

Family

Locality

1.

Abelmoschus ficulneus

Malvaceae

Achanakmar

2.

Aeginitia indica

Orobanchaceae

Achanakmar

3.

Aristolochia bracteolate

Aristolochiaceae

Kabir

4.

Biophytum petersianum

Oxalidaceae

Achanakmar

5.

Caesalpinia bonduc

Caesalpiniaceae

Lamni

6.

Ceropegia hirsute

Asclepiadaceae

Amarkantak Plateau

7.

Cocculus hirsutus

Menispermaceae

Amarkantak Plateau

8.

Dillenia pentagyna

Dilleniaceae

Lamni

9.

Dioscorea wightii

Dioscoreaceae

Amarkantak Plateau

10.

Drosera burmannii

Droseraceae

Amarkantak Plateau

11.

Drosera indica

Droseraceae

Amarkantak Plateau

12.

Epipgon roseum

Orchidaceae

Amarkantak Plateau

13.

Eriolanea hookeriana

Sterculiaceae

Lamni

14.

Exacum carintum

Gentianaceae

Amarkantak Plateau

15.

Exacum pedunculapum

Gentianaceae

Amarkantak Plateau

16.

Flacourtia indica

Flacourtiaceae

Amarkantak Plateau

17.

Hedychium ellipticum

Zingiberaceae

Amarkantak Plateau

18.

Hedychium coronarium

Zingiberaceae

Amarkantak Plateau

19.

Limnophilla connata

Scrophulariaceae

Saihawal

20.

Pimpinella diversifolia

Apiaceae

Amarkantak Plateau

21.

Rotala serpyllifolia

Lythraceae

Amarkantak Plateau

22.

Tamarix ericoides

Tamaricaceae

Khudia

23.

Thalictrum foliolosum

Ranunculaceae

Amarkantak Plateau

24.

Thalictrum javanicum

Ranunculaceae

Amarkantak Plateau

25.

Utricularia graminifolia

Lentibulariaceae

Amarkantak Plateau

26.

Wahlenbergi erecta

Campanulaceae

Amarkantak Plateau

27.

Wahlenbergia marginata

Campanulaceae

Amarkantak Plateau

28.

Zingiber roseum

Zingiberaceae

Amarkantak Plateau

29.

Zingiber zerumbet

Zingiberaceae

Amarkantak Plateau

After Kandya and Prasanth, (2007)

Natural Resource Ecology

Table 7.22

313

Endangered flora of India. Some of the endangered/ rare/ threatened plant species are mentioned below (data collected from various sources)

01.

Abies delavaiyi (Pinaceae)

02.

Acanthephippium sylhetense (Orchidaceae)

03.

Adinandra griffithii (Theaceae)

04.

Aglaia perviridis (Meliaceae)

05.

Anacolosa ilicoides (Oleaceae)

06.

Anoectolchilus sikkimensis (Orchidaceae)

07.

Antiopteris erecta (Angiopteridaceae)

08.

Aphyllorchis Montana (Orchidaceae)

09.

Arachnanthe cathcartii (Orchidaceae)

10.

A. clarkei (Orchidaceae)

11.

Artemisia amygdolina (Asteraceae)

12.

Arundina grammifolia (Orchidaceae)

13.

Astragalus strobiliferus (Papilionaceae)

14.

Atropa acaminata (Solanaceae)

15.

Balanophora dioica (Balanophoraceae)

16.

Botrychium virginianum (Ophioglossaceae)

17.

Brainae insignis (Blechnaceae)

18.

Camellia caduca (Theaceae)

19.

Catamixis baccharoides (Asteraceae)

20.

Colchicum lutcum (Liliaceae)

21.

Captis teeta (Ranunculaceae)

22.

Cyathea gigantean (Cyatheaceae)

23.

Cymbidium macrorhizon (Orchidaceae)

24.

Cypripedium cordigerum (Orchidaceae)

25.

C. elegans (Orchidaceae)

26.

C.himalacicum (Orchidaceae)

27.

C. macranthon (Orchidaceae)

28.

Dendrobium densiflorum (Orchidaceae)

29.

Dianthus coschemiricus (Caryophyllaceae)

30.

Didiciea cuningnamu (Orchidaceae)

31.

Dioscorea deltoidea (Dioscoreaceae)

32.

Dipteris wallichii (Dipteridaceae)

33.

Discludia benghalensis (Asclepiadaceae)

34.

D. roflesiana (Asclepiadaceae)

35.

Drosera indica (Droseraceae)

36.

D. burmanni (Droseraceae)

37.

Elaeocarpus purnifotius (Elaeocarpaceae)

38.

Eremostachys superba (Lamiaceae)

39.

Eria crassicaulis (Orchidaceae)

40.

Galeola lindleyana (Orchidaceae)

41.

Gastrodia exilis (Orchidaceae)

42.

Gentiana kurroo (Gentianaceae)

43.

Hedysarum cachemirianum (Papilionaceae)

44.

Helminthostachys zeylanica (Helminthostachyaceae)

45.

Helwingia himalaica (Helwingiaceae)

46.

Ilex embelioides (Aquifoliaceae)

47.

Iodes hookeriana (Leacinaceae)

48.

Lavatera kashmiriana (Malvaceae)

49.

Lespedeza elegans (Papilionaceae)

50.

Loropetalum chinense (Hamamelidaceae)

51.

Magnolia grifithii (Magnoliaceae)

52.

M. gustavi (Magnoliaceae)

53.

M. pteroorpa (Magnoliaceae)

54.

Meconopsis betonicifolia (Papaveraceae)

55.

Nardostachys grandiflora (Valerianaceae)

56.

Nepenthes khasiana (Nepenthaceae)

57.

Olax nana (Olaceae)

58.

Ormosia glauca (Papilionaceae)

59.

Osmunda regalis (Osmundaceae)

60.

Paphiopedilum druryi (Orchidaceae)

61.

P. fairleanum (Orchidaceae)

62.

P. hirsutissimum (Orchidaceae)

63.

P. insigne (Orchidaceae)

64.

P. spicerianum (Orchidaceae)

65.

P. venustum (Orchidaceae)

66.

P. villosum (Orchidaceae)

67.

Phyllostachys bambusoides (Poaceae)

68.

Picea brachytyla (Pinaceae)

69.

Platycerium wallichii (Polypodiaceae)

70.

Pleione humilis (Orchidaceae) (Contd)

Fundamentals of Ecology

314 Table 7.22 (Contd) 71.

Podophyllum hexandrum (Podophyllum)

72.

Populus gamblei (Salixaceae)

73.

Potameia paradoxa (Lauraceae)

74.

Psilotum nudum (Psilotaceae)

75.

Rauvolfia serpentina (Apocynaceae)

76.

Renanthera inschootiana (Orchidaceae)

77.

Rheum nobile (Polygonaceae)

78.

Rhododendron aritelum (Ericaceae)

79.

R. dalhousiae (Ericaceae)

80.

R. edgeworthii (Ericaceae)

81.

R. nivale (Ericaceae)

82.

R. nutallii (Ericaceae)

83.

R. santapaui (Ericaceae)

84.

R. stenaulum (Ericaceae)

85.

Rhus hookeri (Anacardiaceae)

86.

Sapris himalayana (Rafflesiaceae)

87.

Saussiaea bracteata (Asteraceae)

88.

S. gnaphalodes (Asteraceae)

89.

S. lappa (Asteraceae)

90.

Schizaea digitata (Schizaeaceae)

91.

Tetracentron sinense var himalense (Tetracentraceae)

92.

Thylacospermum rupifragrum (Caryophyllaceae)

93.

Vanda coerulea (Orchidaceae)

94.

V. pumila (Orchidaceae)

95.

Vanilla pilifera (Orchidaceae)

96.

Viola falconeri (Violaceae)

97.

Zanthoxylum scandens (Rutaceae)

98.

Commiphora wightii (Burseraceae)

99.

Helichrysum cutchicum (Asteraceae)

100

Hyphaene dichotoma (Arecaceae)

101

Rosa involucrate (Rosaceae)

102

Aldrovanda vesiculosa (Droseraceae)

103

Anemia tomentosa (Schizaeaceae)

104

Apama barberi (Aristolochiaceae)

Wild Life Protection The government has created many national parks and sanctuaries (Table 7.8c) for the protection of wild life. A national park is an area dedicated by statute for all times (permanent status) to conserve the scenery, natural or historical objects of national importance and wild life. Provision may also be made for public recreation. A sanctuary is created in an area where killing or capturing of any species of animals is prohibited except under the orders of the competent authority and whose boundaries and character should be sacrosanct as far as possible. A sanctuary is created by the order of a competent authority (provincial forest departments by a gazette notification) while a national park is created or abolished by the legislature of a province or by the parliament. Thus, the status of a national park is higher.

The Indian Board of Wild Life was established in 1952 and wild life week has been observed in July every year since 1955. Wild life week is observed to create an awareness among people with regard to the importance of wild life and to highlight the conservational and management needs of wild life in India. The following are the important sanctuaries and national parks in India. Assam 1. The Kaziranga sanctuary is famous for the one-horned rhinoceros, 2. The Manas sanctuary

is known for its wild buffaloes. Bihar

A national park has been created in Hazaribagh.

Gujarat

The Gir forest is famous for lions, Nilgai, Chital, Sambar and wild bears.

Andhra

Kelameru bird sanctuary is famous for pelicans and marine birds.

The Dachigam sanctuary is known for its Kashmir stags, Himalayan Tahr, wild goats, sheeps, antelopes and so on. Jammu and Kashmir

Natural Resource Ecology

Karnataka

315

The Bandipur sanctuary is famous for the Indian bison, elephants, common langurs and

porcupines. Kerala

The Periyar sanctuary is famous for its elephants, gaur, barking deer, sambar, etc.

Madhya Pradesh

Kanha National Park is known for its tigers, leopards, wild dogs and swamp deer.

Orissa Similipal National Park is situated in Mayurbhanj district. Bhittar Kanika National Park in undivided Cuttack district includes the surviving mangroves and their associated fauna. Marine turtles, Lepidochelys olivacea, come in huge numbers to lay their eggs on the coasts of Gahirmatha of this national park. Badrama National Park in Sambalpur district is famous for its elephants and Satkosia George National Park in Dhenkanal-Angul district for its crocodiles. The Nandan Kanan sanctuary near Bhubaneswar in Khurdha or undivided Puri district is a zoological park cum sanctuary. Rajasthan

Bharatpur bird sanctuary is well known for its ducks and herons and Ranthambore for tigers.

The Mundathural sanctuary is renowned for its tigers and deer. Point Calimere sanctuary in the Tanjavur district is known for its sea birds, pelicans, flamingo, etc. and for deer. Annamalai sanctuary is famous for its elephants, gaur (Indian bison), sambar, chital, nilgiri tahr, lion tailed macaque, barking deer and so on. The Guindy deer park has been created near Madras city, and the Vadanthangal bird sanctuary about 85 km south of Madras city.

Tamil Nadu

The Corbett National Park is famous for its tigers, barking deer, sambar, chital, wild bear, rhesus monkey, jackals, common langur and peafowl. Uttar Pradesh

The Jaladpara sanctuary is known for its rhinoceroses. The tiger (Panthera tigris) is India’s national animal (previously the lion was the national animal). Project Tiger for the conservation of the tiger was started on April 1, 1973 and now about 4,000 tigers and 6,828 leopards are present in different states in India (Table 7.23). The national bird is the peacock (Pavo cristaus) and the national flower is the lotus (Nelumbo nucifera). The name of elephant reserves and data on their populations are given in Table 7.24.

West Bengal

Table 7.23

Population of Tigers in the tiger reserves as reported by the states

Sl.

Name of Reserve

1972

1979

1984

1989

1993

1.

BANDIPUR (KARNATAKA)

2.

CORBETT (UTTARANCHAL)

3.

KANHA (MADHYA PRADESH)

43

71

4.

MANAS (ASSAM)

31

69

5.

MELGHAT (MAHARASHTRA)

27

63

6.

PALAMAU (HHARKHAND)

22

37

7.

RANTHOMBORE (RAJASTHAN)

14

25

38

44

36

8.

SIMILIPAL (ORISSA)

17

65

71

93

95

9.

SUNDERBANS (WEST BENGAL)

60

205

264

269

251

10.

PERIYAR (KERALA)

-

34

44

45

30

11.

SARISKA (RAJASTHAN)

–

19

26

19

24

1995

1997

2001– 02*

10

39

53

50

66

74

75

82

44

84

90

91

123

128

138

137

109

97

100

97

114

127

123

92

81

94

125

65*

80

77

72

71

73

73

62

55

44

47

44

32

38

32

35

97

98

99

242

263

245

39

40

36

25

24

22 (Contd)

Fundamentals of Ecology

316 Table 7.23 (Contd) 12.

BUXA (WEST BENGAL)

–

–

15

33

29

31

32

31

13.

INDRAVATI (MADHYA PRADESH)

–

–

38

28

18

15

15

29

14.

NAGARJUNASAGAR (ANDHRA PRADESH)

–

–

65

94

44

34

39

67

15.

NAMDHAPA (ARUNACHAL PRADESH)

–

–

43

47

47

52

57

61

16.

DUDHWA (UTTAR PRADESH)

–

–

–

90

94

98

104

76*

17.

KALAKAD (TAMIL NADU)

–

–

–

22

17

16

28

27

18.

VALMIKI (BIHAR)

–

–

–

81

49

N.R.

53

53

19.

PENCH (MADHYA PRADESH)

–

–

–

–

39

27

29

40

20.

TADOBA (MAHARASHTRA)

–

–

–

–

34

36

42

38

21.

BANDHAVGARH (MADHYA PRADESH)

–

–

–

–

41

46

46

56

22.

PANNA (MADHYA PRADESH)

–

–

–

–

25

22

22

31

23.

DAMPHA (MIZORAM)

–

–

–

–

7

4

5

4

24.

PENCH (MAHARASHTRA)

–

–

–

–

–

10(1994)

–

14

25.

BHADRA (KARNATAKA)

–

–

–

–

–

–

–

35

26.

PAKHUI–NAMERI (ARUNACHAL PRADESH–ASSAM)

–

–

–

–

–

–

–

26 Nameri

27.

BORI–SATPURA–PACHMARI (MADHYA PRADESH)

–

–

–

–

30

–

–

35

268

711

1121

1327

1366

1333

1498

1576

Total * Provisional

Source: Dr. Chandra Sekhar Kar, Forest Department (Wildlife Oganisation, Government of Orissa).

Table 7.24

Tiger (Panthera tigris tigris) populations in Indian states (various sources)

States/Union Territory (Total Population) (Reserves) Andhra Pradesh (Nagarjuna Sagar) Arunachal Pradesh (Namdapha)

Number of tigers 1979

1984

148

164

1993/2006 Tiger

Leopard

197

152

–

65

–

–

139

219

180

98

–

43

–

–

300

376

325

246

(Manas)

69

123

–

–

Bihar

110

138

137

203

(Palamau)

33

62

–

–

Gujarat

7

9

5

772

Assam

(Contd)

Natural Resource Ecology

317

Table 7.24 (Contd) Haryana

0

1

0

25

Karnataka

156

202

305

455

(Bandipur)

36

53

–

–

Kerala

156

202

57

16

(Periyar)

34

44

–

–

Madhya Pradesh

529

786

912

1700

–

38

(Indravati)

–

–

Dadra and Nagar Haveli

0

15

Goa

3

31

Himachal Pradesh

0

821

(Kanha)

71

109

–

–

Maharashtra

174

301

276

417

(Melghat)

63

80

–

–

Manipur

10

6

–

–

Meghalaya

35

125

53

–

Mizoram

65

33

28

49

Nagaland

102

104

83

–

Orissa

173

202

226/101

378/127

(Similipal)

65

71

–

–

Rajasthan

79

96

64

475

(Ranthambhore)

25

38

–

–

(Sariska)

19

26

–

–

Sikkim

0

2

2

–

Tamil Nadu

65

97

97

138

Tripura Uttar Pradesh

5

–

18

698

465

711

(Corbett)

84

90

–

–

West Bengal

296

352

335

108

(Sunderbans)

205

264

–

–

Table 7.25 Sl. no.

6 487

Leopard (Panthera pardus).

Name of Tiger Reserve

State

Total area(in km2)

IUCN Rank

1.

Bandipur

Karnataka

866

2.

Corbett

Uttar Pradesh

1316

3

3.

Kanha

Madhya Pradesh

1945

1

4.

Manas

Assam

2840 (Contd)

Fundamentals of Ecology

318 Table 7.25 (Contd) 5.

Melghat

Maharashtra

1677

6.

Palamau

Bihar

1026

7.

Ranthambhore

Rajasthan

1334

8.

Similipal

Orissa

2750

7

9.

Sunderbans

West Bengal

2585

4

10.

Periyar

Kerala

777

11.

Sariska

Rajasthan

866

12.

Buxa

West Bengal

759

13.

Indravati

Madhya Pradesh

2799

14.

Nagarjunsagar

Andhra Pradesh

3568

15.

Namdapha

Arunachal Pradesh

1985

16.

Dudhwa

Uttar Pradesh

811

17.

Kalakad–Mundanthurai

Tamil Nadu

800

18.

Valmik

Bihar

840

19.

Pench

Madhya Pradesh

758

20.

Tadoba–Andheri

Maharashtra

620

21.

Bandhavgarh

Madhya Pradesh

1162

22.

Panna

Madhya Pradesh

542

23.

Dampha

Mizoram

500

Total

Table 7.26

6

2

5

33126

Elephant populations, mortality data, Location of elephant reserves in India. Province-wise population of elephants. State

Andhra Pradesh

Minimum

Maximum

46

46

Arunachal Pradesh

2,000

3,000

Assam

5,000

6,000

500

600

Karnataka

5,000

6,000

Kerala

3,000

4,000

Meghalaya

2,500

3,000

Orissa

1,500

2,000

Tamil Nadu

2,300

2,500

750

1,000

Bihar

Uttar Pradesh West Bengal Total Mean

200

200

22,796

28,346 25,571

Natural Resource Ecology

Table 7.27

319

Morality of wild elephants due to poaching and unnatural deaths

Year

Poaching

Natural

Total

Ivory pieces

1991–1992

61

28

89

46

1992–1993

56

77

133

20

1993–1994

54

121

175

20

1994–1995

33

151

184

26

1995–1996

85

215

300

171

1996–1997

60

256

316

183

1997–1998

27

106

133

148

Total

376

954

1330

614

Table 7.28

Location of elephant reserves with approximate area (in km2) and elephant population

Sl. no.

Location of the reserve

Area (km2.)

Population (approximately)

1.

South–West Bengal, South–East Bihar to Orissa

8,365

3,000

2.

Kameng in Arunachal Pradesh to Sonitpur in Assam

7,5000

1,580

3.

Dibru in Assam to Deomali in Arunachal Pradesh

5,000

1,800

4.

Kaziranga–Karbi Anglong in Assam to Intanki in Nagaland

4,500

1,800

5.

Barail in Assam to Saifung in Meghalaya

1,500

150

6.

Balphakram and adjoining areas in Meghalaya

1,800

2,500

7.

Nilgiri and Eastern Ghats in Tamil Nadu, Kerala and Karnataka

11,000

5,000

8.

Nilambur–Silent Valley in Kerala to Combatore in Tamil Nadu

2,500

600

9.

Annamalai in Tamil Nadu and Parambikulam in Kerala

3,000

1,500

10.

Periyar in Kerala to Madurai in Tamil Nadu

3,000

1,700

11.

Rajaji to Corbett in Uttar Pradesh

8,000

750

(Enviro News, December 1998).

Table 7.29 Sl. no.

Common and zoological names of wild animals of the Kanha Wildlife National Park, India. Common names

Zoological names

1.

Chital

Axis axis ERXLEBEN

2.

Monkey (langur)

Presbytis entellus DUFRESNE

3.

Wild pig

Sus scrofa LINN

4.

Samber

Cervus unicolor KERR

5.

Barking deer

Muntiacus muntjak ZIMMERMANN

6.

Barasingha

Cervus duvauceli-branderi POCOCK

7.

Gaur

Bos gaurus H.SMITH (Contd)

Fundamentals of Ecology

320 Table 7.29 (Contd) 8.

Chausingha

Tetracerus quadricornis BLAINVILLE

9.

Wild dog

Cuon alpinus PALLAS

10.

Jungle cat

Felis chaus GULDENSTAEDT

11.

Tiger

Panthera tigris LINN

12.

Neel gai (blue bull)

Boselaphus tragocamelus PALLAS

13.

Sloth beer

Melursus ursinus SHAW

14.

Panther (leopard)

Panthera pardus LINN

15.

Blackbuck

Antilope cervicapra LINN

16.

Mouse deer

Tragulus meminna ERXLEBEN

17.

Hyena

Hyaena hyaena LINN

18.

Hare

Lepus nigricollis F.CUVIER

19.

Mongoose

Herpestes edwardsi GEOFFROY

20.

Peafowl

Pavo cristatus LINN

21.

Red jungle fowl

Gallus gallus LINN

22.

Porcupine

Hystrix indica KERR

23.

Python

Python molurus LINN

After Pandey, Kandya and Kotwal (1986)

Table 7.30

Ungulate Chital

Barasingha

Samber

Barking deer

Density and biomass of common wild ungulates in various wildlife national parks of South Asia National park

Unit weight (kg)

Density/ km2

Biomass (kg/km2)

Authority

Wiltpau, Sri Lanka

45.0

12.0

540

Chitwan, Nepal

54.8

17.3

948.0

Seidensticker (1976)

Eisenberg and Lockart (1972)

Spillet (1967)

Bharatpur, India

45.0

12.3

531.0

Bandipur, India

45.0

36.0

1,620

Karnali Bardia, Nepal

48.4

33.9

1,641.0

Kantha, India

51.0

193.7

9879

Pandey et.al (1986)

Karnali Bardia, Nepal

159.0

0.5

80.0

Dinerstein (1979)

Kanha, India

159.0

24.4

3880

Pandey et.al (1986)

Wiltpau, Sri Lanka

135.0

1.0

135.0

Eisenberg and Lockart (1972)

Kanha, India

143.0

0.9

129

Pandey et.al (1986)

Wiltpau, Sri Lanka

13.4

2.3

31

Eisenberg and Lockart (1972)

Karnali Bardia, Nepal

18.0

1.7

31

Dinerstein (1979)

Wiltpau, Sri Lanka

13.4

2.5

34

Barrette (1977)

Kanha, India

18.0

0.07

1.30

(After Pandey, Kandya and Kotwal, 1986)

Dinerstein (1979)

Pandey, Kandya and Kotwal (1986)

Natural Resource Ecology

321

Range Lands It is necessary to provide grazing grounds to cows, buffaloes, goats and sheep, and for this purpose ranges (pastures) need to be maintained in areas specially suited to biotic climaxes of grasslands. Lands which are not sufficiently stable under crop cultivation are usually suitable as ranges. The effect of grazing is an important factor to be considered in range management. The intensity and frequency of grazing have to be regulated after careful research, to maintain forage production at a high rate. In the management of ranges, the rate of removal of resource should be regulated to a level up to which the system can rebuild itself.

The effect of grazing on seed output, reproductive capacity, establishments, vegetative growth and flowering in relation to climate, soil and biotic pressure of grazing and scraping are some of the more important ecological aspects. The distribution of geographical races of grasses, palatability, nutrient value and so on may lead to the introduction of better foreign elements in ranges. Some important techniques in ranges management are as follows. The number of grazing animals should be such that they can be adequately maintained in normal productive years and profitably sold off in years of drought.

Stock level

The range may be divided into a number of compartments. Grazing in successive periods is regulated in such a way that in each compartment, a grazing year alternates with a non-grazing year, so that there is always a mature and full-grown stand available.

Deferred grazing

Fire

The use of fire for regulating desired and palatable species in grasslands is a common method.

Other methods These include the use of herbicides and pesticides to get rid of unwanted species so that palatable species grow well. In India, some 4% of the land is used as pasture and grazing land. The pressure on these lands is very heavy. Ranges are important resources as milk and meat production depends upon range management. Agriculture Agricultural land, a farm or a ranch, is a man-managed ecosystem, which is scientifically manipulated to achieve maximum sustained productivity. Agriculture has evolved beyond crop culture to become an environmental technology with its prime focus on the management of land (soil), water, air, pest control, fertiliser application, use of high yielding seeds, crop management and so on. In primitive agriculture, a piece of land was kept under cultivation for some years depending upon the fertility of the land. Cleared forests (shifting cultivation) and sloping land initially gave good yields but led to soil erosion. People moved to new areas after converting fertile land to degraded wasteland. This was possible because abundant land was available. But with the population explosion, the situation changed. Since agricultural land is limited, modern agro techniques are now practiced to increase productivity.

The basic resources for agriculture are sunlight, soil and water. In a 12-hour day, about 500 kcal cm2 of solar energy is available on Earth and one estimate indicates that about 45% of it is utilised in photosynthesis. It has been estimated that about 140 tonnes of crop yield per hectare per year is possible in India but in practice only about 18% of this theoretical maximum (25 tonnes ha year) has been achieved in some good lands. Soil is very important resource as it takes a long time to form. One centimetre of topsoil may take 50 years to form. It has been estimated that every year about 6,000 million tonnes of soil are washed away by soil erosion, worldwide. Soil erosion and the improper use of soil need to be checked so that the crop yield increases. Indian agriculture depends largely on the monsoon as the country has only 40 million ha of irrigated land compared to 102 million ha of rainfed

Fundamentals of Ecology

322

land. The annual rainfall is about 370 ¥ 104 million m3, of which the southwest monsoon brings in 80%. Table 7.31A gives water resource data for some countries and Table 7.31B gives India’s water resource and water requirement for India (estimated). Table 7.31

Water resources

Table 7.31A

The availability of annual renewable fresh water some selected countries are Name of the country

National Water Policy for India dictates the basic principals for water related development:

In BCM (billion cubic metre)

Brazil

7,000

Russia

5,500

Canada

3,000

China

2,800

Indonesia

2,750

USA

2,700

Bangladesh

2,600

India

2,200

Venezuela

1,500

Myanmar

1,000

Colombia

1,000

Zaire

1,000

Japan

800

Pakistan

700

Nigeria

500

National Water Policy

•

National Water Policy was adopted in September, 1987 and modified in 2002.

•

In the planning and operation of systems, water allocation priorities should be broadly as follows: •

Drinking water

•

Irrigation

•

Hydro-power

•

Ecology

•

Agro-industries and nonagricultural industries

•

Navigation and other uses

Regarding per capita water availability Canada leads with 90,000 m3 followed by Venezuela at 55,000 m , whereas China and India the two most populated countries have only 1,850 and 1,780 m3 per capita. It appears that India is relatively comfortable in respect of over all water wealth as compared to other countries. 3

Table 7.31B

Total water requirement of India estimated by the National Commission of Integrated Water Resources Development Plan (NCIWRDP) Projected

Sl.

Category

In BCM

Year 2010

Year 2025

Year 2050

Medium

High

Medium

High

Medium

High

Irrigation

536

556

688

734

1008

1191

2.

Domestic

41.6

61

52

78

67

104

3.

Industries

37

37

67

79

81

116

4.4

5

12

13

40

44

–

–

4

4

7

7

1.

4.

Energy

5.

Inland navigation

6.

Flood control

–

–

–

–

–

–

7.

Afforestation

36

33

67

67

134

134 (Contd)

Natural Resource Ecology

323

Table 7.31B (Contd) 8.

Ecology

693

5

10

10

20

120

9.

Evaporation

36

36

42

42

65

65

10.

Total

693

733

942

1027

1422

1681

In conformity with national policy and for food security, irrigation development received highest priority as plan schemes until the 6th Five Year Plan. Irrigation infrastructure development has resulted in impounding 200 BCM in large / medium reservoirs and around 50 BCM in small storage leading to creation of 95 Mha of irrigation potential. Abstraction of 630 BCM of freshwater is currently for all users. Irrigation is the largest withdrawal at 83%. Total utilisable withdrawal is 1100 BCM out of the overall availability of 2200 BCM. Table 7.31C

Table 7.31d

Water use in India

Water uses in India

Particulars

Percentage

Irrigation

83.0

Drinking/municipal

4.5

Industry

3.0

Energy

3.5

Others

6.0

The water resources scenario in India Area in million ha.

Annual average precipitation

1,140 mm

Total available water

400 M. ha.

Net shown area

145 M. ha.

Gross cropped area

175 M. ha.

Irrigated area

70 M. ha.

Water demand for irrigation

46 M. ha.

Source: Bulletin, India Water Resources Society, Delhi Centre, New Delhi.

Of the total of about 329 million ha of land in India, about 142 million are under cultivation. Of India’s net national product of about Rs.20,00,000 million, agriculture contributes about 33%. In recent years, there has been a marked increase in crop productivity (Tables 7.32 and 7.32a) due to genetic manipulation, use of fertilisers, pest control methods, mechanisation, and sound ecological methods. Table 7.32

Food grain production in India (Million tonnes)

Food grains

Year 2001–2002

2002–2003

2003–2004

Rice

93.3

71.8

Wheat

72.8

65.8

Coarse cereals, maize, sorghum, millet

33.4

Pulses Food grains (i) Kharif, (ii) Rabi Total –(i) and (ii)

2004–2005

2005–2006

2006–2007*

88.5

83.1

91.8

90.0

72.2

68.6

69.4

72.5

26.1

37.6

33.5

34.1

32.0

13.4

11.1

14.9

13.1

13.4

14.5

112.1100.8

87.287.6

117.096.2

103.395.1

109.998.7

107.2102.0

212.9

174.8

213.2

198.4

208.6

209.2

Source: Economic Survey, 2006–07, Govt. of India * Estimate

Fundamentals of Ecology

324

Two to three crops have now become possible on the same land due to good irrigation and the use of short-duration-growth plants (genetic manipulation). Rice is the main cereal. Rice production has increased from 25 million tonnes in 1954–1955 to about 59 million tonnes in 1984–1985 to 82.3 million tonnes in 1997–1998 and to 90 million tonnes in 2006–2007. The yield per hectare has increased from 820 to 2,900 kg. Wheat is the most important rabi crop. The wheat yield per hectare during the above mentioned period has increased from 827 in 1954–1955 to 2,710 kg. The total wheat production was about 47 million tonnes (1985) and about 70 million tonnes in 1996–1997 and has increased further to 90 million tonnes in 2006–2007. The total production of pulses is about 15 million tonnes in 1996–1997 compared to 11 million tonnes in 1954–1955. The main pulses in India are pigeon pea or arhar, which contains about 22.3% protein. Soyabean, which contains 43.2% protein, is now being grown widely and the production in 2000–2006 was 8.1 million tonnes. The other important crops are oilseeds, sugar crops, fibre crops (cotton), potato and other tuber crops and plantation crops like tea, coffee, cocoa, rubber, coconut, cardamom, black pepper and other spices. India produces about 54.4 million tonnes of fruits from 5.9 million ha and 113.5 million tonnes of vegetables per year from 7.2 million ha. Table 7.32a

Some commercial crop production in India (Million tonnes)

Crop

2002–2003

2003–2004

2004–2005

2005–2006

2006–2007

Cotton

8.6

13.7

16.4

18.5

21.0

Spices

3.8

4.0

4.9

5.9

Plantation crops

13.1

9.4

10.4

9.8

Sugarcane

297.2

287.4

239.9

237.1

315.5

Flowers

0.2

0.60

0.7

0.8

0.60

Jute and Mesta

11.3

11.2

10.3

10.8

11.4

Rapeseed and mustard

3.9

6.3

7.6

8.1

7.6

Groundnut

4.1

8.1

6.8

8.0

4.4

Total nine oil seeds

14.8

25.2

24.4

28.0

23.6

Soyabean

4.7

7.8

6.9

8.3

8.7

The production of food grains was 150 million tonnes in 1984 and is now more than 200 million tones. The world production of wheat was 515 million tonnes in 1984–1985 and has increased considerably. Sharma (1987) estimates that under ideal conditions, the annual global production is adequate for feeding 6 billion individuals. Efforts are now being made all over the world to increase production by using biotechnological methods and putting a lot of auxiliary energy into agricultural fields. However, the crop yield varies from region to region depending upon the climatic factors, technology inputs and management strategies used. Modern agricultural practices also create a serious pollution problem. Agricultural lands need to be conserved from degradation and efficient management practices need to be followed. 7.3.7

Livestock as Renewable Resources

Livestock are an important resources, as they provide milk, eggs, meat, skin (leather) and other products. The total livestock in India mount to a huge population consisting of more than 185 million cattle, 118 million goats, 61 million buffaloes, 45 million sheep, 1 million horses and ponies, 1 million camels and

Natural Resource Ecology

325

about 1 million other livestock. Besides, there are 156 million tonnes poultry, fowls, ducks, turkeys, etc. They provide about more than 1 million tonnes of meat, 74 million tonnes of milk, 40 million kg of wool and 13 million eggs. The amount of dung produced is huge and is used for biogas production and as manure. Livestock are also used for rural transport and agriculture. To get a sustained yield, their proper breeding, health care and management and diet are essential. Recent advances in biology have helped produce better livestock. The milch breed (milk producing) cattle are the Gir, Red Sindhi, Deoni and Sahiwal and the draught breed (work animals) cattle are the Nagari, Malvi, Kenkatha, Khillari, Hallikar, Amrit Mahall, Ponwar, and Siri. The total milk production has increased from 17 million tonnes to 100 million tonnes in 2006– 2007. Some examples of dual-purpose (both for milk and work) cattle are the Rewati, Kankrej, Ongol and Danji. The humped zebu cattle originated in India and there is evidence that humpless cattle were domesticated in India during the Harappan period. India has the best water buffaloes in the world. These buffaloes are the Murrah, Surti, Nili-Ravi, Jaffarabadi and Mehsana. The common breeds of Indian sheep are Kashmir, Chokla, Magra, Kali, Gaddi and Bhakarwal. Breeds of Merino and Suffolk sheeps have been imported for production of better wool. Milk breeds of goat, such as Saanan, Alpore, Nubian and Toggenberg, have been introduced to develop better breeds to suit the Indian environment. The wool and textile breeds are Pashmina and Chegu, Beetal, Jamunapari, Barbati, Deccan, Black Bengal and Malbari. The niche requirements of sheep and goats are different. Livestock contributes at least 40,000 million rupees a year to our national economy. Of this, poultry contributes about Rs.10,000 million. Almost all the world’s fowls trace their origin to India’s red jungle fowl (Gallus gallus). Ducks constitute about 10% of the total poultry in India. In Indian, we have the Assel, Kadaknath and short–legged Nicobari breed fowls. The important broiler strains are B 77, JBL 80, IBB 83, ILI 80 and ILI 82. The list of threatened breeds of animals in India is given in Table 7.33. 7.3.8 Aquaculture as a Renewable Resource

Fish are an excellent source of protein. They feed on plankton (phytoplankton and zooplankton), weeds and organic matter. Crabs, prawns, molluscs, etc. are also aquatic organisms and are a very good source of animal protein for human beings. Over half the population in the developing countries gets at least 40% of its animal protein food from fish (FAO, Status of Food and Agriculture, 1984, Rome). The natural pearl industry depends upon oyster culture. Fishery includes capture fishery and culture fishery. Capture fishery is usually practiced in oceans, large lakes and other aquatic ecosystems. Culture fishery is usually practiced in inland water bodies and artificial ponds. Table 7.33

Threatened breeds of animals in India

Species

Breed

Place of origin

Cattle

Hissar

Hissar and Hansi areas of Haryana.

Yechuri

Kerala Siri

Sikkim, Nepal, Bhutan and adjoining hilly tracts.

Buffalo

Nili-Ravi

Ferozepur district of Punjab.

Mithun

–

Arunachal Pradesh, Nagaland, Tripura and Manipur.

Yak

–

Ladakh, Panni, Lahul, Spiti, Garhwal and Sikkim. (Contd)

Fundamentals of Ecology

326 Table 7.33 (Contd) Goat

Sheep

Horse

Camel Poultry

Jamunapuri

Etawah district and Chambal ravines.

Beetal

Gurdaspur district of Punjab.

Surti

Gujarat and Maharashtra.

Chengu

Mountainous ranges of Spiti, Zanskar, Tibet Plateau and upper ranges of Kashmir Valley.

Changathangi

Mountain ranges of Himalaya, Tibet and Ladakh.

Black Bengal

West Bengal, Bihar and Orissa.

Barbari

Agra and Aligarh districts of Uttar Pradesh.

Malbari

Kerala.

Osmanandi

Osmanabad in Andhra Pradesh.

Marwari

Marwari district of Rajasthan, Mehsana district of Gujarat.

Nilgiri

Tamil Nadu.

Mandya

Karnataka.

Magra

Rajasthan.

Lohi

Punjab.

Marwari

Rajasthan.

Patanwadi

Gujarat.

Deccani

Maharashtra.

Muzaffarnagri

Uttar Pradesh.

Gaddi

Himachal Pradesh, Jammu and Kashmir and hills of Uttar Pradesh.

Nellore

Andhra Pradesh.

Chennai Red

Tamil Nadu.

Hissar Dale

Hissar, Haryana.

Zanskari

Ladakh.

Spiti

Spiti valley in Himachal Pradesh.

Bhutia

Sub–Himalayan tract from Punjab to Darjeeling and along the Tibet Border.

Manipuri

Manipur and Assam.

Marwari

Rajasthan and Gujarat.

Kathiawari

Rajasthan and Gujarat.

Double humped

Ladakh.

Aseel

Andhra Pradesh.

Kadaknath

Jhabua and dhar districts of Madhya Pradesh.

Chagus

Andhra Pradesh and Karnataka.

Burra

Maharashtra and Gujarat.

Miri

Assam.

Source: National Report on Bio–Diversity (Enviro News, Feb. 1999).

Natural Resource Ecology

327

The global marine fish catch was about 76 million tonnes in 1984 and is on the increase. India’s marine fish catch was about 1.2 million tonnes in 1984 and it has reached 2.6 million tonnes in 1996 and it was 3.1 million tonnes in 2005. India has a very long coastline (about 5,600 km) and a continental shelf of about 2,59,000 km2. Thus, there is a vast area available for Table 7.34 Important constituents of marine catch from India (data from many sources) tapping. Marine resources include the Bay of Bengal, Arabian Sea, Indian Name Percentage of total landing Ocean, numerous gulfs, coral reefs and Oil Sardine 11.91 mangrove swamps. The estuaries of Other Sardine 5.20 major rivers, backwaters, lagoons and Sciaenid 7.92 brackish water lakes like Chilka, add Harpodon nehereus 6.76 to India’s marine resources. They form Mackerel 4.93 an additional 2.6 million ha. There is a Elasmobranchii 4.93 good possibility of increasing the fish Catfi sh 4.24 catch along the Indian coast using the sophisticated scientific techniques now Hilsa 3.86 available. Ribbon fish 3.36 In 1984, India produced about 3 million tonnes of fishery products, occupying the eighth position in the world. It has been estimated that this production can be increased to about 12 million tonnes per year. India’s inland waters occupy about 1.6 million ha. The important constituents of India’s marine catch are given in Table 7.34.

Pomfret

2.78

Leiognathus

2.73

Anchoviella

2.70

Perch

2.52

Caranx

2.43

Prawn

13.52

Others (Fish, Mollusca, etc.)

20.21

(Total landing 12,59,782 tonnes).

Table 7.34A Fish production (lakh tonnes) Year

Marine

Inland

Total

1950–1951

5.34

2.18

7.52

1960–1961

8.80

2.80

11.60

1970–1971

10.86

6.70

17.56

1973–1974

12.10

7.48

19.58

1980–1981

15.55

8.87

24.42

1981–1982

14.45

9.99

24.44

1982–1983

14.27

9.40

23.67

1983–1984

15.19

9.87

25.06

1984–1985

16.98

11.03

28.01

1985–1986

17.16

11.60

28.76

1986–1987

17.13

12.29

29.42 (Contd)

Fundamentals of Ecology

328 Table 7.34A (Contd.) 1987–1988

16.58

13.01

29.59

1988–1989

18.17

13.35

31.52

1989–1990

22.75

14.02

36.77

1990–1991

23.00

15.36

38.36

1991–1992

24.47

17.10

41.57

1992–1993

25.76

17.89

43.65

1993–1994

26.49

19.95

46.44

1994–1995

26.92

20.97

47.89

1995–1996

27.07

22.42

49.49

1996–1997

29.67

23.81

53.48

1997–1998

29.50

24.38

53.88

1998–1999

26.96

26.02

52.98

1999–1900

28.52

28.23

56.75

2000–2001

28.11

28.45

56.56

2001–2002

28.30

31.20

59.56

2002–2003

29.90

32.10

62.00

2003–2004

29.41

34.58

63.99

2004–2005

30.10

35.00

65.10

Source: (i) CMFRI Up to 1970–71 (ii) State Govts./ UTs (iii) Ministry of SPI, Govt. of India

Table 7.34B

State–wise fish production in India (1999–2000 to 2004–2005) (in ‘000 Tonne)

States/ UTs Andhra Pradesh Arunachal Pradesh

1999–2000 547.06

2000–2001 589.69

2001–3002 676.11

2002–2003 827.90

2003–2004 944.64

2004[–2005 853.05

2.40

2.50

2.60

2.60

2.65

2.70

Assam

159.77

158.62

161.45

165.52

181.00

186.31

Bihar

254.74

222.16

240.40

261.00

266.49

267.51

65.62

71.57

69.92

76.53

87.36

990.44

Gujarat

741.28

660.74

701.60

777.91

654.62

635.21

Haryana

30.00

33.04

34.57

35.18

39.13

42.05

Goa

Himachal Pradesh

7.00

7.02

7.22

7.24

6.53

6.90

19.01

17.51

18.85

19.75

19.75

19.10

Karnataka

292.30

303.38

249.61

266.42

257.00

251.23

Kerala

667.85

651.81

671.82

678.32

684.70

678.31

Madhya Pradesh

127.43

48.84

47.46

42.17

50.82

62.06

Maharashtra

533.29

526.10

537.05

514.10

545.13

548.02

Jammu and Kashmir

(Contd.)

Natural Resource Ecology

329

Table 7.34B (Contd.) Manipur

15.51

16.05

16.45

16.60

17.60

17.80

Meghalaya

4.68

6.18

4.97

5.37

5.15

5.64

Mizoram

2.89

2.86

3.15

3.25

3.38

3.68

Nagaland Orissa

5.00

5.50

5.20

5.50

5.56

4.90

261.24

259.64

281.95

287.53

306.90

315.59

Punjab

47.18

52.00

58.00

66.00

83.65

77.70

Rajasthan

12.97

12.12

14.27

25.60

14.30

16.39

Sikkim Tamil Nadu Tripura Uttar Pradesh West Bengal

0.14

0.14

0.14

0.14

0.14

0.14

475.00

481.42

485.00

437.50

474.14

459.43

29.34

29.42

29.45

29.52

17.98

19.84

192.71

208.29

225.37

249.84

267.00

277.07

1060.23

1100.10

1120.00

1169.60

1215.00

28.20

27.68

27.08

28.30

31.15

32.68

Chandigarh

0.03

0.08

0.04

0.08

0.08

0.08

Dadra and Nagar Haveli

0.03

0.04

0.06

0.05

0.05

0.05

15.95

16.38

21.52

11.26

13.77

12.51

4.30

3.98

3.20

2.25

2.10

1.41

Andaman and Nicobar Islands

Daman and Diu Delhi

1045.7

Lakshadweep

13.60

12.00

13.65

7.50

10.03

11.96

Pondicherry

42.83

43.30

44.50

45.02

48.00

36.75

Chhatisgarh

43.39

95.76

99.80

111.05

120.07

Uttaranchal

9.07

6.42

2.55

2.56

2.57

Jharkhand Deep Sea Fishing India

42.60

101.00

45.38

75.38

22.00

30.00

30.00

NA

NA

NA

NA

5675.03

5655.35

5955.93

6199.68

6399.39

6304.75

Abbriviations: NA, Not Available. Source: Lok Sabha Unstarred Question No. 3090, dated 20.12.2004 and Ministry of Agriculture, Govt. of India.

However, fishing remains confined to a narrow coastal region of 16 km and the rich offshore and deep waters remain poorly exploited. India has about 1.6 million ha of inland waters. It has many major river systems, such as the Ganges, Jamuna, Brahmaputra, Narmada, Mahanadi, Cauvery and Krishna. Besides, there are canals, ponds, lakes and irrigation channels where culture fishery can be practiced. The main fresh water fish are carps (Labeo rohita, other Labeo Catla catla, Cirrhina mrigala, etc.). The exotic carps available are the Chinese carp (Cyprinus carpio), green carp (Ctenophryngodon idella), mirror carp (Hypophthalmichthys molitrix), catfish and so on. Some Clupeids like Hilsa are also found in river systems like Mahanadi, Hoogly and Subarnarekha and Chilka lake. The total fresh water fish production is about 1.77 million tonnes (1996), (about 50% of the total catch). Now culture fishery has been started in pond cultures, artificial enclosures and net pens, providing fertilisers such as cow dung, domestic and agricultural waste and other animal excreta. Pond culture can be:

Fundamentals of Ecology

330

(a) (b)

Monoculture, involving one species only; usually trouts, eels and cat fishes are monocultured. Polyculture, involving the culture of more than one aquatic species, common combinations are milk, fish with prawn, Chinese carp with Indian carp, and carps with Tilapia. (c) Intensive rearing pond culture with high stocking density and water quality control and rich artificial food, eels, trouts and catfish are usually grown in such cultures. (d) Extensive rearing ponds where stocking density is low and food is natural. (e) Semi-intensive rearing ponds where natural food supplemented with artificial food is given; usually fertilisers are used to increase food production. Carps, tilapia, trout, salmon and some other fish are also cultured in net pens. Milkfish, mullets and some other fish are cultured in enclosures or bamboo fences. In India, fish culture is also done in irrigation canals, paddy fields and other small wetlands. Air breathing fishes, such as Channa sp., Clarias sp., Heteropneustes, Anabas sp. and so on, are cultured in swamps and cage culture systems. A study of the food chain relationships of fishes with a view to shortening the chain is important for aquaculture. Recently, technologies have been developed in Orissa, India, to culture prawns (Paeneus monodon and Paeneus indicus) in confined salt water tanks. The average aquaculture production is about 600 kg per hectare per year in India. This yield can be increased to 11 tonnes per hectare per year using composite fish culture (using surface, column, and bottom feeding fish in the same pond and thus avoiding competition among them for food). The yield of air breathing fish in swamps is now 15 tonnes ha per year.

7.4

CONSERVATION AND RESOURCE MANAGEMENT

The word ‘conservation’ is derived from the Latin word con meaning together and servare meaning guard. Thus conservation means to guard together. Conservation ensures a continuous yield of useful renewable materials and the protection of non-renewable resources from wastage and rapid depletion. The aim of conservation is to ensure the preservation of a quality environment that balances aesthetic, recreational and product requirements of man. It also ensures a continuous yield of useful plants, animal and materials by establishing a balanced cycle of harvest and renewal. Living systems have evolved to their present state through many million years and have become part of the environment through adaptations. Many adaptations have a selective value and through genetic changes these have become established and provided stability to organisms. Human civilisations have developed at the expense of resources collected from the environment. Any conservational measure or rational plan for the management of the ecosystem must recognise that each habitat has certain characteristics and each organism a certain range of physicochemical conditions which it can tolerate. Also, for each environmental factor, there is some point or zone within the range which is near the optimum. Therefore, we can either modify the area to increase its capability or limit our requirements keeping the capability of the ecosystems in view. Charles Elton defined conservation as a ‘wise principle of coexistence between man and nature, even if it has to be a modified kind of man and modified kind of nature’. Cragg (1968) was of the view that biological conservation is concerned with the maintenance of natural systems and, where possible, with their utilisation either directly or by way of information obtained from their study, for the long-term

Natural Resource Ecology

331

benefit of mankind. These concepts are extremely relevant to the conservation of threatened species and management of natural resources. Organisms which require the greatest attention are those which do not adapt readily even to the slightest modification in the ecosystems where they occur. Therefore sound ecological principles must be adopted for the conservation of species and management of resources. 7.4.1 Concept of Sustainable Development Definition The World Commission on Environment and Development has defined sustainable development as “a process of change in which the exploitation of resourceS, the direction of investments, the orientation of technological development, and institutional change are all in harmony and enhance both current and future potential to meet human needs and aspirations.” This definition centres around development of a long-term relationship between ecology and economic development. In simpler terms, sustainable development is development that meets the needs of the present, without compromising the ability of the future generations to meet their needs (Brundtland Commission). In ecological terms, it would mean that every generation should leave water, air and soil resources as pure and unpolluted as when it came on earth. This is, however, a very difficult proposition and can be addressed, if, man raises its consciousness and perception of the environment, considering himself as a integral part of the system. However, it requires proper scientific and technological input to solve environmental problems. 7.4.2 Concept of Sustainability

There are two general conceptions of sustainability, which are often seen as being a conflict. One concept centres around earth’s carrying capacity and focuses on natural resources like fertile soil, healthy wetlands, ozone layer etc. which provide people a clean environment to raise basic requirements. This concept proposes a critical limit for sustainability. It means that we must preserve these ecosystems and respect the limits that they impose on the number of people in the world lany country and their style of living. The other concept of sustainability focuses on balancing the economic, social, and ecological goals. This concept tries to address human needs and aspirations like health, literacy, democratic, values etc. chiefly based on material requirements. The critical limit view of sustainability is not central to the second concept. However, the second concept of sustainability gives importance to technology development. Each concept, however, is concerned about equity within and between generations and recognises that poverty results from inequitable resource distribution and leads to degradation of ecosystem and both the concepts are concerned with quality of life and conservation of environment. Sustainable development has three important components viz. (1) economic development (industrialisation, creating job opportunities, utilisation of natural resources for developmental purposes to raise quality of life), (2) community development (providing basic needs like food, shelter, clothes, health, education etc. for living of people), and (3) environmental protection (providing clean water, air, safe environment to people and for future generations and utilising resources in a sustainable way). The World Commission on Environment and Development (WCED) defines sustainable development as “a process of change in which the (i) exploitation of resources, (ii) the direction of investments, (iii) the orientation of technological development, and (iv) the institutional change are in harmony and enhance both current and future potential to meet human need and aspirations.” In summary, sustainable development is development that meets the needs of present without compromising the ability of the future generations to meet their needs. Every generation should leave water, air and soil resources as pure and unpolluted as when it came to earth.

332

Fundamentals of Ecology

There should be a spirit of local/regional/national/global partnership to conserve, protect and restore the health and integrity of the earth’s ecosystem. Sustainable development is the first principle of the Rio Declaration. The issues of Rio Declaration are: 1. Sovereign rights of nations to sustainable development. 2. Sustainable development for the present and future. 3. Eradicate poverty for sustainable development. 4. Global partnership for sustainable development. 5. Liability and compensation. 6. Cooperation for the environment and human health. 7. Precautionary approach (Prevention of environmental degradation, disasters etc.). 8. Intemal EIA. 9. Immediate notification and international response (environmental accidents etc.). 10. Full participation by women (equal opportunity). 11. Global youth partnership (youth involvement in environmental matters). 12. Role of the indigenous and protection of the oppressed (traditional knowledge). 13. Peace, sustainable development and environmental protection (respect for international laws). 14. Peaceful resolution good faith and partnership. The Declaration states that “human beings are at the center of concerns for sustainable development. They are entitled to a healthy and productive life in harmony with nature.” The Declaration further states that “the right to (sustainable) development must be fulfilled so as to equitably meet developmental and environmental needs of present and future generations.” Concept elaboration The concept of sustainable development provides a framework for the integration of developmental strategies with environmental protection. This concept should include: (1) Reducing excessive resource use and enhancing resource conservation. (2) Recycling and reuse of materials waste minimisation with proper technological input. (3) Scientific, management of renewable resources, specially bioresources which has a life cycle and have inherent sustainable qualities. The concept of sustainable development reorganises that the earth has limited supply of resources and the renewable resources, if managed scientifically will provide man’s requirement from generation to generation and it recognises a symbiotic relationship between developmental processes and environmental protection. Man is part of the nature and he is bound by natural laws and is part of the ecological processes. The developmental process is concerned raising the quality of life vis-á-vis availability of pure water, good air and good nutrition, educational facilities and access to freedom and spiritual welfare. Article 21 of the Indian Constitution (Right to Life) has been interpreted by the Supreme Court of India as right to good environment or visá-vis right to having pure water, air etc. The Indian Constitution also recognises vide Articles 48A and 5 1A (G) the duties and responsibilities of the nation on one hand and citizens of the country on other with regard to maintenance of good environment and to show compassion for other living organisms on the planet. These are aspects, which strengthen the concept of sustainable development.

Natural Resource Ecology

333

We have entered to a new millennium. Human civilisation has attained excellence in scientific and technological fields of such a level that man may be able to produce of its own kind by cloning, land in other planets and can receive informations in no time from anywhere in the world. At the same time the civilisation is facing the greatest challenge for survival against the onslaught of environmental degradation. The state of environmental degradation has reached such a stage that further progress, specially in industrial development, will be at stake unless the problems of the environment are addressed satisfactorily. The UNO Conference on Environment at Stockholm in June, 1972 lead to the establishment of UN Environment Program and gave emphasis on protection of environment for our future. The World Commission on Environment and Development was established in 1983 and brought out its report, Our Common Future in 1987. This report highlighted poverty, depletion of natural resources faster than exploitation, deterioration of environmental quality and quality of life. These activities led to the organisation of Earth Summit in Brazil in June, 1992. In modem human civilisation and society industrialisation is considered important to create avenues for better quality of life by creating job opportunities for unemployed youth and opening of new avenues for people to raise livelihood. On the other hand, industrialisation creates pollution, environmental degradation and destroys the balance of nature. Since we have failed to control human population growth and to meet the demand of the vast population more food are to be raised and other basic requirements are to be made. The choice has become difficult. It is now been accepted that the sustainable development is the answer. The environmental protection movement in India practically started in 1972 after the Stockholm Conference on Human Environment. The environmental enactments like the Forest Act, 1972, 1980. Wildlife Protection Act, 1972, Water (Prevention and Control of Pollution) Act, 1974, Air (Preveition and Control of Pollution) Act, 1981, the Environment Protection Act, 1986 etc. are important steps for conservation of biodiversity and natural resources and control of pollution in India. The major environmental movements like Silent Valley Project, Chipko Movement, Narmada Bachao Andolan, Tehri Dam Movement etc. reflected involvement of people and people’s concern about environmental issues. But the fact remains that India cannot afford to sacrifice industrial development because we are in dire need of them to raise the standard of living of our people and because the industrial and agricultural activities create jobs and solve unemployment problem to a large extent. In view of this, a balance has to be struck so that developmental projects are encouraged and simultaneously environmental protection is adequately done. Human life is intricately linked with plants and animals as man gets food, clothes, building and shelter materials, medicines and some other useful materials from them. The conservation of biodiversity, historical monuments and the environment at large has been emphasised time and again for various reasons. But due to anthropological activities, destruction of ecosystems have occurred on a large scale and the environmental degradation has wiped out many known and unknown species of plants and animals and has caused environmental pollution causing damage to the biological diversity, often in an irreversible manner. One of the world’s most pressing problem is how to organise human activities in eco-friendly way that conserve sustainable livelihood. The Rio Conference has brought extensive informations on conservation problems and so far little less than 2 million species of living forms are known, out of perhaps total 40 million. Some 3,00,000 species of green plants and fungi are known and it has been expected that some 25% of plants are still to be known. Some 10,00,000 of animal species are known which include 8,00,000 species of insects, 23,000 species of fish, 3,000 amphibians, 6,000

334

Fundamentals of Ecology

reptiles, 8,700 birds, and some 4,000 mammalian species. But only a fraction of invertebrates are known to the scientists. Why so many species of plants, animals and microorganisms have evolved? It appears that each component species has some useful function in the ecosystem for its survival and stability and the species forms some important relationship with other species in the form of food web relationship and therefore any break in this relationship brings instability, often, disaster in the ecosystem. Rapid human population growth, effects of deforestation, effects of pollutants, soil erosion, forest fire etc. have brought disastrous consequence in loss of biodiversity. In view of this, the Rio Conference put lot of emphasis on conservation and sustainability of bio-resources. Bioresource India is one of the richest country in the world in natural resources having 45,000 species of plants, 81,000 species of animals and accounting 8% of earth’s wild life. Some 15,000 described species of flowering plants, including 5,000 species of woody plants of which 2,500 species of trees are found in India. The tropical and sub-tropical climates have favoured evolution of new taxa and endemism. The area under the forest in India is estimated to be 75 million hectares which form 23% of the total area. India’s National Forest Policy stipulates 33 million hectares of fertile forest land have been destroyed both in the plains as well as in the Himalayan region. This has brought ecological crisis causing unprecedented intensity of floods or intensity of dry weather. By and large there is a great loss of biodiversity. One hectare of humid tropical forest in South-East Asia contains about 820 species of woody plants, whereas a similar area in mid-latitude zones may contain less 50 woody plant species. It is the humid tropic which is storehouse of biodiversity and it is also witnessing the highest rate of environmental degradation which brings direct threat to biodiversity. An estimated 10% of the plants and 21% of animals in India are threatened (V J Thomas, Times of India, 20 Nov., 1998). The annual rate of deforestation in India ranks (2.7%) highest among the mega-diversity countries. The rate at which the species are becoming extinct due to human activities like habitat clearance, pollution, biological invasions, changes in the biosphere etc. is alarming. Scientific data shows that the biological diversity has increased slowly but steadily through the evolutionary process over geological time. However, mass global extinction of species have occurred due to natural processes of glaciation, volcanic eruption, earthquake etc. Wilson (1992) lists five such global extinctions. But the sixth major decline in biodiversity is now happening not due to natural processes but due to anthropogenic activities like urbanisation, industrialisation, forest clearance and pollution. One estimate shows that the rate of natural extinction ranges from 2 to 5 plant families per million years but the twenty first century may witness extinction of 50 plant families due to human activities. At present, we loose on the average per year one species of mammal, one bird species and many invertebrate species from the planet. This realisation has helped develop the concept of environmental management and planning so that in the scenario of accelerating economic development, the biodiversity and quality environment is maintained. India had earlier some 30.17.009 sq km of wild habitat and at present it has 6.15.000 sq km of wilderness. Thus, 80% of wild habitat has vanished due to anthropogenic activities without much replacement within half a century or so. The north-eastern region is unique in diversity. The eastern Himalayas provided habitat for the origin of citrus and Orissa for the origin of rice (Chopra, 1994). Key Issues Green revolution and, later, white revolution have helped India producing enough food and milk for nearly 1,000 million people. At present India produces around 200 million tonnes of food materials. Cotton production has increased to some 120 x bales, oil seeds production has gone up to some 22 million tonnes, sugarcane to some 250 million tonnes. India is now world’s second largest fruit

Natural Resource Ecology

335

producer after Brazil and second largest vegetable producer after China. It exports fruits like mango, banana, grapes, litchi, chickoo, pomegranatd, custard apple, ber etc. The common vegetables are potato, onion, chilli, sweet corn, beans, brinjal, lady’s fingers, tomato etc. If India has to feed adequately more than one billion Indians in the 21st century, then we have to make great efforts not to only increase food production but to conserve for sustainable use of plant and animal wealth. In view of this a wholistic pattern of resource utilisation and environmental planning is required for the industrial growth. But with the present rate of 2% population growth, 10,000 sq km of forest clearance per year, high rate of soil erosion, increased rate of water, air, and soil pollution, gene erosion, without keeping long-term benefits and environmental considerations in mind, will it be possible to conserve these unique ecosystems unless we plan and manage them scientifically? Hence, the recent policy of the Government of India to insist on environmental audit before executing any developmental project is a very welcome step. For example, the south-eastern part of India has very unique and productive ecosystems like Sunderbans in West Bengal, the mangrove forest patch in Bhittarkanika in Cuttack-Balasore districts of Orissa, the brakish water lagoon the Chilka lake in Orissa, the rich forest belts and associated mining areas of south Bihar, north-west and south-west Orissa and south-eastern regions. The Eastern Ghat areas including the Gandhamardan hills are very rich in medicinal plants. These are the hot-spots for conservation. This region is also traversed by a number of important rivers which are at various stages of exploitation. The open-cast coal and bauxite mines and consequential destruction of rich forest habitats need attention. These systems require urgent attention for scientific management. The region has immense potentiality for sericulture, jute culture, lac culture and for industries based on tribal and rural know-how. The tribal life style is believed to be eco-friendly and hence, it is to be carefully studied and analysed. The tribal and rural know-how may have many important components for understanding the utility of biodiversity. However, the many factors responsible for the large gap between potential and actual production level require scientific planning and management strategy. Building a sustainable system The main cause of most global issues and national issues can be traced on sustainable development at the local level. Technology is the determined factor for the development of the human society. The nation must have a technology policy of its own with the clear objective of developing, self-reliance in science technology and providing minimum basic requirements to its people and maintaining a clean environment. The key to building a sustainable system lies in achieving the following points: (1) Rationalised husbanding of all resources, specially renewable resources. (2) Recycling and reuse of waste and treating waste as a type of resources. (3) Maintaining sustainability of all natural occurring sustainable resources. (4) Resource sharing. (5) It is convenient/easy to talk of sustainability but difficult to practice— for practice it requires scientific management and a commitment. 7.4.3 Resource Planning and Management Exploring resources Conventionally the exploration of minerals and fossil fuels is done by diggingor drilling. Before digging, the habitat characteristics, particularly soil properties and profiles, are studied. This was formerly done by geologists, engineers and some other technologists. Now-a-days remote sensing techniques are used. These involve the use of photographs, radio waves, infrared signals, etc. to locate

336

Fundamentals of Ecology

hidden resources underneath the earth. Much of the exploration is done by an analysis of photographs taken from aircraft or spacecraft. Powerful cameras are carried by aeroplanes to take photographs of the soil, water, vegetation and minerals from a remote place. Television cameras are used to take pictures of land masses, water bodies, forests, clouds, and so on. These photographs are thoroughly analysed and provide valuable clues for the exploration of resources. Radio waves are also sent from spacecraft and the nature of reflection or absorption on a surface is studied. Similarly, infrared signals are sent from satellites and the reflections studied to determine the nature of the reflection surface. 7.4.4 Remote Sensing Definition Remote sensing is acquisition of data for deriving information about objects located at the earth’s surface or in earth’satmosphere using sensors mounted on platforms located at a distance from the targets. Data interpretation depends upon measurements made in different spectral regions of solar region on interactions between targets and electromagnetic regions. Weather satellites provide information over 113–185 km and 2950 km wide regions about patterns and dynamics of cloud surface, vegetation cover and their seasonal variations, surface morphology, sea surface temperature, wave heights and near sea surface wind patterns. Remote sensing is defined as obtaining information about an object or objects by observing them from a distance and without having actual contact with the objects. The term remote sensing is generally used by observing earth’s surface from space by aircraft or by satellites. Remote sensors have the powerful capacity to provide information on the objects on earth’s surface. Remote sensing is used to collect information for defence purpose, agriculture, forestry, oceans, fishing, fish schooling and migration, study of biodiversity and land cover changes, water resources management, mapping of wastelands, location of mineral resources, monitoring of urban growth etc. It has wide application in ecology. Different stages of remote sensing Remote sensing has the following components: 1. Source of electromagnetic energy (solar region/self-emiission). 2. Energy transmission from the sun to earth’s surface and absorption, scattering during passage of solar radiation through earth’s atmosphere. 3. Interaction of electromagnetic radiation with earth’s surface such as reflection, scattering, absorption and re-emission. 4. Transmission of reflected/scattered/emitted energy from the objects. 5. Sensor data output. India’s earth receiving station at Shadnagar, 55 km from Hyderabad, has an antenna of 10 m diameter with a 2,500 km radius visibility range. The Remote Sensing Satellites are IRS-IA or lB and they are launchehd to an altitude of about 904 km, orbits the earth in north south direction, inclined by about 99 degrees and each rotation takes 103 minutes. Narayan (1999) points out that the satellite system comprises space segment, sensor system and ground segments. (i) Space segments This consists of the satellite, which could be put into orbit containing the sensor system mounted on it. The sensor system consists of preplanned format and transmits information to earth’s receiving stations. The scanners move from one side to the other and continuously record information with its range depending upon the line of flight or the direction in which the

Natural Resource Ecology

(ii)

(iii)

337

satellite moves. In the Indian Remote Sensing Satellite, the scanner is called Linear Imaging Self Scan (LISS-I). It scans about 148 km of earth’s surface in each scene on a continuous basis and transmits the data to the earth’s receiving station. The data, which is obtained in digital form, can be converted to picture format (imagery) by electro-optical processing. Sensors system There are instruments which sense the objects on earth’s surface and record them. A camera is a form of sensor. Satellite mounted sensors are also called scanners, which scan the objects in the form of levels of grey in digital format or the deflected energy. The solar energy falls on the object and the scanner sense the part of the energy reflected by the object. Each object on the earth’s surface has distinct special reflectance characteristics. Ground segments Remote sensing technology uses the visible, infrared and microwave regions of the solar radiation for the collection of information about various objects on earth’s surface. The solar energy containing all the regions of the electro-magnetic spectrum falls on the earth and gets partially absorbed and partially reflected. The reflected part is generally used in remote sensing.

The ground segments in IRS-IA are: (i) Telemetry, 4racking and command Network. (ii) Space control centre (iii) Data reception system (iv) Data products system. The ground system controls the movements and track the satellite paths. Digital information related to geographic positions with precision is available from satellite remote sensing data. This enables us to know the exact location of resources and their quantity. Before detailed exploration and exploitation of resources, secondary information is collected on many related matters as all natural resources are interrelated in some way or the other. The visible region of elctro-magnetic radiation is between 0.4 millimicron and 0.7 millimicron wavelength but in the remote sensing infrared (> 0.7 to 1.5 million wavelength) and microwave (1.0 millimicron to 0.8 meters wavelength) region can be used by suitable devices. Different objects reflect different parts of the electromagnetic region exhibiting their own spectral signatures (Narayan, 1999). Hence it is concluded that different objects manifest themselves predominantly in certain wavelengths and using filters and using sensors which are active in certain regions of the spectral range of colours, we can receive information in different bands of the electromagnetic spectrum. Table 7.35 table shows the band, spectral range and application areas. Table 7.35

Band, spectral range and application

Band

Spectra range

1.

0.45—0.52

Coastal morphology, soil/vegetation differentiation, distinction between vegetation types namely confirms and deciduous vegetation.

Application areas

2.

0.52—0.59

Vegetation vigour, soil and rock discrimination, turbidity and bathymetry in shallow waters.

3.

0.62—0.68

Strong chlorophyll absorption facilitating separation of plant species.

4.

0.77—0.86

Delineation of water features, land forms! geomorphology.

338

Fundamentals of Ecology

Spectral characteristics of vegetation, water and soil Vegetation The spectral reflectance of vegetation canopy varies with wavelength of light. A leaf consists of fibrous organic materials containing pigmented. water filled cells and air spaces. Three characteristics are important to affect the reflectance, absorptance and transmittance of leaf, and these are: 1. Pigmentation, 2. Water content, and 3. Physiological structure.

Four primary pigments, chlorophyll A, chlorophyll b, cartone and xanthophyll are found in plants. Chl-a peak absorbance is in 0.45 in and 0.66 m and chl-b absorbs at, wavelengths 0.45 and 0.65 mm. Carotene and xanthophyll absorb blue to green light at a number of wavelengths. Absorption by chl-a and chl- bgive very low reflectance in red and blue bands. The green colour of the leaf is responsible for peak reflectance at 0.54 mm. The middle infrared has strong water vapour absorption bands between 1.6 and 2.0 mm. The remote sensing measurements in 1.55–1.75 and 2.08– 2.35 mm provide informations on moisture content of plant canopy. The plant’s reflectance depends upon the reflectance of its leaves, stems flowers, fruits etc. and can be influenced by litter and soil. Low pigment content causes higher reflectance in red region. Insect infestation, disease and nutrient deficiency can reduce reflectance. A healthy leaf gives less reflectance in near infrared as compared to moderately and severely blight affected leaf. Hence colour infrared photograph can monitor leaf condition better. Seasons affect the reflectance property as seasons are related to plant life cycle. Flowering occurs in a brief period and can affect reflectance. Soil Different types of soils with different water content exhibit different reflectance. Chemical components affect the spectral reflectance. Soil rich in calcium carbonate and poor in iron gives higher reflectance in the visible and near infrared regions than soil with less or negligible CaCO3 content or with high iron content. For dry soil, higher the surface roughness lower the reflectance in visible and near JR region of electromagnetic radiation. . Presence of organic matter and iron may cause darker colour to soils. Dry soils with high sand content exhibit high reflectance. Soil with high salt content has higher reflectance. Soils containing Na2CO3, NaCl, KHSO3 (potassium hydrogen sulphite) exhibit high reflectance (65 to 89%) throughout the visible spectrum. Satellite remote sensing provides (i) synoptic view of the area, (ii) repetivity—we can get data on any area repeatedly, (iii) coverage of inaccessible regions, (iv) computer processing and analysis are possible, (v) saves time and money. Remote sensing can also be used effectively for mapping of biosphere, forest plantation, grassland mapping, wastelands, wildlife habitat assessment, desertification etc. However, the data are obtained at macro level and during cloud cover, it may not be possible to get remote sensing data unless microwave region of the electromagnetic spectrum is used. Remote sensing applications The applications can be listed as follows: 1. Geology and geo-morphology mapping. 2. Surface water and stream pattern mapping. 3. Flood effect mapping (pre-flood and post-flood situation and run-off mapping. 4. Irrigation paftern.

Natural Resource Ecology

5. 6. 7. 8. 9. 10. 11. 12. 13.

339

Determining potential ground water zones. Snow cover mapping. Agriculture—crop identification, crop areas. Forestry and vegetation mapping. Land-use mapping. Identifying fishing zones. Impact of mining activities on land and forest cover. Understanding the distribution and status of biodiversity in an area. Mapping of coastal zones and mangroves.

Example 1 Vegetation cover can easily be identified with the help of photographs. The pattern of seasonal growth of coniferous and deciduous forests is different and this can be observed from photographs taken. Deciduous forests shed leaves in autumn. By taking photographs, it has become possible to know the density of vegetation, shape and size of plant cover, and so on. Infrared reflections are also used to study vegetation. During the daytime, the average leaf temperature remains about 10-15°C higher than the surrounding air temperature because of photosynthetic activity. In the coolest hour of the night the leaf temperature remains slightly below the surrounding temperature. Therefore, by measuring the ground temperature and the air temperature, one can gauge the extent of the vegetation cover. Example 2

Photographs taken from aircrafts and satellite pictures show clearly if there is a break in the continuity of rock types or rock layers or other unique features of the earth. This provides clues to the location of minerals. Distinctive linear features indicate mineral deposits or ground waters. Radio waves and a study of magnetic properties provide clues to mineral deposits and fossil fuels like oil.

Example 3 The round soil may emit gamma rays, which can be picked up by detectors in an a. craft. This emission is affected by the presence of water in the soil. Soil containing water usually supports good vegetation. Therefore analysing the type of vegetation and its density provides clues to the presence or absence of ground water. Infrared detectors may help in the identification of hot springs. Resource maps

Resource mapping helps us know the different land patterns and how best they can be managed. The rural land use map indicates the distribution of forests and the state of deforestation, the distribution of range lands, agricultural land, wasteland, and so on. Regional land maps can be prepared showing state boundaries, water bodies, and forests and may indicate areas prone to natural calamities, such as cyclones and earthquakes. Similarly, soil maps, hydrological maps, maps of snow-covered mountains and mineral maps are prepared with the help of remote sensing techniques.

What is GIS (Geographic Information System)? All factors influencing natural resources exploitation can be made available in the form of digital values. Their spatial locations can be precisely defined with reference to actual geographical position (latitudinal, longitudinal and altitudinal) on earth surface. Hence, these data can be scientifically manipulated on the computer to simulate,various alternatives and final outcome and hence it will enable us taking effective decision to obtain optimum results. By using computers, all types of data are stored in different layers in graphic form and used for different combinations and this is generally termed as Geographic Information System (GIS). In summary, GIS is an information system used for management aecisions and allows the scientist to create, maintain and search electronic databases of information normally displayed on maps, which are spatially oriented indicating the position on the surface of the earth. In other words, GIS consists of a set of computerised tools that can be used to effectively encode, store, retrieve, overlay, correlate, manipulate,

340

Fundamentals of Ecology

analyse, search, display graphically and numerically, and disseminate land related information. The fundamental aspects of GIS is that it provides spatial and specific locational features (geographical coordinates) in a coordinate form which becames helpful in quantitative analysis. Topology refers to spatial entities like points, lines, and polygons, which are dependent on adjacency rather than on their locations in space. GIS includes topology and this differentiates GIS from a graphic system. In cartographic system the emphasis is on display and the main purpose is to produce maps. In GIS the emphasis is on retrieval, analysis and decision support and generation of new information. It integrates digital cartography, computer aided design, remote sensing and database management. GIS is usually based on used needs. Conservation of mineral resources We know that mineral resources are limited in quantity and are being depleted very fast. The following steps are now being taken for the conservation of these resources. 1. Minimising waste and developing technologies to recover the resources from waste. 2. Developing technologies to recycle metals 3. Research is being carried out to substitute some metals like gold, silver, mercury and platinum etc. by man-made products 4. Development of alloys which will reduce the demand on some pure metals, e.g. alloys of magnesium are replacing steel and reducing the demand copper, lead and tin 5. Alternatives to fossil fuels need to be found 6. Mining areas need be reclaimed 7. A data bank on the availability and expenditure of mineral resources should be maintained so that their use is regulated 8. New reserves on the ocean floor and unexplored areas need to be searched for. Land use planning and management Land is an important exhaustible resource, which is being degraded by rain, wind, deforestation, erosion, landslides, and so on. This precious resource must be managed properly and should be used according to its suitability and capability. Fertile agricultural land should not be sacrificed for non-agricultural purposes, such as road building, development of industries, or construction of water reservoirs. Urban areas should not be developed on agricultural lands. Since forests shelter wild life, prevent soil erosion, and affect the climate, they should be developed in hilly areas and deforestation should be checked. Some essential components of land management are as follows: 1. With the help of remote sensing methods, a land classification and land capability map must be prepared. 2. The land must be classified keeping in mind the nature of the soil, physical features, availability of water and its storage, runoff, and so on. The land is usually classified as Types I and II (good agricultural land—continuously cultivated, crop rotation can be practiced), Types III and IV (steeper slopes—may be used for cultivation, perennial crops rotated with pastures can be grown, periodic fallowing is done, requires a lot of attention), Types V, VI, VII (may not be suitable for cultivation, can be used to develop pastures or tree crops), and Type VIII (thin soil cover, steep slopes or marshes and swamps—can be used as a habitat for game, fur bearers, forests, recreational or scenic areas, water shed production, aquaculture for swampy areas, etc.).

Natural Resource Ecology

3.

341

Changes resulting from land use should be monitored and the intensity and frerquency of natural hazards like cyclones, floods, and so on should be anticipated. These aspects can be broken up into finer details while planning land use for urban areas. The landscape and pollution load also need to be considered.

Soil management Soil is a important resource and it takes millions of years to form a few inches of it. In recent years deforestation has caused severe soil erosion, and the large-scale abuse of soil and use of chemicals have reduced soil fertility. Hence, the immediate concerns in soil management are: (a) to check soil erosion, and (b) to make the soil fertile. Soil erosion

Soil erosion can be prevented by large-scale planting of trees and shrubs and the development of grasslands. Plant roots hold the soil and prevent erosion due to floods, wind and landslides. The growth of grasses and trees stabilises the soil and checks erosion. Another method is to develop a good drainage system, which can prevent the uncontrolled flow of water. In hills, landslides can be checked by the construction of drainage ditches. Besides, walls should be construction along hill slopes. A cover of vegetation is always helpful to check erosion and landslides. Erosion by sea waves and currents has been checked to a large extent in Orissa, Andhra Pradesh, Kerala and some other coastal areas by the construction of broad walls of stone along the coasts, along with the growth of casuarina vegetation. In hill slopes or terraced fields, the alternation of crop beds with erosion resistant vegetation, such as grasses, shrubs, trees, sugarcane, maize, and tobacoo is practised, and this method stabilises the soil. In cyclone-prone or desert areas, the effects of strong winds are checked by putting barriers of shrubs and trees.

Soil fertility

The soil losses its fertility and becomes sick because of (a) over use, (b) waterlogging leading to increase in salinity and alkalinity, and (c) the use of certain chemicals which are not degraded easily. Various methods are now in use to overcome these problems. These are: 1. Practice of rotation of crops and vegetables such as leguminous plants, which add nitrogen to the soil. 2. The roots and stems of crop plants are allowed to remain in the field for sometime to protect the soil from erosion. The partially decomposed organic meterials add nutrients to the soil. 3. Waterlogging is avoided by sealing all points of leakage from water sources such as canals, tanks, ponds, so on. 4. Alkalinity and salinity of soil can be neutralised by the application of gypsum, phosphogypsum, pyrites, organic manures, and fertilisers. 5. Salt-resistant plants like cotton, date palm, soya, millets, barely, spinach, and so on are planted to reduce salinity. 6. Use of non-degradable chemicals is avoided.

Water resources Management We know that about two-thirds of this planet is covered with water and yet there is a dearth of fresh water. The management of fresh water resources is thus very important. The watersheds of an area must be identified and steps be taken for its protection and management watershed is defined as Land area drained by a river or given stream or waterbody. There is also a need for the management of sea water because of oil and other pollution threats. Water resource management should ensure that: (a) there is no wastage or misuse of water, (b) pure water is made available to man for various purposes, and (c) water storage and distribution are done in a scientific way. Usually water is

342

Fundamentals of Ecology

wasted by leaking taps and excessive irrigation. Public awareness should be created against using more water than is necessary. Water for drinking, bathing and cooking should be different from that used for irrigation. Hence proper treatment is required for making water fit for drinking, cooking, and so on. After purification, municipal waste water and domestic water can be made fit for use in industry and agriculture. This involves the removal of toxic elements, pollutants, germs, and so on. Rain water can be stored in ponds and lakes for later use and kept in pits, trenches and so forth so that it can gradually filter underground. An important aspect of water management is recharging ground water. In the rainy season the ground water should be recharged for use during times of scarcity. In hills ‘id mountains, water sheds are covered with vegetation and the litter covered soil of the water shed allows the infiltration of rain water, which ultimately reaches the ground water. In India, most of the rain falls in the period between June and the middle of October. The excess flow of water in this time should be diverted to areas of water scarcity, and stored properly. The sea is an abundant source of salt water. Technology is now available to distil sea water by desalination using solar energy, which is cheap. This is now being done in Bhavanagar in Gujarat. Fresh water of good quality may be obtained by this process. Management of forests and wild life We have already discussed the management problems of forests and wild life earlier in this chapter. In summary, the following measures need to be taken for forest resource management. 1. Constant monitoring of the forest growth and depletion rate. 2. Prevention of forest fires. 3. Adoption of scientific methods, for harvesting forest products. \ 4. Stopping unauthorised cutting of trees and strict enforcement or law. 5. Adopting tree plantation and maintenance on a large scale (the productivity of tree plantation like Casuarina and popular is much higher than that of natural forests). 6. Adopting social forestry to meet the requirements of fuelwood, fodder, timber, fruit, and so on. 7. Creating an awareness among people about the necessity of forests for the survival of human beings and wild animals. It has been estimated that during the last 30 years, about 4.3 million hectares of forests have been lost in the construction of roads, dams and conversion into agricultural lands. In India we are losing about 0.16 million hectares of forests every year. Hence, there is an urgent need to adopt the practices mentioned above. Besides, shifting cultivation and overgrazing in forest lands should be avoided. While discussing management strategies for forests, one must mention the Chipko movement. Hugging trees is an age-old practice in the Himalayan region. In 1970, Gopeswar and some 20 villages of the Garhwal region of Uttar Pradesh were devastated by a flash flood in the Alakananda river. This flash flood occurred due to deforestation and was an eye-opener for the villagers. The people ofthese villages under the leadership of Chandi Prasad Bhatta pledged that they would not allow any more felling of trees. The people started hugging trees whenever forest contractors tried to cut them down. This movement became very successful and was popularised all over the world by Sundarlal’ Bahuguna. It became popular in other parts of India, particularly in Madhya Pradesh Rajasthan, Karnataka and parts of Orissa. It is one of the biggest forest conservation movements. The International Biological Programme (IBP), which was started in the sixties, was completed before 1980. This programme was

Natural Resource Ecology

343

originally planned to study the productivity of various ecosystems around the world and in course of time it provided valuable information regarding conservation. Later, the ‘Man and Biosphere’ programme at the international level did an excellent job of conserving ecosystems around the world. Wild life management must involve the restoration of the habitat, enforcement of the law to stop poaching completely, and avoidance of competition from domestic livestock with regard to grazing activity, so as to prevent transmission of diseases. Management programmes should involve the establishment of more national parks and game sanctuaries. The most threatened reptiles, birds and mammals of India are listed in Table 7.36. Table 7.36

Threatened* Reptiles, birds and mammals of India

Reptiles 1. Varanus salvator 2. Crocodylus palustris (Marsh crocodile)

Birds

Mammals

1. Choriotis nigriceps (The great Indian Bustard)

1. Presbytis pileatus (Capped langur)

2. Cairina culalata

2. Macaca silensus (Lion tailed macaque)

3. Crocodylus porosus (Estuarine crocodile)

(The white winged wood duck)

3. Hylobares hoolock (White browed gibbon) Panthera tigris tigris (Tiger)

4. Gavialis gangeticus (Gharial)

4.

5. Tylototriton varrucosus

5. Panthera leo persica (Lion)

(Himalayan Newt or Salamander) *Concept of threatened species: (i) Endangered (E): The species or taxa, which are in danger of extinction and they may not survive if the adverse factors continue to operate. The species whose numbers have been reduced to a critical level or their habitats have been drastically reduced in such a way that they are in the immedi ate danger of extinction. (ii) Vulnerable (V): The species or taxa likely to move into the ‘E’ category in very near future if the adverse factors continue to operate. (iii) Rare (R): The species with small populations and at present neither ‘E’ nor ‘V’ but are at risk. These species are usually localised within restricted habitats or thinly scattered over a more extensive range. (iv) Threatened (T): This term is used in the context of conservation of species or taxa which may be classified under any one of the above categories (‘E’, or ‘V’ or ‘R’). The above classification is based on (a) the present and past distribution of the species or taxa, (b) abundance and quality of natural habitat, (c) decline in the density of population in course of time, (d) the biology and ecological value of the species. The new IUCN Red list categories are Extinct (Ex.), Extinct in the wild (EW), critically endangered (CR), Endangered (EN). Vulnerable (Vn), conservation dependend (CD), Lower Risk (LR), Data Deficient (DD) Not Evluated (NE). The new IUCN red list categories provide a system that facilitates comparisons across widely different taxa. This system is based on population density and distribution criteria. The criteria can be applied to any taxonomic level at or below species level.

6. Panthera pardus (Leopard) 7. Panthera uncia (Snow leopard) 8. Clouded leopard 9. Felis marmorata (Marbled cat) 10. Felis temmincki (Golden cat) 11. Felis bengalensis (Leopard cat) 12. F. silvestris ornata (Desert cat) 13. F viverrina (Fishing cat) 14. F. caracal (Caracal) 15. FLynx (Lynx) 16. Arctictis binturong (Binturong) 17. Prionodon pardicolor (Spotted linsang) 18. Canis lupus pallipes (Indian wolf) 19. Melursus ursinus (Sloth bear) and many others

344

Fundamentals of Ecology

7.4.5 Agriculture Resource Management

The availability of solar energy, water and good soil are the basic requirements for agriculture. India, with a diverse climate and a variety of soils, has the potential to practise different types of agriculture. In the hot desert areas of Gujarat, Rajasthan and Haryana, the rainfall is scanty (about 10—70 cm), the soil is sandy, poor in nutrients and often saline and alkaline, the evaporation rate is high there is abundant sunshine. There is a huge population of cattle, and hence heavy grazing pressure. Under these conditions, fruit trees like pomegranate, and ber, and fuel wood trees like eucalyptus, acacia and Prosopis can be grown. These trees prevent soil erosion and help in the establishment of pastures, and in course of time make the area suitable for growing mungbean and other crops. Cattle dung should not be burnt but added to the soil to make it more fertile, so that millets and beans can be grown. There is adequate ground water in this region, which can be tapped for agriculture and other uses. Since there is abundant solar energy, appropriate-technology is being developed to utilise it. Solar stills are being installed to provide clean drinking water by desalinating salt water. Themain arid areas are in Rajasthan, Haryana, Gujarat, Karnataka and some parts of Orissa. Here aridity restricts the agriculture season to a few months. Ladakh has a cold desert of 70,000 km2 and is very arid. Some cereals, fodder crops and oil seeds can grow in these regions. Animals like Pashmina goats and Bactrian camels are found in Ladakh. The goats are famous for their hair, used in the preparation of shawls and other apparel and the camel is used for transport and milk. Care should be taken to breed these animals in large numbers, to provide adequate food and health care facilities. The drylands of the country form about 74% of the cultivated land and produce about 42% of our food. They produce millets, pulses, groundnut, cotton, and so on. These lands are rain-fed and therefore largely dependent upon the monsoon. In these conditions, the main strategy is to store water during the rainy season and use it for agriculture. Ground water can also be tapped for agriculture. In hill ecosystems, the age-old practice of podu or jhum or slash-and-burn cultivation needs to be stopped as it causes immense harm to the ecosystem. As a substitute, forestry is being practised in the uppermost regions of hills. The zone below the uppermost part is used for growing fruit trees, legumes and fodder grasses. The zone below it is utilised for growing crops. Water is stored in earthen dams and is used for agriculture and aquaculture. To increase productivity and to meet the heavy demand for food of the growing human population, multiple cropping practices are now being followed. Besides, there is now a heavy input of fertilisers and minerals in agricultural fields and pesticides are being used for crop protection. The right type of fertiliser and pesticide must be used to get an optimum yield. The nutrient requirement varies from crop to crop. For example, cereals require more nitrogen than phosphorus an potash because they cannot fix nitrogen. Pulses bear root nodules containing symbiotic bacteria which fix nitrogen directly from the atmosphere and therefore require more phosphorus than nitrogen. Modern agrotechniques, such as cropping system, use of fertilisers, crop protection measures and the use of high-yielding varieties of seeds are now commonly used. Recycling of Resources and Waste An important strategy for the efficient utilisation of resources is to develop technologies to recycle some resources and waste matter. Before disposal, a waste can be considered for following possibilities: (i) Reduction in waste quantities

Natural Resource Ecology

345

(ii) Reuse of waste materials (iii) Materials recovery (iv) Energy recovery. New technologies are now available to recycle some solid wastes. For example, nightsoil or the fermentation of organic waste like cattle dung, animal excreta, garbage, aquatic weeds, etc., can be utilised to produce biogas, which can be used for cooking, street lighting, industry and so on. The slurry produced by this method is used as manure. Waste paper can be converted into toilet paper. Some solid wastes can be utilised in vermitechnolgy for the production of earthworm cast, earthworm tissue protein, and so on. The worm casts can be utilised for the production of mushrooms (Dash and Das, 1989; Das and Dash, 1990) and vegetables and crops (Senapati, 1989). The earthworm tissue is used as feed material for poultry (Das and Dash, 1989, 1990), fish, amphibia and pigs. After extraction of metal from the ore, a waste product called slag remains. The slag can be powdered and added to cement for construction work. Flyash is also used as a cementing material. Scrap metals produced in mills and factories, used metals of discarded vehicles, machines, ships and aeroplanes can be melted and recycled for various purposes. Metals like copper, zinc, lead and platinum, which are in short supply, can be recovered from used materials by recycling. Municipal and domestic waste water contains organic matter. This water is settled in settling tanks and then treated with alum and caustic soda. The clear liquid obtained is passed through sand or filters and air is blown through it. This water now becomes suitable for use in crop fields, gardens, and so on for growing vegetables and crops. It can be treated with chlorine to kill harmful germs to render it safe. Now-a-days, water hyacinth or algae are grown in water bodies and in waste water treatment tanks to clean the water. These plants can later be used for the production of biogas. Vermitechnology: an option for organic waste management Under present day conditions of energy crisis and environmental degradation, it has become essential to develop appropriate technologies for the recovery of energy from non-conventional sources like organic wastes. The concept of resource recycling is particularly relevant to agricultural production, because the natural soil-plant-animal-soil recycling system is remarkably effective in operating the process of bioprocessing and bioconversion. The two broad approaches to tackling the problem of organic recycling in soil improvement and crop production are: (a) improvements in the process of composting by a reduction in the processing period and an enrichment in quality, and (b) utilisation of the available organic residues and inorganic wastes in the natural plant production cycle. India produces about 2,500 million tonnes of organic waste annually, which can be utilised for the recovery of essential resources, such as fertiliser, fodder, fuel and food. If properly managed, about 400 million tonnes of plant nutrients can be produced from this huge organic waste. Earthworm (Verm) is now known to be a good biological element for the recovery of verrnifertiliser and vermiprotein for use in agroecosystems, aquacukure and poultry (Dash and Senapati, 1986). Waste biomass resources Waste biomass from domestic, agriculture, urban an industrial sources is the main cause of organic pollution in developing countries like India. Decomposable materials constitute a major percentage of the refuse (more than 60%). Table 7.37 shows the potential of the waste biomass resources and the plant nutrients that can be recovered from it (Vimal and Talashilar, 1983). Organic and inorganic components of waste can be reutilised. In fact, nothing is really waste and much of it is merely ‘vegetable matter in the wrong place’. Besides recovery of nutrients, 23% of newsprint, 47% of steel, 90% of copper and 96% of aluminium can be recovered from waste( Brown and Shaw, 1982).

Fundamentals of Ecology

346

Table 7.37

Potential of waste biomass resources and plant nutrients*

Organic resources

Quantity in lakh tonnes per annum in India

Plant nutrients in thousand tonnes N

P203

K2O

Total

Animal wastes/byproducts

17,043.2

4,111.9

1,298.6

1,952.0

7,362.5

Crop residues/byproducts

1,599.5

810.9

562.7

2,085.4

3,459.0

0.3

0.2

0.1

0.2

0.5

175.0

243.6

34.4

98.8

376.8

Fruit and vegetable wastes/residues Forest residues/byproducts Fish and marine wastes/residues Human habitation waste Aquatic biomass/other wastes Biofertilisers

0.5

3.4

2.9

0.5

6.8

3,194.8

815.5

322.1

248.8

1,386.4

30.0

30.0

60.0

640.0

1,225.0

22,683.3

7,270.0

60.0

150.0

——

1,225.0

4,445.7

3,967.0

(Rhizobium, non legumes, blue green algae) Grand total

2,250.8

* after Vimal and Talshikar (1982)

The conservation of quality environment may be a function of then rate and amount of waste recycling and possibly utilisation. Organic manure utilisation can help in many ways: 1. By providing a substitute for high-cost inorganic fertilisers in developing countries. 2. By improvement of soil quality by supplying humus forming organic materials. 3. By an increase in the water retention capacity by increasing the humus content. 4. By a supply of essential nutrients (apart from nitrogen, phosphorus and potassium, that were drawn from the soil through vegetation. 5. By a reduction of the leaching of nutrients and helping in the slow release process. 6. Abatement of pollution through organic agriculture. A comprehensive status report on the utilisation and recycling of wastes was prepared in 1975 by the National Committee on Science and Technology of the Government of India (NCST, 1975). The NCST is the progenitor of the Scientific Advisory Committee to the Cabinet (SACC). Considerable effort has gone into the preparation of this report but not much cognisance has been taken of it so far (Khoshoo, 1986). With decentralised management of wastes, employment would be generated by way of collection, handling and procoessing, which, may not require high technical skills. Developing countries with many resource constraints cannot afford to treat any as material waste. Paradoxically, it is industrially developed countries, such as Japan, Germany, UK, and USA, that are in the vanguard of waste utilisation. By and large, waste utilisation has not taken root in the majority of developing countries, including India. Waste and earthworms Soil invertebrates like earthworms, along with soil microorganisms, degrade organic waste materials and thus maintain the nutrient flux in the system (Whyte, 1964; Edwards and Lofty, 1977). The waste of one organism is the energy source for another. The natural process of

Natural Resource Ecology

347

biological degradation is called decomposition and the process of sanitary disposal and reclamation of organic material is termed composting (Gotaas, 1956). The earthworm is physically an aerator, crusher and mixer, chemically a degrader and biologically a stimulator in the decomposer subsystem (Mitchell, 1978, Dash and Senapati, 1984, 1986). The degradation of organic waste by earthworth consumption is known as vermicomposting (Dash and Senapati, 1986). Biological conditioning of wastes through vermicomposting has at least three advantages: (a) abatement of organic pollution by rapid reduction in the bulk density and elimination of foul odour, (b) production of vermifertilizer (worm casts) and compost for application in agroecosystems, and (c) production of vermiprotein or vermitin from waste and utilisation of this protein as feed for poultry, fish, pigs and other domestic animals. Vennicomposting involves three phases as follows. 1. Phase I This involves the collection of wastes, shredding, mechanical separation of the metal, glass, ceramics, etc. and storage of organic wastes. Shredding is a crushing method of decreasing particle size and volume by about 50 to 70%. 2. Phase II This involves composting by earthworms. Organic wastes can be used first for biogas production and then slurry can be added to the earthworm beds for vermicomposting. An earthworm bed can be prepared with a concrete lining or in wooden boxes fo small scale use in households. 3. Phase III This features the screening and sorting of larger undecomposed wastes which can be used for landfilling or reprocessing. Earthworms can be separated from the compost by a dynamic separation method involving a sieve, and a photo or thermal stimulus. Vermicompost and earthworms thus obtained can be utilised as desired. The biomagnification of toxic substances in earthworm tissue, the market value of vermifertiliser an acceptance by society are some of the immediate problems faced by the vermi industry. The selection of species of earthworm for vermicompostig should emphasise the following features: (a) Should be capable of adapting to a high percentage of organic material. (b) Should have high adaptability with respect to environmental factors.. (c) Should have a high fecundity rate with low incubation period. (d) Should have a very small interval between hatching and maturity. (e) Should have high growth, consumption, digestion, and assimilation rate. (f) Should have minimal vermistabilisation (period of inactivity after initial inoculation to organic wastes). Selection of earthworm species and their culture Julka (1986) reported a list of 20 Indian worms which could be possible vermicomposting elements. Table 7.18 gives a comparative account of the vermicultural characteristics of some Indian worms. In a temperate climate the most common vermicomposting worms are Eisenia foetida and Lumbricus rubellus. For Indian conditions, worms like Dichogaster bolaui, Drawida wilisi, Lampito mauritii and Perionyx excavatus are favoured (Dash and Senapati, 1986). The African worm Eudrilus euginiae is now being tried at different centres and is giving encouraging results (Kale, 1986). However, it is better to look for endemic species, because exotic species might carry fungal and other pathogens, which may create additional problems for our crop. The vermiculture method has already been standardised in Indian conditions and can simply be started in used apple boxes with sand and sawdust mixed with dry cowdung and organic wastes.

Fundamentals of Ecology

348

Table 7.38 A

Summary of characteristics considered by Bouche (1977) to differentiate ecological types of earthworms

Character

Ecological type Epigeics

Anecics

Body size

Small

Moderate

Burrowing muscles

Reduced

Strongly

Endogeics Large Developed developed

Longitudinal contraction

Nil

Developed

Least developed

Hooked chetae

Absent

Present

Absent

Sensitivity to light

Feeble

Moderate

Strong

Mobility

Rapid

Moderate

Feeble

Skin moistening

Developed

Developed

Feeble

Pigmentation

Homochromic

Dorsal and

Absent

Fecundity

High

Moderate

Limited

Maturation

Rapid

Moderate

Slow

Respiration High

Modest

Feeble

Survival under adverse conditions

As cocoons

True diapause

anterior

By quiescence

Lampito mauritii and Octochaetona surensis earthworms decreased the C: N ratio of sterilised soil by about 37 and 31% respectively, as against a 4% decrease in the control sets in a month-old laboratory culture. The Drawida wilisi earthworm is even better for vermicomposting. Table 7.9 shows that D. wilisi has better vemicomposting characteristics than O. surensis and L. Mauritii. In a laboratory experiment on the comparative decomposing ability of the three worms, it was calculated that at the end of the 28th day, the percentage disappearance by ignition loss was only 4% in the control without earthworms, 13% with O. surensis, 20% with L. mauritii and 24% with D. wilisi. However, D. wilisi requires a greater amount of moisture in the culture medium (20 g %) whereas L. mauritii can be active at about 15 g % of soil moisture (Senapati and Dash 1984). The abundance of D. bolaui and P. excavatus earthworms in kitchen waste, farmyard manure, and cowdung deposit sites indicates the possibility of their utilisation in the composting of high organic biomass (Sahu, 1985; Mishra, 1986). The modus operandi of culturing earthworms is simple. Fishermen rear worms in waste earthen pots with soil and dry .cowdung. Earthworms can be successfully cultured in a 50 ¥ 25 ¥ 15 cm wooden box, and onefourth filled with soil, with a layer of small gravel at the base, one-fourth with sawdust, rice bran, straw or sieved organic garbage, one-fourth with dry cowdung or any other suitable nitrogenous waste and the rest left as empty space. Initially 100 adult worms can grow more than 150 to 200 times their initial body weight in a six-month culture. Soil moisture should be maintained at about 15–20 g % and a temperature of around 25–28°C is suitable for a tropical species. Waste grass composting with earthworms Eragrositis amabilis (Wright and Am) is a dominant low fodder quality grass in many Indian states. This grass is suitable for the conservation of soil from erosion (Whyte, 1964). Senapati and Dash (1981) have shown that this grass contributes around

Natural Resource Ecology

Table 7.38 B

349

Gut enzymes of Indian earthworms (Mishra and Dash, 1980)

Earthworm species

Gut enzymes Amylaze

Chitinase

Cellulase

Protease

Urease

Dichogaster bolaui

+

–

+

+

+

Drawidacalebi

+

–

+

+

+

Drawida wilisi

+

–

+

+

+

Eutyphoeus sp.

–

–

+

+

Lampito mauritii

+

+

+

+

+

Dendrobaena octoedra

–

+

–

–

–

Eiseniafoetida

–

–

–

+

–

+ Present – Absent

Table 7.38 C

Vermiculture characteristics of some Indian earlhworms*

Species

Soil temperature for maximum growth

Age for cocoon production (weeks)

Upper limit of soil temperature tolerance (°C)

Vermistabilisarion time (weeks)

No. of young cocoon

Incubation period (weeks)

Average size (g)

5—9

25

6—8

2—4

3—4

0.5

Eiseniafoetida

18—25

Eudrillus eugeinae **

20—25

7—10

30

3—4

2—3

4

1

Perionyx excavatus

25—30

15—18

30

4—5

1

4

1

Lämpito mauritii

18—30

8—10

30

3

1

4

1

Octochaetona surensis

20—25

15—20

27

8—10

1

4

1

Drawida willsi

20—25

6—10

30

3—4

2—3

1

0.5

Dichogaster bolaui

25—30

5—9

33

3

1—2

1

0.1

* Collected from different sources ** African worm

15–51% of the net primary production of pasture ecosystems of Orissa and about 5 tonnes of dry plant materials can be obtained from one hectare of land. Laboratory decomposition of this grass with L. mauritii earthworms has shown that the participation of earthworms can enhance decomposition by about 25%. A comparison of the vermicomposting of pure filter paper with soil, green leaves, dead leaves and the litter of E. amabilis with soil has revealed that filter paper amendment with soil decompose at a slower rate (39% decrease in C : N ratio) in comparison to E. amabilis litter (61% decrease in C : N ratio). For decomposition, pure cellulose materials like cotton, paper and straw, with little nitrogen content, can be mixed with nitrogen-rich green manure, sewage sludge, blood, urine and night soil. This experiment also revealed that percentage disappearance (loss in ignitioh) and decrease in C : N ratio have a very high correlation (r = + 0.9, p < 0.001). Thus one of these two parameters can be considered for an assessment of decomposition (Senapati and Dash, 1984).

350

Fundamentals of Ecology

Nitrogen supplementation to vermicomposting by green manure addition An experiment was conducted by Kabi and Senapati, (1984, as reported by Dash and Senapati, 1986) to determine the effect of nitrogen supplementation to decomposing straw by L. mauritii and D. willsi earthworms within a seven days time period. Green manure mulching of Sesbania aculeata provided the supplemental nitrogen. Percentage disappearance was 3% in the field soil without earthworms, 11% with field soil and straw amendment (100%), 34% with field soil, straw amendment and L. mauritii worm (3 g live wt. per pot) and 42% with field soil, straw amendment and D. wilisi worm (3 g live weight per pot), 22% with field soil, straw amendment and green manure (0.200 g %), 40% with field soil, straw, green manure amendment and L. mauritii worm, and 50% with field soil, straw, green manure amendment and D. wilisi worm. The enhanced decomposition (around 8% higher disappearance) over the sets without nitrogen supplements indicates the importance of nitrogenous materials during the vermicomposting of non-leguminous crop residues like straw. Household garbage composting Using about 4 kg of household garbage in earthen pots of 60 cm height with about 45 cm diameter and top cover, vermicomposting was done for 75 days with 20 L. mauritii worms.

The percentage diappearance at the end of the experiment was 36 and 54% without and with L. mauritii worms respectively. Applying the correlation- regression equation between the percentage decrease in C : N ratio (Senapati and Dash, 1982, 1984), it has been calculated that the C: N ratio of the garbage decreased from 39 to about 15 and 23 in 75 days in the experimental and control sets respectively. The application of vermicompost and earthworms has resulted in a higher yield of paddy crops ranging up to a 95% increase in grain, 128% increase in straw and root production and 38% decrease in weed growth (Senapati, personal communication). Two models one small scale and another large scale of vermicomposting are given in Table 7.39 (Dash, 1999). Earthworm feed utilisation for animal culture Dash et al. (1977), Sabine (1978), Guerro (1981) and Kale (1986) have reported high protein content (more than 50% on dry weight basis) in earthworm tissue. Schulz and Graff (1977), and Graff (1981) have shown that earthworm meal is a better source of essential aminoacids than fish or poultry. Hansen and Czochanska (1975) have reported the predominance of unsaturated lipids, and a higher amount of linoleic and linolenic acids in earthworm tissue, which are essential for migratory birds and poultry birds to ensure larger egg size.

Earthworm feed trials have been made for growth studies of anuran larvae of Rana rigrina and Bufo stomaticus by Mohanty and Dash (1986) and Mohapatro and Dash (1987). Boiled leaves of Amaranthus sp., minced goat meat and earthworm tissue, each separately and in combination were taken as feed materials. Earthworm-fed larvae showed maximum growth (129 mg live weight for B. stomaticus and 959 mg live weight for R. tigrina) at the metamorphic climax stage in comparison to the larvae fed with other feed materials (B. stomaticus 121 mg with Amaranthus feed, 71 mg with goat meat, R. tigrina 804 mg with Amaranthus feed, 1,197 mg with goat meat) but the metamorphic climax occurred in 70 days instead of 34. The duration of metamorphosis was shortest with and only-earthworm feed, in comparison to other feeds (13.3 days for B. stomaticus and 34 for R. tigrina). These studies reveal that earthworm can serve as a better feed material for laboratory cultures of anuran larvae. Recent studies by Das and Dash (1989, 1990) indicate that earthworm meal can be used as a substitute for gram meal for raising broilers and Japanese quails and earthworm casts can be used to raise edible mushroom.

Natural Resource Ecology

Table 7.39 A

A.

351

Flowsheet for Management of Canteen and Household organic waste successfully done at Indian Aluminium Company Ltd., Hirakud, Sambalpur. (Small scale) by the author. (based on Dash, 1998 and 1999)

Capital Investment: i. Drying bed (one 2 m ¥ 7 m), storing pit (two, I m ¥ 1 m ¥ 1 m) and vermicomposting pit (Five, 2m ¥ 1.5 ¥ I .5m) construction in cement with proper outlets and shaded roofs (Only above storing and vermicomposting pits). ii. Vermibed (broken bricks, sand, straw, soil, cowdung). iii. Implements (shovel, crow bar, spreader, bucket etc.). iv. Biological specimen used (Lampito mauritii, Drawida bolaui, Perionyx excavatus). (Initially ‘- 1kg freoh weight worm)

B.

Recurring cost: i. Cowdung (for periodical enrichment of bed) ii. Labour (for drying spreading, watering, harvesting, packing etc.)

C.

Waste generation: i. From canteen

20 kg. fresh wt/day

ii. From household

30 kg. fresh wt/day

Total —

50 kg. fresh wt/day

Waste generation during 15 days-

750 kg fresh wt.

Duration of each run -

~90 days

Waste addition in one pit at 15 days interval-

40 kg ¥ 5 pits 200 kg

Number of application of waste-

6 times

Waste addition in one pit in each run (90 days)-

240 kg.

So total waste addition in five pits in each run -

1200 kg.

(~200 kg dry wt)

D.

Vermimanure production: Vermimanure production from five pits in each run =

~800 kg

Duration of each run =

90 days to 100 days

Number of harvests of vermimanure per year =

~4

Annual Vermimanure production = 3200 kg. @ Rs. 5/-per kg.

Rs. 16,000/-

Conclusion Vermitechnology has a bright future in both developing and developed countries, as it concerns waste management, resource recovery and environmental conservation. The importance of earthworms has been realised since the work of Darwin during the late 19th century. Evidence from a wide spectrum of studies has confirmed his observations on the stupendous role of earthworms in the formation, development and maintenance of soil quality for the healthy growth of vegetation and microflora. One hopes that, in the future, agriculture, aquaculture, animal husbandry, waste management and sanitation and the management of many ecosystems will utilise available knowledge of the manipulation of natural resources like earthworms. Research work must continue on the selection of appropriate species and the development of technology for vermiculture, vermicomposting and vermified industries as part of the biotechnology programme.

Fundamentals of Ecology

352 Table 7.39 B

Production Cost of Vermicompost (Large scale). Production capacity- 10 Metric Tonnes (MT) every 4 months. 30 M. T. per year

Requirements A.

Amount (Rs)

Non-recurring cost: i.

Bamboo shades (15 x 5 meter)

ii.

Pit digging (15 mx I m x 1 m)

iii.

Earthworms 20,000 earthworm/tonne Rs. 0.25 worm (For initial 10 tonnes of compost production They will multiply - sustainable).

1,500.00 500.00

50,000.00 = 52,000.00

B.

Recurring cost: 1.

Agricultural and organic wastes @ Rs. 40/tonne with transport for total 75 tonne.

2.

Labour cost @ Rs. 50/day (—200 day/yr required)

3.

Biofertilizer (decomposing material)

2,000.00

4.

Packing and storage

3,000.00

5.

Maintenance

3000.00 10,000.00

2,000.00 = 20,000.00

A.

B.

C.

i.

Total non-recurring cost for 5 years @ 30 ton per year = 150 ton for - 5 years.

ii.

Per ton

i.

Total recurring cost for 30 tons

ii.

Per year/ton

52,000.00 347.00 20,000.00 667.00

Total cost - Rs. 347/- + Rs. 667/- = Rs. 1014/Say Rs. 1000/- per ton.

D.

One ton vermicompost selling price Rs. 5/-

5,000.00

MULTIPLE CHOICE QUESTIONS Choose the correct answer 1. Expand WWF: (a) World wide fund for nature (c) World wildlife fund (b) World women Dev. Fund (d) World water management fund 2. How much land is under cultivation in the planet earth? (a) Less than 15% (b) 20% to 30% (c) 50% (d) 70% 3. How many mega biodiversity countries have been identified in the world? (a) Five (b) Seven (c) Twelve (d) Twenty 4. In Range lands one of the following is meant stock level: (a) Grazing animals (b) Small predators (c) Large predators (d) Grass biomass

Natural Resource Ecology

5.

6.

7.

353

For the conservation of marine coastal resource and reducing the effect of Ocean pollution, commercial fishing is restricted from the seashore to (a) 12 km (b) 14 km (c) 18 km (d) 25 km The most appropriate recent concept of sustainable development involves: (a) Economic developments and community development. (b) Economic development, community development and environmental protection. (c) Economic development and environmental protection. (d) Economic development, community development, environmental protection with help of science and technology and management tools. Write short notes: (a) Importance of forests to human society. (h) Live stock as a renewable resource. (b) Social forestry. (i) Threatened breed of animals in India. (c) Wildlife as a resource. (j) Concept of Sustainable Development. (d) National Parks. (k) Criteria for building a sustainable system. (e) Wetlands. (l) Remote Sensing. (f) Mega diversity countries. (m) Land use management. (g) Floristic diversity of India.

SHORT AND DESCRIPTIVE QUESTIONS 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21.

Discuss water as an important natural resource for India. Why non-conventional energy resources are considered most important energy source in 21st century? Discuss forests as renewable resource and their management needs. Discuss India as a Mega biodiversity country? What is endemism and discuss the endemic flora and fauna and their conservation strategies in India. Distinguish between Sanctuary and National park and give an account of National Parks and their management in India. Discuss the factors, important for management of range lands. Distinguish between capture and culture fishery and discuss the Aquatic resources of Indian lakes and reservoirs and their management strategy. Discuss the ecological factors considered as important for culture fishery. What is Sustainable Development? Discuss the key issues. The debate on development and environment protection is important. Discuss how environment protection is key to achieve proper development for Sustainability. what is GIS and Remote Sensing? Discuss the remote sensing application for environment protection. Discuss the important factors of land use planning and management. What is vermitechnology? Give an account of vermitechnology practices in India.

8

Pollution Ecology

8.1 CONCEPT OF POLLUTION For the first hundreds of thousands of years of life on earth, man largely depended on physical strength to gather food, mainly from hunting. Then man discovered fire, but utilised its true potential only in the eighteenth century, after the invention of the steam engine. Water was used for various purposes since the dawn of civilisation—wind energy was utilised much later. The major transition in energy utilisation came with his acquiring a knowledge of agriculture and animal husbandry. This helped to increase the per capita availability of energy. But it also marked the start of man’s increasing interference with nature. For agriculture, man had to cut forests. But as the food supply increased, so did storage facilities, and social activities changed. Males and females found more time to remain together, Populations increased, villages multiplied and become towns, cities and nations. Agriculture became associated with irrigation, the invention of the iron plough and the use of animals on the field. The fuelwood-based metal working technology helped man develop tools (axes, saws, swards, and so on) which were utilised to cut trees for various purposes. Then man started learning the use of fossil fuels, followed by the industrial revolution in Europe. The large-scale use of fossil fuels made transportation cheaper and helped spread industrialisation. Man developed new technologies and utilised the resources of the earth for creating better living conditions. As populations increased, there was a need for increase in food production. Man cleared forests and introduced many chemicals into the environmental to step up agricultural productivity. These chemicals, called pollutants have created problems which man did not face before. These pollutants have altered the carbondioxide contents of the atmosphere on a global scale and have destroyed fish and other aquatic organisations on a massive scale. These pollutants have now appeared in migratory birds and human beings and pose a health hazard. What does pollution mean? Pollution of the environment is an undesirable change in the physical, chemical and biological charactertiscs of air, water and soil due to the addition to the environment of material or energy (heat ,sound, radioactivity ,etc,)in quantities and at a rate which are harmful to living organism, including man. Materials introduced into the environment cause two types of pollution (i) Some materials remain unchanged for a long time in the environment. These are not easily degradable and are called persistent pollutants (e.g. plastic, pesticides, and nuclear wastes).Many of these persistent pollutants are toxic and get incorporated into the food chain (ii) some pollutants breakdown into simpler substances in a short time and ultimately

Pollution Ecology

355

get mixed with or incorporated into the soil. These substances do not persist in the environment and are therefore termed non-persistent, (e.g. agricultural waste and garbage).Some of these are biodegradable, since some living organisms utilise them as food substrate. Polluants can be(a) gases,(b) metals and their salts,(c) pesticides and agrochemicals (d) drugs and pharmaceutical products,(e) organic matter, (f) radioactive substances,(g) heat, and (h) noise. On the basis of the environmental component, they can also be classified as air pollution, water pollution, soil pollution, and so on.

8.2

AIR POLLUTION: CONCEPT

Air is precious and life cannot be sustained on this planet without it. Without oxygen, aerobic life is not possible. Air has weight and exerts a pressure of about 1,000 millibars at sea level. The general rule is that with an increase of 16 km in elevation, the pressure decreases by a factor of ten. Each sphere of atmosphere has a particular range of temperature. In the troposphere, the temperature generally falls with height. Rain and snow occur in this region, which controls weather conditions. In the stratosphere, the temperature either remains constant or increases with height—ozone is produced here. The normal composition of dry air is almost constant and is given in Table 8.1 An alteration of the composition of the atmosphere by the introduction of potentially harmful substance like gases Table 8.1 Approximate composition of dry air (mainly troposphere) (Antarctica, 1971, based on and particulate matter causes pollution. Spedding, 1974 and other sources) About 100 million tonnes of pollutants are poured into India’s atmosphere every Gas % by volume % by weight year and this amount is increasing every Nitrogen 78.09 75.51 year. Aeroplanes release a large amount Oxygen 20.94 23.15 of burnt or unburnt fuel and gases into Argon 0.93 1.28 the air. A huge amount of smoke comes 0.032 0.46 out of factory chimneys or household Corbon dioxide cooking when the fuel is coal, wood Neon, helium, methane, Negligible Negligible sawdust or dry cowdung. The ground krypton, xenon level pollution in big cities like Calcutta. Other gases (hydrocarNegligible Negligible Delhi, Bombay, Madras and Bangalore bons, nitrogen oxides, hydrogen, ammonia, ozone is mainly due to automobile exhausts. (in stratosphere), SO2, etc.)

8.2.1 Source of Pollution

Air gets polluted largely due to the smoke produced by automobiles, power plants and kitchens and due to the large-scale burning of fossil fuels, such as coal, diesel, petrol, kerosene, and so on. 1. The burning of fossil fuels produces carbon dioxide, carbon monoxide, sulphur dioxides, oxides of nitrogen, hydrocarbons, particulate matter and metallic traces. Coal produces a lot of smoke and dust while petrol and metallic traces. Coal produces a lot of smoke and dust while petrol and its products produce more sulphur dioxide. 2. Thermal power plants are coal based. The main pollutants are fly ash, soot and sulphur dioxide. 3. Fertiliser plants produce oxides of sulphur, particulate matter and fluorine. These pollutants come from sulphuric and phosphoric acid units, Ammonia, nitrogen oxides and hydrocarbons come to the atmosphere from nitrogen-based plants.

Fundamentals of Ecology

356

4. 5. 6.

The major pollutants from the textile industry are cotton dust, nitrogen oxides, chlorine, naphtha vapours, smoke and sulphur dioxide. there are thousands of chemical plants and pesticide plants which prepare caustic soda and produce chlorine gas. steel plants produce carbon monoxide, carbon dioxide, sulphur dioxide, fluorine, particulate matter, phenol, cyanide, sludge, slag etc (Table 8.2)

Table 8.2

Release of pollutants in an integrated steel plant (source: NEERI, Nagpur).

Pollution Ecology

7.

8.

357

Automobiles contribute 60% of the air pollution by releasing compounds like carbon monoxide, oxide of nitrogen, and hydrocarbons. Gases emitted during deceleration and acceleration are more harmful than duces a hydrocarbon. Gases emitted during deceleration and acceleration are more harmful than those produced during constant speed. Incomplete combustion produces a hydrocarbon, 45 of nitrogen oxides, 18 of aldehydes, 17 of sulphur compounds, 2 of organic acids and ammonia and 0.3 pounds of carbon particles. Decomposition of organic wastes and municipal garbage produces foulsmelling gases which pollute the air.

8.2.2 Source Apportionment of Air Pollution Natural Sources

Pollution of the air from the natural sources include volcanic eruptions, naturally occurring forest-fires, dust stirred up by storm winds, gases produced by decay, dust from erosion and air-borne pollen. About 57% of Table 8.3 Fuel uses in different sectors the SO2 is produced globally from hydrogen sulphide gas Sector Fuel from natural resources. About 7.2% of the carbon mon• LPG oxide and 5.8% of nitrogen oxide emission is contrib- • Domestic • Kerosene uted by the forest fires. Natural sources of hydrocarbon • Wood / Coal include bacterial decomposition of organic matter which produces large amount of methane. Man made emission • Cow dung accounts for only 6% of the total atmosphere content of • DG Sets • Diesel Oil hydrocarbons. • Industrial • Coal In an urban area, the major sources of air pollution are domestic fuel consumption, vehicles, D.G. sets operating in the city and the industrial activities in and around the city and Industrial townships.

• Vehicular

The fuels commonly used in India in different sectors are given in Table 8.3.

• Brick kiln

• Coke • Furnace Oil • Diesel Oil • Diesel • Petrol • Coal

Domestic Sources

Slum residents still mostly use cow-dung, kerosene, coal and wood for cooking purpose. However, a large section of the population is dependent on liquefied petroleum gas (LPG). Estimation of pollution load from the domestic sector due to burning of fuel has been calculated using equation as given below: Pollution load (Xi) in kg/day = Fuel consumption (Fw) ¥ Emission factor (Xj) Where, Xi is the pollutant parameter Fw is the quantity of fuel consumption (tons/day) Xj is the emission factor of the fuel (kg/ton) The emission factors for different fuels as per WHO Publication (No. 62) are given in Table 8.4.

Fundamentals of Ecology

358 Table 8.4

Emission factor for different fuels used in domestic sector

Type of fuel

Emission factor (kg / Ton) SPM

Wood / Cow dung Coal Kerosene LPG

SO2

NOx

HC

CO

13.7

0.5

5

1

1

10

19(s)

1.5

10

45

3

17(s)

2.3

0.4

0.25

0.42

0.02(s)

1.8

0.17

0.44

Sulphur content : Kerosene = 30%, Coal = 0.5%, LPG = 0.1% Specific density of kerosene = 0.845, Specific density of LPG = 0.55 S – Based on Percentage of Sulphur content, e.g., pollution load (coal) = Fw ¥ 0.005 ¥ 19 (Source SPCB, Orissa)

Industrial Sector

The emission factors for different fuels used in the industrial sectors as per WHO publication (No. 62) (Table 8.5). Table 8.5

Emission factor for different fuels used in industrial sector

Type of fuel

Emission factor (kg/ton) SPM

Coal Fuel oil residual (furnace oil)

SO2

NOx

HC

CO

6.5(A)

19(S)

7.5

0.5

1

2.87

19 (S)

7.5

0.37

0.52

Oil distillate (HSD/kerosene)

2.13

20.1 (S)

7.5

0.41

0.59

LPG

0.38

0.02 (S)

2.6

0.065

0.35

Natural gas

0.34

20 (S)

3.6

0.058

0.32

(A) – Based on percentage of ash content. (S) – Based on percentage of Sulphur content. Ash content (A) : Lignite coal 40% Sulphur content (S): Coal – 0.5%, Fuel Oil – 2%, Oil distillate – 0.1%, LPG – 0.1%

8.2.3 Behaviour of air pollutant

The behaviour of the pollutants and their residence time in the atmosphere are related to the particulate size. Large solid particles with a diameter of over 50 microns (µ) (1µ = 10–6 meter) are collectively visible in the air and settle down fairly quickly. In view of this, these are not a long-term pollution hazard. Particulates in the size range of 50–0.01 µ diameter are of most significance to air pollution, and because of their size, they are not obviously visible. They can remain in the atmosphere for varying lengths of time and undergo chemical reactions to produce secondary pollutants. Particles below a diameter of 10 µ act as nuclei for the formation of condensation water droplets in cloud formation. They may fall on the vegetation and soil by precipitation as rain and other forms of air moisture within (drizzle, dew) within short time (7–10) days of their emission. Particulates can remain suspended in the atmosphere for days, weeks, months or years. For example, in the lower troposphere for 6 – 14 days; in upper troposphere for 2 – 4 weeks; in the lower stratosphere up to 6 months and in the upper stratosphere for years.

Pollution Ecology

359

According to the behaviour and concentration of the pollutants, the atmosphere can be broadly divided into four layers. Near the ground is a layer of air 1–100 m high which may be much polluted in the urban areas. Some of the pollutants are absorbed into vegetation, buildings and water surfaces. It has been estimated that 33% of the SO2 in this layer is removed by absorption. The next layer extends from 100 m up to the cloud base at a height between 500 and 2,000 m altitude in the troposphere. In this layer, the pollutants become well mixed by the turbulent air currents and some amounts are washed out by drizzle, rain and fog. The third layer contains most of the atmospheric water vapour, cloud and extends upto the tropopause. Some pollutants may be dissolved or become nuclei in the cloud water droplets. Later, they may either be removed from the layers as rain or released again into the atmosphere when clouds evaporate. Small sized particulates remain suspended in the air and undergo photochemical changes under the action of UV radiation. There is also movement of particles by air currents, upward into the stratosphere and horizontally over varying distances, depending on wind speed and direction of wind and other climatic conditions. The upper atmospheric layer with significant presence of pollutants is the lower stratosphere. This contains hardly any clouds or water vapour and a low concentration of pollutants. Photochemical reactions occur in the stratosphere. There may not be any significant movement of the pollutants. The pollutants remain in this layer for a very long period. Smoke and fumes can increase the atmospheric turbidity and reduce the amount of solar radiation reaching the ground especially in industrial and urban areas. Solid particulates take part in cloud formation. Urban pollution and increased water vapour emission can produce increased cloud covers, more wet days and increased mist, fog and smog compared to non-industrial areas without much vegetation. These processes combine to increase the deposits of large sized particulates on the ground. This may affect the erosion and corrosion of building, materials and metals and also plant life. All these processes may occur in some areas of heavy pollution (Table 8.6). Table 8.6

Height and surface influence on wind speed

Height above ground (m)

Relative wind speed over different surfaces in percent of wind speed at 500 m height (%) City centres, tall building

Suburban districts and forest areas

Flat land, sea

500

100

100

100

300

82

92

100

100

53

68

86

30

32

48

71

10

21

36

60

03

13

25

49

Source: IS 13736 (Part 2/Sec 2): 1993, IEC Pub 721-2-2 (1988)

National Air Quality Monitoring Programme (NAMP)

To assess air quality, its present and anticipated pollution status in urban areas, the Central Pollution Control Board started continuous air quality survey / monitoring programmes in selected cities and towns since 1984–85 under a national level programme, i.e., National Air Quality Monitoring Programme (NAMP).

Fundamentals of Ecology

360 8.2.4 Air pollutants

From the above discussion, it appears that there are five major categories of air pollutants: 1. Oxides of carbon (carbon monoxide, carbon dioxide) 2. Sulphur dioxide 3. Oxides of nitrogen 4. Hydrocarbons 5. Particulate matter and Aerosols (dispersion of solid and liquid matter or particles) These five categories of primary air pollutants react with one another and with other substances and produce secondary pollutants, which are very dangerous to living organisms. Air pollutants can be classified on the basis of chemical composition as shown in Table 8.7. Table 8.7

Classification of air pollutants on the basis of chemical composition

Major classes Particulate

Gases-organic

Gases-inorganic

Sub-classes

Typical members of sub-classes

Solid

Dust smoke, fumes, fly-ash

Liquid

Mist, spray

Hydrocarbons

Hexane, benzene, ethylene, methane, benzen, butadiene

Aldehydes and ketones

Formaldehyde, acetone

Other organic

Chlorinated hydrocarbons alcohols

Oxide of carbon

Carbon monoxide, carbon dioxide

Oxides of sulphur

sulphur dioxide, solphur trioxide

Oxides of nitrogen

Nitrogen dioxide, nitrogen trioxide

Other inorganic

Hydrogen sulphide, Hydrogen fluoride, ammonia

The primary pollutants like particulate, hydrocarbons, carbon monoxide, nitrogen oxides and sulphur oxides account for more than 90 per cent of air pollution problems in the developed counties. 8.2.5 Primary Air Pollutants Carbon monoxide

This gas produced by the incomplete combustion of coal, charcoal, petrol, and its produced carbon monoxide are internal combustion engines. In cities like Calcutta and New York the peak concentration may even be 100Mg/kg in busy stress-in very narrow streets—in very narrow streets or tunnels with a high density of vehicles, the concentration may go up about 300mg/kg of air. From combustion sources, the carbon monoxide emission per year in the world is about 2.6 ¥ 108 tonnes (spedding,1974). This figure must have been doubled by now. Furnaces, stoves, open fires, factorise, power plants, and so on give off carbon monoxide. But recent evidence suggests that the oceanic and atmospheric reactions are the major sources of cabon monoxide. Spedding(1974) points out that samples of mid-ocean surface waters were found to contain up to 90 times the concentration of carbon monoxide calculated from the standard carbon monoxide solubility data for the partial pressure of CO in the atmosphere immediately above the surface of the ocean. Thus there is a flux of CO from the ocean surface of the atmosphere. In surface waters, the supersaturation of CO is increased in sunlight. Two possible mechanisms might be operating. One could be the Photochemical oxidation of oxidation of organic matter and the matter and other the biological oxidation oxidation of organic matter and the other the biological oxidation by living marine organisms.

Pollution Ecology

361

The source of atmospheric CO is the oxidation of methane. Anaerobic decomposition of organic matter produces CH4,which is oxidized to produce CO. photochemical decomposition of ozone and the reaction of atomic oxygen with water vapour produces hydroxyl radicals, which initiate methane oxidation, thus CO production in the atmosphere is associated with photochemical reactions. O3 + hv Æ O2 + O O + H2O Æ 2OH Various studies indicate that the residence time of CO in the atmosphere is very short. The destruction of CO in the lower stratosphere probably occurs by the following reaction. OH + CO Æ CO2 + H But in the upper stratosphere, CO maintains a more or less constant concentration, indicating that the production and destruction rates are relatively equal. In the trophoshere (Fig.1.8), although oxidation of CO to CO2 is possible due to the presence of CO is photochemical smog a higher concentration of CO is found here as a result of automobile exhaust. CO is also destroyed at the surface of the earth. Soil fungi and higher plants absorb CO. Depending upon the availability of solar energy, the mechanism of CO absorption and destruction by plants varies. In the presence of sunlight CO is reduced to 5-formyl-trtrahydrofolic acid. The reduced CO is fixed as serine (amino acid) and enters the protein and carbohydrate metabolism. In the dark, CO is oxidized to CO2 in leaves and released to the atmosphere. Thus plant leaves destroy VO regardless of the presence or absence of light. Green plants, soil and oceans are the natural sink of carbon monoxide. Toxic effect of CO

CO combines with haemoglobin and reduces its oxygen-carrying capacity, thus affecting respiratory activity and metabolism. It causes blurred vision, headache, and, in acute toxicity, may cause unconsciousness and even death. The structure of the haem molecule (four haeme molecules with one molecule of globin make haemoglobin) is shown in Fig. 8.1. It is now known that the Fe haem is in a d6 octahedral configuration having four unpaired electrons. The four nitrogen atoms of the organic chelate occupy four of the octahedral coordination positions, more or less in the same plane. One of the positions perpendicular to the plane is occupied by coordination of the positions perpendicular to the plane is occupied by coordination to the globin (protein) molecule and the other position is available for the coordination of oxygen gas. In the oxyhaemoglobin molecule, the oxygen is coordination. CO has 200 times greater affinity than oxygen for occupying the coordination position. Therefore, CO even in low partial pressures is able to displace a good amount of oxygen from HbO2(oxyhaemoglobin)to form the co-haemoglobin complex called carboxhaemoglobin (HbCO).Thus the transport of oxygen from the lungs to other parts of the body is greatly impaired. HbO2 + CO

HbCO + O2

COHb + O2

O2Hb + CO

Since the preceding reaction is reversible, the use of pure oxygen in the treatment of CO poisoning is essential. An

Fig. 8.1

The haem molecule

Fundamentals of Ecology

362 Table 8.8

CO level ppm

Effects of continuous exposure to various levels of carbon monoxide %conversion of O2Hb to COHb

Effects on humans

10

2

Impairment of judgement and visual perception

100

15

Headache, dizziness, weariness

250

32

Loss of consciousness

750

60

Death after several hours

exposure to 120 mg/kg CO for 1 hour will increase the carboxyhaemoglobin content in the blood to 5%, a level usually found in the blood of cigarette smokers (Table 8.8). Green plants, soil, and oceans are the natural sink for carbon monoxide. 8.2.4 Carbon Dioxide

This is a very useful gas for plants because of its role in photosynthesis, in producing glucose.CO2 constitutes only about 0.03% of the gases in air and absorbs solar radiation. But now there is evidence that the concentration of this gas has been increasing slowly in the atmosphere since the year 1900.Data collected from many places indicate that there is a constant increase of approximately 1.0 mg/kg/year in the atmospheric CO2concentration. This increase is largely due to the burning of coal and petrol and its products. Around 1900, the concentration CO2 in air was 290 ppm. In1960,it was about 315 ppm and it is increasing at the rate already mentioned. At present the concentration of carbon dioxide in the atmosphere on the average varies from about 320–330ppm.the reason given for this situation are: 1. Forests with a huge living plant biomass, remove a lot of CO2 in photosynthesis. since the forest cover has been depleted significantly the carbon dioxide content has increased. 2. Since now there are more living organisms, their metabolic output is enormous. The burning of fossil fuels produces a lot of CO2 and this additional CO2 is neither utilized in photosynthesis, due to lack of adequate vegetation, nor absorbed in the oceans. the release of CO2 into the large oceanic reservoir is relatively slow. 3. Although oceans are the main reservoirs of CO2 they are essentially a carbonate and biocarbonate buffer system and thus a large increase in the partial pressure of CO2 in air is necessary to cause a relatively small increase in the CO2 concentration. The carbon cycle only a 0.6% increase in oceanic CO2 concentration. The carbon cycle given earlier in the book shows that the ocean is the main between the atmosphere and ocean surface. The physical and chemical aspects of this exchange have been discussed by spedding (1974).In recent times the balance has been upset due to large-scale burning of fossil fuels and depletion of forest. 1000

66

Rapid death

CO2 was not formerly a pollutant but in recent times it has become one because of its increasing concentration. It is affecting the heat balance of the earth. When solar radiation falls on the atmosphere containing CO2 much of the heat passes enters the atmosphere containing CO2 much of the heat passes down to the earth and some is reflected back to the sky, Heat from the earth the earth enters the atmosphere. Some of which is reflected back to the earth. This process continues and the surface of land and water heated up. Since the amount of CO2 has increased, the net gain of heat has become higher than it used to be. In this process, the earth is being warmed up. This is called the greenhouse effect. A greenhouse with glass side walls and glass roof is used for carrying out experiments on plants. It is often used in cold weather to grow plants of warmer climates. The air inside the greenhouse remains

Pollution Ecology

363

warmer than outside, because it recieves solar radiation through the glass top and side walls but glass prevents the heat inside the glass house from being lost to the atmosphere. Thus the greenhouse becomes much warmer than outside. We all have experienced the same situation inside a closed automobile, particularly a car parked in the sun. Green-house gases warming.

The following are the main green-house gases responsible for global

Carbon dioxide It has been estimated that some 18 billion tonnes of carbon dioxide are being interoduced into the troposphere annually. This gas absorbs heat and keeps the atmosphere warm. It has been estimated that CO2 is 55% responsible for global warming. (2) Water Vapour since about 70% of earth’s surface is covered with ocean, huge amount of water vapour evaporates into the atmosphere. It has been estimated that about 14000 cubic km. of water are available as water vapour in the atmosphere at any point of time. Water vapour retains heat and contributes significantly to global warming. (3) Methane Methane is produced when organic matter decays under anaerobic conditions. The concetration of this gas is rising in the atmosphere. Huge quantity of methane is produced in agricultural fields. In 1950,its concentration was 1.1 ppm in air and the concentration has increased to about 2 ppm in 1990s.About 15% of global warming is attributed to methane. (4) Chloro-fluoro carbons (CFCs) These are man-made colourless, odourless, easily liquefiable gases responsible for global warming. these are stable compounds and resident time in the atmosphere is around 100 years. CFCs are also responsible for ozone depletion in stratosphere. (5) Nitrous oxide This gas decomposes slowly and accumulate in the atmosphere. In 1950,its concetration was 280 ppb in the atmosphere and in about 50 years, its concentration has increased to about 400 ppd. This gas accounts for about 5 to 6% of the total global warming. In troposphere the green-house gases provide an effective thermal insulation but in stratosphere some of the green-house gases like CFCs, nitrous oxide are responsible for depletion of ozone. Chlorine atoms are derived from the disintegration of CFCs in stratosphere. Nitric oxide is produced in the stratosphere by nitrous oxide. Water molecules dissociate in stratosphere by UV radiation and produce hydroxyl ions. These substances aid to depletion of ozone. (1)

It has been estimated that with the current rate of increase in CO2concentration in the atmosphere, it will cause an average temperature increase of 3 to 8ºC. This increase in temperature will affect plant and animal life and their distribution It will severely affect plant and animal life and their distribution. It will severely affect agriculture and cause a food problem. The snow caps in the polar regions will melt and increase the sea level. This may submerge many coastal areas and cities like New York and much of Calcutta, London, Glasgow, Tokyo, Osaka, Stockholm and Florida could be under water. Another view is that the earth’s temperature will be lowered and that the earth will become a cooler place. This view is based on the fact that suspended particles in the atmosphere are increasing because of smoke and soot from industries, transport and forest fires. The clouse of these suspended particles will prevent enough sun rays from reaching the earth, cooling it down Naturally if the temperature is lowered, it will affect agriculture, and animal and plant life. It is believed that there are about 50,000 nuclear bombs in the hands of the super powers and if these were to be used in an unfortunate war, the amount of smoke and soot generated would cover the atmosphere for a considerable period (may be a few hundred years) and prevent solar radiation from reaching the earth’s surface. The earth would

Fundamentals of Ecology

364

remain in a cold winder condition, called nuclear winter. Of course all interlligent life on this planet would be wiped out in such a situation. 8.2.7 Global Warming

Climate change is popularly understood to mean the effect of global warming. Scientific data indicate that the planet is now in a warm period. Previous warm period occurred some 1,30,000 years ago and ended 1,17,000 years ago with return of cold temperature leading to occurrence of ice age. Earlier scientists believed that due to changes in the earth’s orbit around the sun in a slow 1 lakh year cycle, these climatic changes happen. It is believed that the current warm up of the globe started some 15,000 years ago while most of the ice still present in poles, Greenland and Himalaya like high rise mountains. But now it is estimated that about half of the ice sheets and glaciers covering Canada and Europe are also melting. Himalayas have about 9,000 glaciers. The river basins, number of glaciers on each river basin, area loss during the last 30 years are given below (Table 8.9). Table 8.9

River basins and glaciers in India

RIVER BASIN

SL. NO.

NO. OF GLACIERS

AREA LOSS %

CHENAB

359

21

PARBATI

88

22

BASPA

19

19

TOTAL

466

21% (AVERAGE)

GLACIER

BASIN

GLACIER AREA SQKM

RETREAT TOTAL

IN METRES RATE / YR.

1.

MIYAR

CHENAB

87.8

757

16.43

2.

SHAUNE BANGE

SATLUJ

8.8

923

26.4

3.

BILARE BANGE

SATLUJ

2.8

90

2.6

4.

PARBATI

BEAS

48.44

6569

214

5.

SAMUDRA TAPU

6.

CHIPA

CHENAB

77.67

802

21

DHAULIGANGA

5.0

1050

26.92

7.

MEOLA

- DO -

14.0

1350

34.62

8.

JHULANG

- DO -

3.3

400

10.53

9.

GANGOTRI

GANGA

143

535

28.1

10.

DOKARIANA BAMAK

- DO -

5.8

585

16.7

11.

MERU BAMAK

- DO -

4.7

395

17.2

Source: India Today, 2005. Data on 30-year observation, SOURCE: ISRO, Glaciers are found in ARCTICS, ANDES, ALPS, HIMALAYAS

Climate Change Record in Subsurface Temperature Analysis of underground temperature measurements from 358 boreholes in eastern North America, Central Europe, Southern Africa and Australia indicate that, in the twentieth century, the average surface temperature of Earth has increased by

Pollution Ecology

365

about 0.50C and that the twentieth century has been the warmest of the past five centuries. The subsurface temperature also indicate that Earth’s mean surface temperature has increased by about 1.00C over the past five centuries. The geothermal data offer an independent conformation of the unusual character of twentieth century climate that has emerged from recent multiproxy studies. (Pollack et al. 1998). Borehole temperature measurement were made at 10 m depth intervals upto 200–600 m with an electrical resistance thermometer that can resolve temperature changes of 0.010C. In general, all subsurface perturbations arising from surface temperature changes that occurred in the past five centuries are confined to the upper 500 m of Earth’s crust. Air and ground temperature are usually not the same but they generally have similar trends. Site to site variability depends upon local vegetation, subsurface heterogeneity, topographic and hydrologic effects etc. Anthropogenic and other causes of global warming We have discussed about the green house gases (CO2, CH4, CFCs NOx, water vapour). These gases retain heat. The carbon dioxide load in the world’s astrosphere is about 18 billion tones per year as given in Fig. 8.2.

Out of this 18 billion tones of CO2 release, India contributes atleast 305 million tones per year, and considered as sixth largest contribution in the world. This emission amount is Fig. 8.2 CO2 load in the world expected to be more than 700 million tones by 2015 as the country is getting industrialised and 66% of India’s energy source is fossil fuels. Besides, huge amount of methane and other gases are released into the atmosphere. The transportation facilities are increasing day by day, and the green house gases released by automobiles and other transport sources are huge. These green house gases absorb and retain heat, especially long wave radiation, and cause warming of the atmosphere (Table 8.10). Table 8.10

Climate policy report card, countries/regions studied

Country

2001 Emissions (million tons)

Rank

Global emissions share (percent)

2001 population (millions)

Global population Share (percent)

Per capita emissions (ions/person)

95

14

1.4

19

0.3

5.0

Brazil

82

17

1.2

172

2.8

0.5

Canada

129

9

2.0

31

0.5

4.2

Australia

China

721

3

11.0

1,273

20.7

0.6

European Union

829

2

12.7

377

6.1

2.2

(Contd.)

Fundamentals of Ecology

366 Table 8.10 (Contd.) Germany

218

7

3.3

82

1.3

2.7

United Kingdom

147

8

2.2

60

1.0

2.5

India

304

6

4.6

1,033

16.8

0.3

Japan

311

5

4.8

127

2.1

2.5

Russia

403

4

6.2

144

2.4

2.8

South Africa

91

15

1.4

44

0.7

2.1

United States

1,510

1

23.1

285

4.7

5.3

Total

4,475

—

68.4

3,505

57.1

—

—

—

—

—

—

1.1

Global average

Source : World Population Data Set.

India produces a 4.6% share of global carbon emissions, placing it sixth overall and second among developing nations. Its per capita emissions of 0.3 tons per person are the lowest among large emitters, less than one third of the global average, and nearly one nineteenth those of the United States. India’s historical contribution to carbon emissions since 1900 stands at 2%. India is taking a number of steps to reduce green house gas emission by promoting alternate source of energy, especially renewable energy. (Source : World Bank Report)

Sink Factor

The green house gases, especially CO2, are usually absorbed by plants and phytoplankton, but because of disappearing forest, and water pollution, the CO2 sink potential has been reduced. Since the land has been denuded with forest cover, the sun rays directly hit the soil and land which retain more heat that radiate at night and trapped in troposphere causing warming. The recent forest policy of Government of India envisages to achieve forest cover of 33% of land. This will increase the green house sink potential of the country. Impact of global warming around the world In the winter of 1997, Japan experienced a high erratic snowfall and eight tropical cyclones ripped through the islands of central pacific. In 1998, New York was 4.4°C lower than usual temperature in January. Guadala Jara in Mexico experienced snowfall for the first time since 1881. Indonesia experienced worst drought in 150 years and forest fire destroyed 4 lakh hectares of forest. India, abnormally high rains swept over Tamilnadu and Orissa experienced a supercyclone in 1999. These impacts may be due to phenomenon called El-Nino and global warming. What is El-Nino? It is periodic warming of the pacific ocean waters that bring extremes in weather. Meteorological scientist are of the opinion that high pressure in the eastern pacific sends trade winds blowing to the west. These winds push ocean water before them and the surface water level in and around of Australia and Indonesia rise about a half metre than it does off the coast of Peru. The trade winds slacken after pressure drops and then the sea water pushes back down hill to the east and this eastward flow key to understanding the phenomenon called El-Nino. The backward flow of sea water causes high waves. These waves push down the thermocline layer in ocean. Thermocline is a layer of cooler water that normally mingles with the warmer water at sea surface.

As the thermocline sinks down to greater depths, the mixing of cool and warm water stops, and thus, the sea surface water temperature rises and this onsets the phenomenon called El-Nino, warming of

Pollution Ecology

367

the pacific ocean. This phenomenon occurs in a cycle of 4–7 years. These waves can be thousands of kilometres long and travel some 30 m below the sea surface. Satellites pick up the subtle undulations in sea level as ripples pass through. The waves first hit the south American Coast and some reflect back. These reflected waves reach Asia and rebound again. These double bouncing waves lift up cool water and cool the surface water bringing a sea temperature drop in eastern pacific and this decrease is called La Nina. This phenomenon was discovered by Peruvian fishermen about a century ago. In 1982–83 El-Nino caused world-wide destruction, and the Food and Agriculture Organisation (FAO) has observed these weather charging patterns in Asia. El-Nino may affect Monsoon season in South East Asia, especially India. Some of these aspects are discussed in Chapter – 4 (Environment–in–Action). However, data available from other many sources indicate that the number of rainy days are decreasing in some regions but the intensity is increasing. The monsoon is shifting westwards and north-westwards. Month wise distribution of rain fall indicates that the rainfall is decreasing in the month of July where as it shows increasing trend in august and June shows wide fluctuations from year to year (Down to Earth, December, 2006). The position of glaciers and Ice-sheets In 40–50 years in perennial mountains streams and rivers, water flow will be drastically reduced if the glaciers continue to sink. It is estimated that the following effects may also be found: 1. Worldwide flooding 2. Desertification of Africa and some other parts 3. Food Crisis 4. Monsoon season will be affected 5. Drastic climate change 6. Hydro energy crisis 7. Island nations will submerge and some other nations like Bangladesh, Coastal areas, Maldives, etc., will be seriously affected. Diseases like dengue, chiknngunya, etc., will occur.

India is witnessing soaring temperature, especially during summer months, and shorter winters. Nicholas Stern, Chief Economist of World Bank, studied climate change from an angle of economic perspective. Stern review was released on October 30, 2006, just before the twelveth conference of parties to the UN convention on climate change. The scientific evidence is now overwhelming that climate change presents serious global rises and demands urgent global response. Situation in Indian Subcontinent “Down to Earth” – December, 2006 issue of the magazine reports that “Rain is a stranger in a cold desert spread across spiti in Himanchal Pradesh and Ladakh in Jammu and Kashmir”. The Tibetan plateau, however, falls in rain shadow area beyond the Himalaya range. The Tibetan plateau does not receive the monsoon. The annual precipitation is about 100 mm, mostly snow. However, in 2006 monsoon season, this region witnessed heavy rains and floods in August. However, Kashmir valley witnessed severe summer in the past 30 years during this period. At the same time, part of Bihar was under flood and another part suffered from drought. Assam witnessed drought and Barmer district of the Thar desert in Rajsthan was flooded.

368

Fundamentals of Ecology

Monsoon often exhibits fickle behaviour. In the 1990s, India used to receive twelve monsoon depression but it dropped to four in 2000. However in 2006, the monsoon depressions were many in Orissa, which also witnessed a super cyclone in 1999. All these climate flip-flop may be the consequences of global warming. The Indian National Climate Centre in Pune is of the opinion that one of the most significant consequences of global warming would be increase in frequency of extreme precipitation, which would largely be due to increased evaporation for warmer temperatures. However, the meteorological department maintains that there is no evidence of the effect of global warming in India. The variations in rainfall and other climatologically parameters are within the range of inter annual and inter seasonal changes. However, the climate changes are happening more frequently in some states like Orissa and hence, many are inclined to believe that this is effect of global warming. 8.2.8 Urban Heat Island (UHI)

The Environment Protection Agency (EPA, USA) are of opinion that on hot summer country side, the atmospheric temperature may be higher than other months but this is different than Global Warming. An UHI is a metropolitan area phenomenon, which is significantly warmer than its surroundings. Features 1. UHI effect: Studies in temperate countries indicate that monthly rainfall is about 28% greater between (35–65 km) down wind of cities, compared with upwind. Reasons 1. Night time warming (comparatively warmer) due to heat reflections from buildings in urban areas occur blocking the view to the (radioactively cold) night sky. This is largely due to the change in the thermal properties of surface materials and building materials and lack of evapotranspiration in urban areas. 2. Materials used in urban areas such as concrete and asphalt, have different thermal bulk properties such as albedo and emissivity, than the surrounding rural areas with thatched house, mud walls, water bodies, trees, etc. Concrete can hold approximately 2,000 times as much heat as an equivalent amount of air. This initiates a change in energy balance of urban area. This is affected by lack of vegetation, standing water bodies and this situation inhibits cooling by evapotranspiration. Tall buildings block the wind, which inhibits cooling by convection. 3. Tall buildings provide multiple surface for the reflection and absorption of solar radiation increasing the increase in temperature. This is called the “Canyon Effect”. Luke Howard (1820) studied the problem for 9 years in London, and concluded that “Urban Center was warmer at night than the surrounding country side, a condition we now call UHI”. The air temperature in the night is 3.7°C warmer and 0.34° cooler in the city than in the countryside in England. He attributed it to the excessive use of fossil fuel in city. But land surface temperature behaviour is different. The surface temperature in cities is also warmer than surface temperature in countryside. At night, the surface of solar heating cause atmosphere convective winds, the surface cools down and air temperature rises and disperses on the basis of wind pattern. An inversion layer is formed in cities.

Latitude plays some roles. In winter, especially in high latitudes with solar radiation is considerably smaller, affects UHI considerably. In urban area, heat generated by anthropogenic activity (refrigeration,

Pollution Ecology

369

long asphalt roads, Industrial activities, Vehicular emissions etc.) also contributes to UH Island. Urban pollutants with minimum dispersal create local green house effect. Heat Islands form as vegetation is replaced by Asphalt and Concrete for roads, buildings, and other structures necessary to accommodate growing populations. These surfaces absorb – rather than reflecting the Sun’s heat, causing surface temperature and overall temperature to rise”. (EPA, USA). Significance of UHIs As per UNO, almost 50% of the total population in the world and 75% in western countries live in urban areas. UHI have the potential to influence the health and welfare of urban people. Heat waves increase energy expenses due to use of air conditioning and refrigeration in cities. In USA 1000 people die each year due to extreme heat. In India many thousands die during summer time. UHI increase heat waves and cause health problems. The night time effect of UHI can be harmful during a heat wave, as the cool relief is not found in the night. Secondary effect of UHI can be altering local wind patterns, development of clouds, and fog, number of lightning strikes and rate of precipitation. It affects plant growth and growing season of plants in cities and upto a radius of 10 km. UHI Mitigation Using white or reflective materials on roof of houses pavements and roads, surface heat effect is reduced. This changes overall albedo of the city. Regulating vehicular emissions, controlled use of Air conditioning and Refrigeration system should be encouraged. By increasing the well-watered vegetation and by keeping vegetative cover on roofs of houses, effect of UHI can be minimized. The other remedial measures will be adopted to clean energy so that global warming and UHI are minimized Since the Common Building Materials is cement, method should be adopted to increase lower emissions at manufacture stage to produce cement, which will absorb less heat. Alternate building materials can also be used. “Gasified biomass – fueled engine” can be designed to provide power to rural populations of millions. Carbon dioxide can be captured by injecting into under ground geologic formations. We should produce clean coal and better fossil fuel and Bio-fuel (Jatropha sp., Pongamia pinnata). We should switch over to solar energy, wind energy, tide energy, gasified biomass energy, nuclear energy. Air pollution, energy security, climate change and Economic development, all are interrelated. Alternative view The Inter Govt. panel on climate change are of opinion (based on satellite and other data) that the UHI effect on global climate change is not significant (only 0.05°C in a century). (Peterson, 2003). Another study published in Nature in Nov. 2004 (David Parker) theorized that “If urban heat island theory is correct, then instruments should record a bigger temperature rise for calm nights than for windy ones, because wind blows excess heat away from cities and away from measuring instruments. There was no significant difference in air temperature between the calm and windy nights in many urban centers in Europe. In view of this UHI affects only microclimate and may not affect global temperature. 8.2.9 Sulphur Dioxide and Hydrogen Sulphide as a Primary Pollutants Sulphur remains in the atmosphere in three forms, namely SO2, H2S and sulphate particles (aerosol sulphate). About 2.5 ¥ 109kg of sulphur from volcanic emissions and 83 ¥ 109 kg of sulphur from Anthropogenic sources are introduced into the atmosphere annually. The residence time of sulphur dioxide in the atmosphere is usually 40–42 days. Sulphur dioxide is produced mainly by the combustion of fossil fuels like coal, mobil oil (which contains 3%sulphur) and petrol. The smelting of sulphide ores is another important source. In

Fundamentals of Ecology

370

polluted areas its concentration usually remains in the range of 0.3–1.0 mg/m3. Table 8.11A given data on SO2 evolution from industrial activities and burning fuels. Hydrogen sulphide

The anthropogenic sources of H2S such as the Kraft Pulp and paper mills, rayon production, coal gasification and oil refining accounts for approximately 3 ¥ 106 tons yr–1and nearly 98 ¥ 106 tons yr–1 are produced naturally be anaerobic decay of organic material by bacterial reduction of SO. Table 8.11 A

Industrial Activities & SO2 emission

Source

SO2 emission (in kg)

Combustion coal

4.536 per 1000 kg coal (Variable)

Combustion Fuel oil

9.9per10.000 L Oil (variable)

Municipal waste incineration

0.544-0.907 per 1000 kg waste

Sulphuric acid manufacture

9.07–3.75 per 1000 kg 80% acid

Cu smelting (Primary)

635.04 per 1000 kg conc. ore

Pb smelting (Primary)

299.376 per 1000 kg conc .ore

Pb smelting (sec.)

29.03 per 1000 kg metal changed

Zn smelting (Primary)

494.424 per 1000 kg conc.

Ore Kraft mill recovery furnace

1.088-1.078 per 1000 kg air dry pulp

Sulphite mill recovery furnace

18.144 per 1000kg air dry pulp

Source: Kumar and Prakash,1978)

The mean global concentration of H2S is around 0.2 ppb, but at times it may reach 140 gm–3 in cities. Hydrogen sulphide is very toxic and is a hazard encountered when digging wells. Oxidation of H2S in atmosphere contributes to SO2 production and the bacteria, Thiobacillus thioxidans also oxidizes H2S to form sulphur. Table 8.11 B

S.N.

Industrial Activities & SO2 emission

Fuel

SO2 emission in kg per tonne of fuel

1.

LPG

0.0002 to 0.008

2.

Natural Gas

0.2

3.

Petrol

5.4

4.

Diesel

5 to 6

5.

Oil

6 to 7.6

6.

Coal

6 to 15.0

7.

Firewood

20

The source of H2S is the decomposition of organic waste. In polluted areas its concentration reaches 100 mg/m3, while in unpolluted areas its concentration remains around 0.3 mg/ m3. It is generally believed that H2S is oxidised to SO2 but there is not much evidence for this. At atmospheric pressure and temperature, the oxidation of H2S occurs very slowly. The reaction with ozone is measurable, although very slow: H2S + O3 Æ SO2 + H2O However, a chain oxidation reaction may occur with atomic oxygen, which may be derived from the photochemical dissociation of ozone or a photo-chemical smog reaction. However, not much is known on this. It is assumed that SO2 is oxidised to SO4 and returned to earth through rain. Thus the lifetime of SO2 in the atmosphere

Pollution Ecology

371

depends upon the rate at which it is oxidised. A number of oxidation mechanisms are now known and the rates vary, depending upon the conditions in the atmosphere. For example, the photochemical mechanism produces a high oxidation rate at mid-day, but oxidation in fog droplets catalysed by metal ions is not dependent on sunlight. Spedding (1974) describes aqueous phase oxidation, photooxidation, and oxidation on aerosols in detail. A solution of SO2 in water contains SO2, H2SO2 (H2OSO2), HSO, SO and S2O in proportions that depend on the pH and concentration. Rain water usually has a pH of 4–6 and the predominant ion is HSO. From data collected around the world, it has been estimated that the mean residence time of SO2 in the atmosphere ranges from twelve hours to six days. The longer residence time is correlated to aqueous phase oxidation or photochemical oxidation or both and the shorter residence time is correlated to absorption of SO2 into natural waters, and deposition on to vegetation and soil. SO2 is highly soluble in water. At 15°C, 45 vols of SO2 dissolve in 1 vol of H2O. Thus all SO2 reaching the surface of sea water and other natural water dissolves. Most plants are damaged by a high concentration of SO2 (1 mg/kg of air) if exposed for several hours. SO2 gets into plants through stomatal openings, which are controlled by plants for CO2 intake and water exchange. Therefore maximum uptake of SO2 occurs in 100% relative humidity and corresponds to maximal stomatal opening. Toxicity of sulphur dioxide Sulphur dioxide has a sharp odour. It slows down the ciliary movement in the respiratory tract of animals and man and strongly irritates the respiratory tissue. If SO2 reaches the lungs, it causes acute respiratory problems. Continuous inhalation of this gas can cause severe headache. Effects on plants

Plants are affected at lower concentrations of SO2 than human beings. SO2 enters plants mainly through stomatal apertures. Cuticle and wax on epidermis and suberin on stem are impervious. More than 95% of the gaseous pollutants enter a plant through stomata. Alfalfa, barley, cotton and wheat are very sensitive to SO2, while potato, onion, and corn are very resistant. The sensitive species are adversely affected if exposed to more than 100 mg SO2/m3 of air for an indefinite period. Continuous exposure to SO2 for considerable time at 300 mg/m3 causes severe leaf damage in some sensitive species. Short-time exposure at a concentration of 700 mg/m3 also causes leaf damage. Leaf blotching, necroses and loss of yield are the main damages caused by SO2. A widely accepted view is that SO2 after entering to leaf gets oxidised to SO3, which in turn combines with water to form sulphuric acid. The acid – interferes in metabolic process leading to reduction in productivity. The COO– COO – biochemical aspects of sulphur dioxide damage are as follows: HSO 3

The glycolic pathway is associated with photorespiration in plants. It is now known that glycolic oxidase inhibition occurs in barley plants treated with SO2. Besides, an aldehyde-hydrogen suiphite product has been isolated from paddy plants treated with SO2. Glyoxalate hydrogen suiphite is a competitive inhibitor of the glycolic oxidase enzyme, which catalyses the oxidation of glycolate.

COO

HC = O glyoxalate

HC.SO3

HC = O glyoxalate hydrogen sulphite

–

COO

–

glycolic oxidase CH2OH + O2 Effects of other materials SO2 causes yellowing glycolate

and reduces the mechanical strength of paper, thus severely

+ H 2O CHO glyoxalate

372

Fundamentals of Ecology

affecting the storage of books, etc. in industrial areas or cities where SO2 pollution is acute. In humid conditions SO2 is oxidised to H2SO4, particularly in places where metallic impurities are found on paper. Then, acid hydrolysis of the cellulose in the paper causes degradation. Limestone and marble can be severely affected by SO2. Sulphur dioxide is absorbed by limestone and the absorption increases as relative humidity increases. The absorbed SO2 is oxidised to sulphate and becomes a part of the CaCO3 matrix. Thus mechanical stress arises because the molecular volume of CaSO4 is greater than that of CaCO3. Besides, CaSO4 is leached out in rain water, since its solubility in rain water is higher than that of CaCO3. Marble is less damaged by SO2 because of its low porosity. Leather is also damaged by SO2 because of the formation of H2SO4 on the leather surface, which causes acid hydrolysis of leather protein. Iron and steel get corroded very fast in SO2-laden air, as do other metals tike zinc and aluminium. The mechanism of corrosion in iron and steel is different from that in zinc and aluminium. The corrosion process in the latter involves the formation of H2SO4 from SO2 the acid breaks down the oxide coating of the metal and then corrosion proceeds. The process in iron and steel is very complex and involves Table 8.12 Average concentration of some electrochemical mechanisms. hydrocarbons in city areas (based on Spedding, 1974)

8.2.10 Hydrocarbons

Automobile exhaust contains a variety of hydrocarbons. The decomposition of organic wastes and garbage also produces hydrocarbons like methane. Of the thirteen hydrocarbons given in Table 8.12, methane, ethane and propane are derived largely from sources other than automobile exhausts. Toluene and m-xylene are derived from motor vehicle exhaust and industry. In the atmosphere these hydrocarbons are washed down by rain and ultimately mix with water on the earth’s surface or in the soil and become a nuisance after reacting with other chemicals to produce secondary pollutants. Aromatic hydrocarbons like benzene are used by various industries as solvent and in fuel oils as antiknocking substance. Aromatic hydrocarbons are more toxic than aliphatic hydrocarbons. Aromatic hydrocarbons if taken into human body reduced WBC counts in the blood and may cause leukemia and are carcinogenic. Polynuclear Aromatic Compounds (PAC) are derived from pyrolysis of organic matter and are carcinogenic. These organic chemicals contain two or more benzene rings fused together. The examples are benzopyrene, benzoanthracine, dibenzi. Polynuclear Aromatic Hydrocarbons (PAH) can also contaminate drinking water or ground water

Hydrocarbon

Mean concentration mg/kg

Predominant source other than motor vehicle exhaust (mainly decomposition) Methane

2.00

Ethane

0.05

Propane

0.02

Industrial and exhaust origin Toluene

0.02

m—Xylene

0.02

Largely automobile exhaust origin Ethylene

0.03

Acetylene

0.03

n-Butane

0.03

Isopentane

0.02

n-Pentane

0.02

Isobutane

0.02

Propylene

0.01

Butanes

0.01

Pollution Ecology

373

and the source may be from industrial effluents, leaking fuel tanks, leaching from toxic waste dump sites and coal-tar lining in some older water supply pipes. Some of these PAHs have been selected by the US Environmental Protection Agency as priority pollutants for regulatory purposes. Analytical procedures involving use of HPLC coupled with UV and fluorescence detection are used to detct and quantif’ PAH in involving substanr.es. Recently Perkin—Elmer method has been developed which appears to be more simpler and quicker for PAH detection. CFCs are an important group of hydrocarbons. There are colourless, odourless, inert chemicals widely used in refrigeration, air conditioners, foam blowing, foam saving cream, spray cans and as cleaning solvents. CFCs are persistent in troposphere but in stratosphere that dissociate due to UV radiations and yield chlorine atoms, which destroy ozone molecules. The list of CFCs and Halons, which are classified as ozone depleting substances is given in Table 8.12. Ethylene can cause damage to biological systems at atmospheric concentration and without further reaction with other chemicals. It is a plant growth hormone produced by many plants. At a concentration of 0.005 mg/kg in the atmosphere it causes leaf damage in sensitive plants. In some less sensitive plants, such as tomato, it can cause damage at higher concentrations. 8.2.11 Aldehydes

Automobile exhausts and incomplete combustion of fossil fuels, wood, plywood etc. produce aldehydes. The common aldehydes are formaldehyde, acetaldehyde and acrolein, which are associated with photochemical smog and causes eye and lung irritation. 8.2.12 Nitrogen Oxides

Nitrogen oxides (Table 8.13 (A)) are major primaly pollutants. Of these N2O, NO, and NO2 appear in measurable concentrations in the unpolluted atmosphere. Nitrogen oxides play an important role in the formation of photochemical smog (originally Los Angeles smog). The primary source of these oxides is automobile exhausts. Of these oxides, nitric oxide and nitrogen dioxide cause damage to vegetation in low concentrations, and to the respiratory systems of mammals in high concentrations. Table 8.13 A

A Nitrogen oxides found in the atmosphere

Nitrogen oxide Dinitrogen oxide (nitrous oxide)

Formula

Atmospheric stability

N20

Stable gas Stable gas

Nitrogen oxide (Nitric oxide)

NO

Nitrogen dioxide

NO2

Stable gas

Dinitrogen trixide

N203

Unstable gas NO + NO2) (N2O

Dinitrogen tetroxide

N204

Unstable gas 2NO2) (N2O4

Dinitrogen pentoxide

N205

Unstable gas N2O3 + O2) (N2O5

Nitrogen trioxide

NO3

Unstable gas (not isolated)

Fundamentals of Ecology

374

Dinitrogen oxide (N2O) is otherwise called nitrous oxide. N20 concentration remains more or less constant up to the tropopause and then decreases with increase in altitude, because of the following photodissociation reactions: N2O + hv Æ N2 + O ( l < 337 nm) N2O + hv Æ NO + N (l oil > natural gas (at average combustion temperature). Internal combustion engines operate at very high temperatures and produce NO.

Pollution Ecology

375

Toxicity of NO and NO2 At lower concentrations plants absorb NO and NO2 from air without damage. The uptake rate of NO2 is much greater (about 20 times more) than that of NO. Concentration of NO2 in excess of 2 mg/kg of air causes leaf damage to sensitive plants. In some plants, photosynthetic activity is impaired at a concentration of 0.6 mg/kg. In high concentrations, the oxides of nitrogen cause irritation to the mucus membrane and damage to the respiratory system (Table 8.5 B). Table 8.13 B

Effect of exposure to various levels of NO2 on human health

Level of NO2, ppm

Duration of exposure

50–100

Up to 1 hour

150–200 500 or more

Effects on human health Inflammation of lung tissue for 6–8 weeks Bronchiolitis fibrosa obligerans—fatal result within 3–5 weeks of exposure

2–10 days

Death

8.2.9 Photochemical Smog

Photochemical smog was first discovered in Los Angeles, USA and is, therefore, also called Los Angeles smog. We know that hydrocarbons and nitrogen oxides are air pollutants. But when these two pollutants (mainly automobile exhausts) react with one another in the presence of sunlight, NO2, O3 and a compound called PAN (peroxylacetyl nitrate) are formed—this appears as a yellowish brown haze and is called photochemical smog. The key reactant is NO2. The important hydrocarbons for the production of photochemical smog are the olefins. The major changes that occur in the atmosphere are that hydrocarbons and NO are discharged into the atmosphere from automobile exhausts in large amounts in the peak activity hours of the day. With increasing intensity of solar radiation, the concentration of NO goes on decreasing, the concentration of NO2 increases and so does the amount of aldehyde. Then a decrease in NO2 concentration later in the day accompanies the occurrence of significant ozone (O3) concentration, which from mid-day to afternoon goes on decreasing along with aldehydes and hydrocarbons. During the evening hours no increase in NO or hydrocarbon concentration has been observed. Mechanism of formation When large quantities of automobile exhausts are trapped in the lower part of the atmosphere by a stagnant air mass (inversion layer) and if this trapped air mass is exposed to intense sunlight then photo- chemical oxidant are formed and this is called photochemical smog (Table 8.8A). The word smog originally meant combination of smoke and fog, which is usually prevalent in London. This London smog is called reducing smog as it is chemically reducing with high levels of SO2. But the photochemical smog containing high concentrations of oxidant is an oxidising smog and is called photochemical smog. The mechanism of formation of this smog is characterised by following steps. (Fig. 8.3).

1. 2. 3. 4.

Reactive hydrocarbons from automobile exhausts (those with C=C groups) interact with ozone to form a hydrocarbon free radical RCH2. RCH2 rapidly reacts with O2 and forms another free radical RCH2O. RCHO reacts with NO to produce NO2 and free radical RCH2O. This new free radical interacts with O2 and produces a stable aldehyde (RCHO) and hydroperoxyl radical, HO, which then reacts with another molecule of NO to give NO2 and HO.

Fundamentals of Ecology

376

Fig. 8.3

5.

6.

Mechanism offormation ofphosochemical smog.

HO is extremely reactive and reacts with a stable hydrocarbon with RCH3 and produces H2O and regenerate the hydrocarbon free radical RCH2. Thus the cycle is completed. This goes on as a chain reaction. One complete cycle yields two molecules of NO2, one molecule of RCHO and regenerate RCH2 and thus the cycle begin again. In the process a rapid build up smog product occurs. The aldehyde RCHO may interact with HO radical and produce an acyl radical (RC=0), peroxyacyl radical (RCOO) by reacting with oxygen and finally Peroxyacyl Nitrate (PAN) by reacting with NO2.

Synergism The occurrence of photochemical smog is a case of synergism, involving two pollutants reacting with one another under certain conditions and producing a third pollutant which is even more dangerous to living organisms and the environment than the original pollutants. In this case the two primary pollutants are hydrocarbons and nitrogen oxide (nitric oxide) and the pollutant produced by their reaction is PAN. Toxicity of PAN The maximum concentration of PAN in a photochemical smog has been found to be about 0.04 mg/kg of air. The human eye is irritated after about 12 hours of exposure and cardiopulmonary activities are impaired. Sensitive plants exhibit damage at 0.01 mg/kg concentration of PAN. PAN also causes damage to leaves and stomatal tissue. Plants exhibit leaf moulting and reduced growth. PAN also causes headaches in human beings.

The aldehyde of the photochemical smog causes eye irritation, sore throat, respiratory irritation, and so on. Ozone also damages textiles, discolours paintings and damages rubber articles. 8.2.14

Acid Rain

Like the formation of PAN, another side effect of air pollution by sulphur dioxide and nitrogen oxides is acid rain. Sulphur dioxide and nitrogen oxides react with water in the atmosphere producing sulphuric

Pollution Ecology

377

and nitric acids, which come down to the earth along with rain. The strengths of acids and alkalies are measured on a pH scale of 0 to 14. Pure water is neither acidic nor alkaline and has a pH value of 7. Substances having a pH value of less than 7 are acidic while those having a pH value of more than 7 are alkaline. The lesser the pH value (less than 7), the more acidic is the solution. The pH of acid rain may vary from 3 to 6. Natural rain is slightly acidic (pH around 6) because rain water reacts with CO2 in the atmosphere and produces weak carbonic acid. However, acid rain contains H2SO4 and HNO3 along with weak carbonic acid. Lemon juice has a pH of about 2.5 and vinegar one of slightly higher than 3. Causes of acid rain

1. 2. 3.

Natural processes like volcanic eruptions, decomposition and forest fires produce sulphur and nitrogen compounds which move in the air and produce acid rain. Electric generation plants, smelting plants and industrial boilers release nitrogen oxides and sulphur dioxide into the atmosphere which form acids in air. Petroleum refineries and petroleum and coal combustion give rise to sulphur and nitrogen oxides. Coal contains a lot of sulphur and its burning is a major cause of SO2 production. An oil refinery has been set up near Mathura city, 40 km from the world famous monument, the Taj Mahal. This refinery will process about 6.2 million tonnes of crude oil per year and will emit some 30 tonnes of SO2, 150 tonnes of carbon monoxide, 100 tonnes of nitrogen oxides and some 80 tonnes of hydrocarbons. Therefore many believe that besides the photochemical smog, there is now a severe acid rain threat to the Taj Mahal.

Mechanism of acid rain formation Robert Angus Smith, the first Alkali Inspector of England observed unusual acidity in winter rains of Manchester in 1852 and he thought that there was a link between sooty sky which transformed into a fog and the acidic nature of the rain water. He, in 1872 coined the word acid rain and thus the concept of acid rain was known to the scientific world. Later in 1960s a Swedish soil scientist, Svente Oden observed severe acidification of Sweden’s water bodies and death of fishes and other aquatic organisms and he traced the cause to the emissions from UK and Eastern Europe to Scandinavian countries.

Acid rain is a variable mixture of a variety of chemical species. The oxides of sulphur, nitrogen and carbon interact with other components of the atmosphere, which ultimately give rise to sulphuric acid and nitric acids. Hydrogen chloride from sea spray, ammonia from livestock sources and agro ecosystems, volatile organic compounds like alkanes, esters, hydrocarbons and polychiorinated aldehyde form part of the acid rain. The acid rain generation involved five stages of reactions. 1. Emissions of acid gases (SO2 and NOR) from natural and anthropogenic sources. 2. Some oxides and aerosols fall back directly to the ground around the emission point. 3. Ozone formation and formation of photo-oxidant by sunlight. 4. Interaction of ozone with SO2, NO and in the process H2SO4 and HNO3 are formed by oxidation. 5. Dissolution of HSO4, HNO3 and oxides of sulphur and nitrogen and other gases in cloud containing rain and settling down of acid rain containing the ionic species as fog, rain and snow (wet deposition). SO2, NO gases and aerosols accumulate high up in the atmosphere. Water vapours condense on aerosol surface and form a suitable loci and as a catalyst for the oxides of sulphur and nitrogen to

Fundamentals of Ecology

378

dissolve in water and to form corresponding acids. Hydrochloric acid derived from the oxidation of organochlorine compounds and the polyvinyl chloride in plastics may also be present in these droplets. The possible mechanisms are given below. SO2 + H2O Æ H2SO3 + O Æ H2SO4 NO + O2 Æ NO2 + H2O Æ HNO3 + H2O NH3 + H2O Æ NH4OH NH4OH + H2SO4 Æ (NH4)2SO4 + H2O NH4OH + HNO3 Æ NH4NO3 + H2O The catalytic oxidation can also take place on soot dust or in presence of metal oxides and the reaction can be described as follows. + H2O

SO2 + O3 Æ SO3 + O3

H2SO2 Æ (H2SO4)n

Soot dust

SO2 + ½ O3

or metal oxide

Æ

SO3

+ H 2O

Æ H2SO4 Æ (H2SO4)n aerosol droplet

The detailed photochemical reaction for formation of nitric acid can also be described as given below. NO + O3 Æ NO2 + O2 NO2 + O3 Æ NO3 + O2 NO2 + NO3 Æ N2O5 N2O5 + H2O Æ 2HNO3 In summary, HNO3 and H2SO4 combine with HCI to generate acidic precipitation which is called acid rain (Fig. 8.4). Effect of acid rain 1. 2. 3. 4. 5. 6.

Acid rain makes the leaves of plants yellow and brown and accelerates senescence. Thus it affects the productivity of forests, grasslands, and crops. It affects the properties of the soil, changes the distribution of organisms in it and causes damage to soil fertility. It kills aquatic life forms such as plankton and fish and affects the productivity of aquatic ecosystems. It may cause respiratory and skin diseases. It damages limestone and marble monuments. Acidity in soil and water leads to an increase inh dissolved metals, particularly aluminium. Aluminium affects the gills of fish, which die of respiratory failure. Dissolved metals get into the food chain and poison birds feeding on aquatic organisms.

Pollution Ecology

Fig. 8.4

379

Schematic azagram showing the formation of ada rain.

8.2.15 Particulates and Aerosols

The sources of the particles are as follows: 1. The natural sources include volcanic eruptions, dust and soil blowing by wind, spraying of salt and other particles by oceans and seas. 2. The anthropogenic sources include stone crushing, mineral crushing, mining operations, coalbased power plants generating fly-ash and smoke from incomplete combustion processes. Fuel combustion from coal, oil, natural gas, wood, industrial processes, forest fires also play important role in the emissions of particular matter. The total particulate matter emission is around 200–450 metric tonnes per year in India. The total emission of particulate matter into atmosphere may be more than 2000 metric tonnes per year in the world. These particulate matters can be grouped as (i) inorganic particulate matter like metal oxides (e.g. Fe3O4) formed by combustion of pyrite-containing coal, part of the CaCO3 by coal ash converted to CaO and emitted to atmosphere through the stack. 3FeS2 + 8O2 Æ Fe3O4 + 6SO2 CaCO3 3.

heat

Æ CaO + CO2

Combustion of leaded gasoline produce lead halides, which are volatile and emerge by the exhaust system of the vehicle but form particles, when condense. Thus lead pollution occurs in the atmosphere.

Fundamentals of Ecology

380

Pb (C2H5)4 + O2 + C2H4C12 + C2H4Br2 Æ CO2 + H2O + PbC12 + PbBrC1 + PbBr2 Some basic air pollutants like NH3 or CaO may react with acid rain and form droplets of aerosols of particulate matter. 2NH3 + H2SO4 Æ (NH4)2SO4 (Gas) (Acid rain droplet) (Droplet) CaO (Particles) 4.

5.

6.

+

Æ

H2SO4 (Acid rain droplet)

CaSO + H2O (Droplet)

Fly-ash: Smaller ash particles called fly-ash enter furnace flues and emitted from the stack in the absence of collection devices. Coal-based power plants generate huge amount of fly-ash as Indian coal from surface mining contains on the average 40% ash. In 1998–99, India produced more than 300 million tonnes of coal which generated 100 million tonnes of fly-ash. Table 8.14 Elemental composition of coal and Its disposal has created lot of environfly-ash from thermal power plant at Taicher (concentration in ppm unless mental problem. Table 8.14 provides otherwise specfied) information on fly-ash composition of coal from Talcher. Element Concentration coal Fly-ash Organic particulate matter: In urban Na 319.14±20.7 910.7±50.8 atmosphere organic particulate matter Mg (%) .0.12 ± 0.22 0.21 ± 0.02 are easily found. Polycyclic Aromatic Al (%) 2.12 ± 0.02 15.53 ± 0.06 Hydrocarbons (PAH) are important comSi (%) 3.43 ± 0.06 25.6 ± 0.06 ponents of organic particulate matter. S (%) 0.27 ± 0.03 0.15 ± 0.02 These are benzopyrene, chrysene, benK (%) 0.15 ± 0.02 0.37 ± 0.03 zofluoranthene. These are respirable and Ca (%) 0.51 ± 0.04 0.24 ± 0.02 carcinogenic in nature. PAH compounds Ti (%) 0.73 ± 0.04 0.28 ± 0.03 can be absorbed on the soot particles and soot particles may contain metals V 11.7 ± 1.12 125.0 ± 11.7 like cadmium, chromium, manganese, Cr 9.0 ± 0.8 198.2 ± 25.9 nickel, vanadium etc. Mm 64.9 ± 3.4 194.7 ± 17.9 Biological materials like pollen grain, Fe (%) 0.47 ± 0.04 1.9 ± 0.1 fungal spores, bacteria, virus, algae etc. Ni 5.7 ± 0.7 60.1 ± 10.3 are particles having the potentiality of Cu 8.6 ± 1.1 83.5 ± 10.7 causing disease.

Aerosols are also considered primary pollutants. An aerosol is defined as a dispersion of solid or liquid matter in the atmosphere. Nowadays, natural aerosols, are supplemented by man-made pollutant aerosols, which are particulate matter (usually less than 0.002 mm in diameter). These are mostly carbon particles formed by the combustion of fossil fuels. They remain suspended in air and absorb

Zn

11.2 ± 0.9

117.2 ± 18.8

Ga

7.9 ± 0.08

32.4 ± 2.7

As

1.7 ± 0.2

9.3 ± 0.7

Se

1.1±0.2

2.4±0.3

Rb

4.8 ± 0.3

27.4 ± 4.3

Sr

39.6 ± 2.5

112.8 ± 16.2

Y

7.1 ± 0.5

28.6 ± 5.2

Zr

25.9 ± 2.2

363.6 ± 46.4

Pb

6.5 ± 0.7

15.9 ± 3.7

Pollution Ecology

381

other substances, such as hydrocarbons, sulphur, nitrogen oxides, lead, and so on. Diesel automobiles produce more carbon particles than other vehicles. Asbestos mining and milling operations produce a lot of particulate matter, as do foundries, stone cutting sites, glass manufacturing industries and cement factories. Besides, there is always dust and smoke in the air in Indian conditions, particularly in cities. Table 8.15 lists various forms of particulate matter according to their size. Table 8.15

Particulate matter in air Particle

Aitken particles

Nature 0.1 p.m in radius

Medium to large particles

0.1 p.m to 1 p.m in radius

Very large or giant particles

> 1 p.m in radius

Dust particles

Solid particles dispersed by air

Fume

Solid or liquid particles formed in the vapour phase by condensation

Smoke

Fume formed by the combustion process of fossil fuels (most are Aitken particles)

Ash

Solid materials produced by complete oxidation of fuel. Particle size is 75 p.m in diameter.

Problems caused by aerosols in atmosphere 1. A dense layer of aerosols in the troposphere blocks a large portion of olar radiation coming to the earth. This situation may lower earth temperature and disturb local weather conditions, atmospheric pressure and precipitation. 2. Deposition of particulate matter on plant leaves may affect photosynthesis. 3. Aerosols provide a suitable locus for condensation of vapours in the atmosphere and this may accelerate precipitation. They may provide suitable loci for many atmospheric chemical reactions to occur. The metallic aerosols may act as catalytic agent for chemical reactions. 4. Aerosols may contain toxic metallic particles which are a transported to great distances of air currents and deposited at places far from their place of origin. 5. Aerosols of biological origin or living organisms are responsible for dissemination of many pathogenic disease and allergenic agents. These aerosols are capable of penetrating deep insight the respiratory system causing respiratory disease and these are also concinogenic agents. Water vapours stick to aerosols and the aerosols become heavier and these particles settle down simply under the influence of gravity and this process is called dry precipitation. If enough moisture is available in the atmosphere in the form of rain, dew or snow then the aerosols are cleared and heavier particle-matter are quickly cleared from the atmosphere. The dew, snow or rain can bring down this particulate matter and aerosols to the earth surface and this process of clearance of aerosols from the atmosphere is called wet precipitation. Reducing type of pollution If air is polluted by large quantities of oxide of sulphur and nitrogen and smoke, it is called reducing type of pollution. Burning of coal and petroleum products and various industrial operation including metallic ore smelting generate oxide of sulphur, carbon and nitrogen and particulate matter.

382

Fundamentals of Ecology

Particulates and aerosols Small solid particles and liquid droplets are collectively named as particulates. The number of particles in the atmosphere, specially in lower troposphere vary from several hundred per cm3 in clean air to more 100,000 per cm3 in polluted air. In terms of mass it may range from 60 mg to 2000 mg per m3 in urban areas. Their chemical nature and size of the particles are very important from pollution point of view. These particles posses large surface area on which chemical reactions, particularly photo- chemical reactions occur. Besides, the particles scatter light and reduce visibility.

The particulate .matter in the environment includes dust particles from various sources, finer particles of fly-ash derived from coal combustion, fiberous material of plant and animal origin, particles from mining and mineral processing operations, oil and organic matter, biological materials like pollen grains, fungal spores, bacteria, virus, algae etc. These particulate matter are primary pollutants and have the potentiality of causing diseases, particularly respiratory diseases, neural disorders, allergy etc. The particle size is important in determining their behaviour in the air, the horizontal distance and the height up to which they will be carried by air currents. The deposition of these particle matters on plants and inhalation by animals and man are also dependent on the size of the particles. Particles larger than 10 millimicron usually trained to settle down rapidly. Particles smaller than 10 millimicron remains suspended in the air for long duration. These smaller particles are usually collected by high volume air sampler for study and analysis. Damaging effect of particulate matter Lead particles, when inhaled, produce a toxic effect in man. Some hydrocarbons are carcinogens. Asbestosis is a cancerous disease caused by the deposition of asbestos particles in the lung and commonly observed among mihers in Bihar, Orissa, and so on. Silicosis, another cancerous disease caused by the deposition of silica (Silicon dioxide, Si02) in the lungs and respiratory organs, is prevalent among workers involved in stone cutting, pottery, glass manufacturing and the cement industry in India. Aerosols reduce visibility and create problems for aeroplanes. 8.2.12 Depletion of Ozone Layer in the Atmosphere

In the atmosphere, ozone is largely found in the stratosphere. Ozone absorbs most of the UV radiation of the sun and thus acts as a shield, protecting the living organisms of the earth from health hazards. It is now known that oxygen also absorbs solar ultraviolet radiation. Photochemical reactions bring about an equilibrium between oxygen and ozone, as shown in the following. O2 + hv Æ O + O (l < 242 nm) O2 + O + N2 (or O2) Æ O3 + N2 (or O2) The reaction involving molecular oxygen, atomic oxygen and molecular nitrogen (or molecular oxygen) is a three-body collision reaction. Molecular oxygen is derived from ozone: O3 + hv —> O2 + O (l < 400 nm) O + O3 Æ 2O2 Ozone is also found in the troposphere in very low concentrations (0.01 mg/kg of air at sea level). The concentration of ozone in the stratosphere may be 10 mg/kg of air. Thus there is an apparent equilibrium in the ozone region with the concentration of ozone remaining constant. The vertical distribution of Ozone extends roughly between 10 km to 80 km with its peak concentration at 25 km (stratosphere). This region of the upper atmosphere is also called Ozonosphere. The atmospheric ozone plays a very

Pollution Ecology

383

important role in the biosphere. Ozone absorbs all the solar ultraviolet radiations of wavelength less than 290 nm and partially absorbs wavelengths between 290 and 350 nm. The atmosphere is heated because of this absorption and the earth’s biosphere is shielded from the lethal radiations. Recently, satellite data have indicated that there is a reduction of the ozone layer over the Antarctic, causing a hole the size of a big continent. Recently, an International Conference (Montreal protocol to the Vienna Convention, 1985) was held and representatives of governments of many countries participated. The convention called for a reduction in the production and consumption of chlorofluorocarbons by 50% of the 1986 level by the middle of 1998. This protocol has come into effect from January, 1989. What has led to the depletion of the ozone layer from the stratosphere? Recent studies indicate that the reasons are many but the main culprits are chlorofluorocarbons (CFC). These are gases that readily liquef’ if compressed and are therefore used as refrigerants and propellants in plastic foams and aerosol caps. These gases are very stable and accumulate in the atmosphere with a very long residence time (75–185 years). In the atmosphere they react with ozone, thus depleting it. In modern industry, the fluorochioromethane (Freons), mainly difluorodichloromethane (CF2Cl2) and fluorochlorofoi-m (CFCl3) are widely used in refrigerators, air-conditioners and as propellant gases. Their widespread use releases CF2Cl2 and CFC13 into the atmosphere. CF2Cl2 and CFCl3 are inert in lower atmosphere, but are destroyed by the ultraviolet radiation in the ozonosphere and chlorine is released in the process. CF2Cl2 + hm Æ CF2Cl + Cl CFCl3 + hm Æ (never isolate CFCl2 + Cl) Chlorine is also ejected into atmosphere by volcanic eruptions and a fraction of it reaches ozonosphere. In ozonosphere chlorine attacks ozone in the catalytic manner. Cl + O3 Æ 4 ClO + O2 ClO + O Æ Cl + O2 O3 + O Æ 2O2 It is estimated that the total ozone decreases by about 6.5 per cent in this process. With the depletion of atmospheric ozone there is danger of the increase in the flux of ultraviolet radiation over the earth’s biosphere. All the known effects of these radiations are harmful. The effects are skin cancer, retardation in tissue growth, albumin coagulation and ecological disturbances. Common examples of CFCs are CCl3F, CC13F2, C2C13F3, C2Cl2F4, and so on. (Table 8.16). These ozone depleting potentials are based on taking ODP value estimates as 1 for CFC-11 arbitarily. Methyl bromide is a pesticide used to fumigard soils. Once the gas escapes into atmosphere it breaks down to release bromide compounds which destroy ozone layer. In polluted air when large NO2 and O3 mixing ratios are present, the following reaction occurs NO2 + O3 Æ NO3 + O2 NO3 is a powerful oxidising agent and undergoes the reaction NO3 + hv Æ NO2 + O,

NO3 + hv Æ NO + O2

thus destroying ozone. At night NO3 leads to a net destruction of ozone. It is now believed that jet planes introduce nitrogen oxides into the upper atmosphere which is responsible for ozone destruction.

Fundamentals of Ecology

384 Table 8.16 A

Ozone depleting Chemicals

Group

Substance

Ozone depleting potentials

CF3Cl

(CFC-13)

1.0

C2FCl5

(CFC-111)

1.0

C2F2Cl4

(CFC-112)

1.0

C3FCl7

(CFC-211)

1.0

C3F2Cl6

(CFC-212)

1.0

C3F3Cl5

(CFC-213)

1.0

C3F4Cl4

(CFC-214)

1.0

C3F5CI3

(CFC-215)

1.0

C3F6Cl2

(CFC-216)

1.0

C3F7CI

(CFC-217)

1.0

CFCl3

(CFC-11)

1.0

CF2CI2

(CFC-12)

1.0

C2F3Cl3

(CFC-113)

0.8

C2F4Cl2

(CFC-114)

1.0

Cl

(CFC-115)

Chlorofluorocarbons (CFCs) are commonly called freon gases and Bromofluorocarbons are called Halons.

0.6

Methyl bromide

0.6

CF2BrCI

(Halon-1211)

3.0

CF3Br

(Halon-1301)

10.0

C2F4Br2 CCl4

(Halon-2402)

6.0

Carbon tetrachioride

1.1

1,1,1—

0.1

C2H3Cl3

trichioroethane (methyl chloroform)

Table 8.16 B Sl. no.

Chiorofluorocarbons and their uses Sector

Type of substance

1.

Foam products

Chiorofluorocarbon-11 (CFC-11)

2.

Refrigerators and airconditioners

CFC-12

3.

Aerosol products

Mixtures of CFC-11 and CFC-l2

4.

Solvents in cleaning applications

CFC-113, Carbon tetrachloride, Methyl chloroform

5.

Fire extinguishers

Halons-12l1, 1301, 2402

If the ozone is depleted, more ultraviolet radiation reaches the earth’s surface. This radiation causes skin cancer, affects crop productivity, interferes with oxygen cycles and affects weather patterns. In unpolluted areas the ozone concentration is as low as 0.01 mg kg–1 at sea level and the concentration of ozonosphere may reach 10 mg kg–1. In localised polluted area it may go up to 0.02 mg kg–1. Recent studies reveal that there is an alternate natural source of ozone as described in the following equation.

Pollution Ecology

385

NO2 + Olefin + ht Æ O3 + Other products Olefins occur naticrally in the atmosphere particularly as terpenes while NO2 is produced largely by microbial action in soil. The artificial production of ozone only increase its concentration sufficient enough to damage vegétations and materials and affect health. This has already been discussed. 8.2.13 Minor Pollutant Gases

The halogens are minor pollutant gases. Halogens Gaseous halogen pollutants include fluorine, chlorine, bromine and Iodine, hydrogen halides and halogenated hydrocarbons such as freons and some pesticides and herbicides.

A widespread man-made source of chlorine is the motor-vehicle emission. These contain lead halide aerosols formed from anti-knock compounds. Photochemical decomposition of the halide produces chlorine atoms. Damage to humanhealth by chlorine in the atmosphere is possible only at a high concentration due to accident. Plants may be damaged at as low as 0.2 mg kg–1 and at lower concentration (0.1 mg kg–1) the gas can cause partial closure of the leaf stomata. Bromine exists in the atmosphere in two forms-gaseous and particulate. The most important anthropogenic source of bromine in the atmosphere is the combustion of petrol containing lead ‘antiknock’ compounds. Photochemical decomposition of these lead halides result in the release of gaseous bromine. Damage to vegetation by atmospheric concentration of bromine has not been reported. Iodine, both particulate and gaseous forms are thought to originate from ocean and the concentration in the atmosphere range 0.01 to 10 mg m with an average of about 0.1 mg m. Combustion of fossil fuels which can contain up to 5 mg kg of iodide is a source of man-made iodine in the atmosphere. The radio active isotope of iodine I released as a result of nuclear fission has a high radiological toxicity and accumulates in the thyroid gland.

af Le

ion

De

co

mp

it os

Animals

(Particulates) NaF er CaF at n w Ca3F(PO4)2 tio g si in Na3AIF5 o k p rin om D ec D Hydrosphere and lithosphere

rt so icu rp lat tio e d n by epo ro sits ot s

Fig. 8.5

n

Ab

Pa

tio

Industrial source

Plants

la

(Gaseous) H2SiF6 HF SiF4

ha

ab so rpt Vo ion la ta lis at io n

Atmosphere

In

Fluorine The source of fluorine in the environment may be natural and manmade. Sedimentary and igneous rocks contain fluoride at a concentration of 0.06 to 0.09% by weight. The fluoride rich minerals are cryolite (Na3AlF6), Fluorospar (CaF2) and Fluorapatite Ca5(PO4)3F. Through volcanic eruptions an appreciable quantity of gaseous and solid fluoride is discharged into the environment in the form of Hydrogen fluoride, Ammonium Fluoride, Silicon tetrafluorides, Fluorosilicates and Fluoroborates. The industrial or man-made sources include phosphatic fertilizer, phosphoric acid manufacturing industry, Aluminium smelter plant, Fluoride manufacturing process, Animal feed supplement industries etc. Whatever may be the source of fluoride in the environment, it passes to and from air, water, soil and living organisms through some definite pathways (Fig. 8.5).

Fluoride Cycle in Nature

Fundamentals of Ecology

386

Fluoride intake at a lower dose of 0.7 to 1 mg per day is recommended to children for dentine care. However, repeated exposure to a high concentration of fluoride may be injurious to the health called fluorosis. The effect with respect to concentration and duration of exposure on human beings in as follows. Dose

Time

Concentration

Effect

Single

2-4th

2.5-5g

Death

Repeated

10-20 years

20-80 mg

Cripling fluorosis

Repeated 8 years

5-8 g

osteosclerosis

Fluorine occurs in minute quantities in all plants and animals and is one of the essential elements of protoplasm. Its deficiency in water may cause poor teeth in man. But in higher doses fluorine becomes toxic and a pollutant. It occurs in smoke from brick kilns, and iron and aluminium industries. In high concentrations it damages vegetation. While I ppm is safe, vegetation surrounding iron and aluminium industries and brick works may contain about 2,000 ppm. If such vegetation is consumed by cattle, they may be seriously affected and die. It could cause bone abnormalities, lameness and general weakness. The effect of fluoride on an organism in nature depends on the following factors. 1. Concentration of fluoride to which organism is exposed 2. Duration of exposure 3. Severity and duration of the effect 4. Susceptibility and sensitivity of the receptor 5. Micro-meteorological conditions influencing the effect 6. Interaction of two or more pollutants creating synergestic additive or antagonistic effects Control and management of fluoride pollution

Industrial emission having percentage of fluoride gases and fumes are checked through wet scrubber and dry scrubber before it is released to the atmosphere. The water contaminated with fluoride must be defluoridated before use. Adequate control measures like processes optimisation, emission monitoring and control and solid waste management in industries could also check the entry of fluoride to environment to a large extent. Chlorine is emitted by caustic soda industries and is also an air pollutant. Motor vehicle exhaust contains lead halide aerosols. The photochemical decomposition of the halide products produces chlorine atoms. Chlorine damages leaf stomata and causes breathing problems in man.

Ammonia Ammonia is released to the atmosphere in gaseous form. Most atmospheric ammonia originate from natural sources through bacterial activity (approximately 3700 ¥ 106 tons yr–1). Around 4 ¥ 106 tons yr–1 are released from anthropogenic sources like coal combustion and industrial processes using ammonia. In the atmosphere, ammonia may remain as a gas or be found as the ammonia ion, largely in the form of ammonium sulphate. The total atmospheric concentration of ammonia (gas + NH4) is around 5 mgm3 and has a residence time of approximately 7 days. Ozone in the air oxidises NH3 to a number of materials, such as N2O, N2, NH4, NO3. The water vapour attains the liquid state on the ammonium sulphate particles thereby exerting an effect on visibility. Sinks of Atmospheric gases/Pollutants spheric gases.

Vegetation and ocean are the major sinks for the atmo-

Pollution Ecology

1.

Vegetation Plants usually take up atmospheric gases, which may not enter into active metabolism in plant tissues. Some gases like carbon dioxide and oxygen take active part in the metabolic process. Hence planting of trees around industries and in urban areas would reduce the concentration of air pollutants. The velocity of deposition (Vg) is defined as: Vg =

2.

Total deposition per unit area Dosage (concentration ¥ time)

Some plants like maize, some grasses, bean and alfalfa take 03 (0.2 g/m2), CO (0.52 g/m2), SO2 (0.2 g/m2) and NO2 (0.17 g/m2). The corresponding values of Vg (CM/sec.) are 1.25, 0.012, 0.8 and 2.0. Tables 8.18 and 8.19 give the list of plants which are tolerant to air pollutants. Oceans Many gases like SO2, CO, CO2 etc. defuse to the surface of the ocean, cross the gass liquid boundary and finally mix into the bulk of the ocean. The ocean, therefore serve as a sinks for the atmospheric gases. It has been estimated that the annual transfer of SO2 to the oceans is around 4 ¥ 107 tonnes. Sulphur dioxide is transferred from the troposphere to the ocean through the following reactions. (SO2)g + H2O

(SO2) aq

(SO2)aq + H2O H2SO3 + H2O

K1

+

K2 K3 2HSO

H2SO4 –

H3O + HSO 3; K1 = 1.6 ¥ 10 +

HSO3 + H2O

3.

387

–

H3O + SO 3; K2 = 1.0 ¥ 10 2–

S2O 5 + H2O; K3 = 7 ¥ l0_2 mol

Oceans are the main reservoirs of the carbon dioxide. They are essentially a carbonate and bio-carbonate buffer system. A large increase in the partial pressure of carbon dioxide in the atmosphere brings a relatively small increase in the concentration of carbon dioxide in ocean water. For example a 10% increase in the partial pressure of carbon dioxide in the atmosphere will cause only a 0.6% increase in ocean carbon dioxide concentration. Oceans however are the main reservoir of carbon dioxide and there is a constant exchange of carbon oxide between atmosphere and ocean surface. Soil: Soil also acts as a sink CO2 and other gases.

8.2.18 Meteorology and Air Pollution

Meteorology deals with the study of the atmospheric variations in wind speed, rainfall, temperature etc. which govern the transmission and diffusion of air pollutants. The primary meteorological factors like wind speed, wind direction and atmospheric stability are responsible for the dispersion and dilution of pollutants. Precipitation, humidity, solar radiation, atmospheric pressure etc. are classified as secondary meteorological parameters, which influence the dispersion of the pollutants indirectly by affecting primary parameters.

388

Fundamentals of Ecology

Wind speed and direction The drift and diffusion of pollutants near the earth’s surface are greatly influenced by wind speed and wind direction. With a higher wind speed near the point of discharge of the pollutants, rapid dispersion and dilution occur. The reverse is true when wind speeds are low, i.e. the pollutants tend to concentrate near the area of discharge. However in rough terrain like a valley, the movements of pollutants may not be fully governed by the wind speed. Thus in a plain terrain, dilution of air pollutants released from the source is directly proportional to wind speed and wind direction determines the direction of transport of air pollutants. The wind speed and direction are affected by sonie factors like altitude, surface roughness (plain, rough etc.) and diurnal variation in temperature etc. Atmospheric stability and temperature inversion Vertical movement of air masses depends on the stability of the atmosphere. Atmospheric stability indicates a state of equilibrium. In unstable atmosphere, there is greatest amount of vertical movement of air. During the day, the sun heats the earth and air near it. This warm air rises through the cooler air above, carrying smoke and other pollutants from the sources upward into the atmosphere. If nothing interferes, the polluted air may rise more than 15 kilometers from the earth. Thus under normal situation, the temperature of air relatively near the earth’s surface normally decreases with increasing altitude. However, frequently a temperature inversion interferes. A temperature inversion exists if there is warm air rising from the earth meets the warmer air of the inversion layer, it stops rising and is trapped under inversion. A temperature inversion is often set up at night. When the sun sets, the ground and the air near it cool faster than the air higher up, creating an inversion. This type of inversion usually disappears when the sun warms the earth in the mdrning. But in cold and cloudy weather, it may persist for few days. Another kind of inversion called subsidence occurs when a high-pressure centre (during a developing anticyclone) compresses the upper air, thereby heating it. Under the condition of inversion, the denser cold air at the bottom can not rise up due to lack of any driving force and the atmosphere is said to be stable. Any city or town where inversion lasts for days invariably has a serious problem with air pollution. Precipitation Precipitation causes the removal of pollutants from the atmosphere through washout. Washout is the interception and subsequent removal of particulate by falling raindrops. This process is effective on particles with a radius greater that 1 micron. The larger the particle, the more effective is the washout. Rainout is the collection of particulate of the atmosphere by cloud before their growth and descent as raindrops. This process is effective in the size range of 0.1 to 10 micron. Solar radiation, humidity and pressure Depending on the location, solar radiation and humidity can have a pronounced effect on the type and rate of chemical reaction that occur in the atmosphere. The differential effects of solar radiation and humidity are best exemrlified by the comaprison of Los Angeles’ photochemical smog and London type industrial smog (Table 8.17A). Low- and high-pressure systems affect atmospheric stability and thus pollution. Cyclones characterised by uplifting of air and stormy weather is conductive to good dispersion of pollutants. Anticyclones characterised by subsidence of air and fair weather results in building up of pollutants. Topography Topographical features can significantly alter local atmospheric conditions and hence the dispersion of pollutants. A valley tends to channelise the general wind flow along the valley axis resulting in bidirectional wind frequency distribution. During the evening, radiation of heat from the earth’s surface and consequent cooling of the ground and air adjacent to the ground causes density changes. The cold air moving down the slope of the valley will tend to drain into the valley. However if there exists

Pollution Ecology

Table 8.17 Sl. No.

389

A comparision of Photochemical smog and London somg Characteristics

Photochemical smog of Los Angeles, USA

Industrial smog of London, UK

01.

Temperature at time of occurrence

70-90 F

30-40 F

02.

Relative humidity

70%

85%

03.

Type of temperature inversion

Subsidence

Radiation

04.

Wind speed

5 mph

Calm

05.

Visibility at time of maximum occurrence

0.5 to 1 mile

100 yards

06.

Months of most probable occurrence

August-September

December-January

07.

Major fuel used

Petroleum products

Coal and petroleum products

08.

Principal components

Ozone, peroxyacetyl nitrate, aldehydes

Sulphur compounds, particulate matter, carbon monoxides

09.

Type of reactions

Photochemical

Thermal

10.

Effect on chemical reagents

Oxidation

Reduction

11.

Time of maximum occurrence

Mid-day

Early morning

12.

Principal effects on humans

Eye irritation

Bronchial irritation, coughing

an inversion, the pollutants released on the slopes or at the bottom of the valley remains trapped. Sea and land breezes are created due to the differences in heating rates of the earth and the water. Under the same amount of the sunshine, land absorbs heat faster that water. Hence on a sunny day, sea breezes get created which come from water to land. Land also cools faster than water creating land breezes during night time. Thus the wind flows along the shore causes modification of thermal characteristics and diffusion abilities of the troposphere. 8.2.19 Controlling Air Pollution

1.

2.

Industrial pollution can be minimised by using improved equipment design and smokeless fuels. (a) Particulate matter produced by industries can be controlled by precipitators, scrubbers and filters. Industries in India have not done much for the environment. They must now spend some money to install these devices. (b) The amount of smoke produced by industries, households, etc. can be minimised by the use of some recent devices like smokeless chulhas and solar cookers and of biogas. Factories using coal as fuel should construct long chimneys so that the pollutants are carried out by air and dispersed over a large uninhabited area. SO2 pollution may be controlled by several methods. SO2 is largely produced by coal-based industries. One possibility is to shift from high sulphur containing coal fuel to a low sulphur fuel like natural gas, and other energy sources. The second is to remove sulphur from the fuel before use. The third possible measure is to scrubble the gases.

Fundamentals of Ecology

390

3.

4.

5. 6.

Photochemical smog and pollution from exhaust pipes of automobiles need to be minimised or stopped. Vehicles should be fitted with antipollution devices so that pollutants are filtered. A transport system based on alternative energy sources should be developed. Pollution in Indian villages is mainly due to the burning of wood, cowdung and farm waste, smoke produced by brick works, and because of the non-availability of adequate sanitation facilities. In recent times, sanitary conditions have been improved and biogas facilities are being made available. An important aspect is to create public awareness about pollution hazards. Plants remove pollutants. People should be educated by the mass media about the importance of trees and plantations. According to Indian scriptures, a tree is comparable to ten sons, as it provides food, fuel, fodder, fibre and shelter and removes obnoxious substances from the environment. (Tables 8.18 and 8.19).

Table 8.19

Sl. No. 01.

Table 8.18

SI. No.

List of plant species for plantation within and outside industries for greenbelt purpose (from various sources) Botanical name

Common name

01.

Aegle marmelos

Bel

02.

Anacardium occidentale

Cashew nut

03.

Azadirachta indica

Neem

04.

Bougainvillea sp.

Bougainvillea

05.

Cassiafistula

Amaltas

06.

Cassia siames

Senna

07.

Cedrela toona

Mahanim

08.

Dalbergia sisoo

Shisham

09.

Delonix regia

Gulmohar

10.

Mangifera indica

Mango

11.

Nerium Oleander

Indian oleander

12.

Syzygium cumini

Jamun

13.

Tamarindus indica

Imli

14.

Muraya exotica

Kamini

15.

Zizyphus jujuba

Ber

16.

Calotropis procera

Arakha

17.

Peltophorum petrocarpum

Radhachuda

18.

Bauhinia variegata

Kanchan

Deciduous plants arranged in decreasing order of their air pollution tolerance (particulate matter, temperature, chemical emission & noise) these species can be planted on road sides, around mining areas (from various sources) Species Ficus religiosa

Sl. No. 13.

Species Diospyros meianoxyian

02.

Ficus bengaiinesis

14.

Tamarindus indica

03.

Ficus giomerota (Evergreen)

15.

Mangifera indica

04.

Aibizzia iebbek

16.

Syzygium cumim

05.

Cassia tora

17.

Moringa oiefera

06.

Cassia fistula

18.

Madhuca indica

07.

Cassia occidentalis

19.

Aegle marmelos

08.

Nerium ieander

20.

Phoenix regia

09.

Zizyphus jujuba

21.

Phoenix acauii

10.

Zizyphus oenophiia

22.

Butea monosperma

11.

Zizyphus nurnularia

23.

Tectona grandis

12.

Azadirachta indica

24.

Daibergia sissoo

Pollution Ecology

391

8.2.20 Air Pollution Estimation Methods 1. Control of particulate emissions Removal of particulate matter from gas streams is essential to control air pollution. Four types of equipment are usually used for this purpose.

Gravity settling chamber Gaseous emissions are led into a chamber in which the gas velocity decreases and the dust and particulate matter settle down. The chamber is usually of a horizontal rectangular shape and in this process, particles of diameter less than 50 micron are remove. Finer particles do not settle in this process. (ii) Cyclone collector This is based on the principle that gaseous emissions containing suspended particles flow in a tight circular spiral and thus a centrifugal force is created on suspended particles and this centrifugal force push the suspended particles outward to the wall where they are collected. Particles of diameter range from 5–20 micron can be collected in this process. (iii) Electrostatic precipitators This process of separating suspended particles from a gas stream is based on the principles that the aerosol particles acquire electric charge when subjected to a electrical field F = Eq where F is defined as force in dynes, to which the particle (aerosols) are subjected, E is defined as voltage, gradient (volt/cm), and q is defined as electrostatic charge on the particles (aerosols). Particles (aerosols) become charged when a gas stream is led through a high voltage decorona. Electrically charged particles are attracted to a grounded surface and then they are removed. Now-adays, most of the air polluting industries have installed electrostatic precipitators to control pollution due to particulate matter. Corona discharge may contain ozone. (iv) Thermal precipitator Very fine aerosols can be remove from a gas stream by thermal precipitators. In thermal precipitators a temperature gradient is created in which the gas stream flows. The suspended particles or aerosols move to lower temperature region when exposed to a high temperature gradient. (v) Scrubbing Wet scrubbing utilise a liquid (usually water or alkali or lime) to remove liquid, solid or gaseous pollutants. The emission gas stream is introduced into a spray chamber or tower where the scrubbing liquid is sprayed. The existent of contact and interaction of the gas stream with the scrubbing liquid determine removal of particulate matter from the gas stream. Wet scrubbing is a usual method followed by many industries to control pollution by particulate matter. Recently dry scrubbing methods have been developed. (vi) Impingers Impingers collect particles from a high velocity gas stream directed at a surface. The device is called dry impinger or wet impinger depending upon the dry of net surface. (i)

2. Monitoring pollutant gases (a)

Carbon monoxide is usually monitored through infrared spectro-Photometer (IR). or (b) by gas chromatograph. IR principle is based on the fact that CO is absorbed by JR radiation at a particular wavelength. When IR radiation is passed through a long cell, say 100 cm long containing a trace of CO, a part of JR radiation is absorbed by CO. At different level of concentration of CO, different doses of JR are absorbed. By standardising the process the unknown CO in the air sample can be known.

Fundamentals of Ecology

392

The gas chromatogram is another convenient device to estimate CO in air samples. 3. Analysis of sulphur dioxide Sulphur dioxide in the air sample is easily analysed by West-Gaeke spectro-photometric method. In this method SO2 is collected in a scrubbing solution of HgC12 + KC1 and then the solution is allowed to react with HCHO and then with para-rosaniline hydrochloride. The absorbance of the product (red violate colour) is measured in a spectrophotometer at 548 nm. 4. Analysis of hydrogen suiphide H2S in air samples is measured spectrophotometrically. However, initially H2S is trapped as the insoluble metal sulphide like zinc suiphide, silver sulphide, mercury or cadmium sulphide gas. H2S is readily oxidized in air and then through chemical treatments and colour development the absorbance is measured at 670 nm. 5. Analysis of oxides of nitrogen NO analysis is based on interaction with 03 to produce the electronically excited NO2. Molecule which emits radiation in the 600–3000 nm range and then it is measured through chemiluminescence methods. NO can be collected in NaOH solution and is allowed to react with H3P04, sulfanilamide, and N (1-naphthy) ethylenediamine dihydrochloride. In the process a reddish-purple azo dye is developed and measured spectrophotometrically at 543 nm. In this process SO2 interferes in the estimation. Therefore SO2 is removed by reaction with H2O2 to produce H2SO4 before analysis. 6. Estimation of Hydrocarbons in automobile exhaust ‘Straw’, a high boiling petroleum distillate is used as a liquid absorber for hydrocarbons. Hydrocarbons are easily estimated by GLC (gas–liquid chromatography) and gas chromatograph methods. Table 8.20 provides information on the instrumental techniques used to measure concentration of common air pollutants. (Fig. 8.5). Table 8.20 A

Instrumental techniques for some pollutants I. Gaseous air pollutants

Pollutants

Instruments techniques

CO

Infrared spectrophotometry (non-dispersive), gas chromatography

SO2

Spectrophotometry, conductivity, amperometry

NOx

Chemiluminescence, Infrared spectrophotometry

Hydrocarbons

Gas chromatography (GC), Infrared spectrophotometry

NH3

Spectrophotometry, potentiometry

Polycyclic aromatic

Gas chromatography (GC)

Hydrocarbons (PAH) Volatile pesticides

Table 8.20 B Pollutants

Gas chromatography (GC)

II. Particulate matter Instrumental techniques

Silicates

Chromatography

Fluorides

Potentiometry

Suiphates

Electron spectroscopy

Pollution Ecology

Table 8.20 C

393

III. Elements (Air/Particulate matter)

Pollutants

Instrumental techniques

As

AAS, NAA, XRF, S

Be

AAS, ES, S

Cd

AAS, XRF, ES, S

CR

AAS, NAA, XRF, ES

Cu

AAS, NAA, ERF, ES

Fe

AAS, NAA, XRF, ES

Mn

ASS, NAA, XRF, ES, S

Pb

ASS, XRF, ES, S

Hg

AAS, NAA, ES

Zn

AAS, XRP, ES

Se

NAA,XRF,S

AAS = Atomic Absorption Spectrophotometry

Source: De (1995)

NAA = Neutron Activation Analysis; XRF = E-Ray Fluorescence; S = Spectrophotometry ES = Emission spectroscopy

(First converter) I Reduction stage

HC, CO, NO From engine exhaust

Fig. 8.6 Note:

Pt – H + NO

Air (oxygen)

Pt – O + N2

(Second converter) II Oxidation stage

Pt – O +

HC CO

Pt –

(+ NH3)

+ O2

CO2 H2O

N2, CO2, H2 Relased to atmosphere

Catalytic converter for treating automobile emissions (Pt: Finely divided particle catalyst) In the reduction stage, (NO) is reduced to N2 (+NH3) in the presence of Pt (finely divided catalyst) and CO and hydrocarbons, the reducing gases. Under control condition NH3 production is kept minimum. In the oxidation stage, air containing oxygen is supplied for complete oxidation of hydrocarbon and CD into water and CO2 in presence of Pt catalyst. These are released to atmosphere the Pt catalyst can be poisoned by Lead and hence Pb free gasoline must be used.

8.3

WATER POLLUTION

Water exists in three states: (a) liquid, (b) gaseous (as water vapour) and (c) solid (as snow or ice). Of the total water available on this planet, some 97% is salt water and the rest fresh water. In earlier chapters, we have discussed the water cycle. The sources of water on this planet are: (a) rain, (b) surface water, (c) ground water, and (d) the sea. Rain water carries the washed out minerals, salts and organic matter from the earth’s surface and is stored in ponds, lakes, and rivers. It percolates underground and is stored there as ground water. The sources of fresh water are ponds, wells, lakes and rivers. Distilled water has a pH of 7 but most natural waters are slightly alkaline, since they contain salts. Sea water

394

Fundamentals of Ecology

is alkaline because of a high salt content. Natural water (sea water, lakes, rivers) contains numerous organisms like phytoplankton, zooplankton, fish, and so on. Besides, it is a good solvent and contains dissolved gases like oxygen, essential for aerobic aquatic organisms. When we say pure water, we mean water free from organisms, particularly microbes, and which usually contains a negligible amount of salts. We require pure water mainly for drinking and cooking, but also for industry, agriculture and many other activities. Pollution of natural water, particularly fresh water, implies that it contains a lot of inorganic and organic substances introduced by human activities, which change its quality and are harmful for many living organisms, including man. Water pollution is now one of the most serious problems in the world, particularly in developing countries. Fresh water gets polluted due to (i) domestic and municipal sewage (ii) industrial wastes (iii) agricultural waste, (iv) Physical Pollutants like Radioactive materials and Thermal etc. The common impurities present in water are as follows: 1. Turbidity (suspended solids) Turbidity in water is mainly due to (i) finely divided undissolved suspended solids, clay, silt, (ii) organic matters, (iii) colloidal particles. Turbidity gives water unsightly appearance. Turbid water when used for industrial purposes causes problems in functioning of equipments, boilers etc. because it deposits in low velocity regions, impairing heat transfer and consequent over heating, and the process may promote corrosion and also induce erosion. Water with turbidity over 2NTU causes problem for ion exchange units, causing pressure drop, channeling and apparent reduction in operation capacity.

Turbidity is measured by comparing against standard solution of Fullers Earth visually or with the help of suitable instruments and expressed on silica scale units. Turbidity can be removed from water by treatment processes like (i) settling, (ii) coagulation, (iii) filtration using alum and/or polyelectrolyte. 2. Organic matter The main source of organic matter in water are oil and grease or organic products from deoay of naturally occurring substances synthetic and industrial sources and sewage. The paper, food and beverages, and textile industries release organic pollutants to water. Some of these organic matter can be soluble in water and some have border line solubility or of colloidal in nature. These organic matter provide a good substrate for luxuriant growth of bacteria, which decompose the waste and deplete the oxygen. The sewage produced by an adult person per day has given rise to a daily oxygen demand of 115 mg, which is present in ten thousand litres of water, if the water is saturated with oxygen. Oxygen depletion in water may bring fish mortality. The water contaminated with organic waste may contain faecal coliform bacteria in very high density making the water unfit for human use. Table 8.21 provides information on occurrence of microorganisms in water contaminated with high organic load.’

Water containing organic matter when used in industrial set-up causes foaming in boilers, hinder in precipitation method of iron or hardness removal. It also promotes corrosion in boilers and steam carrying pipelines. If water contains organic matter associated with iron and silica in complex form, it gives problem in boiler and turbines. Organic matter affect Anion Exchange Resins and can also stain products in the process. Organic matter from water can be removed by (i) chlorination, (ii) coagulation, (iii) ordinary filtration or active carbon filtration, or ultra filtration, (iv) scavenging type anion exchanger can remove organic

Pollution Ecology

Table 8.21

395

Microorganisms found in water contaminated with heavy load of sewage and organic matter

Name of the organisms

Significance of its presence

Microcystis aeroginosa

Changes the colour of the water, bad odour: fishy test to drinking water and produces neurotoxin.

Oscillatoria sp.

Changes the colour of the water, bad odour, fishy test to drinking water and produces neurotoxin.

Peridinium sp.

Indicator of eutrophication and heavy BOD load

Lyngbya sp.

Indicator of eutrophication and heavy BOD load

Diatoms sp.

Indicator of eutrophication and heavy BOD load

Cosmarium sp.

Indicator of eutrophication and heavy BOD load

Volvox sp.

Indicator of eutrophication and heavy BOD load

Chiorella sp.

Indicator of eutrophication and heavy BOD load

Fungi (Plate Culture) Aspergillus niger

Infection of the nose, gastro-intestinal tract, external ear. Bronchitis.

Aspergillus flavus

Infection of the nose, gastro-intestinal tract, external ear. Bronchitis.

Aspergillus fumigatus

Infection of the nose, gastro-intenstinal tract, external ear. Bronchitis.

Aspergillus flavipes

Infection of the nose, gastro-intestinal tract, external ear. Bronchitis.

Aspergillus wenti

Infection of the nose, gastro-intestinal tract, external ear. Bronchitis.

Aspergillus awamari

Infection of the nose, gastro-intestinal tract, external ear. Bronchitis.

Candida albicans

Causes nutritional deficiency, infection of mouth (thrush) occurs mainly in children, irritation, intense itching to skin, hand and nails.

Cladosporium sp.

Cause bronchial infection

Penicillium chtysogenum

Causes skin disease, considerable damage to foods.

Penicillium oxalicum

Causes skin disease, considerable damage to foods.

Rhizophus stolonfer Syncephalasirum sp. Fusarium sp.

Parasitic and causes root of stored fruits, vegetables and other commodities.

Zooplankton Eutreplia sp.

Indication of eutrophication

Paramecium sp.

Indication of eutrophication

Entamoeba sp.

Amoebiasis (causes dysentery type disease)

Hydra

Indicator of eutrophication

Worm like organisms

matter. Organic matter in water or Chemical Oxygen Demand (COD) is estimated by using oxidizing agent KMnO4, K2Cr2O7 under different oxidi sing conditions. Besides, there are other methods like GC with mass spectrophotometry to estimate organic matter in water. Biochemical oxygen demand and chemical oxygen demand are two important parameters to judge water quality. 3. Oil Oil tnd grease are important water pollutants. These substances coat ion exchange resin, causing fluidisation and channeling through resin beds causing premature exhaustion of beds.

396

Fundamentals of Ecology

Oil can be removed from water by coagulation with alum. The amount of oil and grease in water can be estimated by extracting them by organic solvent, which is evaporated, and weight of the extracted matter is determined. Some unsaturated fats and fatty acids oxidise rapidly and therefore, special precautions are necessary to minimise their loss. Normally, petroleum ether is used as a solvent. In water bodies physical barriers can be set up for partial removal of oil and grease from water. 4. Alkalinity Alkalinity in water is due to the presence of bicarbonate, carbonate and hydro-xide salts. In naturally occurring water, usually bicarbonates and carbonates are present. Industrial contaminated water contains lot of Hydroxide.

Water with alkali, if used in industries, causes foaming in boilers and it leads to carry-over of salts, ultimately producing carbon dioxide and precipitating CaCO3 and Mg(OH)2 in the boiler. Carbon dioxide can promote corrosion in steam lines and condenser, and scaling due to precipitated salts. Alkalinity in water is determined by titration with standard solution of 0.02 N sulfuric acid using methyl orange or phenolphthalein as indicator. High alkaline water is also not potable and alkalinity can be removed by either treating with lime or by neutralising with mineral acid. Alkalinity along with hardness is removed by hydrogen form of weak acid or strong acid cation exchanger for partial demineralisation. 5. Temperature Water temperature is very important for human use, agriculture and industrial use. In industry the scaling and corrosion rates are affected by temperature because the solubility of salts and reaction rates are temperature dependent. Temperature is generally measured by thermometers and temperature of surface water in lakes, ponds, river etc. varies with atmospheric conditions compared to ground water which more or less remains constant. Water-bodies receiving pollutants easily absorb more heat and remain warm. Nuclear reactors, electric power plants, petroleum refineries and steel melting factories require huge amount of water for their cooling processes and the heated water is discharged into water bodies, usually to river, lake or sea. This causes thermal pollution. High water temperature depletes oxygen and is injurious to fish and other aquatic life.

These common substances cause water pollution and make water unsuitable for human use, agriculture use and even industrial use. 8.3.1

Source and Nature of Water Pollution

Oxygen demanding waste pollutants Sewage, other organic wastes, animal and human excreta are classified as oxygen demanding waste. A litre of water at 5°C in free contact with air contains only about 9 ml of oxygen, weighing 13 mg. As the temperature rises, the oxygen content decreases and at 20°C, it is only 6 ml. A litre of air at sea level contains about 210 ml of oxygen weighing about 300 mg. This amount is many times more than the amount of oxygen found in the same amount of water. Thus the depletion of oxygen acts as a stress factor for aquatic organisms, particularly fish.

These organic wastes provide a good substrate for the luxuriant growth of aerobic bacteria, which decompose the waste and deplete the oxygen. The sewage produced by a person gives rise to a daily oxygen demand of 115 g, which is present in 10,000 litres of water (Mellanby, 1967) if the water is saturated with oxygen. Many of the thickly populated urban areas dump their sewage and garbage into water bodies. These wastes deplete the oxygen making the aquatic ecosystems unsuitable for fish. In

Pollution Ecology

397

Indian villages, water sources get polluted mainly by agricultural wastes, sewage and animal exereta. The polluted waters carry germs of typhoid, cholera, diarrhoea, jaundice and hepatitis. Thus, besides oxygen depletion, the consumption of this water creates health hazards. Of the 3,119 urban areas in India, only 8 have full and 209 partial sewage treatment facilities. 8.3.2 Eutrophication

When sewage and organic wastes are broken down, inorganic nutrients enrich the water. The runoff from agricultural lands also greatly increases the nutrient load in water bodies. Fertilisers rich in nitrates and phosphates are washed into water bodies from agricultural lands. In this way the mineral and salt contents of water bodies increase. This nutrient load greatly increases the productivity of water and an algal bloom occurs in such water bodies. The entire water body becomes green. The growth of algae and other organic matter promotes that of a large decomposer population, which breaks down dead algae and other organic matter using oxygen from the water. Living organisms and the algal bloom also consume oxygen at night for respiration. In this way the oxygen is greatly depleted from water bodies and this causes serious problems for fish. This problem of excessive nutrient load in water bodies is called eutrophication. It has become a serious problem in many inland water bodies in India. Nitrite- and nitrate are deemed to be potentially hazardous to human health, if these are taken into body at the rate 0.1 mg/l and 50 mg/l respectively for some time. Nitrate is particularly dangerous to infants and if taken may cause a disease called mithemoglobinemia. Nitrates usually occur in traces in surface water. Nitrites are formed by the oxidation of ammonia and reduction of nitrates. Nitrites and nitrates caused eutrofication. Phosphate It occurs in natural and wastewater as an inorganic substance or organically bound phosphate. The run-off water from agriculture land (use of fertilisers), boiler waters, laundry contain mainly inorganic phosphate. By biological processes, organic phosphates are formed. Phosphates cause eutrofication and also dangerous to human health, if taken constantly in higher concentration. 8.3.3 Industrial Wastes, as Water Pollutants

Many industries, such as steel and paper industries, are situated on the banks of rivers because they require huge amounts of water in their manufacturing process. These industries dump their wastes, containing acids, alkalies, dyes and other chemicals into rivers. Many of these materials are poisonous for living organisms and cause serious water pollution problems. Detergents and other cleaning materials form an important source of water pollution. These chemicals change the pH of water and thereby the distribution and activities of aquatic biota. Hard detergents include substances like sodium tetrapropylene benzene sulphonate, which is extremely resistant to bacterial action. Soft detergents have now been introduced and are said to be broken down by bacterial action. These detergents fill up the water bodies and get shaken up while flowing downstream due to wind action and water current, creating a new mass of white foam called detergent swan. The Thames river in England was once filled with so much of this sud (white foam) that it posed an alarming problem and from a distance it appeared as if the river water was full of white swans (Mellanby, 1967). Drinking and bathing water containing detergents can create serious health hazards. Acids, alkalies and detergents create stress factors for fish, leading to death. Table 8.22 provides information on the nature of water pollution in the river lb (Mahanadi water system) in Orissa due to paper mill effluents.

Fundamentals of Ecology

398 Table 8.22

Effect of paper mill effluent on water quality in river lb. Orissa, India (Mishra et at., 1988, Das et al., 1986)

Physico-chemical/ biological features

Upstream (not polluted by paper mill effluent)

Temperature (°C) (range)

21–28.5

Downstream (polluted) 22—29

pH

7.1–8.2

8–10.8

DO2 (ppm)

6.8–11

3.8—7.2

Alkalinity (ppm)

58–92

110—282

Salinity (ppm)

10.3–34

22.5–55

Free CO2 (ppm)

3–5

5.8–13.9

Total hardness (ppm)

54–85

90–260

Silica (ppm)

10–16

15–20

Phosphate (ppm)

11–18

12–21

B.O.D5 (ppm)

3–16

16.9–38

C.O.D. (ppm)

28–92

128–530

Total heterotrophic bacteria

2.16–7.2

2.01–4.4

(per ml ¥ 106)

(X = 4.9 ± 1.7)

(X = 3.38 ± 0.76)

Total coliform 100 ml.

5,282.5 ± 4,801.6

1,713.3 ± 1,091.3

pH

6.50–8.04

7.96–8.78

Organic matter (g %)

8.65–11.5

15.7–21.8

—

—

Sediments

Heterotrophic bacteria (TPC/g) (¥ 10 )

44.04 ± 14.93

51.84 ± 16.48

Total coliform (MPN/g)

9,097.5 ± 9,352.2

11,190.8 ± 10,265.7

Fecal coliform (MPNIg)

4,128.6 ± 1,267.2

6,114.3 ± 3,168.3

6

Note: During summer, there was not much water downstream and the effluents were discharged more or less on sand or in water of negligible depth. Much water was not allowed to flow downstream during summer due to scaricity of water for use in the factory and domestitully. The study was carried out for three years (1982– 1985).

Chromium Chromium salts are used in ind.strial process. Chemical industries dealing with production of sodium dichromate and other chromium containing compounds usually discharge their effluents after treatment to nearby water bodies. If the treatment process is defective, high concentration of chromium, particularly, hexavalent chromium, which is dangerous to human health, can go to water bodies. The mine water from chromium ore mines also contains chromium salts. Unless treated high concentration of chromium may go to water bodies. The normal level of chromium (CR) in drinking water is 3–40 ppb. The permissible level being 50 ppb. Hexavalent chromium is Carcinogenic. Fluoride High concentration of fluoride in water causes health problems. In lower concentration (less than 1 ppm) prevents dental carries without adverse effects on health. In higher concentration it becomes dangerous to health of mammals including man. Aluminium industries generate lot of fluoride through their emissions to air and effluents into water bodies.

Pollution Ecology

399

Ammonia Ammonia is generated from natural sources by bacterial activity and from organic nitrogen containing compounds and hydrolysis of urea. In water bodies, ammonia is produced by the reduction of nitrates under anaerobic conditions. In high concentration ammonia is toxic to fish and other aquatic organisms. However, it may be present in low concentrations in natural surface water. Fertiliser industries generate lot of ammonia. Cyanide Metal refining and cleaning, electroplating, coke ovens and many other industrial processes generate cyanide and discharge as effluent to water bodies. Cyanide is a very toxic substance. Oxidising agents destroy most of the cyanide during storage and manipulation and during storage ascorbic acid (0.06%) is used as a preservative. Steel plans usually generate cyanides. 8.3.4 Thermal Pollution

Nuclear reactors, electric power plants, petroleum refineries and steel melting factories require huge amounts of water for their cooling processes. The heated water is discharged into water bodies, usually a lake, river or sea. This causes thermal (high heat) pollution and results in an increase in the temperature of the water. The high temperature depletes oxygen and is very injurious to fish and other aquatic organisms. 8.3.5 Pollution by Oil Spills

Big tankers carry petrol, diesel and their derivatives on the high seas. If there is an accident or leakage, the sea water gets polluted. Offshore exploration of petroleum causes oil spills. Ferries which leave a certain amount of oil on river water surfaces cause a similar pollution in fresh water ecosystems. The oil spill covers the water surface and prevents atmospheric oxygen from mixing with water. The oil spill affects fish and other aquatic organisms adversely. 8.3.6 Pollution by Acid Rain

We have already talked about acid rain, which pollutes aquatic ecosystems, changing the pH of water and affecting the activities of fish and other organisms. The suspended particles in air also fall on water bodies as rain and pollute the aquatic ecosystems. 8.3.7 Agrochemicals as Water Pollutants

Water that flows on the surface of crop fields, where agrochemicals such as fertilisers, pesticides and insecticides are used, contributes a lot to water and soil pollution. To increase productivity, man uses pesticides and insecticides. The use of these chemicals has created health hazards not only for livestock and wild life but also for fish, other aquatic organisms, birds, and mammals, including man. Any substance or mixture of substances which prevents, repels, destroys, or mitigates any pest (fungus, insects, weeds, nematodes, rodents, bacteria, viruses, etc.) is called a pesticide. These chemicals are classified on the basis of (a) their chemical structure, (b) on the basis of the class of pests against which they are used, or (c) on the basis of their chemical structure and biological action. Table 8.23 includes a list of pesticides. Many of these pesticides, such as DDT, aidrin and dieldrin, have a long lifetime in the environment. They are fat-soluble and generally not biodegradable. They get incorporated into the food chain and are

Fundamentals of Ecology

400

ultimately deposited in the fatty tissues of animals and man. In the food chain, because of their build up, they get magnified in higher trophic levels (biological magnification, Fig. 2.13). Table 8.23 S.No.

List of pesticides in use Name

Organism against which used

1.

Organochlorine insecticide (BHC, DDT, dieldrin, aidrin, heptachior, methoxychior, chiordane, endosulfan, etc.)

Insect pests

2.

Organo-phosphorus insecticide (malathion, parathion, phorate, dichiorvos, phosphamidon, DDVP, phenthoate, diazinon, etc.)

Insect pests, nematode pests

3.

Carbamate insecticides (Carbaryl, aldicarb, etc.)

Insect pests, nematode pests molluscs

4.

Botanical insecticides (pyrethrins, rotenoids, nicotine)

Insecticides

5.

Fungicides (organo-mercury and its compounds, phenols, dithiocarbamates, quinones, ete)

Fungi

6.

Nematocides (aliphatic halogen compounds, methylisothiocyanate, carbamates, organophosphorus compounds)

Nematodes, particularly plant nematodes

7.

Rodenticides (thallium sulphate, zinc phosphate, arsenic, etc.)

Rodents

8.

Fumigants (hydrogen cyanide, formaldehyde, methyl bromide, carbon disuiphide, ethyl oxide, etc.)

Fungal pests, insect pests

Pesticides have been in use during the last 50 years. Their targets are insects pests, fungi, nematodes, and rodents which damage crops. But these pesticides have created enormous problems for non-target organisms consisting of largely beneficial species like earthworms, fish, amphibia, some reptiles, birds, mammals and man. Kepone case Kepone is used for control of tobacco wire worm, cockroaches and ants. This chemical is also toxic to birds, mammals and human beings and may cause cancer in rodents, if taken persistently. In USA at Hopewell, Virginia, some 50,000 kg of kepone was clumped into the sewage system in mid1970. In one year ultimately this pollutant was discharged to Chesapeake Bay. After some time kepone was found in the tissues of fish and shellfish and thus kepone was incorporated into the food chain. The employees of the plant inhaled about 3 gm/rn3 kepone and suffered from disease and finally the plant was closed. Long lasting pesticides are dangerous to the environment and to loss of biodiversity and human health. Toxicity of pesticides The toxicity of organochlorine pesticides (DDT—Dichlorodiphenyl-trichloroethane, hexachlorocyclohexane, chlordane, aldrin, dieldrin, etc.) lies in their inhibiting Na+, K+ and Mg++ adenosine triphosphatase activity in the nerve endings of animals, particularly insects. It affects the sensory, motor nerve fibres and the motor cortex (Matsuma and Patil, 1961). Earlier, Narahashi and Yamasaki (1960) working on the effects of DDT on the giant axons of cockroach found that DDT influences the efflux of potassium ions from the axon.

Organochlorine pesticides are absorbed from the intestinal tract, from the alveoli of lungs and through the skin if the pesticide is in solution. A high concentration of these pesticides, particularly DDT, causes brain damage, centrolobular necrosis of the liver, and liver enlargement in small

Pollution Ecology

401

mammals. Concentrations as low as 5–10 ppm Table 8.24 Comparative LD5, (mg/kg) of some in diet cause liver damage. In some birds, DDT selected pesticides and their acceptable daily intake (mg/kg) in man concentration as low as 1–3 ppm destroys the female sex hormone and the egg shells become Pesticide LD50 (rat) Acceptable so thin that the eggs break when the parents (oral) daily intake sit on them for hatching. In the USA, a DDT DDT 113–217 0.005 concentration of up to 20 ppm is found in some BHC (benzene hexa3,500 fish eating birds and the body of an average chloride) American has about 12 ppm of it. Lindane has Aldrin 39 0.0001 been shown to occur in human milk (FAO/ Chlordane 283 0.001 WHO, 1971). A number of studies indicate that Dieldrin 46 0.0001 some organochlorine pesticides cause blood Endrin 18 0.0002 dyscrasias in mammals. These insecticides also Hepatachlor 100 0.0005 cause decreased fertility in mammals and other animals. Table 8.24 provides data on the LD50 Lindane 88 0.01 and the acceptable daily intake values of some Hexachlorobenzene 3,500 0.0006 pesticides (Gupta and Salunkhe, 1985). (fungicide) 2,4-D (herbicide) 3,400 0.3 Organophosphorus insecticides are absorbed by the gastrointestinal and respiratory tracts, Demeton 1,700 0.005 and the skin. These insecticides inhibit the Dimethoate 215 0.02 Acetyicholinesterase (AchE) enzyme. Thus Disulfoton 6.8 0.001 an abnormal accumulation of endogenous Fensulfothion 2 0.0003 acetylcholine occurs. This causes excessive Malathion 1,375 0.02 activity of the para sympathetic system, in Parathion 13 0.005 the form of sweating, abdominal cramp, chest Carbaiyl 850 0.01 discomfort, vomitting. overactivity of smooth Bromophos 1,600 0.006 muscles, and so on. It also causes headaches, nervousness and overactivity of voluntary Carbophenothion 10 0.005 muscles. The nervous system is very adversely Captan 9,000 0.1 affected. The carbamate insecticides are Paraquat 57 0.002 absorbed by all portals, including the skin. Pyrethrins 1,410 0.04 These pesticides are reversible inhibitors of Based on Gupta and Salunkhe, 1985) AchE. Many pesticides last long in the environment and hence create problems. These pesticides are metabolised and some are deposited in fatty tissues while others are excreted. But all of them cause serious damage. 8.3.8 Water Pollution by Metals—Mercury

Heavy metals like mercury and lead, which are present in industrial wastes, create serious water pollution problems. In 1970, it was detected that the mercury content in the tissues of fish living in lake Erie was very high. The source of mercury pollution were the chlorine producing plants situated on the banks of the river. Some 250 g of mercury were released into the water for every tonne of chlorine produced. Some anaerobic bacteria converted this mercury into methyl mercury which dissolved in water and

Fundamentals of Ecology

402

through the food chain (phytoplankton Æ zooplankton Æ fish) got magnified in every stage of transfer and was finally deposited in fish tissue. Man got this mercury into his body by eating fish, which created health hazards. In 1953, an outbreak of mercury poisoning in Japan raised public awareness. Minimata Bay was contaminated with methyl mercury and people eating seafood from that region suffered from minimata disease, which produced numbness of limbs, lips and tongue, and caused blurred vision, deafness and mental derangement. Of the 52 reported cases, 17 died and 23 became disabled. Recently, working on the effect of pollution load by a paper mill on the river lb of the Mahanadi water system in Orissa, India, Dash et al. (1988) observed mercury pollution. The paper industry uses mercury as a cathode in chloroalkali electrolytic cells and mercury leakage can be as high as 200 mg/ tonne of chlorine produced (Fergusson, 1982). Samples of water and sediments collected from the aerated logoons of the paper mill at Brajrajnagar and the river lb downstream of the paper mill showed the presence of the mercury. An analysis of the mercury in some fish showed 500 times biomagnification over the downstream surface water (Table 8.25). Table 8.25

Accumulation of mercury in water, sediment and fish in the river lb (Dash et al., 1988) Site/Species

Upstream (not polluted by paper mill) Paper mill lagoon

Water

Sediments

Magnjfication

Nil

Nil

Nil

0.0075

0.4275—2.16

57—288

Effluent discharge point in river

0.005

0.40—1.2

80—240

Downstream (polluted) Fish

0.0025

1.2—1.92

480—768

Downstream Amblypharyngodon sp.

0.95(380)

Mastacemb èllus pancalus

1.075(429)

Channa punctatus

1.1(440)

Chanda range

1.25(480)

Wallago attu

1.33(532)

Differert tissues of W. attu: Ovary

0.87(348)

Heart

0.968(387)

Liver

1.38(552)

Upstream Mustus keletius

0.475(190)

Puntius sophore

0.60(240)

Note: Study period—February—March, 1985. Mercury cone, ppm dry weight. Values in parentheses refer to magnification from downstream water.

In general, benthic fish and those higher in the food chain accumulated more mercury. People of the villages of that region, who used river water for drinking, suffered from diseases of the eye, skin rashes and anaemia.

Pollution Ecology

403

Mercury toxicity The pulmonary, gastrointestinal and skin absorption of mercury by the human body depend upon its chemical form. Solubility, volatility and particle size determine the pulmonary absorption of inorganic and organomercuric compounds. Inorganic mercury absorption by the gastrointestinal tract in man is about 7% but methyl mercury absorption can be as high as 95%. Methyl mercury and long-chained alkyl mercury compounds change into inorganic mercury in mammals. Mercury gets into the blood easily. Short- chain alkyl mercury compounds get into the RBC membranes and easily bind with haemoglobin. Mercury also gets bound to plasma proteins in the blood. High levels of mercury have been found in the kidney, liver, pancreas, RBC, spleen and brain. The half-life of mercury in man is about 48 days for males and 37 for females in the case of inorganic mercury and about 66 days for methyl mercury (Friberg and Vostal, 1972). Mercury compounds get excreted through the urine and faeces. Figures 8.6 and 8.7 deal with biotransformation of Fig. 8.7 Bio-transformation of Hg in Environment Hg in Environment.

Fig. 8.8

Bio-transformation of Hg in Environment

Mercury poisoning usually causes kidney damage and the lethal dose is about 0.5 to 1.0 g for an adult. Toxicity shows symptoms like numbness in the limbs, muscles, lips, blurred vision leading to blindness, emotional disturbances, and so on. In Japan, methyl mercury levels in hair samples, were high. Fish and shelfish are the major sources of high levels of hair mercury.

Fundamentals of Ecology

404

Table 8.26 provides information on the toxicity of some metals. Table 8.26

Nature of metal toxicity

Metal

Source

Symptoms

Mercury (organic and inorganic)

Industrial discharge vapour

Central and peripheral nervous systems dis orders renal failure, blurred vision, numbness of limbs, lips, muscles, etc.

Lead

Industrial waste, dust, polluted food, paint

Nervous disorders, renal failure, blood poisoning and anemia, encephalo pathy

Cadmium

Industrial discharge, dust, fumes, polluted water

Renal, pulmonary and skeletal diseases proteinuria, glucosuria

Arsenic

Polluted water, industrial waste, medicinal use

Respiratory and skin cancer, nervous

Nickel

Aerosols, industrial dust

Pulmonary disorder, dermatitis etc.

Chromium

Industrial waste, fumes

Respiratory disorders including cancer

Tin (organic and inorganic)

Industrial dust, medicinal use

Central nervous system disorder vision and pneumoconiosis

Lead Lead has been in use for the last 6000 years. The Greeks and Romans used it for the manufacture of cooking utensils and in plumbing systems. Cragg (1968) wrote that ‘Millions of tons of lead were produced by the Greeks as a byproduct of silver refining. Greek and Roman aristocracy used lead-lined cooking, eating, and drinking vessels. Lead salts gave a sweet taste to foods and retarded decomposition. Grape syrup was concentrated in lead- lined pots over a fire and stirred to give the mixture a sweet taste. And thus it was that lead poisoning, with all its various effects, lassitude and infertility to mention only two, no doubt contributed to the collapse of the Roman Empire.’

In nature lead occurs as lead sulphide, which is non-poisonous. The USA is the chief producer and consumer of lead products. At present, 2.5 million tonnes of lead are produced every year. The electric storage battery industry and the petroleum industry (gasoline additives and lead alkyls) are now the main users of lead. Lead is used in pigments, in the ceramic industry, as an insecticide (lead arsenate), for electric cable insulation, pipe manufacturing, ammunition, and so on. The lead concentration in both sea water and fresh water has gone up. Gupta and Salunkhe (1985) quoted a figure of 0.02 to 0.40 g per litre in marine water in the preindustrial period. Now the concentration in some areas of the Mediterranean and Pacific is 0.2 and 0.35 g/litre, respectively. Inorganic lead emission from automobile exhausts mainly contributes to the total emission into the environment. Small particles of lead (less than 2m diameter) can be inhaled and are dangerous. The average time of lead in the air is 7–30 days. Toxicity Lead gets into the human body by inhalation and ingestion and about 10% of the lead ingested may be absorbed into the blood. RBC, liver, kidney, and bone are the main organs affected by lead poisoning. It seriously affects the brain ana peripheral nervous systems. The symptoms are abdominal pain, vomitting, diarrhoea, collapse and coma. The initial symptoms are loss of appetite and body weight, anemia, and lead lining of gums. Tetramethyl lead is more dangerous than inorganic lead. The LD50 in the rat for inorganic lead administered intravenously is about 70 mg per

Pollution Ecology

405

kilogram of body weight in comparison to 10 mg per kilogram of body weight for tetraethyl lead (IARC, 1980). The biochemical basis of its toxicity is that it affects haeme biosynthesis, alters mitochondrial membrane structure and function, impairs enzyme activities, and damages brain cells. Cadmium Cadmium occurs in the earth’s crust along with zinc, lead-zinc, and lead-copper-zinc ores. It is usually found as cadmium sulphide. The average concentration in the earth’s crust is about 0.2 ppm. Cadmium compounds, such as cadmium oxide, carbonate, sulphide, and hydroxide, are insoluble in water. But cadmium fluoride, bromide, chloride, iodide, nitrate and sulphate are partially water-soluble. Alkyl compounds of cadmium are unstable and hence not pollutants.

Cadmium is used for the electroplating of metals, as a pigment and a stabiliser in plastic materials, as a constituent of some low melting alloys, and in nickel-cadmium batteries. It is released into the environment from the cadmium industry as fumes, dust, sludge, and waste water. It is also released into the environment by the remelting of cadmium containing alloys, wastes, and cadmium plated metals, by the use of cadmium sludge as fertiliser, and by the wear of automobile tyres. It has been estimated that about 2,000 tonnes of cadmium per year are released into the environment. Gupta and Salunkhe (1985) have quoted values of 2 mg/litre of water for uncontaminated surface waters and 225 mg/litre for contaminated well water. The US drinking water standard for cadmium is 10 mg/litre. Cadmium is also present in foodstuffs and is generally 0.1 ppm but shellfish, and some vegetables may contain much higher levels. Air-borne cadmium is absorbed by lungs, although absorption depends upon particle size, concentration in air, and so on. Cadmium in food and water can be absorbed in the gastrointestinal tract. Absorption through the skin has been observed in animals but is negligible. Toxicity Cadmium becomes bound to plasma proteins like albumin and al-pha-2-macroglobulin after absorption into blood. It usualy gets deposited in the liver, kidney, testes, lungs, pancreas, endocrine organs and intestinal mucosa. Acute poisonning is marked by increased salivation nausea, vomitting, headache, shock, chest pain, bronchial pneumonia, kidney necrosis, and so on. Inhalation of 1 mg/m3 of cadmium over 8 hours shows the above mentioned symptoms. Retention of about 4 mg in the lungs is fatal.

Fig. 8.9

Metabolism of cadmium

Fundamentals of Ecology

406

Arsenic The medicinal and toxic properties of arsenic were known to the Indians, Greeks and Romans for centuries. Arsenic is used in many medicines in low doses. The toxic property of arsenic was considered important for its use as an insecticide. There are a number of instances in which arsenic- contaminated food and drinks have killed people. Arsenic is found in natural rocks and soils in various parts of the world and it leaks into water. Most of the arsenic trioxide produced in the world is used in agriculture, and a considerable amount of it mixes with water. Organic (methyl arsenic and dimethyl arsenic) arsenic is also found in water, because of oxidation, reduction, methylation and demethylation cycles operating in the environment and organisms. Toxicity

Inhalation exposure or ingestion of arsenic compounds is responsible for arsenic poisoning in animals and man. Methyl arsenic acid or dimethyl arsenic acid get excreted in the urine. Arsine gas (AsH3) is a haemolytic poison, which causes renal failure and death. Acute toxicity causes liver and kidney damage, muscular atrophy, gastrointestinal damage, and nerve disorders. Other metals Copper is used to keep ponds free from algae and 0.5 ppm is effective for this. Fish can survive 1 ppm and man can tolerate 2 ppm— beyond this concentration, it is a poison. Zinc affects invertebrate animals like earthworms, snails and insects and acts as a poison in high concentrations. Panda et al (1999) have found that reproduction in some earthworms was reduced when the Zn concentration in soil exceeded 200 mg per kg. Metallothioneins are small, low molecular weight cysteine rich proteins having high metal binding capacity and hence can be used for detoxification of heavy metals. 8.3.9

Mining Operations

Open earth mines create problems of water pollution. Abandoned copper, coal and iron ore mines create problems unless covered with earth. Iron pyrites in these mines undergo aerial oxidation in the presence of water, producing hydrated ferric oxide and hydrogen ions. During the rainy season, these materials are washed away and pollute water bodies Acid mine drainage Coal mines, particularly abandoned ones discharged H2SO4 and Fe(OH)3 into water bodies through seepage. Pyrites, which occur in underground seams of coal, contain FeS2, which is stable in the absence of air. However, without coal, seams become exposed to air in mining opertions, FeS2 is oxidised as shown below and these reactions continue to occur even after coal mining operations are over. Microorganisms, like Thiobacillus ferroxidans, Metallogenium, Thiobacillus and Ferrobacillus are involved in this process. These iron bacteria are active in low pH and catalyse the reactions.

2FeS2 + 2H2O + 7O2 Æ 2Fe2+ + 4HSO4 4Fe2+ + O2 + 4H+ Æ 4Fe3+ + 2H2O Fe3+ dissolves pyrite further. FeS2 + 14Fe3 + 8H2O Æ 15Fe2+ + 2SO42– + l6H+ These reactions occur in acidic pH. Fe(H2O)3+6 is acidic and at pH above 3 gives a precipitate of Fe(OH)3 Fe(OH)3

Æ

Fe3+ + 3H2O

(Precipitate)

+ 3H+

Pollution Ecology

407

Fe(OH)3 makes water yellowish and H2SO4, which is formed in the process turns the mine water acidic and if discharged to water bodies destroys fish and other aquatic organisms. Calcium carbonate usually used to neutralise acids. 8.3.10 River Pollution in India

India has 14 major river systems of which 10 have been declared national waterways. These river systems share between them 83% of the drainage basin and account for 85% of the surface flow. There are also 44 medium and 55 minor rivers which originate from the mountain regions of coastal areas. These rivers are monsoon rain-fed and fast flowing. Four of the 14 major river systems, namely Brahmani, Brahmaputra, Ganga, and Mahanadi, are perennial with a minimum discharge of 0.47 Mm3/km2/year, whereas other major river systems like Indus, Narmada, Tapti, Subarnarekha, Krishna and Godavari have an average discharge of 0.26 Mm3/km2/year. The remaining four, namely Sabarmati, Mahi, Pennar and Cauvery have an average discharge of 0.06 Mm3/km2/year (Tiwari and Ali, 1988). Tiwari and Ali (1988) have developed a water quality index for Indian rivers, taking into account ten physicochemical and biological factors, such as DO2, BOD, pH, chlorides, nitrates, alkalinity, total hardness, total residues, turbidity and MPN of coliform. The pollution load is considered heavy if the value of the water quality index (WQI) is high. Usually a WQI value of 100 or more indicates pollution. Tiwari and Ali have calculated the WQI values for 24 Indian rivers, almost all of which are more than 100. The Ganga has become very polluted because numerous industries are located on its banks. Many important and thickly populated cities, such as Haridwar, Kanpur, Allahabad, Banaras, Patna, Calcutta, etc. are also located on its banks. The industries dump their wastes into the Ganga. Apart from this, the sewage and municipality garbage of these cities is dumped into the river. Considering its importance, the government of India has taken up a Ganga Action Plan to clean the river. 8.3.11 Control of Water Pollution

Polluted water is characterised by its oxygen demand and solid content. A test called Biochemical Oxygen Demand (BOD) measures the level of organic pollution. A sample of polluted water is incubated in the dark at 20°C for five days in a closed container. The oxygen content of the water is measured at the start of the experiment. After incubation for five days, the oxygen content is measured. All living organisms consume oxygen in respiration. The measurement of oxygen after the incubation period is a measure of the biochemical oxygen demand, as it also includes the oxygen demand for the oxidation of orgainc material. A high BOD value indicates pollution. City sewage contains about 14% solids with particle size less than 1 mm. These are called settleable solids as they settle on standing. Small particles may amount to 6% of the total solids. The city waste and sewage must be treated and made harmless before being discharged into the water bodies. The treatment is carried out in three stages—primary, secondary and tertiary. 1. (a) In primary treatment, the solid objects are separated by coarse screens or sieves. The liquid material passes into the settling tanks. The suspended materials settle down in the tanks and form a sludge. (b) In secondary treatment, the effluents are filtered through a bed of rocks, after which the bacterial decomposition of organic materials begins. To hasten this process air is bubbled to increase the oxygen content. This process removes about 90% of the biodegradable materials present in the water. The effulent is also chlorinated to kill the germs and is then discharged into the water bodies.

408

Fundamentals of Ecology

Fig. 8.10

Table 8.10 Water Treatment Process

Fig. 8.11

Activated sludge system for secondary biological wastewater treatment

Pollution Ecology

409

(c)

2.

3.

Tertiary treatment is applied to remove detergents, metal ions, nitrates and pesticides, as these are not removed in the earlier treatments. In this process the effluents from the secondary treatment are passed through activated charcoal to absorb the pollutants. An alternative and less expensive method is to use this water for irrigation to raise crops or to grow algae and aquatic plants for use in biogas plants. This is now being practised, but some sort of preliminary treatment is required to make the polluted water free of germs and pollutants. The creation of public awareness is very important to make village ponds, wells and rivers clean and also to maintain cleanliness in urban areas.

8.4

SOLID WASTE POLLUTION

India’s population is increasing at the rate of 1.7% and in the recent time there is significant migration of people from rural areas to towns and cities. The solid waste has been generated in large quantities in proportion to the increase in the human population, particularly in cities. The solid waste includes domestic biodegradable as well as non-biodegradable wastes. Some of these wastes may be combustible and some non-combustible like metals and glasses. It also includes ash, construction wastes like building materials, sewage sludge, municipal wastes like polythenes, waste paper, leaves, dusts etc. medical wastes which may be hazardous and toxic, agricultural wastes which are usually organic, combustible and biodegradable and industrial wastes which are usually organic, combustible and biodegradable and industrial wastes which may be hazardous and non-hazardous (Tables 8.27 and 8.28). Improper management of these solid wastes causes environmental pollution and therefore, solid waste management is an important factor for maintenance of environmental hygiene and eco-friendly environment planning. The recent epidemics of Plague in Surat and Dengu fever in Delhi are also considered the result of improper Table 8.27

Urban solid waste class!fication and characteristics

Sl. No.

Waste

1.

Refuse

Source (a) Domestic

Characteristics Biodegradables (vegetables, food, oils etc.) Non-biodegradables (Packing, Polythene bags etc.) Combustible (textile, rubber) non-combustible (metals, glass etc.)

(b) Institutional

Combustible (papers, polythenes etc. metals)

(c) Market/commercial

Biodegradables, combustible

2.

Burning ash

Solid Fuel Burning

Generally inert

3.

Construction wastes

Construction/ demolition/ modification

Material or building material, generally inert

4.

Industrial wastes

Industries

Hazardous & non-hazardous

5.

Sewer sludge

Sewer cleaning

Biodegradable, inorganic

6.

Road

Road sweeping

Polythenes, waste paper, leaves, dust

7.

Clinical waste

Nursing homes/hospitals

Hazardous & toxic

8.

Agricultural waste

Crop yield

Organic, combustible, biodegradable

Fundamentals of Ecology

410 Table 8.28

Estimated quantity of waste generation in India

Waste

Quantity

Municipal solid waste (MSW)

27.4 million tons/year

Municipal liquid waste

12145 million litres/day

(121 Classes I & II cities) Distillery (243)

8057 kilo litres/day

Sugar cane, Press mud

9 million tons/year

Food & fruit processing waste

4.5 million tons/year

Willow dust

30,000 tons/year

disposal of urban solid waste. Tables 8.29 to 8.31 provide information on the municipal solid waste in metro cities in India and the composition of urban solid waste. Table 8.32 provides information of current disposal of municipal solid waste around the world.

A city of 8 to 10 lakh people generates around 400–500 tonnes Dairy industry waste 50-60 million litres/day of solid waste everyday (@ 400– Paper & pulp industry waste (300 mills) 1600 m3 waste/day 500 gms per person) and the city has a problem for its disposal. At Tannery (2000 nos.) 52500 m3 waste water/day least one third of the municipal solid waste keep lying on the streets. These wastes could be hazardous and can combine with many secondary wastes unless disposed of scientifically. Figure 8.12 shows the route of the effects of solid waste in the ecosystem. If the solid wastes are not cleared as soon as they are generated it can invite vectors of diseases like flies, mosquitoes and other insects, rats, fire because of the combustible nature of the wastes, bad odour, air and water pollution etc. Urban solid waste management The urban solid waste management is the sole responsibility of concerned Municipalities and Notified Area Councils (NACs). Due to various factors such as financial constraints, lack of manpower, inadequate collection of bins etc. the solid waste management in India has not been effective. The present management practice is only limited to collection and disposal in low-lying areas. Some percentage of total waste generated is transported for dumping, others littering around creating an unhygienic and insanitary condition. Table 8.29

Sl. No.

Average composition of urban solid waste in India

Description

Percentage By weight

1

Vegetable and leaves

40.15

2

Grass

3.8

3

Paper

0.8

4

Plastic

0.62

5

Glass, chemics

0.44

6

Metal

7

Stones, ashes

41.81

8

Miscellaneous

11.73

0.64

Source: CPCB, Parivesh Newsletter Volume 4(1), June, 1997.

The average solid waste composition of some Indian towns is summarized in Table 8.29. It may be seen from the table that vegetables and leaves constitute the major fraction of urban solid waste. The above table excludes clinical and industrial waste, which are not quantified. The general scenario of waste disposal in towns of India is shown in Table 8.30. The problem associated with the refuse are insects, rats, fire, odour, air and water pollution etc. causing long term and short term health risks. These are briefly described below; Insects Flies and insects live on garbage and become a transmission route to food or water and finally

Pollution Ecology

Table 8.30

411

Sourcewise composition of urban solid wastes

SI. No.

Category

Source

Percentage by weight

1

Domestic waste

Residential houses

2

Trade waste

Trades, shops, market, offices, institutions

31

3

Clinical waste

Hospitals, nursing homes

02

4

Other waste including industrial wastes

Drain silt, construction debris, street sweeping waste from industries

13

Table 8.31

54

Municipal solid wastes generation in metro cities in India

City Ahmedabad

Municipal1 population (TDP)

Municipal2 solid wastes

Per capita waste (kg/Day)

2,87,610

1,683

0.585

Bangalore

41,30,288

2,000

0.848

Bhopal

10,62,771

546

0.514

Calcutta

96,43,211

3,692

0.383

Chennai

47,52,974

3,124

0.657

8,16,321

350

0.429

Delhi

84,19,084

4,000

0.475

Hyderabad

40,98,734

1,566

0.382

Indore

10,91,674

350

0.321

Jaipur

14,58,483

580

0.398

Kanpur

18,74,409

1,200

0.640

6,70,009

347

0.518

Lucknow

16,19,115

1,010

0.623

Ludhiana

10,42,740

400

0.384

Mumbai

1,22,88,519

5,355

0.436

Madurai

9,40,989

370

0.392

Nagpur

Coimbatore

Kochi

16,24,752

443

0.273

Patna

9,17,243

330

0.360

Pune

22,44,196

700

0.312

Surat

14,98,817

900

0.600

Vadodara

10,31,346

400

0.389

Varanasi

10,30,863

412

0.400

7,52.037

300

0.400

Visakhapatnam 1. 1991 census 2. Tonnes Per Day (TPD)

Fundamentals of Ecology

412 Table 8.32

International figure on current disposal of MSW waste (%) Recycling

Waste combustion to produce energy

Landfill

Comment

24

11

65

Proposes to ban landfill of waste containing more than 5% organic by 2004.

Belgium

3

54

43

Aims to ban landfihling of combustible wastes.

Canada

29

4

67

Plans to reduce reliance on landfill.

Denmark

25

55

20

Banning landfill of combustible wastes Plans to increase recycling and waste combustion capacity.

Finland

30

4

66

Planning to increase co-combustion capacity to reduce reliance on landfill.

France

8

33

59

Banning the landfilling of combustible wastes by 2002. Expects by then to increase combustion capacity to 57% and recycling to 23%, landfill tax of E20/t currently applies.

18

36

46

Aims, to ban landfill of waste with greater than 3% carbon content by 2005.

5

74

21

Upgrading existing facilities for power generation.

The Netherlands

28

42

30

Has banned landfilling of combustible wastes.

Norway

14

18

68

Aims to ban landfilling of combustible wastes.

Sweden

19

47

34

Plans to further reduce reliance on landfill by increasing recycling and combustion capacities.

Switzerland

42

47

11

Proposes to ban landfilling of combustible wastes by 2000.

6

9

85

Landfill tax of E7/t. Recycling target of 25% by 2002 and recovery target of 40% by 2005.

24

15

61

No immediate changes foreseen.

Austria

Germany Japan

UK USA

Published in Renewable Energy World (July 98).

to human being, causing diseases such as bacillary dysentery, diarrhea etc. If night soil and uncovered sewage drains are adjacent, the disease route is wide open as the flies can travel up to 10 km. Refuse, dumped on land, results in infestation with fly eggs and larvae. The breeding of mosquitoes and their resting place in empty cans, jars and voids of garbage dump further make things worse. Rats The main source of food for rats and other small rodents are refuse and garbage. They quickly proliferate and spread to neighbouring houses. The diseases for which rat may be a reservoir, make a horrifying list: plague, murine typhus, leptospirosis, histoplasmosis, rat-bite fever, salmonellosis, tularemia, trichinosis and many other diseases (WHO Expert Committee, 1971). Fire Fire in garbage dumping area is known to continue for months, even years. Usually fire starts with objectionable practice of open burning of refuse. Fire can be triggered from the heat generated by organic decomposition or glass on an open tip acting as a lens for sunlight. The secondary effect of fire in refuse are many.

Æ Pollution Ecology

413

It causes air and water pollution and can convert inert wastes such as old tyres to toxic leachable materials. Odour The indiscriminate dumping of solid waste consisting of rotting vegetation dead animals and faecal matter generated characteristics objectionable odour. The unpleasant and unbearable stink arises from organic decomposition of most refuses releasing hydrogen sulphide and other organo-suiphur gases. Other effects on health Apart from diseases for which insects and rats are carries, the handling of refuse can cause illness to workers. A survey in India (Central Public Health Engineering Institute, 1973) showed that workers handling garbage are directly affected with roundworm and whip-worm. Atmospheric pollution When refuse is burnt in open, a pall of dense black smoke often covers the site and neighbourhood. Apart from particulate matter that constitutes the ‘smoke’, the gaseous emission from incomplete combustion may include sulphur dioxide, nitrous oxide, dioxins and various noxious gases. If PVC is a constituent of the refuse, the gases may include hydrogen chloride. Water pollution The run off from dump site during rain causes surface and ground water pollution. Waste organic exerts oxygen demand and pathogens can create health hazard in the downstream. If the water table is high and geological condition is favourable, the leaching from refuse dump contaminates the ground water. Environmental degradation Indiscriminate heaping of garbage is an eyesore for public. In a tourist place, such unaesthetic nuisance may reduce the number of visitors with resultant economic loss. Waste of resources Waste is no more complete waste, there are resources in the waste. The generation of huge quantity of refuse are thus considered to be wasteful use of resources. The unaccounted and uncontrolled use of resources results in generation of more waste.

The route of various adverse affect of urban solid waste is presented in Fig. 8.12. Source Classification of Wastes

The urban solid waste composition varies widely depending upon its source, locality and activities. According to the percentage of ingredients, it can be categorised as combustible wastes, which include paper, wood, textiles, rubbers, plastics, garden wastes etc. Non-combustible would include metals, glass, ceramics, stones, dirt etc. The sources of generation of municipal wastes in most of the towns are discussed below. Domestic wastes Everyone generates waste from food preparation and sweeping,

Fig. 8.12

Routes of effect of solid wastes (Source: Orissa State Pollution Control Board)

414

Fundamentals of Ecology

although the quantity and type of waste varies. The common ingredients of domestic waste are old paper, packings, bottles, crockery wastes, furnishing materials, garden wastes, vegetable waste etc. Commercial waste This category of wastes are generated from the business premises, shops and offices, godowns, market and departmental stores. Paper, packing materials, spoiled and discarded goods, organic and inorganic, constitute the major fraction of the waste. Vegetable and fish remnants, rich in biodegradable organics are generated from vegetable and fish markets. Institutional wastes Schools, colleges, research organisations, community halls, religious places generate this type of refuse. The major constituents are waste printer paper, polythene, rejected office stationaries etc. Burning ashes Ashes are residues of solid fuel burning of incineration of solid wastes. Wood, coke and coal are the main fuel for Indian household cooking. Though LPG is being used in more and more urban houses, it is considered to be expensive and not affordable by the weaker section of the society. Besides, other materials such as dried coconut shell, dung and garden debris, waste paper, which are otherwise treated as solid waste and used for heating purpose. As the road side small restaurants are mushrooming in urban areas in an unplanned way, the contribution of these restaurants to burning ash is considerable. Municipal garbage open burning also generates ashes. Construction wastes Demolition and construction activities generate huge quantity of solid waste. This includes bricks, roofing, piping, rods etc. Frequent digging of roads by telephone, electricity, water supply, drainage, works department generates considerable quantity of these debris. Animal wastes Khatals are evenly distributed in Indian towns and produce wastes in the form of dung, reject feed etc. This causes unpleasant odour and insanitary conditioning the surrounding area, if not disposed properly. Street sweeping Road cleaning by sweeping is a regular practice in towns. The quantity and composition of these waste varies seasonally and depend on the activities in the locality. These wastes mostly contain polythene, papers, leaves, sand etc. Sewer cleaning sludge Periodical or regular cleaning of open sewage drain and pipelines is carried out which generates sludge mostly consisting of organic, grit, sand, plastics etc. These are not removed in time and thus roads are narrowed down, create problems for traffic and unhygienic conditions. Offal, dead animal Stray animals like pigs, dogs and domestic animals after death are generally thrown out in the city garbage. Carcasses of dead animals are required to be removed and disposed off separately. A large quantity of offal waste are generated from municipal abattoir and also roadside killings, which consist of parts of bodies of goats, cows etc. Illegal butchering of animals, carried out in an extensive scale in public areas result in dumping of remnants in the surroundings. Industrial solid waste The small and cottage industries operating in the municipal residential areas and industrial estates do generate wastes, sometimes hazardous and toxic in nature. However, this is not considered as urban solid waste as its management required specific treatment, and is the responsibility of Pollution Control Boards. However, wastes of domestic and commercial nature generated from the canteen, office, staff quarters of the industries are often dumped with other garbage.

Pollution Ecology

415

Biomedical waste Wastes generated from hospitals, clinics, nursing homes are obviously hazardous and infectious unless treated carefully. Contaminated materials consist of surgical dressings of all kinds, after birth surplus and expired drugs, plastic disposable syringes. Agricultural solid waste Normally, crop residues and animal manure are returned to land. For examples, vegetables are grown in urban areas utilising sewage and sludge from storm water drain. The agricultural residues are mostly consisting of straw, vegetable remnants etc.

∑ ∑ ∑ ∑ ∑

Municipal conservancy staff collect waste from bins and transport to low-lying area for disposal. The sweeping wastes are burnt openly by roadside and garbage transport vehicles periodically transport the ash. Rag pickers collect recyclable materials such as glass, metal, polythenes and sell to kabadi wallah. Kabadi wallah stores these materials and sells it either to processor or trader. Scavengers such as pigs, street dogs, rats consume the garbage to some extent. Practically, the wastes litter around dumping sites, as there is no management of dumping places.

As revealed from the survey, the present management of urban solid waste is grossly inadequate and no organized disposal option is adopted. Some percentage of total waste generated, are only collected with the present network and taken for open dumping. The environmental condition of dumping area is unhygienic and insanitary. Shortcomings in the present practices of solid waste management

The management of urban solid wastes includes collection, storage and recovery of recyclable materials, transportation, treatment and disposal. The present practices and their shortcomings are discussed below: Collection The efficient collection network is one of the most important aspects of urban solid waste management. Presently, there is no organised door-to-door collection network. Community bins are provided to people in residential areas to throw the domestic wastes. As observed from the survey, the number of bins provided are inadequate and people are of the habit to throw their garbage in nearest open space, causing insanitary condition.

The solid waste collection in small hotels, bus-stand and recreational places are not organised. Slums do not have any collection system. The cow-dung disposal from khatals pose odour problem and many complaints are received. The rag pickers work in highly unhygienic condition. The road sweeper move to various areas in rotation and many a time, they burn it in open or dispose at the available nearest vacant land. It is observed that bins are generally overflows and litters are haphazardly spreaded, creating foul odour in the locality. Storage The collection bins practically work as intermittent storage points. Periodical lifting is done. Prolonged storage of garbage in bins causes unhygienic condition. In most of the urban local bodies, no storage facilities are developed. Practically, there is no concept of storage of refuse in most of the urban areas.

Fundamentals of Ecology

416

Transportation The refuses collected from the bins and road sweeping are transported through open trucks and tractors to disposal site. The frequency of transportation of wastes is controlled by the municipal authorities and varies from location to location, depending on the rate of generation. It is often seen that the frequency of transportation lacks the actual assessment and depend more on the availability of vehicles.

It has also been observed that the trucks and tractors are overloaded and the garbage spills and emits foul odour during transportation. Because of above reasons only 30–60% of the total wastes generated is actually transported to disposal site. Moreover, the drivers are tempted to off load the garbage at aailable vacant lands to minimise fuel consumption, as proper accounting of wastes is not done. Recycling As discussed earlier, the urban solid wastes contains materials such as glass, textiles, polythene, metal containers of economic value and can be recycled, if proper segregation is done. However, rag pickers, most of them women and children from the weaker section of the society, collect these reusable materials, from collection bins and disposal sites. Metals, glasses and waste papers are also procured from people by door-to-door approach. All these materials are sold to kabadi wallahs who in turn sell to the traders or reprocessing units.

The greatest shortcoming in this system is that majority of recyclable materials are not recovered. The quantity collected is about 50% of the total recyclable materials generated. Rag pickers are also exposed to highly unhygienic condition and suffer from health hazards. The storage of recyclable matrials by kabadi wallahs are generally done in slum and causes insanitary condition. The scraps generated from automobile garages and oily sludge from servicing stations remain unaccounted. Cleaning of dirty bottles and plastics by kabadi wallah causes water pollution. As the segregation of recyclable materials is not done systematically, it goes to the dumping sites. Disposal The greatest shortcoming in the management, ironically is the absence of organised disposal system. At present the refuse in most of the towns is disposed of in low-lying area or on vacant land. Other options of disposal such as incineration and composting is practically nil except in few areas. (Table 8.33). Though vermicomposting and composting are practiced in few urban bodies, they treat only very limited quantity of wastes. Table 8.33 1.

Methods of disposal

Incineration: Destruction of waste material by heat (850°C to 1100°C) application – reducing their harmful potential. It is burning of all combustible waste material and generation of energy.

Disadvantage

Factor Dependent

High capital cost

Moisture content

Skilled operation

Heating value

Fuel is required

Inorganic salt

Air and Water pollution

Content Sulphur and halogen

(Contd.)

Pollution Ecology

417

Table 8.33 (Contd.) Types of incinerators 1.

Open Burning

2.

Open PIT Incinerators

3.

Single Chamber

4.

Multiple Chamber

5. Teepee Burners

2.

6.

Controlled-air Incinerator

7.

Rotary Kiln Incinerator

Pyrolysis: Thermal process of treating solid waste. Process of destructive distillation of homogenous organic compounds (wood pulp) in waste in a closed vessel without oxygen supply. Organic mater conversion into - gases, liquid and inert char.

3.

Pulverisation: Quick and simple waste treatment method providing homogenous and less voluminous material. Application of high pressure and reducing volume of waste and increase of density of waste. Decreasing transport cost and the process is used to form bales of very light materials such as grass, paper etc. Bales are formed by press machine and wrapped in wire binding so that form is retained.

4.

Composting (Anaerobic, Aerobic and Vermicomposting) Pollution Abated, Manure Generated, Biogas Produced etc.

The disposal sites are usually identified without any detail survey such as geological, ground water table, surface water sources etc. The concept of leachate management is not at all considered.

Table 8.34 •

Besides, composting bio-methenation, peletisation and recently developed vermicomposting techniques can be utilised for disposal of organic solid waste.

8.5

Biodegradation of organic components by microbiological/earthworm techniques to produce manure

Options for improved management

Table 8.33 provides information on the methods of disposal and merits and demerits of land filling, open land dumping, incineration, pyrolysis, pulverization and bio-conversion of organic wastes. The most common method of disposed of organic solid waste is composting (Table 8.34).

Composting

Advantages •

Foul smell is quickly eliminated

•

Harmful pathogents are killed

•

Wastes become free from flies and insects

•

Weed seeds are destroyed

•

Retains maximum nutrient content (N, P & K)

•

Minimise gas formation like methane, H2S, NH3 - minimise possible fire, smoke hazard

•

Recyclable materials recovered

HAZARDOUS WASTE AND TOXIC CHEMICALS

Hazardous waste connotes as “corrosive, ignitable, reactive or toxic or capable of posing substantial threats to human health and the environment and are to be treated separately from all over wastes”. This definition has been given by the US Federal Resources Conservation and Recovery Act, 1976.

Fundamentals of Ecology

418

Hazardous Waste (Management and Handling) Rules, 1989 of the MoEF. The Government of India states ‘Hazardous Wastes’ are category of wastes specified in its schedule. International consensus for a comprehensive definition and system of classification of hazardous waste has not been reached. It is often difficult to distinguish between hazardous waste and a toxic chemical. The characteristics of hazardous wastes can be as follows: 1. Ignitability: catches fire easily. 2. Reactivity: reacts strongly with water and can explore on reactions with other chemicals. 3. Corrosiveness: it can be corrosive and weans away other materials. 4. Toxicity: these wastes can be toxic to living systems producing symptoms of metabolic disorders, poisoning, disease, cancer and mutations. 5. Radioactivity: these wastes may release ionising radiation. Hazardous wastes are chemical bio-products of an industry, or a factory or a chemical plant. These types of wastes may also arise from hospitals and research laboratories. The nuclear and chemical weapons used in wars may create hazardous wastes. Although toxic and hazardous wastes are used interchangeable but they are different. Toxic is defined as the capacity of a substance to cause injury, if it enters the metabolic process of an animal, a plant, or a human being and the changes caused may be pathogenic causing disease, mutagenic (bringing out mutations), teratogenic or carcinogenic. The term hazardous denotes potential of a substance to pose threat to living systems or substances which can create threat to life by means of their toxicity, corrosiveness, ignitability, reactivity and radioactivity. In view of this the term hazardous is broader and also includes toxic wastes. Table 8.35 provides information on sources of generation of hazardous wastes. Table 8.35 SI. No.

Sources and generation of hazardous wastes Source

Activity

01.

Coal Industry

Production of coal and coal products—coal ash is not considered hazardous. Coal ash contains hazardous metal like lead, copper, zinc, chromium, nickel, selenium, barium, antimony, mercury, arsenic, thallium and cadmium. However the concentration is low and is of same order as in soil. But coal ash also contains radioactive material but the core level is similar to that of other building construction materials. Hence coal ash is taken as only solid waste.

02.

Petroleum industry

Extraction of petroleum and natural gas, petroleum refining

03.

Metallurgical industry

Mining and benefication of ores, extraction of metals from ores.

04.

Electroplating industry

Metal finishing operations, manufacture of mirrors.

05.

Chemical industry

Production of primary organic and inorganic chemicals, pesticides, drugs, detergents and other chemicals.

06.

Paints and related industries

Production of inks, varnish, paints, glues photographic products, rubber, plastic perfumes, explosives etc.

07.

Leather industry

Tanning of leather dyes and dye intermediates.

08.

Textile industry

Laundering, bleaching and cloth dyeing.

(Contd.)

Pollution Ecology

419

Table 8.33 (Contd.) 09.

Automobile industry

Servicing and repairs of automobile engines.

10.

Hospitals

Medical service aid to outdoor patients, sterilisation of instruments, radiotherapy, medical wastes like amputed organs, blood, pus etc.

11.

Laboratories

Research and analysis of old chemicals/materials, discovery of new chemicals etc.

12.

Fuel regeneration industries

Regeneration and recovery of radioactive wastes.

13.

Household activities

Household activities, cooking, laundering.

14.

Pollution control facilities

Residues from pollution control operations (incineration etc.)

For waste minimisation one has to consider (1) industrial process modification, (2) waste concentration, and (3) waste segregation. Hazardous waste management

1. 2. 3. 4.

Hazardous wastes can be managed by the following ways:

Minimising the quantity of wastes. Treatment of the waste before disposal. Recycling of industrial wastes. Collection, transport and disposal of wastes in a scientific manner, which is environmentally sound i.e. secured land filling with impervious lining etc. (Fig. 8.13)

1. Minimising the quantity of wastes The industrial process can be altered in such a way that the

utilisation of the raw material is optimisd and the hazardous waste generated is reduced to minimum. For examples in zinc electroplating, the chloride compound can change sulphate salt with some modification in the process, so that the cyanide problem is eliminated. Wastes can be concentrated using evaporation, precipitation or decapitation techniques. In these processes the volume of the wastes is considerable reduced. Incineration (control high temperature burning) is often practised for waste disposal. Segregation of hazardous wastes from non-hazardous wastes also decreases the volume of waste. 2. Treatment of the waste before disposal

Treatment of hazardous wastes is very important and it may involve (i) physical treatment, (ii) chemical treatment, (iii) solidification, (iv) incineration, and (v) biological treatment. The waste containing hazardous chemicals must be detoxified and neutralise through treatment. Selection of the treatment process will depend upon physicochemical property of the waste. The physical treatment may include phase separation like lagooning, prolonged storage in tanks and sludge drying in beds. These methods help in separating particulate pollutants. Chemical treatment facilitates complete breakdown of hazardous waste and neutralises acidic or alkalinity. This involves oxidation, chemical reduction, heavy metal precipitation, oil/water separation etc. Solidification is utilised to convert the liquid waste into insoluble material so that it can be used for land feeling. This process immobilizes hazardous components. Incineration is also a method of detoxification. Incineration is done in a closed system under high temperature. Biological treatment, particularly for the treatment of sewage includes conditioning, digestion, composting, thickening, dewatering and solidification. For conditioning, the sludge is exposed to air, for a stipulated period to

420

Fig. 8.13

Fundamentals of Ecology

General layout plan for landfill site

get a desired consistency. The sludge is then treated with bacteria in the process of digestion and thus long chain chemical compounds are broken down into the simpler ones. The organic matter in the waste sludge can be converted to compost through composting processes including vermi-composting. Collection, transportation and disposal are multiface activities. Safe collection and transport of hazardous wastes is very important and all precautions are to be taken for these processes. Under Environmental Protection Act-1986, Hazardous Waste Management Act has

Pollution Ecology

421

been promulgated in 1989 by the Government of India, which stipulates the detail procedure for safe collection, transport, treatment, and disposal of hazardous wastes. Disposal of hazardous wastes wastes generated in India. Table 8.36 SI. No.

Table 8.36 provides the list of some of the common hazardous

Common hazardous wastes Types of wastes

SI. No.

Types of wastes

01.

Cyanide and fluoride waste

17.

Oily waste

02.

Acidic and cyanide

18.

Oily and alkaline sludge

03.

Metal finishing waste

19.

Oily and acidic sludge

04.

Waste containing chromium, lead, zinc, barium

20.

Oily and spent chemicals

05.

Sludge containing spent chemicals and water soluble chromium, lead, zinc etc.

21.

Tarry waste

06.

Rejected nickel catalyst containing oil

22.

Sludge containing spent chemicals

07.

Alkaline sludge containing heavy metals

23.

Alkaline spent chemicals

08.

Acidic sludge containing heavy metals

24.

Acidic spent chemicals, heavy metals

09.

Mercury bearing waste.

25.

Phenolic waste containing spent chemicals, tarry, toxic organic.

10.

Alkaline and mercury bearing waste.

26.

Phenolic wastes

11.

Acidic and mercury bearing

27.

Asbestos waste

12.

Contain oil and heavy metals

28.

Alkaline sludge

13.

Pigment wastes

29.

Acidic

14.

Acidic and pigment waste

30.

Off specification products

15.

Dye waste

31.

Discarded containers

16.

Dye and spent chemicals

32.

Acidic, tarry, cyanide, phenol

Many countries use land filling method for disposal or hazardous wastes. Open land filling or open dumps create health hazards. Sanitary land feeling does not cause damage to the environment much. In this process the wastes after treatment are packed and dumped at the site and covered with earth. By covering with earth the waste is not open to insects and rodents. The land filling site usually consists of an artificial impervious double liner at the bottom and cover at the top. Deep wells are dug at suitable sites to monitor ground water quality or leachets periodically. Figure 8.13 shows the outlines of a tropical land filling process. The practice of dumping of wastes at sea is now discontinued because of the inherent quality of the wastes to pollute water and threat to fauna and flora. Biomedical waste The Ministry of Environment and Forest, Govt. of India in their 27th July, 1998 notification have stated that the Biomedical Waste Rules. (Management and Handling) have come into force on July 27, 1998. Any Institutions like hospitals, nursing homes, clinic, dispenaries, engineering institutions, animal houses, blood banks, pathological laboratories etc. generating biomedical wastes

Fundamentals of Ecology

422

should ensure proper handling and management of such wastes, so that they do not create health hazards and pollution. What are the biomedical wastes? Human anatomical wastes, discarded medicines and psycho toxic drugs, blood, pus, liquid and chemical wastes associated with medical operations, treatment, pathological investigations etc. waste sharps, animal wastes, microbiological and biotechnological wastes etc. are called biomedical wastes. Biomedical waste defined Biomedical waste would mean any solid fluid or liquid waste including its containers and any intermediate product which is generated during diagnosis, treatment or immunisation of human being/animals or in production and testing of biologicals including the wasted categorised in Table 8.28. The provisions of the rules have specially dealt with various aspects provide information about the biomedical waste classification, treatment and disposal methods. These rules also prescribe that incineration should be done for discarded medicines, scientific toxic drugs, human anatomical wastes etc. and the standards for incinerators should be as follows: 1. Combustion efficiency (CE) shall be at least 99%. The combustion efficiency is defined as

CE = 2. 3.

% CO 2 ¥ 100 % CO 2 + % CO

The temperature of the primary chamber in the incinerator shall be 750–800°C. The secondary chambers of the incinerator gas respond time shall be at least one second at 1000–1100°C with minimum 3% oxygen with stack gas. 4. The emissions standards have been prescribed as follows: Parameter Concentration mg/Nm3(at 12% CO2 correction) (a) Particulate matter 150 450 (b) NOx (c) HC1 50 5. Volatile organic compounds in ash shall not be more than 0.01%. 6. The minimum stack height shall be 30 m above ground. 7. Waste to be incinerated shall not be chemically treated with any chlorinated disinfectants. 8. Chlorinated plastics shall not be incinerated. 9. Toxic metals in the incineration ash shall be within the regulatory quantities under Hazardous Waste Management and Handling Rules 1989. 10. Only low sulphur fuel shaLl be used in the incinerator. The effluent generated from the hospitals etc. should confirm the following limits. Parameter Permissible Limits (a) pH 6.5–9.6 (b) Suspended solid 100 mg/L (c) Oil and grease 10 mg/L (d) BOD 30 mg/L (e) COD 250 mg/L (f) Bio-assay test 90% survival of fish after 96 hours in - 100% effluent. This is subjected to the conditions notified under the Environment Protection Act, 1986. (Tables 8.37A & B)

Biomedical wastes and recommended treatment options

Waste description

Wastes consisting of anatomical human tissues, organs, waste body parts, body fluids, blood and blood products and items saturated or dripping with blood, body fluids removed during/after treatment, surgery or autopsy or other medical procedures.

Wastes consisting of animal tissues, organs, body parts, caracasses, bleeding, fluid blood and blood products, items contamicated with blood and fluids, wastes from surgery treatment and autopsy and wastes of experimental animals used in research, waste generated by veterinary hospitals, colleges, animal houses and livestock farms.

Wastes from laboratory culture stocks or specimens of micro-organisms, live or attenuated vaccines, human and animal cell culture used in research and infectious agents from research and industrial laboratories, waste from production of biological dishes and devices used for transfer of cultures.

Wastes consisting of sharps, such as needles, scalpel, blades etc. which include both used and unused sharps.

Wastes containing highly infectious living and non-living pathogens.

Biological wastes from discarded material contaminated with blood exertion exudates or secretion from human and animals isolated due to communicable disease.

Waste comprising expired contaminated and discarded medicines.

Wastes generated from glasswares and glass equipment used.

Wastes generated from soiled cotton, dressing, beddings etc.

Wastes generated from disposable items other than the waste sharps

Wastes generated from activities involving genetically engineered organisms or products and their cultures not declared to be safe.

Ash generation from incineration of any biomedical waste.

Wastes generated from laboratory and washing, cleaning, kitchen house keeping and disinfection of the premises.

Table 8.37 A

Class

Human anatomical wastes, and body fluids

Animal waste

Microbiological wastes

Waste sharps

Highly infectious wastes

Isolated wastes

Discarded medicines

Discarded glasswares

Soiled wastes

Disposable (PVC/plastics, cardboard and thermocol)

Biotechnology wastes

Incineration wastes

Liquid wastes

Effluent treatment prior to disposal

Secured landfill as per Hazardous Waste (Management & Handling) Rules, 1989.

Incineration

Chemical disinfection/autoclaving followed by shredding.

Incineration

Chemical disinfectionlautoclaving followed by shredding.

To be sent back to the manufacturers for safe disposal.

Incineration

Incineration

Chemical disinfection/autoclaving followed by shredding.

Incineration

Incineration

Incineration

Treatment method

Pollution Ecology

423

Fundamentals of Ecology

424 Table 8.37 B

Collection, type of containers and recommended colour codings. The biomedical waste is to be properly seggregated, collected and packed for adequate disposal.

Sl. No.

Waste class

Type of containers

1.

Human anatomical waste, blood and body fluids, animal waste, microbiological waste, highly infectious waste, isolated waste, soiled waste, biotechnology waste.

Single use container/polythene holding bags.

Red

Incineration

2.

Waste sharp

Reusable sturdy polythene/metal

Blue

Disinfection/autoclaving followed by shredding/crushing

3.

Discarded glasswares

Reusable sturdy polythene/metal

White

Disinfection/autoclaving followed by shredding/crushing

4.

Disposable (PVC/ plastics, cardborads and thermocol)

Reusable sturdy polythene/metal

Green

Disinfection/autoclaving followed by shredding/crushing

5.

Incineration waste

Reusable sturdy polythene/metal

Black

Landfilling in secured landfill

8.6

Colour coding

Treatment method

SOIL POLUTION

Soil is a very important resource as it is the substrate where plants grow. In recent times the pollution of soil in rural, urban and industrial areas has become a serious problem. In croplands, some unwanted plants called weeds grow and compete with the crop plants for getting nutrients from the soil. To kill these weeds copper sulphate is usually sprayed with bordeaux mixutre. Sodium chlorate and arsenic compounds are also used. These poisonous substances not only pollute the soil, but are harmful to the beneficial organisms of the soil, and dangerous to wild life and man. Areas treated with arsenic compounds cannot be planted for a long time. Nowadays, many herbicides are used to get rid of weeds. Some of these are DNOC (dinitro compounds), hormone weed killers such as MCPA, and allied substances like simazine, 2, 4-D, and Monuron, a long- lasting synthetic organic herbicide, Dalapon, paraquat, and so on. Long-lasting herbicides remain for a long time in the soil, affecting the activities of soil organisms and creating problems for wild life and man. For the control of fungal pests, fungicides are sprayed on plants. Some of these are sulphur and orgnomercury compounds. These poisons get incorporated into the soil, since some of them are washed in with the rain. They also. get incorporated into the food chain and create serious problems for fish, birds, and mammals. We have already disussed pollution by insecticides like DDT, BHC, aldrin and dieldrin. These insecticides also pollute the soil through rain. They are broken down in the soil but many of them are not easily acted upon by bacteria and fungi and hence take a very long time to decompose. The target organisms of these pesticides are insect pests and fungal pests. But some non-target beneficial organisms, such as earthworms and symbiotic bacteria, are adversely affected. Earthworms, in general, are beneficial organisms, as they play a vital role in soil turnover, aeration, decomposition, fertility, cycling of matter, and so on (Dash, 1978, Dash and Patra, 1977, 1979, Senapati

Pollution Ecology

425

and Dash, 1984, Mishra and Dash, 1984). Many pesticides (organophosphate insecticides) may not kill earthworms directly but they do affect their reproduction (Patnaik and Dash, 1990). The organophosphorus compounds, which are highly toxic, include fonofos, phorate, phenyl phosphorothicate and some others. All the carbamates which have so far been tested seem to be toxic to earthworms. They include carbaryl, carbofuran, benomyl and mildothane. Nematicides like sodium methyl bromide, oxamyl and phenamiphos are toxic to earthworms (Edwards and Lofty, 1972). Besides their role in agriculture, soil fertility and vermitechnology, earthworms have immense importance in the food chain since they serve, as the major food source for some insects, amphibians are birds. Hence poisonous chemicals enter the food chain through them. Some workers have reported large residues of organochlorine insecticide in earthworm tissue. Pesticides also affect soil decomposition and metabolism and pesticide application affects soil enzymes activity and CO2 evolution. In many parts of India, thousands of people pollute the soil through their excreta (night soil) and other wastes. In industrial areas, heavy metals, plastics, and persistent organic compounds are major sources of soil pollution. Toilet facilities should be provided in village areas, and people should be educated about the harmful effects of open latrines. According to the statistics given by the World Health Organisation and United Nations’ Children’s Fund, some 15 million children in developing countries die every year before they reach the age of five, partly due to the absence of sanitation facilities. The threat mainly comes from human waste and animal excreta that are infected with the germs of cholera and typhoid fever. Since soil is extremely precious and vital to the survival of mankind, all care should be taken to protect it from pollution and degradation.

8.7

DRUG ABUSE

Of late, hundreds of chemicals and drugs have become freely available in the market. Benzodiazepine tranquilisers are now commonly precribed drugs and the extent of their abuse has been increasing everywhere. Nobody knows the types of side effects these drugs produce and their seriousness. The genotoxic effect of tranquilisers in mice has been studied by Kar and Das (1979, 1981, 1987) and Das and Kar (1986) and in man by Stenchever and Frankel (1969) and Stenchever et al. (1970 a and b). Wyrobek and Bruce (1975) have compared the abnormal sperm producing action of 25 chemicals with their clastogenic, carcinogenic and tetragenic activities in mice. In summary, they observed significant chromosomal aberrations and found a significantly higher incidence of micronuclei in the bone marrow cells due to clastogenic and spindle poisoning effects. They also observed sperm-head and meiotic chromosome abnormalities. Evidently, adequate biological screening needs to be done before marketing a drug or a chemical.

8.8

NOISE POLLUTION

What is noise? Noise is an unwanted, irregular, unpleasant and annoying sound, which is caused by the vibration of matter. These vibrations are transmitted in a continuous material medium as waves. These material waves are received by the human ear Fig. 8.14 and interpreted by the brain as sound signals. The brain is able to scan different types of sound signals. The term noise is also used in electronics and

Fundamentals of Ecology

426

Fig. 8.14 A

The main parts of the ear

Fig. 8.14 B

Sectional drawing 01 cochlea showing the two longitudinal canals separated by the basilar membrane

Fig. 8.14 C

Cross-section of a part of cochlea showing the basilar membrane with the sensitive hair cells (1) and the nerve fibres (2)

communication science where it refers to perturbations that interfere with communication. Such noise increases with the complexity and information contet of systems of all kinds. Thus man faces a growing problem with electronic pollution as radio communication intensifies.

Pollution Ecology

Table 8.38

Relationship between sound pressure and intensity

Sound pressure (N/m2)

Intensity (W/m2)

–5

10

–4

10

–3

10

–2

10

2 ¥ 10 2 ¥ 10 2 ¥ 10

2 ¥ 10

–12

0

–10

20

–8

40

–6

60

–1

10

0

10

2 ¥ 10

2 ¥ 10

1

Table 8.39

–4

80

–2

100

10

2 ¥ 10

Intensity level [(decibels-dB (A)]

120

Typical examples of noise level

Source Faintest audible sound

Noise [(dB (A)] 0

Human heart beat

13

Chewing gum

20

Turning newspaper

30

Typing

40

Average city residence

45

Barking of a dog

66

Average city street

73

Average motor truck

80

427

The unit of measurement of sound is decibel, which is relative unit of measurement based on the logarithm of the ratio of sound intensity to a reference level, arbitrarily established as a sound pressure of 0.0002 microbars (on microbar = 1 dyne/cm2 = 10–16 atmospheric pressure) which is considered to be an intensity level just audible to man. A hundred times increase of sound intensity, the noise level in decibel scale increases only by 20 units. Table 8.39 gives a few examples of typical noise levels. The loudest noise intensity experienced in a natural phenomenon is believed to be during the volcanic eruption of Krakatoa (Indonesia) in August, 1983 probably of intensity 190 in decibel scale. Sound level distribution At any place the sound level is not always constant. It varies from time to time. The weighted average sound level over the time of measurement is written as Leq. Sound level distribution at any place over the time of measurement is generally expressed as the percentile exceeding level. Some examples are as follows.

L10 (ten percentile exceeding level) is the level of sound which exceeded 10% of the total Painful limit to ear (“boiling” point) 120 time. L50 (fifty percentile exceeding level) is the level of sound which exceeded 50% of the total time. L90 (ninety percentile exceeding level) is the level of sound which is exceeded 90% of the total time. The area of human hearing extends in frequency from 20 to 20,000 cycles per second and in intensity from zero to 130 decibels. On this scale, the faintest audible sound is zero decibel. Chewing gum produces a sound of 20 decibels, which is about 100 times louder than the faintest audible sound. Typing produces a sound about 40 decibels. Sounds of intensity ranging from zero to 100 decibels are considered pleasant but a sound intensity of 120 decibels or higher causes physical discomfort and is classified as noise. Thus 130 decibels is the upper limit of the threshold of hearing. Beyond this, physical damage to the ear may occur. Ordinary conversation registers about 30 to 60 decibels. A telephone sound registers 70 decibels. A motorcyle registers about 110 to 120 decibels. A siren registers about 130–150 decibels and a jet plane on take off may produce about 160 or more decibels. People begin to complain when unwanted sound reaches about 100 decibels. Noise can be measured by a sound level meter (Fig. 8.15). Niagara fall/roaring of lion

93

Fundamentals of Ecology

428

Types of noise Noise pollution is of three types, (a) industrial, (b) traf5 6 3 4 1 2 fic, and (c) community noise. Major industries run with heavy machinery 7 which are usually lodged in compact 1. Microphone 2. Preamplifier 3. Weighting network places to save space and money. Such 6. Display meter 4. Amplifier 7. Output jack 5. Rectifier a compact space intensifies the sound effect of running machines. Persons Fig. 8.15 Basic parts of a sound level meter working there are constantly exposed to high levels of noise. In urban areas, trucks, buses, cars and aeroplanes produce noise. Community noises also occur at various functions, such as festivals, marriages, meetings, political and religious gatherings, and so on. Schools, libraries, study centres, and hospitals are the worst victims of such noise. Ambient noise standards The Government of India in the Ministry of Environment have notified under Environment (Protection) Rules, 1986, Ambient Noise Standards for different areas (Table 8.40). The standards are based on Indian situation and permissible noise limits in other countries of the world. Table 8.40

Ambient air quality standards in respect of noise (Notfied under Environment (Protection) Act, 1986)

Area code lew

Category area

Limits in dB (A) day time

night time

(A)

Industrial area

75

70

(B)

Commercial area

65

55

(C)

Residential area

55

45

(D)

Silence zone

50

40

Note: 1. Day time is reckoned in between 6 am to 9 pm.

Table 8.41

Average ambient noise levels (leq) in different cities (parameters in dB (A))

SI. cities No.

Residential area day/night

Commercial area day/night

Silence zone day/night

Industrial area day/night

55/45

65/55

50/40

75/70

Indian ambient Noise standards 1. Delhi

60

71

65

73

2. Calcutta

79/65

82/75

79/65

78/67

3. Mumbai

70/62

75/66

66/52

76/65

4. Madras

66/48

78/71

63/49

71/66

5. Bangalore

67/50

78/53

67

76/57

6. Hyderabad

65/46

76/65

70/56

70/56

7. Kanpur

60/52

79/68

54/42

70/61

8. Jaipur

66/54

77/72

71/60

69/63

9. Bhubaneswar

65/56

70

46

64

Source: Reports of Central Pollution Control Board & Orissa Pollution Control Board.

Pollution Ecology

Table 8.42

429

Behaviourial effects of noise

Noise dB(A)

Observed Effects

0

Threshold audibility

100

Significant change in pulse rate

110

Stimulation of reception in skin

120 130-135

Pain thereshold Nausea, vomiting, dizziness, interference with touch and muscle sense

140

Pain in ear, prolonged exposure can cause insanity

150

Prolonged exposure causing burning of skin.

160

Minor permanent damage if prolonged.

190

Major permanent damage in a short time.

Noise pollution is different from other types of pollution since it does not leave any residue in the environment. But it creates nervous disorders, brain damage, etc. in persons who are constantly exposed to it for a considerable time. Loss of hearing is a common disorder. In noisy surroundings, work efficiency is reduced and sleep is severely affected. This leads to ailments of the stomach and brain. Control of noise pollution Plants are efficient absorbers of noise, especially noise of high frequency. A dense evergreen hedge can reduce the noise of microphones by up to 20 decibels. Hence, plantations on both sides of streets or highways are effective in curbing noise. In urban areas, a green vegetation belt and open space in general may work as a safety device for bringing down the noise level.

Steps should be taken to reduce the noise at the source of production as far as technically possible. Industrial areas, aerodromes and highways should be located outside city limits. The area near the airport may be zoned so that no one is allowed to build a house or factory in close proximity to it. A green vegetation belt of short to medium height around the airport may be a good idea. Adequate laws should be enacted to restrict excessive noise from transportation and microphones, particularly during sleeping hours, in the vicinity of hospitals, educational institutions and residential areas. Public awareness needs to be created through newspapers, radio and television.

Fig. 8.16

Percentage of workers with hearing impairment (average hearing loss at 1, 2 and 3 kHz 25 dB) (From . US National Institute for Occupational Safety and Health, 1972, 1973).d d d d d d d d d d d d d

Fundamentals of Ecology

430

8.9

INDOOR POLLUTION

Pollution inside houses has not received much attention. With the modem living conditions, man has introduced pollutants inside the houses and their effects have not been assessed fully. The source of indoor pollution can be listed as follows: 1. Randon (from tube light). 2. NOx gases from cooking gas, combustion of appliances, butane gas, and kerosene heater. 3. Carbon monoxide. 4. Tobacco smokes. 5. Formaldehyde. 6. Volatile organic compounds from furniture, pressed wood floorings, carpet, adhesive building material, cosmetics, cleaning agents, tobacco smoke, solvent based paints etc. 7. Chlorinated organic compounds. 8. Particulate matter. 9. Cat and dog allergens. 10. Fungi and fungal spores. 11. Bacteria and bacterial spores. 12. Asbestos fibres. These pollutant are potential health hazards. The kitchen should have an exhaust fan. The toilet room should always remain dry and clean. Living in a clean environment and maintenance of personal hygiene are important.

8.10

POLLUTION DUE TO RADIATION

Since the first atom bombs were dropped on Hiroshima and Nagasaki in Japan in 1945, man has become aware of the dangers of atomic radiation. Atomic radiations are of three types, namely (a) alpha particles, (b) beta particles and (c) gamma rays. These radiations are invisible and penetrate living tissue to a lesser of greater extent. Some are stopped by the skin while others can penetrate deeper into the body (Fig. 8.17). Alpha particles are positively charged helium nuclei and can be stopped by a thickness of a fraction of an inch, but they produce ionisation. Beta particles are electrons and exhibit greater penetration but less ionisation. They can be deflected by electric and magnetic fields. Gamma rays are highly penetrating electromagnetic radiation and are not deflected by electrical or magnetic fields. The energy content of these rays is sufficient to break the chemical bonds of molecules, producing high-energy free radicals. Thus all such forms of radiation have more or less similar chemical and biological effects. Since all of them generate free radicals in the living body which may react with other compounds, they may disrupt the activity of a living cell. Radiation is measured in units of rad, which is equivalent to the absorption of enough radiation in any form to liberate 100 ergs of energy per gram of absorbing material. A person exposed to 1,000 rads will die within a week. Natural background exposure amounts to 0.1 rads or one hundred millirads per year. This dose is considered safe. An exposure to a dose of 50 rads may cause cancer or sterility. Radiation effects are cumulative and the damage is usually irreparable. The effect of 50 rads expossure in one year

Pollution Ecology

Fig. 8.17

The nature of alpha, beta and gamma radiatio,s in relation to the organism

431

Fundamentals of Ecology

432

is approximately similar to that of 5 rads exposure continued for 10 years. Nuclear radiation is extremely harmful as it can change the genetic make up of organisms and cause mutations. The occurrence of damage due to radiation in the skin, lymphoid tissue, and bone marrow is common. However, radiation in controlled doses can cure many diseases and is used as a diagnostic tool in the medical and biological sciences. It has been estimated that one-fifth of the Japanese casualties after the explosion of atom bombs were due to radiation and four-fifths due to the force of the explosion. However, even people who lived far away from the site of bombing were affected. Some died after days, weeks, months or years, while some were unharmed. People appeared to suffer from many types of diseases, including genetic ones. At the ecosystem level, radiation can damage vegetation and contaminate the entire ecosystem. Environmental pollution due to nuclear radiation is increasing very rapidly due to the proliferation of nuclear power plants, which produce a large quantity of nuclear waste. This waste remains radioactive for a long time. No satisfactory method has yet been developed to store radioactive material over long periods, without risk of leakage. Radioactive waste may remain active for thousands of years. Industrially developed countries produce these wastes in high quantities and often dump them in the sea in closed containers. If a nuclear explosion occurs in the atmosphere, the radioactive particles are carried to great distances by air currents and ultimately settle on vegetation, soil and water. They get incorporated into the food chain and create a very dangerous situation. Fission fragments, such as strontium-90, have a half-life of 28 years. Strontium-90 shows a chemical similarity with calcium and when it becomes concentrated in calcium-rich cow milk, produces health hazards for children. Caesium-137 has a halflife of 30 years (Table 8.43) and emits gamma rays. It can cause irrepairable damage to all life forms. Plutonium 239 remains in the biosphere for 200,000 years before it loses its radioactivity. Table 8.43

Half-life and nature of radiation of radioactive elements Isotope

Half-life

Radiation

Uranium-235

7 ¥ 10 years

Alpha and gamma

Uranium-238

4.5 ¥ 109 years

Alpha

Radium-226

1,620 years

Alpha and gamma

Potassium-40

1.3 ¥ 109 years

Beta and gamma

Carbon-14

5,568 years

Beta

8

Calcium-45

160 days

Beta

Iodine-131

8 days

Beta and gamma

Iron-59

45 days

Beta and gamma

Phosphorus-32

14.5 days

Beta

Potassium-42

12.4 hours

Beta and gamma

Sodium-22

2.6 years

Beta and gamma

Sodium-24

15.1 hours

Beta and gamma

Strontium-90

28 years

Beta

Strontium-89

53 days

Beta

Cesium-137

33 years

Beta and gamma

Cesium-134

2.3 years

Beta and gamma

Barium-137

2.6 minutes

Beta and gamma

Plutonium-239

2.4 ¥ 104 years

Alpha and gamma

Pollution Ecology

8.11

433

BIOINDICATORS

While discussing the use of the Shannon and Wiener index of diversity and Simpson’s index of dominance in the second chapter of this book, we observed that biological diversity and dominance analysis are very helpful in judging the effect of pollution stress on the ecosystem. For convenience, we often monitor environmental quality by a periodic physicochemical analysis of environmental factors. By doing so, we usually overlook the role of organisms under such environmental conditions, although the best possible monitors of desired enironmental quality are the living organisms themselves. Each organism is a product of the conditions under which it grows and is therefore a measure of the environment. Each species has its own requirement of environmental conditions for carrying out activities. The dominant species are the most important indicators of habitat conditions, because they receive the full impact of the environmental gradients of that habitat from season to season and year to year. Plant species which are regarded as portraying the habitat character are called plant indicators. The dominant species which contribute to the climax, bear its characteristics in the corresponding life form. Thus each community serves as an indicator of a factor or group of environmental factors. For example, the presence of phragmites (salt grass) indicates that the water table is near the soil surface, while Prosopis is an indicator of a deep water table (Bharucha, 1983). Cassia tora and other Cassia sp. are indicative of disturbed soils and plants of Polygonum and Cyperus indicate the presence of seral communities. Thus individual organisms can be an indicator species of very specific conditions in the environment while the community itself can indicate gross environmental conditions. The concept of indicator species has considerable practical importance in ecology. In Chapter 1, we discussed different aspects of the tolerance limits of organisms and the concept of steno and euryspecies. Some species are very sensitive to minor changes in the environmental conditions while some others are more tolerant. It is possible to identify these sensitive and resistant species for many environmental gradients and many pollutants. On the basis of the presence or absence of some species, it is possible to know the type of pollution prevailing in a particular area. Both plants and animals have been used as biological indicators of pollution. However, the concept of plant indicator species is much older than that of animal indicator species. The literature on indicator species and pollution is of recent origin. One of the earliest publications was by Thomas (1961), who dealt with the effects of air pollution on plants. Lichens were found to be indicators of atmospheric pollution (Gilbert, 1965, De Sloover and Le Blane, 1968) and were used for mapping atmospheric pollution. Since then hundreds of research papers have come out on the subject. In India, a useful publication is that of Zafar et al. (1982). Rao (1979) found that the sensitivity and tolerance of plants to SO2 pollution in air were strongly correlated to the ascorbic acid content in the leaves. Leaves with a higher concentration of ascorbic acid were highly tolerant to SO2 pollution while those with zero to negligible content of ascorbic acid were most sensitive. Dadhichi (1982) has given a list of air pollutant indicators in tropical and temperate regions. Varshney (1982) and Ambasht (1982) have independently analysed the role of macrophytes and algae as indicators of the eutrophication of water bodies. Zutshi (1982), Venkateswarlu (1982), Kar et al. (1987), and Palharya and Malviya (1988) have found some phytoplankton and algae to be indicators of water pollution. Mahajan (1982) has found some zooplankton to be indicators of water pollution. Some of these data are summarised in Tables 8.44–8.46.

Fundamentals of Ecology

434

Table 8.44

Bioindicators of SO2 pollution in the atmosphere

Sensitive plants

Resistant plants

Alfalfa (Medicago sativa)

Kadamb (Anthocephalus cadamba)

Mango (mangfera indica)

Banyan (Ficus bengalensis)

Lichen-mosses

Tulsi (Ocimum sanctum)

Nerium odorum

Ber (Zizyphus mauritiana)

Apple (Pyrus malus)

Guava (Psidium guajava)

Wheat (Triticum restivum)

Santra (Citrus maxima)

Cotton (Gossypium herbaceum)

Phyllanthes distichus

Barley (Hordeum vulgare)

Pithecollobium dulce Corn (Zea mays) Potato (Solanum tuberosum) Onion (Allium cepa)

*Zafar et al. (1982) and other sources

8.12

INDUSTRIAL ACCIDENTS

Table 8.32 provide information a list of some industrial accidents leading to serious environmental pollution and death of people. Some accidents have occurred very recently and these are: 1. Bhopal MIC gas tragedy This occurred in the Union Carbide Company at Bhopal, MP, India in the night of December 3, 1984. There was leak of methyl isocyanate gas (MIC gas) (CH3NCO) from the Union Carbide factory. The stack height of the factory chimney was 120 ft. and the scrubber fitted to neutralise the gas was out of order. Around 11.30 pm workers in the night shift of the plant realised that there was MIC leak somewhere as their eyes were aching and tear glands producing water. Some of them could see the yellowish white gas, accompanying a drip of liquid about 50 ft. of the ground and they also observed many other lapses in the temperature gauge pressure system of the MIC tank. The plant supervisor ordered for water spraying on the leak of the MIC gas but the water jet could not reach 120 ft. height of the stack. At 1.00 am in the morning the factory put the sirene on and about an hour after the MIC gas started escaping around that time. For two hours the safety valve remained open releasing 50,000 lbs of MIC in vapour and liquid form, which contained COCl2, HCN etc. During this period hundreds of people were dead and many thousand people were waiting death or waiting to suffer life long. This is the worst industrial disaster occurred in India. In the mid-night people in Bhopal around the plant woke up cuffing violently with eyes burning and fled from their homes. The gas sprayed over 40 sq. km and therefore, there was no escape up to a distance of 5–8 km down the wind. It was like a gas chamber. In the nearby Hamidia hospital thousands of people were admitted suffering from ailments and respiratory problems. Everybody was puzzled and nobody knew what was to be done. Next morning it was found that thousand were lying dead on the roads and homes and more than 2000 lay dying in hospitals. The sufferings of the people could have been lessened, if precautions would have been taken and workers and people could have been informed minimum safety measures to be taken in case of a leak.

Pollution Ecology

Table 8.45

435

Bioindicators of eutrophication of water bodies (Data from various sources)

Sensitive organisms (Macrophytes/ algae/weeds/phytoplankton) Alismaplantago aquatica

Resistant organisms (protozoa, zooplankton, phytoplankton, weeds, algae, macrophytes) Protozoa:

Potamogeton lucens

Coleps, Holophyra, Chilodonells

Potamogeton perfoliatus Elodea canadensis

Paramoecium, Colpoda, Colpidium Zooplankton (crustaceans):

Phalaris arundinacea

Diaphanosoma, Simocephalus

Polygonum amphibium

Ceriodaphnia quadrangula

Spirogyra adanata

Daphnia cucullata

Achnanthes microcephala

Diaptomus sililoides

Achnanthes minutissima v. cryptocephala

Brachionus angularis

Cymbella microcephala

Brachinus catciflorus Filinia brachiata Filinia longiseta Keratella tropica Macrophytes and others: Nuphar luteum Schoenoplectus lacustris Rorippa amphibia Sparganium emersum Sagittaria sagittifolia Emteromorpha sp. Eichhornia sp. Pistia sp. Salvinia sp. Oscillatoria rubescens Oscillatoria chalybea Euglena acus Chlorela vulgaris Cyclotella meneghiniana Achnanithes exigua Nitzschia palea Tabellaria fenestrata Fragilaria crotonensis

Safety devices

1. 2.

The industry has two main safety devices.

Scrub which neutralises the gas with caustic soda. Flare tower where the gas can be burnt up.

Fundamentals of Ecology

436 Table 8.46

Bioindicators of water pollution by paper mill effluent containing mercury (Kar el al., 1987) Sensitive organisms

Phytoplanktons:

Resistant organisms Phytoplanktons

Actinaustraum sp.

Chlorella vulgaris

Kirchnerilla sp.

Dispora cuneiformes

Surirella sp.

Ankistrodesmus felcatus

Chlamydomonas sp.

Cymbella aspera

Macrophytes: Lemna paniculata Crustacea

Cymbella cessati Navicula cryptocephala Nitzschia palea

Diaptomus sp.

But these safety devices either were not working or failed to work on December 3, 1984 night. One requirement was to store MIC in storage tanks in liquid form at 0°C. But the refrigerator system was not properly working and the storage tank temperature was around 15–20°C and MIC was in gas form. MIC can react with almost any chemical and generates considerable heat and CO2. The heat released accelerates the reaction and the pressure goes up creating an explosive situation. Since the safety devices were not maintained as per the safety rules, the accident was imminent. What is MIC?

Methyl isocyanate which is the starting material for production of carbaril.

= COCl2 CO + Cl2 Gas Gas Phosgin gas + COCl2 Æ CH3 — N = C = O + 2HC1 (ii) CH3NH2 (Methylamine) (Phosgene) (Methyl Isocyanate) CH3 — N = C = O + a-Naphthol Æ 1-Naphthyl-N-methyl carbamate MIC (carbaryl/sevin) MIC gas is stored in underground in low temperature as a liquid with help of liquid nitrogen. It has the following properties: MIC is usually accompanied by COCl2 (2%). The threshold limiting value for MIC and COC12 is 0.02 ppm and 0.1 ppm, respectively. COC12 enhances the toxic effect of MIC. Exposure of human beings to MIC leads to chest congestion and pain, breathing troubles and respiratory movements and eye ache. MIC entering into human blood converts haemoglobin to N-methyl carbamoyl haemoglobin, which with help of ATP forms activated adenyl haemoglobin, which with help of AMP ultimately produces a defective haemoglobin and generates cyanide. It becomes fatal to human beings. (i)

Characteristics

1. 2. 3. 4.

Colourless, pungent smell. At 20°C it is converted to gas from liquid. It is two times heavier than air and therefore comes down to ground level easily. It reacts with water giving rise to 1, 3-dimethyl urea or 1, 3, 5— trimethyl biuret and heat. It can react with acid producing carbon dioxide and methylamine salt. It can react with alkali producing

Pollution Ecology

437

carbonate salt and methylamine. MId can react with many active hydrogen compounds and the reactions are vigorous and exothermic. MId can react even with itself undergoing trimerization in presence of NaOH, NaC1 as catalyst and the product is trimethyl-isocyanurate. This reaction is exothermic and liberates heat. How the accident occured

i. ii. iii.

Water entered inside the underground storage tank and reaction started increasing the temperature. The temperature made MIC from liquid to gas and pressure was built up. The pressure could burst the steel tank and the concrete chamber. The scrubber valves broke open. 40 tons of gas released in 1½ hour and moved in the wind direction.

Union Carbide has 15 factories in 8 places and produce insecticides. MIC based pesticide: Production in 1984 a) Sevin 2000 tons/year h) Baygon 140 tons/year c) Aldicarb (Temix) 10 tons/year d) Carbofuran (Furadon) 250 tons/year Effect

a) b) c) d)

e)

More than 2000 people were killed in hospitals within 12 to 72 hours. 1064 lost eyesight partially or fully, 2299 pregnancy aborted. Many thousands died on the street. In air 0.2 ppm to 0.4 ppm is considered safe limit. > 2 ppm - Eye burning, watering, nose and neck burning. > 25 ppm- Burning sensation acute, lung cells are damaged, leading to pulmonary edema. Contraction and expansion of lung impaired. In rats > 5 ppm causes pulmonary edema. Water gets deposited in alveoli. MIC destroys functioning of (i) cytochrome C-oxidase, rhodinase, (ii) damage to cornea, (iii) cerebral paralysis, paralysis of limbs, convulsion in children, lungs become grey, (iv) death due to limb paralysis, gasping (asphyxial death), neurogenic pulmonary edema, brain paralysis, corneal ulcer, skin ulcer, acute conjunctivitis, toxic hepatitis, vomiting, kidney and urinary bladder damage.

Antidote Antidote of this gas is not known. Sodium thiosulphate is taken as antidote for MIC neutralisation in the body (50 ml of 25% sodium thiosulphate is given intravenously). Oxygen is administered, artificial respiration is required and penicillin administered.

2. Chernobyl disaster On 28th April, 1986 at 9.00 pm explosions from runaway nuclear reactions at Chernobyl Ukraine, formerly USSR, occurred. A nuclear reaction burst through a 4000 tonne steel—concrete cover and the reactor core temperature was raised to more than 2000°C. Radioactive debris was thrown into air and hit the surrounding areas. Within a week the radioactive debris and gases from molten mass in the core reached some other parts of Europe. This nuclear accident killed at least 2000 people and it has been estimated that the agricultural fields in this area will remain radioactive for many decades. Experts predict that incidence of cancer will increase among the people of the area. Tonnes of sand clay and other materials were dumped to bury the molten core. But radiation still reached the surrounding areas. This accident was an eye opener of the world for better management of nuclear reactors.

Fundamentals of Ecology

438

3. Minimata disease In 1953 Minimata bay water in Japan was contaminated by methyl mercury. Industrial effluents containing mercury salts were discharged into the bay and these mercury salts got converted to methyl mercury which got incorporated into the food chain and reached fish tissues. People eating fish of that bay suffered from (1) numbness of limbs, lips and tongue, (2) blindness, (3) deafness, (4) mental derangement. 52 such cases were reported in 1953 and out of which 17 persons died and 23 Table 8.47

Chemical species of mercury and their toxicity

Species

Properties

Hg

Non-toxic and relatively inert, vapour highly toxic when inhaled

2+

Mercurous ion—low toxicity, insoluble as chloride

2+

Mercuric ion—toxic, not easily transported across biomembranes.

Hg2 Hg

+

RHg

Organomercurials—highly toxic to living system

R2Hg

Diorganomercurials—low toxicity and can be converted to RHg+ in acidic medium

HgS

Insoluble and non-toxic, trapped in soil.

(Mercuric sulfide)

Table 8.48 Date

Major chemical accidents in India after Bhopai Gas Tragedy Place

No. Killed

May 1985

Cochin

Nov 1985

Cochin

43

Nov 1985

Tamil Nadu

Dec 1985

Delhi

No. Injured

Nature of accident

200

Release of hexacyclopentadiene

82

Fire in gasoline

60

NA

Gasoline explosion during transport

2

500

Oleum gas leak Ammonia leak

June 1987

Orissa

4

—

July 1987

Pune

—

420

Sulphur trioxide leak

Nov 1987

Gujarat

—

5000

May 1988

Gujarat

19

53

Acid tanker overturned

oleum gas leak

Chlorine leak

Oct 1989

Orissa

6

100

Nov 1990

Maharashtra

35

50

Explosion in gas cracker plant

Nov 1991

Maharashtra

9

100

Explosion in filling unit

April 1992

Delhi

12

—

Chemical explosion in warehouse

Sept 1992

Haryana

11

11

Ammonia leak

May 1993

Maharashtra

11

123

Sulphuric acid gas leak

Oct 1994

Uttar Pradesh

30

25

Explosion in factory

1995

Gujarat

—

11

Fire works factory

1995

Howrah

11

20

Fire works factory

1996

Mumbai

4

7

Fire explosion in LPG tanker

1997

Haryana

10

3

Toxic gas leak

1997

Ankaleswar

4

—

Toxic gas leak

2000

Paradeep

2

Some

Five in sulphur conveyor belt, Anunonia leak

Pollution Ecology

439

persons became disabled. Genetic defects were observed in some 50 babies whose mothers had consumed contaminated fish. This situation occurred due to mercury pollution. Mercury pollution has been, reported in many areas of the world, specially, in Lake Eri in USA in 1970, in river lb in Orissa, India in Iraq in 1972 where 450 villagers died after eating wheat which had been contaminated with mercury containing pesticide, and some other places. Anaerobic bacteria convert mercury salts into methyl mercury (CH3)2-Hg which gets dissolved in water and then taken by phytoplankton Æ zooplankton Æ fish Æ man. Toxicity

1.

2. 3. 4.

5. 6.

Solubility, volatility and particle size determine the pulmonary absorption of inorganic mercury. The absorption of inorganic mercury in human alimentary canal is 7% of the intake but methyl mercury absorption is 95%. The toxicity depends upon the chemical species of mercury. Mercury compounds get into blood, particularly to RBC membrane and binds with haemoglobin. Mercury gets bound to plasma protein. High level of mercury is found in kidney, liver, pancreas, RBC, spleen and brain. Symptoms of mercury poisoning appear in Human beings when the methyl mercury level becomes 0.5 ppm in blood. The half-life of inorganic mercury is 48 days in males and 37 days in females. Where as the halflife of methyl mercury is about 66 days. Methyl compounds get excreted through the urine and faeces. Mercury poisoning cause kidney damage and blood poisoning. The lethal dose for adult human bieng is 0.5–7 gm.

8.13

PROVISIONS IN THE INDIAN CONSTITUTION AND ENVIRONMENTAL LAWS

The Constitution of India provides a direct commitment to environmental protection. Article 21 of the Constitution has the provision Right to Life, which has been interpreted by the Supreme Court of India as Right to Healthy Environment. This is a fundamental right and this interpretation can be interpreted as a tool for sustainable development. Article 47 of the Constitution states that, “The State is to ensure as its primary duty of (i) raising standard of living of its people. (ii) To increase the level of nutrition of the people. (iii) To bring improvement in public health.” Article 48A of the Constitution reads, “The State shall endeavor to protect and improve the environment and to safeguard the forests and wildlife and improve the natural environment”. Under Article 51A(g) the citizens are required to “Protect and improve the natural environment, including forests, lakes, rivers and wildlife, and to have compassion for living creatures”. Thus, our constitution provides the necessary foundation for framing environmental legislations. In accordance with the Constitutional provisions, the following important laws and regulations on environmental pollution control are being notified. State and Union Governments and State and Central Pollution Control Boards are administering them. (i) The Water (Prevention and Control of Pollution) Act, 1974 (amended in 1978 and 1988). (ii) The Water (Prevention and Control of Pollution) Cess Act, 1977 (amended in 1991). (iii) The Air (Prevention and Control of Pollution) Act, 1981 (amended in 1987). (iv) The Environment Protection Act, 1986. (v) The Public Liability Insurance Act, 1991.

Fundamentals of Ecology

440

8.13.1 The Water Act and The Air Act

The Water Act is a comprehensive act with an objective for prevention and control of water pollution to maintain and restore wholesomeness of water bodies. The broad implications for the industries are to accept the concept of recycling, reuse, zero discharge of treated effluents. Similarly, air act is notified for improving the ambient air quality in air pollution control areas (densely industrialised, urbanised and sensitive areas). The implications are obvious that emissions should meet the standards. The Central and State Pollution Control Boards are constituted to enforce these acts. The main provisions of these two acts are Consent Administration, “Consent” is required by the industrial projects both for establishment as well as operation. Various conditions of discharge of effluent/emission including quality and standards are laid down in consent. These are periodically renewed and the compliance of consent conditions verified. In extreme cases, Pollution Control Boards have power to give direction, which include; (i) Closure, prohibition or regulation. (ii) Stoppage or regulation of supply of electricity, water and any other services. Violation of consent attracts penal provisions. As per Water Act 41 “whoever fails to comply with any direction given by Pollution Control Boards shall on conviction be punishable with imprisonment for a term which may extend 3 months or with fine to Rs. 10,000 or with both and in case the failure conditions with an additional fine which may extend to Rs. 5,000 for every day during such failure. Under Air Act “whosoever fails to comply with the provisions of the laws and direction given by the Pollution Control Boards shall on conviction be punishable with imprisonment for a term which shall not be less than one year and six months and which may extend to six years and with fine. The Water Cess Act, 1977 (amended in 1991) was enacted to provide the revenue to Pollution Control Boards through cess on water use. There is provision of 25% rebate for setting up of appropriate pollution control measures and meeting the prescribed standard. This is an economic incentive to the industry for encouraging them for pollution control. 8.13.2 The Water Cess Act, 1977 (amended in 1991) was enacted to provide the revenue to Pollution Control Boards through cess on water use. There is provision of 25% rebate for setting up of appropriate pollution control measures and meeting the prescribed standard. This is an economic incentive to the industry for encouraging them for pollution control. Formation of Pollution Control Boards in India

The Boards were constituted after the enactment of Water Act, 1974 and in most of the states, the boards were constituted in 1980s after enactment of Air Act, 1981. Functions

∑ ∑ ∑ ∑

Environmental monitoring Enforcement of law Creation of public awareness Advisory

Pollution Ecology

441

8.13.3 The Air (Prevention and Control of Pollution) Act, 1981

The Air (Prevention and Control of Pollution) Act was enacted in 1981. The Act prescribes various functions for the Central Pollution Control Board (CPCB) at New Delhi and State Pollution Control Boards at the state level. The main functions of the CPCBoard are ∑ to advice the Central Government on any matter concerning the improvement of the quality of the air and the prevention, control and abatement of air pollution; ∑ to plan and cause to be executed a nation-wide programme for the prevention, control and abatement of air pollution; ∑ to provide technical assistance and guidance to the State Pollution Control Board; ∑ to carry out and sponsor investigations and research related to air pollution prevention, control and abatement of air pollution; ∑ to collect, compile and publish technical and statistical data related to air pollution and ∑ to lay down standards for the quality of air and emission levels. The main functions of the State Pollution Control Boards are to ∑ plan a comprehensive programme for prevention, control or abatement of air pollution and to secure the execution thereof; ∑ advise the State Government on any matter concerning prevention, control and abatement of air pollution; ∑ collect and disseminate information related to air pollution; ∑ collaborate with CPCB in programme related to prevention, control and abatement of air pollution and ∑ inspect air pollution control areas, assess quality of air and to take steps for prevention, control and abatement of air pollution in such areas. National Ambient Air Quality Standard (NAAQS)

The ambient air quality objectives/standards are pre-requisite for developing management programme for effective management of ambient air quality and to reduce the damaging effects of air pollution. The objectives of air quality standards are to ∑ indicate the levels of air quality necessary with an adequate margin of safety to protect the public health, vegetation and property; ∑ assist in establishing priorities for abatement and control of pollutant level; ∑ provide uniform yardstick for assessing air quality at national level; and ∑ indicate the need and extent of monitoring programme. The CPCB had adopted first Ambient Air Quality Standards on November 11, 1982 as per section 16 (2) (h) of the Air (Prevention and Control of Pollution) Act, 1981. The air quality standards have been revised by the Central Pollution Control Board on April 11, 1994 and were notified in Gazette of India, Extra-ordinary Part-II Section 3, sub section (ii), dated May 20, 1994. The revised NAAQS are given in Table 8.49. These standards are based on the land use and other factors of the area. The guidelines for declaring sensitive areas as recommended CPCB are as follows: 1. Ten kilometres all around the periphery of the health resorts so notified by State Pollution Control Board in consultation with department of public health of the concerned State.

Fundamentals of Ecology

442 Table 8.49 Pollutants

SO2

NOx

SPM

RSPM

Lead (Pb)

NH3

CO

National Ambient Air Quality Standards Time weighted average

Industrial µg/m3

Resident rural and other area µg/m3

Sensitive area µg/m3

Annual*

80

60

15

24 hours**

120

80

30

Annual*

80

60

15

24 hours**

120

80

30

Annual*

360

140

70

24 hours**

500

200

100

Annual*

120

60

50

24 hours**

150

100

75

Annual*

1.0

0.75

0.50

24 hours**

1.5

1.00

0.75

Annual*

0.1

0.1

0.1

24 hours**

0.4

0.4

0.4

Annual*

5.0

2.0

1.0

24 hours**

10.0

4.0

2.0

* Annual arithmetic mean of minimum 104 measurements in a year taken twice a week 24 hourly at uniform interval. ** 24 hourly/8 hourly value should be met 98% of the time in a year. However, 2% of the time, it may exceed but not on two consecutive days. Note: a. NAAQS: The levels of air quality necessary with an adequate margin of safety to protect the public health, vegetation and property. b. Whenever and wherever two consecutive values exceed the limit specifi ed above for the respective category, it would be considered adequate reason to institute regular/continuous monitoring and further investigation. c. The State government/State Board shall notify the sensitive and other areas in the respective states.

2. 3.

4.

5.

Ten kilometres all around the periphery of biosphere reserves, sanctuaries and national parks so notified by Ministry of Environment and Forests or concerned State. Five kilometres all around the periphery of an archeological monument declared to be of national importance or otherwise so notified Archeological Survey of India in consultation with State Pollution Control Board. Areas where some delicate or sensitive to air pollution crops/important to the agriculture/horticulture of that area grown so notified by State Pollution Control Board in consultation with department of agriculture/horticulture of concerned State. Five kilometres around the periphery of the centers of tourism and/or pilgrim due to their religious, historical, scenic or other attractions, so notified by department of tourism of the concerned State with State Pollution Control Board.

Pollution Ecology

443

8.13.4 The Environment Protection Act, 1986

The Environment Protection Act, 1986 has provisions for fairly comprehensive coverage to deal with various aspects including pollution, hazardous substances management, environmental degradation and protection of ecologically important areas. The act involves various existing agencies to cover diverse spectrum of area, for example, Inspector/ Director of Factories and Boilers, Inspector/ Director of Explosive, Dock Safety, etc. The Act consists of four chapters with 26 provisions and Chapter-III deals with provisions, control and abatement of Environmental Pollution (Provisions 7–17). The Act prescribes stringent penalties of violation of the provisions of the Act. Many rules have been notified under this act. Some are: (i) Standards for emissions and effluents, noise, (ii) Provisions for EIA and EMP, (iii) Provisions for Eco friendly Products (ECOMARKS), (iv) Manufacture, use, import, export and storage of Hazardous Micro organisms genetically engineered organisms/cells, (v) Hazardous Waste (Management and Handling) Rules, 1989 (Amendments 2000, 2003), (vi) Manufacture, storage and import of Hazardous Chemicals Rules, 1989, (vii) Chemical Accidents (Emergency Planning Preparedness and Response) Rules, 1996, (viii) Biomedical Waste (Management and Handling) Rules, 1998, (ix) Coastal Regulatory Zone (CRZ), 1999. 8.13.5 Public Liability Insurance Act, 1991

As per provisions of Public Liability Insurance Act, 1991, the industries handling hazardous chemicals, as defined under the act, are required to take insurance policy for providing immediate relief to victims (outside factory) in case of major accident. While there are number of legislation for environmental protection, their effective implementation is very important. The public awareness and judicial activities have increased many folds and accountability of industries, regulatory agencies has also increased. Legislation alone cannot tackle the problem. It has to be an integrated approach by industrial authorities, regulatory bodies and general public. 8.13.6 National Environment Tribunal Act, 1995

This as was enacted to provide strict liability for damages arising out of accidents of hazardous substances and for establishment of a National Environment Tribunal for effective and expeditious disposal of cases arising from such accidents, with a view to provide relief and compensation for damages to person, property and the environment.

8.14 ENVIRONMENTAL LAWS IN INDIA AND INTERNATIONAL CONVENTIONS General Enactments Air Pollution

1. 2. 3. 4. 5. 6.

The Air (Prevention and Control of Pollution) Act, 1981, amended in 1987. The Indian Boilers Act, 1923. The Factories Act, 1948, amended in 1987. The Industries (Development and Regulation) Act, 1951. The Mines and Minerals (Regulation and Development) Act, 1947. The Oriental Gas Company Act, 1857.

Fundamentals of Ecology

444

7. 8. 9. 10. 11. 12.

The Indian Explosives Act, 1884. The Explosive Substance Act, 1908. The Motor Vehicles Act, 1938, amended in 1988 and Rues, 1989. The Inflammable Substances Act, 1952. The Petroleum Act, 1934 and Rules, 1979. The Environmental (Protection) Act, 1986.

Water Pollution

1. 2. 3. 4. 5. 6. 7. 8.

The River Boards Act, 1956. The Merchant Shipping (Amendment) Act, 1987. The Water (Prevention and Control of Pollution) Act, 1974, amended in 1988. The Water (Prevention and Control of Pollution) Cess Act, 1977. The North India Canal and Drainage Act, 1873. The Indian Fisheries Act, 1897. The Damodar Valley-Corporation (Prevention of Pollution of Water) Regulation Act, 1948. The Environment (Protection) Act, 1986.

Noise Pollution

1.

The Environmental (Protection) Act, 1986.

Marine Pollution

1. 2. 3. 4. 5. 6. 7. 8.

The Shore Nuisance (Mumbai and Colaba) Act, 1953. The Obstruction in Fairways Act, 1891. The Indian Fisheries Act, 1897. The Indian Ports Act, 1908. The Major Port Trusts Act, 1963. The Merchant Shipping (Amendment) Act, 1987. The Territorial Waters, Continental Shelf, Exclusive Economic Zone, and other Maritime Zones Act, 1976. The Coastguards Act, 1978.

Hazardous Substances

1. 2. 3. 4. 5. 6. 7. 8. 9.

The Poison Act, 1919. The Dangerous Drugs Act, 1930. The Drugs and Cosmetics Act, 1940. The Factories Act, 1948, amended in 1987. The Prevention of Food Adulteration Act, 1954. The Industries (Development and Regulation) Act, 1951. The Insecticides Act, 1968. The Environment (Protection) Act, 1986. The Consumer (Protection) Act, 1986.

Radiation

1. 2.

The Atomic Energy Act, 1962. Radiation Protection Rules, 1971.

Pollution Ecology

445

Pesticides

1. 2. 3.

The Insecticides Act, 1968. The Factories Act, 1948. The Poison Act, 1919.

Forest and wildlife conservation

1. 2. 3. 4.

The Indian Arms Act, 1978. The Wildlife (Protection) Act, 1972. The Indian Forests Act, 1927. The Forest (Conservation) Act, 1980, amended in 1988.

Others

1. 2. 3. 4.

The Urban Land (Ceiling and Regulation) Act, 1976. The Prevention of Food Adulteration Act, 1954. The Ancient Monuments and Archaeological sites and Remains Act, 1958. The Slum Areas (Improvement and Clearance) Act, 1956.

The Rules are

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15.

The Petroleum Rules, 1975. The Gas Cylinders Rules, 1981. The Static and Mobile Pressure Vessels (Unfired) Rules, 1981. The Explosives Rules, 1983. The Indian Boilers Rules, 1956. The Water (Prevention and Control of Pollution) Rules, 1982, amended in 1992. The Air (Prevention and Control of Pollution) Rules, 1982, amended in 1992. The Central Motor Vehicle Rules, 1989 amended in 1994. The Environment Protection Rules, 1986. The Hazardous Waste (Management and Handling) Rules, 1989, amended in 1999. The Manufacture, Storage and Import of Hazardous Chemicals Rule, 1989, amended in 1994, 1998. The Manufacture, Use, Import, Export, Storage of Hazardous Micro-organism or Genetically Manipulated Organisms Rules, 1989. The Public Liability Insurance Rules, 1991. The Chemical Accidents (Emergency, Planning, Preparedness and Response) Rules, 1996. The Biomedical Wastes (Management and Handling) Rules, 1998.

State Enactments Water Pollution

1. 2.

The Orissa River Pollution Prevention Act, 1953. The Maharashtra Prevention of Water Pollution Act, 1969.

Smoke Control:

1. 2. 3.

The Bengal Smoke Nuisance Act, 1905. The Gujarat Smoke Nuisance Act, 1963. The Bombay Smoke Nuisance Act, 1912.

Fundamentals of Ecology

446 Pest Control

1. 2. 3. 4. 5.

The Andhra Pradesh Agricultural Pests and Diseases Act, 1919. The Assam Agricultural Pests and Diseases Act, 1954. The Uttar Pradesh Agricultural Diseases and Pests Act, 1954. The Mysore Destructive Insects and Pests Act, 1917. The Kerala Agricultural Pests and Diseases Act, 1958.

Land Utilization and Land Improvement

1. 2. 3. 4. 5. 6. 7. 8.

The Andhra Pradesh Improvement Scheme Act, 1949. The Acquisition of Land for Flood Control and Prevention of Erosion Act, 1955. The Bihar Waste lands (Reclamation) Cultivation and Improvement Act, 1946. The Delhi Restriction of Use of Land Act, 1964. The Madhya Pradesh Nagar tatha Gram Nivesh Adhiniyam, 1973. The Madhya Pradesh Gandhi Basti Kshetra (Sudhar tatha Nirmulan) Adhiniyam, 1976. The Madhya Pradesh Town (Periphery) Control Act, 1960. The Madhya Pradesh Regulation of Uses of Land Act, 1948.

Forest and Wildlife Conservation

1. The Madras Elephants Preservation Acts, 1873 and 1879. 2. The Nilgiris Game and Fish Preservation Act, 1879. 3. The Indian Arms Act, 1978. 4. The Wild Birds and Game Protection Act, 1887. 5. Notification in 1902 under the Sea Custom Act, 1878. 6. The Wild Birds and Animals Protection Act, 1912. 7. The Bengal Rhinoceros Protection Act, 1932. 8. The Punjab Wild Birds and Wild Animals Protection Act, 1933. 9. The Andhra Pradesh Forests Act, 1967. Note: Further information on any of these can be obtained from the Central Pollution Control Board. International Conventions on Environment

∑ ∑ ∑ ∑ ∑ ∑

29 July 1968 UNO Advisory Committee on Economics and Social Affairs recommended organisation of an International Conference on “Human Environment”. 5 June 1972—UNO Conference on Human Environment held at Stockholm—Late Mrs. Indira Gandhi participated. World Climate Conference, 1979. UN Framework Convention on climate change, came into force, 9 May in 1992 New York. Kyoto Protocol, 1997. Bruntland Commission, 1983—Report published in 1987 “Our Common Future”. Vienna Convention for the Protection of the Ozone layer, 22 March, 1985. Montreal Protocol on Substances that deplete the Ozone layer, 1987.

Pollution Ecology

∑ ∑

∑ ∑ ∑ ∑ ∑ ∑ ∑ ∑

447

Convention on the Control of Transboundary Movements of Hazardous Wastes and their disposal (Basel Convention, Switzerland) 22 March, 1989. Earth Summit, at Rio de Janeiro, Brazil on 5 June, 1992. • Sustainable Development. • Ozone Depletion. • Global Warming. • Biodiversity Conservation. • Environmental Protection and the concept of “Landscape Ecology” – Eco-cities, etc. Convention on the prior informed Consent procedure for certain Hazardous Chemicals and Pesticides in International Trade, 1998, Rotterdam. FAO International code of conduct on the distribution and use of Pesticides, 1985, Rome. Convention on the Prevention of Marine Pollution by Dumping of Wastes and other matter, London Convention, 1972. UNO Convention on the Law of the Sea, 1992. Convention on the Conservation of Migratory Species of Wild Animals, 1979, Bonn. Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITIES), 1973, Washington D.C. Convention on Wetlands of International Importance especially as Waterfowl habitat (Ramsar Convention), 1971, Ramsar. FAO International undertaking on Plant Genetic Resources.

8.15

ENVIRONMENTAL MANAGEMENT

A number of internationally recognised models for environmental management exist. These are termed as ISO 9000 series of quality management standards and ISO 14000 series of standards for environmental management systems. The environmental management system should be integrated with the organisations other activities to get maximum benefit out of this management system. ISO 9000 emphasises on quality management standards. But ISO 14000 series encourages proactive environmental management and facilitates cooperation between industry and the regulatory agency. These management systems take a holistic view of the industry and environment establish a framework for continual improvement, encourages innovations at the facility level and brings international awareness about the environmental performance of the industry. However, these management Fig. 8.18 Relationship between Management .iystems

Fundamentals of Ecology

448

systems do not indicate environmental performance standards and does not set goals to achieve excellence in environmental performance. However, these systems improve the quality of management and therefore, should be adopted by all industries, so that their environmental performance becomes much better than the existing performance. The industries should look for long-term goals and a symbiotic relationship with the community instead of short-term profit oriented goals. They must spend money (part of their profit on the upliftment of socio-economic conditions and health of the people in the area where industries are built. The industry has also the obligation to provide finance for environmental restoration activity. The environmental laws, which have been enacted in India, provide a framework to achieve these goals. However, there are constraints in implication and these can be solved by raising consciousness for sustainable development among people, industrial organisations, government functionaries. 8.15.1

Green Path

An industry’s environmental performance is increasingly viewed as an essential part of their national commitment to environmental protection for adoption of green path. Each industry should have the following components in their organisation. 1. Organisational profile indicating size of the organisation like revenue generation, number of employees, major lines of activity, nature of environmental impact of the organisations operations. 2. Environmental policy Each industry should have its own environmental policy and the policy should indicate the scope and applicability, contains and goals. 3. Environmental management Each industry should adopt a management system which should indicate organisational accountability for implementation of environmental policies and programmes and it should indicate the management structure like staff, organisational relationship, activities, training programmes and achievements. 4. Environmental releases The amount of effluents and wastes released to the environment may be considered as an indicator of industry’s impact on environment. The industry should provide baseline data with regard to emissions to the atmosphere, discharges to water, hazardous waste, waste discharge to land, objectives, targets and programmes and measures taken to abate pollution at the source instead of the end of the pipeline. 5. Organisational commitment to the conservation and recycling of materials with regard to water, energy, forest and land etc. 6. Adoption of aiidit programmes and environmental response programme The industry should adopt internal/external audit programmes and should have provision for environmental emergency response programme with regard to meeting emergency commitment etc. 7. Environmental compliance to regulatory agencies There should be transparency with regard to implementation of environmental laws and regulations and reporting/interacting with regulatory agencies. 8. R and D cell Each industry should have a cell for pursuing research and development activities, training programmes, acquiring environmentally preferable technologies and interacting with people of the area specially with regard to health, education and environment. 9. Excellence recognition

Each industry should have a programme to reward their employees for excellence in their work with regard to environmental practices, resource conservation and R and D activities.

Pollution Ecology

449

10. Publication

Each industry should have a publication cell. This cell should highlight periodically the activities of the industry specially their achievements, quality of their products, nature of technology they use and their commitment to environmental compliance.

Know your Environmental Protection Statutes / Legislations

The different statutes / legislations enacted in India exclusively for environment protection are: 1. The Water (Prevention and Control of Pollution) Act, 1974. 2. The Water (Prevention and Control of Pollution) Rules, 1975. 3. The Water (Prevention and Control of Pollution) Cess Act, 1977. 4. The Water (Prevention and Control of Pollution) Cess Rules, 1978. 5. The Air (Prevention and Control of Pollution) Act, 1981. 6. The Air (Prevention and Control of Pollution) Act, 1982. 7. The Environment Protection Act, 1986. 8. The Environment (Protection) Rules, 1986. 9. Hazardous Wastes (Management and Handling) Rules, 1989. 10. Manufacture, Storage and Import of Hazardous Chemical Rules, 1989. 11. The Forest (Conservation) Act, 1980. 12. The Forest (Conservation) Rules, 1981. 13. The Wildlife Protection Act, 1972. 14. The Wildlife (Transactions and Taxidermy) Rules, 1973. 15. The Wildlife (Stock Declaration) Central Rules, 1973. 16. The Wildlife (Protection) Licensing (Additional matters for consideration) Rules, 1983. 17. The Wildlife (Protection) Rules, 1995. 18. The Wildlife (Specified Plants – Conditions for possession by Licensee) Rules, 1995. 19. The Public Liability Insurance Act, 1991. 20. The Public Liability Insurance Rules, 1991. 21. The National Environment Tribunal Act, 1995. 22. The National Environment Appellate Authority Act, 1997. 8.15.2 ISO 14001 Certification

The requirements for ISO 14001 are listed below: 1. Initial Environmental Review (IER). 2. Identification of Environmental Aspects. 3. Evaluation of Significant Environmental Aspects and Impacts. 4. Framing Environmental Policy. 5. Setting Environmental Objectives and Targets. 6. Preparation of Environmental Management Programme (EMP). 7. Preparation of EMS Policy Manual, EMS Procedures and Operational Control Procedures (SOP/ SMP) for all identified significant Environmental aspects. 8. Preparation Environmental Legal Register. 9. Maintaining Environmental Records pertaining to all activities having environmental impact. 10. Environmental Training and Awareness.

450

11. 12. 13. 14. 15. 16. 17. 18. 19.

Fundamentals of Ecology

Environmental Communication. Emergency Preparedness and Response. Environmental Monitoring and Measurement. Evaluation of compliance to legal and other requirements. Non-conformity, corrective action and preventive action. Conducting internal EMS Audit at periodic interval. Conducting Management Review at periodic interval. Conducting Pre-Certification Audit by Certifying Body. Conducting Certification Audit and Certification by Certifying Body.

MULTIPLE CHOICE QUESTIONS Choose the correct answer 1. The minimum dissolved oxygen (D.O.) required for survival of aquatic life is: (a) 4 ppm (b) 0.2 ppm (c) 0.4 ppm (d) 1 ppm o 2. Standard 5 day BOD at 20 C, when compared to ultimate BOD is about (a) 58% (b) 68% (c) 98% (d) None of the above 3. If a 2% solution of sewage sample is incubated for 5 days at 20oC and the D.O. depletion is 10 mg/l, then the BOD of the sewage would be (a) 50 mg/l (b) 200 mg/l (c) 500 mg/l (d) 5,000 mg/l 4. The clogging of soil with sewage is called (a) Sewage farming (c) Sewage bulking (b) Sewage sickness (d) Sewage infiltration 5. Select the correct sequence of the formation of the following compounds during chlorination of water in which ammonia is present : 1. NCl3 2. NH2Cl 3. NHCl2 (a) 1,2,3 (b) 2,3,1 (c) 3,1,2 (d) 2,1,3 6. High COD to BOD ratio of an organic pollutant represents (a) High biodegradability of pollutants (b) Low biodegradability of pollutants (c) Presence of free oxygen for aerobic decomposition (d) Presence of toxic material in the pollutant 7. A reactor in which the randomly packed solid medium provides the surface area for biofilm growth is (a) an oxidation column (c) a trickling filter (b) a bio tower (d) an anaerobic sewage lagoon 8. Two sources generate noise levels of 90 dB and 94 dB respectively. The cumulative effect of these two noise levels is (a) 184 dB (b) 95.5 dB (c) 94 dB (d) 92 dB 9. The rising of warm air in a building is called (a) Stack effect (b) Ventilation effect (c) Coning effect (d) Fanning effect 10. Photochemical smog is formed in the presence of sunlight by the reaction of (c) Hydrocarbons with NOx (a) Lead with SO2 (b) Ozone with CFC (d) SO2 with silver nitrate

Pollution Ecology

11.

12.

13.

14.

15. 16.

17. 18.

19.

20. 21. 22.

23.

24. 25.

26.

451

A minimum amount of fluorides should be present in potable water to prevent: (a) Dental carries (c) Scale formation (b) Corrosion (d) Water-borne diseases Among the environmental laws enacted in India, one of the following is considered as umbrella act: (a) Water Act, 1974 (c) Environmental Protection Act, 1986 (b) Air Act, 1981 (d) Hazardous Waste Management Act, 1989 The Ambient noise level limits as prescribed by the Central Pollution Control Board for a residential area for day and night are, respectively: (a) 50 and 25 dBA (b) 75 and 50 dBA (c) 90 and 20 dBA (d) 55 and 45 dBA Which industry is the major source of fluoride pollution in the ecosystem? (a) Thermal power plants (c) Paper Industry (b) Aluminium smelter plants (d) Leather Industry Steel corrodes much faster if exposed to air laden with one of the following gases. (a) Carbon dioxide (b) Oxides of Nitrogen (c) Oxides of sulphur (d) Oxygen In which atmospheric conditions, air temperature does not decrease with increase in height in the air. (a) Green house effect (c) High pollution dispersion (b) Temperature inversion (d) Rain The acid rain pH usually varies between: (a) 11 and 9 (b) 8 and 6 (c) 3 and less than 6 (d) Below 2 Which of the chemicals are largely responsible for causing Eutrophication? (a) Nitrite, nitrate and phosphate (c) Phosphate and oxides of iron (b) Nitrate, oxides of iron, fluoride (d) Fluoride and pesticides Which chemical is used as a coagulant for treatment of water for drinking purpose? (a) Al2 (SO4)3 (c) Bleaching powder (b) Liquid chlorine (d) Carbon compounds In which of the method, biodegradable waste is converted to manures: (a) Pyrolysis (b) Incineration (c) Pulverisation (d) Vermicomposting The colour of ozone gas is: (a) Drake blue (b) Green (c) Red (d) Yellow Montreal protocol was signed by 46 industrial nations for: (a) Climate change (c) Green house gas phasing (b) Ozone accord (d) Biodiversity Act Which organisms are used in the preparation of activated sludge? (a) Bacteria and earthworms (c) Nematodes and earthworms (b) Bacteria and protozoa (d) Fungi and microarthopods One of the following chemicals has higher ozone depleting potential: (a) CFCs (b) Chlorine (c) Carbon tetrachloride (d) Halons One of the following empirical formula is used to determine stack heights of thermal power plants of capacity 200 MW or less when H = stack height in metre, Q = Particulate matter (a) H = 72 (Q)0.27 (b) H = 74 (Q)0.27 (c) H = 72 (Q)0.37 (d) H = 74 (Q)0.37 Under one of the following Article of Indian constitution, the water (prevention and control) Act was passed by Indian Parliament: (a) 252 (b) 253 (c) 226 (d) 268

452

27.

28. 29. 30. 31.

32. 33.

34. 35. 36.

Fundamentals of Ecology

Under which environmental Law/ Act public Hearing / Consultation is Mandatory. (a) Water Act, 1974 (b) Air Act, 1981 (c) EP Act, 1986 (d) Hazardous waste management Rules, 1989 Which provision of ISO emphasise quality management standards? (a) ISO 9000 series (b) ISO 14001 (c) ISO 14031 (d) ISO 14040 From which year World Environment Day is observed? (a) 1972 (b) 1990 (c) 2002 (d) 1962 One of the following sensitive plant is used as bioindicator of SO2 pollution: (a) Tulsi (b) Kadamb (c) Lichen (d) Potato Laser beam scan is a tool to measure (a) PAH in air (c) Suspended pollutants in air (b) SO2 gas in air (d) SPM10 only Which is the main green house gas in the atmosphere? (a) CO2 (b) CH4 (c) CFCs (d) Water vapour Decibel is based on (a) Logarithmic scale (c) Arithmetic scale (b) Antilogarithmic scale (d) Log and antilog scale Which is the least polluted part of the Earth? (a) Artic circle (b) Antarctica (c) Temperate region (d) Tropical region The COD / BOD ratio in a polluted water body is usually: (a) 1–1.5 (b) 1.5–2 (c) More than 2 (d) Less than 1 Which type of pollutants can be removed from a gas stream by thermal precipitators. (a) SPM (c) Very fine aerosole (b) SPM10 (d) Lead and cadmium particles.

FILL IN THE BLANKS 37. 38. 39. 40. 41. 42. 43. 44. 45.

The burning of refuge, especially solid waste in a controlled manner is called ——————. A device in which gas is allowed to mix up with water and then impinges on a plate is called ———— ————. Graphic display of the distribution of wind speed and wind direction experienced at a particular location is represented by ————————. ——————————candle is used for detecting and measuring sulphur dioxide in air. ——————————— is a major green house gas and is also a hydrocarbon. Fabric filtres are used for control of ———————— air pollutants. Potassium dichromate is used in the estimation of chemical oxygen demand of water samples as an —-—————agent. The sound power from a voice shouting is 0.001 W. The value of sound pressure level is —— —— dB (60, 70, 80, 90). The process in which a portion of the sludge is returned to the aeration tank and mixed thoroughly and allowed to settle in the final setting tank is called ——————.

Pollution Ecology

46. 47. 48. 49. 50. 51. 52. 53. 54.

453

The normal period of detention of sewage in a settling tanks is ———— to ———— hours. Automobile emissions can be controlled by providing —————————— in engines. ———————— instruments is used to measure turbidity in water. Soil moisture level is measured by ———————————. Volatile substances in a sample can be measured using ———————————. ——————— instrument is used to make metrological observations in upper atmosphere. Which flightless bird in Mauritius became extinct due to overhusting by sea sailors ————. ————————— instrument is used to measure slope of the ground surface. ————————— decibels is the approximate intensity of sound in normal conversation.

SHORT AND DESCRIPTIVE QUESTIONS 55. 56. 57. 58. 59. 60.

61. 62.

What is photochemical smog? Explain its formation. What is Green House effect? Explain the Green House Phenomenon. What are heavy metals? What are their pollution potential. Evaluate mercury or cadmium as an environmental pollutant. What is noise? Explain how noise is measured and what are the national standards for different zones. Write notes on: (a) Indicator species (h) CFCs (b) NOx gases (i) Fluoride cycle in nature (c) SO2 as a pollutant (j) Minor pollutant gases (d) Flow chart of generation of pollutants (k) Temperature Inversion in a steel plant (e) PAN (l) Eutrophication (f) Formation of acid rain (m) Instruments used for air pollution control methods (g) Aerosols (n) Hazardous waste Discuss the nature of metal toxicity. What is solid waste? Discuss the methods of disposal of Municipal solid waste.

9

Environmental Toxicology

Toxicity tests are usually done using small mammals like rats, mice or dogs and monkeys, and the findings are extrapolated to humans. Many environmental pollutants are considered as toxicants. The presence of some environmental pollutants or toxic chemicals in the environment at lethal levels or causing harmful effects on living system are called environmental toxicants. These toxicants can be (i) food contaminants (afla toxin, botulinum toxin etc.). (ii) air pollutants (CO, NON, asbestos, vinyl chloride, acrylo nitrite, mercury, arsenic and some other metals, chlorinated solvents, chlorofluorocarbons, polychlorinated bi-phenyls (PCBS), nitrosoamines etc. Toxicology deals with toxins (toxicum or toxicon means poison, logous means study) or poisonous substances which when enter into living system cause disturbances in their functioning leading to harmful effects and ultimately death. Toxin can be of plant, animal or microbial origin or can be a synthetic substance. Toxicity is a relative term and one toxic chemical is compared with another and toxicity tests are done to evaluate the adverse effects of a chemical on organisms under standardised conditions and which permit a comparison with other chemicals tested. (iii) Water pollutants (industrial effluents, pesticides, rodenticides, sewage etc..). (iv) Soil pollutants (toxic chemicals used in agriculture etc.).

9.1

TOXIC CHEMICALS AND DEFINITION OF TOXICOLOGY

Man has synthesised a number of chemicals and there are a number of chemicals in the environment now. Some of these chemicals are toxic to living systems and some are non-toxic. Industries through their effluents and emission discharge toxic chemicals into air, water and soil, and some of these chemicals get incorporated into human food chain. The toxic chemicals enter the human food chain and disturb the biochemical process occurring in living bodies and cause death. Toxicology deals with the adverse effects of chemicals in biological systems including human beings. Toxicity is defined with regard to quantity of the chemical administered or absorbed (dose). The administration of these chemicals will involve inhalation, ingestion or injection into the body. Time

Environmental Toxicology

455

factor is important. Tolerance limit of the individual and all the species are also important. Many metals listed as environmental hazards are essential for living systems for normal growth and development in very minute quantities. These are called dietary trace elements. These elements are Al, Sb, As, Ba, Be, Bl, Cd, Co, Cu, Ce, ln, Pb, Hg, Mo, Ag, Te, Sn, Ti, W, U and Zn. However, most of these substances become toxic to living systems and human body in higher concentration. Heavy metals like mercury, lead, cadmium, etc become very toxic in higher concentration to bio-systems. The toxic substances can be classified as mutagens, carcinogens, heavy metals, organo-chlorine compounds etc. on the basis of their function and biological effects. There are now more than four million known chemicals and approximately 30,000 new compounds are synthesised every year. Many of these chemicals are beneficial to man in many ways. Many chemicals like chlorofluorocarbons, SO2, NOx, nitros amine etc. are air pollutants and are toxic in high concentration.

9.2

TOXIC CHEMICALS

Table 9.1 provides information on some toxic chemicals/trace elements found in the environment. These are either found in air or water and soil. 9.2.1 Impact of Toxic Chemicals on Enzymes

In general, toxic chemicals get attached to the active sites of enzymes, inhibiting essential enzyme function. Heavy metal ions, in particular Hg2+, Pb2+ and Cd2+ act as effective enzyme inhibitors because of their affinity for sulphur containing ligands e.g. SCH3 and –SH in methionine and cysteine amino acids, which are part of the ezyme structure: S

SH

(i)

Enzyme

+ Hg

Enzyme

2+

Hg + 2H+ S

SH

S

SH----O

(ii)

—

Enzyme

+ As-O SH----O

—

Enzyme

—

As-O + 2OH S

Metalloenzymes contain metals in their structures. Enzyme action is inhibited when one metal ion of a metalloenzyme is replaced by another metal ion of similar size and charge. For example Zn2+ in some metalloenzymes can be substituted by Cd2+, which leads to cadmium toxicity. The enzymes inhibited by Cd2+ include (i) adenosine triphosphate, (ii) alcohol dehydrogenase, (iii) amylase, (iv) carbonic anhydrase, (v) peptidase activity in carboxypeptidase, and (vi) glutamic-oxaloacetic transminase. Pb2+ inhibits (a) acetylcholinesterase, (b) alkaline phosphatase, (c) adenosine triphosphates, (d) carbonic anhydrase, (e) cytochrome oxidase, and some of the key enzymes in the synthesis of heme, which is important for haemoglobin synthesis. Arsenic compounds inhibit pyruvate dehydrogenase and thus ATP generation is prevented. Arsenic compounds in high concentration coagulate proteins and they also uncouple phosphyrylation.

Fundamentals of Ecology

456 Table 9.1

Toxic elements and compounds in environment

Elements/ compounds

Sources/uses

Effects

Arsenic

Mining, pesticides, chemical waste

Toxic, carcinogenic

Beryllium

Coal, nuclear power and space industries

Carcinogenic

Boron

Coal, detergent formulations, industrial effluents

Toxic to some plants

Cadmium

Industrial effluent, mining waste, metal plating, water pipes

Replaces zinc bio-chemically, causes high blood pressure, kidney damage, destruction of testicular tissue and red blood cells, toxic to fish

Copper

Metal plating, industrial and domestic waste, mining, mineral leaching

Toxic to plants at moderate levels

Chromium

Metal plating, cooling tower water additive (chromate) normally found as Cr (VI) in polluted water, mining

Carcinogenic as Cr (VI)

Fluorine (fluoride ion)

Natural geological sources, industrial waste, water additive, industrial emissions

Prevents tooth decay at about 1 mg/I, causes mottled teeth and bone damage at about 5 mg/I

Lead

Industry, mining, plumbing, coal, gasoline

Toxic (anaemia, kidney disease, brain and nervous disorder)

Manganese

Mining waste, acid mine drainage, microbial action on manganese minerals.

Relatively non-toxic to animals, toxic to plants at higher levels, stains fixtures and clothing

Mercury

Industrial effluent, mining, pesticides, coal

Highly toxic to bio-systems

Molybdenum

Industrial effluent, natural sources

Toxic to animals, essential for plants

Selenium

Natural geological sources, sulphur, coal

Essential at low levels but toxic at higher levels.

Zinc

Industrial effluent metal plating, plumbing

Essential in many metalloenzymes, toxic to plants at higher levels

Benzidine

Manufacture of dyes, rubber, plastics, printing ink.

Causes bladder cancer

Beta-naphthylamine

Dye manufacture, reagent

Causes bladder cancer

Bis (chloromethyl) ether

Ion-exchange resin manufacture

Causes lung cancer

Ethyleneimine

Paper and textile treating

Beta-propiolactone

plastics manufacture

Caricinogen

Ethylene dichloride

Industrial solvent, grain fumigant and gasoline additive for lead scavenging- 74 ¥ 1O4 kg are lost to environment each year

Causes stomach, spleen, lung cancer

(Contd)

Environmental Toxicology

457

Table 9.1 (Contd) 3,3- dichlorobenzidine

Dye manufacture

Carcinogen

Methyl- chioromethylether

Ion-exchange resin manufacture

Usually contaminated with carcinogenic bis (chloromethyl) ether.

4,4-methylenebis (2-chloroaniline)

Plastic curing agent

Cause bladder cancer

Alpha- naphthylamine

Anti-oxidant, dye manufacture, colour film manufacture

Cause bladder cancer

4-nitrophenyl Vinyl chloride

Chemical analysis Polyvinyl chloride plastics (PVC) manufacture

Cause bladder cancer Causes liver cancer

9.3

FACTORS AFFECTING TOXICITY

1. Host factors (a) Size or body weight The size or body weight of an individual determines the dose of a chemical agent required eliciting a given response. Metabolism is proportional to body surface area. This function determines tolerance limits and acceptable daily intake of a drug/chemicals. (b) Age Human infants are usually susceptible to chemicals/drugs, which may be relatively safer at a later period of life as these are related to metabolism (oxidative pathways) and excretion pattern. Immaturity of kidney, brain and deficiency of some key enzymes like glucuronyl transferase activity results enhanced toxicity of chemicals. Glucuronyl transferase enzyme is involved in detoxification. (c) Species and Strain Biotransfermation mechanism may be species specific, even strain specific. (d) Sex Sex hormones influence enzymes of bio-transformation of a compound Females have small size and hence lower dose of drugs and chemicals required. They are susceptible at pregnancy also. (e) Nutrition

High fat diet makes organisms sensitive to toxicants. High carbohydrate or protein diet makes the organisms less sensitive. (Hepatotoxic effect, affecting kidney, affecting brain and nervous system).

(f) Change in internal environment Physiology factors such as, physical activity, stress condition, hormonal state of animals, ageing of internal organs, pathological conditions, influence toxicity of a compound.

Besides, susceptibility of an animal or human to a drug or chemical toxicity can be affected: (1) by physical and chemical property of the toxicant. (2) solubility in water. (3) solubility in vegetable oil. (4) suspending medium. (5) chemical stability of the toxicant. (6) particle size. (7) rates of disintegration and dilution. (8) grittiness of the substance etc.

Fundamentals of Ecology

458

9.4

ROUTES AND RATE OF ADMINISTRATION

The route that carries the toxic substances/chemicals to the blood stream is important. The lethality of the toxic substance/chemical is dependent on the route of administration. Normally the following three routes are used to determine the medium lethal dose (LD50): 1. oral route, 2. dermal route, and 3. inhalation route Toxicity becomes maximum by the route that carries the compound to blood stream rapidly. 1. A compound can be more toxic, if an active product is formed in the alimentary canal. 2. A compound can be very toxic if the absorption of the compound is maximum in the gastrointestinal tract. Chemicals are considered either extremely toxic or highly toxic depending upon dose administered producing 50% lethality in the test organism (Table 9.2). Table 9.2

Toxicity in different routes of administration

Degree of toxicity

Extremely toxic Highly toxic

Medium lethal dose by the oral route (oral toxicity) LD50 (mg/kg) body weight of test animals

Medium lethal dose by the dermal route(dermal toxicity) LD50 (mg/kg) body weight of test animals

Medium lethal concentration by inhalation route (four hours) LD50 (mg/I) inhalation on test animals

1–50

1–200

0.1–0.5

51–500

201–2000

0.5–2.0

These factors are important in determining lethal doses.

9.5

ENVIRONMENTAL FACTORS/ BEHAVIOURAL FACTORS

The following factors may affect/influence the response of an animal or man to a drug/toxic chemical. 1. The attitude of the animal/man can influence the toxic response to drugs to some extent. 2. Presence of other male/female individuals of the same species can affect toxic reaction to certain chemicals due to fear, aggression, emotions etc. 3. Physical factors like light, temperature, RH etc. influence the response of the organism to drug/ chemical. The effects of temperature on the LD50 of several chemicals in rat have been studies. Dry condition and warm, humid conditions may affect response of the animal/man. Dark— light cycles of the day may also affect. Dose It specifies the amount of chemical administered per unit body weight. The administration route i.e. stomach/skin/respiratory tract/intramuscular/intravenous/transport across the membranes may be incomplete and the absorbed dose will not be identical with the dose administered. An estimate of dose is made from the measurement of environment conditions, food concentration as function of time, frequency of food intake, inhalation rate and appropriate deposition and retention factors.

Environmental Toxicology

459

The dose in the organ/tissue may be estimated by: (a) administered dose or intake, (b) measurement of the concentration in tissues/organ samples, and (c) measurement of concentration in excreta or exhaled air. Presence of the chemical in blood indicates absorption. Drug concentration in blood indicates dose effectiveness. 9.5.1 Tolerance

The toxic reaction of an animal to a given dose of chemical/drug may decrease, remain unchanged or increase on subsequent daily administration of that dose. A decrease in toxic response is usually called tolerance and an increase hyper-susceptibility. The increased enzyme activity for detoxification or elimination of the drug is common mechanism of tolerance development to a drug on repeated administration. Example Chlorpromazine depresses CNS of normal albino rats and lessens their locomotor activity. On

repeated administration of chlorpromazine, an increase in excitatory feedback to the centres depressed by chlorpromazine with a resultant decrease in their sensitivity to depression by the drug occurs. On abrupt withdrawal of the drug, the excitatory feedback is no longer balanced by the depressant action of the drug. It follows a marked increase in activity of the brain with insomnia and augmented locomotor activity.

9.6

EFFECT AND RESPONSE

The terms are used interchangeably to denote a biological change either in individual/population associated with exposure of the dose. Some feel that effect relates to biological change. Response may mean incidence rate of an effect. For example, LD50 value may be described as the dose expected to cause 50% response in a population tested for the lethal effect of a chemical. Effect is measured in a graded scale of intensity or severity and its magnitude related directly to the dose. Some effects may not be evaluated in a graded scale and evaluated as occurring/not occurring. Such effects are called Quantal. Toxic effect of a chemical 1. affects the whole organism. 2. primary effect on a specific organ or target. Acute effects are those that develop rapidly after a single administration. Acute effects can appear repeatedly or prolonged exposure. Chronic effects are characterised by duration and pathological features. (accumulation of toxic substance or it’s metabolism in the body or summation of acute effect). 9.6.1 Latent Period

The time of occurrence of an observable effect after administration of the chemical or drug is called latent period. If the dose is low or exposure to the factor is low the latent period will be longer.

Fundamentals of Ecology

460

9.7 1. 2. 3.

SYNERGISM AND ANTAGONISM

Two chemicals or different structures administered simultaneously may exhibit additive effect called summation or negative effect or negative summation or antagonism. If the agents act on the same organ/tissue and the effect is the algebraic sum of their independent action, it is called additive effect or positive summation or synergism. Potentation or sensitisation If two chemicals are acting on the same or different organs or systems, one chemical is made more effective in the presence of the other it is called potentation or sensitisation.

Example

Two cholinesterase inhibiting pesticides, EPN (O-ethyl O- para nitrophenyl phenyl phosphorothiate) and malathion when given simultaneously to test animals are far more toxic than the sum of their toxicities when fed separately. In contrast to potentiation of toxicity, one agent may antagonise the toxicity of another then the negative summation or antagonism is observed. Such agents do not have to be given simultaneously.

Example Several agents are known to stimulate liver microsomal enzyme activity and may antagonise the toxicity of subsequently administered chemical that area detoxified by the liver microsomal enzyme system.

9.8

BASIC PRINCIPLES OF DOSE RESPONSE

The magnitude of a chemical effect is a function of the dose administered. Characteristics of exposure and the spectrum of the effects are related to each other. This relationship is called dose response relationship or dose effect relationship or concentratin response relationship. Toxicity of substance is dependent on the toxic properties of the substance and on the dose of substance administered. The dose response relationship is a function of (i) concentration of the toxic chemical at the site of action and the site can be a cell organelle, a receptor, another type of macromolecule etc. The interaction of the toxicant can be reversible or irreversible and the interaction usually initiates a proportional response, which may be different types. With reversible interactions at low concentrations occupancy of receptors may be negligible and hence the response is nil to negligible. Hence there may be a threshold below which there is no effect level. With irreversible interactions, a single interaction may be sufficient to initiate a significant response. Repeated exposure brings cumulative effect. For example, inhibition of cholinesterase by organophosphorus pesticide is irreversible in some cases and half-life of inhibited enzyme can be measured in weeks. Initial exposure of a biological unit to a toxicant may not give a detectable response but continuous or repeated exposure could lead to 50% inhibition, which is the level necessary for the toxic effect to be manifested by biological unit (ii) The concentration of the chemical at the site of action is dependent on the dose of the chemical administered to the dose the organism is exposed. Concentration of the toxicant in tissues is usually related to the dose but it depends upon absorption, distribution in tissues, metabolism and excretion etc. Hence concentration of the toxicant may not be directly proportional to the dose. The LD50 of chemicals may be either few micrograms (very toxic chemicals) or several grams (not very toxic). Tables 9.3 and 9.4 provide information on toxicants on the basis of LD50 and on threshold limits.

Environmental Toxicology

Table 9.3

Classflcation of toxicants on the basis of LD50

Category

LD50 value

461

Table 9.4

Threshold limit of some environmental pollutants

Substance

Extremely toxic

1mg/kg or less

Ammonia

Highly toxic

1-50 mg/kg

Carbon dioxide

Moderately toxic

50-500 mg/kg

Carbon tetrachloride

Slightly toxic

0.5-5 gm/kg

Chloroform

Practically non-toxic

5-15 gm/kg

Ethyl alcohol

Relatively harmless

15 gm/kg

Formaldehyde Liquid petroleum gas

Threshold value (ppm) 50.0 5000.0 10.0 50.0 1000.0 5.0 1000.0

For some substance, there is clearly a dose Ozone 0.1 below which no response is measurable and Phenol 5.0 the dose is termed as ‘threshold dose’. This can Propane 1000.0 be seen for quantal responses like presence or Sulfur dioxide 5.0 absence of pathological lesion, teratogenic effect, Trichloroethylene 100.0 or lethality. (iii) The response is obtained due to Turpentine 100.0 administration of a chemical. If the dose response relationship is obtained under many variables then it is difficult to ascertain the key factor or specific toxic agent. Hence, experiments are designed under control conditions so that the dose response relationship is based on the fact that the observed response is a result of exposure to a known toxicant. The determination of threshold dose is important for setting exposure limits and to determine the safe intake of food additives, contaminants like drug residues, pesticide residues etc. The acceptable daily intake (ADI) is determined by use of suitable safety factor (say, 100). No observed effect level (NOEL) ADI = 100 And NOEL is determined in mg or mg per kg body weight or biological unit per day. It can also be used in deciding occupational exposure time limits. 9.8.1 Therapeutic Index

The margin of safety for a chemical is the range doses between a non- effective dose and lethal dose. For a drug, the pharmacologist or physician is interested to estimate the margin of safety considering the range of doses between the dose producing a lethal effect and the dose producing the effect desired (ED). Hence, therapeutic index is the ratio of LD50 and ED50 (ED50 amount of drug/chemical that produces desirable effect in 50% of the organism/biological unit tested). Therapeutic index =

LD50 ED50

9.8.2 Dose Effect Relationship: (Figs 9.1 and 9.2)

(i)

The quantitative type which relates the dose of a chemical to the size of the response in a single biological unit.

Fundamentals of Ecology

462

Fig. 9.1

Fig. 9.2

Organismal response to chemical dose.

Dose effect relationship (log transformation)

(ii)

The quantal or all or none type in which the relationship is between the dose of the chemical and the proportion of biological objects displaying a given response. For response of an isolated rat colon to increasing conc. to carbachol, the isotonic contraction of the colon is expressed as per cent of the maximum response on the ordinate. The degree of effect produced by increasing dose of a chemical or drug will ultimately reach a steady level called Ceiling effect. Doses beyond the ceiling effect do not produce any further effect. Rather such a dose may produce undesirable response. The ceiling effect or ceiling dose is used for comparison of therapeutic efficacy of several drugs. Quantal response Minimum dose, that produces a given effect in a population of biological objects is called quantal response.

The relationship between dose and response is usually established when the chemical/ drug effect at a particular dose has reached a maximum or a steady state level. Chemical effects change with time. Thus the magnitude of a chemical effect at any given moment is a function not only of the dose but also of the amount of time elapsed since the chemical made contact with the reactive tissue (Fig. 9.3). Fig. 9.3

Time action curve or time effect relationship

The distinct phase Phase 1 Time of onset action (Ta), administration of a chemical agent to the system(Æ) delay in time before the effect is manifested (lag phase has a finite time). For some chemicals the lag phase may be very small. Phase 2 (Tb) Time to peak effect (the chemical has reached even the most tolerant cell and in acces-

sible cells). Phase 3 (Tc)

Duration of action depends upon the rate at which it is metabolised or altered or inactivated or removed from the body.

Environmental Toxicology

463

Phase 4 (Td)

Residual effects. Many chemicals exert a residual action even after primary action is over. It may not be possible always to determine whether residual effect is caused by a persistence of minute quantities of the chemical or by persistence of subliminal effects.

9.9

STATISTICAL CONCEPT OF TOXICITY

A compound administered to a uniform population of biological specimen will exhibit the following dose and mortality relationship. LC50/LD50 values can be calculated either by (i) graphic method or by (ii) probit mortality curve method. In graphical method, concentration/dose of toxicant is plotted against mortality % and 50% mortality corresponding to the dose/concentration is calculated as shown in the Sigmoid graph (Fig. 9.1). But in the probit mortality curve (Figs. 9.2 and 9.4) method, log values of concentration/dose of toxicant is plotted against porbit mortality, which is obtained from acute lethality test with time dependent (usually 48 hours/96 hours) LC50/LD50 values and their 95% confidence limit (Finney 1971). In a simple way, the mortality in any Fig. 9.4 Straight line dose–response concentrationldose of toxicant can be corrected as follows. curve % test mortality at a particular concentration/ dose within a time period

–

% mortality in control within the same time period

Corrected mortality in % =

¥ 100

100 – % mortaility in control This can be plotted against log, concentration or dose of the toxicant and LC50/LD50 can be calculated. LD1 and LD99 can be plotted accordingly. The slope of the lethal dose line in animal studies is of considerable assistance in arriving at an estimate of the maximal non-lethal dose even for man. Margin of safety Hypothetical dose response curves for two chemicals (A and B) administered to a uniform population of biological specimens is given here. Chemical B indicating a greater margin of safety than chemical A (Fig. 9.5).

Fig. 9.5 A

Hypothetical dose–response curves for two chemicals, A and B

Fig. 9.5 B

Hypothetical LD50 response curve for two chemicals, A and B

Fundamentals of Ecology

464

9.10 TRANSLOCATION OF TOXICANTS The process of transport of toxic substances from their application site to the action site(s) is called translocation of toxicants. Translocation of a toxicant (toxic chemical/drug) involves absorption across biological membranes and hence membranes are barriers for toxicants to enter into cell or cell organelle. Usually the toxicant is absorbed through the skin into the body of an animal or man or through the alimentary canal during intake of food or through the lungs by inhalation. To reach specific site of action, the toxicant has to pass across cellular, nuclear or mitochondrial membranes. The toxicant can be stored in some organs or tissues, which can convert them into other substances. Some enzymes in certain organs like liver of mammals can do the biological conversion of toxicants. Besides membrane barriers there is blood—brain barrier (this barrier prevents neuro-toxicants to reach the brain), placental barriers etc. Toxicants can be absorbed into body either by (1) passive transport involving simple diffusion and filtration, or (2) by special transport mechanism like active transport, facilitated diffusion, and (3) by phagocytosis and pinacocytosis. Absorption of the toxicant usually occurs through skin, alimentary canal and lungs but it can occur through special routes like intraperitoneal route, subcutaneous route, intramuscular route and intravenous route. Some toxicants easily pass through membrane barriers and get distributed through the body while some others, because of their large molecular size and other properties cannot readily pass through barriers and their distribution in the body is restricted. The concentration of toxicant in blood plasma is important and is measurable. This is important because it reflects the distribution of the toxicant in the body. A toxicant highly soluble in lipids will have low concentration in the plasma. Whereas a toxicant less soluble in lipids will have high concentration in the blood plasma. The volume of distribution of the toxicant (VD) is measured as follows: Dose mg/mg VD = Plasma cocentration (mg or mg) The toxicant can get stored in a particular organ because of its affinity to some tissues or macromolecule. Some toxicants can be deposited in adipose tissue. These storage depots are protective mechanism developed in the body of organisms. These storage depots for toxicants are (1) liver and kidney, (2) fat, (3) plasma protein, and (4) bone. The toxicants can be excreted through kidney, bile, lungs, faeces, sweat gland, tears, semen etc.

9.11

MECHANISM OF TOXICANT ACTION

The effects of toxicant result from their interaction with certain receptors of the organisms. Any functional macromolecular component can serve as toxicant/drug receptor. Some exogenous molecules are called Agonists as these molecules mimic some of the effects of endogenous substances due to their interaction with some physiological receptors. Certain substances may not have endogenous regulatoiy activity but they compete with agonists for binding to receptors or at specific sites. These substances are called antagonists. These receptors can be macromolecules with which chemicals/drugs interact to produce characteristic effects and these receptors can be (1) protein receptor: Cellular proteins are toxicant receptors. Acetylcholine receptor is a protein found at the nerve synapse and this substance is embedded in the outer membrane at the proximal end of postsynaptic neuron. (2) Specfic enzyme

Environmental Toxicology

465

receptor: For example, acetylcholinesterase, which hydrolysis neurotransmitter (ACh) into choline and acetic acid act as a receptor for organophosphorus and carbamate pesticides. Na+ - K+ - ATPase is a receptor of cardiac glycosides and some Organochlorinated pesticides. (3) Nucleic acid receptor: Usually drug receptors such as furanocoumarins, steroid hormone etc. Cancer drugs are targeted to specific sites by linking them with DNA/RNA molecules. Many endogenous and exogenous substances form complexes with receptors. Complex formation triggers some stimulus, which is translated ultimately to physiological, biochemical and neurological effects depending upon the characteristics of the endogenous and exogenous substances. The binding of substances with receptors involves all kinds of interactions viz, ionic, hydrogen, hydrophobic, van der Waal’s and covalent bondings. Most of the exogenous substances like drugs bind with their receptors very loosely. This binding may involve bonds, viz, ionic, hydrogen and van der Waal’s bonds. Since these bondings are weak, the interactions are reversible. In case of covalent binding the duration of interaction is prolonged. The toxicant—receptor interaction involves occupation of receptor site by a toxicant, which has structures complementary to the sites of the receptor. Some exogenous substances like organophosphate and carbamate pesticides have structural similarities with acetylcholine, neurotransmitter. These pesticides inhibit AChE activity. If a toxicant has low dissociation constant, it can occupy the receptor site for a relatively long time. The distribution of receptors on the body of the organism is important aspect of formation of toxicant— receptor complex and their actions. For example, choline receptors may occur in peripheral nerves which control muscle and organ functions. If choline receptors are blocked by some pesticides, the blocking may affect functions controlled by these nerves and therefore death may occur primarily because of blocking of breathing or cardial function. Some exogenous substances may effect the control systems in the brain. 9.11.1 Pesticide Action

DDT is an axonic poison. DDT is not equally effective on all axons. Its effects are more pronounced on the axons of sensory nerves than of axons on motor neurones. DDT disrupts the movements of sodium and potassium ion across the nerve membrane and produces repetitive discharges in the neurones causing tremors, exhaustion and death. Since DDT has great affinity for lipids, it forms complexes with axonal membrane lipids and blocks the sodium ion gate. DDT also inhibits Na+- K+ - ATPase. Some Organochlorinated pesticides like Aldrin and Dieldrin produce neurotoxic effects by affecting the release of ACh from presynaptic vesicles and interfere in synaptic transmission. There are four types of organophosphorus pesticides, viz. Phosphorothionate (having P(S)O group) and phosphorodithionate (containing P(S)S group, phosphate (containing P(O)O group) and phosphorothionate (containing P(O)S group). The first two categories of organophosphorus pesticides contain P(S) group whereas the latter two have P(O) group. Organophosphorus pesticides containing P(O) group are strong AChE inhibitors, and strongly toxic. The compounds containing P(S) group, are not strong inhibitors, and are less toxic. However, organophosphorus and carbamates differ in their mode of action although both groups are inhibitors of AChE activity. These inhibitors differ due to different reaction rates and affinity constant. If the active part of the compounds is denoted as ‘A’ and the leaving group as ‘X’ the generalised reaction between AChE and ACh or AChE inhibitors will be as follows. EOH + AX

k1 –1

k2 EOH – AX Æ EOA Æ

k

–

X +H

+

k3 H 2O

–

EOH + A + H

+

Fundamentals of Ecology

466

In this equation EOH represents an enzyme, EOH-AX represents a reversible complex, EOA represents acetylated, phosphorylated and carbamylated enzyme, k1, /(k–1, k2 and k3 indicate reaction rates k–1/k1 = ka which represents affinity constant between enzyme and inhibitors or substrate. 9.11.2 Differences between Different Pesticide Function

The affinity constant ka is a function of structural resemblance of the compound with AChE molecule. In reaction involving ACh and AChE small value of ka indicates high affinity between the enzyme and substrate and EOH-AX complex formation is favoured. High values of k2 and k3 indicate that reaction rates are fast and the acetylation and hydrolysis are rapid. In reactions involving organophosphates and carbamates pesticides with AChE, k2, k3 gives low values, which indicate that EOH-AX complex hydrolysis and phosphorylation or carbamylated enzyme (EOA) are slow, which cause accumulation of both of these forms. In this process the ‘A’ group of these inhibitors get attached to the esteratic site of the enzyme (AChE) and hence the enzyme does not react with the substrate(ACh). Reaction of AChE with organophosphate pesticides involves high values of k1 and k2 (30/min) and –1 low values of k and this situation indicates that EOH-AX of complex never tends to accumulate. The value of k3 is nil to negligible which indicates rate of hydrolysis is very low. In the process EOA form of the enzyme (inhibited form of enzyme) accumulates. In reactions involving carbamate pesticides and AChE, affinity constant (ka) shows very low value and quick formation of enzyme inhibitor complex (EOH-AX) occurs. k2 shows low values (1/min) and the rate of conversion of EOH-AX into inhibited form of the enzyme is very slow. In this process accumulation of EOH-AX complex occurs. The value of k3 is around 0.05/min, although smaller yet more than those of reactions involving organophosphates. The small k3 value shows that conversion rate of EOA into EOH is very slow and hence EOA form of enzyme (inhibited form) gets accumulated.

9.12

BIOTRANSFORMATION OF TOXICANTS

Biotransformation of toxicants in the living system involves catalytic conversion of a chemical into another involving enzyme. Metabolism is referred to the biological conversion of nutrients like proteins, fats, carbohydrates etc. in living systems for its maintenance and continuance, whereas biotransformation involves transformation (neutralisation) of a toxicant or a toxic chemical into another comparatively less toxic or inactive form. Enzymes involved in biotransformation are usually more concentrated in the midgut regions, liver, and kidney. Liver in vertebrates neutralises toxic substances and xenobiotic substances from the portal circulation and modifies them into inactive forms or another active chemical form and which can be excreted into the bile or can be released into general circulation. The enzymes involves in biotransformation of xenobiotic compounds or toxicants have usually low degree of substrate affinity and these enzymes can catalyse reactions involving wide variety of chemicals. The presence of these enzymes in bio-systems is interpreted as a protective device developed in the evolutionary process. 9.12.1 Biotransformation Reactions

Biotransformation reactions are mainly of two types. In Type 1 (Phase 1) the functional group like OH, -SH, -NH2, -COOH of toxic chemicals or xenobiotics are either added or exposed in the process of oxidation, reduction and hydrolysis, whereas Type 2 reactions (Phase 2) consists of conjugation

Environmental Toxicology

467

and synthesis. In the Type-1 reactions the mixed function of oxidase enzyme system are involved. This system is otherwise called as mono-oxygenases, which catalyses the incorporation of one atom of molecular oxygen into substrate. These enzyme systems are cytochrome P-450 and cytochrome P-450 reductase. Esterase and amidases are the hydrolytic enzymes and they also expose functional groups of toxic chemicals or xenobiotic. These enzymes are usually located in the endoplasmic reticulum. Constituent enzymes of microsomal mixed function oxidase have not been fully established with regard to neutralisation or biotransformation of toxicant. However, the involvement of these enzymes in biotransformation has been identified. Microsomal hydrolytic enzymes like epoxide hydrolase are considered as a detoxication enzyme. Some non-specific esterases and amidases occur in mammalian tissues and these enzymes hydrolase ester and amide linkages of toxicants and xenobiotic substances. Biotransformation of toxicants/pollutants/xenobiotics depend upon concentration of the chemical in the specific target site but their chemical nature (lipophilic or hydrophilic or polar), environmental factors like temperature, light, moisture etc. and it may be species specific or strain specific or it may depend upon sex, age, body weight of the animal or man, nutritional status, health conditions, etc. Sometimes, a pollutant may be biotransformed into a more active chemical and this process of conversion of inactive or less active pollutantlxenobiotics into more active products is called bioactivation. For example, phosphorothionates and phosphorodithionates having P = S group are poor inhibitors AChE but in mammals and insects these compounds are bioactivated into more active form of organophosphates having P = O group by the microsomal mixed function oxidases. After the bioactivation these compounds become more active and become potent inhibitors of AChE. Likewise, the less active malathion having P = S group is bio activated into malaoxon having P = O group and parathion into paraoxon.

9.13

BIO-ACCUMULATION OF POLLUTANTS/ XENOBIOTICS

Chemicals accumulate in biological systems and bioaccumulation can be (1) bioconcentration which is a process involving entry of the chemical into the body of an organism from the surrounding medium and accumulation in some specific tissues, (2) bioaccumulation usually involves accumulation of xenobiotic chemicals in the body tissues from the surrounding and from food intake. Bioaccumulation also involves uptake of chemicals in dissolved and suspended form in the water, (3) biomagnification, which involves bioconcentration, bioaccumulation and movement of the toxic chemical or pollutant in the bio-system involving gradual increase in the concentration of the chemical in the living tissues as it passes through food chain. The bioconcentration factor (BCF) in aquatic ecosystems can be taken as follows. BCF =

Concentration of chemical in tissues / organism (for unit bodym mass) Concentration of chemical in water (per litre)

9.14

ANTIDOTES

Substances/chemicals used by man to prevent adverse effects or toxic effects of pollutants in the body are designated as antidotes. Antidotes are highly specific, a particular antidote is used against a particular pollutant. However there are some antidotes, which can be considered universally or broadspectrum

Fundamentals of Ecology

468

antidotes, which are used for neutralisation of unknown pollutants. For example, an antidote containing activated charcoal (2 parts), one part of magnesium oxide and one part tannic acid is used in case of poisoning by acids, alkaloids, heavy metals and glucosides. This is considered a multiple antidote. A simple antidote is a carbonate, which may not be suitable to neutralise acid poisoning. 1% calcium chloride CaCl2 or lime water is used as antidote for NH3 gas poisoning. Some neutralisers like sodium thiosulphate can be considered as an antidote as it neutralises cyanide poisoning by forming sodium thiocyanate which is a non-toxic compound. Tannin is a neutraliser or antidote, which acts as a precipitating agent. An activated charcoal is considered as mechanical antidote as it adsorbs poisons. Various chelating agents like Pb-EDTA chelate, Pb-2, 3-dimercaptopropanol and 2, 3-dimercaptopropanol form stable complexes with lead and arsenic respectively and facilitated their excretion and thus act as antidote for metallic pollution. Some of these chelating agents are also considered as competitive antidotes as they compete with poisons for the receptor site binding or some are non-competitive antidotes as they induce physiological and biochemical changes increasing the resistance of organisms to the pollutants.

9.15

TOXICITY TESTS

Toxicity tests are performed depending upon the need. The test can be (1) single species test, (2) multi species test, or (3) community/ecosystem level test. The single and multi species tests are usually performed in the laboratory and the ecosystem level test are usually done in controlled field condition or in Lab ecosystem model. The tests may involve single dose test and or multi dose test. In single dose test the toxicant is applied only once and the desired effect is recorded after certain interval. The multiple dose tests are performed administering usually more than 2 dose levels (usually 3 dose or 5 dose levels) and these type of studies characterise, dose—response relationship, tolerance levels etc. Basing on exposure time the toxicity dose can be considered (1) acute toxicity test, or (2) chronic toxicity test. In the acute toxicity test the aim is to determine the test/concentration of test materials producing adverse effect on a group of test organisms during short-term exposure under controlled laboratory conditions. The chronic toxicity tests is usually designed to investigate the effects of a toxicant over prolonged periods either to the entire life cycle of the organism or to a particular stage of the organism or the most sensitive stage of the organism. These tests are helpful in understanding the mechanism of toxicity of chemicals and finding out the sensitive stages in the lifecycle of an organism and the safe level (sublethal doses etc.) of toxicants. In toxicity tests usually rodents (small mammals) are used as laboratory animals and the data are extrapolated to human beings. In pesticide toxicity testing, earthworm models are extensively used. In the proceeding chapter (pollution ecology) toxicity of heavy metals have been discussed and in this chapter toxicity of some pesticides are discussed (case studies).

9.16

SOME CASE STUDIES

1. A study was undertaken to find out the LC50 values for fenitrothion and monocrotophos, two organophosphorus insecticides on Drawida calebi, Drawida wilisi, Lampito mauritii and Octochaetong surensis earthworm species in the Laboratory conditions after acclimatising the worms to the experimental conditions. The worms were kept half immersed in tap water at room temperature. Six worms of each species per petridish in three petridishes were taken as control. Similarity six worms of each species in triplicate were taken as experimental. The control worms were kept in 25 ml of tap water.

Environmental Toxicology

469

Experimental worms were exposed to different concentrations (0, 5, 10, 12, 14, 16, 18, 20, 22 and 24 ppm) of monocrotophos suspensions for two hours and then transferred to petridishes, each containing 25 ml of tap water. LC50 was calculated following probit analysis (Finney, 1971) considering the 48h lethality after exposure (Table 9.6). The water in each petridish was changed every day to prevent accumulation of excretory materials. The experiment was continued for 10 days with four different sublethal concentrations (5, 8, 10 and 12 ppm) of monocrotophos and 0 ppm as control to see the effect of pesticides as well as of starvation on these worms. Details of insecticides used are given in Table 9.5. LC50 values ranged from 14.1 ppm to 18.2 ppm for monocrotophos and 12.6 ppm to 15.9 ppm for Fenitrothion suspension. Worms become more ureotelic and ammonotelic due to starvation and the rate of excretion gradually increased with concentration of pesticide suspension and time of exposure. Higher concentration, after long exposure period proved to be fatal for all the species (Patnaik and Dash, 1990 and 1991). Table 9.6 gives information on toxic effects of some’ organophosphorus compounds on earthworms. Table 9.5

Details of the insecticides used.

Trade name/ common name

Chemical name

Empirical formulae

Half ljfe

Sumithion 36% EC/Fenitrothion

O, O-dimethyl 0-3 methyl-4 nitrophenyl phosphorothionate

C9H12NO5PS

8-9 days

AIMOCRON 36SL/ Monocrotophos

(E)- Dimethyl 1-methyl-3- (methylamine)-3- (Oxo1- propenyl phosphate

Table 9.6 A

(CH3O)2P(O)OC–CHCONHCH3 CH3

48 hour mortality of earthworms at different concentrations of monocrotophos exposure (for 2 hour).

Monocrotophos concentra tion

Earthworm Species

Drawida calebi I

(ppm)

LC50

0

0.393–0.456

5

II –

Drawida wilisi I LC50 0.167-0.207

–

II –

Lampito mauritii I LC50 0.47–0.442

–

II –

Octochetona surensis I LC50 0.447-0.476

II –

–

10

16.7

–

–

16.7

12

33.3

16.7

16.7

33.7

14

33.3

33.3

16

14.79 ppm

33.3 66.7

15.85 ppm

50.0

50.0

66.7

18

66.7

83.3

50.0

83.3 83.3

18.20 ppm

14.125 ppm

50.0

20

83.3

83.3

66.7

22

100

100

83.3

100

24

100

100

100

100

I: Body live weight (g), II: % killed, LC50: Based on graph (Finney, 1971) (Log dose vs. empirical probit). Each value represents an average of five replicates.

Fundamentals of Ecology

470 Table 9.6 B

Toxic effects of some organophosphorus compounds on earthworms (a = acre).

Organophosphorus compounds

Toxicity

Notes

Azinphosmethyl

Moderately toxic

100% survival of adults, large reduction in reproductive rate of Eisenia species after 8 weeks exposure at 5.6 kg/ha.

Phorates

Very toxic at normal dose rates.

Numbers were reduced by 91.8% and biomass by 91.6% in comparsion to control at 3.4 kg/ha.

Disulfoton

Slightly toxic, probably not significant at normal dose rates.

Reduction in numbers varied with the species, LC50 29.62 lb/a. for L.terrestis

Fonofos

Moderately toxic

LD50 = 28 kg/ha a.i. for L.terrestis

Fenitrothion

Slightly toxic

Surface application at 2.24 kg a.i./ha had no significant effect no A. caliginosa population.

Ethoprop

Very toxic at normal dose rates

LD50 = 5.08 kg/ha a.i., for L.terrestis.

Malathion

Non-toxic at normal dose rates

90% survival of adult Eisenia species. No effect on reproductive rate after 8 weeks exposure at 8.4 kg/ha.

Chloropyrifos

Slightly toxic

Slight effect on mortality was noted at 1 lb/a-no effect was noted at 2 and 4 lb/a. LC50>32 lb/a for L. terrestis.

2. Organophosphates inhibit cholinesterase (ChE) activity with consequent accumulation of acetylcholine are nerve-endings, which disrupts the neuronal activity and kills both vertebrate and invertebrate animals (O’Brien, 1967). The degree of ChE inhibition is, therefore, widely accepted as a method of assessing the exposure of animals to organophosphorus insecticides (White et. al; 1979, Busby et al: 1981, Zinkyl et. al; 1981). Earthworms (non-target organisms to insecticides) play important role in soil fertility, organic matter recycling and soil energetic in the ecosystem. The biological sensitivity and constant exposure of earthworms to a variety of toxicants in their natural habitat have made them choice organisms for monitoring the environmental impact of toxic burden from ever-increasing use of synthetic chemicals. A study was undertaken (Patnaik and Dash, 1992) to determine the acute toxicity of fenitrothion through its potential to inhibit ChE activity in the nerve and muscle tissues of two commonly found Indian earthworm species, Lampito mauritii (Kinberg) and Drawida calebi (Gates) and its recovery potentiality after a short-term, sub-lethal exposure. 9.16.1 Methods

Fenitrothion, 36 % SL (o,o-dimethyl-o-3-methyl-4-nitrophenyl phosphorothionate) was obtained from Bayer India Limited, Bombay. Adult worms (size ≥ 4 cm, clitellum well developed) of L. mauritii and D. calebi were maintained in the laboratory pot culture. For experimentation, worms were kept in petridishes half-immersed in deionised water at 25 ± 3°C (laboratory temperature) for 24 h to clean the gut contents. Six worms of a species per petridish in six petridishes were considered as one set. Six such sets (three each for D. calebi and L. mauritii) were taken for each experiment.

Environmental Toxicology

471

Worms of these two experimental sets containing two different species were kept continuously half immersed in 30 ml of 7 ppm (approximately LC20 dose equivalent, fenitrothion suspension Patnaik and Dash (1990). In two other experimental sets, worms were exposed only for one hour and then transferred to petridishes containing 30 ml of deionised water. Two sets for two different species were taken as control. Throughout the study the containers were changed every 24 h. Five worms from five different petridishes for both control and treated sets were killed at a time interval of 1 h, 12 h, 24 h, 3 days and 7 days for estimating the ChE activity of nerve and muscle tissue by colorimetric method of Bergmeyer (1968). The units of ChE activity is expressed in m moles of acetylcholine hydrolysed per mg protein per hour. The proteins content of the tissue homogenates were determined according to Lowry et. al, (1951) using bovine serum albumin as standard. The values recorded are the average of four observations. Student ‘t’ test was applied for statistical significance between control and treated values. 9.16.2 Pesticide-Enzyme Interaction

Tables 9.7 and 9.8 represent the ChE activity of nerve and muscle tissues of control and exposed D. calebi and L. mauritii in continuous and one hour exposed worms. In both the worm species, the nerve tissue possessed greater ChE activity than muscle tissue. Species wise D. calebi exhibited greater nerve ChE activity and less muscle ChE activity in comparison to L. mauritii. An inhibition in enzyme ChE was observed in both muscle and nerve tissues of both the worm species suddenly after the pesticide exposure. In worms exposed only for I h to fenitrothion suspension showed a significant reduction after 1 h of reintroducing the worms into deionised water. The percentage reduction after 1 h of lh sub-lethal fenitrothion exposed worms in comparison to control sets of worms were 18.9% and 23.97% for D. calebi and 13.4% and 24.2% for L. mauritii for nerve and muscle tissues, respectively, (Table 9.8). However the treated worms recovered to normal ChE activity in nerve and muscle tissues within 12th after exposure in L. mauritii and 24 h after exposure in D. calebi. The experiment was continued for 7 days to notice any delayed effect due to this short-term fenitrothion exposure. Table 9.7 shows the ChE activity of earthworms continuously exposed to fenitrothion suspension compared to a normal set of worms for seven days. The percentage reduction in ChE activity increased with the time of exposure. The maximum percentage reduction recorded after 7 days in nerve tissues were 59.1% and 54.5% for D. calebi and L. mauritii, respectively. Muscle tissues, however, showed a less percentage reduction as compared to nerve tissue (41.0% and 50.4% for D. calebi and L. mauritii, respectively). The overall reduction of ChE activity in nerve and muscle tissues of exposed worms were statistically significant as compared to control set of worms (for D. calebi t = 3.06 for nerve and 2.93 for muscle tissues, p < 0.05 and for L. mauritii t = 4.7 for nerve and 4.4 for muscle tissues, p < 0.25, respectively). Biological activity of organophosphorus compounds is in many cases related to their phosphorylating or alkylating ability (Eto, 1974). The rate and mechanism of hydrolysis, methanolysis and serine enzyme inhibition were examined to evalute the reactivity or toxicity of these organophosphorus compounds (Ozoe et. al; 1982). Copage, 1972 suggested that there is a critical level of AChE inhibition in the range of 70 to 80% in the sheephead minow, which serves as an index to fish poisoning and fish death. The maximum percentage reduction of 40% and 60% recorded in the present study after 7 days of fenitrothion exposed worms showed the higher survival limit after which the worms died.

29.82 ±4.36

±4.2

±4.39

±9.2

49.12

30.06

±6.59

±6.2

50.86

30.32

53.01

30.53 ±4.36

53.49

± 7.8

Calebi Muscle

±5.6

43.22

±4.6

45.81

±3.8

45.99

± 4.5

46.39

Lampito Nerve

±4.12

30.99

±3.69

31.44

±3.69

31.49

± 4.03

31.68

Mauritii Muscle

28.99 ±3.89 (8.49) 25.76 ±3.66 (18.2) 23.55 ±3.82 (25.1) 15.38 ±4.44 (50.37)

39.43 ±2.3 (15.01) 32.31 ±4.6 (29.75) 29.81 ±4.2 (34.93) 19.66 ±3.2 (54.51)

25.13

(17.69) 22.39 ±5.11 (26.15) 19.86 ±4.86 (33.92) 17.59 ±3.97 (41.01)

(10.5)

±3.6 (19.8)

±9.2 (27.68)

±4.8 (59.06)

20.11

36.78

42.51

47.88 ±5.21

Mauritii Muscle

Lampito Nerve

Calebi Muscle

±9.1

Drawida Nerve

Treated (exposed to fenitrothion)

*Values are mean ± SD of four observations. Values shown in parentheses are per cent inhibition.

7 days

3 days

24 hrs

12 hrs

Drawida Nerve

Control

ChE activity * = m moles of ACh hydrolysed per mg of per hour

ChE activity in the nerve and muscle tissue of Drawida calebi and Lampito mauritii worms on continuous exposure to the pesticide suspension.

Duration of exposure

Table 9.7

472 Fundamentals of Ecology

26.71 ±3.6

±3.7

±3.8

±3.6

44.67

26.46

±4.2

±4.1

45.81

28.57

±6.1

±2.9

47.17

30.71

±2.9

±3.2

48.47

29.87

48.96

Calebi Muscle

±4.2

33.71

±1.7

36.77

±2.9

39.18

±3.5

39.89

±2.8

41.17

Lampito Nerve

27.97 ±3.5

±2.2

29.57

±2.6

30.46

±4.1

32.96

±3.7

33.13

Mauritii Muscle

25.11 ±1.2 (24.21) 32.17 ±0.9 (2.4) 30.55 ±1.9 –(0.29) 28.99 ±2.1 (1.96) 27.72 ±3.1 (0.88)

36.66 ±3.7 (13.38) 39.96 ±4.1 –(0.18) 38.67 ±3.3 (1.31) 37.01 ±3.2 –(0.65) 33.36 ±3.2 (1.04)

22.71 ±1.8 (23.97) 27.76 ±1.6 (9.61) 29.11 ±1.9 –(1.89) 25.98 ±3.2 (1.81) 26.76 ±3.8 (0.88)

±3.1 (18.89)

±4.21 (3.96)

±3.2 (0.59)

±4.1 (0.65)

±4.1 (1.25)

44.1

45.51

46.89

46.55

39.71

Mauritii Muscle

Lampito Nerve

Calebi Muscle

Drawida Nerve

Treated (exposed tofenitrothion)

* Values are mean ± SD for four observations. Values shown in parentheses are per cent inhibition.

7 days

3 days

24 hrs

12 hrs

1 hr

Drawida Nerve

Control

ChE activity * = m moles of ACh hydrolysed per mg of protein per hour

ChE activity in the nerve and muscle tissue of Drawida calebi and Lampilo mauritii worms on one hour exposure to the pesticide suspension.

Duration of exposure

Table 9.8

Environmental Toxicology

473

474

Fundamentals of Ecology

Recovery of ChE activity from sub-lethal exposure of organophosphates is generally considered to be rapid (Eto, 1974). Nakatsugawa and Nelson, 1972 and Stenersen 1979 a,b earlier reported the possibility of detoxification of organophosphorus insecticides in earthworm tissues. There are also reports showing recovery in growth and metabolic processes in earthworms after exposure to organophosphorus insecticides. The present finding give a direct evidence to the fact that earthworm exposed to sub-lethal concentration show an inhibition in ChE activity reciprocal to the time of exposure and the recovery rate is faster in short-term exposed worms. Fenitrothion inhibits cholinesterase (ChE) activity in nerve and muscle tissues of D. calebi and L. mauritii. The degree of inhibition gradually increased with time in continuously exposed worms from about 11% to 59% for D. calebi and 8% to 54% for L. mauritii. Short-term (1 h) exposed worms show no significant reduction after 12 h of reintroducing them to deionised water and recovered completely to normal activity within 24 h. 9.16.3 Metal Toxicity at Cellular Level

We have discussed metal toxicity in pollution ecology chapter. A case study involving aluminium toxicity to fish is discussed here (Naskar et al., 2006 and Naskar and Mukhopadhyay, 2004). 9.16.4 Methods

Naskar et al. conducted laboratory experiments to study aluminium metal toxicity to an air breathing Indian telecast, Clarias batrachus. They collected healthy mature fish and acclimatised the fish in laboratory and conducted a series of experiments at 17–19o C and at 25–28oC ranges in acidic (pH 5.0) medium maintained with stock solution of 1M H2SO4 and water in aquaria, aluminium sulphate {Al2 (SO4)3. 14H2O}. Fishes of same size class and body weights were selected. They were divided into different groups and the control sets were exposed at pH 7.0 only and the experimental sets were exposed to acidic water (pH 5.0) and to acidic water with aluminium (ph 5.0) in triplicate with five fishes for 7 days. They initially determined acute lethal toxicity of aluminium to fish in soft water and determined 96 hour LC50 value percentages of fish death at different concentrations of aluminium. 9.16.5 Effects of Aluminium Toxicity

Acute exposure to aluminium in soft water brings imbalances in osmo-regulatory and iono-regulatory mechanisms at pH 5.0 and this causes loss of sodium and chloride ions at the gills as solubility of aluminium is maximum at pH 5.0. (Waring and Brown, 1995). At higher pH (> 5.0), aluminium toxicity causes respiratory malfunctioning leading to hypoxia, impaired breathing and suffocation to fishes (Playle et al., 1989). Disturbance in Ca2+ regulation also occurs. Naskar et al. (2006) also observed decline in blood serum Na+ and Cl– concentrations due to aluminium toxicity. They also found significant increase in serum K+ concentration values and this was associated with loss in Na+ and Cl– ions in the blood plasma. The scanning electron microscopic studies (Plate-10 and 11) of aluminium treated fishes (provided by Dr. N. Sen of Ranchi University) showed marked abnormalities of blood erythrocyte shape, abnormal roughness and granular appearance on membrane morphology. This indicates cytoskeleton fragility.

Environmental Toxicology

475

There was also swelling of RBC and reduction in Hb content. Exposure of fish to sublethal concentration of 55 mg/l of aluminium exhibited alteration at cellular level in fish gills with huge secretions of mucous from mucus gland openings of gill arches. Exposure of fish to 165 mg/l dose of Al caused damage to epithelial cells of gill arches (Plate-11) and there was evidence of epithelial hypertrophy and hyperplasia of cells at the base of the gill lamellae (Nisarga Sen, personal communication). Lydersen et al. (2002) explained the mechanism of acute toxicity of aluminium in fish due to Al polymerisation by precipitation of Al (OH)3 and other aluminium species on gill surface. Due to industrialisation, there is now threat of metal pollution in water leading to metal toxicity to fish. In the process of movement through food chain, the metallic pollutant ultimately reaches human body and therefore, is a big concern for human health. APPENDIX I Table A-1

Ambient air quality standards for common pollutants

Industrial

Residential

Air pollution sensitive area like hospitals, monuments, sanctuary etc.

SPM

500

200

100

RPM

120

100

75

Parameter

Microgram/M3

SO2

120

80

30

Nox

120

80

30

CO

5000

2000

2000

1

0.75

075

Lead

APPENDIX II Table A-2

Test characteristics of drinking water

SI No.

Parameter

Requirement (Desirable limit)

Remark

01.

Taste

Agreeable

Safety is to be established

02.

Escherchia Coli

No sample (100 ml) should contain Escherchia Coli

10, requires disinfection and pollution control measures.

03.

Turbidity (Nephelometric turbidity unit) NTU

10

Absence of alternate source of water may, be extended to 25.

04.

PH

6.5 to 8.5

In absence of alternate source, it may be extended up to 9.2.

05.

Total hardness (CaCO3) mg/I max.

300

600 in absence of alternate source.

06.

Calcium (as Ca), mg/l, max.

75

200 in absence of alternate source.

(contd)

Fundamentals of Ecology

476 Table A-2 (contd) 07.

Magnesium (as mg) mg/l max.

30

100 in absence of alternate source.

08.

Copper’mg/l, max.

0.05

1.5 in absence of alternate source.

09.

Iron (as Fe) mg/l max

0.3

1.0 in absence of alternate source.

10.

Manganese (as Mn) mg/l max.

0.1

0.5 in absence of alternate source.

11.

Nitrate (as NO3) mg/l max.

45

No relaxation

12.

Fluoride (as F) mg/l

0.6 to 1.2

1.5 in absence of alternate source. If the value is less than 0.6, Public Health measures are to be taken. 1000 in absence of alternate source.

13.

Chloride mg/l max.

250

14.

Sulphate mg/l max.

150

400, provided mg does not exceed 30.

15.

Phenolic Compounds mg/l, max.

0.001

No relaxation is permitted.

16.

Mercury (as Hg) mg/l max.

0.001

No relaxation is permitted.

17.

Lead mg/l max

0.1

No relaxation is permitted.

18.

Cadmium mg/l max.

0.01

No relaxation is permitted.

19.

Selenium mg/l max.

0.01

No relaxation is permitted.

20.

Arsenic mg/l max.

0.05

No relaxation is permitted.

21.

Chromium (Cr6+ mg/l max.

0.05

No relaxation is permitted.

22.

Zinc. mg/l max.

5

15

23.

Pesticides

Absent

Based on Indian Standard Specification for drinking water, Indian Standards Institution, New Delhi, 1983.

MULTIPLE CHOICE QUESTIONS Choose the correct answer 1. One of the following belongs to carbamate group of insecticide: (a) Aldicarb (b) Diaszinon (c) Permethrin (d) Disulfoton 2. What is EIA? (a) Environment Impact Assessment (b) Environment Improvement Assessment (c) Environment Investigation Assessment (d) Ecological Impact Assessment 3. Mercury, lead and cadmium act as very effective enzyme inhibitors because of their affinity to ligands contain: (a) Sulphur (b) Oxygen (c) Magnesium (d) Calcium 4. Two chemicals/agents acting on the same organism/tissue and generating an effect of algebraic sum of their independent action, is called: (a) Potentation (b) Antagorism (c) Synergism (d) Both antagonistic and sensitive 5. Therapeutic index is: (b) LD25 / ED50 (c) LD75 / ED75 (a) LD50 / ED50

Environmental Toxicology

6.

7.

477

The degree of response effect generated in an experimental animal by increasing the dose of a chemical or drug and then reaching a steady level is called. (a) Quantal response (c) Therapeutic effect (b) Ceiling effect (d) Tolerance The combustion efficiency of biomedical wastes is measured by: % CO 2 (a) % CO 2 ¥ % CO (b)

% CO 2 %SO 2 ¥ % NH3

(c)

% CO % CO 2 ¥ %SO 2

(d)

% CO % CO ¥ % CO 2

SHORT AND DESCRIPTIVE QUESTIONS 8. 9. 10. 11.

Give an account of impact of toxic chemicals on enzymes. Discuss the environmental factors that affect the response of an animal to a toxic chemical. What is basic principles of dose response? Explain the following concepts: (a) Therapeutic index (b) Statistical concept of toxicity (c) Mechanism of toxicant action (d) Antidotes (e) Pesticide–enzyme interaction (f) Toxicity tests

10

Molecular Ecology

10.1 INTRODUCTION: WHAT IS MOLECULAR ECOLOGY? Ecology is a wide-ranging discipline, which is usually not very much concerned with interpretation of ecological phenomenon/processes with genetics. However, understanding of the population biology and gene flow in the population depends on genetical research and has been given importance in ecological researches on population. Ford (1975) and Berry (1977) are the pioneer scientists in interpreting ecological events/phenomenon from genetics angle. This discipline is known as ecological genetics, which investigates the genetical roots and environment interaction on expressing variation among individuals in wild populations. The classical work of Ford and others deal with “Industrial Melanism” in the peppered moth, Biston betularia and Polymorphism in the tiger moth, Panaxia dominula. Phenotypic similarity has been correlated with the features of habitat. The background colour and bending patterns of Cepaea nemoralis (land snails) shells differed from one population to another depending upon the background habitat colour. This has been considered an adaptation mechanism to minimise visibility to predators. With this concept of ecological genetics, the modern discipline of molecular ecology has been developed. Molecular ecology is the application of principles of molecular genetics and its methods to understand ecological problems. It is considered a new science. This science as a discipline is documented with the increasing availability and scope of molecular genetics and genetic markers. Problems in ecology, specially conservation and evolutionary problems are understood more clearly with molecular approaches. Molecular ecology also covers understanding aspects of behavioural ecology, population ecology, evolutionary processes and biodiversity conservation (Schierwater et al., 1994, Carvalho, 1998, Frankham et al., 2002). Since ecology has a firm root in systematics, the current scientific efforts to distinguish and classify the varieties of life forms and their phylogenetics relationship and the principles involved in this diversity. Systematics is key to ecology and was revolutionised following Darwin’s Natural Selection theory. Since Darwin, most of the Ecologists and Evolutionary Biologists are involved comparing morphological characters. Linnaeus applied the Binomial method of classification of plants and animals by which every

Molecular Ecology

479

species was identified using two names, one generic and the other specific name. Around 1870, the role of molecules in systematics was discussed. Many microorganisms and plants produce a diverse array of structurally complex organic metabolites dealing with molecules (Church, 1870, Giannasi and Crawford, 1986). The current research focused on methods of protein and DNA molecular analysis and opened the way of molecular phylogenetics. Determination of relationships, similarity and dissimilarity among species based on differences in molecular structures are possible. Based on similar DNA and protein sequences, close relative of organisms should exhibit similar patterns. Approximately, 1.5–2 million species of organisms have so far been described by scientists and assigned scientific names. Estimates of the total number of species on the planet range from more than 3 to 30 million. Describing them using molecular tools will be authentic phylogenetically. Although the morphological and anatomical structural differences provide initial clue of similar and dissimilar species. The phenotype is an integration of environmental conditions and genotypic influences on an organism. Phenotypic variations occur in natural situations depending upon influences of environment. Phenotypic plasticity is the ability of an individual genotype to respond to environment influences. Different phenotypes are generated from the same genotype depending upon local environmental conditions. This is also considered an important process in the natural selection. The genotype is defined as a full set of genes, possessed by an individual and the phenotype is defined as a full set of characteristics involving morphological, physiological, biochemical and behavioural. Variability is the key to evolutionary process by natural selection, and it arises due to the combined effects of genotypic differences and environmental influences. The phenotypic variation is however, not necessarily inherited as per Mendelian way. Molecular basis of phenotypic plasticity in some cases of species have been stressed to the understanding of the patterns of gene expression (Wilhelm Johannson, 1909, James, 1983, Pigliucci, 1996). With this background, molecular ecology is considered a modern discipline and in a sense, it is a modern tool to understand evolutionary processes and also conservation ecology. For example, the cheetah Acinonyx jubatus, although extinct from India in their natural habitat, but still found in African plains. Cheetah is a beautiful big cat, sleek and elegant. It is known for its running speed in pursuit of prey. Cheetah has become extinct in their natural habitat in India largely due to habitat loss, but recent studies in molecular ecology of the species in Africa indicate that this species does not exhibit much genetic diversity across a wide range of different genes. Unrelated individuals of cheetah even fail to reject skin graphs from one another, an indication that they are very similar and there is not much diversity. Cheetah perhaps could not adapt to the changing environmental conditions over the years. Another reason for their extinction may be due to intense predation on the cubs of cheetah by other big cats, low fertility and susceptibility to infectious disease. Thus, the reasons are both ecological and genetical. Analysis of DNA and protein patterns lead to this type of conclusion. Thus, molecular ecology has become powerful tool to understand evolution and extinction of species.

10.2

SYSTEMATICS AND PHYLOGENETICS: MOLECULAR PHYLOGENY

10.2.1 Introduction

Molecular evolution encompasses two areas of study (i) the evolution of macromolecules and (ii) the reconstruction of evolutionary history of genes and organisms. The second area is also known as molecular phylogeny, related to molecular ecology. Phylogeny is defined as the evolutionary history

480

Fundamentals of Ecology

of group of taxa or genes and their ancestors. All life forms on earth, both extant and extinct, share a common origin and their ancestries can be traced back to one or few organisms that lived approximately few billion / million years ago. Consequently, all animals, plants, and bacteria are related by descent to each other. Closely related organisms are descended from more recent ancestors than are distantly related ones. The objectives of phylogenetic studies are (i) to reconstruct the correct genealogical ties between organisms and (ii) to estimate the time of divergence between organisms since they last shared a common ancestor. In phylogenetics studies, the evolutionary relationship among a group of organism are illustrated by means of a phylogenetic tree. A phylogenetic tree (Fig. 10.1) is a graph composed of nodes and branches in which only one branch connects any two adjacent nodes. The nodes represent the taxonomic units and the branches define the relationship among units in terms of descent and ancestry. The branching pattern of a tree is called topology. The branch length usually represents the numbers of changes that have occurred in that branch. The taxonomic units represented by the nodes can be species, genes, populations or individuals. Brooks and Mc Lennan (1991) consider phylogenetic tree as a hypothesis of the genealogical relationship among taxa. Since phylogenetic trees are hypotheses and not facts they are dependent upon both the quality and quantity of the data, that support them. There are several methods of constructing a phylogenetic tree (Table 10.1). Among all the methods, the principle of maximum parsimony searches for a tree that requires the smallest number of evolutionary changes to explain the differences observed among the operational taxonomic units (OTUs) which are basically external nodes representating the extant taxonomic units (Li, 1997). The maximum parsimony method makes no explicit assumption, except that the parsimony criterion assumes that a tree which requires fewer substitution is better than one that requires more (Li, 1997), that is the tree with least number of steps is most likely to be the real evolutionary branching order. In statistics, bootstrap is a computational technique for estimating statistics or parameters when the distribution is difficult to derive analytically (Li, 1997). The bootstrap technique is frequently used to measure the confidence level of phylogenetic hypotheses. There are several reasons why molecular data, particularly DNA sequence data, are more powerful for evolutionary studies than morphological and physiological data. First, DNA and protein sequence evolve in a much more regular manner than the morphological and physiological characters, and therefore, can provide a clearer picture of relationships of organisms. Second, molecular data are much more amenable to quantitative treatments than morphological data. The methods or programmes for reFig. 10.1 Molecular phylogeny of modern and extinct constructing a phylogenetic tree should elephants based on mitochondrial DNA cytochrome be: (i) efficient and fast, (ii) powerful b sequence.

Molecular Ecology

Table 10.1

481

Methods for Inferring phylogenetic trees from sequence data.

Distance matrix methods (1) Genetic distance values are calculated pairwise on the basis of the nucleotide or amino acid differences between the sequences compared (including correction factors for multiple substitutions). (2) Distance values are then converted into phenetic dendrograms. (3) The goodness-of-fit of the observed distances in the tree to the calculated distances is measured, and the tree with the minimum discrepancy is preferred. This method is largely rate-independent, but is sensitive to sampling set. Maximum parsimony methods (1) The trees that need the minimum number of steps (mutations) to convert the sequences into each other are found. (2) Hypothetical ancestral sequences are calculated. Maximum parsimony is compatible with the concept of ‘phylogenetic systematics’; any extra count of site change on a tree gives the number of ancillary hypotheses that must be erected to explain evolution in the group. The method favours the tree with the minimum number of hypotheses. These methods are rate-sensitive. Fast-evolving non-related sequences tend to be grouped together. A rate-insensitive variant is Lake’s evolutionary parsimony or ‘invariants’. Sites where predominantly transitions occur are excluded from the analysis. However, since it uses only part of the sequence information, less-significant branches may result. In some parsimony methods (Hennig 1986), ancestral states can be defined. Maximum likelihood methods These have a statistical approach. (1) A concrete model of the evolutionary process that converts one sequence into another is specified. (2) The likelihood that the given evolutionary model will yield the observed sequences is calculated. The inferred phylogenies are those with the highest likelihood. This method uses the largest amount of sequence information, but is computationally very intensive. Bootstrapping (1) Repeated samplings (up to 1000 and more) of the aligned data set are made, whereby parts of the sequence are excluded; other parts are included several times in order to yield a slightly different data set. (2) All modified data sets can then be analysed with one of the tree-building methods and the number of times a branch appears in the different trees be visualised in a consensus tree. Although computationally very time-consuming, this method is frequently used to estimate the significance of branchings in a tree. Analysis of signature sites This is a phylogenetic approach. Signature sites mean the presence of the same character (nucleotide, amino acid, insertion, deletion) in all outgroup sequences (or at least predominantly). The presence of the same character in the ingroup indicates a plesiomorphy, and shared deviations indicate synapomorphies; these are used to argue for a relationship. Usually, however, only a few sites in a sequence are signature sites. {Quoted from Schlegel, M. (1994)}

and consistant, (iii) robust and (iv) falsifiable. Often the use of chloroplast DNA / mitochondrial DNA and nuclear DNA is considered in molecular phylogeny. Example-1 Chloroplast DNA (cp DNA) and nuclear DNA are two distinct DNA set that are present in eukaryotes. The two DNA greatly vary in base composition and length and exist in widely differing intracellular environments. Condition in the organelle may be different and the organelle DNA may, therefore, evolve at its own distinct rate. Wolfe et al. (1987) and King and Ferris (1998) report that the cp DNA evolves at a slower rate than nuclear DNA. The cp DNA in vascular plants is circular and varies in size from 1,20,000 to 2,20,000 bp with an average size of 1,50,000 bp (Li, 1997). The outstanding structural feature of cp DNA genome of almost all higher plants is a large inverted repeat varying in length from 10 to 30 kb in different species (Palmer, 1985). Wolfe et al. suggested that the average synonymous substitution rates in plant mitochondrial and chloroplast genes are 0.2–1.0 × 10–9 and 1.0–3.0 × 10–9

482

Fundamentals of Ecology

respectively, all rates being expressed in terms of substitution per site per year and further they suggest that the average synonymous rate in plant nuclear gene is 5.0–3.0 × 10–9. So the cp DNA evolves at only half the rate of plant nuclear DNA. Even within the cp DNA the trnL intron tends to evolve faster than the chloroplast coding regions such as rbcl gene (Gielly and Taberlet, 1994). The nuclear DNA (5.8S ribosomal DNA) shows mendelian inheritance—it is biparentally inherited, and it undergoes recombitation and crossing over in the gametes, thus increasing it chances for change in its DNA content. The cp DNA in majority of the flowering plants is maternally inherited and does not, therefore, show mendialian inheritance pattern (King and Ferris, 1998). It also does not undergo recombination and probably because of all these factors it evolves slower than the nuclear DNA. Example 2

If we take time as criteria than for a long evolutionary time span or period, the nuclear DNA evolve much faster, and therefore, they are considerably diversified and therefore, alignment would cause problems in this case, cp DNA (intron), which are maternally transmitted and evolve slowly, are helpful. In shorter evolutionary time periods, the cp DNA do not show much difference even in its noncoding regions; so in this case, the nuclear DNA might be useful. Further, since cp DNA is uniparental in transmission, (mostly maternal) therefore it has limited use in population studies in intraspecific level (King and Ferris, 1998) as only rarely does it display the type of intraspecific variation that is useful to population level studies. So, the use of both phylogenies help to evaluate the relative influences of seed and pollen dispersal on total gene flow.

Example 3

For very closely related taxa, nuclear DNA is more suitable for phylogeny since it evolves faster; so even if the cp DNA is similar in very closely related plant taxa, the phylogenetic tree can be resolved by taking the nuclear DNA which differs considerably. The smaller rate of evolution of chloroplast DNA has limited its use in population studies at intraspecific level (King and Ferris, 1998). In species where seed flow is much less than the pollen flow, it is predicted that organelle genes (chloroplast and mitochondrial) will be highly structured when compared to nuclear genes. In a phylogenetic tree, the branch length is correlated with divergence and accuracy of the tree; the longer the branch length, the more accurate the tree. A safer approach would be to use a combination of both the type of DNA. Basically, if some polymorphism could be detected in the cp DNA even within a given species, then it could be used to construct phylogenetic tree and population studies at intraspecific level. Milligan (1991) reports that there might be some intraspecific cp DNA polymorphism which could, in fact, be useful in analysis of population level studies.

10.2.2 Comparative Genomics

The genome of every organism contains within it a complete genetic map of the organism. Just having the genome does not give us any clues as to how the DNA sequence leads to observable traits and behaviours (otherwise called as ‘Phenotype’). Comparative analyses of complete or subset of genome sequences can unravel the functional parts of genome and answer many important questions regarding species evolution, evolutionary drift, phylogenetic distances, selection pressure and so forth (Hardison, 2003). Comparative genomics exploits: 1. The common functional parts (i.e., sequences which are important for functionality for the DNA) of DNA of two organisms are conserved and can thus be identified.

Molecular Ecology

483

2.

Similarly, sequences within the DNA which encode for different proteins of two related or unrelated organisms are not conserved and will be divergent. Thus, comparative genomics takes advantages of both the similarities and the dissimilarities in genome sequences between two or many species to address various questions such as 1. What sequences account for unique features of organisms? 2. What is the core protein set in a multicellular organism? (Hardison, 2003). Several genomes have already been sequenced and many more are in the pipeline. Databases and browsers such as Ensembl, VISTA and UCSC-Genome-Browser hold pre-computed whole-genome sequences and alignments, which can access for various analysis. While alignment of DNA sequences is the core process of in comparative genomics as discussed in other sections of this chapter, frequently protein-coding regions of related genes between species have a high alignment percentage such as Mice and Humans (>90%); however, sometimes sequences which do not have any obvious functions (such as fragments of transposons and other non-coding sequences) can align at a lesser percentage. This result could also throw light on the sequences which might have been active in an ancestral common ancestor between two species. Non-coding DNA sequence alignment between two species might also be candidate for containing regulatory sequences. Several new bio-informatics tools are being devised rapidly to address and locate interesting features in sequences. By using bio-informatics tools, one can identify putative new genes, promoters, upstream and downstream regulatory elements which might or might not be conserved across a taxon or indeed across several taxa. However, it must be noted that the real functionality of any given sequence can only be tested using wet-science methods. 10.2.3 Ecological Significance

Ecologists are focusing their attention on species that have successfully colonised new territories, factors that promote biological invasion, the speed with which the invasion takes place and the effects of invasion on the indigenous ecosystem. Interspecific hybridisation between a native and an invading plant species sometimes results in a new, sexually reproducing taxon. Several examples of such taxa have been confirmed by recent molecular and isozymes analysis. Interspecific hybridisation is now accepted as a major mechanism for generating evolutionary novelty in plant kingdom (Abbott, 1992). Such hybridisation can lead to (i) the introgressive origin of new intraspecific taxa, for example, varieties, ecotypes and subspecies, (ii) the origin of new homoploid hybrid derivative species, i.e., species at same ploidy level number as the parents, (iii) the multiple origin of new allopolyploid species. A precondition for (i) and (ii) is that the hybrid must exhibit some fertility either as an ability to backcross to a parent or a capacity to reproduce via sibling crossing or inbreeding. Back crossing to one or both parents leads to the infiltration of genes from one species to another. Such interspecific gene flow, known as introgression, results in production of offspring that are clearly referable to one of the parent species, but that possess certain characters inherited from the second species. Sometimes these products may become stabilised and develop into a new intra specific taxa (Abbott, 1992). Introgression leads to an increase in genetic diversity within a species, breaks down or reinforces reproductive barriers or results in transfer or origin of adaptation. Table 10.2 gives an account of the plant taxa produced following plant invasion and subsequent interspecific hybridisation. Spartina foliosa is native of west coast of North America and is shorter and cannot self pollinate. S. alterniflora is native of east coast of N. America and is taller, produces pollen and can self pollinate.

Fundamentals of Ecology

484 Table 10.2

Plant taxa produced following a plant invasion and subsequent interspecific hybridisation a. Hybrid taxon

Intraspecific taxa

Species

Parent taxa

Country

Evidence b

Helianthus annuus sp. texanus

H.annuus*x H.debilis sp. cucumerifolius

USA

m,c,cp DNA, rDNA

Senecio vulgaris var. hibernicus

S. vulgaris var. vulgaris x S.squalidus*

UK

m, c, as, i

USA

m,c,cp DNA, rDNA

USA

m, c, cp DNA, rDNA

USA

m, c, i, cp DNA, rDNA

Helianthus anomalus H. deserticola

H.annuus*x H.petiolaris*

H. paradoxus Iris nelsonii

I.brevicaulis*, I.fulva*, I.hexagona*

USA

m,c,i

Senecio cambrensis

S. vulgaris x S.squalidus*

UK

m,c,as,i,rDNA

Spartina anglica

S.alterniflora*x S.maritime

UK

m,c.i

Tragopogon mirus

T.dubius*x T.porrifolius*

USA

m,c,i,rDNA

Tragopogon miscellus

T.dubius*x T.pratensis*

USA

m,c,i,cp DNA, rDNA

Allopolyploids Species

(Based on Abott, R.J. (1992). a

Only examples confirmed by isozyme and/or molecular analysis are included.

m, morphological; c, cytological; as, artificial synthesis; i, isozymes; cp DNA, chloroplast DNA; rRDA, nuclear ribosomal DNA.

b

*Invading species

Somehow by anthropogenic activity, S. foliosa was introduced to east coast and both the species could breed and produce a hybrid. In the hybrid, the nuclear gene Spartina foliosa x S. alterniflora was 50% from either parent, however, the cp DNA (maternal inheritance) of the hybrid was from the female parent (S. foliosa). The hybrid could back cross to S. alterniflora and with F1 hybrid each backcrossing to S. alterniflora the ratio of S. alterniflora 50% nuclear gene from both parent 100% cp DNA from S. foliosa genes in the progenies continued to increase while the cp subsequent DNA was still from S. foliosa and after repeated backcrossing backcrossing of progeny with S. alterniflora a time came when the progeny of progenies with had 95–99% S. alterniflora nuclear genes while the cp DNA S. alterniflora was 100% from S. foliosa (Ferris personal communication Progeny to SPD) (Fig. 10.2). Ferris et al. (1997) cite another example ~ 90-95% nuclear gene from S. alterniflora of such introgressive hybridisation and origin of species 100% cp DNA from S. Foliosa Spartina anglica. This phenomenon is interesting since the new species which are formed have two DNA set (nuclear Fig. 10.2 Cross between two related and chloroplast) which come from two different parents. species. 10.2.4 Phylogeography

Recent advances in phylogeography have become a powerful tool for elucidating geographical patterns in ecological gradients within species and species complexes. The goal of phylogeography (Avise et

Molecular Ecology

485

al., 1987, Avis, 2000) is to characterise the phylogenetic deployment of genealogical lineages across a geographical landscape with distinct ecological relationships. Use of molecular markers help to understand intraspecific population phylogeny. The commonly used molecular marker has been animal mitochondrial DNA (mt DNA). Plant chloroplast DNA has also been used. Individuals are sampled from the geographical range of a species, and mt DNA genome is characterised for each individual by molecular techniques. The resulting haplotypes are used to construct phylogeny tree or gene tree from evolutionary angle and then related to geographical distributions with ecological relationships. This technique (mt DNA phylogeography) has been now widely used to understand phylogeographic structure and taxonomy of North American boreal mammals, the American black bear and other animals (Wooding and Ward, 1996, Demboski et al., 1999, Stone and Cook, 2000).

10.3

GENETICS IN ECOLOGY: GENETIC MARKERS

Ecological genetics explores for the first time how functioning of genetics in wild population subjected to environmental variations and natural selection. Analysis of genetics of population helped to understand of evolutionary processes and also the relationship of the organism to their environment. Population genetics involved determining gene flow and high hybridisation between populations. Population will maintain the same allele frequencies as per Hardy–Weinberg Equilibrium if they are interbreeding. In molecular ecology, the changes in environmental conditions bringing different response by differently adapted individuals and relating it to genetics level of gene expression are studied by real time polymerise chain reactions (PCR) or DNA micro arrays. Ecological genetics is the study of genetics on an ecological scale. Ecological genetics have been studied largely with wild populations of organism. However, molecular genetics involves understanding the structure and function of genes at a molecular level. Researches in molecular genetics have helped us to understand traits of ecological significance like sex ratio in organisms, drought tolerance and flowering time in plants. Genetic markers, specially molecular markers, can explain questions in ecology. Markers and marker variations can be quantified with greater precisions than other types of ecological measurements. In view of this, marker quantifications provide better data for statistical analysis and comparisons. Molecular markers are polymorphic proteins or DNA sequences which are used as indicators of genome wide variations. Therefore, molecular genetics focuses on techniques, which can be helpful to understand ecological phenomenon at molecular level. Molecular markers are sections of the genome, and these are chosen because they are taken as representative of much largely stretches of DNA. Each section is considered as a single “Locus”, which may or may not be a functional gene. A functional gene is the region of the genome that are described into messenger, transfer or ribosomal RNAs. We know that only messenger RNAs are translated into proteins but other types of RNAs take part in the process of regulation of proteins synthesis. All sections of the genome may not be equally useful as molecular markers. The important requirement is that alternative sections, i.e., alleles can be readily identifiable as alleles different from one another in their DNA sections. Since most of the eukaryotic organisms are diploids, they carry two alleles at each locus. Identical copies of the allele in the individual make it homozygous, and when the copies of allele differ, it is heterozygous. It has become natural to the development of molecular ecology to isolate and characterise a wide variety of molecular markers with different levels of polymorphism related to specific questions of research interest. Behavioural studies have been greatly benefited by molecular marker studies. Various markers available for molecular

Fundamentals of Ecology

486

ecological studies are discussed by Carvalho (1998) and Sunnuck (2000). The following table (Table 10.3) gives major markers in molecular ecology. Although many proteins are only expressed in one or limited range of tissues, yet protein variants called allozymes have been used as molecular markers widely in ecology. Since ‘soft’ tissues, like skin, muscle and blood, and ‘hard’ tissues, like bone, contain DNA and DNA is found in all stages of the life cycle of an organism, DNA markers are, therefore, considered more convenient and advantageous to deal with. We know that diploid have a maximum of two alleles present at each locus, and in homozygotes the alleles are identical and in heterozygotes the alleles are different. New markers sometimes displace old markers {micro satellites (Table 10.4) have largely replaced mini satellites}. This is a new line up research which shows lot of promise for future studies. Table 10.3

Main markers used in molecular ecology Single locus

Codominant

PCR assay

Overall variability

Mitochondrial and chloroplast DNA RFLP

Yes

Haplotypes

Yes

Low/medium

Sequence

Yes

Haplotypes

Yes

Low–high

No

No

No

High

Nuclear multilocus Minisatellite and microsatellite fingerprints RAPD

No

No

Yes

High

AFLP

No

No

Yes

High

Ribosomal DNA*

No

No

Yes

Medium/high Low/medium

Nuclear single locus Allozymes

Yes

Yes

No

Minisatellites

Yes

Yes

Not usual

High

Microsatellites

Yes

Yes

Yes

High

Sequence

Yes

Yes

Yes

Low–high

Notes: Codominant markers are those in which homozygotes and heterozygotes can be distinguished. RFLP, restriction fragment length polymorphism RAPD, randomly amplified polymorphic DNA; AFLP, amplified fragment length polymorphism. *Mostly used in microbial molecular ecology. (Reference A history of Molecular Ecology, Trevor and Graham, 2004).

Table 10.4 A microsatellite locus showing two allelic variants. Dinucleotide repeats are italicised and underlined Allele 1(12 repeats) TGCATTATGCGTAGGCCTCACACACACACACACACACACACAGTTGCATCGGGTA… ACGTAATACGCATCCGGAGTGTGTGTGTGTGTGTGTGTGTGTCAACGTAGCCCAT… Flanking region

Dinucleotide repeat

Flanking region

Allele 2(14 repeats) ATTATGCGTAGGCCTCACACACACACACACACACACACACACAGTTGCATCGGGTA.. TAATACGCATCCGGAGTGTGTGTGTGTGTGTGTGTGTGTGTGTCAACGTAGCCCAT.. Source: Trevor and Graham, 2004.

Molecular Ecology

10.4

487

ADVANCES AND DIMENSIONS IN MOLECULAR ECOLOGY

In 1900, Karl Landsteiner made the first discovery of agglutination of human red blood cells by serum of another man. He discovered ABO blood group system. Von Dungern and Hirszfeld showed that the ABO blood groups are inherited as Mendelian characters. Their work laid the foundation of molecular ecology. Later Hirszfeld (1918–1919) found that the ABO blood group frequencies differed between one human population and another. Landsteiner and Levine discovered the MN and the P blood group systems in 1927, and they and other scientists discovered the rhesus (Rh) blood groups. Later, these blood group systems were subdivided to many more systems. Several important issues in population ecology and also identification of individuals with their parentage were address by these studies. Polymorphic genetic markers are now used to determine genetic diversity in populations and also used as a tool to determine population structure and inter mixing of individuals between different populations. Development of methods of protein electrophoresis using starch gel as the supporting medium was developed in 1955 and is considered an important milestone in genetic analysis. Since this method separates protein variants according to their mobility in an electric field, scientists could demonstrate variations in the number and distribution of blood serum proteins among human individuals. Smithies (1955) used this technique to observe serum protein variants in 43 human individuals. Later, this technique was applied to domesticated animals like sheep, goats, horses and cattle. Using this method, Hubby and Lewontin (1966) showed polymorphisms at protein-coding loci in the fruit fly Drosophila pseudoobscura. Allelic variants of an enzyme that differ in their electrophoretic mobility, but are encoded by a single locus, were called as allozymes. Allozymes are allelic variants of an enzyme which differ in their electrophoretic movement and were used to solve ecological and evolutionary problems. Besides the starch gel and cellulose, acetate is now largely used as the medium for electrophoresis of allozymes. Recent advances in molecular biology suggest better techniques involving DNA sequences analysis. Restriction fragment length polymorphism (RFLP) analysis which includes restriction enzymes cleaving DNA only at sites with specific recognition sequences has advantages over alloenzyme techniques. RFLP analysis helps in comparing individuals with mutations that have either created or lost restriction enzyme recognition sequences. These methods have wider ecological applications. At present, mitochondrial DNA and nuclear DNA are used in this method to study polymorphism. Besides these two markers, such as allozymes and RFLPs, other techniques have been discovered using mini satellite DNA. In 1985, Alec Jeffreys of University of Leicester, U.K., discovered that human genome contains multilocus, tandemly repetitive “minisatellite” regions which share 10–15 bp (core sequences) (Jeffreys et al. 1985). Many minisatellites are highly polymorphic due to allelic variations, and some minisatellites were individual specific and referred to as DNA finger prints. It was also found that individual bands of fingerprints are inherited in a Mendelian fashion. DNA finger printing has become most authentic tool in human forensic science and parentage disputes. DNA fingerprinting techniques have also been used now in animal species. Multi locous fingerprinting remarked the beginning of modern molecular ecology with lot of significance for evolutionary studies. In recent years, there has been a distinct change towards PCR-based techniques having many potential benefits. In PCR technique only, tiny tissue fragments can also be used, and therefore, this technique has become very popular. With development of PCR primers for ribosomal genes, extensive molecular analysis have been made and these studies have opened the way for microbial molecular ecology. PCRbased molecular markers are now extensively used in molecular biology and molecular ecology.

488

Fundamentals of Ecology

10.4.1

PCR-Based Analysis of Minisatellites Alleles Present in Small Sample of Human Population

The human genome contains several tandemly repeated region called minisatellites (also known as VNTR, i.e., variable number tandem repeat) which serve as highly informative genetic marker. Molecular biology relies on techniques that enable the detection of minute quantity of nucleic acid. The PCR process is exquisitely sensitive and various parameter have an important say in final amplification of DNA. The parameter include the size of the DNA to be amplified, PCR conditions like temperature, cycle parameters, etc. a. Template consideration Successful amplification of the region of interest is dependent upon the amount and quality of template DNA. The amount of template required for successful amplication is dependent upon the complexity of the DNA sample. There is an inverse relationship between size of the VNTR allele and efficiency of the amplification, that is, the shorter the allele, the more efficient the amplication. Jefferys et al. (1988) have reported the amplification of VNTR allele up to about 10 kb in length. Increasing extension time could increase the product yield for longer alleles. The most efficient amplication of VNTR allele are obtained at loci where the amplified products are relatively short (< 1 kb). b. Magnesium ion concentration It is a crucial factor for PCR technique. It has been shown that the concentration of Mg2+ ion affects the specificity of priming and primer extension by PCR. In absence of adequate free magnesium, Taq DNA polymerase is inactive, and on the other hand, excessive free magnesium reduces enzyme fidelity and may increase non-specific amplification. The optimal MgCl2 concentration is 1.0–3.0 mM per 100 µl of reaction mixture. c. Taq polymerase One unit of Taq polymerase in 100 µl of reaction mixture represents an enzyme concentration of 1 nM. At 1 nM concentration, there is ample enzyme free at all times even after million-fold amplification. Excessive use of Taq polymerase can result in greater production of non-specific PCR products and reduced yield of the desired target fragment. d. Cycle number and parameters Excessive cycle number is not useful as amplification reaction, and it is not infinite, and after a certain number of cycles, the desired amplification fragment gradually stops accumulating exponentially and reaches a plateau. Excessive cycle number produces huge amount of amplified products which might produce a smear when further analysed on a gel electrophoresis. The temperature profile determines the specificity of the PCR assay. Low anneallines temperature may cause ‘false priming’ at sites on the DNA molecule. For primers with high Tm, it is useful to increase the annealing temperature. The higher temperature minimises non-specific primer annealing, thus increasing the amount of specific product and reducing the amount of primer-dimer production. Splinkerettes strategy in PCR Vectorettes permit PCR amplification of DNA which lie between a single known primer and a restriction site which is close by. Splinkerettes are modified and improved vectorettes which are designed to decrease ‘end repair priming’ which is a negative feature of vectorette. The specificity of the vectorette reaction is not complete, and many unrequired products come out from non-specific annealing of either primer and also from ‘end repair’ priming. Splinkerette incorporates a hairpin structure on bottom strand, and here the primer is of same sequence as top strand, and so just like the vectorette, it is unable to serve as primer until the complement of this strand has been synthesised. During PCR, the free 3¢ end of the bottom strand flips back to form a hairpin and begin elongation further along the bottom strand. The resulting double strand is unable to function during the reaction,

Molecular Ecology

Fig. 10.3

Diagram of spunkerette and vectoette, from Devon et al., 1995

489

and therefore, it is not able to cause ‘endrepair’ priming. One important difference between splinkerette and vectorette is that in splinkerette, unlike vectorette, only one strand acts as a non-specific primer. Another thing about splinkerette is that they are not kinased, so there is no covalent bond between the splinkerette bottom strand and the target DNA to be amplified, which avoids elongation from the hairpin along the whole length of insert molecule. Splinkerette has definite advantages over vectorettes in the amplification of larger fragments.

10.4.2 Ecological genomics

From the discussion made previously in this chapter, it should be apparent that genome expression profiling has enormous potential to unravel intractable systems to genetic analysis. In 2002, Gibson Greg has used micro array technology to unravel the relations of parasitism and symbiosis. Genome sequencing of a variety of pathogenic and symbiotic bacteria has helped to understand the mechanism of the evolution of genome contain (Ochman and Moran, 2001, Gata et al., 2001). Micro array analysis provide with a pick of the evolution of gene usage and all interactions between genomes and the environment. These powerful molecular techniques have now been extended to study many parasite species, specially Nematode species which cause disease in man. This technique is used to determine parasitic strain diversity and their gene expression and has, therefore, numerous applications in ecology. Advances in molecular techniques and analytical methods suggest that an exact genetic description of the number and distribuFig. 10.4 Chromosomes of the closely related Indian muntjac tion of genes affecting a trait can be obdeer Muntiacus muntjakand Chinese muntjac deer Muntiacus reevesi. After Short (1976) tained. In view of this, ecologists and Source: Trevor and Graham, 2004 evolutionary biologists working with

490

Fundamentals of Ecology

natural population can use quantitative trait locus analysis to solve ecological and evolutionary problems (Erickson, Davil L. et al., 2004). The chief application of micro arrays has been in the identification of sets of genes which respond to some treatment in intense manner. It is now clear that genome-wide surveys of transcription can contribute significantly to ecology and evolutionary biology. The common technologies are cDNA micro arrays and oligonucleotide expression arrays (Figure 10.5) (Gibson, 2002). Micro array technology is a new tool for molecular ecologists. Gibson (2002) says “gene expression profiling with cDNA micro arrays in particular has numerous applications in ecology and evolution, from basic questions concerning the degree of covariation of gene expression, to applications in determination of strain diversity”.

Fig. 10.5

Comparison of cDNA and oligonucleotide microarrays. (A) In cDNA microarray analysis, nanolitre amounts of concentrated 1–2 kb polymerase chain reaction product derived from cDNAs are deposited at high density in spots on a glass slide or filter. These are hybridised competitively to fluorescently labelled cDNA derived from two different RNA sources, and the ratio of the two signals at each spot reflects the relative levels of transcript abundance. (B) Affymetrix GeneChips® consist of up to 20 microsquares of 25 mer oligonucleotides per gene, including perfect and mismatch pairs (not shown) that will hybridise specifically or non-specifically to a different part of the same transcript. Each square yields a different intensity measure, reflecting differences in GC content and folding of the RNA, so the values are massaged to produce a measure of gene expression that is contrasted with measures from other chips (Taken from Gibson, 2002).

MULTIPLE CHOICE QUESTIONS Choose the correct answer 1. Molecular phylogeny is based on the fact that: (a) All organisms have DNA as genetic material. (b) All organisms can adopt to changing environment. (c) Organisms are related by descent to each other.

Molecular Ecology

2.

3.

491

A phylogenetic tree is generally constructed using DNA sequence data of: (a) Chloroplasts / mitochondria (b) House keeping genes (c) Species specific genes A GC rich region within a sequence would require: (a) High TM (b) Low TM (c) No TM

SHORT AND DESCRIPTIVE QUESTIONS 4. 4. 5. 6. 7. 8.

Define molecular ecology and its significance. Give two examples to illustrate your answer. What are phylogenetic trees? Describe in brief methods of generating phylogenetic trees. What are nodes and branches in phylogenetic trees? What are genetic markers? Describe how DNA finger printing is used to identify relationships between species. Explain why nuclear DNA is more suitable for phylogenetic studies between very closely related species. What are genetic markers? How are they useful in unraveling the evolutionary history of an organism? Why PCR is such a versatile tool to study molecular ecology? Describe the optimum conditions for PCR reaction.

11

Ecotechnology

11.1 INTRODUCTION Application of ecological principles, organisms and their living processes and products and using biological, biotechnological, chemical, physical and engineering, etc., tools, environmental problems can be solved. Reclamation of waste lands, waste, especially organic waste recycling by vermitechnology, controlled microbial decomposition, pollution control, metal mining, increasing plant and animal production technology, environmental biotechnology methods, etc., are included in ecotechnology.

11.2 ENVIRONMENTAL BIOTECHNOLOGY AND BIOTECHNOLOGY FIRMS: Biotechnology employs biological systems (Fig. 11.1) of microbial, plant or animal origin or specific compounds derived from these systems for the production of goods, including foods. Biotechnology also uses living organisms at the cellular or molecular level for agricultural, medical or industrial purposes. The publication of the human genome sequence in 2001 brought biotechnology dramatically before the public as a leading-edge scientific endeavour. Basic biotechnology is, however, thousands of years old. The basics of biotechnology were known to Indians and others on the preparation of curd, “Soma Rasa” (Alcohol) including fermentation since 3000–2500 B.C. Baking and brewing also involved use of biotechnology. Later, discovery of antibiotics opened a new era in biotechnology. The gene technology and biotechnology is now considered as the application of scientific and engineering principles to the processing of materials using biological organisms and/or processes etc. to produce goods and services for mankind. (Abelson, 1984, Marx, J.L. (Ed.), 1989, Eisenberg, 1992). Modifying plant and animal genes are not new. Typically, this was done through hybridisation in which two related plants/ animals were cross-fertilised and the resulting offspring has characteristics of both parents. Breeders then selected and reproduced the offspring that had the human-desired traits. Hybrid maize was an early success of applying genetic theory to food production. Hybrid farm animals were produced in this way. During the 1930s, hybrids replaced open pollinated varieties of maize in USA and by 1960s, virtually all maize crops planted in US were hybrids. In 1997, the US maize yields average of increased to 8 tonnes/hectare, compared with 1 tonne/hectare in 1930.

Fig. 11.1

Development of modern and new buological sciences

Ecotechnology

493

494

Fundamentals of Ecology

Yeast has been a component of baking and fermenting throughout recorded history. Vaccination against the smallpox virus was introduced in the eithteenth century, long before the details of cell structure and action were elucidated. But it was James Watson and Francis Crick’s discovery in 1953 of the structure of DNA, the molecule that carries genetic information, that gave firm footing to molecular genetics and biotechnology. In 1953, this development ushered in the modern era of biotechnology. Since then, the science of genetics and its technological applications have advanced rapidly. In 1973, the first alteration of a DNA molecule could be done and the process is now referred to as recombinant DNA technology. In 1982, the US Food and Drug Administration approved the first drug, human insulin, produced in genetically modified bacteria. In 1989 and 1990, cotton and corn were, respectively, genetically modified to protect them against insect pests. The first animal cloned from an adult cell wasof Dolly, the sheep, in 1997. A number of biotechnology drugs and vaccines are used today in the industrially developed countries, and agricultural applications of biotechnology are phenomenal. Industrial uses of biotechnology are fast growing. Biotechnology is used to address remediation of environmental pollution and remedial of environmental degradation and resource recovery. 11.2.1 Biotechnology Techniques

Understanding of the biological, chemical and biophysical aspects of a living cell (system) is the basic requirement for the development of biotechnology techniques. (a) Cell culture technology is the growing of cells outside the living organism in which they develop naturally. Applications of bio-technology include growing cells for testing new medicines, growing cells to replace dead or malfunctioning cells in human organs and mass production of natural substances of medicinal value. (b) Cloning is the reproduction of molecules, cells, plants or animals that are genetically identical to their source. Cloning gained popularity in 1997 when scientists cloned a sheep from an adult sheep cell. Before that, animal cloning had been done with embryo cells. Monoclonal antibody production and much of cell culture technology are based on cloning. Cloning is also used in livestock breeding and modification of agriculturally important plants. (Willadsen, 1989, Zanwar, 1989, Pursel et al, 1989). (c) Genetic engineering or recombinant DNA technology is the insertion of DNA from one organism into the genetic material of another organism. This technology is a more specific and direct approach to the same ends as selective breeding. (Hammer, et al, 1985, Glover,(Ed.), 1985, Rigby (Ed.), 1987). Other uses of this technology include production of medicines and vaccines, treatment of genetic diseases and nutritional enhancement of foods. Monoclonal antibody technology develops antibodies from cloned cells that can be used to identify and treat antigens that infect humans. Because antibodies are very specific in their action, monoclonal antibody technology encompasses an extensive field of research. One of the more important applications of this technology is cancer treatment and development of vaccines, such as the biotech vaccine against hepatitis B. Monoclonal antibody technology is also used to locate environmental pollutants and to detect harmful microorganism in food. (Golding, 1983). (d) Proteins are the chemical substances through which much genetic and cellular activities occur. Research efforts are made to understand and manipulate proteins. Currently, there are several

Ecotechnology

(e)

(f)

495

biotech drugs based on protein chemistry for treatment of diseases like anaemia, cystic fibrosis, haemophilia, leukaemia and some cancers. Besides their functions in living organism, enzymes are also used as biocatalysts to improve the efficiency of production processes for chemicals, pharmaceuticals, pulp and paper, textiles, food and animal feeds. (De Gardo et al., 1989, Hodgson, 1991). Modern techniques in plant biotechnology: Techniques of modern plant biotechnology involve directed insertion of DNA into plant cells via agrobacterium or accelerated particle-mediated transformation. Following cell transformation, tissue culture techniques facilitate the development of fertile plants containing unique traits that are the objective of the transformation process. One of the success in plant biotechnology is a number of plant varieties capable of synthesising an insecticide protein encoded by gene isolated from bacterium, Bacillus thurningiensis (Bt). After ingestion by the susceptible insect, the protein is proteolytically metabolised to an active form that disrupts ion transport channels of cell membrances in the insect intestine. This leads to the death of the insects that destroy crop plants. (Goodman, et al. 1987, Grierson, 1991). Genes known to code proteins resistant to water stress and drought and other stress factors in some bacteria and plants, have been successfully transferred to some crops, cash crops and other commercially important plants. For example transgenic tobacco and rice plants have been produced by transferring the gene P5CS from moth bean. Transgenic soybean tolerant to drought and water stress has also been produced. The gene, SacB found in the bacterium, Bacillus subtilis encodes for the enzyme Levan Sucrase, which mediates in the fructan (Polyfructose molecules) synthesis. This gene was transferred to tobacco to make it more resistant to drought. Transgenic plants have been genetically engineered by transferring genes from bacteria (Serratia marcescens) fungi (Tricoderma harziannum) and some plants to withstand fungal and bacterial pathogens. There are many such success stories of producing transgenic plants. Genes encoding antimicrobial proteins have been transferred to potato and many food plants (a-Thionin gene, alfAFP gene, etc.). Another example is biofertilisers which belong to two categories of microorganisms: (i) nitrogen fixing and (ii) phosphate solubilising. Genetic engineering of crop plants by transferring nif genes from nitrogen-fixing microorganisms have been done. Nif genes encode for nitrogenase enzyme and some protein factors, which catalyse the formation of ammonia from atmospheric nitrogen. Considerable researches are being carried out in this line. Another line of research in environmental biotechnology is production of biopesticides. Bacillus thuringiensis have a number of different strains like B. thuringiensis kurstaki, B. thuringiensis israelensis, B. thuringiensis tenebrionis, etc., and these strains are toxic to different groups/species of insects. Using genetic engineering techniques, specific genes in these strains of bacteria are transferred to other field suitable bacteria like Escherichia coli or Psendomonas fluorescens and then field applications of these bacteria are done to protect crops from insect pests.

11.2.2 Agriculture Productivity and Biotechnology

Great success has been achieved in increasing agriculture productivity to fulfill human needs of food and fibre during the second half of the twentieth century. On the basis of the current population growth rate of 1.4% per year, the world population will increase from the current level of 6 billion to approximately 9–12 billion in 50 years. Providing food to this population will require enormous increase in agricultural production. Based on the minimum protein requirement for humans (0.8 g/kg body weight/day), it is

496

Fundamentals of Ecology

estimated that for each additional billion people added to the planet, there will be an additional 14.5 million tonnes of quality protein requirement per year. In view of this: i. Increasing the nutritional composition of plant foods should be a priority. The World Health Organisation recently reported that more than three billion people worldwide are malnourished. In addition, macronutrient and micronutrient deficiencies are widespread. Approximately, 250 million children are at risk of vitamin A deficiency, which may lead to eye damage or blindness. This is a problem in India. Two billion people worldwide are at risk of iron deficiency, which is the most common nutritional disorder. It impairs immunity and adversely affects the physical and mental capacities of people of all ages. (Swaminathan, (ed), 1991, Swaminathan and Jana (Eds.), 1992). (a) Genetically Engineered Foods

One of the most exciting development in improving nutritional values of agricultural products using recombinant DNA techniques is the introduction of genes into rice that results in the production of bcarotene in the rice grain. b-carotene is a vitamin A precursor and a pigment required for photosynthesis. It is synthesised in the green tissues of all plants, including rice; but it is usually not present in non-photosynthetic tissues. Traditional plant breeding has given us some plants that produce b-carotene in non-photosynthetic tissues such as roots of carrots. To get cells of the grain to produce b-carotene, three genes were inserted into the rice genome. Two were from daffodil and one from bacterium, Erwina uredovora. They specifically code for key enzymes of b-carotene synthesis. The grain of the transgenic rice has a light golden–yellow colour because of its b-carotene content. This rice particularly offers another food product to improve nutrition for the billions of people in developing countries including India where vitamin A deficiency is prevalent and where rice is a major food. Tomato fruit and its products—juices, soups and sauces–are the major dietary sources of b-carotene and the principal sources of lycopene, an immediate precursors of b-carotene in tomato. Like b-carotene, lycopene has received attention for the association between tomato consumption and improvement of human health, for example, reducing the risk of certain cancers. Lycopene is converted from its precursors phytoene by phytoene desaturase enzyme. Introducing a bacterial carotenoid gene (crtl) to tomato plants results in the conversion of phytoene to lycopene. Expression of this gene in plants results in a three-fold increase in b-carotene in tomato fruit. Tomato eating should be encouraged and its availability to common people should always be looked into and its price should be affordable. (b) Other Agricultural Uses

Biotechnology has become an important tool of plant agricultural produce. i. The most important use of genetic modification in plant agriculture is herbicide tolerance. In this process, the genetic composition of plants is altered to make them resistant to damage from the chemical herbicides used to kill weeds in the agricultural fields. In this process, crop losses from herbicides are reduced and yields are increased. When plants are made resistant to more lethal herbicides, fewer applications of herbicide can also be used, reducing both farmer’s production costs and environmental damage. ii. The second major use of genetically modified crop is insect resistance. This process involves taking genetic material from naturally occurring organisms that are lethal to insects and inserting it into plants. When the genetic insecticide from a naturally occurring bacterium is inserted in the

Ecotechnology

497

genetic make up of plants, the insects that feed on them are killed before they damage the plant. This reduces the requirement of chemical insecticides, thereby protecting crops more efficiently and reducing the threat of poisoning animals and humans. iii. Another recent advance is the use of genomics-based approach to increase a-tocopherol content in oil-seeds. Vitamin E is an essential nutrient and is a lipid-soluble phenolic compound synthesised in higher plants and some photosynthetic bacteria. Vitamin E refers to a family of related compounds called tocopherols. There are four types of tocopherols synthesised in plants: a, b and l, and d tocopherols, a-tocopherol is found in relatively low levels in all major oilseed crops, whereas its immediate precursor, l-tocopherol methyl transferase (l-TMT), is limiting in the oilseeds. Over-expression of the l-TMT gene in the seeds of Arabidopsis results in an 80-fold increase in a-tocopherol without altering the total tocopherol content; this suggests the increase is due to the conversion of the large pool of l-tocopherol. Arabidopsis is a small flowering plant that is widely used as a model organism for basic research in genetics and molecular biology, and it is very similar to the major oilseeds in which TMT is limiting. Therefore, it appears possible to convert a large pool of l-tocopherol in oilseeds, including soyabean, to l-tocopherol by over-expressing the l-TMT gene. The safety issues surrounding foods from genetically engineered crops are key to their acceptance. Consumers seek reassurance about the safety of the foods they eat in terms of their ‘immediate and long-term’ health effects. There are government agencies with regulatory authorities on genetically engineered products in different countries. The ultimate goals of these regulatory agencies are to ensure the safety of any products that will be used by consumers and to monitor and protect the environment. India should develop a comprehensive plan for testing of genetically modified foods for safety as it is done in USA and EU. There is concern that genetically engineered foods may introduce allergens. It is different from conventionally produced foods. In fact, it is feasible to eliminate possible allergens from food sources by using modern biotechnology.

11.3

BIOTECH DRUGS

Biotech drugs have been introduced at an increasing rate, especially since the mid-1990s. A number of biotech drug products and vaccines available in the market. Current biotech medicines include important treatments for anemia, cystic fibrosis, growth deficiency, haemophilia, hepatitis, transplant rejection, and leukemia and other cancers. Biotech products are also used for several diagnostic procedures. Hundreds of biotech medicines are undergoing clinical trials. Most new biotech drugs currently being tested are intended for cancer treatment. Other therapeutic categories with a large number of biotech drugs in the clinical trial phase are for infectious diseases, neurological disorders, heart disease and respiratory diseases.

11.4

TRADITIONAL KNOWLEDGE AND TRADITIONAL MEDICINE

Since the Eastern civilisation, especially of India and China, are very old, they harbour traditional knowledge on many aspects of human living, especially in health care. Traditional medicine has been

Fundamentals of Ecology

498

practiced by physicians in India since time immemorial. These systems are called Indian systems of medicines which include Ayurveda, Siddha, Unani, etc. These are also called ethno-medicine, based in folklore for thousand of years and aims at holistic health. The earliest recorded evidence of use of these traditional knowledge dates back some 5000 years. The Indian texts are the Vedas, especially Rig Veda, Athar Veda, Charak Samhita and Sushruta Samhita. Like wise there is also recorded ancient texts in China, Syria, Egypty and Greece. World Health Organisation (1991) estimates that 65% of Indians, 40% of Chinese and 71% of Chilean people use traditional herbal medicine for primary health care. Since these medicines are in use for hundred of years, it is accepted to be safe and effective (Kamboj, 2005). The market in USA opened for Ayurveda due to passage of Dietary Supplement Health Education Act in 1994. The neutraceuticals include herbal drugs, pro-biotics and functional foods. It has been found that atleast 25% Americans take herbal pills daily. Sizeable percentage of people in Europe also take herbal drugs and food supplements daily. India is rich in Biodiversity and the country is one of the 12-mega biodiversity countries of the world. Of the 400 families of flowering plants used in traditional medicine in the world, India houses 315 families (about 78% of medicinal plants). Using ecotechnology and biotechnological methods herbal gardens can be developed and value added products can be produced to raise India’s share in world market of traditional medicines from about 2% to higher percentage. Since India is rich in plant biodiversity and traditional knowledge, these are to be protected by Intellectual Property Rights and value-added products should be developed. Forty-nine percent of medicinal plant based USA patents are based on traditional knowledge (Kamboj, 2005) and India’s share is marginal. American Chemical Society documentation shows that out of 747 patents on medicinal plants, only 9 patents by Indians. This is a big challenge for Indian pharmaceutical industry, scientists and academicians. Attention is being drawn to understand the relationship between genome and diet, especially health foods/ neutraceuticals. This science is called nutrigenomics aims to elucidate the influence of nutrition on genome. Nutrigenetics aims to elucidate how genetic make up of a person responds to diet, especially neutraceuticals / health diet and ayurved medicines. This diet–genome interaction is a new science under environmental biotechnology / ecotechnology. Since many developing countries including India are rich in biodiversity, development of herbal gardens with the goal of producing value added products for human health care will be commercially profitable. This should be encouraged.

11.5

BIOINCUBATORS: BIOTECHNOLOGY FIRMS

Biotech firms traditionally have focused on therapeutics like vaccine development, diagnostics like making kits for testing various diseases and drug discovery. These days with the Human Genome being sequenced, ‘Genomics’ (The scientific study of genes and their role in an organism’s structure, growth, health, disease (and/ or resistance to disease etc.), ‘Functional genomics’ (Study of, or discovery of, what traits/ functions are conferred to an organism by given (gene) sequences. Typically, functional genomic study follows after discovery of gene sequences found via structural genomics study.) and ‘Proteomics’ (Study and cataloguing of proteins their structure and interactions and properties.) have become the buzz words.

Ecotechnology

499

Stem cells and their use in therapeutics is big area here and so is a new technology (8–10 years old) called RNA Interference (using antisense RNA to block or knockdown specific gene expression). These are being routinely used to test for therapies against tumours and cancers. Another area which I see is ‘chemical-genetics’ where scientists use an array of organic small molecules to screen for biologically relevant function using a fast and high throughout breeding vertebrate like fish or frogs. For example, various tadpoles are incubated in different chemicals and their subsequent phenotype is observed. Say on exposure to chemical X, tadpoles show inhibition of migration of pigment cells, or formation of another head. Then by looking at genes which cause similar phenotype, chemical X and its interaction with specific genes involved in head formation or pigment cell migration is further elucidated (Dash, 2005). Like in ecology, another very hot topic in molecular biology/biotech is ‘System-Biology’ at human body level where scientists are trying to identify not only individual genes but gene networks and every other component involved in the network(s), thus connecting RNA, DNA, genes, proteins and elucidating how they interact with each other to create breathing, blood pumping, disease fighting, food processing, problem solving human ! (Dash, 1999) Of course, it is daunting since as you identify networks you start to look with a non-reductionist approach. Modelling gene networks and guessing certain outcomes at hypothetical physiological condition is also a big research thrust. Bio-informatics and data mining is important (using computers and softwares to create information database that permit analysis of genomes, protein sequences, biomolecules and other organic matters). ‘Microarray technology’ (where one studies total gene expression patterns in response to certain drugs, certain diseases and so forth) is also hot since 10 years or so.

11.6

BIO-SAFETY

A strong Bio-safety regulation is also required especially for storage and disposal of transgenic organism. Bio-safety regulation is very stringent in UK. Some molecular biologists routinely making transgenic frogs (Dash, 2005). And there is always a risk of these organism leaking into the wild and then contaminating native species with their transgene. They are used to make frogs which are transgenic for a protein called (green fluorescent protein FGP), so when you use this protein and if you see the frogs using UV then they glowed green. The scientists have to be very careful in handling and storage of these frogs and so were others who were making transgenic plants, transforming bacteria and viruses. Risk evaluation and control is a must for any Biotech park (Bioincubators). Many Biotech parks have dedicated firms producing biologically active substances, like enzymes, antibodies and other products, which are routinely needed in molecular biology experiments. Biofuels (Jatropha sp.) , such as bioetahnol production and conversion of agri-waste as also quite popular and huge amount of money is invested on research. All biotech firms here have an in-house technology transfer personnel who can be patent lawyers or “idea sellers” some of them like to be called and they produce value added products. There is new romance with biotech incubators. It would be great to see them pump out new companies such as Amgen, but almost by definition, most may fall and may lose tremendous amount of money in the process. And long before we carry around personal genomic data on credit cards, local governments

Fundamentals of Ecology

500

are likely to face a revolt by taxpayers who believe they have been sold a false bill of goods. This threat is there and careful planning is required. That is because biotech companies, particular by those focused on drug discovery, are more delicate than orchids when it comes to the environment they need to survive. Building a successful biotech cluster takes smart ideas, smart people and smart money. And even when these things are in place, some plain good luck is needed. Not all smarts can easily be found together. A 2002 study by the brookings Institution {J. Cortright, H. Mayer, “Signs of Life: The Growth of Biotechnology Centers in the U.S.” The Brookings Institution Center on Urban and Metropolitan Policy (2002)} found that NIH grants in the life sciences have over the last several years been going to researches in increasingly diverse locations. Yet venture capital (VCs) funding in biotech, and the rare instances of commercial success, is actually becoming more concentrated. Just two areas, Boston and San Francisco, captured more than half the venture capital that went to biopharmaceuticals between 1995 and 2001. These examples are to be carefully analysed before taking policy decisions on establishing biotech firms. Understanding of molecular biology, especially molecular genetics and molecular ecology is essential for the development of biotechnology and environmental biotechnology methods. Biotechnology, its principles and methods are the basics of biochemical engineering, sciences, which will be extensively used for human welfare. Biotech incubators (Biotech Parks) should be built on a different model than other technology incubators. Given the higher barriers to entry, expectations need to be more modest. That could mean smaller parks and higher pre-requisites for getting a space say, a certain level of government grant money or existing private investment. That way, there will be less wasted on companies that ultimately cannot pay the rent. The state biotech money could be spent improving existing infrastructure rather than trying to entice something that does not yet exist. For example, Minnesota in USA, eager for more biotech growth, is considering a $100 million investment in a genomics research facility at the Mayo Clinic. The research that would come out of such an institution might be of great public benefit, and as a side effect may spur more private sector entrepreneurship than a government programme can foster. This should be an eye-opener for developing countries. Investment in molecular biology, molecular genetics and biotechnology research in Universities and Research institutes with time bound and goal oriented programme will be very much rewarding.

11.7

ECOTECHNOLOGY FOR ECO REMEDIATION

Microorganisms/specific animal species or processes associated with them are used for waste land reclamation, organic waste management, pollution control, metal recovery from ores and tailings, etc. (Singh, Ed., 1992, Dash, 1993 1998, 1999, Dash et al, 1986, Kale, 1998, CPCB, 1999, 2001). Besides, environmental biotechnology is used for generation of electricity, biogas, lipid bio-fuel, alcohol, hydrogen, etc. (SPAN, 2006). 11.7.1 Vermitechnology

Earthworms (verms) (Plates-11. 1A, 11.1B) are now utilised to produce organic manure (compost), (Plates-11.1C, 11.1D, 11.1E), to grow mushrooms, vegetables, flowers and crops profitably and as a feed

Ecotechnology

501

for fish, poultry, pigs and of man. Earthworm technology (Vermitechnology) involves three components, (i) Vermiculture, (ii) Vermicomposting and (iii) Utilisation of products like vermiprotein and vermifertiliser (Dash et al., 1985). (i) Vermiculture The modus operandi of culturing earthworms is simple. The fisherman rears worms in waste earthen pot with soil and dry cow dung. Earthworms could be suitably cultured in 50 x 25 x 15 cm size wooden box. Considering the total volume of the box, 1/4th is to be filled with soil, 1/4th with saw dust or rice bran above the soil layer, 1/4th with dry cow dung above the sawdust and rest 1/4th to be left as empty space. Initially, 100 adult worms could be inoculated. Considering one cocoon per adult and 2-weeks incubation period, 100 worms will multiply to more than 4 thousand worms in 4–6 months and to about 14,000 worms in a year. Soil moisture should be maintained at about 40–50 g% and a temperature of around 20–25°C is very suitable. Weekly turning over and quarterly change of organic material is necessary for continual growth. Too much carbohydrate is harmful to worms because of rapid acidification by bacteria. A carbon nitrogen ratio of about 30 is suitable and this decreases to about 10–15 making the organic manure most suitable for plant growth. Vermiculture for Indian village people will be most suited because of low investment and easy availability of unskilled labour who can learn vermiculture within no time. Organic Wastes for Vermiculture

Most organic wastes can be broken down by epigeic earthworms but some wastes have to be pre-treated in various ways to make them acceptable to worms. All organic wastes cannot grow earthworms equally well. The characteristics of the different wastes are found to be as follows: (a) Cattle solids are the best animal waste in which to grow earthworms. They usually contain nonmaterials that are unfavourable to growing earthworms except when these are very fresh. Solids have to be separated from slurries before these can be used to grow earthworms very satisfactorily, but the solids can be added back to the liquids at a later stage of composting. (b) Horse manure is a very good material for growing earthworms. Pig waste contains ammonia and inorganic salts. These are to be composted for about two weeks before inoculation with earthworms. Pig wastes may also contain copper. The processed wastes are high in nutrients. (c) Fresh poultry wastes, including chicken, duck and turkey manures, contain good amounts of inorganic salts and ammonia that may kill worms. After removal of these materials through composting for few days, earthworms grow well in them. The compost produced is high in nutrients. (d) Potato peel waste, from the processed potato and frozen potato industry, is an ideal growth medium for earthworms. Earthworms can also grow on spent mushroom waste. (e) Paper pulps are produced by mechanical separation or sedimentation from the press washings. These solids are very suitable material for growth of earthworms. Worms can process brewery waste quickly and grow and multiply rapidly in it. (f) Municipal organic wastes, including grass clippings and tree leaves, as well as food wastes from supermarkets and restaurants, are easily decomposed by earthworms, particularly after maceration and thoroughly mixed before use. (ii) Vermicomposting (Refer to Plate 11.1E)

Out of the four alternative methods for organic waste management: (i) land filling, (ii) incineration, (iii) windrow composting and (iv) vermicomposting, the latter has been proved to be the most suitable

502

Fundamentals of Ecology

way for preparation of quality organic manure in short time period of 6 weeks with simultaneous harvest of manure and worm protein. If properly managed, India may produce more than 500 million tonnes of vermifertiliser per year. Vermicomposting is in practice by farmers in Philippines, Taiwan, Japan, Europe, Canada, USA, etc. in large scale. Japan is taking care of its paper and spinning mill wastes through vermicomposting to prevent pollution and gain revenue. Vermicomposting should be considered as part of the ecotechnology programme / environmental biotechnology to develop rural economy and healthy environment. (iii) Product Utilisation: Vermifertiliser and Vermiprotein Vermifertiliser (worm worked organic waste) has been proved to be a high quality organic manure to take care of soil porosity, water conservation, aeration and balanced nutrient supply. Earthworms do not produce nitrogen and other nutrients de novo, rather they provide mineralised substance through biodegradation of crop and organic residues. Pot cultures and field trials with worm casts by us have revealed enhanced paddy growth and yield. Mushroom production has been doubled with application of worm casts. Vermiprotein is the earthworm tissue. Earthworm body constitutes more than 50% of protein on dry weight basis. Earthworm tissue contains very high concentration of essential amino acids, like arginine, tryptophan, and tyrosine and is more nutritive than any other protein feed available in the market. Authors have fed worms to fish, tadpoles, toad and frogs, chick and hens and found it acceptable, palatable and better promoter of growth. Earthworm protein has now become a “hot stuff” in different countries like South Korea to Canada, Philippines to Great Britain. North American Earthworm farming centre is making an annual competition for earthworm recipes. Worm meat with egg, butter, lemon, milk and spices will make a delicious mouth watering dish. Earthworm utilisation as food, feed and medicine is known from ancient Indian literatures. Earthworm is reported to cure protein deficiency, and for excellent feed material for fish, poultry and pig. India has rich earthworm resource. With proper application of knowledge and technology, they can perform wonders for us raising vegetables, mushrooms, rose plant and even crops. They can be utilised as a protein source for fish, poultry and for man through the food chain. Vermitechnology methods are discussed in Chapter 7. A diagrammatic model (Fig. 11.2) (low cost technology) given below can neutralise wastewater with organic matter load. Earthworms have been used in the management of Agro ecosystems (Lavelle et al. 1999) and their inoculation has increased plant production and tea plant yield in India (Senapati et al., 1999). Senapati et al. (1999) and Giri (2007) elucidated the use of Vermitechnology in restoring soil fertility and enhancing productivity in Tea plantations in India (Figure 11.3). 11.7.2 Compost (Enzyme Intervention)

The compost used in bioremediation is called “tailored” or “designed” compost as it is specially mode to treat specific wastes at specific sites for specific purpose. It is now recognised that specific pollutants can be treated by specific enzymes to neutralise them (Karam and Nicell, 1997). The process has been found cost-effective. The most promising method is enzyme immobilisation (Nicell et al., 1993). The following table shows the names of enzymes, source and the pollutants / chemicals that can be neutralised. The effect of immobilised horseradish peroxidase on activated alumina and hydrogen peroxide concentration on the removal efficiency of phenol showed

Fig. 11.2

Kitchen and domestic waste water treatment using vermatology

Ecotechnology

503

Fundamentals of Ecology

504

Fig. 11.3

Vermitechnology for restoring soil fertility Source: Senapati et al., 1999.

that one molecule of horseradish peroxidase can remove about 1,100 molecules of phenol at pH 8.0 and at room temperature. These enzymes are derived from biological sources and are very effective. Reactors can be designed to neutralise the specific solid wastes/chemicals (Table 11.1). Table 11.1

Enzymes, their biological source and application in biodegradation.

Enzymes

Biological source

Application to substances

Tyrosinase

Agaricus bisporus

Catechol degradation

Lacease

Trametes hispida

Dye degradation

Pyricularia oryzae

Azo-dye degradation

Trametes versicolor

Chlorophenol degradation

Catechol dioxygenases

Pseudomonas pseudoalacaligenes

Polychlorinated biphenyls (PCB), Chlorothanes

Phenoloxidase

Phanerochate chrysopsorium

Chlorinated substances

Peroxidases

Horse radish

Phenol, Chlorophenol, Aniline degradation

Artromyces ramosus

Phenol, PAH, Herbicide degradation.

Chloroperoxidase

Caldariomyces funago

Phenol degradation

Manganese peroxidase

Phenerochate chrysopsorium

Phenols, lignin, Dyes degradation

Nematolona frowardie

Lignin degradation

Phanerochate chrysosporium

Phenols, Aromatic compounds degradation.

Lignin peroxidase

Ecotechnology

11.7.3 Panchagavya

This technology has been developed by Natarajan (2003). He writes “Panchagavya” consists of five products from the cow dung, urine, milk, curd and ghee. When suitably mixed with other substances (Table 11.2) and fermented and used, these have miraculous effects on plants, animals and human beings. Mode of Preparation

505 Table 11.2

Ingredients for making Panchagavya.

Fresh cow dung

5 kg

Cow urine

3 litres

Cow’s milk

2 litres

Cow’s curd

2 litres

Cow’s ghee

1 kg

All the above items can be added to a wide-mouthed mud pot, Sugarcane juice 3 litres concrete tank or plastic cans in the order specified in the table. Tender coconut water 3 litres The container should be kept open but kept in the shade. The Banana (ripe) 12 contents are to be stirred twice a day, both in the morning and Toddy (if available) 2 litres evening. The Panchagavya stock solution will be ready after the 18th day. Care should be taken not to mix buffalo products. If toddy is not available, add 100 of yeast powder and 100 of jaggery to 2L of warm water. After 30 min, add this solution to replace toddy in Panchagavya. When stirred twice daily, the Panchagavya solution can be kept for 6 months without any deterioration in its quality. Whenever the solution becomes thick due to evaporation of water over a long period, suitable quantity of water can be added to keep it in a liquid state. The cost of production is around Rs.35/- per litre. If the volume is more and the farmers use their own cow’s products, the cost can be further reduced. By using the quantity of ingredients specified in the table, one can obtain approximately 20 litres of Panchagavya. Mode of Action

Basically, Panchagavya is a living elixir of many microorganisms, bacteria, fungi, proteins, carbohydrates, fats, amino acids, vitamins, enzymes, known and unknown growth promoting factors, micronutrients, trace elements, antioxidants and immunity enhancing factors. However, the active formulae are yet to be established. He further finds that when taken orally by animals and human beings, the living microorganisms in the Panchagavya stimulate the immune system and produce a lot of antibodies against the ingested microorganisms. It acts like a vaccine. This response of the body increases the immunity of animals and humans and thus helps prevent illness and cure disease. It slows down the aging process and restores youthfulness. The other factors present in Panchagavya improve appetite, digestion, and assimilation and elimination of toxins in the body. Constipation is totally cured. When applied externally, psoriasis is fully cured. The animals and humans become hale and healthy with shining hair and skin. The weight gain is impressive. One has to see it and experience it to believe how effective it can be (Natarajan, 2003). Recommended Dosages for Plants

Three percent solution was found to be most effective compared to the higher and lower concentrations investigated. Three litres of Panchagavya to every 100 l of water is ideal for all crops. The power sprayer of 10 l capacity may need 300 ml tanks of Panchagavya. When sprayed with power sprayer, sediments are to be filtered and when sprayed with hand-operated sprayers, a nozzle with higher pore size is to be used.

Spray system

506

Fundamentals of Ecology

The solution of Panchagavya can be mixed with irrigation water at 20 l per acre, either through drip irrigation or flow irrigation. Flow system

Seed/Seedling treatment Three per cent solution of Panchagavya can be used to drench the seeds, soak or dip the seedlings before planting. twenty minutes soaking is sufficient. Rhizomes of turmeric, ginger and sets of sugarcane can be soaked for 30 min before planting. Seed storage The 3% Panchagavya solution can be used to dip the seeds before drying and storing

them. Periodicity of application

Pre-flower phase (20 days after planting) Flowering and pod-setting stage Fruit/pod maturation stage

Once in 15 days (two sprays depending upon duration of the crops). Once in 10 days, (two sprays). Once during pod maturation.

Beneficial effects of Panchagavya on commercial crops

Panchagavya has been tried on mango, acid lime, guava, banana, turmeric, ginger, vegetables, paddy, sugarcane, groundnut, coconut, sunflower and jasmine, and in all of these plants, yield increased significantly and the flavour and aroma of the fruits are extraordinary. It acted as a growth stimulant and disease pest inhibitor. Panchagavya for Animal Health

Natarajan (2003) reports that after successful studies on plants using Panchagavya, trials were started on animals. So far, the results are very successful. He writes that they have tested it on dogs, pigs, poultry, fisheries, goats, sheep and cows both externally for skin diseases and orally for some other diseases with successful results and without any unwanted harmful side effects, unlike other chemical drugs, which do have residual effects. The active formulae are to be documented widely. Panchagavya for Human Health

The farmers who handled Panchagavya and herbal pesticide informed him that their appetite was more. Psoriasis was fully cured. The light white patches on the skin disappeared. The split wounds on the foot healed. 11.7.4 Phytoremediation of Metal Toxicity in Soil

The environmental degradation remediation can be done using appropriate plants and the process is very cost effective and aesthetically pleasant. Many plants are capable of the uptake and storage of heavy metals in their roots, shoots and leaves. This method is used to prevent soil and water contamination with heavy metals. Table 11.3 gives data on plants that can uptake and store heavy metals. Many plants can bind heavy metals and are called hyper accumulators.

Example-1

The uptake and translocation mechanisms and metal accumulation are different for different species. These plants are identified and grown in soils with metal pollution. Angul-Talcher area of Orissa is site for mega thermal power plants of National Thermal Power Corporation and NALCO. Huge amount of

Ecotechnology

507

fly ash are generated and stored in ash ponds. The becomes air-borne in summer and windy days and the plants growing around the therMetal ions, Hg (II) and chromium, Cr (III) mal power plants are considered metal tolerSalix sp. Solanum elaegnifolium ant plants as fly ash contains sodium, magneNicotiana tobacum (tobacco) Dicoma niccolifera sium, iron, potassium, cadmium, chromium, Liriodendro tulipifera Sutera fodina copper, nickel, cobalt, zinc. Studies by many Arabidopsis thaliana Berkheya coddii workers have confirmed this and they have Azolla caroliniana Personia metallifera also found metals in plant roots, stems, etc. Water Lilies Azolla caroliniana, Aquatic plants like Eichhornia crassipes, Lemna minor, Pistia Marsilea quadrifolia and Ludwigia perennis stratiote, Eichhornia exhibit luxurious growth in water containing crassipes coal flyash slurry. In view of these findings, these plants including aquatic weeds can be used for phyto remediation of soil metal toxicity. Most of these plants are timber plants, herbs and shrubs and are not consumed by human beings or cattle. Table 11.3

Plants that store mercury and chromium

11.7.5 Green belt development

The main objective of green belt development is abatement of air, especially suspended particulate matter (SPM) and noise pollution. Green belt development is necessary in mining and industrial areas and mining overburden dump reclamation. Green belt can also protect soil erosion and act as CO2 sink and sink for other gaseous pollutants and beautify the landscape and enhance the aesthetic value. Green belt development requires understanding of wind speed in the site direction, type of SPM, the emission level height, source strength, maximum impact zone and the type of plants for attenuation of pollution. All plants may not be suitable for SPM and noise abatement and many gaseous pollutants. Ornamental cultivated plants absorb and tolerate lead in high concentration. For removal of SPM, the following characteristics in plants are necessary. (a) Height and spread of crown. (b) Firm petioles supporting leaves of crown shapes, which can arrest SPM. (c) Other features of leaf should be Epidermal outgrowths on petioles, abundance of axillary hairs, hairs and scales on laminar surfaces, stomata on the leaf are protected by wax/hairs, etc., bark should be rough. Likewise, for good absorption of gaseous pollutants, the characteristics of plants should be (i) high level tolerance to gaseous pollutants, (ii) freely exposed foliage through adequate crown height, big sized leaves with long and broad laminar surfaces, (iii) large number of well exposed stomata etc. Fig 11.4 gives different crown shapes of leaves (CPCB – Publications). Ecotechnological methods help to choose right type of plants and culture methods. In general, fast growing plants with thick canopy cover can act as a mechanical barrier. Indigenous plants with perennial and evergreen large leaf area index (LAI) keeping the soil and hydrological characteristics of the site should be chosen. Example-2 Automobiles may be considered as ground level and mobile sources of SPM and gaseous pollution. Green belt on roadsides hence should have plants, which can be good absorbers of gaseous pollutants and SPM accumulators including lead particles, emitted in exhaust gases of automobiles.

Fundamentals of Ecology

508

The height of plants should not be very high as it will block visibility. The choice of plants should be mainly from shrubs of 1–1.5 m high and trees with 3–5 m height. The foliage area density should be uniform vertically and the leaf architecture (Phyllotaxy) should be such to capture maximum SPM. Thus, medium-sized shrubs and small trees in alternate pattern will be suitable. Traffic safety is important and hence shrubs in traffic islands and along road dividers will be most suitable. 11.7.6 Bioremediation of Nitrate Loaded WasteWater

IDL Industries Limited has its explosive manufacturing factory at Rourkela, India producing mining explosives of water gel type. The major raw materials used for manufacturing these exploFig. 11.4 Tree canopy shapes (taken from CPCB Publ.) sives are nitrates of ammonia, calcium, sodium besides powder of aluminium, thickners and common salts. Being a nitrate-based factory, the trade effluents contains a significantly high quantity of dissolved nitrates sometimes exceeding 500 ppm in wastewater. The present practice of disposal of such wastewater is to allow the water to enter to an impervious lined large lagoon. However, during monsoon and peak season of the activity the overflow water reach outside contaminating the soil and water bodies. In India, the statutory requirement for disposal of nitrate contaminated wastewater is 45 ppm. As the conventional treatment methods are cost-prohibitive, ecotechnology methods of treatment with hydrophytes like water hyacinth (Eichhornia crassipes) alone and in combination with duckweed (Valisneria sp.) in presence of cow dung as a source of nitrifying bacteria were tried in open lagoons of the size 30’ x 30’ x 10’. Water hyacinth alone in presence of bacteria source could reduce the nitrate load up to 50% within 60 days. However, in combination with duckweed the nitrate load could be reduced by 90% within 45 days indicating the potentiality of these hydrophytes in removing the nitrate load from wastewater. (P.C. Mishra, Sambalpur University, personal communication). 11.7.7

Bio-Mapping of Water Quality in Rivers (Taken from Central Pollution Control Board, New Delhi Publications)

Rivers are the lifeline of people in India and have got very important place in Indian culture and tradition. During festivals, people take holy dip in rivers. Every river stretch has a distinct water use like bathing, drinking, municipal supply, navigation, irrigation and fishing. It is also used as a receptacle for discharge of industrial effluent, municipal sewage and dumping of solid wastes. The Water (Prevention and Control of Pollution) Act, 1974 is aimed to support the water quality of various designated best-uses

Ecotechnology

509

of water bodies. The Water Quality Atlas of the Indian River System was prepared by CPCB on the basis of five major uses of river water such as: (a) Drinking water source after disinfection but without conventional treatment. (b) Outdoor bathing. (c) Drinking water source with conventional treatment followed by disinfection. (d) Requirement of wild life, fisheries. (e) Irrigation, industrial cooling, controlled waste disposal. Thus, the concept of water quality mapping based on biological criteria is now recommended by CPCB in India. It has been initiated with the identification of beneficial uses of water in terms of primary water quality criteria and maintaining the wholesomeness of river water in terms of their ecological sustainability. For maintaining the quality of river water, the pollution levels in rivers have been detected by monitoring some physico-chemical parameters, which determine the changes in chemical characteristics of water bodies. Deterioration in water quality, over the past several years has gradually rendered the river water quality unsuitable for drinking, bathing and other beneficial purposes. The concept of iomapping is used for the prediction and detection of ecological effects of pollutants and to protect rare and endangered biotic species from the effect of water pollution. On the basis of basin area, rivers are classified as major, medium and minor rivers. The information from bio mapping can be used in the classification of zoning of water bodies by the level of ecological degradation. The water quality of an entire river as per bio mapping is determined and the action plan for pollution control is prepared by comparison of the colour maps of water quality of previous years. Bio mapping is the technique of transformation of biological water quality information of a river in the form of a coloured map. Different colours on a river basin water quality map, such as blue, light blue, green, orange and red, indicate various water quality classes in terms of clean, slight pollution, moderate pollution, heavy pollution and severe pollution of a water body respectively. This method is developed by CPCB in collaboration with Dutch Experts and the method enhances the water quality evaluation in a cost-effective manner. Benthic macro invertebrates have been found most suitable parameter for water quality evaluation of water bodies, especially rivers. Benthic macro invertebrates (Fig. 11.5) are most suitable as there are visible to unaided eyes and are retained on a sieve with a mesh size of 0.6 mm diameter and they are inhabiting the different substratum of rivers, and other water bodies. Water bodies have different pollution level, support diverse macroinvertebrate communities and the taxonomy has been developed adequately. This method demonstrates an integrated effect of pollution and is very useful in assessing the impact of municipal, industrial and agricultural wastes on water. Biotic community response is sensitive to organic loading, thermal impacts, substrate alterations and toxic pollution in water bodies. Bio-Mapping Methods

(i) (ii)

(iii) (iv)

Benthic macro-invertebrates are the best suitable biological parameter, among the biotic communities in aquatic ecosystem, for bio-mapping of water body. Biological sampling is undertaken at a water depth of less than 1 m, at selected locations on a river basin map with the help of hand net, hand picking, uprooting the plants, shovel, etc., and by Eckman grab and by an artificial substratum at a depth of more than 1 m. Taxonomic identifications up to family level of Benthic macro-invertebrates. Biological water quality evaluation through:

Fig. 11.5

Distribution of dominant Benthic macro-invertebrate families in river Yamuna. (CPCB, New Delhi Publ.)

510 Fundamentals of Ecology

Ecotechnology

(v)

(vi) (vii)

511

(a) Saprobic score and (b) Diversity score. Assigning the water quality class, to each sampling locations, with respect to combinations of saprobity and diversity score of the biological sample using Biological Water Quality Criteria (BWQC). Translating the biological water quality class of each location on river basin map into respective colours assigned in BWQC. Preparation of coloured Bio-map of entire river basin for identification of pollution control strategies.

Saprobic Score (SS)

This methodology involves inventory of the presence of Benthic macro-invertebrate fauna up to the family level. All possible families having saprobic indicator value are classified on a score-scale of 1–10 according to their preference for saprobic water quality. The saprobic scores of all the families are registered and averaged to produce BMWP score. Diversity Score (Sequential comparison)

This methodology involves pairwaise comparison of sequentially encountered individuals and the difference of two Benthic animals up to the species level. The diversity is the ratio of the total number of different animal species (runs) and the total number of organisms (of all species) encountered. The ratio of diversity has a value between 0 and 1. Shannon and Wiener diversity transferred to 0 – 1 scale can also be used. Normally, high diversity of Benthic animals always support a good quality of water. However, diversity alone can not indicate the overall health of water body. High and low diversity could be of tolerant or sensitive animals to pollution. For biological water quality evaluation, the diversity of Benthic animals is compared with the saprobic score with the help of BWQC. Primary Water Quality Criteria (PWQC)

CPCB, New Delhi has derived PWQC as required in the designated best uses of river stretches (Table 11.4). Based on the long-term water quality data generated over the years, thirteen heavily polluted and twenty-six medium polluted river stretches have been identified by CPCB. The critical pollutants parameters identified for the polluted river stretches are dissolved oxygen, bio-chemical oxygen demand and total coliforms. In most of the rivers, these parameters are not adequate to determine the overall health of a water body. The bio-map based on bio-assessment clearly depicts, the stretches where the deterioration of water quality has occurred as it has affected the biodiversity. Hence, appropriate action can be taken. Outcome of PWQC

The Ganga Action Plan (GAP) was formulated and launched primarily to arrest degradation of river water quality by a programme of interception, diversion and treatment of domestic sewage and prevention of toxic and industrial chemical wastes from identified grossly polluting industrial units/stations entering into the river. India’s National River Action Plan (NRAP) has been conceived as larger plan to undertake pollution abatement in all the polluted river stretches. Industrial units are being persuaded to adopt

Fundamentals of Ecology

512 Table 11.4

Biological Water Quality Criteria (BWQC) Range of saprobic score (BMWP)

Range of diversity score

Ephemeroptera, Plecoptera, Trichoptera, Hemiptera, Diptera.

7 and more

0.2-1

Ephemeroptera, Plecoptera, Trichoptera, Hemiptera, Planaria, Odonata, Diptera

6–7

0.5 – 1

Ephemeroptera, Plecoptera, Trichoptera, Hemiptera, Odonata, Crustacea, Mollusca, Polychaeta, Hemiptera, Coleoptera, Diptera, Hirudinea, Oligochaeta

3–6

0.3 – 0.9

Mollusca, Hemiptera, Coleoptera, Diptera, Oligochaeta

2–5

Diptera, Oligochaeta, No animals

0–2

Taxonomic group

Water quality characteristic

Water quality class

Indicator colour

Clean

A

Blue

Slight Pollution

B

Light blue

Moderate pollution

C

Green

0.4 and less

Heavy pollution

D

Orange

0 – 0.2

Severe pollution

E

Red

clean technologies, to install and operate the treatment plants. seventeen categories of major polluting industries were identified and targets were fixed to adopt pollution control measures. 11.7.8

Aerobic and Anaerobic Bioreactors

For treatment of organic waste, microorganisms are used in aerobic and anaerobic biodegradation process. The principle of aerobic biodegradation is based on : CxHy + O2 + Microorganisms / nutrients Æ CO2 + H2O + Microorganismic biomass In the oxidation process, organic pollutants act as substrates and used as a source of carbon and energy and are broken down into CO2, water, nitrates, sulphates, etc. (Fig. 11.5A). Many species of bacteria and fungi have been identified for aerobic degradation of waste and they are used in bioreacters designed with specific chemical and physicals conditions suitable to them to degrade pollutants. The principle of anaerobic biodegradation is based on:

Fig. 11.5 A

Aerobic Degradation Process

Ecotechnology

Æ

CxHy + Microorganisms / nutrients

513

CO2 + CH4 + Microorganismic biomass

In the process, organic waste is converted in the absence of oxygen in several independent, consecutive and parallel reactions and the end product is methane and CO2 (Fig. 11.6). Depending upon temperature conditions, thermophillic or mesophillic, etc., microorganisms are utilised (Doble and Kumar, 2005) in the bioreactors. 11.7.9 Microbial Mining of Metals

Environmental biotechnology can be combined with conventional metallurgy called biohydrometallurgy or microbial mining or bioleaching. In this process, metals can be recovered from sulphide iron ores and tailings using the bacteria, Thiobacillus ferroxidans, Thiobacillus thioxidans, Thiobacillus acidophilus, Thiobacillus organoparus, Ferrobacillus sulfooxidans.

Fig. 11.6

Anaerobic Degradation Process.

The general reaction for indirect microbial mining is: Bacterial (i)

Metal sulphide (MS) + Fe2 (SO4)3

(ii)

4 FeSO4 + O2 + 2H2SO4

Intervention

MSO4 + 2 FeSO4 + S

2Fe2(SO4)3 + H2O Thiobacillus ferrooxidans

Presence of the bacteria in the acidic medium (at pH 2.0 – 3.0), the oxidation of Fe2++ is about 10 5 + 10 times faster than chemical oxidation process. 6

Sulphur generated in the process is oxidised to H2SO4 by the bacteria (T. ferrooxidans and T. thiooxidans). The acid makes the medium acidic for faster bioleaching. Direct bacterial leaching involves direct constant contact between the sulphide- containing mineral and the bacterial species. Bacterial enzymes are involved in the process and ultimately: Meral Sulphide (MS) + 2O2

MSO4

These are some of the examples of ecotechnology. Thiobacillus sp. are tolerant to copper, aluminium and zinc along with iron ores metals are recovered by bacterial mining and the general flowchart is (Fig. 11.7):

514

Fig. 11.7

Fundamentals of Ecology

Flowchart of Biohydrometallurgy.

MULTIPLE CHOICE QUESTIONS Choose the correct answer 1. Pig and poultry wastes used for vermicomposting after conditioning for two weeks because the wastes contain: (a) High organic matter (c) Less organic matter (b) Ammonia and inorganic wastes (d) Sulphur dioxide and methane 2. One of the following methods is part of vermicomposting process: (a) Windrow composting (c) Incineration (b) Anaerobic composting (d) Pyrolysis 3. Thyrosinase is extracted from one of the following biological sources for catechol degradation: (a) Horse radish (c) Agaricus bisporus (b) Artromyces ramosus (d) Nematolona frowardie 4. Besides other substances Panchagavya consists of: (a) Cow dung, urine, milk, curd, and ghee (b) Horse dung, urine, milk, curd and ghee (c) Earthworm, urine, milk, ghee, honey (d) Cow dung, urine, milk, curd and honey

Ecotechnology

5.

6.

7. 8. 9.

515

For removal of SPM, the following features in plant leaf are necessary: (a) Firm petiole, epidermal outgrowths on petiole, Stomata protected by wax and rough bark. (b) Soft petiole, no outgrowths on petiole, rough bark and open stomata. (c) Firm petiole, petiole with outgrowth, open stomata and soft bark. (d) Firm petiole and open stomata. Bio-mapping of aquatic bodies is done using: (a) Micro invertebrates (c) Benthic macro invertebrates (b) Macro invertebrates (d) Benthic micro invertebrates Which range of Saprobic score indicates severe pollution in an aquatic body: (a) 0 – 2 (b) > 2 – 5 (c) > 3 – 6 (d) ≥ 7 The end product of anaerobic degradation of organic wastes are: (b) CH4 + CO2 (c) CO2 + NO3 (d) CH4 + NO3 (a) CO2 + H2S In microbial mining, one of the following organism is utilized: (a) Thiobacillus sp. (c) Clostridium sp. (b) Psendomonas sp. (d) Azotobacteria sp.

Write explanatory notes on:

(a) (b) (c) (d) (e) (f) (g) (h) (i) (j) (k)

Vermitechnology Flowchart of biohydrometallurgy Anaerobic degradation process Biological water quality criteria Green belt. Plants are hyperaccumulators of metals Eco-remediation Traditional knowledge GM foods Nif genes Classical biology vs. modern biology

12

Statistical Ecology

12.1 INTRODUCTION In recent times, ecology has become highly quantitative discipline although it started as a descriptive science. A basic background in statistics is required to understand quantitative techniques used in community, population ecology and ecological modeling. Many books (Legendre and Legendre 1983, Pielou 1984, Orloci and Kenkel 1985, Ludwig, and Reynolds, 1988) on quantitative (statistical) ecology deal with statistical techniques, used in community ecology. In this book, some statistical techniques have been used to explain diversity, similarity, associations, ecological patterns, principal component analysis, ecological modeling, phytosociology and some other topics. However, in this chapter, an overview of the principles of data collection (sampling), spatial patterns and statistical distributions, some other statistical procedures and testing of hypotheses have been discussed.

12.2 ECOLOGICAL SAMPLING The sampling method is designed keeping the aim of the research work. A successful sampling method involves choosing an appropriate sampling unit and number of such units. The sampling unit may include quadrats, soil cores, transects, pit traps, etc. Statistics deals with quantitative methods for collecting, organising, presenting, analysing, summarising and drawing valid conclusions and making decisions on the strength of such analysis. Statistical tools are utilised to quantify ecological situations and relationships. The environment is vastly bigger, houses many biotic communities who interact among themselves and with the physical environment and hence ecological systems are much more complicated than any man-made system or machinery. It is not always possible to study every group of individuals or all individuals of each group, especially if it is large. The entire group is called population or universe. The ecologist examines a small part of the group, called a sample. Since the sample represents the population, its collection procedure should be unbiased and the sample size should be adequate to represent the population. Important conclusions about the

Statistical Ecology

517

population and community can often be inferred from the sampling analysis. The condition under which such inference is valid is called statistical inference. Such inferences are associated with certain degree of uncertainty. Hence, probability is used in such inferences. 12.2.1 Sampling theory

For estimating population parameters like population mean and variance, we depend upon sample statistics. Sampling theory is a study of relationships that exist between a population and samples drawn from the population. Sample statistics includes sample mean and variance. The ecologist estimates population mean and variance from the measurements of sample statistics. In view of this, sampling procedure has to be unbiased and the selection of the site/plot/subplot or individual has to be random and the selection can be with some purpose. Simple random sampling is the process of selecting the individual or item from the population in such a manner that each item or individual of the population has the same chance of selection. The theory of sampling involves with estimating the population parameters and with assigning the limits within which the population parameters are expected to lie with a specified degree of confidence. Hence, the estimate is based on the theory of probability. Sampling theory also deals with the determination of the fact whether the observed differences between two samples are due to chance variation or whether they are significant. For example, to test a new medicine in the treatment of a disease or deciding whether one fertiliser is better than the other in promoting increased crop production. The inferences involve the use of tests of significance and hypotheses testing that are important in the theory of decisions. This is also based on theory of probability and this method is called statistical inference. 12.2.2 Random Sampling

An unbiased or representative sample may be obtained by a process called random sampling, each member of a population will have equal chance of being included in the sample. The method is to use a table of random numbers prepared for such purposes and available in standard books of statistics, or alternatively another method for obtaining a random sample is to assign numbers to each member of the population and write these numbers on small pieces of paper, keep them in a box and mix them thoroughly and then draw numbers from the box. A population consisting of a finite number of items/observations (number of students in a school, number of people living in a village, etc.) is called a finite population whereas a population consisting of large number of items/observations (number of people in the world, number of people in a big country, number of birds in India etc) is called an infinite population. If we draw a number from a box, we have choice of replacing or not replacing the number into the box before a second drawing. If we replace the number, it can come up again and again, and if we do not replace, the number can only come up once. The method of sampling is, respectively, called as sampling with replacement or sampling without replacement. A finite population where sampling is done with replacement is like an infinite population as any number of samples can be drawn.

518

Fundamentals of Ecology

12.3 SAMPLING DISTRIBUTIONS Consider all possible samples of size N that can be drawn from a population with replacement (infinite population) or without replacement (finite population) of size Np > N. For each sample, the sample statistics of mean and variance or standard deviation can be computed. The sample statistics may vary from sample to sample, and in this process, we can obtain a distribution of means and standard deviations of number of samples. This is called a sampling distribution. We may differentiate the sampling distribution of means, sampling distribution of standard deviations, etc. We can denote the mean and standard deviation of the sampling distribution of means by mx– and sx– and the population mean and standard deviation by m and s, respectively. Then for a finite population: mx– = m and sx– = s/√ N √ (Np–N/Np–1) If the population is infinite or if sampling is done with replacement, the above cited equations become: mx– = m and sx– = s/√ N The sampling distribution of means is considered approximately a normal distribution if the sample size is more than or equal to 30 (N = 30 or N > 30), called large sample size or large sampling method and the normal distribution with mean mx– and standard deviation sx–, irrespective of the population and assuming the population mean and variance are finite and the population size is not less than twice the sample size. The accuracy of the approximation increases as N becomes larger. Often, it is called that the sampling distribution is asymptotically normal. The other concept is that if the population is normally distributed, the sampling distribution of means is also normally distributed even for small sample size (N < 30). 12.3.1 Sampling Distribution of Standard Deviations

We may consider all possible samples of size N that can be drawn from a given infinite population or of sampling with replacement from a finite population and for each sample we can compute the sample mean and standard deviation. The standard deviation of a sampling distribution is called its standard error. The quantities m, s, x–, s denote, respectively, the population mean and standard deviation and sample mean, and standard deviation. If the sample size is < 30 (N 1 and concave to the Z-axis for Z < 1.The points on the curve for which Z = + &-1 are points of inflection. There are other properties, beyond the scope of this book.

12.4.5 Fitting a Normal Curve to an ecological distribution

Sometimes the ecologist becomes interested to examine if the data fit to such theoretical distributions, often called model or expected distribution. The method used in general of using the sample mean and standard deviation to estimate the population mean and standard deviation and then to test the goodness of fit of the theoretical distributions by chi-square test(consult a statistics book). It is also convenient to use normal-curve graph paper to see if the data fit to a normal distribution. Many organism distributions may not fit perfectly to normal distributions. In some cases, the distributions may not be fully symmetrical like a normal distribution but either slightly skewed (either positive or negative) or kurtic (leptokurtic, or platykurtic). The degree of skewness (SK) can be measured by: SK = 3 (mean–median)/Standard deviation and the kurtosis (K) can be measured by: K = Sd4/s4 – 3, – – where d = X – X (X = sample mean) and s = standard deviation. 12.4.6 Confidence Interval Estimates of Population Parameters

0.95 Critical Region

Critical Region

0.025

0.025 Z = – 1.96

Fig. 12.2

Z = – 1.96

Normal curve showing confidence intervals and critical regions

It is important to realise that from sample statistics, the ecologist estimates the population parameters. There are two parameters in the equation of the normal distribution, m and σ, but assuming that σ is fixed, confidence lim– its for m from the mean X of a sample can be estimated as mean of the sample is normally distributed with mean m and standard deviation s /√ N and for small sampling distribution (sample size < 30). The standard deviation is calculated by using σ /√ N – 1 and as s is the — ——— —– sample standard deviation, then σ = s√(N/ N –1) can be used. Thus – m = X ± 1.96 σ / √ N.

12.4.7 Statistical Decision Theory

We take decisions on the basis of sample data and such decisions are called statistical decisions. For example, on the basis of sample information, we wish to decide whether a new vaccine is really effective in preventing a disease, whether one laboratory procedure is better than another, whether one educational procedure is better than another. In trying to reach decisions, it is convenient to make assumptions about the populations involved in the study and such assumptions may or may not be true and are called statistical hypotheses. Statistical Hypotheses In many cases, we make a statistical hypothesis for the sole purpose of nullifying it. For example, if we want to decide whether a new serum is really effective, we formulate

Statistical Ecology

523

the hypothesis that there is no difference between the new serum and old method in curing the disease. In other words, we say that the observed differences are due merely to fluctuations in sampling from the same population. Such hypotheses are called null hypotheses and are denoted by Ho. Any hypothesis that differs from the given null hypothesis is called an alternative hypothesis and is denoted by H1. For example if the null hypothesis is that there is no difference, the alternative hypothesis can be (i) there is difference between the two serums. (ii) the new serum is superior than the other serum; (iii) the new serum is inferior to the other serum in curing the disease. 12.4.8 Tests of Hypotheses and Significance

Ecologists perform experiments/ carry out field studies and collect information. They analyse the data and formulate hypotheses and using statistical methods test it. If the results observed in a random sample differ markedly from the expected results under hypothesis, then the conclusion can be made that the differences are significant and thus we would be inclined to reject the null hypothesis. Statistical procedures that enable us to determine whether observed sample results differ significantly from the expected results under hypothesis, and thus help us to decide whether to accept or reject hypotheses, are called tests of hypotheses, tests of significance or decision rules. 12.4.9 Type I and Type II Errors

While performing tests of hypotheses, if we reject a hypothesis when it should have been accepted, we say that type I error has been made. Alternatively, we accept a hypothesis when it should be rejected; we say that type II error has been made. In either case, error in testing of hypothesis has occurred. The aim of the ecologist must be minimise errors of decision. Increasing sample size helps to reduce errors. However, it is not always possible to increase sample size as it costs money, more time and logistic support, etc. In testing a hypothesis, the maximum probability with which the ecologist would be willing to risk a type I error is called the level of significance of the test. In practice, a significance level of 0.05 or 0.01 is used. In 0.05 level; we give five chances in 100 that we would reject the hypothesis when it should be accepted. In other words, we are 95% confident that we have made the correct decision. In 0.01 levels, we give 1 chance in 100 that we would reject the hypothesis when it should be accepted. Use of Normal Distribution to test the Hypotheses

The ecologist takes the help of normal distribution curve to test the hypothesis using the levels of significance. Under a given hypothesis, the sampling distribution of a statistic S is a normal distribution with mean ms and standard deviation ss. The distribution of the standardized variable (called Z score) is given by Z = (S – ms)/ss. This is the standardised normal distribution with mean 0 and variance 1.The diagram below explains the situation (Figs. 12.2 and 12.3). The ecologist can be 95% confident that if the hypothesis is true, then the z score of an actual sample statistic S will lie between –1.96 and + 1.96, as the area under the normal curve between these values is 0.95. If we like to be 99% confident that the hypothesis is true, then the z score of an actual sample statistic S will lie between –2.58 and + 2.58 as shown in the diagram. However, by choosing a single sample at random we find that the z score of its statistic lies outside the range –1.96 to 1.96 or –2.58 to 2.58, the ecologist would conclude that such an event could happen with a probability of only 0.05 or 0.01(the total shaded area in the diagram)if the given hypotheses were true. The ecologist would then

Fundamentals of Ecology

524

say that this z score differed significantly from what would be expected under the hypothesis, and we would then reject the null hypothesis. On the basis of this statement, the decision rule will be: Reject the hypothesis at the 0.05 level of significance if the score of the statistic S lies outside the range -1.96 to + 1.96 (Z < –1.96 or z > 1.96). It means that the observed sample statistic is significant at the 0.05 level. Accept the hypothesis otherwise. At 0.01 level, reject the Hypothesis if the Z score of the statistic S lies outside the range –2.58 to +2.58 (Z < -2.58 or Z >2.58). It means that the observed sample statistic is significant at the 0.01 level. Accept the hypothesis otherwise. Two-tailed and one-tailed tests

In testing the hypothesis, the ecologist may be interested in extreme values of the statistic S or its corresponding Z score on both sides of the mean (in both tails of the distribution) as explained in the above cited example. Such tests are, therefore, called two-tailed or two-sided tests. In many cases, the ecologist may be interested only in extreme value to one side of the mean( in one tail of the distribution). If the ecologist tests the hypothesis that one fertiliser is better than the other or worse than the other, the test would be one-tailed or one-sided test. In one-tailed tests, the critical region is a region to one side of the distribution, with area equal to the level of significance. The following table gives the critical values of Z for both two-tailed and one-tailed tests at various levels of significance. Critical values of z Significance Level

0.005

0.01

0.05

0.10

Critical value of Z for two-tailed tests

–2.81 or + 2.81

–2.58 or + 2.58

–1.96 or+ 1.96

–1.645 or+1.645

Critical value of Z for one-tailed tests

–2.58 or+2.58

-2.33 or +2.33

—1.645 or + 1.645

–1.28 or + 1.28

Critical values of z for different significance levels are given in the table of normal-curve areas of good statistics book (Refer to Kenney and Keeping, 1954) (Figure 12.3(a, b, c).

Fig. 12.3A

Normal curve showing confidence intervals and critical regions

Fig. 12.3B

(Z = +1.645)

Statistical Ecology

525

In statistical ecology, the common topics are Community analysis, spatial pattern analysis of organismic populations, usually using distribution models, species–abundance relations using species area curve, dominance and diversity indices, niche overlapping,inter and intraspecific asCritical Region sociations, similarity indices, community ordination methods, especially principal component analysis and ecological modZ eling. The ecologist understands the problem and makes inferences Fig. 12.3c (Z = –1.645) using basic statistical methods as enumerated above and other quantitative techniques. The principles with examples of most of these techniques have been discussed in this book in appropriate places, especially in the chapter ‘Systems concept in Ecology’, Population and Community ecology. Number of books on statistics, Quantitative Ecology etc is available and deals with these subjects. However, some of the additional topics in which the students at B.Sc.Honuors, Masters and research Level will be interested are elaborated below.

12.5 SPECIES RICHNESS Quantification of species richness in communities has drawn attention of many scientists. Margalef (1958) proposed an index of species richness as follows: R1 = S -1/ln (n), where S = the total number of species in a community/or total number of individuals observed. It increases with increasing sample size (n); ln is (logn.) The index is based on the relationship between S and n. It is, thus obvious that the value of index depends upon n. Menhinick (1964) developed another index, R2 = S/√n. This index also presupposes that a functional relationship exists between S and n in the community. It is often said that S = k√n and k is a constant. Let us examine the differences in the two indices. To measure species richness of an Oligochaete community in Nandadevi biosphere reserve mountain gradient at three sample locations. Sampling location at the base of the mountain (Base), at the middle elevation (M), at the peak elevation (P) was chosen and Oligochaetes were sampled. The hypothetical data are as follows: The species richness of the Oligochaete R1 R2 Sampling S (number of species) community is highest at the base and decreasN locations ing to reach the lowest value at the peak of the B 10 36 2.51 1.67 mountain in both the richness indices. HowM 06 36 1.395 1.00 ever, the number of species at the peak of the P 03 36 0.558 0.5 mountain (P) is 30% of the number of species observed at the base (B) of the mountain. The index value (R1) at P is 22.2% of the index value at B and R2 index value for P is 30.86% of the index value at B. Complications arises if sample sizes are different for different location. In situations where sample sizes are not equal, a statistical method called rare fraction is used to compare species richness between different communities. Hurlbert (1971) shows that

526

Fundamentals of Ecology

the number of species that can be expected in a sample of n individuals (E (Sn)) sampled from a population N total individuals consisting of S number of species is: s Ï ¸ E ( Sn ) = Â Ì1 - [( N - ni )/( N )]˝ n i =1Ó n ˛ Where ni = number of individuals of the ith species. Many ecologists prefer the rare fraction method over the simple richness indices.

12.5.1 Biodiversity Assessment

Biodiversity is a characteristic unique to the community level of organisation. Three different relationships are involved in the concept of diversity. Alpha diversity refers to the diversity of species within a given habitat. Beta diversity describes the degree of change in species from one habitat to another. Gamma diversity relates to the total regional species diversity involving many habitats. The species richness approach to assessing biodiversity examines the distribution of all resident species . The method is based on the premise that it is possible to use the large sample size of all vertebrate species to provide general patterns of species richness in an area and their response to change, even though there is not a great deal of information on each particular species. Although species richness is a simple measure of biological diversity, it provides a basis by which management decisions can be made. There is a strong inverse correlation in many groups between species richness and latitude: the farther from the equator, the fewer species can be found, even when compensating for the reduced surface area in higher latitudes due to the spherical geometry of the earth. Equally, as altitude increases, species richness decreases, indicating an effect of area and climatic conditions, available energy, isolation and/ or zonation (intermediate elevations can receive species from higher and lower). In ecology, the species–area curve is a graph showing the number of species found in a defined area of a particular habitat or of habitats of different areas. It is related to, but not identical with, the species discovery curve. The species–area relationship is usually constructed for a single type of organism, such as all vascular plants or all species of a specific trophic level. It is rarely, if ever, constructed for all types of organisms of an area simply because of the prodigious data requirements. The species–area relationship is sometimes called as species-area theory. 12.5.2 Species Area Curve

The occurrence of the number of species in a given area is a balance between two ecological processes, i.e., the loss of species by extinction, dispersal and the appearance of new species by immigration and colonisation over longer periods. The number of species is also a function of the size of the area, and for convenience the area chosen arbitrarily for study, as in the case of a sampling plot. Generally as the size of the sampling plot/quadrat size increases, the number of species encountered increases. This increase tends to be rapid at first, but then stabilises as the number of species approaches the number in the whole area. This is represented by: S = CAz where: S = number of species, A = sampling area, C = coefficient varying with group of organisms and biogeography region, Z = slope of the species-area relationship.

Statistical Ecology

527

In this equation, the exponent, z, varies with several ecological factors which may be: 1. The degree of isolation of the area sampled 2. The degree of stability of the environment 3. The dispersal ability of the organisms Let us consider the following examples: (1) A high z value indicates that the rate of decline of species number with decrease in size of the occupied area/quadrat is rapid. This is observed in oceanic islands and in patchy habitats in which species occupy in patches of varying size. In unstable environments, environmental conditions fluctuate and cause disturbances and may create patches of favourable microhabitats of some species but not for others. Thus, a high degree of instability often produces high z value. (2) A small z value indicates a species area relationship of a flat slope. Dispersability of organisms relates to the species area relation and if the species disperses Fig. 12.4 Showing species area relationmore effectively, the species area relationship will ship. Note that on log scale show a flat slope. If the dispersal is slow and the the relationship becomes rate of dispersal is low, the slope will be steep linear with high z value. (3) The coefficient, C, of the species–area curve has an ecological meaning. For two sets of data/land uses if the slope, z, of this relation is the same, the ratio of C values indicate the relative richness in species of the region from which the two sets of data are taken (or of the different taxa which are compared in a single region). The species–area relation can be calculated by linear regression analysis of data on number of species and size of the area, both expressed as logarithms. The logarithm of the number of species (S) is the dependent variable, the logarithm of the area (A) is the independent variable, C, is the intercept of the regression line and z is the slope of the species–area relation. Log S = Log C + Z Log A Diversity and evenness indices have already been discussed earlier in this book. (Refer to Systems Ecology chapter)

12.6

NICHE OVERLAP INDICES

In the chapter ‘Organism and Environmental Complex, the concept of niche has been discussed. Niche overlapping and competition zones have been graphically demonstrated. However, niche overlapping is a common occurrence (food and space) in nature and species having similar pattern of resource usages exhibit overlapping. Some of the early attempts to quantify niche overlapping are those of Horn (1966), Levin (1968) and Pianka (1973) on different vertebrate species. Levin (1968) calculated the overlap index as distance measures, Pianka (1973) calculated as correlation coefficients, Cody (1974) calculated on the basis of association analysis and the subject has been reviewed by many ecologists.

Fundamentals of Ecology

528

Dash and Mahanta (1993) studied the niche breadth and niche overlap of ten species of Indian amphibians in six different study sites using Levin’s and Horn’s (1966) indices for niche breadth and niche overlap respectively. 12.6.1 Niche breadth

Levin’s formula is: 1/Bj = SP2ij, where Bj = niche breadth of species j and Pij = proportion of occurrences of species j in plot/habitat i. 12.6.2 Niche Overlap

Horn’s formula is: a jk =2SPij.Pik/(SP2ij + SP2ik), where Pij = proportion of occurrences of species j in plot/habitat I, ajk = overlap of species j and k , Pik = proportion of occurrences of species k in plot i. The niche breadth refers to the habitat niche (space) breadth. The amphibian species that utilise a broad spectrum of the environment and are found in all the study sites were considered as habitat generalists. These species usually have high habitat niche breadth scores. Species which are apparently restricted in their distribution and seem to live in narrow range of the environmental spectrum and have low niche breadth score are considered habitat specialists. All other amphibian species were considered habitat intermediates. The habitat generalists had a niche breadth score of > 3 and the habitat specialists had a score of < 1 and the habitat intermediates had a score of between 1 and 3. Another example based on trophic niche (food niche) is discussed below. The niche breadth on the basis of food resource can be quantified by using Simpson’s diversity index as follows: B (Breadth) = 1/S Pi2, where s = number of different resources, Pi = frequency of utilisation of the i=1 ith category. For example, a frog’s prey (the prey is taken as one niche dimension) might consist of the following: Prey options (%)/ frog species

Ants

Mosquito

Other insects

Niche breadth

Species 1

50

40

10

2.38

Species 2

60

30

10

2.17

Species 3

90

10

0

1.23

The niche breadth score of species 3 is much less than the other two species because of its dependence on ants for food whereas in the other two species the situation is different. Niche overlap on the basis of food requirement of three species of snakes was studied by Gregory (1978). Niche overlap can be calculated using the following formula: Ojk =

SPijPik ( SPij 2SPik 2)

Where Pij and Pik are the Pi values for the species j and k.The value Ojk varies from 0(no overlap) to 1 (total overlap). Taking actual feeding data from the field or experimental studies or from hypothetical data, one can calculate niche overlap score and interprete it.

Bibliography Abbasi, SA and Ramasami E, Biotechnological Methods of Pollution Control, Universities Press (India) Limited, Hyderabad, p. 168., 1999. Abelson, PH Biotechnology and Biological Frontiers, Amer. Assoc. Adv. Sci. USA, Publc. No. 84–88, p. 516, 1984. Abbott, (Quoted in Trevor and Rowe, 2004), 1992. Agrawal, K.C., Environmental Biology, Agro-Botanical Publication India, p. 439, 1987. Alexander, M, Microbial Ecology, John Wiley & Sons, Inc., New York, 1971. Allan, D.J., “Life history patterns in zooplanktons”, Am. Nat., 110, 165–179, 1976. Allee, W.C., A.E. Emerson, O. Park, T. Park, and K.P. Schmidt, Principles of animal Ecology, Saunders, Philadelphia, 1949. Ambhasht, R.S., A Text Book of Plant Ecology (3rd edn.), Students, Friends and Co., Varanasi, p. 261, 1974, (1988, 9th edn, p. 351). ———, “Responses of Aquatic Plants to Pollution”, Biological Indicators and Indices of Environmental Pollution, Eds Zafar et al., Central Board for Prevention and Control of Water Pollution, New Delhi, 61–66, 1982. ———, “Studies on the Biomass Productivity of Some Tropical Grazing Lands and Plantation Forests”, Rangelands Resource and Management, Eds Panjab Singh and P.S. Pathak, Indian Grassland and Fodder Res. Inst. Jhansi, India, 1988. Ananthakrishnan, T.N., Bioresources Ecology, Oxford and IBH Publ. Co., New Delhi, p. 159, 1982. Andrewartha, H.G., Introduction to the Study of Animal Populations, University of Chicago Press, Chicago, p. 281, 1961. Andrezejewski, L., “Estimation of the Effects of Feeding of the Sucking Insect Cicadella Viridis L. (Homoptera-Auchenorrhyncha) on plants”, Secondary Productivity of Terrestrial Ecosystems, Ed. K. Petrusewicz, Polish Acad. Sci. Warsaw, 791–805, 1967, Appelhof, M., “Vermicomposting on a Household Scale”, Ed. D.L. Dindal, Soil Biology as Related to Land Use Practices, Proceedings of the VII International Colloquium of Soil Zoology, 157–160, 1980 Arbogast, Brian and Kenagy G J, Comparative Phylogeography as an Integrative Approach to Historical Biogeography, J. Biogeo., 28, 819–825, 2001. Asthana, D.K and Meera Asthna, Environment: Problems and Solutions, S. Chand and Co Ltd, New Delhi, p. 323, 1998.

530

Fundamentals of Ecology

Avise, JC, Molecular Population Structure and the Biogeographic History of a Regional Fauna: A Case History With Lessons for Conservation Biology, Oikos, 63, 62–76, 1992. Avise, JC, Phylogeography: The History and Formation of Species, Harvard University Press, Cambridge, M A, USA, 2000. Avise, JC et.al., The Mitochondrial DNA Bridge Between Populations Genetics and Systematics. Annual Review of Ecology and Systematics, 3, 457–498, 1987. Bakker, R.T., The Deer Flees, the Wolf Pursues: Incongruencies in Predator-prey Coevolution. In Futuyma, D.J. and Slatkin, M (Eds.), Coevolution, Sinauer Associates Inc. Massachusetts, p. 350–382, 1983. Bell, R.H.V., A Grazing System in the Serengeti, Scienti?c American, 225, 86–93, 1971. Bergmeyer, H.V., In: Methods of Enzymatic Analysis, Acad. Press, New York, 772–774, 1968. Beyers, R.J., “The Metabolism of Twelve Aquatic Laboratory Microecosystems”, Ecol. Monog., 33, 281– 306, 1963, Bhat, D.M. et al., Forest Dynamics in Tropical Rain Forests of Uttarakannada District In Western Ghat, India Current Science, 79(7): 975–85, 2000. Bharucha, F.R., A Text Book of the Plant Geography of India, Oxford University Press, Delhi, 1983. Billings, W.B., Plants and the Ecosystem, Wardsworth Publ. Co. Inc., Belmont, 1965. Billore, S.K. and L.P. Mall, “Seasonal Variation in Chlorophyll of a Grassland Community”, Trop. Ecol., 17, 39–44, 1976. Bioenergy News, Ministry of Non-conventional Energy Sources, Govt. of India, New Delhi. 1997–1999, Vol. 1–3. Biotechnologies for Treatment of Wastes, Concept of Biomapping of Rivers and Other Publications, Central Pollution Control Board, New Delhi. Birch, L.C., “The Meaning of Competition”, Amer: Nat., 41, 5–18, 1957, Black, W., “Oxygen Consumption of the Antarctic Spring Tail, Paristema actooculata”, Rev. Ecol. Biol. Sol., 16(2), 227–233, 1979. Blackman, E.F., “Optima and Limiting Factors”, Ann. Bot., 19, 281–295. 1905, Bose, T.K., P. Das and G.G. Maiti., Trees of the World, Regional Plant Resource Centre, Bhubaneswar, 1998. Bouche, M.B., “Strategies Lombriciennes”, Ecol. Bull., 25, 122–132, 1977, Boughey, A.S., Ecology of Populations, The Macmillan Co., New York, p. 135, 1968. ———, Man and Environment, The Macmillan Co., New york, p. 472, 1971, Bowen, H.J.M., Environmental Chemistry of the Elements, Academic Press, New York, 1979. Bray, J.R., “Measurement of Leaf Utilization as an Index of Minimum Level of Primary Consumption”, Oikos, 12, 70–74, 1961. ———, “Root Production and the Estimation of Net Productivity”, Can. J. Bot., 41, 65–72, 1962. ———, “Primary Consumption in Three Forest Canopies”, Ecology, 45, 165–167, 1964. ——— and E. Gorham, “Litter Production in Forests of the World”, Ed. J.B. Cragg, Advances in Ecological Research, 2, 101–157, Academic Press, London, 1964. Braun-Blanquet, J., Plant Sociology (English translation by G.D. Fuller and H.S. Conard), McGrawHill Book Co. Inc., New York, p. 438, 1932. Brain, M.V. Ed., Production Ecology of Ants and Termites, Synthesis Series, 13, Cambridge University Press, London. 1977. Brooks, D.R. and D.A. McLennan, Phylogeny, Ecology and Behavior, The Univ. Chicago Press, Chicago, 1991.

Bibliography

531

Brown, J.H. and M.V. Lomolino. Biogeography, Sinauer Associates. Inc., Sunderland, Ma, USA. 1998. Brown, L.R. and P. Shaw, “Six Steps to a Sustainable Society”, Worldwatch Paper, 48, 1972, Brown, TA. Gene Cloning – An Introduction. 3rd Ed., Chapman and Hall. Buch, W., Atmospheric Pollution, McGraw Hill, New York, 1972. Burges, A. and F. Raw, Soil Biology, Academic Press, London, p. 532, 1967. Busby, D.G., P.A. Pearce, N.R. Garrity, L.M. Reynolds, J. AppI. Ecol. 20, 255–263. 1983. Byzova, J.A., “Comparative Rate of Respiration in Some Earthworms (Lumbricidae, Oligochaeta)”, Rev. Ecol. Biol. Sol., 2, 207–216, 1965. Cadle, R.D. The Measurement of Air-borne Particles, John Wiley and Sons, New York, 1975. Cain, S.A., Foundation of Plant Geography, Harper and Brothers, New York, 1944, Calvin, M. and J. Bhassham, The Photosynthesis of Carbon Compounds, W.A. Benjamin Inc., New York, 1962. Calvin, W.H. The Great Climate Flip-?op. The Atlantic Monthly January, 281, 47–64, 1998. Carvalho, Advances in Molecular Ecology (Quoted in Trevor & Rowe, 2004), 1998. Central Pollution Control Board, New Delhi. Biotechnologies for Treatment of Wastes: Concept of Biomapping of Rivers, 2001. Chailakhyan, M.H., “Mechanism of Flowering”, Ann. Rev. Plant Physiol, 19, p. 1, 1968. Chaphekhar, S.B., “Biological Indicators: The Concept and New Additions”, Int. J. Ecol. Environ. Soi., 4, 45–52, 1978. Chaturvedi, O.P., and J.S. Singh, “The Structure and Functions of Pine Forests in Central Himalaya, I. Dry Matter Dynamics”, Annals of Botany, 60, 237–262, 1978. ———, “The Structure and Functions of Pine Forests in Central Himalaya, II. Nutrient Dynamics”, Annals of Botany, 60, 253–267, 1987. Chapman, R.N., “The Quantitative Analysis of Environmental Factors”, Ecology, 9,111–122, 1928, Chapman, J.L. and M.J. Reiss., Ecology: Principles and Applications. Camb. Univ. Press. U.K., 1992. Chatterjee, D., “Studies on the Endemic Flora of India and Burma”, Jour. Asiatic Soc. Bengal Sci., 5, 19–67, 1939. Chadha, S. and CS. Kar, Bhitar Kanika: Myth and Reality, Natraj Publishers, Dehra Dun, p. 388, 1999. Chilika, A Ramsar Site, Chilika Development Authority Bhubaneswar, 2000. Chitty, D., “Population Processes in the Role and their Relevance to General Theory”, Can. J. Zool., 38, 99–113, 1960. ———, “The Natural Selection of Self Regulatory Behaviour in Animal Populations”, Proc. Ecol. Soc. Aust., 2, 51–78, 1967. Chouard, P., “Vernalisation and its Dormancy”, Ann. Rev. Plant Physiol., 11, p. 191., 1960. Choudhury, A., “Tigers in India Today”, Tiger Paper, XVI(3), 1–6, 1989, Choudhury, N.K., B.C. Guru, and M.C. Dash, Observations on the Relationship between Leaf Pigment Concentration, Moisture and Dry Weight before Leaf, all in Dalbergia sissoo Roxb., CPE, 1(4), 147– 149, 1976. Choudhury, N.K., P.K. Pradhan, and M.C. Dash, “Certain Physicochemical Factors and Phytoplankton of Hirakud Dam”, Geobios, 6, 104–106, 1979. Church, (Quoted in Trevor & Rowe, 2004), 187. Clements, F.E., Plant Succession: An Analysis of the Development of Vegetation, Carnegie Inst. Wash., 242, 1–512, 1916. ———, “Nature and Structure of the Climax”, J. Ecol., 24, 252–284, 1936.

532

Fundamentals of Ecology

Cloud, P.E. Jr. Resources, Population and the Quality of Life (quoted by E.P. Odum, 1971), 1969. Cody, M.L. Competition and the Structure of Bird Communities. Princeton University Press, Princeton, New Jersey, 1974. Cole, L.C., “Population Cycles and Random Oscillations”, J. Wild. Mgt., 15, 233–251, 1951. ———, “Some Features of Random Cycles”, J. Wild. Mgi., 18, 107–109, 1954. ———, “The Ecosphere”, Sci. Amer., 198(4), 83–96, 1958. Coleman, D.C., A. Sasson, A.I. Breymeyer, M.C. Dash, Y. Dommergues, H.W. Hunt, E.A. Paul, R. Schaefer, B. Uleblova, and R.I. Zlotin, “Decomposer Sub-system”, Grasslands, Systems Analysis and Man, Ed. A.I. Breymeyer and G.M. van Dyne, Cambridge University Press, London, 1980, Collier, J.E. and D. Livingstone, “Commercial Vermicomposting: A Better Solution to Organic Waste Conversion”, Compiled by M. Applehof–Proceedings of the Workshop on the Role of Earthworms in the Stabilisation of Organic Residues, Beech Leaf Press, Michigan, 255–259, 1981. Commission of European Communities, Criteria (Dose/Effect Relationship) for Cadmium, Pergamon Press, New York, 1978, Coppage, D.L., E. Mathews, G.H. Cook and J. Knight. Biochem. Physiol. 5, 536–542, 1975. Cortright, Mayer H, Signs of Life: The Growth of Biotechnology Centers in the USA, The Bookings Inst. Center on Urban and Metropolitan Policy., 2002. Coulson, J.C. and J.B. Whittaker, “The Ecology of Moorland Animals”, in “Production elocogy of British Moors and Montane Grasslands”, Ecological Studies, Eds O.W. Heal and D.F. Perkins, 27, 52–53, Springer, Berlin, 1978. Coupland, R.T., Ed., Grassland Ecosystems of the World, IBP No. 18, Cambridge University Press, Cambridge, London, p. 401, 1979. Cragg, J.B., The Theory and Practice of Conservation, IUCN Publ., New Series No. 12, 25–35, 1968. Criscione, Charles, Poulin R. and Michael S. Blouin, Molecular Ecology, 14, 2247–2257, 2005. Cummins, K.W., Calori? c Equivalents of Studies in Ecological Energetics, Mimeographed, Univ. Pittsburg, p. 52, 1967. Czechanovski, (Quoted by Kar et al., 1987), 1913. Current Science, 75(3), 1998. Current Science, 72(12), 73(2), 1997. Dadhich, L.K., “Recognition and Monitoring of Air Pollutants with the Aid of Plants”, Biological Indicators and Indices of Environmental Pollution, Eds Zafar et al., Central Board for the Prevention and Control of Water Pollution, New Delhi, 19–26, 1982. Dani, H.P., D.P. Pati, S. Basu and N. Behera Phytosociological Analysis of Forest Vegetation of Kantamal Region, Phulbani, Orissa, Jour. Tropical Forestry, 7: 151–158, 1991. Daniel, R. R. Future Challenges in Food Grain Production in India. Current Science, 79(8): 105 1–53, 2000. Dansereau, P., Biogeography: An Ecological Perspective, Ronald Press, New York, 1957. Darwin, C. The Origin of Species by Means of Natural Selection or the Preservation of Favoured Races in the Struggle of Life. John Murray, London, 1859. Das, A.K. and P.S. Ramakrishnan, “Litter Dynamics in Khasi Pine (Pinus kaesiya Royle ex Goerdon) of North Eastern India”, For. Ecol. Mgt., 10, 135–153, 1985. Das, A.K. and M.C. Dash, “Earthworm Meal as a Protein Concentrate for Japanese Quails”, Ind. Jr. Poult. Sci., 24, 136–137, 1989. ———, “Earthworm Meal as a Protein Concentrate for Broilers”, Trop. Agril, 67, 342–344, 1990.

Bibliography

533

Das, R.C., M.C. Dash, P.C. Mishra, K. Choudhury, and G.K. Kar, “Pollution Load in the Mahanadi Water System”, Industrial Engg. Jour., XV(9), 19–24, 1986. Das, R.C., K. Choudhury, M.C. Dash, and P.C. Mishra, “Water Pollution and Control in Paper mills of Orissa”, Pollution Management in India, Ed, R.K. Trivedy, Ashish Publ. House, New Delhi, 1989. Das, R.C. and S.K. Ghosal, Noise Pollution. Orissa Pollution Control Board, p. 38, 1996. Das, R.K. and R.N. Kar, “Genotoxic Effects of Three Benzodiazepine Tranquilizers in Mouse bone marrow as revealed by the macronucleus test”, Caryologia, 39, 193–198, 1986. Das, S.M. and S.K. Moitra, “Studies on the Food of Some Common Fishes of Uttar Pradesh, India, 1. The Surface Feeders, the Mid-feeders and the Bottom Feeders” Proc. Nat. Acad. Sci. India, 258(1&2), 1–6, 1955. Dash, H.K., B.N. Beura and M.C. Dash, “Gut Load, Transit Time, Gut Micro?ora and Turnover of Soil, Plant and Fungal Material by Some Tropical Earthworms” Pedobiologia, 20, 13–20, 1986. Dash, M.C., “The Role of Earthworms in the Decomposer System”, Glimpses of Ecology, Eds J.S. Singh and G. Gopal, Int. Sci. Publ., Jaipur, India, 399–409, 1978. ———, “Consumers”, Grassland Ecosystems of the World, Ed. R.T. Coupland, Cambridge University Press, London, 1979. ———, Biology of Enchytraeidae (Oligochaeta), Int. Book Distributors, Dehradun, India, p. 171, 1983. ———, “The Other Annelids”, Animal Energetics, 1. Eds T.J. Pandian and F.J. Vernberg, Academic Press, New York, 261–299, 1987. ———, “Secondary Productivity from Indian Rangelands”, Rangeland Resource and Managements, Eds Panjab Singh and P.S. Pathak, Ind. Grassland and Fodder Research Inst., Jhansi, 395–403, 1988. ———, “Secondary Productivity from Indian Grasslands”, Perspectives in Ecology, Eds. J.S. Singh and B. Gopal, Jagamander Book Agency, New Delhi, 105–117, 1989. ———, “The Enchytraeidae (Oligochaeta)”, Soil Biology Guide, Ed. D.L. Dindal, John Wiley and Sons, New York, 1990. Dash, MC, Biotechnology and Human Health. 8th Orissa Science Congress Proceedings, p. 4–8, 2004. Dash, MC. and J.B. Cragg, “Selection of Microfungi by Enchytraeidae (Oligochaeta) and Other Members of Soil Fauna”, Pedobiologia, 12, 282–286, 1972. ———, “Ecology of Enchytraeidae (Oligochaeta) in Canadian Rocky Mountain Soils”, Pedobiologia, 12, 323–335, 1972. Dash, M,C. and Charulata Dei, “Crowding effect on Growth and Metamorphosis of Microhyla ornata (Dumeril & Bibron)” Curr. Sci. 70, 406–408, 1995. Dash, M.C. and Charulata Dei, “Effect of Diet on Growth Rates, Body Size at Metamorphosis and on Duration of Larval Period in Microhyla Orrata Tadpoles”, Tropical Ecol. 39, 1–18, 1998. Dash, M.C. and J.K. Mohanta “Quantitative Analysis of Comm. Structure of Tropical Amphibian Assemblage and its Signi?cance to Conservation”, Jour Bio Sci, 18, 121–139, 1993. Dash, M.C., U.C. Patra and A.V. Thambi, “Comparison of Primary Production of Plant material and secondary production of Oligochaete in a tropical grassland soil from Southern Orissa, India”, Trop. Ecol., 15, 16–21, 1974. Dash, M.C., A.K. Hota, B.C. Guru, and B.K. Senapati, “Relationship on the Community chlorophyll contents with reference to height and dry weight”, Geobios, 2, 126–127, 1975. Dash, M.C., N.K. Choudhuty, N. Behera, and P.K. Mohapatra, “Primary Production in Four Species of Ipomoea”, Geobios, 3, 13–15, 1976. Dash, M.C. and U.C. Patra, “Density, Biomass and Energy Budget of a Tropical Earthworm Population from Orissa, India”, Rev. Ecol. Biol. Soil., 14, 461–471, 1977.

534

Fundamentals of Ecology

Dash, M.C., A.K. Hota, and N.K. Satpathy, “Relationship between Weight, Length and Metabolic Rate in Hemidactylus ? avirdis (Ruppel)”, CPE, 3, 204–206, 1978. Dash, M.C. and U.C. Patra, “Wormcast Production and Nitrogen Contribution to Soil by a Tropical Earthworm Population from a Grassland Site in Orissa, India”, Rev. Ecol. Biol. Sol., 16, 79–87, 1979. Dash, M.C., B.K. Senapati, and N. Behera, “Microfungi Associated With the Decomposition of Earthworm Tissue in Pasture”, Soil Biol. Bull. Ind., 1, 21–23, 1979, Dash, M.C., P.C. Mishra, and N. Behera, “Fungal Feeding by a Tropical Earthworm”, Trop. Ecol., 20, 9–12, 1979. Dash, M.C., B. Nanda and N. Behera, “Fungal Feeding by Enchytraeidae (Oligochaeta) in Tropical Woodland from Orissa, India”, Oikos, 34, 202–206, 1980. Dash, M.C. and B.K. Senapati, “Cocoon Morphology, Hatching and Emergence Pattern in Tropical Earthworms”, Pedobiologia, 20, 316–324, 1980. Dash, M.C. and B.C. Guru, “Distribution and Seasonal Variation in Numbers of Testsacea (Protozoa) in Some Indian Soils”, Pedobiologia, 20, 325–342, 1980. Dash, M.C. and A.K.’ Hota, “Density Effects on the Survival Growth Rate and Metamorphosis of Rana tigrina tadpoles”, Ecology, 61, 1025–1029, 1980. Dash, M.C., B. Nanda, and P.C. Mishra, “Digestive Enzymes in three Species of Enchytraeidae (Oligochaeta)”, Oikos, 36, 316–318, 1981. Dash, M.C., P.C. Mishra, R.K. Mohanty, and Neelam Bhatt, “Effect of Speci?c Conductance and Temperature on Urease Activity in Some Indian Soils”, Soil Biol. Biochem., 13, 73–74, 1981. Dash, M.C. and P.C. Mishra, “Effect of Moisture on Intrinsic Rate of Increase and Net Reproductive Rate of Soil Nematodes”, J. Soil. Biol. Ecol., 2, 58–66, 1982. Dash, M.C., B. Satpathy, N. Behera, and C. Dei, “Gutload and Turnover of Soil, Plant and Fungal Material by Drawida calebi, a Tropical Earthworm”, Rev. Ecol. Biol. Sol., 21, 379–393, 1984. Dash, M.C. and G.B. Pradhan, “Distribution and Population Dynamics of Soil Nematodes and their Relationship with Primary Production in a Tropical Hill Ecosystem of Sambalpur, India”, Pedobiologia, 26, 349–359, 1984. Dash, M.C. and B.K. Senapati, “Vermitechnology: Potentiality of Indian Earthworms for Vermicomposting and Fermifeed”, Soil Biology, Eds M.M. Mishra and K.K. Kapoor, HAU, Hissar, India, 61–69, 1985. Dash, M.C. and P.C. Mishra. Man and Environment, Menaka Prakashani, Sambalpur. p. 235, 1996. Dash, M.C., N. Behera, and H.K. Dash, “Earthworms and Micorfungal Interaction in Soil”, Soil Biology, Ed. M.M. Mishra and K.K. Kapoor, HAU, Hissar, India, 77–83, 1985. Dash, M.C. and B.K. Senapati, “Vermitechnology: an Option for Organic Waste Management in India”, Verms and Vermicomposting, Eds M.C. Senapati and P.C. Mishra, Five Star Printing Press, Burla, India, 157–172, 1986. Dash, M.C. and P.C. Mishra, “Persistence and Effect of Pesticides in Earthworms and Soil”, Final Technical Report to the UGC, New Delhi, School of Life Sciences, Sambalpur University, Burla, Orissa, India, 1986. Dash, M.C. and C.S Kar, “Conservation and Management of Sea Turtle Resources in Orissa Coast (India)”, Env. and Toxicology, 303–306, 1987. Dash, M.C., P.C. Mishra, K. Choudhury and R.C. Das, “Bioaccumulation of Mercury in River Ib”, Ecology and Pollution of Indian Rivers, Ed R.K. Trivedy, 293–302, Ashish Publ. House, New Delhi, 1988. Dash, M.C. and P.K. Mishra, “Energy Cost of Metamorphosis in a Tropical Tree Frog, Polypedates maculatus”, Jr. Ecobiology 1(2), 131–136, 1989.

Bibliography

535

Dash, M.C. and A.K. Das, “Earthworm Cast as a Substitute for Wheat Supplementation in Growth of Tropical Edible Mushroom, Pleurotus sajorcaju “, Trop. Agril., 66, 179–180, 1989. Dash, M.C. and C.S. Kar, The Turtle Paradise–Gahirmatha: An Ecological Analysis and Conservation Strategy, Interprint, New Delhi, p. 295, 1990. Dash, M.C. Vermitechnology for Sustainable Development, Orissa Pollution Control Board, Bhubaneswar, India. 15 p, 1998. Dash, M.C. Earthworm Diversity and Ecophysiology to Vermitechnology for Sustainable Development, Presidential Address, Indian Science Congress, Zoology, Entomology and Fisheries Section, 86th session, Chennai, 46 p, 1999. Dash, M.C. and S.P, Dash, Conservation and Sustainable Management of Belowground Biodiversity: A Review on the Functional Role of Soil Fauna in Indian Ecosystems with Particular Reference to Earthworms, International Journal of Ecology and Environmental Sciences, 34(3): 223–243, 2008. Dash, SP, How Does the Gap Junction Protein, Connexin43 Inhibit Cell Growth? M.Sc. Dissertation, Univ. of Leicester, England., 1999. Dash, SP, Analysis of the Expression and Regulation of Xenopus Frizzled 7, Ph.D. Thesis, Univ. of East Anglia, England., 2005. Dash, S P, Biotechnology & Bioincubator, (In: Environmental Biotechnology edited by Mishra, S.K. & Juwarkar), APH Publ., New Delhi, p. 1–18, 2007. Davidson, J., “On the Growth of Sheep Population in Tasmania”, Trans. Royal Soc. Austr., 62, 342–346, 1938. De, AK., Environmental Chemistry, Wiley Eastern Ltd. New Delhi p. 364, 1994. De Gordo, WF, Wasserman ZR, and Lear JD, Protein Design, a Minimalist Approach Science, 243: 622–628, 1989. De Sloover, J. and F. Led Blanc, “Mapping of Atmospheric Pollution on the Basis of Lichen Sensitivity”, Proc. Sy. Eds. M. P. Res. Adv. Trop. Ecol., Ed. R. Mishra and B. Gopal, 42–56, 1968. Deevey, E.S. Jr., “Life Tables for Natural Populations of Animals”, Quart. Rev. Biol., 22, 283–314, 1947. ———, “The Probability of Death”, Sd. Amer., 182, 58–60, 1950. Devon, RS, Porteous, DJ, Brookes, AJ, Splinkerettes–Improved Vectorettes for Greater Ef?ciency in PCR Walking. Nuc. Acid Re., 23, 1644–1645, 1995. Dempster, J.P. “A Quantitative Study of the Predators on the Eggs and Larvae of the Broom Beetle, Phytodecta Olivacda Forster, Using the Precipitin Test,” J. Anim. Ecol., 29, 149–167, 1960. Dobzhansky, T. A Review of Some Fundamentals Concepts and Problems of Population Genetics. Cold Spring Harb, Symp. Quant. Biol. 20, 1–15. 1995. Dobzhansky, T. Genetics of the Evolutionary Process. Columbia University Press, New York., 1937. Doble Mukesh and Anil Kumar, Biotreatment of Industrial Ef?uents, Clesevier-Butterworth Hinemann, Amsterdam, London, 322 pages, 2005. Down to Earth, (Science and Environment Fortnightly, Centre for Science and Environment, New Delhi. All issues, 200. Dyer, M.I. “Consumers”, Grassland Ecosystems of the World, Ed. R.T. Coupland, Cambridge University Press, London, 1979. Down to Earth, New Delhi, 1997–2000. Edwards, C.A. and J.R. Lofty, Biology of Earthworms, Chapman and Hall, London (2nd edn, 1977), 1972. Ehrlich, P.R., The Population Bomb, Ballantine, New York, 1968. Ehrlich, P.R. and A.H. Ehrlich, Population, Resources and Environment: Issues in Human Ecology (2nd edn), Freeman and Co., San Fransisco, 1973.

536

Fundamentals of Ecology

Elrich, HA, PCR Technology—Principles and Application for DNA Amplification. W.H. Freeman & Company, New York, 1992. Elsenberg, RS Genes, Patents, and Product Development, Science, 257: 903–906, 1992. Elton, Charles, Animal Ecology, Macmillan Co., New York, p. 207, 1927. ———, Voles, Mice, and Lemmings: Problems in Population Dynamics, Oxford University Press, London, 1942. Emme, A. (undated), The Biological Clock, Peace Publ. Moscow (English translation by G. Yankovsky). Engelmann, M.D., “The Role of Soil Arthropods in Community Energetics”, Anim. Zool., 8, 61–96, 1968. Erickson, David et al. Molecular Ecology, 13, 2505-2522, 2004. Evens, A.C. and W.J.McL. Guild, “Studies on the Relationships Between Earthworms and Soil Fertility, I. Biological Studies in the Field”, Ann. Appl. Biol., 34, 347, 1947. Erlich, P.R. and P.R. Raven. Butter?ies and Plants: A Study in Coevolution. Evolution, 18. 586–608, 1964. Environ News, Ministry of Env. and Forests, Govt. of India, New Delhi, Vol. 1–3, 1998–1999. Eto, M., In: Organophosphorus Pesticides: Organic and Biological Chemistry, CRE Press, Cleveland, 1974. F.A.O/W.H.O., “Evaluation of Some Pesticide Residues in Food”, Pesticide Residues Ser. No. 1, 1971. ———, Pesticide Residues Ser. No. 2 and 3, 1973. ———, Ibid., Ser. No. 4, 1974. Fergusson, J.E., Inorganic Chemistry and the Earth, Pergamon Series on Environmental Science, Pergamon Press, p. 400, 1982. Ferris, C., R.A. King, and A.J. Gary. Molecular evidence of maternal parentage in hybrid origin of spartina anglica, molecular ecology, 6: 185–187. Finney, D.J. Probit Analysis, 3rd edn. Cambridge Univ. Press, 1971. Fisher, R.A., The genetical theory of natural selection, Clarendon Press, Oxford. 1930. Forbes, S.A., “The lake as Microcosm”, Bull. Sc. A. Peor:, Reprinted in Nat. Hist. Surv. Bull., 15, 537–550 (1925), 1987. Ford, E.B. Ecological Genetics, Methaen, London.1964. Forrester, J.W., Industrial Dynamics, Massachusetts Inst. of Technology Press, Mass, 1961. Fosberg, R.F., “Vegetation and the Geologist”, Trop. Ecol., 6, 3–18, 1965. ———, “Succession and Condition of Ecosystems,” Jour. Ind. Bot. Soc., 40(4), 351–355, 1967. Frankham et al. (Quoted in Trevor & Rowe, 2004), 200. Fredericks, I and David MaCallum. International Standards for Environmental Management Systems: ISO 14000, Icc-EMC N. letter 2–6, 1999. Frazier, J.M., “Bioaccumulation of Cadmium in Marine Organisms”, Env. Health Perspect., 28, 75–79, 1979. Friberg, L.M. Piscator, G.F. Nordberg and T. Kjellstrom, Cadmium in the Environment, CRC Press, Cleveland, Ohio, USA, 1974. Gaddie, R,E. Sr., “Worming away”, News Week, June 21, 67–68, 1976. Gadgil, M. Defining Biodiversity Resources, Current Science 79(3), 280–83, 2000. Gadgil, M. and O.J. Solbrig, “The Concept of r and k Selection: Evidence from Wild Flowers and Some Theoretical Considerations”, Am. Nat., 106, 14–31, 1972. Ganguly, B.N., R.N. Kaul, and K.T.M. Nambiar, “Preliminary Studies on a Few Too Feed Species”, Annals of Arid Zone, Jodhpur, 3, 33–37, 1964.

Bibliography

537

Garg, VK and Chaudhury A, Biohydrometallurgy. Bacteria can extract metals. Env. Pol. Control J., 1999. Gates, D.M., Biophysical Ecology, Springer-Verlag, New York, p. 611, 1980. Gates, G.E., “Burmese Earthworms–An Introduction to the systematics and Biology of Megadrile Oligochaete With Special Reference to South-East Asia”, Trans. Am. Philo. Soc., 63(7), 1–326, 1972. Gause, G.F., “Ecology of Populations”, Quart. Rev. Biol., 7, 27–46, 1932. ———,The Struggle for Existence, Williams and Wilkins, Baltimore, 1934. ———, “Experimental Analysis of Vito Volterra’s Mathematical Theory of the Struggle for Existence”, Science, 79, 16–17, 1934. ———, “Ecology of Populations”, Quart. Rev. Biol., 11, 320–336, 1936. Geiger, R., The Climate Near the Ground, Cambridge, MASS., Harvard University Press, 1941. Giannasi and Crawford, (Quoted in Trevor & Rowe, 2004), 198. Gibson, Greg, Microarrays in Ecology, and Evolution: a Preview. Molecular Ecology, 11, 17–24, 2002. Gilbert, O.L., Bryophytes as Indicators of Air Pollution in the Vyne Valley”, New Phytol., 67, 15–30, 1968. Giri, Sohan, Impact of Organic Matter Quality and Earthworm Inoculation in Soil and Its Role on Growth of Tea Plant (Camellia assamica), Ph.D. Thesis, Utkal University, India, 2006. Glover, DM Ed. DNA Cloning Vol. I & II, IRL Press, New York, 1985. Golding, JW Monoclonal Antibodies: Principles and Practice. Academic Press, New York, 1983. Gopal, B., PS Pathak and KG Saxena, (Ed), Ecology Today, Int. Scientific Publ., New Delhi, 1997. Goodald, DW and RA Perry (Ed). Arid-Land Ecosystems, Vol. 1, Cambridge Univ. Press, Cambridge, 1979. Golley, F.B., “Energy Dynamics of a Food Chain of an Old Field Community”, Ecol. Monogr.,30, 187–206, 1960. ———, “Energy Values of Ecological Materials”, Ecology, 42, 581–584, 1961. ———, “Energy ?ux in Ecosystems”, Ecosystem Structure and Function, Ed. J. Wiens, Oregon State University Press, Oregon, 69–90, 1972. Goodman, RM. et al., Gene Transfer in Crop Improvement. Science, 236, 48–54, 1987. Good, R., “A Theory of Plant Geography”, New Phytol., 30, 149–171, 1937. ———, The Geography of Flowering Plants (2nd edn), Longmans, Green and Company Inc., London, 1953. Gotas, H.B., Composting, Sanitary Disposal and Reclamation of Organic Wastes, World Health Organisation, Geneva, p. 205, 1956. Graff, O., “Investigations in Soil Zoology With Special Reference to the Terricole Oligochaeta”, Z P? aErnahr Dung., 61, 72–77, 1953. ———,Preliminary Experiments of Vermicomposting of Different Waste Materials Using Eudrilus Eugenie kinbeg Compiled by M. Appelhof–Proceedings of Workshop on the Role of Earthworms in the Stabilization of Organic Residues, Beech Leaf Press, Michigan, 179–191, 1981. Gregory, P.T. Feeding habits and diet overlap of three species of garter snakes (Thamnophis) or Vancouver Island. Canadian Journal of Zoology, 56: 1967–1974, 1978. Greigh-Smith, P., Quantitative Plant Ecology (2nd edn), Butterworth and Co. Publ., London, p. 256, 1964. Grierson, D, Plant Genetic Engineering, Plant Biotechnology, Vol. 1, Blackie, Glasgow, 1991. Grinnell, Joseph, “Field Tests of Theories Concerning Distributional Control”, Amer. Nat., 51, 115–128, 1917. Grinnell, J. Geography and Evolution, Ecology, 5, 225–229, 1924. Gross, A.O., “Cyclic Invasion of the Snowy Owl and the Migration of 1945–46”, AUK, 64,584–601, 1947.

538

Fundamentals of Ecology

Guderian, R. and M. Schoenbeck, “Recent Results for Recognition and Monitoring of Air Pollutants with the Aid of Plants”, Proceedings of the Second Int. Clean Air Cong., Academic Press, New York, 1971. Guerro, R.D., “The Culture and Use of Perionyx Excavatus as a Protein Source in Philippines”, Proceedings of the Darwin Centenary Symposium, Ed. J.E. Stachel, Grange-Over Sands, Cumbria, Great Britain, p. 22, 1981. Guild, WJMCL, “Earthworms and Soil Structure”, Soil Zoology, Ed. D.K.Mc. E. Kevan, Butterworth, London, 1955. Gupta, P.K. and D.K. Salunkhe, Modern Toxicology, Vol. I-III, Metropolitan Book Co. Pvt. Ltd., New Delhi, 1985. Gupta, R.K., “Grassland Productivity Under Moisture Stress in the Arid Zone of Rajasthan”, Proceedings of IBP Symposium and Synthesis Meeting on Tropical Grassland Biome, Banaras Hindu University, Varanasi, India, 1974. Gupta, R.K. and R.S. Ambasht, “Use and Management”, Grassland Ecosystems of the World, Ed. R.T. Coupland, Cambridge University Press, London, 14 1–246, 1979. Gupta, P.K. and D.K. Salunkhe, Modern Toxicology, Vol. I-III Metropolitan, New Delhi, 1985. Halberg, F.Z., Vitamin, Hormone and Fermantforschung, 10, 225–296, 1959. Hale, W.G., “Production and Energy Flow in Two Species of Onychurus”, Pedobiologia, 20, 274–287, 1980. Hamner, W.M., “Circadian Rhythms in Photoperiodism”, Science, 142, 1294–1295, 1963. Hammer, T. et al., Production of Transgenic Rabbits, Sheep and Pigs by Microinjection. Nature, 315, 680– 683, 1985. Hansen, R.P. and Z. Czochanska, “The Fatty acid Composition of the Lipids of Earthworms”, J. Sci. Fd. Agric., 26, 961–971, 1975. Hardison, RC, Comparative Genomics, Plos Biology, Vol. I, Issue 2, 156–160, 2003. Hartenstein, R., N.F. Edwards and D.L. Kaplan, “A Progress Report on the Potential Use of Earthworms in Sludge Management”, Proceedings of the 8th National Sludge Conference, Inst. Trans. Inc., Silver Spring, Maryland, 1979. Hatch, M.D. and C.R. Slack, “Photosynthesis by Sugarcane Leaves: A New Carboxylation Reaction and the Pathway of Sugar Formation”, Biochem. J., 101, p. 103, 1966. ———, “Photosynthetic CO2 Fixation Pathways”, Ann. Rev. Plant Physiol., 21, 1970. Hawkswoth, D.L., “Mapping studies”, Air Pollution and Lichens, Eds B.W. Ferry et al., 38–76, Oxford University Press, London, 1973. Heal, O.W. and S.F. Maclean, “Comparative productivity in ecosystems– secondary productivity R.H., Unifying concepts in Ecology”, Eds Van Dobben W.H. and Lowe-McCannel, The Hague, 89–108, 1975. Hellmers Henry, J.F. Bonner and J.M. Kelleher, “Soil fertility: A Watershed Management Problem in the San Gabriel Mountains of Southern California”, Soil Sci., 80, 180–197, 1955. Hemingsen, A.M., “Energy metabolism as related to body size and respiratory surfaces and its evolution”, Rep. Steno. Memo. Hosp. Nord., Insulin, 9, 1–110, 1960. Hennig, (Quoted in Trevor & Rowe, 2004), 1986. Hodgson, J Data Directed Drug Design. Biotechnology, 9: 19–21., 1991. Holland, H.D., The Chemistry of the Atmosphere and the Ocean, Wiley Interscience, New York, 1978. Holling, C.S., “Resilience and Stability of Ecological Systems”, Ann. Rev. Ecol. System, 5, 1–23, 1973.

Bibliography

539

Horn, H.S. The measurement of overlap in comparative ecological studies. American Naturalist, 100, 419– 424, 1966. Hota, AK. and M.C. Dash, “Effect of Food Level and Larval Density on Growth and Metamorphosis of Rana tigrina larvae”, Oikos, 37, 349–352, 1981. ———, “Evidence of Interspeci?c Predation Among Larval Anurans: Predation of Rana tigrina Larvae on Bufo Melanostictus Larvae”, Biol. Bull., 5, 64–65, 1983. ———, “Growth and Metamorphosis of Anuran Larvae: Effect of Diet and Temperature”, Alytes, 5, 165– 172, 1986. Hubby and Lewontin, (Quoted in Trevor & Rowe, 2004), 1966. Huber, B., “Der Ein?uss der Vegetation auf Die Schwankungen Des CO2-Gehaltes der Atmosphaxe”, Arch. Met. Wien, B4, p. 154, 1952. Hulbert, S.H. The measurment of niche overlap and relatives. Ecology, 59: 67–77, 1978. Hutchinson, G.E., The Ecological Theater and the Evolutionary Play, New Haven, CT, Yale University Press, USA, 1965. ———, A Treatise on Limnology, Vol. 1: Geography, Physics and Chemistry, John Wiley and Sons Inc., New York, p. 1015, 1957. ———, A Treatise on Limnology, Vol. II: Introduction to Lake Biology and the Limnoplanklon, John Wiley and Sons Inc., New York, p. 1115, 1967. ———, An Introduction to Population Ecology, New Haven, Yale University Press, USA. Hutchinson, K.J. and K.L. King, 1979, “Consumers”, in Grassland Ecosystems of the World: Analysis of Grasslands and Their Use, Ed. R.T. Coupland, Cambridge University Press, London, 259–265, 1967. Indira Gandhi Inst. of Development Research, New Delhi -Sustainable Wetlands. p. 24. IARC, IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Man, 23, Some Heavy Metals, Lyon, France, 1980. Ito, Y., Comparative Ecology (translated and Edited in English by Jiro Kikkawa), Cambridge University Press, Cambridge, p. 436, 1980. Indira Gandhi Open University, New Delhi, Publications on Science and Environment. Jacobson, J.S., L.H. Weinstein, D.C. MeCune and A.E. Hitchcock, “The Accumulation of Fluorides by Plants”, J. Air Pollut. Control Ass., 16, 412–417, 1966. Jam, S.K., “Botanical Regions, and Flora of India”, Everyman’s Science, XXIV(6), 213–223, 1990. Janzen, D.H. Coevolution of Mutualism Between Ants and Acacias in Central America. Evolution 20, 249– 75, 1966. Jayashree, B and S. Arunachalam; Mapping Fish Research in India. Current Science, 79(5): 6 13–620, 2000. Jeffers, John, Modelling, Chapman and Hall, London, p. 80, 1982. Jeffreys, A. J., V. Wilson and S.L. Thein. Indivisual specific Fingerprints of Human DNA. Nature, 316: 76–79, 1985. Jeffreys, A. J., J.F.Y. Brookfield, and R. Semenoff. Positive identification of an immigration test case using human DNA fingerprints. Nature, 317: 577–579, 1985. Jeffreys, A. J., and D.B. Morton. DNA fingerprints of cats and dogs. Animal Genetics, 18: 1–15, 1987. Jorgensen, S.E., Fundamentals of Ecological Modelling, Elsevier, Amsterdam, p. 389, 1986. Joshi, S.K. and N. Behera, “Qualitative Analysis of Vegetation From a Mixed Tropical Forest of Orissa, India”, Ind. Forester, 117(3), 200–206, 1990. Juday, C., “The Annual Energy Budget of an Inland Lake”, Ecology, 21, 438–450, 1940.

540

Fundamentals of Ecology

Julka, J.M., “Earthworm Resources of India”, Proc. of Nat. Sein. on Organic Waste Utilisation and Vermicomposting, Part B: Verms and Vermicomposting, Eds M.C. Dash, BK. Senapati, and P.C. Mishra, Sambalpur University India. Janzen .H. 1980. When is it Coevolution? Evolution 34, 611–12, 1986. Kale, R.D,, “Earthworm Feed for Poultry andAquaculture”, Organic Waste Utilisation and Vermicomposting, Eds M.C. Dash, B.K. Senapati and P.C. Mishra, Sambalpur University, India, 1986. Kale, Radha D, Earthworm-Cinderella of Organic Farming, Prism Books: Bangalore, pp 1-88, 1998. Kale, RD., K. Bano and R.V. Krishnamoorthy, “Potential of Perionyse exacavatus for Utilising Organic Wastes”, Pedobiologia, 23, 419–425, 1982. Kamboj, VP Traditional Medicine: An Opportunity for India, Presidential Address, The National Academy of Science, India, p. 15, 2005. Kar, G.K., P.C. Mishra, M.C. Dash and R.C. Das, “Pollution Studies in River Ib. III. Plankton Population and Primary Productivity”, Indian J. Environ. Health, 29(4), 322–329, 1987. Kar, R.N. and R.K. Das, “Incidence of Dominant Lethality and Micronuclei in Mice Treated with õazopam”, Nucleus, 22, 192–195, 1979. ———, “Effect of Long-term Diazopam Treatment on the Mitotic and Meiotic Chromosomes, Sperm Head Mophology and Sperm Count in Male Mice”, Perspectives in Cytology and Genetics, Eds G.K. Manna and U. Sinha, Hindasia Publications, New Delhi, 3, 469–474, 1981. ———, “Induction of Sperm Head Abnormalities in Mice by Three Tranquilizers”, Cytobios, 36, 45–51, 1983. ———, “Cytogenetic Effect of Chiorodiazepoxide on the Bone Marrow Cells of Swiss Mice In vivo”, Cytobios, 36, 73–82, 1983. ———, “Dominant Lethality and Spermatocytic Chromosome Aberrations in Mice Treated with Chloriazepoxide”, Caryologia, 40, 267–273, 1987. Kaul, V. and Y.K. Sarin, “Life-form Classification and the Biological Spectrum of the Flora of Bhaderwah”, Trop. Ecol., 17, 132–138, 1976. Kendeigh, S.C., “Tolerance of Cold and Bergmann’s Rule”, AUK, 86, 13–25, 1969. ———, Ecology with Special Reference to Animals and Man, Prentice Hall Inc., USA, 1974. Kenney, J.K. and E.S. Keeping Mathematics of Statistics. D. Van NO Strand Company, Inc. Toronto, 1954. Kershaw, K.A., Quantitative and Dynamic Plant Ecology, Edwards Arnold Publ. Ltd., London, p. 308, 1973. Khoshoo, T.N., “Environmental Priorities in India and Sustainable Development”, Indian Sci. Cong. Assoc. Presidential Address, p. 224, 1986. Khoshoo, T.N., Human Race at the Cross Roads, Current Science, 79(10): 1428–35, 200. King, A.R. and C. Ferris, Chloroplast DNA Phylogeography of Alnus glutinosa (L). Gaertn. Molecular Ecology, 7: 1151–1161, 1998. Kira, T. and T. Shidei, “Primary Production and Turnover of Organic Matter in Different Forest Ecosystems of the Western Paci?c”, Jap. J. Ecol., 17, 70–87, 1967. Kormondy, E. J., Concepts of Ecology (2nd edn, 3rd printing), Prentice-Hall of India Pvt. Ltd., New Delhi (1989, 3rd edn, 5th printing), 1978. Krishnamurthy, L., “Production, Dominance, Diversity and Stability in Some Semi-and Grazing Lands”, Intecol. Bull., 14–21, 1978. Kuenzler, E.J., “Phosphorus Budget of a Mussel Population”, Limnol. Oceangr., 6,400–415, 1961. Lack, D., The Natural Regulation of Animal Numbers, Clarendon Press, Oxford, 1–343, 1954. Lawry, O.H., O.H., N. J. Rose-brough, A.L. Farr and R.J. Randall. J. Biol. Chem. 193, 265–275, 1951.

Bibliography

541

Lawrence, G.H.M., Taxonomy of Vascular Plants, Macmillan, New York, 1954. Lee, KE, Earthworms: Their Ecology and Relationships with Soils and Land Use. Acad. Press, Australia., 1985. Lef Kovitch, L.P., “The Study of Population Growth in Organisms Grouped by Stages”, Biometrics, 21, 1–18, 1965. ———, “The Effects of Adult Emigration on Populations of Lasioderme serricorne (F.) (Coleoptera: Anobiidae)”, Oikos, 15, 200–210, 1966. ———, “A theoretical Evaluation of Population Growth After Removing Individuals from Some age Groups”, Bull. Ent. Res., 57, 437–455, 1967. Legendre, L. and P. Legendre. Numerical Ecology, Elsevier, New York, 1983. Legris, P. and V.M. Meher-Homji, “Phytogeographic Outlines of the Hill Ranges of Penninsular India”, Trop. Ecol., 18, 10–24., 1977. Leopold, Aldo, “Deer Irruptious”, Wisconsin cons. Bull., Aug. 1943, Reprinted in Wisconsin Cons. Deptt. Publ., 321, 3–11, 1943. Leslie, P.H., “On the Use of Matrices in Certain Population Mathematics”, Biometrika, 33, 183–212, 1945. Levins, R. The Strategy of Model building in Population Biology, American Scientist, 54: 421–431, 1966. Levins, R. Evolution in Changing Environment: Some Theoretical Explorations. Princeton Univ. Press, Princeton, 1968. Levitt, J., Responses of Plants to Environmental Stresses, Academic Press, New York, p. 607, 1980. Lewis, E.G., “On the Generation and Growth of a Population”, Sankhya, 6, 93–96, 1942. Lewis, P.R. and M.C. Lobban, “Human Circadian Rhythms”, Arctic J. Physiol., 133, 670–680, 1956. Liebig, Justus, Chemistry in its Application to Agriculture and Physiology, Taylor and Walton, London (4th edn, 1847), 1840. Lieth, H., “The Measurement of Calorific Values of Biological Material and Determination of Ecological Efficiency”, Copenhagen Symposium, UNESCO, 1968. ———, “Continuity and Discontinuity in Ecological Gradients and Plant Communities:, Bot. Rev., 3, 291– 302, 1968a. ———, “Uber Die Primarproduktion Der Pflanzendecke Der Erde”, Ztschft. f Angew. Bot., 46, 1–37, 1972a. ———, “The Net Primary Production of the Earth with Special Emphasis on the Land Areas”, Perspectives on Primaiy Productivity of the Earth, Ed. R.H. Whittaker, Symposium at the Amer. Institute of Biol. Sci., 2nd Natal. Cong., Miami, Florida, Oct. 1971, 1972b. ———, “Modelling the Primary Productivity of the World”, Trop. Ecol., 13(1), 125–130, 1972c. ———, “Modelling the Primary Productivity of the World”, Intecol Bull., 4, 11–20, 1974. ———, “The Gross Primary Productivity Pattern of the Land Vegetation: a First Attempt”, Trop. Ecol., 18(2), 109–115, 1977. Linderman, R.L., “The Trophic-dynamic Aspect of Ecology”, Trop. Ecol., 23, 399–418, 1942. Li, W.H. Molecular Evolution, Sinauer Associates, Inc., Publ., USA 1997. LI, You-Chun, Korol AB, Tzion Fahima, Beiles A and Nevo E, Microsatellites: Genomic Distribution, Putative Functions, and Mutational Mechanisms: A Review. Mol. Eco., 11, 2453–2465, 2002. Liz K et al, Epistasis for Three Grain Yield Components in Rice (Oryza sativa L. ), Genetics, 145, 453-456, 1997. Lotka, A.J., Elements of Physical Biology, Williams and Wilkins, Baltimore, p. 460. Reprinted by Dover Publ., New York, 1956, 1925.

542

Fundamentals of Ecology

Ludwig, John A. and J.F. Reynolds. Statistical Ecology: A Primer on Methods and Computing. John Wiley & Sons, Inc. New York, 1988. Luxton, M., “General Ecological In?uence of the Soil Fauna on Decomposition and Nutrient Circulation”, Oikos, 39, 355–388, 1982. Lynch, M., “Fitness and Optimal Bodysize in Zooplankton Population”, Ecology, 38, 763–774, 1977. Lydersen, E, et al. The Effects of Ionic Strength on the Toxicity of Aluminium of Atlantic Salmon (Salmo salar) Under Non-steady State Chemical Conditions, J. Limnol. 61, 69–76, 2002. MacArthur, R. Population Ecology of Some Warblers of Northeastern Coniferous Forests, Ecology, 39, 599– 619, 1958. MacArthur, R. and E.R. Pianka. On Optimal Use of a Patchy Environment, American Naturalist. 100, 603– 609, 1966. MacArthur, R. and Joseph, Connell, The Biology of Populations, John Wiley and Sons Inc., New York, p. 200, 1966. MacArthur, R. and E.O. Wilson, The Theory of Island Biogeography, Princeton University Press, Princeton, N.J., p. 203., 1967. MacArthur, R.H., “Patterns of Species Diversity”, Biol. Rev., 40, 510–533, 1965. Maccune, D.C. and Hitchcock, “Fluride in Forage–Factors Determining Its Accumulation from Atmosphere and Concentration in Plant”, Proceedings of the 2nd Int. Clean Air Congress, Academic Press, New York, 289–292, 1971. Macfadyen, A., “The Meaning of Productivity in Biological Systems”, J. Anim. Ecol., 17, 75–80, 1949. ———,Animal Ecology: Aims and Method (2nd edn.), Pitman, London, p. 344, 1963. ———, “Soil Metabolism in Relation to Ecosystem Energy Flow and to Primary and Secondary Production”, Method of Study in Soil Ecology, Ed. J. Phillipson, UNESCO, Paris, 167–172, 1970. Maclean, S.F. Jr., “The Detritus Based Trophic System”, An Arctic Ecosystem: the Coastal Tundra and Barrow, Alaska, Eds J. Brown et al., US-IBP Synthesis Series No. 12, pp. 411–457, Dowden, Hutchinson and Ross, Stroudsburg, Pennsylvania, 1980. Madge, D.S., “How Leaf Litter disappears”, New Scientist, 32, 113–115, 1966. Mahajan, C.L., “Zooplankton as Indicators for Assessment of Water Pollution”, Biological Indicators and Indices of Env. Pollution, Eds Zafar et at., Central Board for the Prevention and Control of Water Pollution, New Delhi, 135–148, 1982. Mani, M.S., Ecology and Biogeography of India, Dr. W. Junk Publishers, The Hague, p. 773, 1974. Mandal, D. and S.K. Ghosh, Precision Farming: The Emerging Concept of Agriculture for Today and Tomorrow Current Science 79(2): 1644–47, 2000. Mann, K.H., “The Pattern of Energy Flow in the Fish and Invertebrate Fauna of the River Thames”, Verh. Int. Ver. Limnol., 15, 485–495, 1964. ———, “Energy Transformations by a Population of Fish in the River Thames”, J. Anim. Ecol., 34, 253–275, 1965. ———, “The Dynamics of Aquatic Ecosystems”, Advances in Ecological Research, 6, ed. J.B. Cragg, Academic Press, New York, 1–81, 1969. Manahan, S.E. Environmental Chemistry, Willard Grant Press, Boston, USA, 1979. Margelef, R., “On Certain Unifying Principles in Ecology”, American Naturalist, 97, 357–374, 1963. ———,Perspectives in Ecological Theory, University of Chicago Press, Chicago, p. 112, 1968. ———, “Diversity, Stability and Maturity in Natural Ecosystems”, Unifying Concepts in Ecology, Eds W.H. Van Dobben and Lowe McConnel, pp 151–160, Dr. W. Junk B.V. Publishers, The Hague, 1975.

Bibliography

543

Marx, J L, Ed, A Revolution in Biotechnology, Cambridge Univ. Press, Cambridge., 1989. Mason, H.L., “The Principles of Geographic Distribution as Applied to Floral Analysis”, Madrono, 3, 188– 190 (cited by Lawrence, 1954), 1936. Mason, H.L. and J.H. Langenbein, “Language Analysis and the Concept of Environment”, Ecology, 38, 325–340, 1957. Mathur, C.M. and S.K. Verma, “Vegetation Types of Sirohi Forest Division”, Indian For., 90, 413–430, 1964. Matsumara, F. and K.C. Patil, “Adenosine Triphosphate Sensitivity to DDT in Synapses of Rat brain”, Science, 166, 121–122., 1969. May, R.M., Stability and Complexity in Model Ecosystems, Princeton Monographs in Population Biology, No. 6, Pricneton University, N.J., p. 235, 1973. McNaughton, S.J., “Relationships Among Functional Properties of California Grassland”, Nature, 216, 168– 169, 1967. ———, “Definition and Qantification in Ecology”, Nature, 219, 180. McNaughton, S.J. and L.L. Wolf, 1973, General Ecology, Holt, Rinehart and Winston, New York, 1968. Meadows, D.H., D.L. Meadows, J. Randers, and W.W. Behrens, The Limits of. Growth, Universe Books, New York, 1972. Meher-Homji, V.M., Vegetation Mapping in India, Perspectives in Ecology, Eds J.S. Singh and B. Gopal, 327–333, Jagmander Book Agency, New Delhi, 1989. Mehta, M.C. Human Rights and Environment, Yojana, Feb. 28–32, 1998. Mellanby, K., Pesticides and Pollution, Collins, London, p. 221, 1967. Menhinick, E.F. A comparison of some species—individuals diversity indices applied to samples of .eld insects. Ecology 45: 859–861, 1964. Menn, J.J., “Comparative Aspects of Pesticide Metabolism In Plants and Animals”, Environ. Health. Persp., 27, 113–124, 1978. Melkania, N.P. and J.S. Singh, “Ecology of Indian grasslands”, Perspectives in Ecology, eds J.S. Singh and B. Gopal, Jagmander Book Agency, New Delhi, 67–103, 1989. Milligan, (Quoted in Trevor and Rowe, 2004), 199. Misra, K.C., Manual of Plant Ecology, Oxford and IBH Publishing Co., New Delhi, p. 376, 1974. Mishra, A.B. and M.C. Dash, “Studies on the Light Trap Catches of the Rice Borer, Scirpophaga incertulas WIk. in Irrigated Tracts of Sambalpur, India”, Oryza, 17, 248–250, 1980. ———, “Population Dynamics of Nala Lividepes (Labiduridae)”, Orien. Insect., 14, 63–71, 1980. ———, “Desertification Around Hirakud Reservoir”, The Environmentalist, 4,51–58, 1984. Mishra, C.C. and M.C. Dash, “Distribution and Population Dynamics of Nematodes in A Rice Field and Pasture in India”, J. Nemat., 13, 538–543, 1981. Mishra, C.S.K., J.W. Kim, and A. Saxena. Environmental Issues and Options, Daya Publishing, Delhi, 2006. Mishra, P.C., R.K. Mohanty, and M.C. Dash, “Enzyme Activity in Subtropical Surface Soils Under Pasture”, Ind. J. Agril. Chem., 12, 19–24, 1977. Mishra, P.C. and M.C. Dash, “Evidence of Interspecific Interaction in the Respiration of Earthworms”, Trop. Ecol., 20, 13–20, 1979. ———, Digestive Enzymes of Some Earthworms”, Experientia, 36, 1156–1157, 1980. ———, “Diurnal Variation in the Soil Respiration in Pasture and Forest Sites at Sambalpur India”, CPE, 7, 137–140, 1982.

544

Fundamentals of Ecology

———, “Population Dynamics and Respiratory Metabolism of Earthworm Population in Subtropical Woodland of Western Orissa, India”, Trop. Ecol., 25, 103–116, 1984. Mishra, P.C., M.C. Dash, K. Choudhury and R.C. Das, “Pollution Studies in River Ib: Microbial Analysis of Water and Sediments”, Ecology and Pollution of Indian Rivers, ed, R.K. Trivedy, Ashish Publ. House, New Delhi, 293–302, 1988. Mishra, P.C. and A. Naik. Environmental Management in Coal Mining and Thermal Power Plants Techno Science Publ. Jaipur, India, p. 217., 1999. Mishra PC, Sambalpur University, Personal Communication., 2006. Mishra, P.K. and M.C. Dash, “Larval Growth and Development of a tree Frog, Rhacophorus Maculatus (Gray)”, Trop. Ecol., 25, 203–207, 1984. ———, “Metamorphosis of Polypedates Maculatus (Gray): An Analysis of Crowding Effect”, Alytes, 3, 163–171, 1984. ———, “Oxygen Uptake by Polypedates Maculatus (Gray): Larvae During Developmental Stages”, Alytes, 4, 79–84, 1985. Misra, R., “Energy Transfer Along Terrestrial Food Chains”, Trop. Ecol., 9, 105–118, 1968. ———, The Ecology work Book, Oxford and IBH Publ. Co., Calcutta, p. 244, 1968. ———, “A Comparative Study of Net Primary Production of Deciduous Forest and Grasslands of Varanasi, India”, P.M. Golley and F.B. Golley (Compilers), Tropical Ecology with an Emphasis on Organic Production, University of Georgia, Athens, USA, 279–293, 1972. Misra, S. Orchids of Similipal. In Similipal: A Natural Habitat of Unique Biodiversity (P.C. Tripathy S.N. Patro, ed), O.E.S., Bhubaneswar, 1997. Mishra, R., J.S. Singh and K.P. Singh, A New Hypothesis to Account for the Opposite Trophic Biomass Structure on Land and in Water, in Curr. Sci., 37, 382–383, 1968. Mishra, R.R. and R.P. Tiwari, Impact of Air Fungal Population on the Microbiology of Leaf Surface Environment, in Trop. Ecol., 16, 49–54, 1975. Mishra, S.K., Population Biology of Dicogaster Bolaui in Agroecosystem, in M. Phil. Thesis, Sambalpur University, p. 88, 1986. Mitchell, M.J., “Role of Invertebrates and Microorganisms in Sludge Decomposition”, Conference Proceedings in Sludge Decomposition, ed. R. Hartenstein, SUNY CESE, New York, 1978. Mohanta, J.K., S.K. Swain and M.C. Dash, “Morphometric Relationships in Nine Species of Tropical Anurans and their Signi?cance to Some Life History Parameters”, BNHS, 94: 276–282, 1997. Mohanty, S.N. and M.C. Dash, “Effects of Diet and Aeration on the Growth and Metamorphosis of Rana tigrina Tadpoles”, Aquacullure, 51, 89–96, 1986. ———, “Larval Energetics of Rana Tigrina (Daud)”, Ind. Jr. Expt. Biol., 26, 88–91, 1988. Mahapatro, B.K. and M.C. Dash, “Density Effect on Growth and Metamorphosis of Bufo Stomaticus Larvae”, Alytes, 6, 88–98, 1987. ———, “Larval Energetics of Bufo Stomaticus Lutken”, 1990. Moore, J.W., The Changing Environment, Springer-Verlag, New York, p. 23, 1986. Morrison, D.F., Multivariate Statistical Methods, 2nd ed., McGraw-Hill, New York, 1976. Mueller-Dombois, D. and H. Ellenberg, Aims and Methods of Vegetation Ecology, Wiley, New York, 1974. Murphy, P.W. ed. Progress in Soil Zoology, Butterworths, London, 1982. Murthy, M.S. and S.J. Pathak, “Dominance, Diversity and Net Production in the Grasslands at Rajkot, India”, Japanese Journal of Ecology, 221, 47–49, 1972.

Bibliography

545

Murukesapillai, K. Science, Technology and Society–A Broad Perspective. Current Science, 79(9): 1141., 2000. Myers N. The Environmentalist, 10: 273–295, 1990. Musgrave, R.B. and D.N. Moss, “Photosynthesis Under Field Conditions, I. A Portable Closed System for Determining Net Assimilation and Respiration of Corn”, Crop. Sci., 1, 37–41, 1961. National Inst. of Ecology, New Delhi Publ. Understanding Wetlands. Nace, G.W. and C.M. Richards, “Living Frogs, and Tadpoles”, Carolina Tips, XXXV(1), Burlington, North Carolina, 45–46, 1972. Nakane, K., “Carbon Cycling in Forest Ecosystem”, Jap. J. Ecol., 36, 29–39, 1986. Nakatsugawa, T. and P.A. Nelson. In: Env. Tox. Pesticides. Acad. Press, New York, 501–524, 1972. Narahashi, T. and T. Yamasaki, “Mechanism of Increase in Negative After Potential by Dicophanum (DDT) in the Giant Axon of the Cockroach”, J. Physiol., 152, 122–140, 1960. Narayan, L.R.A. Remote Sensing and its Applications. Universities Press, India Ltd. Hyderabad. p. 215, 1999. Naskar, Ranu and Mandira Mukhopadhyay, SEM Study of Erythrocyte Alterations in Clarias Batrachus (Linn), Exposed to Sublethal Concentrations of Aluminium in Low pH., Ranchi University Journal of Sci. & Technology, 1, 9–11, 2004. Naskar, Ranu, Sen NS, and Firoz Ahmad, Aluminium Toxicity Induced Poikilocytosis in Air-Breathing Teleost, Clarias Batrachus (Linn). Ind. J. Expt. Biol. 44, 83–85, 2006. Natusch, D.F.S. and P.K. Hopke, Analytical Aspects of Environmental Chemistry, John Wiley and Sons, New York, 1983. Nayak, B.K. and M.C. Dash, “Environmental Regulation of Voltinism in Anthraea mylitta Drury, the Indian Tasar Silk Insect”, Sericologia (in press), 1990. Nayak, B.K. and M.C. Dash “Seasonal Life Table of the Indian Wild Tasar Silk Moth”, Antheraea Paphia Linn. (Lepidoptera: SaSaturmidal) Sericologia, 39, 97, 119, 1999. Nicolson, A.J., “The Balance of Animal Populations”, J. Anim. Ecol, 2, 132–178, 1933. Naveh, Z. Culture and Landscape Conservation: A Landscape-Ecological Perspective. pp., 19-48, In: Ecology Today, ISP, New Delhi, 1998. Naveh, Z. Interactions of Landscapes and Cultures., Landscape and Urban Planning, 32: 43–54, 1995. Naveh, Z and A.S. Lieberman. Landscape Ecology Theory and Applications. 2nd edition, Springer-Verlag, N.Y, 1994. Nicholson, A.J. “An Outline of the Dynamics of Animal Population”, Australian J. Zool., 2, 9–65, 1954. Nicholson, A.J. “The Self-adjustment of Populations to Change”, Cold Spring Harbor Symp. Quant. Biol., 22, 153–173, 1957. ———, “Dynamics of Insect Populations”, Ann. Rev. Entomol., 3, 107–13, 1958. Nijahwan, S.D. and J.S. Kanwar, “Physicochemical Properties of Earthworm Castings and their Effect on the Productivity of Soil”, Ind. J. Agric. Sci., 22, 357–373, 1952. O’Brien, R.D. In: Insecticides Action and Metabolism, Acad. Press, New York, 1967. Ochman, H. and N. Moran, Genes Lost and Genes Found: Evolution of Bacterial Pathogenesis and Symbiosis. Science, 292: 1096–1099. Odum, E.P., Regenerative systems: Discussion in Human Ecology in Space Flight, Ed. D.H. Calloway, The N.Y. Acad. Sci. Interdisciplinary Communications Program, New York, 82–119, 1966. ———, “The Strategy of Ecosystem Development”, Science, 164, 262–270, 1969. ———,Fundamentals of Ecology (3rd edn), Saunders, Philadelphia., 1971.

546

Fundamentals of Ecology

———, “Ecosystem Theory in Relation to man”, Ecosystems–Structure and Function, 31st Biol. Coil., Oregon State University Press, Carvailis, Ore, 1971. ———, “Diversity as a Function of Energy Flow” in Unifying Concepts in Ecology, eds W.H. Van Dobben and Lowe-McConnel, pp. 11–14, Dr. W. Junk B.V. Pubishers, The Hague, 1975. ———, Ecology (2nd edn), Oxford and IBH Publ. Co., New Delhi, p. 244, 1975. Odum, E.P., C.E. Connell and L.B. Davenport, “Population Energy Flow of Three Primary Consumer Components of Old Field Ecosystems”, Ecology, 43, 88–96, 1962. Odum, H.T., “Primary Production in Flowing Water”, Limnol. Oceanogr., 10, 102–117, 1956. ———, “Efficiencies, Size of Organisms and Community Structure”, Ecology, 37, 592–597, 1956. ———,Environment, Power and Society, Wiley Interscience, New York, 1971. ———, “An Energy Circuit Language for Ecological and Social Systems: Its Physical Basis”, Systems Analysis and Simulations in Ecology, Vol. II, Ed. B.C. Patten, Academic Press, New York, 1972. ———, “Energy Quality and Carrying Capacity of Earth”, Trop. Ecol., 16, 1–8, 1975. Odum, H.T. and E.P. Odum, Energy Basis of Man and Nature, McGraw-Hill, New York, p. 297, 1976. Odum, H.T., Charles M. Hoskin,. “Metabolism of a Laboratory Stream Microcosm”, Publ. Inst. Mar. Sci., Univ. Texas, 4, 115–133, 1957. Old, RW and Primrose SB, Principles of Gene Manipulation: An Introduction to Genetic Engineering, Blackwell Scienti?c Publ., London., 1989. Omkar, Concepts of Toxicology, S.L.N. Chand & Co. Jalandhar, India 228 p, 1994. O’Neill, R.V., “Niche Segregation in Seven Species of Diplopods”, Ecol., 48, 983, 1967. Orians, G.H., “Diversity, Stability and Maturity in Natural Ecosystems”, Unifying Concepts in Ecology, eds W.H. Van Dobben and Lowe-McConnel, pp. 134–150, Dr. W. Junk B.V. Publishers, The Hague, 1975. Orloci, L. and N.C. Kenkel. Introduction to Data Analysis with Examples from Population and Community Ecology. Statistical Ecology Monographs, Vol. I, International Cooperative Publishing House, Fairland, MD, USA. 1985. Osborn, F., Our Plundered Plant, Pyramid, New York, 1968. Ovington, J.D., “Quantitative Ecology and the Woodland Ecosystem Concept”, Advances in Ecological Research ed. Cragg, J.B., Academic Press, New York, 1, 103–192, 1962. ———, “Organic Production, Turnover and Mineral Cycling in Woodlands”, Biol. Rev., Cambridge Phil. Soc., 40, 295–336, 1965. Ovington, J.D. and D. Heitkamp, “The Accumulation of Energy in Forest Plantations in Britain”, J. Ecol., 48, 639–646, 1960. Ozoe, Y, K. Mochida and M. Eto. Agric. Biol. Chem. 1982, 46, 2527–2531, 1982. Palharya, J.P. and S. Malviya, “Pollution of the Narmada River at Hoshangabad in Madhya Pradesh and Sugested Measures for Control”, Ecology and Pollution of Indian Rivers, ed. R.K. Trivedy, Ashish Publ. House, New Delhi, 55–85, 1988. Palmer, (Quoted in Trevor & Rowe, 2004)., 1985. Palmgren, P., “Some Remarks on the Short Term Fluctuations in the Numbers of Northern Birds and Mammals”, Oikos, 1, 114–121, 1949. Panda, R., S. Pati, and S.K. Sahu, Accumulation of Zinc and Its Effects on the Growth Reproduction and Lifecycle of Drawida Willsi (Oligochaeta), A Dominant Earthworm in Indian Crop Fields. Biol. Ferti. Soils, 29, 419–423., 1999.

Bibliography

547

Pandian, T.J. and F. John Vernberg, eds Animal Energetics, Vols. 1 and 2, Academic Press, Inc., San Diego, 1987. Pandeya, S.C., “Ecology as an Aid to Floristics, II. Autecology”, Bull. Bot. Surv., India, 4, 147–153, 1962. Park, Thomas, “Experimental Studies of Interspeci?c Competition, I. Competition between Populations of Flour Beetles, Tribolium Confusum Duval and T. Castaneum Herbst; Physiol. Zool., 18, 265–308, 1948. ———, “Experimental Studies of Interspeci?c Competition, II. Temperature, Humidity and Competition in Two Species of Tribolium”, Physiol. Zool., 27, 177–238, 1954. ———, “Experimental Studies of Interspeci?c Competition, III. Relation of Initial Species Proportion of Competitive Outcome in Populations of Tribolium”, Physiol. Zool., 30, 22–40, 1957. ———, “Beetles, Competition and Populations”, Science, 138, 1369–1375, 1962. Pathak, H. Emissions of Nitrous Oxide from Soil. Current Science. 77(3), 359–369, 1999. Pati, D.P., N. Behera, and M.C. Dash, “Microbial and Root Contribution to Total Soil Respiration in a Tropical Grassland from Orissa, India”, Rev. Ecol. Biol. Sol., 20, 183–193, 1983. Patnaik, N., “Features of Ecology Modelling”, Proc. Short Term Institute on Environmental Science and Engineering, University College of Engg., Sambalpur University, India, 177–185, 1983. Patnaik, H.K. and M.C. Dash, Effect of Fenitrothion on Gut Enzyme Activity of Tropical Earthworms, F.E. Bull. 2, 540–546, 1993. Patnaik, H.K. and M.C. Dash, Toxicity of Monocrotophos and Fenitrothion to Four Common Indian grassland Earthworm species, Poll. Res. 9, 95–99, 1990. ———,Monocrotophos Toxicity and its Effect on Ammonia and Urea Excretion of Some Subtropical Grassland Earthworm Species Proc. Nat. Acad: Sci. India 61, 275–282, 1991. Patnaik, H.K. and MC. Dash Brain and Muscle Cholinesterase Response in The Earthworms Exposed to Sublethal Concentration of Organophosphorus Insecticide, Ecotoxicol and Env. Monit, 2, 279–282, 1992. Patnaik, H.K. and M.C. Dash, Recovery Potentiality of Nerve and Muscle ChE Activity in Fenitrothion Exposed Drawida Calebi and Lampito Mauritii, FE. Bull. 1, Sl10–115, 1992. Patten, B.C., “Plankton: Optimum Diversity Structure of a Summer Community”, Science, 140, 894–898, 1963. ———, “A Primer for Ecological Modelling and Simulation with Analog and Digital Computers”, Systems Analysis and Simulation in Ecology, ed. B.C. Patten, 1, 1–122, 1971. ———, “The Zero State and Ecosystem Stability”, Proc. 1st Int. Cong. Ecol., The Hague, Suppl, 1974. Patro, S.N. and G.K. Panda. (ed) Eastern Ghats in Orissa, Environment, Resources and Development, OES, Bhubaneswar, 1994. Pearce, S.C., “Multivariate Techniques of Use in Biological Research, Expt. Agric., 5, 67–77., 1969. Pearl, Raymond and S.L. Parker, “Experimental Studies on the Duration of Life: Introductory Discussion of the Duration of Life” Am. Nat., 55, 481–509, 1921. Perel, T.S., “Life Forms of Lumbricidae”, Zh. Obshch. Biol. Moscou., 36, 189–202, 1975. Petit, J Remy, Duminil J, Finoschi S, Hampe A, Salvini D, and Giovanni G. Vendramin, Comparative Organisation of Chloroplast, Mitochondrial and Nuclear Diversity in Plant populations, Molecular Ecology, 14, 689–701, 2005. Petit Remy J., et al., Comparative Organization of Chloroplast, Mitochondrial and Nuclear Diversity in Plant Populations. Molecular Ecology, 14, 689–701, 2005. Petrusewicz, K., ed., “Secondary Productivity of Terrestrial Ecosystems”, Inst. Ecol. Polish Acad. Sci. Int. Biol. Program (Warsaw), I. p. 367, II. p. 879, 1967.

548

Fundamentals of Ecology

Petrusewicz, K. and A. Macfadyen, Productivity of Terrestrial Animals, Blackwell, Oxford, 1970. Phillipson, J., Ecological Energetics, Edward Arnold, London, p. 57, 1966. Phillipson, J. (ed.) Methods of Study in Soil Ecology, UNESCO, Paris, p. 303, 1970. Phillipson, J., R. Abel, J. Steel and S.R.J. Woodell, “Enchytraeid Numbers, Biomass and Respiratory Metabolism in a Beech Wood and–Wytham Woods, Oxford”, Oecologia, 43, 173–193, 1979. Pianka, E.R., Evolutionary Ecology, (4th edn). Harper and Row Publ., USA, 1988. Pianka E.R. Competition and Niche Theory, In May, R.E. (ed.). Theoretical Ecology-Principles and Applications. Blackwell Sci. Publ. Oxford, 1976. Pianka E.R. The Structure of Lizard Communities, Annual Review of Ecology and Systematics, 4: 53–74, 1973. Pielou, E.C., An Introduction to Mathematical Ecology, Wiley Interscience, New York, p. 256, 1969. ———, Ecological Diversity, John Wiley and Sons, New York, 1975. ———, Biogeography, John Wiley and Sons, New York, 1979. ———, The interpretation of Ecological Data, Wiley, New York. 1984. Pigliucci, (Quoted in Trevor & Rowe, 2004), 1996. Pimental, David, “Animal Population Regulation by the Genetic Feedback Mechanism”, Amer. Nat., 95, 65–79, 1961. Pimental, David and F.A. Stone, “Evolution and Population Ecology of Parasite-Host Systems”, Canad. Entomol., 100, 655–662, 1968. Pincince, A.B., J.F. Donovan and J.E. Bates, “Vermicomposting of Municipal Solid Wastes and Municipal Waste Water Sludges,” M. Appelhof (compiled), Proc. Workshop on the Role of Earthworms in the Stabilization of Organic Residues, Beech Leaf Press, Michigan, 122–130, 1981. Playle, RC, Goss GG and Wood CM, Physiological Disturbances In Rainbow Trout (Salmo gairdneri) During Acid and Aluminium Exposures in Soft Water of Two Calcium Concentrations., 1989. Pollack, Henry N., S. Huang, P-Y Shen Climate Change Record in Subsurface Temperatures: A Global Perspective, Science. 282, 279–28 1, 1998. Pollution Control Acts, Rules and Noti?cations Issues There under. CPCB, New Delhi, 1996. Pradhan, G.B. and MC. Dash, “Seasonal Variation in Plant Biomass and Net Primary Productivity of a Savanna Type Hill Ecosystem of Sambalpur, India”, Trop. Ecol., 25, 172–178, 1984. ———, “Rhizosphere Effect of Andropogoss Pumilus Roxb. on soil Nematodes, Soil Organic Matter and Nitrogen”, Proc. Ind. Acad. Sci., 93, 77–82, 1984. ———, “Distribution and Population Dynamics of Soil Nematodes of Tropical Forest Ecosystem of Sambalpur, India”, Proc. Ind. Acad. Sci., 96, 395–402, 1988. Pradhan, G.B., BK. Senapati and MC. Dash, “Relationship of Soil Nematodes Populations to Carbon: Nitrogen in Tropical Habitats and Their Role in the Laboratory Decomposition of Litter Amendments”, Rev. Ecol. Biol. Sol., 25, 59–76, 1988. Prakash, I. Foods of Indian Desert Mammals. J. Biol. Sci. 21, 100–109, 1959. Prakash, I. Food of the Indian Ealsevampire, Jr. Mammalogy, 40, 545–547, 1959. Pramod, P., N.V. Joshi, U. Ghate., and M. Gadgil. Curr. Sci. 73, 122–127., 1997. Pramod, P. R. Daniels, N.y. Joshi and M. Gadgil Curr. Sci. 73, 156–162, 1997. Prasad, N.S., L. Vijayan, S. Balachandran, V.S. Ramachandran and CPA. Verghese Curr. Sci. 75(3), 211–219, 1998. Precht, H., J. Christophersen, and H. Hensel, Temperature and Leben, Springer, Heidelberg, 1955.

Bibliography

549

Precht, H., “Concepts of the Adaptation of Unchanging Reaction Systems of Coldblooded Animals”, Physiological Adaptation, ed. C.L. Prosser, pp. 50–77, Am. Physiol. Soc. Washington, D.C, 1958. Promega – Protocol & Application Guide, 3rd Ed. Promega Corp., USA, 1996. Prosser, C.L., “Perspectives of Adaptation: Theoretical Aspects”, Handbook of Physiology, Section 4: Adaptation to the Environment, ed. D.B. Dill, pp. 11–25, Am. Physiol. Soc., Washington, D.C., 1964. ———, ed, “Molecular Mechanisms of Temperature Adaptation”, Amer. Assoc. Adv. Sci., Washington, D.C, 1967. ———, ed, Comparative Animal Physiology, W.B. Saunders Co., Philadelphia, p. 966, 1973. Prosser, C.L. and F.A. Brown, Jr., Comparative Animal Physiology, W.B. Saunders Co., Philadelphia, 1961. Puri, G.S., Indian Forest Ecology, Vols. 1 and 2, Oxford Book Company, New Delhi and Calcutta, p. 710, 1960. Pursel, VG et al., Genetic Engineering of Livestock. Science. 244: 1282–1287. Rigby, P.W.J. Ed. Genetic Engineering-6, Academic Press, London, 1989, 1987. Rabe, F., Uber Die Austrocknungsfahigkeit Gekeimter Samen and Sporen, Flora (Jena), 95, 253–324, 1905. Rajvanshi, R. and S.R. Gupta, “Decomposition of Litter in A Tropical and Deciduous Forest”, Intern. J. Ecol. Env. Sd., 6, 37–49, 1980. ———, “Mineral Cycling in a Tropical Deciduous Dalbergia sissoo Roxb. Forest”, Act. Oecologia Oecol. Plant., 6, n–3, 247–262, 1985. Ramakrishnan, P.S., “Ecotypic Differentiation in Some Plants of Varanasi”, Proc. Nat. Acad. Sci. India, 28(B), 68–76, 1958. Ramakrishnan, P.S. and U. Gupta, “Nitrogen, Potassium and Phosphorus Nutrition of the Adaphic Ecotypes in Cynodon Dactylon (L.)”, Pers. Ann. Bot. (NS), 37, 885–894, 1973. Ramalingaswami et. al., Urban air Pollution; Current Science, 77(3): 334–336, 1999. Rambler, M.B., L. Margulis, R. Fester, ed., Global Ecology Towards a Science of the Biosphere, Academic Press, 1989. Rao, D.N., “Plant Leaf as a Pollution Monitoring Device”, Fertilizer News, May, 25–28, 1979. Rao, K.P., “Some Biochemical Mechanisms of Low Temperature Acclimation in Tropical poikilotherms”, The Cell and Environmental Temperature, ed. A.S. Troshin, Proc. of Intern. Symp. Cytoecology, Leningrad, Intern. Series Monographs in Pure and Applied Science, XXXIV, pp. 98–112, Pergamon, New York, 1967. Rao, D.P. Remote Sensing for Earth Resources. Assoc. of Exploration Geophysicists, Osmania Univ., Hyderabad, 201 p, 1995. Rao, T.V., Diapause Induced Physiological and Biochemical Changes in Octochaetona Surensis: A Tropical Earthworm, Ph.D. Thesis, Sambalpur University, p. 127., 1984. Raunkiaer, C., The Life forms of Plants and Statistical Plant Geography, Clarendon Press, Oxford, p. 639, 1934. Reichle, D.E., and D.A. Crossley, Jr., “Investigation on Heterotrophic Productivity in Forest Insect Communities”, Secondary productivity of Terrestrial Ecosystems, ed. K. Petrusewicz, Polish Acad. Sci. Warsaw, 563–587, 1967. Reichle, D.E., “Energy and Nutrient Metabolism of Soil and Litter Invertebrates”, Productivity of Forest Ecosystems. Proc. Brussels Symp., ed. P. Duvingneud, 1969, UNESCO, 465-477, 1971. Ricklefs, R.E., Ecology (3rd edn), W.H. Freeman and Co., USA, p. 896, 1990.

550

Fundamentals of Ecology

Rodin, L.E. and N.I. Bazilevich, Production and Mineral Cycling in Terrestrial Vegetation, Oliver and Boyd, London, p. 288, 1965. Ryan, J.K., Synthesis of Energy Flows and Population Dynamics of Truelove Low Land Invertebrates”, Truelove Low Land, Devon Island, Canada: A High Arctic Ecosystem, ed. L.C. Bliss, University of Alberta Press, 325–346, 1977. Ryszkowski, L., “Energy and Matter Economy of Ecosystems”, Unifying Concepts in Ecology, eds W.H. Van Dobben and R.H. Lowe-McConnel, Junk, The Hague, 109–126, 1975. Roy, N.U. and J. Pringle. ISO 14001: Implications for Pollution Prevention. Jour. Ensearch, (Quoted in ICCEMC. N-letter, 7–12), 1999. Sabine, J.R., “The Nutritive Value of Earthworm Meal”, Utilisation of Soil Organisms in Sludge Management, Ed. R. Hartenstein National Tech. Int. Services, Spring?eld, USA, 122–130, 1978. Sahu, S.K., Interspeci?c Variations with Regard to Ecological Functions of Three Species of Tropical Pasture Earthworms, M.Phil. Thesis, Sambalpur University, 1985. Sahu, S.K. and B.K. Senapati, “Secondary Production and Energy Utilisation Strategy of r and k Selected Earthworms from Tropical Pastures of Orissa”, Proc. 3rd Int. Rangeland Congress, II, eds Panjab Singh, Vinod Shankar and A.K. Srivastava, Rasna Printers, New Delhi, India, 476–479, 1988. Sahu, S.K., The ecological Implications of Interspeci?c Variations in Some Tropical Earthworms from Pasture Ecosystems of Orissa, India, Ph.D. Thesis Submitted to Sambalpur University, Orissa, India, p.279, 1989. Saito, S., Structure and Energetics of the Population of Ligidium Japonicum in a Warm temperate forest ecosystem”, Jap. J. Ecol., 15, 47–55, 1965. ———, “Energetics of Isopod Populations in a Forest of Central Japan”, Res. Popul. Ecol., 11, 229–258, 1969. Sajise, P.E., N.M. Orlido, J.S. Lales, L.S. Castillo and R. Atabay, “The Ecology of Philippine grasslands, 1. Floristic composition and community dynamics”, The Philippine Agriculturist, 59, 317–334, 1976. Satpathy, B., N. Behera and M.C. Dash, “Microbial Population Biomass and Activity in Some Tropical Soils of Orissa, India”, Biol. Bull. India, 4, 150–157, 1982. Satchell, J.E., “Lumbricidae”, Soil Biology, eds A. Burges and F. Raw, Academic Press, New York, 259–322, 1967. Saunders, P.T. and M.J. Bazin, “Stability of Complex Ecosystems”, Nature, 256, p.120., 1975. Schier Water et al. 1994. Molecular Ecology & Evolution, (Quoted in Trevor and Rowe, 2004). Schlegel, M., Molecular Phylogeny of Eukaryotes, Trends in Ecology and Evolution, 9(9): 331, 1994. Schultz, E. and O. Graff, Zur Bewenhing Un Regen Warmmeh: ause Eisenia foetida (Savingny, 1826) abs. Eiweissfultt ermitted Landbauforschung Volkenrode, 27, 216–218, 1977. Schultz, A.M., “The Nutrient Recovery Hypothesis for Arctic Microtine Cycles, II. Ecosystem Variables in Relation to Arctic Microtine Cycles”, Grazing in Terrestrial and Marine Environments, ed. D.J. Crisp., Blackwell, Oxford, 57–58, 1964. ———, “A Study of An Ecosystem: The Arctic Tundra”, The Ecosystem Concept in Natural Resource Management, ed. G. Van Dyne, Academic Press, New York, 77–93, 1969. Sears, P.B., “Ecology–A subversive science”, Bioscience, 14, 11, 1964. Sen, N, and Firoz Ahmad, Ranchi University, India. Personal Communication., 2007. Senapati, B.K., Personal Communication, 1990. Senapati, B.K., P. Larelle, S. Giri, B. Pashanasi, et al. Soil Earthworm Technologies for Tropical Agroecosystems. In: Larelle, P. et al. (Eds), Earthworm Management in Tropical Agro-ecosystems, CAB International, Wallingford, 199–237, 1999.

Bibliography

551

Senapati, B.K. and M.C. Dash, “Seasonal Dynamics and Emergence Pattern of a Tropical Earthworm Drawida calebi (Oligochaeta)”, Intern. J. mv. Reprod., 1, 271–277, 1979. ———, “Laboratory Observation on the Rate of Cocoon Production of Drawida willsi (Oligochaeta)”, Comp. Physiol. Ecol. 4, 110–112, 1979. Senapati, B.K., M.C. Dash, A.K. Panda, and B.K. Panda, “Observation on the Effect of Earthworm in the Decomposition Process of Soil Under Laboratory Condition”, Comp. Physiol. Ecol., 5, 140–142, 1980. Senapati, B.K. and M.C. Dash, “Effect of Grazing on the Elements of Production in Vegetation and Oligochaetes of a Tropical Pasture”, Rev. Ecol. Biol. Sol., 18, 487–505, 1981. Senapati, B.K. and M.C. Dash, “Earthworm as Waste Conditioner”, Indian Eng. Jour., X(2), 53–57, 1982. ———, “Environmental Regulation of Oligochaete Reproduction in Tropical Pastures”, Pedobiologia, 23, 270–271, 1982. ———, “Energetics of Earthworm Populations in Tropical Pastures from India”, Proc. Ind. Acad. Sci., 9, 315–321, 1983. ———, “Functional Role of Earthworm in the Decomposer Subsystem”, Trop. Ecol., 25, 52–72, 1984. ———, “Influence of Soil Temperature and Moisture on the Reporductive Activity of Tropical Pasture Earthworms of Orissa, India”, J. Soil. Biol. Ecol., 4, 13–21, 1985. Shannan, C.E. and W. Weaver, The Mathematical Theory of Communication, University of Illinois Press, Urbana, p. 117, 1963. Sharma, Archana, “Resources and Human Well-being: Inputs from Science and Technology”, Presidential Address, Indian Science Congress (74th Session, Bangalore), Indian Science Congress Association, Calcutta, 1987. Sharma, P.D. and R.S. Dwivedi, “Succession of Microfungi on Decaying Setaria Glauca Beauv.”, Trop. Ecol., 13, 183–201, 1972. ———, “Mycoflora Colonizing on Down Shoots of Setaria Glauca Beauv.”, Trop. Ecol., 16, 96–103, 1975. Shelford, V.E., Animal Communities in Temperate America, University of Chicago Press, Chicago., 1913. ———, Laboratory and Field Ecology, Williams and Wilkins Co., Baltimore, 1929. ———, “The Abundance of Collared Lemming in the Churchill Area, 1929– 1940”, Ecology, 24, 472–484, 1943. ———,Paired Factors and Master Factors in Environmental Relations, Illinois Acad. Sci. Trans., 45, 155– 160, 1952. Short, (Quoted in Trevor & Rowe, 2004), 1976. Shukla, G.S. and V.B. Upadhyay, Economic Zoology, Rastogi Publication, Meerut, India, p. 272, 1985. Simpson, E.H., “Measurement of Diversity”, Nature, 163, p. 688, 1949. Simpson, G.G., Anne Roe, R.C. Lewontin, Quantitative Zoology, Harcourt, Brace and World Inc., New York, 1960. Sing, JS (Ed) “Restoration of Degraded Land: Concepts and Stretegies, Rastogi Publ., Meerut, India, 1992. Singh, J.S. and M.C. Joshi, “Primary Production”, Grassland Ecosystems of the World, ed. R.T. Coupland, Cambridge University Press, London, 197–218., 1979. ——— and R. Misra, “Diversity, Dominance Stability and Net Production in the Grasslands at Varanasi”, Can. Jou. Bot., 47, 425–427, 1969. Singh, K.P. and S.K. Tripathi, Impact of Environmental Nutrient Loading on the Structure and Functioning of Terrestrial Ecosystems. Current Science, 79(3), 316–323, 2000. Singh, J.S. and S.R. Gupta, “Plant Decomposition and Soil Respiration in Terrestrial Ecosystems”, Botanical Review, 43, 449–528, 1977.

552

Fundamentals of Ecology

Singh, R.B., “Conservation and Utilisation of Forage Germplasm for Ruminants in the Asia-Paci?c Region”, Rangelands Resource and Management, eds. Panjab Singh and P.S. Pathak, Range Management Society of India, Indian Grassland and Fodder Research Institute, Jhansi, India, 1–19, 1988. Slobodkin, L.B., “Energetics in Daphnia pulex population”, Ecology, 40, 232–243, 1959. ———, “Energy in Animal Ecology”, Advances in Ecological Research ed J.B. Cragg, Academic Press, London, 1, 69–10, 1962. Smith, F.E., “Population Dynamics in Daphnia Magna and a New Model for Population Growth”, Ecology, 44, 651–653, 1963. Smith, J.M., Models in Ecology, Cambridge University Press, Cambridge, 1974. Smith, K.C. and P.C. Hana Walt, Molecular Photobiology Inactivation and Recovery, Academic Press, New York, 1969. Southwick, H., Ecology and Quality of Our Environment, Van Nostrand Co., New York, p. 426, 1973. Southwood, T.R.E., Ecological Methods with Particular Reference to the Study of Insect Populations, Methuen, London, p. 391, 1966. SPAN, India, September – October issue, American Embassy, New Delhi, 2006. Spedding, D.J., Air Pollution, Oxford University Press, p. 76, 1974. Spiegel, Murray R., Schaum’s Outline of Theory and Problems of Statistics, McGraw-Hill Book Company, London, 1992. Sppellerberg, I.F., Monitoring Ecological Change. Cambridge University Press, Cambridge, U.K. 1991. Steams, S.C. “Life History Tactics: A Review of the Ideas”, Quart. Rev. Biol., 51, 3–47, 1976. ———, “The Evolution of Life History Traits: A Critique of the Theory and a Review of the Data”, Ann. Rev. Ecol. Syst., 145–171, 1977. Stenchever, M.A. and R.B. Frankel, “Some Effects of Diazepam in Human Cells in Vitro”, Am. J. Obstet. Gynec., 103, 836–842., 1969. Stenchever, M.A., R.B. Frankel and J.A. Jarvis, “Effect of Diazepam on Chromosomes of Human Leukocytes in vivo”, Am. J. Obstet. Gynec., 107, 456–460, 1970a. Stenchever, M.A., R.B. Frankel, J.A. Jarvis and K. Verss, “Effect of Chlordiazepoxide Hydrochloride on Human Chromosomes”, Am. J. Obstet. Gynec., 106, 920–923, 1970b. Stenersen, J. Pesticide Science, 10. 104–112, 1979a. ———,Pesticide Science, 10. 113–122, 1979b. Sunnuck, (Quoted in Trevor & Rowe, 2004). Swaminathan, MS Ed. Biotechnology in Agriculture: A Dialogue, Macmillan, Madras, 1991. Swaminathan, MS and Jana S, (Eds) Biodiversity, Implications of Global Food Security, Macmillan, Madras., 1992. Swaminathan, M.S. Science in Response to Basic Human Needs. Current Science, 77(3): 341–353, 1999. Taber, R.D. and Raymond Dasman, “The Dynamics of Three Natural Populations of the Deer, Odocuileus hemionus columbianus”, Ecology, 38, 23 3–246, 1957. Tanaka, M., “Ecological Studies on Communities of Soil Collembola in Mt. Sobo, Southwest Japan”, Jap. J. Ecol. 20, 102–110, 1970. Tansley, A.G., “The Use and Abuse of Vegetational Concepts and Terms”, Ecology, 16, 284–307, 1935. Taylor, Walter P., “Significance of Extreme or Intermittent Conditions in Distribution of Species and Management of Natural Resources, with a Restatement of Liebig’s Law of the Minimum”, Ecol., 15, 374–379, 1934.

Bibliography

553

Teal, J.M., “Community Metabolism in a Temperate Cold Spring”, Ecol. Mongr., 27, 282–302, 1957. ———, “Energy Flow in the Salt Marsh Ecosystem of Georgia”, Ecology, 43, 614–624, 1962. Techno Rama: New Technologies, May (1998), Calcutta. Thambi, A.V. and M.C. Dash, “Seasonal Variation in Numbers and Biomass of Enchytraeidae (Oligochaeta) Population in Tropical Grassland Soil of India”, Trop. Ecol., 14, 228–287, 1973. Thiel, Karl, New York Times Technology Section (articles on Biotechnology)., 2006. Thomas, M.D., Effects of Air Pollution on Plants, WHO Monograph 46: Air Pollution, 233–278, 1961. Thomas, W.A., “Accumulation and Cycling of Calcium by Dogwood Trees”, Ecol. Monogr., 39, 101–120, 1969. Thompson, W.S. and D.T. Lewis, Population Problems, Tata McGraw-Hill, New Delhi, p. 591, 1965. Tilly, L.J., “The Structure and Dynamics of Cone Spring”, Ecol. Monogr., 38, 169–197, 1968. Tiunov, A.V. and S. Schev, Microfungal Communities in Soil, Litter, and Casts of Lumbricus terrestris L. (Lumbricidae): A Laboratory Experiment. Applied Soil Ecology, 14: 17–26, 2000. Tiwari, T.N. and Manzoor Ali, “Water Quality Index for Indian Rivers”, Ecology and Pollution of Indian Rivers, ed. R.K. Trivedi, Ashish Publ. House, New Delhi, 271–286., 1988. Transeau, .E.N., “The Accumulation of Energy by Plants”, Ohio Jour. Science, 26, 1–10., 1926. Treshow, M., “Evaluation of Vegetation Injury as an Air Pollution Criteria”, J. Air Polln. Contr. Ass., 15, 226., 1965. Tripathy, R.S., “Comparison of Competitive Ability of Certain Common Weed Species”, Trop. Ecol., 9, 37–41, 1968. ———, “Growth of Two Common Weed Species Under Different Intensities of Competition From Wheat and Grain”, Proc. Nat. Acad. Sci. India, 39(8), 59–64, 1969. ———, “Weed Problem: An Ecological Perspective”, Trop. Ecol., 18(2), 138–148., 1977. Tripathy, P.C., S.N. Patro (Ed.). Similipal: A Natural Habitat. of Unique Biodiversity, OES, Bhubaneswar, 1997. Trivedy, RK and Arvind Kumar, Eco-Technology for Pollution Control and Environmental Management. Enviromedia, Karad – 145110, India, 322 p, 1998. Trevor, Beebee and Graham Rowe, An Introduction to Molecular Ecology, Oxford University Press, Oxford., 2004. United States Env. Protection Agency, Health Assessment Document for Cadmium, 1979. Usher, M.B., “A Matrix Model for Forest Management”, Biometrics, 25, 309–315, 1969. Utkarsh, Ghate, N.V. Joshi and M. Gadgil On the Patterns of Tree Diversity in the Western Ghats of India. Curr. Sci. 75, 594–603, 1998. Van Dyne, G.M., “Ecosystems, Systems Ecology and Systems Ecologists, Oak Ridge National Laboratory Report, 3957, p. 31, 1966. Varshney, C.K., “Macrophytes as Indicators of Water Quality”, Biological Indicators and Indices of Environmental Pollution, eds, Zafar et al., Central Board for the Prevention and Conrol of Water Pollution, New Delhi, 53–59, 1982. Vasistha, P.C., A Text Book of Plant Ecology, Vishal Publication, Jullundur City, India, p. 340, 1974. Venkateswarlu, V., “Algae as Indicators of River Water Quality and Pollution”, Biological Indicators and Indices of Environmental Pollution, ed. Zafar et al., Central Board for the Prevention and Control of Water Pollution, New Delhi, pp. 93–100, 1982. Venkateswarlu, B Soil Microbial Diversity Studies in Rainfed Agro Ecosystem with Emphasis on Impact of Land Management Practices and Cropping Systems. Paper Presented at the Review Workshop on

554

Fundamentals of Ecology

TSBF programme on “Conservation and Sustainable Management of Below Ground Biodiversity”, JNU, New Delhi., 2004. Venkataraman, A. Incorporating Traditional Coexistence Propensities Into Management of Wildlife Habitats in India. Current Science, 79(11), 153 1–35, 2000. Vernberg, F.J. and W.B. Vernberg, The Animal and the Environment, Holt, Rinehart and Winston, New York, 1970. Verhuist, P.F., “Notice sur la loi Que La Population Suit Dans Son Accroissement”, Corresp. Math. et Phys., 10, 113–121, 1838. Vermiculture Biotechnology for Waste Management CPCB, New Delhi, p. 18, 1999. Vimal, O.P. and S. Talshikar, “Recycling of Wastes in Agriculture: Looking Ahead to 2000 A.D.”, J. Sci. Ind. Res., 42, 115–127, 1983. Vonhof, M.J., Barber D, Fenton MB and Strobecks C, Molecular Ecology, 15, 241–247, 2006. Vyas, A.B. and F.B. Golley, Ecological Principles, Intern. Sci. Publ., Jaipur, India, p. 127, 1975. Waloff, Z., “The Upsurges and Recessions of the Desert Locust: A Historical Survey”, Anti-Locust Mem. No. 8, London, p. 111, 1966. Wangersky, P.J. and W.J. Cunmingham, “On Time Lags r Equations of Growth”, Proc. Natl. A cad. Sci. (Wash.), 42, 699–702, 1956. ———, “Time Lag in Population Models”, Cold Spring Harbor Symp. Quant. Biol., 22, 329–338, 1957. Wellington, W.G., “Individual Differences as a Factor in Population Dynamics: The Development of a Problem”,Canad. J. Zool., 35,293–323, 1957. ———, “Qualitative Changes in Natural Populations During Changes in Abundance”, Canad. J. Zool., 38, 289–314., 1960. Whittaker, R.H., “Dominance and Diversity in Land Plant Communities”, Science, 147, 250–260, 1965. ———,Communities and Ecosystems, MacMillan Company, New York, p. 158, 1970. Whyte, R.O. “Grasses and Grasslands”, Natural Resources of Humid Tropical Asia, 239–262, UNESCO, Paris, 1964. ———,The grassland and fodder Resources of India, ICAR, New Delhi, p. 553, 1967. Whyte, D.H, K.A. King, C.A. Mitchell, E.F. Hill and T.G. Lamont Bull. Env. Contam. Toxicol. 23, 281–284, 1979. Wiegert, R.G., “Thermodynamic Considerations in Animal Nutrition”, Amer. Zool., 8, 71–81, 1968. ——— and F.C. Evans, “Investigation of Secondary Productivity in Grasslands”, Secondary Productivity of Terrestrial Ecosystems, ed. K. Petrusewicz, Polish Acad. Sci., Warsaw, 499–518, 1967. Wilhelm Johannson, (Quoted in Trevor & Rowe, 2004), 1909. Wilhm, J.L. and T.C. Dorris, “Biological Parameters for Water Quality Criteria”, Bio-Sci., 18, 477–481, 1968. Willadsen, SM, Cloning of Sheep and Cow Embryos, Genome, 31: 956–962, 1989. Willis, J.C., Age and Area: A Study in Geographical Distribution and Origin of Species, Cambridge University Press, England, 1922. Williams, C.B., Patterns in the Balance of Nature and Related Problems in Quantitative Ecology, Academic Press, New York, p. 324, 1964. Williams, C.M., “Third Generation Pesticides”, Sci. Am., 217, 13–17, 1967. Willamson, S.J. Fundamentals of Air Pollution, Addison-Wesley Publ. co. Massachusetts, 1973. Wittich, W., Untrsuchungen Uber den Verlauf der Streuzersetzung auf. Linem. Boden mit Regenwarntatig Keit. Schrift Reiche Fak Univ. Gottingen, 9, 7–33, 1953.

Bibliography

555

Wooding S and Ward, R, Phylogeography and Pleistocene Evolution in the North American Black Bear, Molecular Biology and Evol. 14, 1096–1105., 1997, 1989. Woodwell, G.M., “Radiation and the Patterns of Nature”, Science, 156, 461–470, 1967. ———, and W.D. Dykeman, “Respiration of a Forest Measured by CO2 Accumulation During Temperature Inversions”, Science, 154, 1031–1034., 1966. ———, and R.H. Whittaker, “Primary Production in Terrestrial Communities”, Amer. Zool., 8, 19–30, 1968. ———, and H.H. Smith, eds, Diversity and Stability in Ecological Systems, Brookhaven Nat. Lab. Publ., 22, Upton, New York, p. 264, 1969. Wolfe, J.B., E. D. Brodie., and M.J. Wade., Epistasis and the Evolutionary Process. Oxford Univ. Press, 2000. Wooding, S. and R. Ward. Phylogeography and Pleistocene evolution in the North American black bear. Molecular Biology and Evolution, 14: 1096–1105, 1996. World Health Organization, Environmental Health Criteria, 1, Mercury, Geneva, 1976. Wuiff, E.V., An Introduction to Historical Plant Geography, Waltham, Mass, USA, 1943. Wynne-Edwards, V.C., “Population Control in Animals”, Sci. Am., 221, 68–74., 1964. ——— V.C. Self-regulating Systems in Population of Animals”, Science, 147, 1543–1548. Wyrobek, A.J. and W.R. Bruce, 1975, “Chemical Induction of Sperm Abnormalities In Mice”, Proc. Natn. Acad. Sci. U.S.A., 72, 4425–4429, 1965. Zafar, A.R., M.A. Khan, K.R. Khan, and G. Seenayya, eds, Biological Indicators and Indices of Environmental Pollution, Central Board for the Prevention and Control of Water Pollution, New Delhi, p. 209., 1982. Zanhar, SG., Embryo Transfer in Cattle. Indian Dairyman 41: 194–196. Zinki, J.G., R.B. Roberts, P.J. Shea and J. Lasmonis Arch. Env. Contam. Toxicol. 10, 185–192, 1981. Zutshi, D.P., “Evaluation of Eutrophication in Fresh Water Lakes Using Phytoplankton and Primary Production as Indicators”, Biological Indicators and Indices of Environmental Pollution, eds, Zafar et al., Central Board for the Prevention and Control of Water Pollution, New Delhi, 85–92., 1982.

Index

A Abiotic 1 ABO blood group 487 Acclimation 5 Acid rain 304, 376 Acid mine drainage 406, 456 Acute toxicity 361, 406, 468, 470, 475 Adaptation 4 ADI (acceptable daily intake) 461 Additive effect 460 Aerobic 512 Aerosols 360, 379, 380–84 Agrochemicals 399 Air pollutants 360, 392, 454, Albedo 368 Aldehyde 373, 376 Aldicarb 400, 437 Allen’s rule 5 Alkalinity 341, 396 Allopolyploids 483, 484 Altitudinal 149, 150, 173 Alpha particle 430 Allelic Variants 486, 487 Ambient 428, 441, 442 Ammonia 386, 399 Anaerobic 512 Anecic 258, 348 Antagonism 460 Antaretic 160, 172 Anova 73, 134, 135, 136 Antelope 17 Antidote 437, 467 Arabian 158 Arabidopsis 497, 507 Assimilation 87, 94, 111 Association 46

—analysis 46, 47 —index 48, 229 Asphalt 368, 369 Atomic energy 278, 284 Atmosphere 1, 18 Aquatic 23, 26 ecosystem 33, 82, 86, 102, 161 Aquaculture 325 Autotroph 33, 95, 101 Autecology 26 Autotrophic succession 236 Azolla 507 B Basal area 153, 229, 234 Baygon 437 B-carotene 496 Bell shaped 521, 251 Benthos 164, 165 Bergmann’s rule 5 Bernoulli distribution 519 Bhopal gas tragedy 434, 438 Bioaccumulation 467 Biodiversity 25, 293, 296, 299, 303, 478, 526 Biological stress 3 Biomass 35, 41, 102, 282, 283 Biome 18, 149 Bio-mapping 509 Biomagnification 467 Binomial 478, 518, 519 Biological order 18, 293 Biological oxidation 360 Biological clock 212 Biodegradable 355, 409 Bioindicator 433, 435 Bio fuel 369, 500 Biogas 283, 500

558 Biotic 1 Biotic factor 205 Biotic community 220, 509 Biotic potential 246 Bio-informatic tools 483 Bioresource 334 Bioluminiscence 191 Biomedical 415, 421, 423 Bioreactor 512 Bioremediation 502, 508 Biotechnology 492, 494, 513 Bio-safety 499 Biotransformation 403 Biotech drugs 497 Bio Kinetic zone 2, 187 Boot Strap 480, 481 BWQC 511, 512 Bryoids 225 C Cadmium 404, 405 Carbon dioxide 85, 120, 192 Carbon cycle 120 Carnivore 96, 211 Carbon monoxide 355, 360 Canyon effect 368 Capillary 101, 197 Carbofuran 425, 437 Catechol dioxygenase 504 Cation exchange 122, 199 Carrying capacity 131, 252 C3-plant 114 C4-plant 114 Catalytic converter 393 Chapral ecosystem 155 Chaemaephytes 223, 224 Chresard 198 Chart 251 Chemoautotroph 33 Chloro-fluoro carbon (CFC) 363, 373, 383 Chromium 398 Chernobyl disaster 437 Chlorophyll 75, 86 Chloroperoxidase 504 Chilika 168 Chronic toxicity 468 Chloroplast DNA 481 Chlorpromazine 459 Circadian 213 Climate 158 Climax 240 Climatic factor 180 Cloning 494 Clutch size 257 Coastal 164

Index

Concrete 368 Commensalism 206 Colonisation 236 Consumer 34 Compost 502 Competitive exclusion 14, 266, 267 Conservation 24, 293, 330 Contingency table 48 Confidence interval 522 Convergence 5 Cryptophytes 223, 224 Cyclone collector 391 D Decibel 427 Decomposer 34, 35 Demography 274 Deficient 7 Density 228 Density dependent 272 Desert 157, 158 Detritus 87, 98 Deterministic 134 Dice index 49 Distance matrix method 481 Diversity index 43, 528 Diversity score 511 Divergence 5 Distribution Model 135 Dose 458, 460 Dose response 460 Dominance index 43 DNA 482 DNA polymorphism 482 DNA micro arrays 485, 490 DNA finger print 487 E Eastern ghat 152 Ecocity 26 Ecology 17 Ecological amplitude 220 Ecomark 443 Ecological mortality 248 Ecological natality 247 Ecotone 221 Ecosystem 33 Ecological equivalents 17 Ecological compression 16 Ecological landscape 24 Ecological modeling 130 Ecological rhythms 212 Ecological succession 236, 237, 241 Ecological pyramids 101 Ecological genetics 478, 485 Ecological effect 221

Index

ED50 461 Edaphic factor 194 Endemism 175 Endogeic 258, 348 Enthalpy 107 Entropy 107 EMP 443, 449 Electrostatic precipitator 391 Environmental Law 439 Environmental biotechnology 492 Energy resource 282 Energy flow 37, 103 Enzyme 455 Endangered 313, 343 Emissivity 368 Empty niche 14 Elastic resistance 3 EL-Nino 336 Eltonian pyramid 101 Eury 8 bathic 8 ecious 8 haline 8 phasic 8 thermal 8 Epigeic 258 Epiphytes 150, 225 Epiphytism 207 Evenness index 45 Equatorial 164, 173 Eutrophication 397 EP Act 449 Exponential 130 F Family planning 275 Floristic 172 Fluorine 385 Fluoride cycle 385 Food Chain 95, 96 Forcing function 129 Forest ecosystem 149 Frequency 227 G Ganga Action Plan 407, 511 Gamma rays 430 Genetic engineering 494, 495 Genetically engineered foods 496 Genotype 1, 479 Geothermal 283 Genomics 482, 489 Gloger’s rule 6 Glaciers 364, 367 Gut content analysis 100

559 Grasslands 156, 157 Gravitational 198 Genetic Marker 485 Green Path 448 Gravity settling Chamber 391 Greenhouse effect 120, 362 Greenhouse gas 363 H Halogens 385 Habitat niche 10 Habitat 10 Harike lake 170 Harvest method 83 Hazardous 417, 418, 444 Herbs 226 Hemicryptophytes 223, 224 Herbivore 87, 89 Heterozygotes 486 Heterotroph 35, 239 Heterotrophic succession 236 Host factor 457 Homeostasis 1, 126 Homozygotes 486 Holard 198 Hybrid 298, 483 Hydrosere 237 Hydrogen Sulphides 369, 370 Hydroscopic 197 Hydrophyte 185 Hydrosphere 1 Hydrological cycle 118 Hydrocarbon 305, 372 Hyper volume 10 niche 10 I Incineration 370, 416 Indicator species 14 Ingestion 87 Interspecific 1, 16 Intraspecific 1, 16 Indoor pollution 430 Ionosphere 18, 19 Information theory 241 Impingers 391 Importance Value Index (IVI) 229 Imbibitional 197 Intellectual Property Rights (IPR) 498 Intrinsic 144, 247, 260 rate 144, 247 ISO 14001 449 J Jacard index 49 J-shaped growth curve

253

560 K Kabadi wallahs 416 K-selection 258 Kepone case 400 Kyoto Protocol 446 L Land use 24, 280, 340 Latitude 108 Latitudinal Zonation 150 Law of minimum 9 Landfill 413 LA-Nina 182, 367 LAI 77 Lianas 225 Light 150, 189 Lignin peroxidase 504 Living dead 303 Life history strategy 256 Live stock 324 Lithosphere 1, 20 Limiting factor 4 Lindeman’s trophic–dynamic concept 109 Liquefied petroleum 284, 257 Linear relationship 130 Limnetic 161 Littoral 161 Life Table 248 Leptophyll 225 Lethal 7 Lentic 161 Lotic 163 Lycopene 496 LC50 463, 468 LD50 463, 401, 458 M Microplankton 165 Minimata disease 477 Monoclonal antibody 494 Microbial mining 513 Megaphanerophytes 223 Microphanerophytes 223 Monoclimax 240 Mortality 246 Mineral resource 279 Monoculture 330 Mull 21 Moder 21 Mor 21 Meteorology 387 Microecosystem 39 Model 111, 129 Model Symbols 132 Montane 150 Markov Model 134, 141

Index

Multi Variate 134, 141 Matrix 134 Material Cycling 117 Multidimensional niche 10 Mini satellite 486, 487 Macronutrient 35 Micronutrient 35 Metal Toxicity 404, 474, 506 Molecular Phylogeny 479 Mitochondrial DNA 480, 481 Molecular ecology 27, 478 Micro array analysis 489 Muntjac deer 484 Monitoring 359 Microorganism in swage 359 Mercury 401 Toxicity 403 MIC 434, 436 Methane 363 Merophyll 225 Mesophyll 225 Macrophyll 225 Megaphyll 225 Microbial diversity 204 N Nanophyll 225 Nannoplankton 165 Natality 246, 247 Nektan 165 Niche 9 fundamental 12 realised 12 Niche overlap 13, 528 Niche Indices 527 Niche breadth 12, 528 Niche Width 14 Nif gene 495 Nitrogen cycle 121 Natural resource 278 Nearctic 172 Nitrous oxide 363 Niche 12 Nitrification 122 Neotropic 172 Nutrient 118 Nucleic acid 465 Noise Pollution 425, 428, 429, 444 Nutrigenetics 498 Nudation 236 Null hypothesis 523 Normal distribution 518, 521 NAAQ 441 O Ocean 163 Ochiai Index 52

Index

Oil 427 Organophosphorous Pesticide 465 Organochlorine 328, 400 Our common future 333, 446 Oxygen 13, 84 Oxygen cycle 123 Ozone 382 P PAN 375, 376 Panchagavya 505 Parasitism 206, 264 Parsimony 480, 481 Parasitic food chain 98 Palaearctic 172 Palaecology 26 Pelagic 165 Peroxidases 504 PAH 372 Pioneers 236 Primary Producer 110, 164 Principal component analysis 50 Phagotroph 35 Phytogeography 171, 173 Phosphorus cycle 124, 125 Phenoloxidase 504 Photosynthetic pigment 105 Phanerophytes 223 Phytoclimatic spectrum 223 Phenology 220 pH 192, 377 Phenotype 1, 479 Phyto remediation 507 Photo antotroph 33 Photochemical oxidation 371 Plankton 99 Plant indicators 433 Plastic Strain 3 PCR 485, 486, 487 Phosgin 436 Permanent set 3 Pollution ecology 27, 354 Producer 33, 34 Primary consumes 96, 98 Population 114, 251, 246 Polyclimax 240 Polygraph 229, 230 Predation 47, 210, 264 Predator 1 Precipitin test 101 Probit 463 Pulverisation 417 Pyramid 101 Pyrolysis 417 Potentiation 460

561 Q Quadrat 231, 232 Quantal 459 response 462 R Ramsar Convention 168 Renewable 278, 280 Resource map 339 Reducing smog 375 Residual effect 463 Recycling 332, 344, 416 Resource 16, 278 Raunkiaer’s 223, 224 Relative density 228 Relative dominance 228 S Sambhar lake 169 Sample 488, 516 Sampling theory 517 SAC–B 541 Salix sp. 507 Saprobic score 511 Saprotroph 35 Scrubbing 391 Secondary Production 75, 86, 94 Seed 207, 506 Sevin 436, 437 Seedling treatment 506 Sensitisation 460 Sere 236 Sensor 336, 337 Seral community 43, 222 Secondary consumer 96 Sedimentary cycle 118 Shannon index 44 Shrubs 151 Signature sites 481 Sigmoid growth 254, 256 Sink 366, 386 Sink factor 366 Simpson’s index 44 Similarity index 46 Soil 21, 192, 194 Soil fertility 341 Soil management 341 Soil erosion 341 Soil organisms 200 Solar energy 282 Social forestry 291 Soil fauna 200 Social behaviour 293 Sorenson’s index 49 Space 336 Species richness 525

562 Spectral 338 Standard error 518 Steno 8 bathic 8 ecious 8 hydric 8 phasic 8 thermal 8 State variable 129, 132 Strain 3 Stress 2, 3 Standing crop 35 Stochastic 135 Stratosphere 19 Statistical ecology 516 Statistical inference 517 Standard deviation 518 Statistical hypothesis 522 Sulphur cycle 124 Subtropical 150, 152 Sustainable 293, 331 development 293, 331 Synchroniser 213 Synergism 376, 460 Synecology 26 Systems ecology 27 System concept 31 Symbiosis 1, 205

Index

Trees 151, 156 Translocation 464 Therophytes 224 Tropical 152 deciduous forest 152 rain forest 149 savanna 155 Trophic Level 35, 95 Tundra 160 Turnover 82 time 82 rate 82 Turbidity 394 Type-I and II error 523 Tyrosinase 504 U Ultra violet 104, 189 Urbantieat island (UHI) 368 V Vectorette 488 Vermiculture 501 Vermifertiliser 502 Vermitechnology 345 Violet 104 Visible spectrum 104 Vista 48 W

T Tailored compost 502 Taq polymerase 488 Temperate 151, 156, 157 Template 480 Temperate forest 95, 150 Temperate rain forest 151 Temperature 187, 396 inversion 388 Tests of hypothesis 523 Tidal energy 280 Thermosphere 18 Thermal Pollution 396, 399 Thermal Precipitator 391 Threshold Limit 461 dose 461 Toxic elements 342, 456 Toxin 505, 454 Topography 388 Troposphere 18 Transect 250 Tropopause 18 Traditional Knowledge 497 medicine 497

Wave 283 Water Act 440 Water cers. 10, 161 Water cycle 119 Wetland 165 Wet precipitation 381 Western ghats 150 Wholesomeness 440 Wildlife 306, 314 Wind energy 283 X Xerarch 238 Xenobiotics 467 Xerosere 238 Z Zone of tolerance 2 Zone of Compatibility 2 Zone of capacity adaptation 2 Zone of resistance 2 Zone of Winter rains 173 Zoogeographical realms 172, 188 Zoogeography 172 Zooplankton 34, 395