Citrus Tristeza Virus: Methods and Protocols [1st ed.] 978-1-4939-9557-8;978-1-4939-9558-5

Table of contents :
Front Matter ....Pages i-x
A Short Note on Reflections and Publications on Citrus tristeza virus (CTV) Methodologies (Moshe Bar-Joseph)....Pages 1-6
A Brief Historical Account of the Family Closteroviridae (Giovanni P. Martelli)....Pages 7-13
Phenotyping Biological Properties of CTV Isolates (Marcella Russo, Antonino F. Catara)....Pages 15-27
CTV Vectors and Interactions with the Virus and Host Plants (Raymond Yokomi)....Pages 29-53
Tissue-Print and Squash Capture Real-Time RT-PCR Method for Direct Detection of Citrus tristeza virus (CTV) in Plant or Vector Tissues (Mariano Cambra, Eduardo Vidal, Carmen Martínez, Edson Bertolini)....Pages 55-66
Detection of Citrus tristeza virus and Coinfecting Viroids (Maria Saponari, Stefania Zicca, Giuliana Loconsole, Beatriz Navarro, Francesco Di Serio)....Pages 67-78
Assessment of Genetic Variability of Citrus tristeza virus by SSCP and CE-SSCP (Elisavet K. Chatzivassiliou, Grazia Licciardello)....Pages 79-104
Identification and Characterization of Resistance-Breaking (RB) Isolates of Citrus tristeza virus (Maria Saponari, Annalisa Giampetruzzi, Vijayanandraj Selvaraj, Yogita Maheshwari, Raymond Yokomi)....Pages 105-126
Genotyping Citrus tristeza virus Isolates by Sequential Multiplex RT-PCR and Microarray Hybridization in a Lab-on-Chip Device (Giuseppe Scuderi, Antonino F. Catara, Grazia Licciardello)....Pages 127-142
Rapid and Sensitive Detection of Citrus tristeza virus Using Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) Assay (Dilip Kumar Ghosh, Ashish Warghane, Kajal Kumar Biswas)....Pages 143-150
Amplification and Cloning of Large cDNA Fragments of the Citrus tristeza virus Genome (Munir Mawassi, Sabrina Haviv, Ludmila Maslenin)....Pages 151-161
Bioinformatic Tools and Genome Analysis of Citrus tristeza virus (Ana Belén Ruiz-García, Rachelle Bester, Antonio Olmos, Hans Jacob Maree)....Pages 163-178
Analysis of Genotype Composition of Citrus tristeza virus Populations Using Illumina Miseq Technology (David A. Read, Gerhard Pietersen)....Pages 179-194
Citrus tristeza virus: Host RNA Silencing and Virus Counteraction (Susana Ruiz-Ruiz, Beatriz Navarro, Leandro Peña, Luis Navarro, Pedro Moreno, Francesco Di Serio et al.)....Pages 195-207
Proteomic Response of Host Plants to Citrus tristeza virus (Milena Santos Dória, Carlos Priminho Pirovani)....Pages 209-218
Gene Expression in Citrus Plant Cells Using Helios® Gene Gun System for Particle Bombardment (Yosvanis Acanda, Chunxia Wang, Amit Levy)....Pages 219-228
Methods for Producing Transgenic Plants Resistant to CTV (Nuria Soler, Montserrat Plomer, Carmen Fagoaga, Pedro Moreno, Luis Navarro, Ricardo Flores et al.)....Pages 229-243
Back Matter ....Pages 245-247

Citation preview

Methods in Molecular Biology 2015

Antonino F. Catara · Moshe Bar-Joseph Grazia Licciardello Editors

Citrus Tristeza Virus Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in Pub Med.

Citrus Tristeza Virus Methods and Protocols

Edited by

Antonino F. Catara Department of Phytosanitary Sciences, University of Catania, Science and Technology Park of Sicily, Catania, Italy

Moshe Bar-Joseph The S. Talkowski Laboratory, Department of Plant Pathology and Weed Research, The Volcani Center, Agricultural Research Organization, Bet Dagan, Israel

Grazia Licciardello Consiglio per la Ricerca in agricoltura e l’analisi dell’Economia Agraria, Centro di Olivicoltura, Frutticoltura e Agrumicoltura (CREA-OFA), Acireale (Catania), Italy

Editors Antonino F. Catara Department of Phytosanitary Sciences University of Catania Science and Technology Park of Sicily Catania, Italy

Moshe Bar-Joseph The S. Talkowski Laboratory Department of Plant Pathology and Weed Research The Volcani Center Agricultural Research Organization Bet Dagan, Israel

Grazia Licciardello Consiglio per la Ricerca in agricoltura e l’analisi dell’Economia Agraria Centro di Olivicoltura Frutticoltura e Agrumicoltura (CREA-OFA) Acireale (Catania), Italy

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-4939-9557-8 ISBN 978-1-4939-9558-5 (eBook) https://doi.org/10.1007/978-1-4939-9558-5 © Springer Science+Business Media, LLC, part of Springer Nature 2019 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, express or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 233 Spring Street, New York, NY 10013, U.S.A.

Preface Citrus tristeza virus (CTV) is one of the most destructive plant viruses that replicates in the cytoplasm of companion or phloem parenchyma cells of Citrus, Poncirus, and Fortunella. It causes a variety of symptoms depending on the host species, the cultivar, and the CTV isolate involved. Given that this virus is associated worldwide with citrus, many plant pathologists and virologists have been involved in the study of this complex virus and the diseases it causes. Few, however, have spent as long as 50 years like Moshe Bar-Joseph. His pioneering efforts led to the development of new methods of CTV diagnosis (1970) based on the electron microscope observation of partially purified particles and enabled other groups to develop rapid serological assays (Chapter 1). With some modifications, his method was also useful for Beet yellows virus (BYV) particles that cause Closterovirus. To demonstrate the genetic diversity of CTV isolates, Moshe Bar-Joseph developed strain-specific assays using CTV-VT cDNA fragments as hybridization probes. He also developed a CTV-dsRNA cloning method and used complementary oligonucleotides for cDNA synthesis and PCR amplification. To honor his invaluable dedication and contribution to the study of the virus, 45 authors have contributed to this laboratory methods and protocols book on the Citrus tristeza virus, which is one of the most complex viruses, as well one of the most scientifically attractive research topics. Thanks to the highly sensitive and specific diagnostic procedures developed, knowledge of the molecular characteristics, expression strategies, genetic variability, and epidemiology of the virus have improved significantly. Since deep sequencing opened new doors to reconstructing viral populations in a high-throughput and cost-effective manner, many of the past grouping criteria have now been revisited. Today, 67 complete sequences of CTV genomes from different countries are in the GenBank. Unfortunately, not all of them have been associated with a phenotypic profile. Reports from all over the world show that several destructive isolates of CTV, not dependent on sensitive rootstocks, may suddenly appear as a result of rearrangements or mutations of the genome. The rapid identification of the genetic diversity of the virus remains critical for surveying specific land areas. This book provides methods and clear protocols for the various technologies available to detect, characterize, and study CTV, a member of the genus Closterovirus family Closteroviridae (Chapter 2). Despite the fact that new detection methods have strengthened the discrimination potential of genotypes of the isolates, biological indexing remains invaluable in order to phenotype the biological properties of isolates in terms of their aggressiveness on various hosts (Chapter 3). Enzyme immunoassays and PCR-based assays, which are frequently used in combination, have revealed the worldwide rapid diffusion of the virus, even in symptomless infected citrus trees. The relationships of vectors with the virus and its host plants, which are mostly based on host plant inoculation, have been highlighted by sensitive detection technologies (Chapter 4). The potential of CTV detection by RT-PCR was strengthened after the development of direct systems of sample preparation and real-time RT-PCR (Chapter 5). Fast, reliable, and specific detection methods based on real-time PCR protocols have been designed to simultaneously detect CTV, HSVd, and CEVd (Chapter 6). The analysis of single-strand

v

vi

Preface

conformation polymorphism of RT-PCR product by polyacrylamide gel or capillary electrophoresis is still now the most common and informative method to investigate the structure of CTV isolate populations (Chapter 7). Integrating molecular assays and biological tests has made it possible to identify RB CTV isolates which overcome the resistance of trifoliate orange and its hybrids (Chapter 8), whereas sequential RT-PCR and microarray hybridization, on a lab-on chip device, enable a fast characterization of virus genotypes (Chapter 9), which is very useful for the CTV surveillance of territories. At the same time, the fast and sensitive field detection of CTV has recently been achieved by reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay (Chapter 10). A strategy to clone the entire genome of CTV obtained from two RT-PCR amplified products has also been developed (Chapter 11). After high-throughput sequencing (HTS) was developed, bioinformatics started to be applied to analyze the genome of the virus (Chapter 12), to differentiate between isolates based on genotype composition which has been used to select candidate cross protective isolates (Chapter 13), and to study host RNA silencing and virus attack (Chapter 14). The study of proteins involved in CTV infection has been made possible by techniques such as proteomics (Chapter 15), whereas transient expression of the virus proteins is possible by biolistic bombardment (Chapter 16). Methods are now available for producing transgenic plants resistant to CTV (Chapter 17). This book will be of interest to plant pathologists, plant virologists, molecular biologists, and graduate students, as a guide to performing qualitative and quantitative tests as well as recently developed diagnostic methods. We hope the methods and protocols reported here will be helpful to find new solutions to improve the management of the disease, and we wish to thank all the authors who have contributed. Catania, Italy Bet Dagan, Israel Acireale (Catania), Italy

Antonino F. Catara Moshe Bar-Joseph Grazia Licciardello

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

1 A Short Note on Reflections and Publications on Citrus tristeza virus (CTV) Methodologies . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Moshe Bar-Joseph 2 A Brief Historical Account of the Family Closteroviridae . . . . . . . . . . . . . . . . . . . . . Giovanni P. Martelli 3 Phenotyping Biological Properties of CTV Isolates. . . . . . . . . . . . . . . . . . . . . . . . . . Marcella Russo and Antonino F. Catara 4 CTV Vectors and Interactions with the Virus and Host Plants . . . . . . . . . . . . . . . . Raymond Yokomi 5 Tissue-Print and Squash Capture Real-Time RT-PCR Method for Direct Detection of Citrus tristeza virus (CTV) in Plant or Vector Tissues. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Mariano Cambra, Eduardo Vidal, Carmen Martı´nez, and Edson Bertolini 6 Detection of Citrus tristeza virus and Coinfecting Viroids . . . . . . . . . . . . . . . . . . . Maria Saponari, Stefania Zicca, Giuliana Loconsole, Beatriz Navarro, and Francesco Di Serio 7 Assessment of Genetic Variability of Citrus tristeza virus by SSCP and CE-SSCP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Elisavet K. Chatzivassiliou and Grazia Licciardello 8 Identification and Characterization of Resistance-Breaking (RB) Isolates of Citrus tristeza virus. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Maria Saponari, Annalisa Giampetruzzi, Vijayanandraj Selvaraj, Yogita Maheshwari, and Raymond Yokomi 9 Genotyping Citrus tristeza virus Isolates by Sequential Multiplex RT-PCR and Microarray Hybridization in a Lab-on-Chip Device . . . . . . . . . . . . . Giuseppe Scuderi, Antonino F. Catara, and Grazia Licciardello 10 Rapid and Sensitive Detection of Citrus tristeza virus Using Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) Assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Dilip Kumar Ghosh, Ashish Warghane, and Kajal Kumar Biswas 11 Amplification and Cloning of Large cDNA Fragments of the Citrus tristeza virus Genome . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Munir Mawassi, Sabrina Haviv, and Ludmila Maslenin 12 Bioinformatic Tools and Genome Analysis of Citrus tristeza virus. . . . . . . . . . . . . Ana Bele´n Ruiz-Garcı´a, Rachelle Bester, Antonio Olmos, and Hans Jacob Maree

vii

v ix

1 7 15 29

55

67

79

105

127

143

151 163

viii

Contents

Analysis of Genotype Composition of Citrus tristeza virus Populations Using Illumina Miseq Technology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . David A. Read and Gerhard Pietersen 14 Citrus tristeza virus: Host RNA Silencing and Virus Counteraction . . . . . . . . . . . ˜ a, Luis Navarro, Susana Ruiz-Ruiz, Beatriz Navarro, Leandro Pen Pedro Moreno, Francesco Di Serio, and Ricardo Flores 15 Proteomic Response of Host Plants to Citrus tristeza virus . . . . . . . . . . . . . . . . . . Milena Santos Doria and Carlos Priminho Pirovani 16 Gene Expression in Citrus Plant Cells Using Helios® Gene Gun System for Particle Bombardment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Yosvanis Acanda, Chunxia Wang, and Amit Levy 17 Methods for Producing Transgenic Plants Resistant to CTV . . . . . . . . . . . . . . . . . Nuria Soler, Montserrat Plomer, Carmen Fagoaga, Pedro Moreno, ˜a Luis Navarro, Ricardo Flores, and Leandro Pen 13

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

179 195

209

219 229

245

Contributors YOSVANIS ACANDA  Department of Plant Pathology, Citrus Research and Education Center, University of Florida, Lake Alfred, FL, USA MOSHE BAR-JOSEPH  The S. Talkowski Laboratory, Department of Plant Pathology and Weed Research, The Volcani Center, Agricultural Research Organization, Bet Dagan, Israel EDSON BERTOLINI  Departamento de Fitossanidade, Faculdade de Agronomia, Universidade Federal do Rio Grande do Sul (UFRGS), Porto Alegre, RS, Brazil RACHELLE BESTER  Department of Genetics, Stellenbosch University, Matieland, South Africa; Agricultural Research Council, Infruitec-Nietvoorbij: Institute for Deciduous Fruit, Vines and Wine, Stellenbosch, South Africa KAJAL KUMAR BISWAS  Division of Plant Pathology, Advanced Centre for Plant Virology, ICAR Indian Agricultural Research Institute, New Delhi, India MARIANO CAMBRA  Plant Protection and Biotechnology, Department of Virology and Immunology, Centre of Moncada, Instituto Valenciano de Investigaciones Agrarias (IVIA), Valencia, Spain ANTONINO F. CATARA  Department of Phytosanitary Sciences, University of Catania, Catania, Italy; Science and Technology Park of Sicily, Catania, Italy ELISAVET K. CHATZIVASSILIOU  Plant Pathology Laboratory, Faculty of Crop Science, Agricultural University of Athens, Athens, Greece FRANCESCO DI SERIO  Dipartimento di Scienze del Suolo, della Pianta e degli Alimenti, ` di Bari “Aldo Moro”, Bari, Italy; Istituto per la Protezione Sostenibile delle Universita Piante, Consiglio Nazionale delle Ricerche, Bari, Italy MILENA SANTOS DO´RIA  Centro de Biotecnologia e Gene´tica, Universidade Estadual de Santa Cruz, Ilhe´us, BA, Brazil CARMEN FAGOAGA  Facultad de Veterinaria y Ciencias Experimentales, Universidad Catolica de Valencia (UCV), Valencia, Spain RICARDO FLORES  Instituto de Biologı´a Molecular y Celular de Plantas, Universidad Polite´ cnica de Valencia-Consejo Superior de Investigaciones Cientı´ficas, Valencia, Spain DILIP KUMAR GHOSH  Plant Virology Laboratory, ICAR-Central Citrus Research Institute, Nagpur, India ANNALISA GIAMPETRUZZI  Istituto per la Protezione Sostenibile delle Piante, Consiglio Nazionale delle Ricerche, Bari, Italy SABRINA HAVIV  The S. Tolkowsky Laboratory, Department of Plant Pathology and Weed Research, The Volcani Center, Agricultural Research Organization, Bet Dagan, Israel AMIT LEVY  Department of Plant Pathology, Citrus Research and Education Center, University of Florida, Lake Alfred, FL, USA GRAZIA LICCIARDELLO  Consiglio per la Ricerca in agricoltura e l’Analisi dell’Economia Agraria, Centro di Olivicoltura, Frutticoltura e Agrumicoltura (CREA-OFA), Acireale (Catania), Italy GIULIANA LOCONSOLE  Dipartimento di Scienze del Suolo, della Pianta e degli Alimenti, ` di Bari “Aldo Moro”, Bari, Italy Universita YOGITA MAHESHWARI  San Joaquin Valley Agricultural Sciences Center, USDA-ARS, Parlier, CA, USA

ix

x

Contributors

HANS JACOB MAREE  Department of Genetics, Stellenbosch University, Matieland, South Africa; Citrus Research International, Nelspruit, Mpumalanga, South Africa ` degli Studi GIOVANNI P. MARTELLI  Department of Soil, Plant and Food Sciences, Universita di Bari “Aldo Moro”, Bari, Italy CARMEN MARTI´NEZ  Plant Protection and Biotechnology, Department of Virology and Immunology, Centre of Moncada, Instituto Valenciano de Investigaciones Agrarias (IVIA), Valencia, Spain LUDMILA MASLENIN  The S. Tolkowsky Laboratory, Department of Plant Pathology and Weed Research, The Volcani Center, Agricultural Research Organization, Bet Dagan, Israel MUNIR MAWASSI  The S. Tolkowsky Laboratory, Department of Plant Pathology and Weed Research, The Volcani Center, Agricultural Research Organization, Bet Dagan, Israel PEDRO MORENO  Centro de Proteccion Vegetal y Biotecnologı´a, Instituto Valenciano de Investigaciones Agrarias (IVIA), Valencia, Spain BEATRIZ NAVARRO  Istituto per la Protezione Sostenibile delle Piante, Consiglio Nazionale delle Ricerche, Bari, Italy LUIS NAVARRO  Centro de Proteccion Vegetal y Biotecnologı´a, Instituto Valenciano de Investigaciones Agrarias (IVIA), Valencia, Spain ANTONIO OLMOS  Instituto Valenciano de Investigaciones Agrarias (IVIA), Moncada, Valencia, Spain LEANDRO PEN˜A  Instituto de Biologı´a Molecular y Celular de Plantas, Universidad Polite´ cnica de Valencia-Consejo Superior de Investigaciones Cientı´ficas, Valencia, Spain; Instituto Valenciano de Investigaciones Agrarias, Moncada, Spain GERHARD PIETERSEN  Department of Genetics, Stellenbosch University, Stellenbosch, South Africa CARLOS PRIMINHO PIROVANI  Centro de Biotecnologia e Gene´tica, Universidade Estadual de Santa Cruz, Ilhe´us, BA, Brazil MONTSERRAT PLOMER  Valgenetics S.L., Valencia, Spain DAVID A. READ  Biotechnology Platform, Agricultural Research Council, Onderstepoort, South Africa ANA BELE´N RUIZ-GARCI´A  Instituto Valenciano de Investigaciones Agrarias (IVIA), Moncada, Valencia, Spain SUSANA RUIZ-RUIZ  Instituto de Biologı´a Molecular y Celular de Plantas, Universidad Polite´cnica de Valencia-Consejo Superior de Investigaciones Cientı´ficas, Valencia, Spain MARCELLA RUSSO  Agrobiotech Soc. Coop., Catania, Italy MARIA SAPONARI  Istituto per la Protezione Sostenibile delle Piante, Consiglio Nazionale delle Ricerche, Bari, Italy GIUSEPPE SCUDERI  Agrobiotech Soc. Coop., Catania, Italy VIJAYANANDRAJ SELVARAJ  San Joaquin Valley Agricultural Sciences Center, USDA-ARS, Parlier, CA, USA NURIA SOLER  Granada Coating S.L., Carchuna, Granada, Spain EDUARDO VIDAL  Ascenza Productos Para Agricultura, S.A.U. Paterna, Valencia, Spain CHUNXIA WANG  Citrus Research and Education Center, University of Florida, Lake Alfred, FL, USA ASHISH WARGHANE  Plant Virology Laboratory, ICAR-Central Citrus Research Institute, Nagpur, India RAYMOND YOKOMI  San Joaquin Valley Agricultural Sciences Center, USDA-ARS, Parlier, CA, USA STEFANIA ZICCA  Istituto per la Protezione Sostenibile delle Piante, Consiglio Nazionale delle Ricerche, Bari, Italy

Chapter 1 A Short Note on Reflections and Publications on Citrus tristeza virus (CTV) Methodologies Moshe Bar-Joseph Abstract My PhD thesis work of Citrus tristeza virus (CTV) purification was aimed to develop a rapid serological assay to replace biological indexing. The task turned difficult and was achieved after a lengthy struggle, rewarded by allowing (1) the rapid diagnosis of the first incidences of natural spread of a severe CTV-VT strain in our region and (2) finding that the CTV particle isolation protocol, with some modifications, was also useful for Beet yellows virus (BYV) particles, leading to their assignment in the Closterovirus group, the first group of elongated plant viruses with different modal lengths. Later, following the introduction of ELISA for large-scale diagnosis of tristeza-infected citrus trees, the CTV infection rates through the coastal citrus production areas were continually increasing, with many ELISA-positive samples appearing symptomless, prompting the need to develop strain-specific assays. Using CTV-VT cDNA fragments, as hybridization probes, the genetic diversity among local CTV isolates was demonstrated. With the emergence of the PCR technology, we developed a CTV-dsRNA cloning method based on the ligation of known oligonucleotide molecules to dsRNA ends and the use of complementary oligonucleotides for cDNA synthesis and PCR amplification. The method allowed the cloning of a cDNA molecule complementary to a defective dsRNA of 2.4 kb with intact 5 and 3 ends of the CTV-VT genome. A list of publications, resulting from continuous collaborative work with local and foreign associates and students on the development and adaptation of novel CTV methodologies, is present. Key words DsRNA, Defective RNA, Oligonucleotide dsRNA ligation, ELISA, cDNA cloning, Hybridization, Diagnosis, Virus strain differentiation, Symptomless virus isolate

My first CTV publication on citrus tristeza work was published in 1970 [1]. On the same year, there was an international meeting on ornamental plant production in Tel Aviv, and one of the keynote speakers used the figure showing the purified CTV preparation from our paper to illustrate progress on difficult virus isolation. It took me 2 more years to complete my thesis involving not only characterization of the citrus tristeza disease associated with threadlike particles (TLP) but also pointing to the considerable variation in aphid transmissibility of different local CTV isolates. It was the first paper describing the VT strain of CTV obtained from a quickdeclined Valencia tree on a sour orange rootstock, in a grove of a Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_1, © Springer Science+Business Media, LLC, part of Springer Nature 2019

1

2

Moshe Bar-Joseph

friend located about half a KM from Hibat Zion, where natural CTV spread was for the first time noted in Israel in 1970. Later the VT strain was the second CTV isolate to be completely sequenced [2]; however, already in 1984, fragmented cDNA clones of VT were shown to be useful to demonstrate the considerable genetic variation among CTV isolates [3]. In my work on CTV starting in 1966 as PhD candidate in Prof Gad Loebenstein virus laboratory, I was lucky in several ways: (1) the finding of EW Kitajima et al. in Brazil that tristeza-diseased trees were associated with TLP, (2) the fear of a tristeza disease epidemic decimating our famous production of citrus on the sour orange rootstock, (3) and the considerable difficulty isolating these long and gentle spaghetti-like particles in the absence of biological assays to quantify the purification steps. The last issue made my project highly risky, which I was fortunate to complete only through long hours of work despite endless failures. Indeed I already mentioned in one of my reviews that the name tristeza, which means sadness in Portuguese, was most appropriate for the disease because of three reasons: (1) the appearance of infected trees, (2) the feeling of the growers, and (3) because of the endless frustrations of CTV investigators. The rewarding part was during my postdoc work at John Innes Institute, Norwich, UK. The experience gained with CTV isolation was useful for isolating the Beet yellows virus (BYV) particles [4], and biophysical comparisons allowed us to establish that despite large differences in particle sizes, these two viruses should be categorized in the same group of elongated viruses sharing not similar sizes but considerable biophysical similarities along with phloem restriction, semipersistent mode of aphid transmission, and similar cytological alterations of infected host plants [5]. The ELISA method [6], introduced for CTV diagnosis in collaboration with Steve Garnsey, Dennis Gonsalves and Dan Purcifull from Florida, and Dr. M. Clark, then at East Malling, UK, revolutionized CTV detection and allowed testing >1 million citrus trees through the years 1979–1980 and the realization that many of the ELISA-positive samples were derived from trees infected with symptomless CTV isolates. Collaborating with Dr. Allan Dodds, while on sabbatical at the University of California Riverside, I was introduced to the dsRNA extraction technology, which Allan found to be highly effective for CTV. Realizing the great value of Allan’s finding for other difficult to isolate Closteroviridae, I gathered a collection of other Closteroviridae species, including BYV, Carnation necrotic fleck virus (CNFV), and Apple chlorotic leaf spot virus (ACLSV), considered then to belong to the same group [5]. The BYV and CNFV later turned out to be members of the Closterovirus genus within the Closteroviridae family with closely similar dRNA patterns. The large replicative form (RF) dsRNAs of BYV and CNFV were shorter than the RF of the

Reflections on CTV Methodologies

3

CTV-dsRNA molecules, as expected from the differences of their virus particle sizes. In addition to the RF molecules, several shorter dsRNA molecules were observed both for CTV and for BYV and CNFV. The ACLSV pattern of dsRNA molecules was slightly different with the major band(s) far more diffuse compared to the typical three Closterovirus [7]. With the emergence of the PCR technology, we embarked on an ambitious attempt to clone dsRNAs by ligating known oligonucleotide molecules to dsRNA ends and the use of the complementary oligonucleotides for cDNA synthesis and PCR amplification. With the failures we obtained experience and eventually cracked the main problem of oligo DNA ligation to RNA molecules. The other parts of the procedure were already common, and once the ligation protocol became workable, the method became generic allowing starting reverse transcription and amplification with specific primers corresponding to the chimeric ends. We published the detailed protocols in Methods of Molecular Biology [8], which unfortunately was discontinued shortly after our paper was published, and as a result the paper and the detailed protocol were lost to public attention. It’s interesting to note that the development of simple, rapid, and generic dsRNA extraction methods and molecular cloning allowed obtaining genomic data on more than 30 Closteroviridae, many of which are emerging and previously unrecognized disease agents of commercially important crop plants (see Chapter 2 in this volume).

Acknowledgment and Dedication My thanks and gratitude goes to my family and fellow friends with whom I was fortunate to collaborate through the years. This short biographical note was edited by Dr. W.O. Dawson and is dedicated to the memory of our dear friend and collaborator, Dr. Stephen M. Garnsey. References 1. Bar-Joseph M, Loebenstein G, Cohen J (1970) Partial purification of viruslike particles associated with the citrus tristeza disease. Phytopathology 60:75–78 2. Mawassi M, Mietkiewska E, Gofman R et al (1996) Unusual sequence relationships between two isolates of Citrus tristeza virus. J Gen Virol 77:2359–2364 3. Rosner A, Bar-Joseph M (1984) Diversity of citrus tristeza virus strains indicated by

hybridization with cloned cDNA sequences. Virology 139:189–193 4. Bar-Joseph M, Hull R (1974) Purification and partial characterization of sugar beet yellow virus. Virology 62:552–562 5. Bar-Joseph M, Garnsey SM, Gonsalves D (1979) The closteroviruses: a distinct group of elongated plant viruses. Adv Virus Res 25:93–168 6. Bar-Joseph M, Garnsey SM, Gonsalves D et al (1979) The use of enzyme-linked

4

Moshe Bar-Joseph

immunosorbent assay for detection of citrus tristeza virus. Phytopathology 69:190–194 7. Dodds JA, Bar-Joseph M (1983) Doublestranded RNA from plants infected with closteroviruses. Phytopathology 73:419–423

8. Wexler A, Mawassi M, Lachman O et al (1991) A procedure to amplify cDNA from dsRNA templates using the polymerase chain reaction. Methods Mol Cell Biol 2:273–279

Selected Additional Personal Publication List Bar-Joseph M, Frenkel H (1983) Spraying citrus plants with kaolin suspensions reduces colonization by the Spiraea aphid (Aphis citricola van der Goot). Crop Prot 2:371–374 Bar-Joseph M, Hull R (1974) Purification and partial characterization of sugar beet yellow virus. Virology 62:552–562 Bar-Joseph M, Loebenstein G (1973) Effects of strain, source plant, and temperature on the transmissibility of citrus tristeza virus by the melon aphid. Phytopathology 63:716–720 Bar-Joseph M, Malkinson M (1980) Hen egg yolk as a source of antiviral antibodies in the enzymelinked immunosorbent assay (ELISA): a comparison of two plant viruses. J Virol Methods 1:179–183 Bar-Joseph M, Smookler M (1976) Purification, properties and serology of carnation yellow fleck virus. Phytopathology 66:835–838 Bar-Joseph M, Loebenstein G, Cohen J (1972) Further purification and characterization of threadlike particles associated with the citrus tristeza disease. Virology 50:821–828 Bar-Joseph M, Josephs R, Cohen J (1977) Carnation yellow fleck virus particles “in vivo”. A structural analysis. Virology 81:144–151 Bar-Joseph M, Sacks JM, Garnsey SM (1978) Detection and estimation of citrus tristeza virus infection rates based on Elisa assays of packing house fruit samples. Phytoparasitica 6:145 Bar-Joseph M, Garnsey SM, Gonsalves D et al (1979) The use of enzyme-linked immunosorbent assay for detection of citrus tristeza virus. Phytopathology 69:190–194 Bar-Joseph M, Moscovitz M, Sharafi Y (1979) Reuse of coated enzyme-linked immunosorbent assay plates. Phytopathology 69:424–426 Bar-Joseph M, Sharafi Y, Moscovitz M (1979) Re-using the non-sandwiched antibody-enzyme conjugates of two plant viruses tested by enzyme-linked immunosorbent assay (ELISA). Plant Dis Rep 63:204–206 Bar-Joseph M, Rosner A, Moscovitz M et al (1983) A simple procedure for the extraction of double-stranded RNA from virus-infected plants. J Virol Methods 6:1–8

Bar-Joseph M, Gumpf DJ, Dodds JA et al (1985) A simple purification method for citrus tristeza virus and estimation of its genome size. Phytopathology 75:195–198 Bar-Joseph M, Filatov V, Gofman R et al (1997) Booster immunization with a partially purified citrus tristeza virus (CTV) preparation after priming with recombinant CTV coat protein enhances the binding capacity of capture antibodies by ELISA. J Virol Methods 67:19–22 Bar-Joseph M, Che X, Piestun D et al (2000) Citrus tristeza virus biology revisited: quick decline and seedling yellows—The cost of sour orange resistance gene(s). In: Proceedings of the International Society of Citriculture, IX International Citrus Congress Orlando, Florida, 3–7 December 2000. p 963–965 Batuman O, Mawassi M, Bar-Joseph M (2006) Transgenes consisting of a dsRNA of an RNAi suppressor plus the 30 UTR provide resistance to Citrus tristeza virus sequences in Nicotiana benthamiana but not in citrus. Virus Genes 33:319–327 Ben-Ze’ev IS, Bar-Joseph M, Nitzan Y et al (1989) A severe citrus tristeza virus isolate causing collapse of trees of sour orange before virus is detectable throughout the canopy. Ann Appl Biol 114:293–300 Che XB, Piestun D, Mawassi M et al (2001) 50 co-terminal subgenomic RNAs in citrus tristeza virus-infected cells. Virology 283:374–381 Che XB, Mawassi M, Bar-Joseph M (2002) A novel class of large and infectious defective RNAs of citrus tristeza virus. Virology 298:133–145 Che XB, Dawson WO, Bar-Joseph M (2003) Defective RNAs of citrus tristeza virus analogous to Crinivirus genomic RNAs. Virology 310:298–309 Dodds JA, Bar-Joseph M (1983) Double-stranded RNA from plants infected with closteroviruses. Phytopathology 73:419–423 Dulieu P, Bar-Joseph M (1989) Rapid isolation of double stranded RNA segments from disulphide cross linked polyacrylamide gels. J Virol Methods 24:77–83 Febres VJ, Ashoulin L, Mawassi M et al (1996) The p27 protein is present at one end of citrus

Reflections on CTV Methodologies tristeza virus particles. Phytopathology 86:1331–1335 Folimonov AS, Folimonova SY, Bar-Joseph M et al (2007) A stable RNA virus-based vector for citrus trees. Virology 368:205–216 Licciardello G, Raspagliesi D, Bar-Joseph M et al (2012) Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresissingle-strand conformation polymorphisms. J Virol Methods 181:139–147 Marcus R, Fishman S, Talpaz H et al (1984) On the spatial distribution of citrus tristeza virus disease. Phytoparasitica 12:45–52 Mawassi M, Karasev AV, Mietkiewska E et al (1995) Defective RNA molecules associated with citrus tristeza virus. Virology 208:383–387 Roistacher CN, Bar-Joseph M, Gumpf DJ (1984) Transmission of tristeza and seedling yellows tristeza virus by small populations of Aphis gossypii. Plant Dis 68:494–496 Rosner A, Bar-Joseph M (1984) Diversity of citrus tristeza virus strains indicated by hybridization with cloned cDNA sequences. Virology 139:189–193

5

Rosner A, Ginzburg I, Bar-Joseph M (1983) Molecular cloning of complementary DNA sequences of citrus tristeza virus RNA. J Gen Virol 64:1757–1763 Satyanarayana T, Bar-Joseph M, Mawassi M et al (2001) Amplification of citrus tristeza virus from a cDNA clone and infection of citrus trees. Virology 280:87–96 Short MN, Hull R, Bar-Joseph M et al (1977) Biochemical and serological comparisons between carnation yellow fleck virus and sugarbeet yellows virus protein subunits. Virology 77:408–412 Tatineni S, Robertson CJ, Garnsey SM et al (2008) Three genes of Citrus tristeza virus are dispensable for infection trees. Virology 376:297–307 Wexler A, Mawassi M, Lachman O et al (1991) A procedure to amplify cDNA from dsRNA templates using the polymerase chain reaction. Methods Mol Cell Biol 2:273–279 Yang G, Mawassi M, Gofman R et al (1997) Involvement of a subgenomic mRNA in the generation of a variable population of defective citrus tristeza virus molecules. J Virol 71:9800–9802

Reviews and Chapters Bar-Joseph M (2014) Closteroviridae: the beginning. Front Microbiol 5:14 Bar-Joseph M, Dawson WO (2008) Citrus tristeza virus. In: Mahy BWJ, van Regenmortel MHV (eds) Encyclopedia of virology, Evolutionary biology of viruses, vol 1, 3rd edn. Elsevier Ltd, Amsterdam, pp 161–184 Bar-Joseph M, Garnsey SM (1981) ELISA principles and applications for the diagnosis of plant viruses. In: Maramorosch K, Harris KF (eds) Plant diseases and vectors: ecology and epidemiology. Academic Press, New York/London, pp 35–39 Bar-Joseph M, Mawassi M (2013) The defective RNAs of Closteroviridae. Front Microbiol 4:132 Bar-Joseph M, Murant AF (1982) Closterovirus group. In: Descriptions of plant viruses Commonwealth Mycological Institute and Association of Applied Biologists, No 260 Bar-Joseph M, Garnsey SM, Gonsalves D (1979) The closteroviruses: a distinct group of elongated plant viruses. Adv Virus Res 25:93–168 Bar-Joseph M, Roistacher CN, Garnsey SM et al (1982) A review on tristeza, an ongoing threat to citriculture. In Proceedings of International Society of Citriculture, I: 419–423

Bar-Joseph M, Roistacher CN, Garnsey SM (1983) The epidemiology and control of citrus tristeza disease. In: Plumb RT, Thresh JM (eds) Plant virus epidemiology. Blackwell Scientific Publications, Oxford, UK, pp 61–72 Bar-Joseph M, Segev D, Blickle W et al (1986) Application of synthetic DNA probes for the detection of viroids and viruses. In: Developments in applied biology, pp 13–23 Bar-Joseph M, Marcus R, Lee RF (1989) The continuous challenge of Citrus tristeza virus control. Annu Rev Phytopathol 27:291–316 Bar-Joseph M, Yang Guang GR, Mawassi M (1997) Subgenomic RNAs: the possible building blocks for modular recombination of Closteroviridae genomes. Semin Virol 8:113–119 Bar-Joseph M, Batuman O, Roistacher CN (2010) The history of citrus tristeza virus-revisited. In: Karasev AV, Hilf M (eds) Citrus tristeza virus. APS Press, pp 3–26 Batuman O, Che XB, Yang G et al (2010) Interference or insurance? More questions than answers on the roles of the multiple defective RNAs of citrus tristeza virus. In: Karasev AV, Hilf M (eds) Citrus tristeza virus. APS Press, St. Paul, MN, pp 73–94

6

Moshe Bar-Joseph

Clark MF, Bar-Joseph M (1984) Enzyme immunosorbent assays in plant virology. Methods Virol 7:51–85 Dawson WO, Bar-Joseph M, Garnsey SM et al (2015) Citrus tristeza virus: making an ally from an enemy. Annu Rev Phytopathol 53:137–155 Garnsey SM, Bar-Joseph M, Lee RF (1981) Applications of serological indexing to develop control strategies for Citrus tristeza virus. In: Matsumoto K (ed) Proceedings of the International Society of Citriculture, International Citrus Congress, Tokyo, Japan, 9–12 November 1981. p 448–452 Karasev AV, Bar-Joseph M (2010) Citrus tristeza virus and taxonomy of closteroviruses. In:

Karasev AV, Hilf M (eds) Citrus tristeza virus. APS Press, St. Paul, MN, pp 119–1132 Lee RF, Bar-Joseph M (2000) Citrus tristeza virus. In: Timmer P, Garnsey SM, Graham JH (eds) Compendium of citrus diseases. APS, St. Paul, MN, pp 61–63 Lee RF, Bar-Joseph M (2003) Gcraft-transmissible diseases of citrus. In: Loebenstein G, Thottappily G (eds) Virus and virus-like diseases of major crops in developing countries. Kluwer Academic Publishers, Dordrecht, pp 607–639 Lister RM, Bar-Joseph M (1981) Closteroviruses. In: Kurstack E (ed) Handbook of plant virus infections: comparative diagnosis. Elsevier, Amsterdam, pp 809–844

Chapter 2 A Brief Historical Account of the Family Closteroviridae Giovanni P. Martelli Abstract The history is outlined of the steps that, starting from the establishment of the “taxonomic group Closterovirus,” have brought to the erection of the family Closteroviridae, a taxon comprising plant viruses that possess very long helically constructed filamentous particles and a positive-sense single-stranded, monopartite or bipartite RNA genome and are transmitted either by aphids (genus Closterovirus), pseudococcid mealybugs/soft scale insects (genus Vitivirus), or whiteflies (genus Crinivirus) or have no known vector (genus Velarivirus). Key words Ampelovirus, Crinivirus, Velarivirus, Genome, Evolution, Taxonomy

The purification and partial characterization of Beet yellows virus (BYV) [1] laid the bases for its designation as the type member of the “taxonomic group Closterovirus,” i.e., one of the clusters of plant viruses sharing major characterizing traits, which were used by plant virologists up to 1995 as a handy taxonomic category in place of the classical taxa. The “Closterovirus group” was officially recognized by the International Committee on Taxonomy of Viruses (ICTV) and included in its second report [2]. Its name is derived from the Greek “kloster” (thread) because of the size and appearance of the virions, i.e., very long, flexuous, and helically constructed filaments with open structure and conspicuous cross banding. In its initial composition (second ICTV Report), the “Closterovirus group” comprised 6 definitive and 2 putative members, a number that grew to 8 and 5, respectively, in the third ICTV Report [3], to 10 and 4 in the fourth ICTV Report [4], and to 10 and 12 in the fifth ICTV Report [5]. When, after a long debate [6], plant virologists agreed to classify plant viruses according to the taxonomic system family-genus-species already in use for viruses of

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_2, © Springer Science+Business Media, LLC, part of Springer Nature 2019

7

8

Giovanni P. Martelli

other organisms, at the Ninth International Congress on Virology (at Glasgow in 1993), upon the proposal of the Plant Virus Subcommittee of ICTV, the “Closterovirus group” was given the status of genus of which the name Closterovirus was retained [7]. The number of definitive species of this genus was reduced to 6, whereas putative and unassigned species grew to 20. Interestingly, the putative species were assembled in three groups according to their epidemiological behavior, i.e., whether they were vectored by aphids, mealybugs, or whiteflies, thus anticipating the structure of the future family Closteroviridae. This family was established in 2000 [8] and comprised two genera: Closterovirus (virions above 1000 nm in length, monopartite RNA genome) and Crinivirus (virions with two modal lengths, 650–850 nm and 700–900 nm, fractioned RNA genome). The genus Closterovirus had 11 definitive species clustering in three distinct groups transmitted either by aphids (seven species), whiteflies (one species), and mealybugs (two species). The vector of the 11th species, Grapevine leafroll-associated virus 2 (GLRaV-2), was unknown (and still is). Tentative species with known and unknown vectors were eight each. The genus Crinivirus had seven definitive species. Over time, the family Closteroviridae has been repeatedly reviewed and updated [9–23], also from the nomenclatorial point of view, with special reference to the grapevine-infecting species, whose confusing classification was straightened up and the Latin numerals in their names were changed into Arabic numerals [24]. Hence, by 2012 the family Closteroviridae included the genera Closterovirus (8 definitive and 8 putative species), Ampelovirus (8 definitive and 7 putative species), and Crinivirus (12 definitive and 2 putative species), plus three related viruses that were not assigned to genera [21]. In 1996, a virus denoted Grapevine leafroll-associated virus 7 (GLRaV-7) was identified in an Albanian grapevine cultivar [25]. This virus had the morphological and molecular properties of a Closterovirus [26] but did not have a recognized insect vector; thus it remained as an unassigned species in the family Closteroviridae. Further studies disclosed that GLRaV-7 was sufficiently distinct molecularly from the known members of this family, so as to warrant classification as the type species of a new genus which, as proposed by [27, 28] was given the name Velarivirus. This addition prompted a further revision of the family whose current structure consists of four genera comprising 29 definitive and 2 putative species (see Fig. 1): Ampelovirus (monopartite genome, 8 species

The Closteroviridae Family

Clo oaV

FMM

OLYaV

ste

rov

iru

s

BYV CYLV

s iru

MV-1

v

i rin

V-2 Ra SV GL BY

9

TICV LIYV

C

CTV

BYVaV RLMoV

BPYV PYVV

SCFaV

LCV

1000

1000

BYDV 997

CYSDV

MVBaV 976

1000

ToCV

Outgroup

LChV-1

PBNSPaV GLRaV-4

CoV-1

Ve

GLRaV-7

lar

ivir

us

PMWaV-1 PMWAV-2 GLRav-3 LChV-2 GLRav-1

PMWaV-3

p ou

II

gr

b Su

Subgroup I 0.1

virus

Ampelo

Fig. 1 Current composition of the family Closteroviridae (from Martelli et al., 2012)

in 2 subgroups), Closterovirus (monopartite genome, 9 species), Velarivirus (monopartite genome, 3 species), and Crinivirus (bipartite genome, 8 species; tripartite genome, 1 species, i.e., Potato yellow vein virus) [29] (see Fig. 2) (Table 1). The biological and molecular complexity of the family Closteroviridae results from its modular evolution [30] that encompassed a series of successive modifications of the viral genomes, e.g., splitting (bipartition), gene duplication, loss of sequences through deletion, or their acquisition from external sources such as other viruses and/or other organisms, including host plants.

10

a

Giovanni P. Martelli

Genus Ampelovirus (Subgroup I)

GLRaV-3 (18,498 nt)

HSP70h

p6

HEL

p21

p20

p7

CP P-Pro MTR

POL

AlkB

CPm

p5

p55

p20

Genus Ampelovirus (Subgroup II) GLRaV-4 (ca. 13,700 nt)

p5

HEL

P-Pro MTR

AlkB

p4

CP HSP70h

POL

p60

p23

Genus Velarivirus GLRaV-7 (16,404 nt)

p4

HEL

CPm p25

HSP70h P-Pro MTR

b

POL

p10

p64

CP

p27

Genus Crinivirus LIYV RNA-1 (8,118 nt) P31 P-Pro

MTR

Pol

HEL

LYYV RNA-2 (7,193 nt) p5

HSP70h

P26

CP CPm

p59 p9

Fig. 2 (a) Schematic representation of the genome organization of Grapevine leafroll-associated virus 3 (GLRaV-3) and Grapevine leafroll-associated virus 4 (GLRaV-4) representatives of the genus Ampelovirus subgroup I and subgroup II, respectively, of the genus Ampelovirus and of Grapevine leafroll-associated virus 7 (GLRaV-7), a representative of the genus Velarivirus. Legend of major expression products: P-Pro papain-like protease, MTR methyltransferase, HEL helicase, POL RNA-dependent RNA polymerase, HSP70h heat shock protein homologue, C coat protein, CPm minor coat protein. (b) Schematic representation of the genome organization of Lettuce infectious yellows virus (LIYV), a representative of the genus Crinivirus. Legend of major expression products: P-Pro papain-like protease, MTR methyltransferase, HEL helicase, POL RNA-dependent RNA polymerase, HSP70h heat shock protein homologue, C coat protein, CPm minor coat protein

The Closteroviridae Family

11

Table 1 Current taxonomic layout of the family Closteroviridae Genus Closterovirus Approved species Beet yellows virus (BYV) Beet yellow stunt virus (BYSV) Burdock yellows virus (BuYV) Carnation necrotic fleck virus (CNFV) Carrot yellow leaf virus (CYLV) Citrus tristeza virus (CTV) Grapevine leafroll-associated virus 2 (GLRaV-2) Mint virus 1 (MV-1) Raspberry leaf mottle virus (RLMoV) Strawberry chlorotic fleck-associated virus (SCFaV) Wheat yellow leaf virus (WYLV)

Genome size (nucleotides) 15,480 10,545 (partial sequence) ND 15,602 16,354 19,296 16,486 15,540 17,481 17,039 ND

Putative species Alligator weed stunting virus (AWSV) Clover yellows virus (CYV) Dendrobium vein necrosis virus (DVNV) Festuca necrosis virus (FNV) Fig leaf mottle-associated virus-1 (FLMaV-1) AM279676∗, KC914285∗ Fig mild mottle virus (FMMV)

16,292

Genus Ampelovirus (subgroup I) Grapevine leafroll-associated virus 1 (GLRaV-1) Grapevine leafroll-associated virus 3 (GLRaV-3) Little cherry virus 2 (LChV-2) Pineapple mealybug wilt-associated virus 2 (PMWaV-2)

18,659 18,498 15,045 14,861

Genus Ampelovirus (subgroup II) Grapevine leafroll-associated virus 4 (GLRaV-4) Pineapple mealybug wilt-associated virus 1 (PMWaV-1) Pineapple mealybug wilt-associated virus 3 (PMWaV-3) Plum bark necrosis stem pitting-associated virus (PBNSPaV)

13,830 13,071 11,872 14,214

Genus Crinivirus Approved species Abutilon yellows virus (AbYV) Bean yellow disorder virus (BYDV) Beet pseudo-yellows virus (BPYV) Blackberry yellow vein-associated virus (BYVaV) Cucurbit yellow stunting disorder virus (CYSDV) Cucurbit chlorotic yellows virus (CCYV) Diodia vein chlorosis virus (DVCV) Lettuce chlorosis virus (LCV) Lettuce infectious yellows virus (LIYV) Potato yellow vein virus (PYVV) Strawberry pallidosis-associated virus (SPaV) Sweet potato chlorotic stunt virus (SPCSV) Tomato chlorosis virus (ToCV) Tomato infectious chlorosis virus (TICV)

ND ND ND ND

8965/8530 8006/7903 7800/7916 9123/7976 8607/8041 8.010/8220 8591/8556 8118/7193 8035/5339/3892 8066/7978 9407/8223 8594/8242 8271/7913 (continued)

12

Giovanni P. Martelli

Table 1 (continued) Genus Velarivirus Approved species Cordyline virus 1 (CoV-1) Grapevine leafroll-associated virus 7 (GLRaV-7) Unassigned species in the family Mint vein banding-associated virus (MVBaV) Olive leaf yellowing-associated virus (OLYaV)

16,883 16,934 13,387 (partial sequence) 4605 (partial sequence)

ND not determined

References 1. Bar-Joseph M, Hull R (1974) Purification and partial characterization of sugar beet yellows virus. Virology 62:552–562 2. Fenner F (1976) Classification and nomenclature of viruses. Second report of the International Committee on Taxonomy of Viruses. Intervirology 7:115 3. Matthews REF (1979) Classification and nomenclature of viruses. Third Report of the International Committee on Taxonomy of Viruses. Intervirology 12:160 4. Matthews REF (1982) Classification and nomenclature of viruses. Fourth report of the International Committee on Taxonomy of Viruses. Intervirology 17:199 5. Francki RIB, Fauquet CM, Knudson DL et al (1991) Classification and nomenclature of viruses. Fifth report of the International Committee on Taxonomy of Viruses. Arch Virol Suppl 2:450 6. Martelli GP (1992) Classification and nomenclature of plant viruses: state of the art. Plant Dis 76:436–442 7. Candresse T, Martelli GP (1995) Genus Closterovirus. In: Murphy FA, Fauquet CM, Bishop DHL, Ghabrial SA, Jarvis AW, Martelli GP, Mayo MA, Summers MD (eds) Virus taxonomy, fourth report of the International Committee on Taxonomy of Viruses. Springer, Vienna, pp 461–464 8. Martelli GP, Agranovsky AA, Bar-Joseph M et al (2000) Family Closteroviridae. In: van Regenmortel MHV, Fauquet CM, Bishop DHL, Carstens EB, Estes MK, Lemon SM, Maniloff J, Mayo MA, McGeoch DJ, Pringle CR, Wickner RB (eds) Virus taxonomy. Seventh report of the International Committee on Taxonomy of Viruses. Academic Press, San Diego, CA, pp 943–952

9. Bar-Joseph M, Garnsey SM, Gonsalves D (1979) The closteroviruses: a distinct group of elongated plant viruses. Adv Virus Res 25:93–168 10. Lister RM, Bar-Joseph M (1981) Closteroviruses. In: Kurstak E (ed) Handbook of plant virus infections and comparative diagnosis. Elsevier/North Holland Biomedical Press, Amsterdam, pp 810–844 11. Bar-Joseph M, Murant AF (1982) Closterovirus group. CMI/AAB descriptions of plant viruses No. 260 12. Francki RIB, Milne RG, Hatta T (1985) Closteroviruses. In: Atlas of plant viruses, vol 2. CRC Press, Boca Raton, FL, p 219 13. Dolja VV, Karasev AV, Koonin EV (1994) Molecular biology and evolution of closteroviruses: sophisticated build-up of large RNA genomes. Annu Rev Phytopathol 32:261–285 14. Dolja VV, Kreuze JF, Valkonen JP (2006) Comparative and functional genomics of closteroviruses. Virus Res 117:38–51 15. Coffin RS, Coutts RHA (1993) The closteroviruses, capilloviruses and other similar viruses: a short review. J Gen Virol 74:1475–1483 16. German-Retana S, Candresse T, Martelli GP (1999) Closteroviruses. In: Webster RG, Granoff A (eds) Encyclopedia of virology, 2nd edn. Academic Press, New York, NY 17. Agranovsky AA (1996) Principles of molecular organization, expression and evolution of closteroviruses: over the barriers. Adv Virus Res 47:119–158 18. Agranovsly AA (2016) Closteroviruses: molecular biology, evolution and interactions with cells. In: Gaur RK, Petrov NM, Patil BL, Stoyanova MI (eds) Plant viruses: evolution and management. Springer, Vienna, pp 231–252

The Closteroviridae Family 19. Karasev AV (2000) Genetic diversity and evolution of Closteroviruses. Annu Rev Phytopathol 38:293–324 20. Martelli GP, Agranovsky AA, Bar-Joseph M et al (2002) The family Closteroviridae revised. Arch Virol 147:2039–2044 21. Martelli GP, Agranovsky AA, Bar-Joseph M et al (2012a) Family Closteroviridae. In: King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ (eds) Virus taxonomy. Ninth report of the International Committee on Taxonomy of Viruses. Elsevier-Academic Press, Amsterdam, pp 987–1001 22. Martelli GP, Abou Ghanem-Sabanadzovic N, Agranovsky AA et al (2012b) Taxonomic revision of the family Closteroviridae with special reference to grapevine leafroll-associated members of the genus Ampelovirus and the putative species unassigned to the family. J Plant Pathol 4:7–19 23. Martelli GP, Candresse T (2010) Closteroviridae. In: Encyclopedia of life sciences (eLS). Wiley, Chichester 24. Boscia D, Graif C, Gugerli P et al (1995) Nomenclature of grapevine leafroll-associated putative closteroviruses. Vitis 34:171–175 25. Choueiri E, Boscia D, Digiaro M et al (1996) Some properties of a hitherto undescribed filamentous virus of the grapevine. Vitis 35:91–93

13

26. Mikona C, Turturo C, Navarro B, et al (2009) Taxonomy, complete nucleotide sequence and genome organization of grapevine leafrollassociated virus 7. In: Proceedings 16 meeting of ICVG, Dijon, France, pp 275–277 27. Al Rwahnih M, Dolja VV, Daubert S et al (2012) Genomic and biological analysis of Grapevine leafroll-associated virus 7 reveals a possible new genus within the family Closteroviridae. Virus Res 163:302–309 28. Al Rwahnih M, Saldarelli P, Rowhani A (2017) Grapevine leafroll-associated virus 7. In: Meng B, Martelli GP, Golino DA, Fuchs M (eds) Grapevine viruses: molecular biology, diagnostics and management. Springer International Publishing AG, Cham, pp 221–228 29. Livieratos IC, Eliasco E, Mu¨ller G et al (2004) Analysis of the RNA of Potato yellow vein virus: evidence for a tripartite genome and conserved 30 -terminal structures among members of the genus Crinivirus. J Gen Virol 85:2065–2075 30. Dolja V, Karasev A, Koonin E (1994) Molecular-biology and evolution of closteroviruses–sophisticated buildup of large RNA genomes. Annu Rev Phytopathol 32:261–285

Chapter 3 Phenotyping Biological Properties of CTV Isolates Marcella Russo and Antonino F. Catara Abstract The protocol described is intended to be used alongside molecular methods in order to reveal the relationship between the genome sequence and the biological properties of a single isolate of Citrus tristeza virus complex (CTV). It enables the phenotypic profile of the isolates to be defined and to infer the associated tristeza diseases (decline, seedling yellows, or stem pitting), to assess their aggressiveness or potential cross protectiveness (if any), and to monitor their movement into the host plants and the transmissibility by aphids. Key words Indicator plants, Biological indexing, Graft inoculation, Mechanical inoculation, Leaf disc inoculation, Cross protection

1

Introduction Citrus tristeza virus (CTV) is a phloem-limited Closterovirus that causes three major diseases on citrus hosts: tristeza (decline), stem pitting (SP), and seedling yellows (SY) [1, 2]. Its severity is variable in terms of (a) the host infected, (b) the mixture of genotypes, and (c) biotic and abiotic factors of stress acting on the plant. The decline involves quick or slow wilting until death of different Citrus and Fortunella species grafted on sour orange, a scion/ stock combination that causes a bud-union disorder. The majority of CTV isolates lead to a decline when they infect this susceptible stionic combination. However, they do not systemically affect trifoliate orange and its hybrids (as citranges and citrumelo). A few recombinant isolates, anyway, known as resistance-breaking (RB) isolates can overcome this resistance and are able to replicate and systemically invade host plants [3]. The stem pitting is caused by a malfunctioning of cambium in susceptible species. It affects both rootstock and grafted varieties, which show the development of pits in the wood, associated with the decreased vigor of trees, dwarfing, reduced fruit yield, and poor quality. It may cause deep grooving of the trunk and limbs of

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_3, © Springer Science+Business Media, LLC, part of Springer Nature 2019

15

16

Marcella Russo and Antonino F. Catara

susceptible rootstocks and varieties such as rough lemon, alemow, grapefruit, and selected sweet oranges [4]. The term seedling yellows is derived from the general yellowing and stunting of the seedlings of sour orange, lemon, and grapefruit, under greenhouse conditions or when are top-grafted on infected sour orange [4]. Attempts to correlate the biological properties of representative isolates with their molecular differences have been made many times [4–7]. However, extensive sequencing and biological assays have demonstrated that slight differences in a sequence can lead to important changes in the phenotype of the disease [4, 8]. CTV isolates assigned to a particular strain can differ notably in their capacity to induce specific symptoms. Even small mutations in specific regions may cause a different phenotype [8, 9]. In addition, CTV-infected plants may contain mixed virus populations and/or a pool of sequence variants [8, 10], which cause additional effects that are not easily distinguishable. Although some associations between symptoms, CTV genotypes, and reactions to the selective monoclonal antibody MCA13 [11] have been observed, absolute correlations have not been established [6, 8]. Even the analysis of the relevant parts of the CTV sequence, or the entire genome, is of limited value in terms of predicting the pathogenic properties of CTV isolates [3, 12]. However, they are helpful in identifying molecular and phylogenetic correlations between CTV genotypes [8]. Therefore, appropriate biological assays are needed to gain a complete genetic and biological pattern of each isolate [6, 13]. It has also been clearly demonstrated that biological assays are the most accurate way of identifying the aggressiveness and pathogenicity of viruses (see Note 1). They are essential when studying cross protection or using it to inoculate seedlings in the nursery or to propagate cross-protected mother trees. Host plants also seem to be particularly suited to separating individual genotypes by single aphid transmission or passaging through selective citrus hosts, thus enabling the biological and molecular characterization of the resulting isolates. This phenotyping is frequently used in parallel to molecular testing protocols such as SSCP [14], CE-SSCP [15], and NGS [16], to help in better understanding the characteristics of CTV isolates. This chapter describes techniques and protocols to assess the biological properties of the CTV isolates, to infer the associated tristeza diseases (decline, seedling yellows, or stem pitting), and to assess their aggressiveness or potential cross protectiveness (if any). The methodology allows also monitoring the movement of the virus into the host plants and its transmissibility by aphids.

Phenotyping CTV Isolates

2 2.1

17

Materials Basic Facilities

1. All the biological tests to characterize CTV isolates should be performed in an insect-proof greenhouse, screen house, or a controlled environment (see Note 2). 2. A standardized plant growth medium that absorbs and releases macro- and micronutrients and maintains the pH of the drainage water at 5.5 to 6.5. As reference, soil mixes based on 50% Canadian peat moss and 50% fine sand, with the addition of macro- and micronutrients, are recommended [17, 18] (see Note 3).

2.2

Plant Materials

1. Six- to ten-month-old seedlings or budlings derived from seedling lines grafted on vigorous rootstocks (alemow, rough lemon, or volkameriana lemon) grown in containers filled with a selected mix of sterilized soil (see Note 4) [6, 19, 20]. (a) Basic indicators. – Mexican lime (Citrus aurantifolia). – Sour orange (C. aurantium). – Duncan grapefruit (C.paradisi). – Madame Vinous (C. sinensis).

(or

Pineapple)

sweet

orange

– 8–10-month-old sweet orange budlings grafted onto sour orange rootstock. (b) Optional indicators. – C. excelsa. – Citron (C. medica). – Alemow (C. macrophylla). 2. With the exception of the Mexican lime, all plants, whether seedlings or grafted, must be trained as a single shoot (see Note 5). 2.3

Virus Isolates

1. Biologically characterized isolates of different strains of CTV (T30, VT, T3,T68, T36, and RB) maintained on donor plants, preferably Etrog citron or sweet orange grafted onto a vigorous rootstock (rough lemon, alemow, volkameriana lemon), to be used as positive controls. 2. Alternatively, desiccated and/or frozen leaf and/or bark tissue from plants infected with biologically characterized CTV isolates.

2.4 Grafting and Budding Inoculation

1. Knife or razor blades. 2. Paper hole punch.

18

Marcella Russo and Antonino F. Catara

3. 1% (v/v aq) sodium hypochlorite (see Note 6). 4. Budding tape or Parafilm. 5. Inoculum sources. 6. Polythene bags. 7. Ice chest. 8. Refrigerator 5–6  C. 2.5 Mechanical Transmission

1. Extraction buffer (0.05 M Tris–HCL buffer, pH 7.8 supplemented with 100 mg/L sucrose and 2 μL/mL of 2-mercaptoethanol. 2. Tissue homogenizer. 3. Knife or razor blades. 4. Pipettes. 5. Dry ice. 6. Parafilm or self-adhesive tape. 7.

3

80  C freezer.

Methods

3.1 Seedling Preparation

1. Unless citrus seeds have been purchased, they should be extracted from mature fruit, rinsed thoroughly in water, and planted as soon as possible or stored in a refrigerator (see Note 7). 2. Seeds should be planted at a depth of 1/4 to 1/2 in. in suitable pots or flats containing sterile potting media (see Note 8). 3. Under ideal conditions of sunlight, soil temperatures, and moisture, emergence will likely begin about 10–15 days after planting. 4. Plants should be trained to a single stem (no branches within 6–8 in. of the soil).

3.2 Grafting and Budding Inoculation

1. Budding is carried out when seedling stems are about 6–8 mm in diameter (about 6 in. above ground), the bark is slipping, and budwood inoculum is suitable. 2. Buds (or blind buds) used for the inoculum preparation should be taken from donor plants that are in good shape, avoiding excessively hot weather (see Note 9). 3. Select round budwood (not angular as young wood is less suitable), approximately the same diameter as the rootstock stem to be budded, with well-formed buds in the leaf axils. Remove leaves and thorns, but leave petioles attached, label, pack in a plastic bag, and maintain in an ice chest.

Phenotyping CTV Isolates

19

4. Take the inoculum from the budwood. When the bark of the receptor host does not come off, so that the plant can be grafted with a regular bud or blind bud, chip buds should be used (which include a small portion of wood). For a proper evaluation of biological properties, graft-inoculate buds or bark on seedlings or budlings of indicator plants: – Mexican lime reaction allows detecting all types of tristeza. – Grapefruit, as an initial index for stem pitting (SP-CTV) and/or seedling yellows (SY-CTV). – Sweet orange to test for SP biotype. – Sour orange to evaluate the development of seedling yellows’ symptoms. – Sweet orange grafted on sour orange for the decline syndrome (stunting and chlorosis) associated with bud-union phloem necrosis. 5. Make a T-cut into the stem bark of the receptor plant to be inoculated, open the upper portion at the top of the T-cut, and insert the bud or blind bud (see Fig. 1b–c). 6. Put two inoculums (buds or leaf pieces) in the lower part of each indicator, making sure that the cut surfaces of phloem tissue of donor and receptor plants are in correct contact (see Fig. 1c). 7. Secure the inoculum buds to the stem by tightly wrapping with Parafilm including the eye (see Fig. 1a). 8. Remove leaves from the lower stems, and cut back the seedlings to 20–25 cm from the soil. 9. If a sweet orange budling on sour orange rootstock is used to assay the bud-union effect of the CTV, both propagation of the scion and inoculation of the rootstock can be performed simultaneously (see Note 10). 10. Add positive and negative controls as references. Use two plants inoculated with a mild and two with a severe CTV isolate to check possible side effects of biotic or abiotic factors (see Note 11). 11. Leave side shoots of the Mexican lime plants in order to increase the number of leaves enabling vein clearing detection (see Note 12). Trim lateral shoots of the other indicators to observe seedling yellows and stem-pitting phenotypes (see Note13). 12. Apply liquid fertilizers with each watering (see Note 14). Prevent salinity buildup by overwatering periodically. 13. Plan a balanced and thorough pest control program to prevent damage by insects or mites or by pesticide sprays, which could impair symptom reading (see Note 15).

20

Marcella Russo and Antonino F. Catara

Fig. 1 Different types of indicator plants’ inoculation: (a) multiple buds inoculated seedling wrapped with Parafilm; (b) removal of blind bud to be used as inoculum from donor plant; (c) blind bud inoculum inserted into the stem bark of the receptor plant after a T-cut; (d) leaf-piece graft of a receptor plant; (e, f) leaf grafting by a disc taken from the midrib section of an inoculum source plant is grafted into the leaf of a receptor plant and fastened with adhesive tape

3.3

Leaf-Piece Graft

1. Put leaf pieces (about 2 by 10 mm) taken from young immature leaves under flaps cut on the bark of receptor plant, as done for buds (see Fig. 1d). Two inoculations per plant are recommended. Wrap with Parafilm as done with buds. 2. Cut the wrapping film 2 or 3 weeks after inoculation to check for survival. If both leaf inoculums are dead, reinoculate the plant or inoculate a new plant. After some time, the leaf piece of a successful graft can be seen to expand and grow inside the T-cut (see Note 16).

Phenotyping CTV Isolates

3.4

Leaf Grafting

21

1. Prepare the inoculum by cutting a disc from the midrib section of a moderately mature (or mature) leaf using a paper hole punch. Place the discs on a slightly moistened tissue paper with the top leaf surface facing up. At least five discs are recommended to inoculate each plant (see Fig. 1e, f). 2. Punch a hole in each of five moderately mature or mature leaves of the receptor test plant, which are not too young. 3. Put a piece of adhesive tape on the bottom of each hole of the receptor leaf, and carefully insert the cut discs into it with a dissecting needle, with the top leaf up. Take care to align the midribs as well as possible and the disc matches carefully to the hole. Place another piece of adhesive tape above the leaf, and firmly press into place (see Fig. 1e, f). 4. Check for graft survival after 1–2 weeks. If three or more of the five grafts will turn brown, repeat the inoculations.

3.5 Mechanical Transmission

1. Slash the stem bark of the donor plant with a knife or razorblade and then the stem of the receptor plant (citrus to citrus or citrus to herbaceous plants), repeating 40 or more times. 2. Alternatively, apply a drop of an extract of bark tissue finely diced in a 0.1 M Na2SO4 titrated to pH 8.1 with KH2PO4 and placed on the knife blade used to make the inoculation cuts [21] or of a partially purified extract from young bark tissue [22] (see Note 17). 3. Prune and wrap tightly the receptor plant with Parafilm.

3.6 Testing CrossProtective Isolates

1. Select potential cross-protective source of CTV: choose the best-looking surviving CTV infected trees in highly CTV-infected areas or symptomless seedlings aphid infected in highly infected areas (see Note 18). Alemow is a very attractive host for aphids. 2. Inoculate-blind buds of each candidate protective source into Mexican lime or into sour orange seedlings (use very mild reference controls). 3. Graft-transfer the isolates that produce very mild or slight vein clearing and stem pitting to receptor plants (such as citron or alemow). 4. Graft-inoculate sweet orange and grapefruit budlings on sour orange with the (potentially) protective isolate. 5. After the (protective) bud takes, challenge by graft-inoculation each source with severe CTV isolates. Leave the same number of plants without challenge inoculation. 6. Check the bud-take at 2 weeks after graft challenge, and reinoculate if buds have died. 7. Compare growth for at least 6 months with unchallenged plants.

22

Marcella Russo and Antonino F. Catara

3.7 Symptom Assessment

1. Record the experiment number, date of inoculation, source of the inoculum, indicator plants, inoculum survival rate, reading dates, and observation notes (see Note 19). The relative tristeza phenotype detection is based on symptoms’ indicators. 2. Discontinuous translucent vein clearing in the leaves of Mexican lime is expected within 5 weeks post inoculation, if the right temperature and new flush growth are ensured. The underside of leaves will usually show “water-soaked” areas, persistent in mature leaves. Use representative isolates of the genetic structure of local population of the virus as appropriate reference (see Note 20). Mild vein clearing is also observed in the leaves of alemow (see Fig. 2a).

Fig. 2 Different reactions of indicator plants to CTV isolates: (a) vein clearing on alemow; (b) vein corking on Mexican lime inoculated with an aggressive isolate; (c) leaf yellowing and short internodes of sour orange seedlings inoculated with CTV; (d–f) stem pitting on alemow, grapefruit, and citron, respectively

Phenotyping CTV Isolates

23

3. Mexican lime and alemow may show stem pitting 4–6 months after inoculation since vein clearing appears in the leaves by peeling the bark (see Note 21). If pitting is evident, score the severity of pits on a scale of 0–3 (none, mild, moderate, or severe) (see Fig. 2d–f). 4. After seedling yellows is detected in the grapefruit indicator, sub-inoculate sour orange and sweet orange seedlings to determine the severity of the CTV-SY or CTV-SP isolate. Smaller, chlorotic, or yellow leaves, with pointed tips and shorter internodes, giving the plant a severe or mild stunting, usually characterize seedling yellows (see Fig. 2c). Eureka or Lisbon lemon is equally excellent supplemental indicators of CTV-SY as sour orange. They will very rarely show stem-pitting symptoms (see Note 22). 5. Leaf-cupping symptoms are usually associated with severe CTV isolates or when plants are grown at cool temperatures and under good growth conditions. They usually remain after the leaf matures or hardens (see Note 23). 6. Vein corking, very similar to symptoms induced by boron deficiency, may be observed on the veins of Mexican lime, sweet orange, or grapefruit in the cases of severe isolates of CTV-SY (see Fig. 2b). 3.8

Termination

1. Once Mexican lime shoots are well developed (about 6 months after inoculation), check if any pit is present in the stem of the positive control plants inoculated with a mild isolate by peeling the bark. If no pitting is evident, cut back to force new shoots and repeat the evaluation. 2. Symptoms of CTV-SY appear within 3 months after inoculation or somewhat longer in the case of mild isolates. Some isolates may show severe pitting without yellowing in grapefruit or sweet orange. Therefore, positive stem-pitting controls are important to decide when the tests might be terminated. 3. Sour orange rarely shows stem pitting and does not need to be peeled in routine indexing. The test on sour orange terminates when the milder-reacting seedling yellows’ positive controls show definitive symptoms (about 4 months after inoculation).

4

Notes 1. A detailed description of the biological assays of citrus viruses when molecular characterization was at its beginning was published by Roistacher [19]. Many symptoms of picture of host response to inoculation are available [23].

24

Marcella Russo and Antonino F. Catara

2. Proper prevention measures should be adopted to exclude insects entering. Doors and doorways should use a positive pressure air curtain or double doors. All exterior openings (cooling pads, fans, vents) should be covered with an insectproof screen not exceeding 0.3 square millimeters. Flooring should be in gravel and well drained, with strict sanitation measures. Temperatures should be controlled (17–21  C minimum at night and 24–28  C maximum during the day). 3. Other acid peat mosses (pH 3.5), perlite, or vermiculite can be tried. A fine sand or silt, with a particle size from 0.05 to 0.5 mm, is preferred. The sand should be inert and preferably siliceous, without clay. Calcareous or limestone sands may negatively affect the pH. Steams sterilize the soil mixture for about 15 min to control soil-borne pathogens. 4. Plastic containers 15 cm in diameter are suitable for a 1–2 year growth of plants. Those deeper are preferable to allow a correct root development. 5. When using the Mexican lime allow all shoots to develop for the first three growth flushes, then prune and train as a single shoot. Grapefruit, sour orange, and sweet orange seedlings must be trained as a single leader or shoot, starting with the first dominant emerging shoot. Supplemental lighting during the winter increases the production of leaves and enhances symptom expression [24]. 6. Sterilize collecting tools (clippers, knives, etc.) by dipping in a 1.0% sodium hypochlorite solution, made up fresh each day, for a few seconds. Do NOT use alcohol. 7. After extraction, wash seeds thoroughly with soapy water to free from pulp. Dip in hot water for 10 min at 52  C and then in cool water. Disinfect with a powdered fungicide (such as thiram) or by dipping in a 1% solution of 8-hydroxy quinoline sulfate. Air-dry under shade conditions on paper or on a finemesh screen turning frequently. Place in polyethylene bags and store at 4–8  C [25]. 8. By removing the seed coats, or soaking seeds in aerated water for about 8 h immediately prior to planting, can reduce the time required for germination and seedling emergence. 9. When collecting bud sticks, put into polythene bags, cool in an ice chest, and store into a refrigerator at 5–6  C for no longer than 2 weeks. 10. Depending on the vigor of the plants, cut at the time of inoculation or 2–3 weeks afterward. To promote rapid forcing of the scion bud, bend the sour orange just above the scion bud. 11. The mildest reacting isolate that induces very few leaf or stempitting symptoms in Mexican lime should be used.

Phenotyping CTV Isolates

25

12. Trim the side shoots, after the third growth flush, tie the most vigorous terminal shoot to a stake, and train to grow as a single shoot for later examination for stem pitting. 13. Although tristeza is not readily transmitted mechanically, it should be a standard procedure to dip all tools in a 1.0% sodium hypochlorite solution prior to cutting any plant. 14. Nauer et al. [18] suggest mixing 9 (dry) parts NH4NO3 + 3.75 parts Ca(NO3)2 + 2.75 parts KNO3 and applying at the rate of 67.5 g of mixture to 100 L water (9 oz. per 100 gallons). 15. Keep insects and mites under control by periodic inspection and good pesticide treatments. Avoid the introduction into the greenhouse of plant material from the field, examine carefully for pests, cut back to a minimum number of leaves, and spray with a pesticide. 16. The bark should separate readily in order to permit easy entry of the leaf-piece inoculum into the T-cut. 17. Take fresh tissue bark powder in dry ice in 0.1 M Tris buffer, filter through cheesecloth and partially clarify by low-speed centrifugation. Add PEG 6000 and NaCl to the supernatant and centrifuge. Collect the precipitate, repeat the centrifugation and the PEG precipitation, and resuspend the pellet in 0.015 M potassium phosphate, pH 8. 18. Cross protection, the phenomenon that occurs when a symptomless isolate prevents the expression of the symptoms of an aggressive severe isolate of the same virus, has been successfully tested in many countries against tristeza stem-pitting disease [26]. 19. Records should include temperature and light conditions in which indexing is performed. 20. Vein clearing is manifest if the sunlight shines directly through the leaf. Under shaded conditions, mild symptoms are better detected if plants are taken out into direct sunlight. Veinclearing symptoms induced by some mild-reacting isolates may be difficult to see and do not persist. Observe new flushes of plants frequently. 21. Steaming the stems in an autoclave helps to lose tight bark. 22. Almost any seedling of any variety can show pits by some specific CTV isolate. Mexican lime, alemow, citron, and grapefruit may show severe pits, whereas sweet orange shows symptoms only when infected with specific isolates. 23. Note that leaf cupping is also a symptom induced in the leaves of Mexican lime seedlings by the vein enation virus and, therefore, if not associated with other symptoms, may not be of diagnostic value for tristeza disease.

26

Marcella Russo and Antonino F. Catara

References 1. Moreno P, Garnsey SM (2010) Citrus tristeza diseases-A worldwide perspective. In: Karasev AV, Hilf ME (eds) Citrus tristeza virus complex and tristeza diseases. APS Press, St. Paul, MN, pp 27–49 2. Dawson WO, Garnsey SM, Tatineni S et al (2013) Citrus tristeza virus–host interactions. Front Microbiol 4:88. doi: 10.3389/ fmicb.2013.00088 3. Harper SJ, Dawson TE, Pearson MN (2010) Isolates of Citrus tristeza virus that overcome Poncirus trifoliata resistance comprise a novel strain. Arch Virol 155:471–480 4. Moreno P, Ambros S, Albiach-Marti MR et al (2008) Citrus tristeza virus: a pathogen that changed the course of the citrus industry. Mol Plant Pathol 9:251–268 5. Hilf ME, Mavrodieva VA, Garnsey SM (2005) Genetic marker analysis of a global collection of isolates of Citrus tristeza virus: characterization and distribution of CTV genotypes and association with symptoms. Phytopathology 95:909–917 6. Garnsey SM, Civerolo EL, Gumpf DJ et al (2005) Biological characterization of an international collection of Citrus tristeza virus (CTV) isolates. In: Hilf ME, Duran-Vila N, ˜ a MA (eds) Proceedings of the Rocha-Pen 16th Conference of the International Organization of Citrus Virology IOCV, Riverside, CA, pp 75–93 7. Roy A, Brlansky RH (2009) Population dynamics of a Florida Citrus tristeza virus isolate and aphid-transmitted subisolates: identification of three genotypic groups and recombinants after aphid transmission. Phytopathology 99:1297–1306 8. Harper SJ (2013) Citrus tristeza virus: evolution of complex and varied genotypic groups. Front Microbiol 4:93. doi: 10.3389/ fmicb.2013.00093 9. Varveri C, Olmos A, Pina JA et al (2014) Biological and molecular characterisation of a distinct Citrus tristeza virus isolate originated from a lemon tree in Greece. Plant Pathol 64:792–798 10. Rubio L, Ayllon MA, Kong P et al (2001) Genetic variation of Citrus tristeza virus isolates from California and Spain, evidence for mixed infections and recombination. J Virol 75:8054–8062 11. Permar TA, Garnsey SM, Gumpf DJ et al (1990) A monoclonal antibody that discriminates strains of Citrus tristeza virus. Phytopathology 80:224–228

12. Bar-Joseph M, Batuman O, Roistacher C (2010) The history of Citrus tristeza virus— Revisited. In: Karasev AV, Hilf ME (eds) Citrus tristeza virus complex and tristeza diseases. APS Press, St. Paul, MN, pp 3–26 13. Wang JB, Bozan O, Kwon SJ et al (2013) Past and future of a century old Citrus tristeza virus collection: a California citrus germplasm tale. Front Microbiol 4:366. doi: 10.3389/ fmicb.2013.00366 14. Sambade A, Rubio L, Garnsey SM et al (2002) Comparison of viral RNA populations of pathogenically distinct isolates of Citrus tristeza virus: application to monitoring crossprotection. Plant Pathol 51:257–265 15. Licciardello G, Raspagliesi D, Bar Joseph M et al (2012) Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms. J Virol Methods 181:139–147 16. Licciardello G, Scuderi G, Ferraro R et al (2015) Deep sequencing and analysis of small-RNAs in sweet orange grafted on sour orange infected with two Citrus tristeza virus isolates prevalent in Sicily. Arch Virol 160:2583–2589 17. Nauer EM, Roistacher CM, Labanauskas CK (1967) Effects of mix composition, fertilization, and pH on citrus growing in UC-type potting mixtures under greenhouse conditions. Hilgardia 38:557–567 18. Nauer EM, Roistacher CM, Labanauskas CK (1968) Growing citrus in modified UC potting mixture. Calif Citrogr 53:456, 458, 460–461 19. Roistacher CN (1991) Graft-transmissible diseases of citrus. In: Handbook for detection and diagnosis. FAO, Rome, p 286 20. Pina J A, Moreno P, Juarez J et al (2005) A new procedure to index Citrus tristeza virusinduced decline on sour orange rootstock. In: Proceedings of the 16th Conference of the International Organisation of Citrus Virologists IOCV, Riverside, CA, USA, 491, p.47 21. Garnsey S M, Muller GW (1988) Efficiency of mechanical transmission of Citrus tristeza virus. In: Timmer LW, Garnsey SM, Navarro L (eds) In: Proceedings of the 10th Conference of the International Organization of Citrus Virology IOCV, Riverside, CA, pp 46–54 22. Garnsey SM, Gonsalves D, Purcifull DE (1977) Mechanical transmission of Citrus tristeza virus. Phytophatology 67:965–968

Phenotyping CTV Isolates 23. Bove` JM, Vogel R (1980) Description and illustration of virus and virus like-like diseases of citrus. A collection of colours slides. I.R.F.A SETCO-FRUITS, Paris 24. Roistacher CN, Nauer EM (1985) Effect of supplemental light on citrus seedlings in winter. Citrograph 70:181–196

27

25. Nauer EM, Carson RC (1985) Packaging citrus seed for long-term storage. Citrograph 70:229–230 26. Lee RF, Keremane ML (2013) Mild strain cross protection of tristeza: a review of research to protect against decline on sour orange in Florida. Front Microbiol 4:259

Chapter 4 CTV Vectors and Interactions with the Virus and Host Plants Raymond Yokomi Abstract Citrus is a graft-propagated perennial crop, and Citrus tristeza virus (CTV) is readily graft-transmissible. CTV is comprised of a complex of strains and isolates and, in nature, is spread semi-persistently by aphid vectors. Therefore, citrus trees become infected with multiple CTV strains over time. An important step in characterizing a CTV field isolate is to use aphid vectors to “clean” up the CTV population of a source tree to separate strains and eliminate other graft-transmissible agents. Use of Toxoptera citricida or Aphis gossypii will expedite efficient CTV transmission. CTV vector studies require critical coordination of abundant robust and virus-free vector-competent aphid colonies and an insect-proof, climate-controlled greenhouse or growth chamber. CTV donor and healthy receptor plants with young flush growth must be available for virus acquisition and inoculation. Vector optimums for virus acquisition and inoculation are 24 h for each. CTV infection is readily determined by serology using a polyclonal antiserum or a monoclonal antiserum cocktail; whereas, molecular genotyping is conducted with reverse transcription polymerase chain (RT-PCR) or real time quantitavtive RT-PCR (RT-qPCR) with strain-specific primers and probes. However, the phenotype of the aphid-transmitted isolate still requires virus indexing by graft inoculation to a citrus host range and evaluating symptoms such as stem pitting, vein clearing, stunting, and chlorosis. Key words Nonpersistent, Semi-persistent transmission, Tristeza, Aphids, Quick decline, Stem pitting

1

Introduction Citrus tristeza virus (CTV) is naturally transmitted by aphids in a foregut-borne, semi-persistent manner. CTV is typically acquired within 1–24 h of feeding on an infected plant; inoculation typically occurs within 1–24 after acquisition; no transmission occurs after a molt unless the virus is reacquired [1]. Efficiency in transmission can vary among different aphid species colonizing citrus; therefore, obtaining the correct vector for transmission is important. This involves field inspection of citrus young flush and collecting vector candidates and establishing voucher specimens that are correctly identified and kept for reference. Toxoptera citricida (Kirkaldy), the brown citrus aphid (see Fig. 1), is the most efficient [2, 3]; however, Aphis gossypii (see Fig. 2) is a competent vector where T. citricida is

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_4, © Springer Science+Business Media, LLC, part of Springer Nature 2019

29

30

Raymond Yokomi

Fig. 1 Toxoptera citricida infestation on citrus. (a) Large population on citrus flush. (b) Mature apterae and nymphs on leaf. (c) T. citricida adults and nymphs with aphid mummies from parasitism by braconid wasps

Fig. 2 Mature Aphis gossypii morph with second instar nymphs

absent [4–6]. Differences in transmission efficiency exist between isolates of CTV [7, 8] and among populations of vector species and biotypes [1, 2, 9, 10]. Host specificity is an important vector attribute: T. citricida is host specific to citrus. A. gossypii (cotton or melon aphid) and other aphids are polyphagous and reproduce on a wide variety of host plants. Buildup of large populations of competent CTV vectors results in development of aphid winged morphs (alate) which disperse in search of new host plants. These flights are typically short-range, and those that involve citrus-tocitrus dispersal are drivers of CTV epidemics [11]. Citrus cultivars that flush frequently also influence epidemics as aphids feed and

CTV Vectors and Host Interactions

31

develop almost exclusively on young flush. Hence, weather, irrigation, cultivar, and horticultural practices play critical roles in the development of aphid populations. The mechanisms involved in CTV-aphid transmissibility remain largely unknown [7, 8, 12]. This chapter discusses a classical approach to CTV vector transmission relevant to determining vector efficiency, rate of CTV spread, and transmissibility phenotype of a given CTV isolate. It does not include contemporary elements such as artificial feeding sachets [13, 14] or recombinant CTV isolates [14, 15].

2

Materials

2.1 Aphid Surveys [16]

1. Yellow acryllic sheets cut to fit inside of a clear plastic sandwich box container make convenient water pan traps for winged aphids (see Fig. 3) (see Note 1). 2. Ethylene glycol, dish detergent. 3. 10–20
magnifier; stereomicroscope (10–50
) with illuminator; compound microscope (25–100
). 4. Fine point forceps; teasing needle straight tip, teasing needle with bent tip; hot plate, camel hair brush size 1, microscope slides, cover slips, and slide mounting media. 5. 10% KOH. 6. Canada balsam microscope slide mounting media. 7. Slide box. 8. 75–95% ethanol.

Fig. 3 Water pan traps to collect alate aphids. (a) Yellow acrylic panel. (b) Green ceramic tile

32

Raymond Yokomi

Table 1 Macronutrients and micronutrients in UC soil mixture to grow citrus Macronutrients 1.7 kg super phosphorus 2.25 kg MgCO3 (dolomite) 1.0 kg CaCO3 Micronutrients 85 g CuSO4 34 g ZnSO4 37 g MnSO4 48 g FeSO4 The elements are added in weight per m3 soil with a pH between 5.5 and 6.5

2.2

Aphid Rearing

1. Growth chamber, insectary, or a dedicated greenhouse space. 2. An insect-proof temperature-controlled greenhouse to grow plants [17] equipped with an in-line fertigation system. 3. Aphid cages or bug dorm of different sizes. Aphid cages can be custom-made from various sized plastic tubes cut to convenient size with top covered by organdy cloth or equivalent. 4. Fertilizer mixture (dry parts per weight): 9 parts NH4NO3, 3.75 parts Ca(NO3)2, and 2.75 parts KNO3. 5. Canadian peat moss and fine sand to make UC soil mixture for citrus. Any suitable potting mixture form garden center can be used for non-citrus plants. 6. Macro- and micronutrients (Table 1). 7. Boiler (steam generator) and soil cart. 8. Pots of various sizes including Ray Leach Cone-tainers (SC10 UV resistant) and RL98 tray (see Fig. 4). 9. Host plants for aphid rearing: Poncirus trifoliata, cotton, okra, hibiscus, cantaloupe, zucchini, squash, pumpkin, or viburnum, depending on aphid species and biotype.

2.3 Host Plants for CTV Vector Transmission

2.4 Detection of CTV by DASI-ELISA [18, 19]

1. CTV-infected donor plants for vector acquisition: sweet orange (Citrus sinensis) (see Fig. 5). 2. Receptor plants for aphid transmission: Mexican lime (C. aurantifolia) (see Fig. 6) or alemow (C. macrophylla). 1. Any plant tissue homogenizer: Kleco tissue pulverizer (Garcia Machine) (see Fig. 7), Geno/Grinder (SPEX SamplePrep) (see Fig. 8), and Homex 6 (Bioreba). 2. Extraction bags (if using Homex 6 homogenizer). 3. CTV-specific polyclonal antisera (coating antisera).

Fig. 4 Mexican lime seedling in cone-tainer pots for inoculation access period (IAP). Small plants facilitate many replications

Fig. 5 Madam Vinous sweet orange CTV donor plant. (a) Young flush for virus acquisition by aphid vector. (b) Donor plant with aphids and cages during AAP

Fig. 6 Mexican lime receptor plants. (a) Aphids on receptor host for inoculation access period (IAP); (b) Receptor plants with aphids and cages during IAP

34

Raymond Yokomi

Fig. 7 Kleco ball pulverizer (http://www.kleco.net/)

4. Alkaline phosphate (AP)-conjugated CTV antiserum or antirabbit AP conjugate. 5. ELISA buffers (Table 2). 6. Alkaline phosphatase substrate ( p-nitrophenyl phosphate (pNPP)—1 mg/mL dissolved in substrate buffer). 7. 3 N NaOH solution. 8. Microcentrifuge tubes, 1.5 mL or 2 mL. 9. ELISA microtiter plates. 10. Pipette for micro-volumes (P20, P200, and P1000). 11. Tips for pipette to aliquot different volumes. 12. ELISA microplate reader. 2.5 Immunocapture (IC) for Real-Time and Conventional PCR Detection of CTV in Plants

1. PCR tubes (0.2 mL). 2. CTV-specific polyclonal antisera (coating antisera). 3. ELISA buffers (Table 2). 4. Incubator set at 37  C.

CTV Vectors and Host Interactions

Fig. 8 Geno/Grinder. https://www.spexsampleprep.com/genogrinder Table 2 ELISA buffers Coating buffer 1 L, pH 9.6 1.59 g NaCl 2.93 g NaHCO3 Phosphate buffered saline (PBS), 5 L, pH 7.4 40 g NaCl 10 g Na2HPO4 1 g KH2PO4 1 g KCl PBS-T 1 L PBS 0.4 mL Tween 20 PEP extraction buffer 1 L PBS-T 20 g PVP-10 Substrate buffer 1 L, pH 9.8 (to be stored in dark bottle at 4  C) 97 mL diethanolamine 800 mL ddH2O

35

36

2.6

Raymond Yokomi

cDNA Synthesis

1. RNase-free water. 2. M-MLV reverse transcriptase (200 U/L). 3. 5
M-MLV buffer. 4. DTT. 5. dNTP mix (10 mM each). 6. RNaseOUT™ RNase Inhibitor (40 U/μL). 7. Random hexamers (alternatively gene-specific reverse primer can be used). 8. Pipettes for micro-volumes (P10, P20, P200, P1000). 9. Sterile filter tips (10 μL, 20 μL, 200 μL, 1000 μL). 10. Vortex mixer. 11. Benchtop centrifuge. 12. Heat block (at 70  C and 42  C).

2.7 Conventional PCR

1. Thermocycler. 2. Individual or 8-strip PCR tubes or 48-/96-well PCR plate and seals. 3. Any PCR master mix, for example, GoTaq 2
[Promega]. 4. Primers: T36CP-F (50 -ATGGACGACGAAACAAAGAAA TTG-30 ) and T36CP-R (50 -TCAACGTGTGTTGAATTT CCCA-30 ) for broad-spectrum detection of CTV strains [20]. 5. Ultrapure agarose. 6. 1
TAE: 40 mM Tris base, 20 mM acetic acid, and 1 mM EDTA. 7. 6
Loading dye: 0.02% bromophenol blue, 0.02% xylene cyanol, and 50% glycerol. 8. GelRed™ Nucleic Acid Gel Stain. 9. 1Kb plus DNA ladder. 10. Pipettes for micro-volumes (P10, P20, P200, P1000). 11. Sterile filter tips (10 μL, 20 μL, 200 μL, 1000 μL). 12. Electrophoresis apparatus, power supply, tray, and combs. 13. UV transilluminator.

2.8

Real-Time PCR

1. Any real-time PCR master mix for TaqMan, for example, PerfeCTa qPCR ToughMix [Quantabio]. 2. Nuclease-free water. 3. Primers and probes (Table 3).

2.9 Extraction of Total RNA from Aphids

1. Trizol (Invitrogen or other vendors). 2. Tungsten beads (3 or 5 mm in diameter).

CTV Vectors and Host Interactions

37

Table 3 Primers and probe targeting the coat protein gene for broad-spectrum detection of CTV Primer/probe

Name

Sequence

Reference

Forward primer Reverse primer Probe

P25F P25R CP probe

AGCRGTTAAGAGTTCATCATTRC TCGRTCCAAAGTTTGTCAGACA CRCCACGGGYATAACGTACACTCGG

[21, 22]

3. Microcentrifuge safe-lock tubes, 1.5 mL and 2 mL. 4. Pipettes for micro-volumes (P200, P1000). 5. Sterile filter tips (200 μL and 1000 μL). 6. Chloroform. Use in a chemical hood. 7. Isopropanol. 8. Nuclease-free water. 9. Laboratory mixer mill or Mini-BeadBeater-96. 10. Benchtop refrigerated centrifuge. 2.10 One-Step RealTime PCR

1. Real-time PCR instrument and software. 2. iTaq™ Universal Probes One-Step Kit [Bio-Rad or equivalent products]. 3. Individual tubes/8-strip low-profile tubes and ultra-clear caps or plates (48 or 96 wells) and seals. 4. Pipettes for micro-volumes (P10, P20, P200, P1000). 5. Sterile filter tips (10 μL, 20 μL, 200 μL, 1000 μL). 6. Primers (desalt) and probes (PAGE or HLPC purification) (Table 3). 7. Vortex mixer. 8. Benchtop centrifuge.

2.11 Molecular and Biological Characterization of CTV Strains 2.11.1 Molecular Characterization by RT-qPCR 2.11.2 Biological Characterization

1. See the above Subheadings 2.5, 2.6, and 2.10 for all materials needed to perform the extraction of the viral RNA or plant total RNAs, the cDNA synthesis, and the qPCR or one-step RT-qPCR assays. 2. Primers (desalt) and probes (PAGE or HPLC) available for strain differentiation (Table 4).

1. Citrus host range to bio-index Citrus tristeza virus [26] (Table 5). 2. Citrus can be grown as seedlings and/or propagations and should have stem diameter of >~0.5 cm to accept leaf piece or blind bud inoculum for graft inoculation.

38

Raymond Yokomi

Table 4 Sequences of the primers and probes to be used in real-time PCR assay for CTV strain differentiation Strain

Primer/Probe

Name

Sequence

Reference

VT/T3 Forward primer P27F Reverse primer P27R Probe VT3

TACGYGATTTGGGWAAGTAYT GACCCTTAAAGCAGTGCTCA ACGGKGRTATTRCGC

[23]

T30

Forward primer VT/T30/T68-RT-F Reverse primer Common RT reverse Probe T30

CGATGGTCAAGCGGACGACTT GCAAACATCTCGACTCAACTACC TGAACAAACGATCAACCAGTCATC

[24]

T36

Forward primer P27F Reverse primer P27R Probe T36

TACGYGATTTGGGWAAGTAYT GACCCTTAAAGCAGTGCTCA ACGGTAACATTATACTATCCC

[23]

S1

Forward primer S1F Reverse primer S1R Probe S1

CGTTGCGCGCTAAGTTT [25] GACACTCCAGCTTCGTCTTA TCGTCACCGTCTGGGAGATTGTCT

RB/S1 Forward primer P27F Reverse primer P27R Probe T36NS

TACGYGATTTGGGWAAGTAYT GACCCTTAAAGCAGTGCTCA CGGTARTATYATRCCATCCT

[23]

Table 5 Indicator plants Citrus cultivar Madam Vinous sweet orange (C. sinensis) (MV) Duncan grapefruit (C. paradisi) (DGF) Sour orange (C. aurantium) (SO) Mexican lime (C. aurantifolia) (ML) Sweet orange grafted on sour orange rootstock (Swt/SO)

3

Methods

3.1 Capturing and Identification of Aphid Species

1. Yellow water pan traps should be placed in a convenient location and height in a clearing immediately adjacent to or a few rows inside the citrus orchard [16] (see Note 1). 2. A small amount of dish detergent and ethylene glycol (antifreeze) should be added to the water (see Fig. 3) to break surface tension and reduce evaporation, respectively.

CTV Vectors and Host Interactions

39

Fig. 9 Toxoptera aurantii showing location of abdominal stridulatory apparatus (arrow 1) and setae on the cauda (arrow 2) and forewing medial vein once branched (arrow 3). Reproduced from Kono and Papp (1977) with permission from the California Department of Food and Agriculture, Sacramento

3. Traps should be checked at least 2
per week. Winged aphids in the trap is collected by camel hair brush and transferred to a vial with 70–95% ethanol for preservation. The traps should be cleaned and fresh water added each visit. 3.2 Aphid Identification

1. Use the hand lens to determine critical morphological features such as cauda shape and setal hairs; cornicle shape and size, wing venation; and antennal segmentation [27, 28] (see Figs. 9–11) (see Note 2). 2. Laboratory verification of aphid identification (if needed):

40

Raymond Yokomi

Fig. 10 Aphis gossypii, cotton, or melon aphid. Reproduced from Kono and Papp (1977) with permission from the California Department of Food and Agriculture, Sacramento

(a) Clear winged aphids with gentle heat for several minutes in 10% KOH. (b) Transfer specimen to microscope slide in a drop of Canada balsam (or equivalent media), position the antennae and wings, cover specimen with a clean, dry coverslip for visual observation, label the slide, and dry with gentle heat (~35  C) on a hot plate or drying oven or incubator. (c) Examine embedded specimen on slide with compound microscope at 25–100
[30, 31]. Morphological characters include wing venation, cauda, setal patterns,

CTV Vectors and Host Interactions

41

Fig. 11 Aphis spiraecola, spirea, or green citrus aphid. Reproduced from Kono and Papp (1977) with permission from the California Department of Food and Agriculture, Sacramento

antennae, etc. as shown for T. citricida and T. aurantii (see Figs. 9), A. gossypii (see Fig. 10), and A. spiraecola (see Fig. 11). (d) Store slides in slide box. 3.3 Rearing Aphid Colonies

1. A nascent aphid colony should be started with 3 to 10 nymphs derived from a single parthenogenic mature aphid (see Note 3). T. citricida can be reared on P. trifoliata since it is resistant to most strains of CTV. A. gossypii can be reared on cotton, kenaf, or hibiscus (cotton biotype) and squash or pumpkin (melon biotype). A. spiraecola, the green citrus aphid or spirea aphid, can be reared on viburnum [2, 8, 10].

42

Raymond Yokomi

2. Ventilated cages such as bug dorms (see Fig. 4) are convenient for holding plants and rearing aphids. 3. Vigorous host plants for aphid colonies must be continually grown free of pesticide residue and kept with new succulent growth to support nymph development. 4. Aphid colonies should be transferred to a new host in a fresh clean cage frequently to avoid becoming crowded. Crowding results in the production of alate aphids (see Note 4). 3.4 Soil and Fertigation System [17]

1. UC soil mix—Combine equal parts of Canadian peat moss and fine sand and macro- and micronutrients in small loads; mix in a concrete mixture; add some dolomite dump mixture into soil bin with perforated base and a coupler to the steam generator (boiler). 2. Steam soil—Cover soil bin with a canvas tarp and bungee cords; attach bin to steam generator hose; steam soil for 15 min after steam percolates through the canvas top. This is necessary to kill soil pathogens such as Phytophthora. Cool soil mix to ambient temperature before use (see Note 5).

3.5

Growing Plants

1. Plant seeds in soil mixture in seed flats in the greenhouse. Citrus should be grown in UC mix. Non-citrus plants can be grown in any suitable potting soil. 2. After germination continue growing plants with the in-line fertigation system proportioned to 1 part fertilizer and 100 parts water. 3. Aphid host plants can be sown and grown directly in the pots used for colonies. 4. Citrus seedlings are typically transplanted into appropriate size pots and grown until they reach the size needed for the experiment. 5. Fertigate plants at a ratio of part fertilizer to 100 parts water. Avoid overwatering and extreme desiccation. 6. Inspect plants daily for nutritional deficiencies and pests (mites, scales, whiteflies, aphids, thrips, etc.). Eliminate pests promptly with appropriate treatments. 7. Check greenhouse daily to insure cooling, heating, and supplementary lighting are operating properly and repair as needed. Repair immediately any greenhouse structure deficiency that allows ingress or egress of pests.

3.6 Vector Transmission

1. Graft inoculate field CTV isolates into Madam Vinous seedling using three leaf pieces or bark from field source tree. Use an inverted T or bark pull to position the inoculum under the bark

CTV Vectors and Host Interactions

43

of MV plant. Wrap inoculum tightly with grafting tape to seal and prevent desiccation [17]. Keep plants in greenhouse. 2. Check inoculated plants regularly for inoculum failure, and reinoculate as needed. 3. The bark of inoculated plants should heal successfully after 2 weeks. If so, unwrap inoculum, and leave plant in place to complete a 4- to 8-week incubation period. 4. Test MV donor plant for CTV by using either serological or molecular assays as described in Subheadings 3.7.1–3.7.5. 5. Virus acquisition access period (AAP). Source plant for acquisition is CTV-infected MV with multiple young flush grown in 1 gallon-size pots and maintained in a greenhouse at 24–27  C day and 18–21  C night. This cultivar grown under these conditions supports high CTV titer and is typically fed on by the vector aphid. Colony aphids are mass transferred by gently brushing or gently chopping colony host plant leaves with aphids (avoid damaging aphids as much as possible) to the virus donor host for an acquisition access period (AAP) of 24 h in a growth chamber or controlled environment room at ~25  C and 16:8 (L/D) photoperiod (see Note 6). Isolate the donor plant and spray it with an insecticide to disinfest the plant. Keep the plant in isolation until at least 24 h, inspect for live aphids, and spray again if found. Otherwise, return disinfested donor plant to the greenhouse. Wash the AAP cage with soapy water, rinse, dry, and store. 6. Virus inoculation access period (IAP). After the IAP, gently transfer 5–10 aphids from the source plant by a moist camel hair brush to a small Mexican lime or alemow (C. macrophylla) at the 4–10-leaf stage grown in container pots (see Fig. 7a). Place cage snuggly over the receptor plant (be sure there are no gaps for aphids to escape), and place the plant in the RL98 tray. With all receptor replications in the tray, place tray in the growth chamber or environmental room with the same conditions as the AAP for a 24-h IAP. After the IAP, remove the cage, count, and record the number of live aphids feeding on the receptor plant. Isolate the receptor plants, and spray it with an insecticide like that done with the donor plant. Wash IAP cages in soapy water, rinse, dry, and store. After 24 h, inspect receptor plants for live aphids, and if found, spray again. Otherwise return disinfested receptor plants to the greenhouse. 7. Maintain receptor plants in the greenhouse at 24–27  C day and 18–21  C night for an incubation period of 4–6 weeks. 8. Fertigate plants daily in Cone-tainer pots since it holds a small volume of soil and receptor plants grow rapidly. 9. Maintain strict insect-proof conditions by daily inspection, and spray with insecticide as needed.

44

3.7

Raymond Yokomi

CTV Detection

3.7.1 DASI-ELISA [18, 19 ]

The presence of CTV infections in donor and receptor plants can be determined by serological tests like DASI-ELISA or by PCR-based molecular approaches (mainly conventional and real-time PCR). PCR can also be used to identify the CTV genotype(s) of the isolate(s) causing the infection. For the PCR-based assays, the RNA template for reverse transcription and subsequent conventional or real-time PCR can be prepared by immunocapturing the virions or by extracting the total plant RNA. 1. Coat ELISA plates with primary CTV antisera properly diluted in coating buffer, and incubate at 37  C for at least 2 h. Coating buffer is dumped from plate and washed 3
with PBS-Tween (see Note 7). 2. Macerate 0.5 g of excised tissue from test plant using the Kleco canisters or the extraction bags, after adding 5 mL of extraction buffer (PEP), and proceed with the homogenization of the tissue. 3. Recover at least 1 mL of homogenate, and transfer in microcentrifuge tubes (1.5 mL). Centrifuge at low speed (2000–3000
g) to pellet the plant debris. 4. Load 200 μL of each sample (pipetting from the upper part of the microcentrifuge tube) into 2-well replicates of the ELISA plate. 5. In each plate include the following controls: CTV-positive, CTV-negative, and PEP buffer. 6. Cover the loaded plates and incubate overnight at 4  C. 7. Remove the plant sap from the wells and wash 3
with PBS-T. 8. Add in each well 200 μL of secondary CTV antiserum properly diluted in PEP buffer. 9. Incubate the plates at 37  C for 2 h. 10. Dump the plate and wash 3
with PBS-T. 11. Add 200 μl anti-rabbit AP conjugate in PEP buffer containing BSA (40 mg/20 mL) per well, and incubate the plate for 2 h at 37  C. 12. Dump the plate and wash 3
with PBS-T. 13. Add the alkaline phosphatase substrate to the substrate buffer, and load 200 μL in each well. 14. Positive samples will turn yellow. Absorbance is measured at 405 nm using an ELISA plate reader. According to OD values of the controls, plate readings are made at 30 min, 1 h, and/or 2 h. Samples with OD values 2–2.5 times higher than the average value of the negative control are considered positive for CTV.

CTV Vectors and Host Interactions 3.7.2 Immunocapture RT-PCR and RT-qPCR [20–25] (See Note 8)

45

1. Coat each PCR tube with 100 μL of primary CTV antiserum diluted in coating buffer. Make sure there are no bubbles at the bottom of sides of the tube. Incubate overnight at 4  C. Wash each tube 3
with PBS-T, 1 min per wash. 2. Remove all PBS-T buffer. 3. Load 100 μL plant sap after a brief spin (to pellet plant debris) to each coated PCR tube (avoid transferring pellet). 4. Incubate the loaded PCR tubes overnight at 4  C or for 2 h at 37  C. 5. Remove the plant sap, and wash the tubes 3
with PBS-T, 1 min for each wash. Centrifuge the tubes and remove any remaining PBS-Tween. 6. Proceed with the synthesis of the cDNA by adding to each tube the reverse transcription reaction mix up to a total final volume of 20 μL according to the following instructions (see Note 9): Nuclease-free H2O

12.5 μL

5
M-MLV RT Buffer

4.0 μL

200 U/μL M-MLV RT

1.0 μL

0.5 μg/μL random primers

1.0 μL

10 mM dNTP mix (each)

1.0 μL

40 U/μL RNaseOUT™ RNase Inhibitor

0.5 μL

7. Vortex briefly and centrifuge the tubes for few seconds. Be sure to eliminate air bubbles. 8. Incubate the samples at 37  C for 45 min. 9. Denature the samples at 65  C for 10 min.

3.7.3 Conventional PCR

10. The recovered cDNA can be used immediately to set up PCR and qPCR reactions or stored at 20  C for future testing. 1. Set up 25 μL PCR reactions by mixing the following components (see Note 9): 2
PCR master mix

12.5 μL

10 μM forward primer T36CP-F

0.5 μL

10 μM reverse primer T36CP-R

0.5 μL

cDNA

2.5 μL

Nuclease-free water

9 μL

46

Raymond Yokomi

2. Set up the following cycling conditions on the PCR thermocycler: Step

Temp ( C)

Time

Initial denaturation

95

10 min

1

Amplification

95 55 72

30 s 30 s 1 min

35

Final extension

72

5 min

1

No. of cycles

3. Mix 10 μL of the PCR reaction product with 2–3 μL of 6
loading dye. 4. Analyze PCR reaction products by electrophoresis on 1% agarose gels buffered in 1
TAE and containing GelRed™ (1:100,000, v:v). 5. Load the samples and the 1 Kb plus DNA ladder onto the gel. 6. Run gel for approximately 30 min at 110 V. 7. Transfer the gel onto the UV transilluminator to visualize the presence of the DNA bands of the expected size (672 nt). 3.7.4 Real-Time PCR Reactions

1. Prepare the qPCR reactions in 22 μL final volume by mixing the components according to the following instructions (see Note 9): Nuclease-free H2O

7.4 μL

qPCR 2
master mix

11.0 μL

10 μM CP25 TaqMan probe

0.3 μL

10 μM CP25 forward primer

0.7 μL

10 μM CP25 reverse primer

0.7 μL

2. Transfer 20 μL of the reaction mix in each tube or well. 3. Add 2.0 μL of the cDNA template (see Subheading 3.6). Two replicates should be tested for each sample. 4. Include in each qPCR assay a positive control, a CTV-free control, and a non-template control in duplicate wells. 5. Be sure to eliminate air bubbles in the reaction wells (see Note 10). 6. Set up the qPCR thermocycler using the following program:

CTV Vectors and Host Interactions

47

Step

Temperature ( C)

Number of Time cycles

DNA denaturation

95

5 min

DNA denaturation 95 Annealing/extension + plate 56 read

15 s 40 s

1 40

7. Determine the virus status of the individual samples by cycle number (Ct) at which the threshold is crossed (see Note 11). 3.7.5 Total RNA Extraction from Aphids

1. Transfer individual aphid into 2 mL safe-lock microcentrifuge tubes with 3–5 mm tungsten beads. 2. Add 500 μL of Trizol reagent [Invitrogen]. 3. Homogenize aphid using the mixer mill or Geno/Grinder. Other instruments or tools can be substituted (e.g., microfuge tube/pestle). 4. Add 100 μL of chloroform to the homogenate, and incubate the tubes at room temperature for 5 min. 5. Centrifuge the samples at 12,000
g for 15 min. 6. Recover and transfer microcentrifuge tube.

the

supernatant

into

a

lean

7. Add 250 μL of isopropanol, and incubate at room temperature for 15 min. 8. Centrifuge samples for 10 min at 12,000
g at 4  C. Total RNA precipitate forms a white gel-like pellet at the bottom of the tube. 9. Discard the supernatant, add 500 μL of 75% ethanol, and centrifuge for additional 5 min. 10. Remove the ethanol, and vacuum or air-dry the RNA pellet for 5–10 min. 11. Resuspend the pellet in 15 μL of RNase-free water. 12. Determine the RNA yield and the quality by measuring absorbance at 260 nm (total nucleic acid content) and at 280 nm (sample purity). 3.7.6 RT-qPCR from Aphids

1. Set up 20 μL one-step RT-qPCR reaction containing the following components reported (see Note 9): iTaq Universal Probes reaction mix (2
)

10 μL

iScript advanced reverse transcriptase

0.5 μL

10 μM CP25 forward primer

0.6 μL

10 μM CP25 reverse primer

0.6 μL (continued)

48

Raymond Yokomi 10 μM CP25 TaqMan probe

0.3 μL

Nuclease-free water

6 μL

2. Add 2 μL of RNA extract (step 11 above) to each reaction well. Two replicates for each sample should be performed. 3. Include in each assay CTV-positive and CTV-negative controls and the non-template control. 4. Start the RT-qPCR cycling with the parameters as listed below

Step

Temperature ( C)

Time

DNA denaturation

95

5 min

DNA denaturation Annealing/extension + plate read

95 56

15 s 40 s

Number of cycles 1 40

5. Determine virus status of the individual samples by cycle number (Ct) at which the threshold is crossed. 3.8 CTV Strain Characterization (See Note 12) 3.8.1 Molecular Strain Characterization

Rapid screening of the CTV strain(s) causing the infections in the donor plants and/or in the receptor plants after aphid transmission can be achieved by RT-qPCR using strain-specific primers and TaqMan probes [23–25]. 1. For the preparation of the RT-qPCR templates (viral RNA or total plant RNA), follow the procedures described in Subheading 3.8. 2. Set up the qPCR or one-step RT-qPCR reactions as described in Subheadings 3.7.2 or 3.7.3 using the primers reported in Table 4. 3. Start cycling using PCR conditions reported in Subheading 3.7.4, step 6 for two step or Subheading 3.7.4, step 6 for one step RT-qPCR.

3.8.2 Biological Characterization

1. Graft inoculate 2–3 leaf pieces or bark of each CTV aphidtransmitted (AT), and sub-isolate into each citrus host range host using three replications per host per sub-isolate. 2. Greenhouse temperature should be maintained between 10 and 30  C with a ~16/8 h (day/night) regime [29]. 3. Follow the steps for graft inoculation, virus incubation, and confirmation of CTV infection described in Subheadings 3.6 and 3.7. 4. Indicator plants should be trimmed and grown as a single leader plant, staked, and tied. Side shoots should be eliminated to insure uniform growing conditions.

CTV Vectors and Host Interactions

49

5. Confirmed infected plants should be rated visually on a scale of 0 to 3 (0 ¼ no symptoms; 3 ¼ severe symptoms) for vein clearing, leaf cupping, chlorosis, stunting, and seedling yellows [25]. Host reaction is scored for each character (leaf cupping, vein clearing, stem pitting, stunting, seedling yellows) from 0 ¼ no symptoms to 3 ¼ severe. Host plants were Mexican lime (ML), Madam Vinous (MV), MV grafted on sour orange (SO), Duncan grapefruit (DGF), and SO. A weighted disease index (DI) is used with each host’s symptom score weighted per host as
1,
2,
3,
4, and
5, respectively, and summed per isolate [29]. 6. SAS PROC GLIMMIX is used for making comparisons among interaction of means. Isolate
host measures are done in a randomized complete block framework with blocks ¼ replicates. Each isolate has four replicates per host. Tukey-Kramer Grouping for each CTV isolate is separated by least square means [25]. After 6 months, this data should be summarized 1 year, stems harvested, and bark peeled to examine for stem pitting symptoms.

4

Notes 1. The trap collects winged aphids flying in or around a citrus grove which can be collected intact and identified in the laboratory. Yellow acrylic plastic (Plexiglas) (1/800 thick) (see Fig. 3a) sheets are readily available and can be cut to a size (~10.8
10.8 cm) that fits into a plastic sandwich-size container. The trap can be laid on the ground or perched on a stand at a convenient height. A green ceramic tile (~10.8
10.8 cm) (see Fig. 3b) also makes a good trap that mimics plant foliage and is used if aphid landing rates are monitored [30]. Alternatively, the sticky shoot method can be used to trap winged aphids directly on the tree by applying an adhesive spray to the shoot [31]. 2. The key character of the genus Toxoptera is stridulatory apparatus at the base of the cornicle (see Fig. 10). The aphid must be cleared, mounted on a microscope slide, and examined with a compound microscope to see this character. T. citricida can be distinguished from T. aurantii as follows: T. citricida, cauda usually more than 20 hairs, antennal segment III black, and pterostigma light; T. aurantii, cauda usually less than 20 hairs, antennal segment III light, and pterostigma with dark spot. The key character of the genus Aphis is its antennal tubercles are weakly developed. A. gossypii can be distinguished from A spiraecola as follows:

50

Raymond Yokomi

(a) A. gossypii: coloration yellowish-green to blackish-green and cauda pale in color with two to three pairs of lateral setae and tapering, slighted constricted at the middle (b) A spiraecola: coloration light green and cornicle and cauda blackish-brown with cauda bushy bearing 3 to 6 pairs of lateral setae (see Figs. 9–11) [27, 28] 3. New aphid colonies should be started once a week to avoid crowding. Reproduction is asexual; aphid colony should be comprised only of female morphs and maintained as apterae (wingless) morphs. Mature females give birth to live first instar nymphs. Under ideal insectary conditions of 20–25  C, 16:8 photoperiod (day/night), a life cycle can occur in 7–10 days. One adult aphid can produce 100 or more offspring. 4. Alate aphids are far less efficient vectors than apterae in the laboratory since they are programmed to disperse and fly rather than settle and feed. 5. Phytosanitation is critical in the greenhouse and cannot be overemphasized. To maintain healthy citrus, use of citrus seedlings is recommended as this eliminates seed-borne and grafttransmissible pathogens inadvertently present. 6. Mass inoculation (100’s) of aphid vectors on a CTV donor plant with multiple flushes is achieved using a large cage over the entire plant typically maintained in 1 gallon-sized pots. For uniformity, AAP is conducted in a growth chamber maintained at 23–25  C for a 24-hour IAP. We gently remove an entire flush with aphid vectors still feeding on the foliage one flush at a time and transfer 5–10 A. gossypii apterae to a small receptor plant and immediately cover it with a small cage that fits snugly inside the diameter of the Cone-tainer pot (see Fig. 7). We try to have at least 100 replications for each isolate tested. If you use T. citricida, you can use 1–2 aphids per receptor plant. The small number of aphids per receptor plant increases the chance to separate isolates in a mixture. The large number of replications provides a good sample to determine % transmission efficiency. 7. We recommend making up PEP buffer fresh as the buffer may become contaminated within a week. It should be discarded at the first sign of cloudiness. It takes ~300 mL of PEP buffer per plate to complete an ELISA test. PEP, coating buffer, and substrate buffers should be stored at 4  C, whereas PBS and PBS-Tween can be stored at room temperature. We recommend adding alkaline phosphate substrate to the substrate buffer just before it is used to load into the plate. The mixture will begin to turn yellow with time and exposure to light. 8. IC-RT-qPCR is an ideal method to efficiently test for CTV when many aphid- transmission receptor plants need testing

CTV Vectors and Host Interactions

51

and many are likely negative. The raw sample extracts left over from ELISA can be used directly for the immunocapture step, without the need to further extract and purify nucleic acids from the sample, thus reducing cost and time needed for the detection. 9. It is recommended when preparing the PCR reaction mixes to calculate based on one additional sample than the actual number of samples to be tested (e.g., if you have 20 samples, mix sufficient quantity of reagents for 21 samples). 10. In the process of transferring the super mix and samples to the wells, bubbles can occur. Bubble can cause false reading in the assay. It is recommended that the plate or tubes be spin down before the run. If a plate spinner is not available, the super mix and the sample can be mixed in a separate tube, and then transfer the well, resulting in only one pipetting event per well. 11. In real-time qPCR assays, a positive reaction is the result of the accumulation of florescent signal detected by the instrument. A test will be considered positive if it produces an exponential amplification curve with Ct (cycle threshold) values higher than the cutoff value determined based on the Ct values of the negative and NTC controls. The Ct is inversely proportional to the amount of target nucleic acid in the sample. Thus, a lower Ct value indicates greater amount of CTV target RNA. Typically, for plants Ct values in the range of 15 to 29 are considered positive; Ct above 30 are considered doubtful or undetermined. Conversely, when testing single aphid, Ct values in the positives are generally above 30. A test will be considered negative if it does not produce an amplification curve or if it produces a curve which is not exponential. 12. CTV biocharacterization. Even in the era of NGS and molecular characterization, symptom expression or phenotype of a CTV isolate remains as a focal and essential part to describe an isolate. The use of a temperature-controlled greenhouse, UC mix, fertilization, good horticulture practices and phytosanitary conditions, and zero-tolerance insect control all are essential.

Acknowledgments This work was supported by the USDA Agricultural Research Service, In-House Appropriated Project Number 2034-22000013-00-D. References 1. Raccah B, Loebenstein G, Bar-Joseph M (1976) Transmission of Citrus tristeza virus

by the melon 66:1102–1104

aphid.

Phytopathology

52

Raymond Yokomi

2. Yokomi RK, Lastra R, Stoetzel MB et al (1994) Establishment of the brown citrus aphid (Homoptera: Aphididae) in Central America and the Caribbean Basin and transmission of Citrus tristeza virus. J Econ Entomol 87:1078–1085 ˜ a MA, Lee RF, Lastra R et al (1995) 3. Rocha-Pen Citrus tristeza virus and its vector Toxoptera citricida. Plant Dis 79:437–445 4. Dickson RC, Johnson MM, Flock RA et al (1956) Flying aphid populations in southern California citrus groves and their relation to the transmission of tristeza virus. Phytopathology 46:204–210 5. Roistacher CN, Bar-Joseph M (1984) Transmission of tristeza and seedling yellows tristeza by small populations of Aphis gossypii. Plant Dis 68:494–496 6. Yokomi RK, Polek M, Gumpf DJ (2010) Transmission and spread of Citrus tristeza virus in Central California. In: Karasev AV, Hilf ME (eds) Citrus tristeza virus complex and tristeza diseases. APS Press, St. Paul, MN, pp 151–166 7. Raccah B, Loebenstein G, Singer S (1980) Aphid transmissibility variants of Citrus tristeza virus in infected citrus trees. Phytopathology 70:89–93 8. Yokomi RK, DeBorde RL (2005) Incidence, transmissibility and genotype analysis of Citrus tristeza virus (CTV) from CTV eradicative and non-eradicative districts in central California. Plant Dis 89:859–866 9. Yokomi RK, Garnsey SM (1988) Host effects on natural spread of Citrus tristeza virus in Florida. In: Timmer LW, Garnsey SM, Navarro L (eds) Proceeding 10th Conference of the International Organization of Citrus Virologists, Valencia, November 1986. IOCV, Riverside, pp 77–81 10. Yokomi RK, Garnsey SM (1987) Transmission of Citrus tristeza virus by Aphis gossypii and Aphis citricola in Florida. Phytophylactica 19:169–172 11. Gottwald TR, Gibson GJ, Garnsey SM et al (1999) Examination of the effect of aphid vector population composition on the spatial dynamics of Citrus tristeza virus spread by stochastic modelling. Phytopathology 89:603–608 12. Harper SJ, Yokomi RK, Dawson WO (2016) Citrus tristeza virus-aphid interactions. In: Brown JK (ed) Vector-mediated transmission of plant pathogens. APS Press, St. Paul, MN, pp 121–130 13. Herron CM, Mirkov TE, da Grac¸a JV et al (2006) Citrus tristeza virus transmission by the Toxoptera citricida vector: in vitro

acquisition and transmission and infectivity immunoneutralization experiments. J Virol Methods 134:205–211 14. Killiny N, Harper SJ, Alfaress S et al (2016) Minor coat and heat shock proteins are involved in the binding of citrus tristeza virus to the foregut of its aphid vector, Toxoptera citricida. Appl Environ Microbiol 82:6294–6302 15. Harper SJ, Killiny N, Tatineni S et al (2016) Sequence variation in two genes determines the efficacy of transmission of citrus tristeza virus by the brown citrus aphid. Arch Virol 161:3555–3559 16. Yokomi RK, Oldfield GN (1991) Seasonal fluctuations of alate aphid activity in California citrus groves. In: Brlansky RH, Lee RF, Timmer LW (eds) Proceeding of the 11th Conference of the International Organization of Citrus Virologists, Orlando, November 1989. IOCV, Riverside, pp 71–76 17. Roistacher CN (1991) The plant laboratory. In: Graft-transmissible disease of citrus: Handbook for detection and diagnosis. International Organization of Citrus Virologists and Food and Agriculture Organization of the United Nations, Rome, pp 159–189 18. Bar-Joseph M, Garnsey SM, Gonsalves D et al (1979) The use of enzyme-linked immunosorbent assay for detection of citrus tristeza virus. Phytopathology 69:190–194 19. Garnsey SM, Cambra M (1991) Enzymelinked immunosorbent assay (ELISA) for citrus pathogens. In: Roistacher CN (ed) Grafttransmissible diseases of citrus handbook for detection and diagnosis. FAO, Rome, pp 193–209 20. Hilf ME, Mavrodieva VA, Garnsey SM (2005) Genetic marker analysis of a global collection of isolates of Citrus tristeza virus: Characterization and distribution of CTV genotypes and association with symptoms. Phytopathology 95:909–917 21. Saponari M, Keremane M, Yokomi RK (2008) Quantitative detection of Citrus tristeza virus in citrus and aphids by real-time reverse transcription-PCR (TaqMan®). J Virol Methods 147:43–53 22. Saponari M, Yokomi RK (2010) Use of the coat protein (CP) and minor CP intergene sequence to discriminate severe strains of Citrus tristeza virus in three U.S. CTV isolate collections. In: Hilf ME, Milne RG, Timmer LW et al (eds) Proceedings of the 17th Conference of the International Organization of Citrus Virologists, Adana, October 2007. IOCV, Riverside, pp 43–57

CTV Vectors and Host Interactions 23. Yokomi RK, Saponari M, Sieburth PJ (2010) Rapid differentiation and identification of potential severe strains of Citrus tristeza virus by real-time reverse transcription-polymerase chain reaction assays. Phytopathology 100:319–327 24. Harper SJ, Cowell SJ, Dawson WO (2015) With a little help from my friends: complementation as a survival strategy for viruses in a longlived host system. Virology 478:123–128 25. Yokomi R, Selvaraj V, Maheshwari Y et al (2018) Molecular and biological characterization of a novel mild strain of citrus tristeza virus in California. Arch Virol 163:1795–1804 26. Garnsey SM, Civerolo EL Gumpf DJ et al (2005) Biocharacterization of an international collection of citrus tristeza virus (CTV) isolates. In: Hilf ME, Dura´n-Villa N, Rocha˜ a MA (eds) Proceedings of the 16th ConPen ference of the International Organization of Citrus Virologists, Monterrey, November 2004. IOCV, Riverside, pp 75–93

53

27. Blackman RL, Eastop VF (1984) Aphid on the world’s crops: an identification guide. Wiley, Chichester 28. Kono T, Papp CS (1977) Aphids. In: Handbook of agricultural pests: aphids, thrips, mites, snails and slugs. CDFA, DPI, Laboratory Services – Entomology, Sacramento, pp 13–86 29. Garnsey SM, Gumpf DJ, Roistacher CN et al (1987) Toward a standardized evaluation of the biological properties of citrus tristeza virus (CTV) isolates. Phytophylactica 19:151–157 30. Irwin ME, Ruesink WG (1986) Vector intensity: a product of propensity and activity. In: McLean GD, Garrett RG, Ruesink WG (eds) Plant virus epidemics. Academic Press, Sydney, pp 13–33 31. Marroquı´n C, Olmos A, Gorris MT et al (2004) Estimation of the number of aphids carrying Citrus tristeza virus that visit adult citrus trees. Virus Res 100:101–108

Chapter 5 Tissue-Print and Squash Capture Real-Time RT-PCR Method for Direct Detection of Citrus tristeza virus (CTV) in Plant or Vector Tissues Mariano Cambra, Eduardo Vidal, Carmen Martı´nez, and Edson Bertolini Abstract Direct systems to process samples allow high-throughput testing or identification of Citrus tristeza virus (CTV) by the sensitive real-time reverse transcription coupled to polymerase chain reaction (RT-PCR) neither with extract preparation nor nucleic acid purification. Immobilized CTV targets are amplified from fresh sections of plant tissues or squashes of fresh or already caught vectors onto paper, nitrocellulose, or positively charged nylon membranes. The printed or squashed support can be stored or mailed at room temperature. These validated user-friendly methods are recommended by IPPC-FAO standard for CTV diagnosis, detection, and identification. The methods are safe, not under current quarantine regulations because they do not involve any risk of introduction of exotic CTV isolates or vectors and are discrete and useful for epidemiological studies or screening for large-scale analyses. In this chapter, tissue-printing and squashing capture methods for direct sample preparation without extract preparation or nucleic acid extraction and purification were coupled with validated real-time RT-PCR detection protocols based on TaqMan chemistry for CTV detection. Key words CTV hosts and vectors, Validation, CTV infection, User-friendly, Direct sample preparation, Immobilized targets

1

Introduction Citrus tristeza virus (CTV) causes tristeza one of the most damaging citrus diseases and devastating epidemics that have changed the course of the citrus industry worldwide [1]. Detection and identification of CTV can be achieved using biological, serological, or molecular amplification tests including next-generation sequencing or combined strategies. Nevertheless, the simultaneous use of laboratory methods based on tissue print-ELISA, using the specific monoclonal antibodies 3DF1 and 3CA5 and real-time RT-PCR, can accurately substitute for the conventional Mexican lime biological indexing for CTV [2]. Real-time PCR is a useful tool that has proven indispensable in a wide range of pathogen detection

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_5, © Springer Science+Business Media, LLC, part of Springer Nature 2019

55

56

Mariano Cambra et al.

protocols. This high-throughput technique has improved the systems in use, achieving high speed, specificity, sensitivity, and reliability, as well as reducing the risks of cross-contamination compared with conventional PCR [3–5]. Several real-time RTPCR-based protocols for detection of CTV have been developed using SYBR Green [6], but the most frequent assays use TaqMan chemistry and are highly sensitive [7, 8]. The templates used in PCR usually require extract preparation and nucleic acid purification. Nucleic acid purification can be totally circumvented using direct sample preparation methods such as dilution or spot immobilization on membranes [5, 9–12] or partially circumvented using the so-called “direct PCR” methods [13]. Nevertheless, all these methods require extract preparations which limit the number of samples that can be processed daily in a robust way, increase the risk of cross-contamination, and generate PCR inhibitors of plant or arthropod origin. Tissue-print capture concept [9] and squash sample preparation systems on membranes [2, 5, 7, 8, 14–20] are direct methods of sample preparation in which neither extract preparation nor conventional nucleic acid purification is necessary. In a DIAGPRO ring test [21, 22] conducted by ten laboratories for CTV detection, the methods based on tissue-printed material exhibited a higher sensibility, specificity, and accuracy when compared with DAS-ELISA, immunocapture (IC) RT-PCR, and IC-nested RT-PCR in a single closed tube. The sensitivity of direct tissue print-ELISA (another similar direct system of sample preparation) was higher than the above mentioned techniques [2]. Several references, described in the IPPC-FAO standard for CTV diagnosis and characterization [23], validated the tissue-print method for real-time amplification. The method is currently used for several pathogens including viruses, viroids, bacteria and fungi, and there are commercially available kits based on this direct system of sample preparation (i.e., www.plantprint.net). They facilitate sample collection from exotic countries or when traveling without facilities to preserve plant or arthropod samples at low temperature. The methods are safe, not under current quarantine regulations because they do not involve any risk of introduction of exotic CTV isolates or vectors and are discrete and useful for epidemiological studies or screening for large-scale analyses. Similarly, the squash of arthropod vector species to detect pathogens is well documented in the literature for several pathogens, even using already caught specimens by Moericke traps or sticky traps or preserved in 70% ethyl alcohol. Some references specifically for CTV [7, 14, 15, 17] show optimal performance of the technique. The main drawback of these direct systems based on target immobilization is the small amount of targets per sample that can be loaded onto the support. This limitation is avoided by coupling

Tissue Print and Squash Real-Time RT-PCR

57

these user-friendly preparation methods with highly sensitive techniques such as real-time PCR. The method [7], where the expected amplicon size is 95 bp, was fully validated [2, 23], using tissue-printed samples properly collected [22]. This user-friendly protocol named tissue-print realtime RT-PCR demonstrated a better sensitivity, specificity, and positive and negative likelihood ratios [2, 23] when compared with conventional methods of sample preparation. The estimated diagnostic parameters show that tissue-print real-time RT-PCR was the most sensitive technique when compared with the gold standard direct tissue print-ELISA using CTV-specific monoclonal antibodies, validating its use for routine CTV detection and diagnosis. The method is highly recommending for assessing the CTV-free status of any plant material [2]. The high sensitivity of this technique allows the accurate analysis of composite samples (up to ten batched trees or nursery plants) as one diagnostic sample when tested in any season of the year, and it also allows analysis of aphid species to detect low CTV concentrations [23]. The other real-time RT-PCR assay that also uses TaqMan chemistry [8], where the expected amplicon size is 101 bp, perfectly works with printed or squashed materials. Nevertheless, diagnostic parameters (i.e., sensitivity, specificity, accuracy, positive and negative likelihood ratios, and posttest probability of disease) have not been reported yet [23]. The real-time PCR procedures for analysis of plant samples imprinted or immobilized on membranes or individual vector squashed preparations [7, 8] are the more user-friendly options to accurately monitor the presence of CTV at high disease prevalence as is shown in Fig. 1, where relation between pre- and posttest probability of CTV infection according to the results obtained by tissue print-ELISA, tissue-print real-time RT-PCR, and the combination of both techniques is shown. Also, real-time RT-PCR for CTV is a convenient technique to assess or certificate the viral absence from an analyzed plant material [2]. The tissue-print method is practical, simple, robust, readily available, safe, discrete, and cost-effective [5]. The in situ printed or squashed (immobilized) samples could be mailed to a central laboratory for analysis at room temperature.

2

Materials The solid supports must be handled with care using gloves. The Eppendorf or microcentrifuge tubes for helping in disruption of the specimens when squashing arthropods on the membrane must be clean and sterile before use. The Eppendorf tubes, microtiter ELISA plates, and real-time PCR plate seals must be sterilized

58

Mariano Cambra et al.

Fig. 1 Relation between pre- and posttest probability of CTV infection according to the results obtained by tissue print-ELISA, tissue-print real-time RT-PCR, and the combination of both techniques. (Reprinted from Vidal E, Yokomi RK, Moreno A, Bertolini E, Cambra M, 2012. Calculation of Diagnostic Parameters of Advanced Serological and Molecular Tissue-Print Methods for Detection of Citrus tristeza virus: A Model for Other Plant Pathogens. Phytopathology 102:114–121)

before use, as well as the scissors, scalpel, and tweezers used to cut and handle membranes. Prepare the real-time RT-PCR solutions using ultrapure molecular grade water following the recommendations by the IPPCFAO [23].

Tissue Print and Squash Real-Time RT-PCR

2.1 Tissue Print and Squash

59

1. Whatman 3MM paper (0.45 mm). 2. Positively charged nylon membranes. 3. Nitrocellulose membranes. 4. Sterile gloves without powder. 5. Eppendorf, microcentrifuge tubes or microtiter ELISA plates. 6. Scissors, scalpel, and tweezers. 7. Glycine buffer: 0.1 M glycine, 0.05 M NaCl, and 1 mM EDTA. 8. Thermoblock for microtubes or microtiter plates. 9. Vortex for microtubes or microtiter plates. 10. Microcentrifuge. 11. Micropipettes (P10, P20, P100, P200). 12. Sterile RNase-free 10, 20, 100, and 200 μL pipette tip cones.

2.2 Real-Time RT-PCR

1. Micropipettes (P10, P20, P100, P200). 2. Sterile RNase-free 10, 20, 100, and 200 μL pipette tip cones. 3. Sterile gloves without powder. 4. Ultrapure molecular grade water. 5. Real-time PCR plates or microtubes. 6. Real-time PCR plate seal. 7. Real-time thermal cycling machine. 8. 10 μM primer solutions: (a) 30 UTR1: 50 - CGTATCCTCTCGTTGGTCTAAGC -30 . (b) 30 UTR2: 50 -ACAACACACACTCTAAGGAGAACTTC TT-30 . or (c) P25F: 50 - AGCRGTTAAGAGTTCATCATTRC -30 . (d) P25R: 50 - TCRGTCCAAAGTTTGTCAGA-30 . 9. 5 μM TaqMan probe solutions: (a) 181T: FAM-TGGTTCACGCATACGTTAAGCCTCACTTG-TAMRA. or (b) CTV-CY5: CY5-CRCCACGGGYATAACGTACACTCGG. 10. One-step real-time RT-PCR master mix and enzyme mix.

3 3.1

Methods Tissue Print

1. Sample collection (see Note 1). 2. Make several partially overlapping imprints from different tissues on about 0.5 cm2 of the membrane, and allow to dry for 2 min (see Note 2 and Fig. 2a).

60

Mariano Cambra et al.

Fig. 2 Tissue-print and squash capture procedure for direct sample preparation. (a) Leaf petioles of two handdetached leaves/shoots (total of five shoots/tree collected around the canopy) are directly firmly pressed on the membrane. Printed membranes can be kept for several months in a dry and dark place at room temperature (18–25  C) or into a plastic bag at 20 or  80  C. The printed membranes can be mailed at room temperature into a protected envelop to a central laboratory for analyses. (b) Carefully cut the membrane around the imprinted samples, and place inside a microcentrifuge tube. (c) Discs containing the imprinted samples are placed inside the microtiter ELISA wells for large-scale testing. (d, e) Squash fresh single aphid or individuals already preserved in alcohol on membrane with the rounded end of microcentrifuge tube. A complete disruption of the tissues of the tested arthropods is necessary. In the figures Aphis spiraecola individuals are squashed. (e) 100 μL of glycine buffer are added to each piece of membrane harboring the sample into a microcentrifuge tube. The tube is incubated at 95  C for 10 min, vortexed, and placed on ice until use

3. Carefully cut the membrane (see Notes 3 and 4) around the imprinted samples, and insert into Eppendorf or any microcentrifuge tubes, or place inside microtiter ELISA wells for large-scale testing (see Fig. 2b, c). 4. Add 100 μL of glycine buffer, incubate at 95  C for 10 min, vortex, and place on ice until use (see Note 3). 5. Use 5 μL of the extract for direct real-time RT-PCR assays. 3.2

Squash

1. Squash fresh single aphid or individuals already preserved in alcohol on membrane with the rounded end of an Eppendorf or any microcentrifuge tube. A complete disruption of the tissues is necessary. Use a different Eppendorf tube for each squashed sample (see Notes 4 and 5 and Fig. 2d, e). 2. Carefully cut the squashed arthropod species immobilized on membranes around the samples, and insert into Eppendorf or any microcentrifuge tubes, or place inside ELISA microplate wells for large-scale testing.

Tissue Print and Squash Real-Time RT-PCR

61

3. Add 100 μL of glycine buffer, incubate at 95  C for 10 min, vortex, and place on ice until use (see Note 3 and Fig. 2f). 4. Use 5 μL of the extract for direct real-time RT-PCR assays. 3.3 Real-time RT-PCR

1. Prepare the A or B real-time RT-PCR cocktails according to the following conditions (see Notes 6 and 7):

A (μL)

B (μL)

Ultrapure water

0.95

6.6

2 RT-PCR master mix

12.5

12.5

25 RT-PCR enzyme mix

1.0

0.5

10 μM primer UTR1/P25F

2.4

1.0

10 μM primer UTR2/P25R

2.4

2.0

5 μM probe 181 T/CTV-CY5

0.75

0.4

RNA sample

5.0

2.0

Final volume

25.0

25.0

2. In the case of using the validated protocol A, dispense 20 μL of the cocktail in each PCR plate well and after 5 μL of the sample from tissue print or squash (see Note 6). 3. Perform amplification steps as follows: 10 min at 45  C, 10 min at 95  C, and 45 cycles of 15 s at 95  C and 1 min at 60  C. 4. As an example, amplification curves are shown for plant material (see Fig. 3) and for squashed aphid species (see Fig. 4). 5. In the case of the protocol B (see Note 7), dispense 23 μL of the cocktail in each PCR plate well and after 2 μL of the sample from tissue print or squash. 6. Perform amplification steps as follows: 2 min at 55  C, 5 min at 95  C and 40 cycles of 15 s at 95  C and 30 s at 59  C. 7. The amplification is positive if the positive control produces an amplification curve with the virus-specific primers and probe, and the negative extraction control and negative amplification control do not produce amplification curves with the virusspecific primers and probe. The test on a sample will be considered positive if it produces a typical amplification curve in an exponential manner. The cycle threshold (Ct) value needs to be verified in each laboratory when implementing the test for the first time [23]. In the validated protocol A, the samples are currently submitted to 40–45 Ct and the amplification results analyzed; consequently a sample is considered positive when it produces a Ct value of 40 and the positive controls show amplification. Data acquisition (FAM/TAMRA) and analyses are performed with the software provided with the real-time thermal cycler instrument. The default threshold set by the instrument needs to be adjusted above the noise to the linear part of the growth curve.

4

Notes 1. Collect plant material from adult trees or nursery plants according to [22–24]. Hand collection of plant material is recommended to avoid contamination among samples when using scissors. If scissors are used, avoid the use of the material close to the section. Five young or mature shoots, five mature fruits (including peduncle), five flowers, or ten fully expanded mature leaves including petioles can be collected from around

Tissue Print and Squash Real-Time RT-PCR

63

Fig. 4 Typical amplification curves obtained from squashed aphid species. Note that amplification curves corresponding to aphids start at Ct 30 compared with the tissue-printed citrus material (Ct 17) from which experimentally aphids acquired CTV

the canopy of the adult tree. For nursery plants collect one shoot or two mature leaves per rootstock or already grafted nursery plant. Store the samples at 2–4  C for a maximum of 1 week. 2. Directly firmly press the leaf petiole (see Fig. 2a) of two handdetached leaves/shoots (total of ten) or a fresh section of the shoot (total of five) or flower peduncles or fruit peduncles (total of five) for adult trees or one section of shoot or two leaf petioles on Whatman 3MM paper (0.45 mm) (GE Healthcare, Europe), on positively charged nylon (Roche), or on 0.45 mm nitrocellulose (NCM, NitroBind Micron Separations Inc., Westborough, MA, USA) or Millipore membranes. Printed membranes can be kept for several months in a dry and dark place at room temperature (18–25  C) or into a plastic bag at 20 or  80  C for longer storage. Printed or immobilized samples can be mailed to a central laboratory at room temperature in order to be analyzed. The tissue print can be

64

Mariano Cambra et al.

done under field conditions in situ using gloves to avoid touching the membrane. 3. The yield, efficiency, and reproducibility for CTV detection and quantitation are optimal probably because it preserves the integrity of the nucleic acids and removes efficiently citrus PCR inhibitors. Optionally the pieces of membranes harboring samples can be inserted into Eppendorf tubes or microtiter ELISA plate wells and stored at 20  C until use. The rest of the extract can be frozen at 80  C for successive analysis (for a maximum of 2–3 times of freezing/thawing steps) after removing the piece of membrane harboring the sample. 4. The recommended membranes for squash are Whatman 3MM paper (0.45 mm) (GE Healthcare, Europe), positively charged nylon (Roche), nitrocellulose (NCM, NitroBind Micron Separations Inc., Westborough, MA, USA), or Millipore membranes. The aphids can be caught by any trap (i.e., Moericke yellow or green traps or by sticky traps or plants). 5. The squashed samples immobilized on the support can be kept for several months in a dry and dark place at room temperature (18–25  C) or into a plastic bag at 20  C or 80  C for years. The squashed specimens can be mailed to a central laboratory for analyses into a protected envelope. The squash of vector species can be done under field conditions using gloves to avoid touching the membrane. 6. For real-time RT-PCR analysis according to Bertolini et al. (2008) [7], use the primers 30 UTR1 and 30 UTR2, coupled with 181 T FAM-TAMRA TaqMan probe. The expected amplicon size is 95 bp. The reaction is carried out in a final volume of 25 μL. 7. For real-time RT-PCR analysis according to Saponari et al. (2008) [8], use the primers P25F and P25R coupled with CTV-CY5 TaqMan probe. The expected amplicon size is 101 bp. The reaction is carried out in a final volume of 25 μL.

Acknowledgment This work was supported by Instituto Nacional de Investigaciones Agrarias (INIA) and Instituto Valenciano de Investigaciones Agrarias (IVIA) grants and for Plant Print Diagnostics SL agreements for the development and validation of direct methods of sample preparation. The methods were patented in Spain, EU: (1) “Procedure for targets preparation prior to PCR,” N P9601155/6, May 17, 1996, by M. Cambra, A. Olmos, and MA Dası´ (IVIA) and (2) “Procedure for direct and specific detection of ‘Candidatus Liberibacter spp’, Potato spindle tuber viroid, Citrus exocortis viroid

Tissue Print and Squash Real-Time RT-PCR

65

and Peach latent mosaic viroid by immobilized targets and real-time PCR,” N 2001001157, September 8, 2010 (IVIA and Fundecitrus), by E. Bertolini, M. Cambra, P. Serra, MM Lo´pez, S. Lopes, N. Dura´n-Vila, J. Ayres, and JM. Bove´. We are grateful to the authors and to the people of the Virology and Immunology Department team of Plant Protection and Biotechnology Centre of IVIA that participated in the research involved in this work over the last 20 years. References 1. Moreno P, Ambros S, Albiach-Marti MR et al (2008) Citrus tristeza virus: a pathogen that changed the course of the citrus industry. Mol Plant Pathol 9:251–268 2. Vidal E, Yokomi RK, Moreno A et al (2012) Calculation of diagnostic parameters of advanced serological and molecular tissueprint methods for detection of Citrus tristeza virus. A model for other plant pathogens. Phytopathology 102:114–121 3. Schaad NW, Frederick RD (2002) Real-time PCR and its application for rapid plant disease diagnostics. Can J Plant Pathol 24:250–258 4. Lo´pez MM, Llop P, Olmos A et al (2009) Are molecular tools solving the challenges posed by detection of plant pathogenic bacteria and viruses? Curr Issues Mol Biol 11:13–46 5. De Boer SH, Lo´pez MM (2012) New growerfriendly methods for plant pathogen monitoring. Annu Rev Phytopathol 50:197–218 6. Ruiz-Ruiz S, Moreno P, Guerri J et al (2007) A real-time RT-PCR assay for detection and absolute quantitation of Citrus tristeza virus in different plant tissues. J Virol Methods 145:96–105 7. Bertolini E, Moreno A, Capote N et al (2008) Quantitative detection of Citrus tristeza virus in plant tissues and single aphids by real-time RT-PCR. Eur J Plant Pathol 120:177–188 8. Saponari M, Manjunath K, Yokomi RK (2008) Quantitative detection of Citrus tristeza virusin citrus and aphids by real-time reverse transcription-PCR (TaqMan). J Virol Methods 147:43–53 9. Olmos A, Dası´ MA, Candresse T et al (1996) Print capture PCR: a simple and highly sensitive method for the detection of Plum pox virus (PPV) in plant tissues. Nucleic Acids Res 24:2192–2193 10. Osman F, Rowhani A (2006) Application of the spotting sample preparation technique for the detectionof pathogens of woody plants by RT-PCR and real-time RT-PCR (TaqMan). J Virol Methods 133:130–136

11. Schaad NW, Berthier-Schaad Y, Knorr D (2007) A high throughput membrane BIO-PCR technique for ultrasensitive detection of Pseudomonas syringae pv. phaseolicola. Plant Pathol 56:1–8 12. Capote N, Bertolini E, Olmos A et al (2009) Direct sample preparation methods for the detection of Plum pox virus by real-time RT-PCR, validation and practice parameters. Int Microbiol 12:1–6 13. Fujikawa T, Miyata SI, Iwanami T (2013) Convenient detection of the citrus greening (huanglongbing) bacterium ‘Candidatus Liberibacter asiaticus’ by direct PCR from the midrib extract. PLoS One 8:e57011 14. Cambra M, Gorris MT, Roma´n MP et al. (2000) Routine detection of Citrustristeza virus by direct immunoprinting-ELISA method using specific monoclonal and recombinant antibodies. In: Da Grac¸a JV, Lee RF, Yokomi RK (eds). Proceedings of the 14th International Organization of Citrus Virologists, IOCV, Riverside, pp 34-41 15. Marroquı´n C, Olmos A, Gorris MT et al (2004) Estimation of the number of aphids carrying Citrus tristeza virus that visit adult citrus trees. Virus Res 100:101–108 16. Olmos A, Bertolini E, Gil M et al (2005) Realtime assay for quantitative detection of non persistently transmitted Plum pox virus RNA targets in a single aphid. J Virol Methods 128:151–155 17. Cambra M, Bertolini E, Olmos A et al (2006) Molecular methods for detection and quantitation of virus in aphids. In: Cooper I, Kuhne T, Polischuk V (eds) Virus diseases and crop biosecurity. Springer, Dordrecht, pp 81–88 18. Moreno A, Fereres A, Cambra M (2009) Quantitative estimation of Plum poxvirus targets acquired and transmitted by a single Myzuspersicae. Arch Virol 154:1391–1399 19. Bertolini E, Felipe RTA, Sauer AV et al (2014) Tissue-print and squash real-time PCR for direct detection of ‘Candidatus Liberibacter’

66

Mariano Cambra et al.

species in citrus plants and psyllid vectors. Plant Pathol 63:1149–1158 20. Teresani G, Herna´ndez E, Bertolini E et al (2015) Search for potential vectors of ‘Candidatus Liberibacter solanacearum’: population dynamics in host crops. Span J Agric Res 13 (1):e10-002 21. Harju VA, Henry CM, Cambra M et al (2000) Diagnostic protocols for organisms harmful to plants-DIAGPRO. Bull EPPO/OEPP Bull 30:365–366

22. Cambra M, Gorris MT, Olmos A et al. (2002) European Diagnostic Protocols (DIAGPRO) for Citrus tristeza virus in adult trees. In: Da Grac¸a J, Milne R, Timmer LW (eds). Proceedings of 15th International Organization of Citrus Virolologist, IOCV, Riverside, pp 69–77 23. IPPC-FAO (2016) Diagnostic protocols for regulated pests. Citrus tristeza virus. ISPM 27:2016, DP 15, p 22 24. EPPO (2004) Diagnostic protocols for regulated pests. Citrus tristeza closterovirus. PM7/31. Bull OEPP/EPPO Bull 34:239–246

Chapter 6 Detection of Citrus tristeza virus and Coinfecting Viroids Maria Saponari, Stefania Zicca, Giuliana Loconsole, Beatriz Navarro, and Francesco Di Serio Abstract Citrus can host a number of important vector- and graft-transmissible pathogens which cause severe diseases. Citrus disease management and clean stock programs require pathogen detection systems which must be economical and sensitive to maintain a healthy citrus industry. Rapid diagnostic tests for simultaneous detection of major graft-transmissible disease agents enable reduction of cost and time. The genetic and biological features of viruses and viroids can vary according to the strains/variants, with severe and mild strains described within the same species. The use of diagnostic tests that can allow to selectively discriminate severe strain(s) is a powerful tool to intercept the most harmful strains and to reduce the need for biological indexing. Moreover a combination of these detection methods will facilitate the studies on the interactions between CTV and viroids, a research topic only partially explored so far. Key words Mixed infection, Simultaneous detection, Multiplex, Citrus tristeza virus, Citrus exocortis viroid, Hop stunt viroid, Cachexia

1

Introduction Citrus tristeza virus (CTV) is a phloem-limited pathogen that, depending on the virus isolate and the variety/rootstock combination, may induce three different syndromes (decline, stem pitting, seedling yellowing) or may remain completely latent [1, 2]. The molecular mechanisms underlying symptom expression have been only weakly understood. Modification of the accumulation of small RNAs, including miRNAs, in CTV-infected citrus plants [3] and elicitation of virus-like symptoms through ectopic expression of the CTV RNA silencing suppressor protein p23 [4] support the involvement of RNA silencing, although further research is needed to completely dissect CTV pathogenesis [1]. Citrus species are also frequently infected by viroids, mostly reported in mixed infection. Eight viroids naturally infecting citrus species have been identified, including members of viroid species of the genera Pospiviroid (Citrus exocortis viroid) [5], Hostuviroid

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_6, © Springer Science+Business Media, LLC, part of Springer Nature 2019

67

68

Maria Saponari et al.

(Hop stunt viroid) [6], and Apscaviroid (Citrus bark cracking viroid, Citrus bent leaf viroid, Citrus dwarfing viroid, Citrus viroid V, Citrus viroid VI) [7] and the recently reported Citrus viroid VII, which has been proposed as a new species of the genus Apscaviroid [8]. However, so far only CEVd and certain HSVd variants, causing exocortis and xyloporosis and cachexia diseases, respectively, have been associated with citrus diseases with significant economic impact in citrus production worldwide [9]. Although frequently found in nature, mixed virus/viroid infection in citrus have been poorly investigated, so far. In the study of Serra and colleagues [10], the titer of CDVd was found enhanced in Mexican lime plants coinfected with CTV. The viral encoded RNA silencing suppressors p23 and, at lesser extent, p25 are likely involved in this phenomenon [10]. Moreover, in another study, several genes known to be regulated by sRNA have been found to be differentially expressed in grapefruits simultaneously infected by CTV and CDVd with respect to the healthy ones [11]. These findings support both (a) the involvement of RNA silencing in the interplay between citrus hosts and the coinfecting CTV and CDVd and (b) the possibility that CTV-encoded suppressor proteins impair the RNA silencing-based system counteracting viroid infection [12]. At the same time, these studies open the relevant question on whether and at which extent CTV infection may interfere with other viroids during natural mixed infections. To further investigate the interference between viruses and viroids, the availability of fast reliable and specific detection methods is particularly relevant. Perennial crops like citrus are commonly subjected to coinfections associated to different pathogens. Given the widespread occurrence of multiple infections in citrus, i.e., presence of viruses and viroids, several protocols have been developed in the past years to simultaneously detect their presence. Indeed, the existence of biological different strains of viruses and viroids infecting citrus prompted the development of strain-specific assays based primarily on molecular makers capable to differentiate severe from mild variants. Here, we report the real-time PCR protocols currently available to detect simultaneously CTV, HSVd, and CEVd (see Fig. 1) and for differentiating the HSVd “pathogenic variants” that induce the cachexia disease in sensitive hosts from the “nonpathogenic variants” that infect the same hosts without inducing symptoms. The latter method includes two different high-resolution melting (HRM) temperature assays, both allowing the differentiation of HSVd variants. The first assay is based on the use of the DNA intercalant EvaGreen (assay A) (see Fig. 2), whereas the second one is based on an asymmetric PCR coupled with the use of a specific TaqMan probe.

CTV and Viroid Detection

69

Fig. 1 Multiplex RT-qPCR assays with primers/probes for Citrus tristeza virus (CTV) (a), Hop stunt viroid (HSVd) (b), and Citrus exocortis viroid (CEVd) (c)

2

Materials Prepare all solutions using ultrapure water. Use only sterile tips with filter to avoid contamination among samples.

2.1 Total Nucleic Acid (TNA) Extraction

1. Extraction Buffer: 2% CTAB, 0.1 M Tris–HCl (pH 8), 20 mM EDTA (pH 8), 1.4 M NaCl. 2. Autoclaved TE buffer: 10 mM Tris–HCl (pH 8.0), 1 mM EDTA (pH 8.0). 3. Extraction bags. 4. Chloroform: Isoamyl alcohol 24:1. 5. Cold isopropanol stored at
20  C. 6. 75% ethanol (v/v) stored at
20  C. 7. Nuclease-free microcentrifuge tubes (1.5 mL and 2 mL). 8. Pipettes for micro-volumes (P20, P200, P1000). 9. Sterile filter tips (20 μL, 200 μL, 1000 μL). 10. Extraction platform [Homex, Bioreba, or similar apparatus]. 11. Refrigerated benchtop centrifuge for 1.5–2 mL microcentrifuge tubes. 12. Chemical hood. 13. UV spectrophotometer (Nanodrop 1000 or similar).

70

Maria Saponari et al.

Fig. 2 Discrimination of Hop stunt viroid (HSVd) variants in field samples by real-time RT-PCR and HRM analysis based on EvaGreen (assay A). Normalized (a) and difference plots (b) obtained on a panel of HSVdinfected samples. Different colors are used to indicate distinct profiles, corresponding to the HRM-based clusters indicated with a different number. Red curves indicate HSVd-a variant (non-cachexia), blue curves the HSVd-b (cachexia), and green curves the HSVd-h (intermediate) variants. Green and red columns represent pre- and post-melting normalization regions

CTV and Viroid Detection

71

Table 1 Primer and probes for real-time reverse transcription PCR detection of Citrus tristeza virus (CTV), Citrus exocortis viroid (CEVd), and Hop stunt viroid (HSVd) Target pathogen Primer/probe

Name

Sequence 50 -30

Primers and probe for CTV CTV Forward primer P25F AGCRGTTAAGAGTTCATCATTRC Reverse primer P25R TCGRTCCAAAGTTTGTCAGACA Probe CP probe FAM-CRCCACGGGYATAACGTACACTCGGBHQ1 Primers and probe for HSVd and CEVd HSVd Forward primer HSVd-f CTCTTCTCAGAATCCAGCG Reverse primer HSVd-r GGACGATCGATGGTGTTTCGAA Probe HSVd-pr TEXAS RED - AGAGAGGGCCGCGGTGCTC BHQ1 CEVd Forward primer CEVd-f GCGTCCAGCGGAGAAACA Reverse primer CEVd-r CAGCGACGATCGGATGTG Probe CEVd-pr CY5-AGCTCGTCTCCTTCCTTTCGCTGCTGBHQ1

2.2 Real-Time RT-PCR for Simultaneous Detection of CTV, HSVd, and CEVd

Reference [13]

[14]

[14]

1. Real-time PCR instrument and software. 2. iQ™ Multiplex Powermix (Biorad or equivalent products). 3. M-MLV Reverse Transcriptase (200 U/L). 4. Individual tubes/8-strip low profile tubes and ultra-clear caps/ plates (48 or 96 wells) and plate seals. 5. Pipettes for micro-volumes (P10, P20, P200, P1000). 6. Sterile filter tips (10 μL, 20 μL, 200 μL, 1000 μL). 7. 10 μM primers (Desalt) and 10 μM probes (PAGE or HPLC purification) (Table 1). 8. Vortex mixer. 9. Benchtop refrigerated centrifuge.

2.3 Real-Time RT-PCR for Differentiation of HSVd Variants: Assay A 2.3.1 cDNA Synthesis

1. RNase-free water. 2. 200 U/L M-MLV Reverse Transcriptase. 3. 5 M-MLV Buffer. 4. DTT. 5. 10 mM dNTP mix (each). 6. 40 U/μL RNaseOUT™ RNase Inhibitor. 7. Random hexamers (alternatively gene-specific reverse primer can be used). 8. Pipettes for micro-volumes (P10, P20, P200, P1000). 9. Sterile filter tips (10 μL, 20 μL, 200 μL, 1000 μL).

72

Maria Saponari et al.

Table 2 Primer and probes for the differentiation of cachexia and non-cachexia variants of Hop stunt viroid (HSVd) Primer/probe

Name

Sequence 50 -30

Primers and probe for “assay A” Forward primer HSVd-hrm-f CTCTTCTCAGAATCCAGCG Reverse primer HSVd-hrm-r GAAGCCTCTACTCCAGAGCA Primers and probe for “assay B” Forward primer HSVd-f CTCTTCTCAGAATCCAGCG Reverse primer HSVd-hrm-r GGACGATCGATGGTGTTTCGAA Probe for the non-cachexia HSVd-prNC CY5-CCC TCT CTC CTA CGC CTC motif TCG- BHQ-1

Reference [15]

[15]

10. Vortex mixer. 11. Benchtop centrifuge. 12. Heat block (at 70  C and 42  C). 2.3.2 Real-Time PCR

1. Precision Melt Supermix (containing the DNA intercalant dye EvaGreen) [Biorad]. 2. Individual tubes/8-strip low profile tubes and ultra-clear caps/ plates (48 or 96 wells) and plate seals. 3. 10 μM primers (Desalt) (Table 2).

2.4 Real-Time RT-PCR for Differentiation of HSVd Variants: Assay B

1. GoTaq DNA polymerase [Promega, or any Taq DNA polymerase lacking 50 -30 exonuclease activity]. 2. Individual tubes/8-strip low profile tubes and ultra-clear caps/ plates (48 or 96 wells) and plate seals.

2.4.1 cDNA Synthesis (See Subheading 2.3.1) 2.4.2 Real-time PCR

3

3. 10 μM primers (Desalt) and TaqMan probe (HPLC purification) (Table 2).

Methods

3.1 Total Nucleic Acid (TNA) Extraction

1. Recover 0.5–1 g of fresh small pieces of midribs or phloem tissue from young stems of citrus trees (see Note 1). Transfer the tissue into the extraction bags or into suitable tubes with 5 mL of CTAB buffer. Apply homogenization of tissue prepared (see Note 2) using the Homex [Bioreba] extraction platform or similar. 2. Transfer 1 mL of sap into 2 mL microcentrifuge tubes.

CTV and Viroid Detection

73

3. Heat the samples at 65  C for 30 min. 4. Centrifuge samples at 12,000  g for 5 min, and transfer 1 mL to a new 2 mL microcentrifuge tube, being careful not to transfer any of the plant tissue debris. Add 1 mL of chloroform: isoamyl alcohol 24:1, and mix well by shaking (see Note 3). 5. Centrifuge sample at 18,630  g for 10 min. Transfer 700 μL to a 1.5 mL microcentrifuge tube, and add 450 μL (approximately 0.6 V) of cold isopropanol. Mix by inverting two times. Incubate at 4  C or
20  C for 20 min. 6. Centrifuge the samples at 16,060  g for 20 min and decant the supernatant. 7. Wash pellet with 1 mL of 70% ethanol. Centrifuge sample at 16,060  g for 10 min and decant 70% ethanol. 8. Air-dry the samples or use a vacuum. 9. Resuspend the pellet in 100–150 μL of TE or RNase- and DNase-free water (see Note 4). 10. Determine the concentration using a UV spectrophotometer [Nanodrop 1000 or similar]. Read the absorption (A) at 260 nm and at 280 nm. Optimal A260/280 ratio should be close to 2 for high-quality nucleic acid (see Note 4). 3.2 Multiplex RealTime RT-PCR for Simultaneous Detection of CTV, HSVd, and CEVd

Include in each assay CTV-positive and CTV-negative controls and the non-template control (NTC). 1. Set up 20 μL qPCR reaction containing a mixture of components listed below (see Note 5): iQ™ Multiplex Powermix (2)

10 μL

M-MLV Reverse Transcriptase

0.25 μL

10 μM CP25 forward primer

0.6 μL

10 μM CP25 reverse primer

0.6 μL

10 μM CP25 TaqMan probe

0.3 μL

10 μM HSVd-f forward primer

0.6 μL

10 μM HSVd-r reverse primer

0.6 μL

10 μM HSVd-pr TaqMan probe

0.3 μL

10 μM CEVd-f forward primer

0.6 μL

10 μM CEVd-r reverse primer

0.6 μL

10 μM CEVd-pr TaqMan probe

0.3 μL

Nuclease-free water

3.25 μL

74

Maria Saponari et al.

2. Add 2 μL of CTAB-extracted total nucleic acid. Start the qPCR cycling using the following parameters:

Step

Temperature ( C)

Time

Reverse transcription

42

15 min

1

DNA denaturation

95

2 min

1

DNA denaturation 95 Annealing/extension + plate 58 read

15 s 40 s

Number of cycles

40

The typical result of a real-time PCR analysis with a detection system based on three dyes is an amplification plot with a curve for each detector (see Fig. 1). Since the level of fluorescence signal is variable depending on the dye, a threshold value will be independently set for each curve. The amplification signal for each dye will be considered positive whenever the amplification curve crosses its threshold value (quantitation cycle—Cq). Therefore, samples will be considered positive (presence of the CTV and/or HSVd and/or CEVd) whenever they display a FAM and/or TEXAS RED and/or CY5-positive signals, with a typical amplification curve consisting of an exponential increase phase and a plateau. By contrast, samples will be considered negative (absence of all or some of the target pathogens) only when the corresponding signal is negative. In general, samples with Cq < 30–32 are considered positives; samples yielding Cq > 32 are considered doubtful and should be retested. 3.3 Real-Time RT-PCR for Differentiation of HSVd Variants: “Assay A” and “Assay B” 3.3.1 Synthesis of the cDNA

Include in each assay HSVd-positive and HSVd-negative controls and the non-template control (NTC). HSVd-positive controls must include samples previously characterized and known to contain non-cachexia and cachexia variants (reference variants).

1. Set up the cDNA synthesis reaction by mixing the following components: 50 μM random hexamers

1 μL

10 mM dNTP mix (each)

1 μL

CTAB extracts

Up to 11 μL

Nuclease-free water

Up to a final volume of 13 μL

2. Heat reaction mix at 70  C for 5 min, and then cool the reaction to 4  C on ice.

CTV and Viroid Detection

75

3. Briefly spin down tubes and add reagents described below (see Note 5): Nuclease-free water

Up to a final volume of 20 μL

5 M-MLV Buffer

4.0 μL

100 mM DTT

1.2 μL

40 U/μL RNaseOUT™ RNase Inhibitor

1.0 μL

200 U/μL M-MLV Reverse Transcriptase

0.5 μL

4. Incubate the reaction at 42  C for 45 min. 5. Incubate the reaction at 70  C for 15 min and then cool down in ice. 3.3.2 Real-Time PCR: Assay A

1. Set up 10 μL real-time PCR reactions by mixing the components listed below (see Note 5): 2 Precision Melt Supermix

5 μL

10 μM HSVd-hrm-f

0.3 μL

10 μM HSVd-hrm-r

0.3 μL

cDNA

1 μL

Nuclease-free water

3.4 μL

2. Set the thermocycler program as follows: Step

Temp

Initial denaturation 98  C Amplification



98 C 58  C

Time 2 min 30 s 5s

No. of cycles 1 40

Melt curve analysis From 65  C to 95  C with 0.2  C increment each 10 s

The result of the real-time PCR analysis based on the intercalant dye EvaGreen consists of (a) an amplification plot with amplification curve corresponding to the amplification of HSVd (regardless the variants) and (b) a melting curve plot (see Fig. 2) which allows to distinguish the HSVd variants. The amplification signal for each sample will be considered positive whenever the amplification curve crosses its threshold value (quantitation cycle—Cq), with a typical amplification curve consisting of an exponential increase phase and a plateau.

76

Maria Saponari et al.

By contrast, samples will be considered negative (absence of HSVd) only when the corresponding signal is negative. Analysis of the amplification plot will allow to define if a given sample is positive (Cq < 30–32), doubtful (Cq > 32), or negative (no Cq detected) for HSVd. The positive samples are then analyzed for the melting temperature (Tm). The melting curve analysis will yield a peak corresponding to the temperature at which 50% of strands are hybridized; each of HSVd sequence variants will have a specific Tm. Based on the Tm detected for each sample, the HRM software will then categorize the samples in clusters. Samples in a given cluster share the same Tm. The presence of a specific HSVd variant in the unknown samples will be associated based on the reference variant clustering in the same group. If a given sample falls in a distinct separate cluster from the reference HSVd variants incorporated in the assay, more analysis should be performed (i.e., sequencing the amplicon) to determine its specific variant. 3.3.3 Real-Time PCR: Assay B

1. Set up 25 μL real-time PCR reactions by mixing the following (see Note 5): 0.25 μL

GoTaq DNA polymerase ®

5 Colorless GoTaq Reaction Buffer

5 μL

10 μM HSVd-f forward primer

2.5 μL

10 μM HSVd-hrm-r reverse primer

0.125 μL

10 μM HSVd-prNC TaqMan probe

0.3 μL

cDNA

2.5 μL

Nuclease-free water

14.32 μL

2. Set the thermocycler program as indicated below: Step

Temp 

Initial denaturation 98 C Amplification

98  C 55  C 72  C

Time 1 min 5s 20 s 20 s

No. of cycles 1 40

Melt curve analysis 95  C 30 s 1 From 45  C to 90  C with a temperature increase rate of 0.5  C/step at 10 s intervals

The result of the asymmetric real-time PCR analysis based on the CY5-labeled TaqMan probe consists of (a) an amplification plot with amplification curve corresponding to the amplification of HSVd (regardless the variants) and (b) a melting

CTV and Viroid Detection

77

curve plot (similar to the one showed in Fig. 2 for assay A) which allows to distinguish the HSVd variants. The amplification signal for each sample will be considered positive whenever the amplification curve crosses its threshold value (quantitation cycle—Cq), with a typical amplification curve consisting of an exponential increase phase and a plateau. By contrast, samples will be considered negative (absence of HSVd) only when the corresponding signal is negative. Analysis of the amplification plot will allow to define if a given sample is positive (Cq < 30–32), doubtful (Cq > 32), or negative (no Cq detected) for HSVd. The positive samples are then analyzed for the Tm. Each of HSVd sequence variants will have a specific Tm, resulting from the dissociation of the DNA hybrids formed by the TaqMan HSVd-prNC: target sequence detected in the sample. Based on the Tm detected for each sample, the HRM software will then categorize the samples in clusters. Samples in a given cluster share the same Tm. The presence of a specific HSVd variant in the unknown samples will be associated based on the reference variant clustering in the same group. If a given sample falls in a distinct separate cluster from the reference HSVd variants incorporated in the assay, more analysis should be performed (i.e., sequencing the amplicon) to determine its specific variant.

4

Notes 1. Cetyltrimethylammonium bromide (CTAB) is toxic by inhalation. Use a protecting mask. 2. Fresh plant material is cut in small pieces with disposable razor blades or bleach-treated scissors to avoid sample to sample contamination and placed in a suitable tube or plastic bag. 3. Chloroform and chloroform-containing solutions are harmful and must be handled with appropriate protections such as gloves and lab coat and under an extractor hood. 4. Extracts of total nucleic acid can be stored at 4  C for immediate use or at
20  C for use in the future. 5. It is recommended when preparing the PCR reaction mixes, to calculate the needed quantities of components considering one additional sample than the actual number of samples to be tested (e.g., if you have 20 samples, mix sufficient quantity of reagents for 21 samples).

78

Maria Saponari et al.

References 1. Dawson WO, Garnsey SM, Tatineni S et al (2013) Citrus tristeza virus-host interactions. Front Microbiol 4:88. https://doi.org/10. 3389/fmicb.2013.00088 2. Moreno P, Ambros S, Albiach-Marti MR et al (2008) Citrus tristeza virus: a pathogen that changed the course of the citrus industry. Mol Plant Pathol 9:251–268 3. Ruiz-Ruiz S, Navarro B, Gisel A et al (2011) Citrus tristeza virus infection induces the accumulation of viral small RNAs (21-24-nt) mapping preferentially at the 30 -terminal region of the genomic RNA and affects the host small RNA profile. Plant Mol Biol 75:607–619 4. Flores R, Ruiz-Ruiz S, Soler N et al (2013) Citrus tristeza virus p23: a unique protein mediating key virus–host interactions. Front Microbiol 4:98 5. Duran-Vila N (2017) In: Hadidi A, Flores R, Randles JW, Palukaitis P (eds) Viroids and satellite. APS Elsevier, London, pp 169–179 6. Hataya T, Tsushima T, Sano T (2017) In: Hadidi A, Flores R, Randles JW, Palukaitis P (eds) Viroids and satellite. APS Elsevier, London, pp 199–210 7. Tessitori M (2017) In: Hadidi A, Flores R, Randles JW, Palukaitis P (eds) Viroids and satellite. APS Elsevier, London, pp 243–249 8. Chambers GA, Donovan NJ, Bodaghi S et al (2018) A novel citrus viroid found in Australia, tentatively named citrus viroid VII. Arch Virol 163:215–218 9. Hadidi A, Vidalakis G, Sano T (2017) Economic significance of fruit tree and grapevine

viroids. In: Hadidi A, Flores R, Randles JW, Palukaitis P (eds) Viroids and satellite. APS Elsevier, London, pp 15–25 10. Serra P, Bani Hashemian SM, Fagoaga C et al (2014) Virus-viroid interactions: citrus tristeza virus enhances the accumulation of citrus dwarfing viroid in Mexican lime via virusencoded silencing suppressors. J Virol 88:1394–1397 11. Visser M, Cook G, Burger JT et al (2017) In silico analysis of the grapefruit sRNAome, transcriptome and gene regulation in response to CTV-CDVd co-infection. Virol J 14:200 12. Flores R, Minoia S, Carbonell A et al (2015) Viroids, the simplest RNA replicons: how they manipulate their hosts for being propagated and how their hosts react for containing the infection. Virus Res 209:136–145 13. Saponari M, Keremane M, Yokomi RK (2008) Quantitative detection of Citrus tristeza virus in citrus and aphids by real-time reverse transcription-PCR (TaqMan®). J Virol Methods 147:43–53 14. Saponari M, Loconsole G, Liao HH et al (2013) Validation of high-throughput real time polymerase chain reaction assays for simultaneous detection of invasive citrus pathogens. J Virol Methods 193(2):478–486 ¨ nelge N, Yokomi RK et al 15. Loconsole G, O (2013) Use of real time RT-PCR and high resolution melting analysis for rapid differentiation of citrus Hop stunt viroid variants. Mol Cell Probes 27:221–227

Chapter 7 Assessment of Genetic Variability of Citrus tristeza virus by SSCP and CE-SSCP Elisavet K. Chatzivassiliou and Grazia Licciardello Abstract Single-strand conformation polymorphism (SSCP) is a popular method used to study the genetic heterogeneity and population variability of Citrus tristeza virus (CTV) isolates. It is a simple, low-cost, and highly specific method for mutation detection of specific genes, mostly of the CTV major coat protein gene (p25). The technique is based on a comparison on polyacrylamide gel of electrophoretic profiles of single-stranded (ss) DNA sequences in terms of their spatial conformation. SSCP involves cDNA synthesis and amplification of the target gene, denaturation of single strands, and electrophoresis in non-denaturing conditions. The ssDNAs can be afterward visualized by staining the polyacrylamide gel. Alternatively, using fluorescently labeled primers, the procedure can be performed in automated sequencers equipped with an appropriate capillary (CE-SSCP), which increases the potential of high-throughput analysis, precision, and the reproducibility of results. CE-SSCP can be also directly applied to the virus particles obtained by elution from ELISA plates or tissue-print membranes. Key words Single-strand conformation polymorphism (SSCP), Capillary electrophoresis (CE), CESSCP, Polymerase chain reaction (PCR), Polyacrylamide gel electrophoresis (PAGE), Silver staining, Genetic variability

1

Introduction Citrus tristeza virus (CTV) is one of the most complex plant viruses characterized by the genetic diversity of its isolates. It is responsible for three main syndromes in citrus trees, decline (“tristeza”), seedling yellows, and stem pitting [1], which lead to considerable losses for commercial citrus hosts [2, 3], according to aggressiveness of the isolates and scion/rootstock combinations. Typing of CTV strains is therefore considered key in predicting the disease impact [1]. Despite recent advances in the molecular analysis of the genome, the lack of sufficiently tested genetic markers for predicting the pathogenicity of CTV isolates does not enable “a phenotypic label, such as a ‘seedling yellows’ or a ‘stem pitting’ isolate on

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_7, © Springer Science+Business Media, LLC, part of Springer Nature 2019

79

80

Elisavet K. Chatzivassiliou and Grazia Licciardello

a genetic basis alone” [4]. Although the complete genome sequencing permits the unequivocal assignation of CTV isolates to a specific genotype, biological indexing is still the most accurate protocol to determine a phenotype classification [1, 4]. However, neither of procedures is simple or fast, they require specific structures and specialized personnel, and they are not suitable for largescale surveys. Single-strand conformation polymorphism (SSCP) was applied for the first time in human mutation studies to detect single base changes after the analysis of mobility shifts of single-stranded (ss) DNA [5]. The method soon became a useful tool with multiple applications [6, 7], including the study of the genetic heterogeneity of virus RNA populations, both for human or plant diseases [8–10]. Since its first application in CTV genetic studies [11], SSCP has been widely used to easily differentiate genomic variants of the virus [12], enabling the genetic diversity within or between isolates to be estimated. The method provides useful data regarding the population structure of field isolates, which often reveal mixed infections involving multiple virus strains, the composition of which is affected by host changes or aphid transmission [13–15]. SSCP has mainly been used for selecting diverse clones of CTV to be sequenced [8, 9, 12, 16–24], thus representing an efficient tool for typing CTV strains. As such, the method was further used to study the effect of aphids in CTV strain segregation and genetic bottleneck events [25]. Efforts have also been made to combine SSCP with pathogenicity studies in order to associate symptoms with CTV population structures [26, 27] and to specifically study the profile of mild and severe isolates [28], the stability of CTV protective isolates over time [29–31], or their temporal evolution in cross-protection experiments [32–34]. SSCP enables cDNA fragments of the virus to be differentiated according to the different spatial conformation of ssDNA after denaturation and electrophoretic migration in non-denaturing conditions. The method entails the synthesis of cDNA by reverse transcription followed by PCR amplification (RT-PCR) with specific primers. During the years, different primer sets and target genomic regions have been used for CTV, as reported in Table 1. After a denaturation step, which induces the separation of single strands and a comparison of electrophoretic mobility, even a single base substitution can be detected based on the different conformation of the secondary structure. Since SSCP detects the conformation polymorphisms of ssDNA molecules of selected genomic regions, better information on population diversities, not limited to a restricted sequence, is obtained by investigating different target regions selected according to nucleotide variations and genomic locations. However, SSCP results may be affected by several factors most of which are associated with polyacrylamide gel analysis, so in

Polymorphism Analysis by SSCP and CE-SSCP

81

order to obtain reproducible results, highly standardized electrophoretic conditions are needed [6]. The association of capillary electrophoresis with SSCP (CE-SSCP) enables the differences in electrophoretic migration of cDNA to be amplified and to detect any difference in more detail. This is possible, thanks to the use of a fluorescently labeled primer and the greater resolving power provided by the length of the capillaries, thus differentiating the mobility of each cDNA strand and allowing the simultaneous analysis of more than one target region. The automation and standardization of electrophoresis run conditions, provided by the use of a genetic analyzer, enable multiple samples to be handled (up to 96 in a single run), with a throughput of up to 100 samples per day [35]. CE-SSCP has been widely applied for mutation detections [36] or for categorizing influenza viruses [37]. In plant pathology, apart from CTV isolate discrimination [38], it has been used for the analysis of the spatial distribution of a Plum pox virus population [39] and for the study of other potyviruses [40]. This chapter describes the techniques and protocols used for genotyping CTV isolate variability by single-strand conformation polymorphism detected on non-denatured acrylamide gel (SSCP) or on capillary electrophoresis (CE-SSCP), sequentially after immunological tests and RT-PCR amplification of the gene of interest or coupled with PCR amplification of the respective recombinant colonies.

2 2.1

Materials General

1. Sterile RNase-/DNAse-free plastic wares (tubes, microtubes, tips, etc.). 2. Standard lab devices (gloves, pipettes, racks, glass or polyethylene trays, plastic containers, conical flasks, etc.). 3. Sterile razor blade, nipper, and tweezer. 4. Laboratory platform rocker. 5. Deionized water. 6. Molecular biology grade water (ultrapure). 7. Wet ice. 8. Bench-top microcentrifuge. 9. Microwave. 10. Storage/incubating devices for
80  C,
20  C, +4  C, +37  C, +60  C, +65  C, and +95  C. 11. Water bath. 12. Laboratory Safety Chemical Fume Hood.

82

Elisavet K. Chatzivassiliou and Grazia Licciardello

13. Analytical balance. 14. Vortex mixer. 15. Gas burned. 16. Orbital shaker. 2.2 Samples and Controls

1. Bark and/or leaves of citrus plants to be analyzed. 2. Leaves from infected plants to be used as positive controls. 3. Leaves from non-infected plants to be used as negative controls.

2.3

RNA Extraction

1. Sterilized mortars and pestles. 2. Liquid nitrogen. 3. TRIzol™ reagent [Invitrogen or equivalent] (see Note 1). 4. UV spectrophotometer [Thermo Scientific NanoDrop or equivalent].

2.4 Immunoenzymatic Detection and Virus Release

1. Single-use extraction bags [Bioreba or equivalent]. 2. Tissue homogenizer homogenizer].

[Homex

6,

Bioreba

or

Turrax

3. ELISA kit for CTV detection (see Note 2). 4. Tissue-print ELISA kit [Plant Print Diagnostics; Valencia, Spain]. 5. ELISA microplate reader [Bioreba or equivalent] for absorbance reading at OD450 nm. 6. Virus release buffer (VRB): 10 mM Tris–base, pH 8.0 with 1.0% (v/v) Triton X-100.

2.5 cDNA Synthesis and Amplification

1. Forward and reverse primers 10 μM each (Tables 1 and 2). 2. High fidelity Taq DNA polymerase (5 U/μL) (see Note 3). 3. RNase inhibitor (ribonuclease inhibitor) (24 U/μL). 4. M-MuLV reverse transcriptase (50 U/μL). 5. 25 mM MgCl2. 6. 10 mM dNTP mix (each). 7. Thermocycler apparatus.

2.6 Agarose Gel Electrophoresis

1. Molecular biology grade agarose. 2. 6 Loading dye for agarose gel electrophoresis. 3. 100 bp DNA ladder. 4. 0.5 M EDTA (ethylenediaminetetraacetic acid) solution (pH 8.0) (see Note 4).

CTV1 CTV10

CN150

p25

p25

CTV_CP1 CTV_CP3

CTV42 CTV43

p25 sense p25 reverse

CP-forward CP-reverse

p25

p25a

p25

p25

p27

AACGCCCTTCGAGTCTGGGGTAGGA TCAACGTGTGTTGAATTTCCCAAGC

TGAATTATGGACGACGAAAC TCAACGTGTGTTGAATTTCCC

CTCAAATTGCGRTTCTGTCT ATGTTGTTGCXGCXGAGTC

ATGGACGACGAAACAAAG TCAACGTGTGTTGAATTT

ATGGACGACGAAACAAAGAAATTG TCAACGTGTGTTGAATTTCCCA

AGATCTACCATGGACGACGAAACAAAG GAATTCGCGGCCGCTCAACGTGTGTTAAA TTTCC

ATATATTTACTCTAGATCTACCA TGGACGACGAAACAAA GAATCGGAACGCGAATTCTCAACGTGTG TTAAATTTCC

ATGGACGACGAAACAAAGAA ATCAACGTGTGTTGAATTTCC

Primer sequence (50 to 30 )

P27-E-3 Antisense 30 Febres

CAAACGCTCTACGTAAGT AAGCTTCTAGAACATGGCAGGTTATACAGTAC

Sense 50 Febres AAGCTTCTAGAACATGGCAGGTTATACAGTAC P27-P-3 ACTTACGTAGAGCGTTTGG

T36CP-F T36CP-R

p25

p27

CN119 CN120

p25

CN151

Primer set

Gene

Table 1 Primers used to analyze gene variability of CTV isolates by SSCP

281 bp

459 bp

273 bp

Cleaved by BstE II in 409 and 271 bp

417 bp

672 bp

672 bp

670 bp

670 bp

672 bp

Amplicon size

[9, 12]

50  C

(continued)

[27]

50  C

[28]

[25]

52  C

50  C

[26]

52  C

[28]

[16, 20]

56  C

50  C

[29, 30, 34]

[11, 15]

[8, 18, 22, 24, 41]

References

50  C

55  C

52 C



Annealing temperature

Polymorphism Analysis by SSCP and CE-SSCP 83

CPm-A CPm-B

PM 44 PM 45

PM68 (p18A) PM69 (p18B)

p20F p20R

PM48 (20A) PM49 (20B)

p20A p20B

p23 sense p23 reverse

PM50 PM51

PM46 PM47

p27

p18

p18

p20

p20

p20

p23

p23

p13

ORF1A F-forward F-reverse

GTGTTATCATGCGTCTGAAGCG GGAATCTTAATCCTAATCAAG

GTCGATAACTCGACAAACGAGC

ACGTGTTCGTGAAACGCGG

CCGTTGTAATAATCTCGTC AGACTCTAGTTATCGCAAGGT

ACTAACTTTAATTCGAACA AACTTATTCCGTCCACTTC

GTCTCTCCATCTTGCGGTGTAG CAATCAGATGAAGTGGTG

ACAATATGCGAGCTTACTTTA AACCTAACAGCAAGATGGA

CGAGCTTACTTTAGTGTTA TAATGTCAAACTGACCGC

ACAATATGCGAGCTTACTTTA AACCTACACGCAAGATGGA

ATGTCAGGCAGCTTGGGAAATTCA TAAGTCACGCTAAACAAAGT

TTCTATCGGGATGGTGGAGT GACGAGATTATTACAACGG

AAGCTTCTAGAAC ATGGCAGGTTATACAGTAC AACCGCGAATTCCAACTATAAGTACTTACCCA

CATGGCAGGTTATAC CTATAAGTACTTACCCAAATC

Primer sequence (50 to 30 )

In combination with CTV1 and CTV10 in a nested PCR

a

p27 sense P27 reverse

p27

ORF1A PM82 (A-forward) PM73 (A-reverse)

Primer set

Gene

Table 1 (continued) Annealing temperature

438 bp

528 bp

438 bp

698 bp

Cleaved with Nde I in 396 bp and 340 bp

557 bp

520 bp

549–561 bp

502 bp

425 bp

–

[13, 33] [12, 9, 19, 20] [21, 32, 33] [13, 14] [27] [32] [32] [9, 12, 14]

55  C 50  C 55  C 55  C 50  C 55  C 55  C 50  C

[9, 12]

[32]

55  C

50  C

[23]

[27]

References

–

Cleaved with Bgl II in 265 bp and 50  C 459 bp

Amplicon size

84 Elisavet K. Chatzivassiliou and Grazia Licciardello

p27 short FW p27 short RV p23 long FW p23 short RV P25 FW P25 RV

p27

p25

p23

Primer set

Gene

GCTCTACGTAAGTATGCTTG TAACCTTGACGTCTAGCTAAC CTGTGAACCTTTCTGACGAAAG TCTGAGACTGCGTATTGTTGAC CTCAAATTGCGRTTCTGTCT ATGTTGTTGCNGCNGAGTC

Primer sequence (50 to 30 ) HEX 6-FAM 6-FAM HEX NED VIC

Fluorescent dye

Table 2 Primers used to analyze gene variability of CTV isolates by CE-SSCP

415 bp

249 bp

224 bp

Amplicon size

58  C

58  C

57 C



Annealing temperature

[38]

References

Polymorphism Analysis by SSCP and CE-SSCP 85

86

Elisavet K. Chatzivassiliou and Grazia Licciardello

5. Tris-acetate-EDTA (TAE) buffer: 40 mM Tris base (pH 7.6), 20 mM glacial acetic acid, and 1 mM EDTA (see Note 5). 6. SYBR™ Safe DNA gel stain [Invitrogen or equivalent]. 7. Agarose gel electrophoresis system. 8. UV transilluminator. 2.7 Non-denaturing Polyacrylamide Gel Preparation and SSCP Gel Electrophoresis

1. 99% Formamide. 2. Xylene cyanol (optional). 3. Tetramethylethylenediamine (TEMED or TMEDA). 4. 0.5 M EDTA (pH 8.0) (see item 4 in Subheading 2.6). 5. Ammonium persulfate (APS): 10% (w/v) solution in water (see Note 6). 6. Acrylamide/bis-acrylamide (29.02:0.8): 30% (w/v) solution in water (see Note 7). 7. 1 Tris-borate-EDTA (TBE) buffer (pH about 8.3): 89 mM Tris base, 89 mM boric acid, and 2 mM EDTA (see Note 8). 8. Denaturing solution: 95% formamide, 20 mM EDTA, 0.05% bromophenol blue (see Note 9). 9. Vertical electrophoresis system (e.g., Bio-Rad vertical minigel apparatus). 10. Vacuum apparatus (optional).

2.8 Silver Staining of SSCP Gel

1. 10% (v/v) Acetic acid solution in water (see Note 10). 2. 37% (v/v) Formaldehyde solution in water. 3. 0.1% (w/v) Silver nitrate solution in water (see Note 11). 4. 1% (v/v) Nitric acid solution in water (see Note 10). 5. Staining solution: In 100 mL of 0.1% silver nitrate solution (see item 3 in Subheading 2.8), dilute 1.5 μL of 37% formaldehyde, just before use. 6. Development solution: Dissolve 3 g sodium carbonate (Na2CO3) and 0.0002 g sodium thiosulfate pentahydrate (Na2S2O3∙5H2O) in 100 mL of water by using a magnetic stirrer (this solution must be prepared fresh). Add 0.15% of 37% formaldehyde (always) just before use. 7. Vacuum apparatus (optional).

2.9 Denaturation of PCR Products and Capillary Electrophoresis Analysis

1. Hi-Di formamide [Applied Biosystems]. 2. GeneScan-500 ROX size standard [Applied Biosystems]. 3. GeneMapper® software [Applied Biosystems]. 4. POP™ Conformational Analysis Polymer (CAP) [Applied Biosystems].

Polymorphism Analysis by SSCP and CE-SSCP

87

5. Glycerol. 6. 10 Genetic Analyzer buffer [Applied Biosystems]. 7. 10 TBE [Applied Biosystems]. 8. Thermocycler apparatus. 9. PCR Cooler, iceless cold storage system for 96-well plates PCR plates. 10. ABI PRISM® 3130 Genetic Analyzer (4 capillaries, 36 cm length) [Applied Biosystems].

3

Methods SSCP analysis can be performed either on the amplicons obtained by RT-PCR of the double-stranded (ds) RNA of infected tissues (field isolates) or on the PCR products of recombinant Escherichia coli colonies of the respective gene. Various CTV genes (p13, p18, p20, p23, p25, p27) have been analyzed alone or in combination (Table 1). The major CP (p25) gene is the most used target. The PCR reaction for CE-SSCP requires the use of 50 fluorescent-labeled primers. GeneMapper software is then used to define the mobility of each strand using the internal size standard to generate a size-calling curve, which is recorded and stored in the internal database and represents the specific polymorphism of the sample.

3.1 Sample Preparation and dsRNA Extraction

The same dsRNA isolation procedure applies for both SSCP and CE-SSCP. In addition, for the CE-SSCP procedure, viral RNA particles can be directly eluted after ELISA or DTBIA tests. Targeted regions are retro-transcribed into cDNA and amplified with different types of primers used for SSCP and CE-SSCP. 1. Collect twigs of young fully expanded leaves, sterilize the razor blade before moving on to another plant, put the samples in separate plastic bags, keep in a cool container, and store at 0–4  C. 2. Peel the bark and cut the leaves (preferably the midveins) using a sterile razor blade. 3. Grind the sample in a sterile mortar with liquid nitrogen and a sterile pestle. 4. Transfer 100 mg of powder into a sterile 1.5 mL tube containing 1 mL of TRIzol™ reagent (or the respective buffer of the used extraction kit or protocol), and store it at
20  C while processing other samples. The remaining citrus powder can be stored for long periods at
80  C. Proceed with RNA extraction protocol.

88

Elisavet K. Chatzivassiliou and Grazia Licciardello

5. Determine the RNA concentration by measuring absorbance ratio A260 nm/A280 nm with a spectrophotometer. 6. Store RNA at
20  C for a short period, or at
80  C for a long period (see Note 12). 3.2 Virus Release Procedure After ELISA or DTBIA (Only for CESSCP)

Follow the manufacturer’s procedure for the ELISA or DTBIA kit used for immuno-detection, as suggested by the diagnostic protocol for CTV reported by EPPO standards (see Note 2) [41]. After ELISA: 1. Wash the ELISA plate three times with PBS, tap dry, and immediately process for virus release (see Note 13). 2. Fill the wells in which a positive or a potentially positive reaction has been detected with 50 μL of VRB, and cover the plate to prevent evaporation (see Fig. 1a). 3. Incubate the plate at 65  C for 5 min with shaking at slow speed (see Fig. 1b). 4. After incubation, decant the extracts and store at 4  C, if they are processed on the same day, or freeze at
80  C, in the case of a long storage. 5. Five microliter aliquots of these extracts will be used for cDNA synthesis, without any further processing.

Fig. 1 Steps involved in sequential ELISA/CE-SSCP analysis for differentiation of genomic variants of CTV strains: (a, b) release procedure of CTV particles from ELISA-positive wells; (c) RT-PCR amplification of selected genomic regions; (d, e) capillary electrophoresis of ssDNA using ABI 3130 Genetic Analyzer; (f) typical electropherograms of sense- and antisense-labeled ssDNA generated by GeneMapper profile analysis software. The red peaks correspond to the GeneScan-500 ROX size standard

Polymorphism Analysis by SSCP and CE-SSCP

89

After tissue-print immune-blot assay (DTBIA) (see Note 14): 1. Cut carefully the tissue-printed area surrounding the immobilized samples in the nitrocellulose membranes (about 0.5 cm2), using a sterile razor blade. 2. Insert the piece of membrane into a 1.5 mL tube, using a nipper with clean tweezers and avoiding touching the sample. 3. Add 100 μL of VRB. 4. Incubate the tubes at 95  C for 10 min, vortex, and place the samples on ice. 5. Five microliter aliquots of the extracts are used for cDNA synthesis, without any further processing. 3.3 Single-Strand Conformation Polymorphism (SSCP) Analysis 3.3.1 Production of cDNA and Amplification of CP Gene from CTV-Infected Tissues (Field Isolates)

1. Prepare the RT-PCR mix in a total volume of 50 μL, according to the following conditions when using the primers CTV1 and CTV10 (Table 1): 10 Enzyme buffer

5 μL

25 mM MgCl2

8 μL

10 mM dNTP mix (each)

1 μL

10 μM CTV1

1 μL

10 μM CTV10

1 μL

24 U/μL RNase inhibitor

0.15 μL

50 U/μL M-MuLV reverse transcriptase

0.15 μL

5 U/μL Taq DNA polymerase

0.2 μL

RNA

2 μL (approx. 1–2 μg)

H2O mol. biol. grade

31.5 μL

2. Maintain all reagents and the mixture in wet ice, and add enzymes just prior to use (see Note 15). 3. Perform reverse transcription and amplification steps as follows: (a) 38  C for 45 min. (b) 94  C for 2 min. (c) 30 cycles: 92  C for 30 s, 52  C for 30 s, 72  C for 45 s. (d) 72  C for 5 min. 4. Analyze 5 μL of amplified products in a 1% agarose gel in 1 TAE. 3.3.2 Amplification of CP Gene from Recombinant Clones (Colony PCR) (See Note 16)

In case of recombinant (harboring CTV CP gene) clone analysis, for each transformation, select a number of white colonies that are well isolated from the nearby ones. Mark and number each of these colonies at the bottom of the plate. Using a pipette tip or a sterile

90

Elisavet K. Chatzivassiliou and Grazia Licciardello

toothpick, carefully transfer just a touch (approximately 2 μL) of each single selected colony to the bottom of a PCR tube. 1. Prepare the PCR mix in a total volume of 50 μL, according to the following conditions using primers CTV1 and CTV 10 (Table 1): 10 Enzyme buffer

5 μL

25 mM MgCl2

3 μL

10 mM dNTP mix (each)

1 μL

10 μM CTV1

1 μL

10 μM CTV10

1 μL

5 U/μL Taq DNA polymerase

0.2 μL

Colony

2 μL

H2O mol. biol. grade

38.8 μL

2. Maintain all reagents and the mixture in wet ice, and add enzymes just prior to use (see Note 15). 3. Perform amplification steps as follows: (a) 94  C for 2 min. (b) 30 cycles: 92  C for 30 s, 52  C for 30 s, 72  C for 45 s. (c) 72  C for 5 min. 4. Analyze 5 μL of amplified products in a 1% agarose gel in 1 TAE. 3.3.3 Agarose Gel Electrophoresis

1. Prepare the agarose gel (1%) in a 200 mL conical flask dissolving 15 g of agarose in 150 mL of 1 TAE. Put in microwave for 1 min, swirl the flask, and heat again until it has a clear dilution (being careful not to overboil the solution). 2. Cool down to about 50  C (i.e., to the point when you can keep your hand on the flask) under running water; in case of precasting stain in agarose gel, add 15 μL of 10,000 SYBR™ Safe DNA gel stain [Invitrogen], and mix gently; and pour the solution into a gel tray of 7 cm  15 cm (see Note 17). 3. Insert the appropriate gel comb and leave the gel at room temperature for about 20–30 min, or place it at 4  C for about 10–15 min, to solidify completely. 4. Once the agarose gel is set, mix 5 μL of each PCR reaction product with 1 μL (6) loading dye, and load into the agarose gel. Include also a 100 bp molecular weight DNA marker. 5. Run the gel at 80–100 V for 30 min in a 1 TAE buffer. 6. Post-stain the gel (if stain is not precasted in the gel in step 2), by completely submerging in SYBR™ Safe DNA gel stain

Polymorphism Analysis by SSCP and CE-SSCP

91

solution in 1 TAE for 30 min (depending on the thickness of the gel) while agitating gently. 7. Visualize under UV transilluminator. Verify in the analyzed samples (but not in any of the negative-control reactions) the presence of bands of ~672 bp product, corresponding to the expected size for the CP gene amplified with CTV1 and CTV10 primers, by a comparison with the molecular weight marker and photograph. 3.3.4 Non-denaturing Polyacrylamide Gel Preparation and SSCP Gel Electrophoresis

1. Assemble the gel plates in a casting frame on a clean flat surface, and place in a casting stand according to the manufacturer’s instructions (see Note 18). 2. Prepare 12 mL of gel solution for two non-denaturing 8% polyacrylamide gels of 8 cm (W)  7.3 cm (L) and thickness of 0.75 cm, as follows: 30% Acrylamide (29.02:0.8)

3.2 mL

5 TBE

2.4 mL

Water

6.4 mL

3. Ensure complete mixing by immersing the flask into a 60  C water bath until most of the acrylamide has dissolved, and then vigorously magnetically stir the solution (see Note 19). 4. Just before pouring the gel solution between glass plates, add 10 μL of TEMED (or TMEDA), and mix thoroughly by swirling gently or using a pipette. Immediately add 100 μL of 10% APS and mix thoroughly (see Note 20). 5. Pour the acrylamide mixture gently between the assembled gel plates using a pipette or a syringe, and fill it almost to the top. Insert the comb using a slight angle to avoid trapping any air, clamp the comb in place, and fill any empty spaces with acrylamide solution, avoiding any leaks. Allow the gel to polymerize for approximately 45–60 min at room temperature (see Note 21). When the gel is ready, remove it from the casting system, remove any bottom spacers, and clean any spilled gel from the back of the plates. Insert the plates with gel into the electrode assembly module, and place the module in the electrophoresis tank according to the manufacturer’s instructions. Remove the comb carefully straight up and out of the gel. Fill the inner chamber of the tank first with cold 1 TBE buffer so that the wells on the gel are covered and then fill the outside chamber (see Note 22). Flush out the wells with buffer from the tank using a Pasteur pipette or a syringe (see Note 23). 6. Pre-run unloaded gel under 5–10 V/cm for 10–30 min.

92

Elisavet K. Chatzivassiliou and Grazia Licciardello

7. Prepare a heat block set at 95  C under a fume hood and a set of tubes (same number as the samples) each with 9 μL of denaturing buffer (see Note 24). 8. Prepare samples by adding 1 μL of PCR product in a tube containing the denaturing buffer (see Note 25). Briefly centrifuge to ensure that all the contents are in the bottom, and gently mix the tube. 9. Denature the samples by heating at 90  C for 5 min. Immediately chill the mix by transferring the tubes to an ice box for about 5 min. 10. Load the samples into the gel wells using a micropipette by inserting the tip to about 1–2 mm from the well bottom. Load a non-denatured sample as a control for the migration of the dsRNA. Do not (1) expel the entire sample to avoid introducing air bubbles, (2) delay loading the samples to avoid diffusion from the well, or (3) overload wells as samples will float out contaminating neighboring wells. 11. Electrophorese at 100 V for 15 min and subsequently at 200 V running for 3 h at 4  C (in the refrigerator, to enhance the stability of the conformational structure of the analyzed ssDNA fragments). 12. Silver stain the gel (see Note 26) and dry. Analyze the results by comparing the electrophoretic patterns obtained. 3.3.5 Silver Staining of SSCP Gel

Silver staining is the most commonly used method for staining nucleic acids after PAGE in SSCP, due to its low cost and high sensitivity. The basic protocol involves a number of steps (fixing, pretreatment/oxidation, silver impregnation, image development, stopping the reaction, stabilization of the image) (see Note 27). Several silver staining kits are also available. 1. Immediately following SSCP electrophoresis, turn off the power supply, remove the lid, take out the electrode assembly module, and pour the buffer back into the electrophoresis tank. Disassemble the module, prize open the glass plates with the aid of a spatula or similar tool, and carefully separate the upper (small) glass plate so that the gel remains on the bottom (large) glass plate (see Note 28). 2. Wash the gel while it is still on the plate with water to remove traces of the running buffer. Carefully peel off the gel from the plate (see Note 29). 3. Immerse and soak the gel in the fixing solution for at least 20 min (thicker gels may need higher fixing times) to immobilize the nucleic acids in the gel and prevent diffusion and image blurring (see Note 30). 4. Wash the gel thoroughly with water three times for 3 min to remove trace substances that may interfere with staining and

Polymorphism Analysis by SSCP and CE-SSCP

93

result in a blemished background (the gel cannot be overwashed at this stage). 5. Oxidize the gel by submerging it in 1% nitric acid. Incubate for 3 min. 6. Rinse the gel thoroughly with water for 3 min. 7. Impregnate silver by incubating the gel in a staining solution for 30 min. Gels should turn slightly yellow. Protect the gel and solution from direct light. 8. Rinse the gel thoroughly with water for only 3 min to remove any silver solution on the surface of the gel. Do not increase rinsing time as this might remove impregnated silver, which results in faint bands. 9. Place the gel in a new staining tray to avoid residual silver nitrate that increases background staining. Add cold (about 8–12  C) development solution, and incubate until the appearance of dark brown bands against a pale-yellow background (see Note 31). 10. When the desired density is achieved, quickly stop the reaction by transferring the gel to stop developing solution, chill to 4  C, and incubate for no more than 5 min to prevent altering the band coloration. 11. De-stain the gel by thoroughly washing in water to remove the acetic acid (till there is no longer the typical acetic acid smell). 12. Photograph and analyze. 13. For long-term storage, the gel can be placed on filter paper and air-dried in a vacuum apparatus (65  C for 1 h) or stored in 1% acetic acid solution. 3.3.6 SSCP Gel Analysis of Electrophoretic Patterns

After silver nitrate staining of the ssDNA, each haplotype conformation is represented in the gel by a band, and each polymorphic band (band shift or additional bands) between two samples reflects a variation. The complexity of the SSCP migration patterns (number and position of the bands) may vary depending on the nature of the analyzed sample, which correspond either to a recombinant clone or a field isolate (see Fig. 2). When analyzing CTV clones, the resulting SSCP patterns are generally simple, consisting of only two clearly identifiable bands of the denatured ssDNA in the upper part of the gel (see Fig. 2a). Sometimes a faster migrating band corresponding to a non-denatured or partially renatured PCR product can be seen at the bottom of the gel. In some cases, instead of two, only one ssDNA conformation band can be clearly seen due to the close electrophoretic mobility of the two ssDNA fragment conformations.

94

Elisavet K. Chatzivassiliou and Grazia Licciardello

Fig. 2 SSCP profiles after PAGE and silver nitrate staining of the ssDNAs of the CP (p25) gene (amplified with primers CTV1 and CTV10) (a) of recombinant clones of CTV consisting of only two bands and (b) of naturally occurring CTV (field) isolates consisting of two or more than two bands of denatured ssDNA

Naturally occurring CTV isolates are known to exist as populations or mixtures of genetic variants at the single plant level. Therefore, the SSCP profiles of field isolates may be more complex, composed of several haplotypes, and polymorphism is described by the shift, deletion, or the addition of specific band(s) when comparing their SSCP profiles (see Fig. 2b). The genetic structure of two or more field CTV isolates can also be compared via the SSCP analysis of a number of recombinant clones (usually at least ten colonies per field isolate are analyzed in the same gel) and the frequency of each haplotype conformation band in the analyzed groups. Clones showing different SSCP patterns in the same gel are considered as different haplotypes with unique sequences. Therefore, after the SSCP analysis, all PCR products showing different electrophoretic profiles are considered as different genomic variants, and plasmids harboring selected variants are purified and sequenced. 3.4 CE-SSCP Analysis 3.4.1 Primer Design

CE-SSCP analysis is suitable for detecting a high rate of mutations. In an optimized system, fragment sizes of 150–350 bases are usually targeted because the sensitivity of detecting sequence variability increases with decreasing the analyzed fragments. Thus, at least 90% of all point mutations are detectable when fragments are maintained at approximately 200 bases. Primer selection needs to be optimized in order to focus on a highly variable genomic region, which is useful for the discrimination of CTV strains, because each portion of DNA interacts differently with other regions, often changing the secondary structure of the molecule. The relative mobility of the amplified target region may be different according to the primer location. Labeling both strands increases the chances of detecting a mutation that affects the mobility of only one strain. The use of different dyes enables residual double-stranded molecules, which remain after denaturation to be detected, appearing as overlapping peaks of two

Polymorphism Analysis by SSCP and CE-SSCP

95

colors (see Note 32). It also enables the detection of mutations, which cause the forward and reverse strands to switch positions without affecting the relative mobility between different samples. Primers reported in Table 2 have been successfully used for the discrimination of T30 and VT-like strains of CTV [38]. 3.4.2 One-Step RT-PCR Amplification

RT-PCR can be performed in a single closed tube either immediately after the release of the virus particles from the ELISA plate, or from the membrane, or by using total RNA (see Fig. 1c). 1. Prepare the RT-PCR mixture according to the following conditions: 10 Enzyme buffer

4 μL

25 mM MgCl2

1.25 μL

10 mM dNTP mix (each)

0.5 μL

10 μM Primer F

0.5 μL

10 μM Primer R

0.5 μL

24 U/μL RNase inhibitor

0.2 μL

50 U/μL M-MuLV reverse transcriptase

0.2 μL

5 U/μL DNA Taq polymerase

0.2 μL

RNA (pure or eluted)

5 μL

H2O mol. biol. grade

12.65 μL

2. Incubate the mixture in a thermal cycler machine with the following program: (a) 50  C for 30 min. (b) 95  C for 7 min. (c) 35 cycles: 94  C for 20 s, 57–58  C for 30 s, 72  C for 40 s. (d) 72  C for 4 min. 3. Check the quality of PCR products by electrophoresis on agarose gel 2% (100 V, 30 min) (see Note 33). 3.4.3 Setting the Genetic Analyzer

The PCR products, after dilution and denaturation, are run on the ABI 3130 Genetic Analyzer [Applied Biosystems]. The fluorescent signals are detected by a laser. Raw fluorescent data are stored and analyzed by GeneMapper® software [Applied Biosystems]. The 3130 or 3130xl Genetic Analyzer for CE-SSCP runs enables fragment separation within capillaries filled with non-denaturing polymer mixture (POP™ Conformational Analysis Polymer, CAP, Applied Biosystems) (see Note 34). The CAP is supplied at a 9% concentration and is diluted to a concentration of 5% with 10% glycerol (see Note 35).

96

Elisavet K. Chatzivassiliou and Grazia Licciardello

1. For the preparation of 5 g of polymer, use the following doses: 9% POPTM Conformational analysis polymer (CAP)

2.78 g

10 TBE [Applied Biosystems]

0.5 g

Glycerol mol. biol. grade

0.5 g

H2O mol. biol. grade

Up to 5 g

2. Mix for about 3 h at room temperature. Before use, filter through a 0.45 μm filter. 3. 1 TBE prepared in molecular biology grade water is used as a running buffer. 4. Install the 36 cm capillary array according to the instructions supplied by Applied Biosystems using the “Install Array and Change Polymer Wizard” (see Note 36). 3.4.4 Preparation of Labeled Products and Capillary Electrophoresis Analysis

In the capillary electrophoresis mixture, PCR-labeled products can be loaded in two forms: (1) diluted up to 128-fold, in the case of pure template RNA, or (2) undiluted, if virus-released templates from ELISA or DTBIA membranes are used (see Note 37). PCR products are denatured by heating in the presence of formamide. 1. Prepare the capillary electrophoresis mixture (10 μL/reaction) in each well of the sample plate as follows: Hi-Di formamide

10 μL

GeneScan™ ROX-500 size standard

0.25 μL

PCR-labeled product

1 μL

2. Denature the PCR product for 5 min at 95  C. 3. Cool on ice for 2 min to prevent the complementary strands from reannealing. 4. Place the sample plate on the tray of the ABI 3130 or ABI 3130xl Genetic Analyzer [Applied Biosystems] (see Fig. 1d, e). 5. Set and perform the electrophoresis run as follows (see Note 38): Temperature

24  C

Current stability

5.0 μA

Pre-run voltage

15.0 kV

Pre-run time

180 s

Injection voltage

3.5 kV

Injection time

12 s

Run voltage

15.0 kV

Run time

1600 s

Polymorphism Analysis by SSCP and CE-SSCP 3.4.5 Data Analysis

97

During the electrophoresis run inside the capillary, each ssDNA strand is detected by a laser, which records the fluorescent data according to the migration time (see Fig. 1f). Thanks to the presence of the GeneScan-500-ROX size standard, the GeneMapper® software [Applied Biosystems] performs sizing for each individual sample to generate a size-calling curve. Note that because the GeneScan-500-ROX size standard does not run true to size (in bp) under native conditions, the fragments do not conform to the software’s expected linear relationship between the bands (see Note 39). For this reason, the size standard, and all the samples, should be defined according to the data point rather than base pair size. Thus, a complete analysis of electropherograms is needed, comparing all the data with isolates of different genotypes (see Fig. 3). Relative positions of the peaks with a different color, total number of peaks for each profile, conformation of the peak, curve shape, and any partial overlapping need to be analyzed and annotated, thereby facilitating the grouping between different isolates. The software can store the data, and thus profiles can be compared whenever required. In addition, thanks to the different ssDNA strand mobility, the co-migration of two amplicons with different sizes enables isolates to be differentiated into a single-run analysis of two different genomic regions (see Fig. 4).

Fig. 3 CE-SSCP electropherograms of CTV isolates containing VT and T30 genotypes show different patterns of each selected region located in the p27, p25, and p23 genes. Black, green, and blue peaks correspond to sense (S)- and antisense (A)-labeled ssDNA molecules. The red peak corresponds to the GeneScan-500 ROX size standard

98

Elisavet K. Chatzivassiliou and Grazia Licciardello 48

52

50

54

56

58

60

62

64

66

68

70

72

p23

2400

74

76

p25 VT

2000

A

1600

S

1200

A S

800 400 0 47 1800 1600 1400 1200 1000 800 600 400 200 0

49

51

53

55

57

59

61

63

65

67

69

p23

73

p25 A

S

71

T30 S

A

Fig. 4 CE-SSCP electropherograms differentiating VT and T30 CTV strains generated by co-migration of ssDNAs of two genomic regions, p23 and p27 genes, in a single electrophoretic run. Blue/black and green peaks correspond to sense (S)- and antisense (A)-labeled ssDNA molecules, respectively

4

Notes 1. Use TRIzol™ reagent [Invitrogen] or the RNeasy Plant Mini Kit [Qiagen], or alternative protocols for dsRNA isolation. 2. Monoclonal or polyclonal antibodies can be used, as suggested by EPPO (PM7/31). 3. A high-fidelity (proofreading) Taq polymerase is needed to avoid introducing changes in the amplified DNA sequence. 4. For 500 mL solution, dissolve 93.05 g of EDTA disodium salt in 400 mL water, adjust the pH with NaOH, and add water to final volume. Solution is autoclaved and can be stored at room temperature for several months. EDTA will be completely dissolved while stirring vigorously on a magnetic stirrer only when the pH is adjusted to 8.0. 5. Prepare 1 L of 50 TAE stock dissolving 242 g Tris base, 57.1 mL glacial acetic acid, and 100 mL 0.5 M EDTA solution (pH 8.0) in water. Do not titrate to a pH to prevent altering the ion balance of the buffer. Solution is autoclaved and can be stored at room temperature for several months. Ready-to-use 10 TAE buffer is also commercially available. To prepare a working TAE solution, mix 20 mL of 50 stock buffer with 980 mL of water.

Polymorphism Analysis by SSCP and CE-SSCP

99

6. APS solution may be prepared in small aliquots for daily use that are kept at
20  C for up to 6 months. Allow to come at room temperature before use. Store at 4  C for up to 1 month. 7. For 100 mL, dissolve 29.2 g of acrylamide and 0.8 g crosslinker bis-acrylamide in water. Heat the solution to 37  C, mix to dissolve the chemicals, and filter through 0.45 μM filter. Store in an aluminum foil-wrapped bottle at 4  C for up to 1 month. Acrylamide powder is toxic when inhaled; therefore, you should avoid inhaling the powder or better wear a mask. Unpolymerized acrylamide solutions are also potentially neurotoxic; therefore you must use protective gloves, glasses, and lab coat to avoid skin contact. You may also use premixed polyacrylamide solutions, commercially available. Acrylamide solution can be aliquoted, frozen, and used indefinitely. 8. Prepare a 5 TBE stock, dissolving 54 g of Tris base and 27.5 g of boric acid and 20 mL of 0.5 M EDTA (pH 8.0) in 1 L of water. Do not titrate to a pH to prevent altering the ion balance of the buffer. Autoclave and store at room temperature for several months. Discard if a precipitate is formed. Ready-touse 5 or 10 TBE buffers are also commercially available. 9. For a 10 mL solution, mix 9.6 mL formamide (99%) and 0.4 mL of 0.5 M EDTA (pH 8.0), and subsequently dissolve 5 mg bromophenol blue. Store in aliquots at
20  C. Xylene cyanol at 0.05% may be also added. 10. Store at 4  C for up to 1 month. 11. Prepare a 20 stock solution dissolving 10 g silver nitrate in a smaller amount of water, and make up to 500 mL. To prepare the working solution, dilute 25 mL of 20 stock solution to 500 mL water. Store tightly closed in a brown or aluminum foil-covered glass bottle at room temperature for up to 1 month. Avoid spilling solutions as silver nitrate will stain skin, clothing, and most surfaces. 12. RNA can be stored in small aliquots in order to prevent repeated freeze-thaw cycles, which have a negative effect on RNA preservation. 13. After washing with the PBS buffer, the ELISA plate can be stored at
20  C for up to 4 months. 14. Samples can be analyzed directly after immobilization of the samples by pressing the pedicels of fresh handpicked citrus leaves or stem sections and partially overlapping the prints. Store the membranes at room temperature in a dark and dry environment. Membranes are stable for several months. 15. Include also “positive” (i.e., RNA known to amplify) and “negative” (i.e., no-template and/or healthy host RNA) control reactions in each RT-PCR run. When preparing the

100

Elisavet K. Chatzivassiliou and Grazia Licciardello

RT-PCR mix, excluding the RNA, consider the total number of samples with a 10% excess or a spare sample for pipetting errors. Provided a high-quality Taq polymerase and the present primer concentrations are used, standard RT-PCR kits can be used following the manufacturers’ instructions. 16. When the amplified gene has not been purified from the RT-PCR products, unspecific products may have been cloned. PCR is therefore also used for screening the recombinant clones harboring the gene of interest. 17. The total gel volume depends on the size of the casting tray and can be calculated approximately with the formula: Total volume of agarose solution ¼ width of casting tray  length of casting tray  thickness of gel. 18. Glass plates, spacers, and combs should be thoroughly washed with detergent, rinsed with water and 70–98% ethanol, and dried in a dust-free area. Always wear gloves when touching the plates to avoid grease stains that may introduce air bubbles into the gel. Make sure that the bottom sides of the glass plates are aligned when mounted with the casting frame and placed in the stand. Test potential leaking by filling with ultrapure H2O. Drain away the water by inverting the unit or using filter paper. If there is a leak, reassemble the system. 19. The gel solution can be prepared in large volumes and stored at 4  C for up to 6 months. 20. Polymerization starts when APS is added in the mix; therefore it is important to act quickly after this step. 21. Polymerized gel with combs still inserted can be stored flat at 4  C, wrapped with a paper towel, soaked in 1 TBE, and sealed in a plastic film, for about a month. It is also possible to use commercially available precast polyacrylamide gels. 22. To prevent any change in the conformational structure of the ssDNA, the buffers and material used should be cold (4  C). 23. Any air bubble trapped under the gel can be removed by swirling the buffer with a syringe with a bent needle or a glass Pasteur pipette hook. 24. The samples can be prepared while the gel is polymerized or during the pre-run stage of the unloaded gel. 25. If there is a poor signal-to-noise ratio or faint bands, the volume of the PCR product can be increased up to 3 μL. However, at high concentrations, the two ssDNA molecules tend to reanneal leading to decreased resolution. In which case the PCR products may need to be diluted, or the number of PCR cycles may need to be decreased.

Polymorphism Analysis by SSCP and CE-SSCP

101

26. Alternatively, the gel can be stained with ethidium bromide, or other nucleic acid stains, such as SYBR® Green or Gold and GelStar®. 27. Carry out all procedures at room temperature avoiding direct sunlight; if the ambient temperature falls outside of this range, the developing time should be adjusted accordingly (e.g., by decreasing the incubation time in higher temperatures). The solutions should be allowed to warm to room temperature if refrigerated, unless otherwise suggested. Never touch the gel directly or with any metal object to avoid stain artifacts. Always wear clean disposable powder-free gloves (that have been washed and rinsed with water), and avoid crushing the gel when handling. 28. Make a small trim at the upper left or right corner of the gel using a razor blade to record the orientation of the gel. 29. To easily detach the gel from the plate, put the plate upside down in a container half-filled with water, gently lift the corner of the gel to allow the water to get in between the plate and the gel, and shake gently. Remove water and proceed. 30. Gels can be fixed for longer periods without any problem and can be stored in the fixing solution for up to 1 day if not stained immediately. During this step all solutions that are needed can be prepared fresh for the subsequent steps. 31. Using a cold solution at this step helps to control the development of the stain and prevents the development of a dark background. Band intensity increases up to about 15–20 min of development. To prevent high background, do not prolong incubation. The contrast will increase with drying; therefore the developing reaction should be stopped before the best contrast is obtained. Poor staining may be the result of old or low-quality reagents. 32. Select the dyes according to the chemistry detectable by the genetic analyzer. In our case, we used the ABI 3130 (Applied Biosystems), and the dye chemistry includes 6FAM, HEX, and NED™ for custom-labeled primers and ROX for the internal size standard. 33. If DNA artifacts are present due to the incorporation of primers with SSCP conformers or if unincorporated fluorescently labeled primers are present, PCR products can be purified using various methodologies and commercial kits (a simple column filtration step is sufficient). Excess salt and PCR primer can lead to poor resolution, a weak signal, and poor sensitivity. This step is not necessary for clean or optimized PCR products. 34. The use of the CAP is recommended by Applied Biosystems and described for ABI 3130 and 3130xl Genetic Analyzers as

102

Elisavet K. Chatzivassiliou and Grazia Licciardello

an efficient, convenient, and cost-effective solution for performing CE-SSCP. Other instruments or materials are likely to impact the expected results. 35. The prepared polymer solution is stable at 4  C for at least 2 weeks. Once on the instrument, the polymer should be replaced after 50 injections, or 1 week, whichever comes first. 36. The use of a dedicated 36 cm capillary array for CE-SSCP applications is strongly recommended to minimize negative performance issues due to the presence of residual POP™ or CAP within the array. 37. Test different dilutions for any given sample in order to optimize signal intensity. Ensure that the signals for the individual strands of the amplicons are within the intensity range of the system. When performing the dilutions, it is preferable to make sequential 1:2 dilutions until the optimal solution is reached. 38. As recommended by Applied Biosystems, run the temperature between 25  C and 35  C, and optimize it for a better fragment separation. After several experiments, we found that a 24  C run temperature is the best for separating CTV fragments. 39. To achieve a size consistency from capillary to capillary and from run to run, it is important to perform some runs with only the 500-ROX standard and continue to analyze its migration after each sample run.

Acknowledgments The CE-SSCP protocol was developed thanks to the project IT-Citrus Genomics PON 01_1623, funded by MIUR and MISE and co-funded by the EU, and the “Lotta al virus della tristezza degli agrumi” project funded by Assessorato delle Risorse Agricole ed Agroalimentari, Regione Siciliana granted to Parco Scientifico e Tecnologico della Sicilia. The method was patented in Italy, EU: “Metodo per la discriminazione di ceppi virali Citrus tristeza virus ” N 1405881, 30/01/2014, by Licciardello G., Raspagliesi D., Lombardo A., Catara A (Parco Scientifico e Tecnologico della Sicilia). References 1. Moreno P, Ambro´s S, Albiach-Martı´ MR et al (2008) Citrus tristeza virus: a pathogen that changed the course of the citrus industry. Mol Plant Pathol 9:251–268 2. Bar-Joseph M, Marcus R, Lee RF (1989) The continuous challenge of Citrus tristeza virus control. Annu Rev Phytopathol 27:291–316

3. Dawson WO, Garnsey SM, Tatineni S et al (2013) Citrus tristeza virus-host interactions. Front Microbiol 4:88 4. Harper SJ (2013) Citrus tristeza virus: evolution of complex and varied genotypic groups. Front Microbiol 4:93

Polymorphism Analysis by SSCP and CE-SSCP 5. Orita M, Suzuki Y, Sekiya T et al (1989) Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 5:874–879 6. Kakavas KV, Plageras P, Vlachos AT et al (2008) PCR–SSCP: a method for the molecular analysis of genetic diseases. Mol Biotechnol 38:155–163 7. Sunnucks P, Wilson ACC, Beheregaray LB et al (2000) SSCP is not so difficult: the application and utility of single-stranded conformation polymorphism in evolutionary biology and molecular ecology. Mol Ecol 9:1699–1710 8. Cerni S, Skoric D, Ruscic J et al (2009) East Adriatic—a reservoir of severe Citrus tristeza virus strains. Eur J Plant Pathol 124:701–706 9. Rubio L, Ayllo´n MA, Kong P et al (2001) Genetic variation of Citrus tristeza virus isolates from California and Spain: evidence for mixed infections and recombination. J Virol 75:8054–8062 10. Kalvatchev Z, Draganov P (2005) SingleStrand Conformation Polymorphism (SSCP) analysis: a rapid and sensitive method for detection of genetic diversity among virus population. Biotechnol Biotechnol Equip 19:9–14 11. Rubio L, Ayllo´n MA, Guerri J et al (1996) Differentiation of citrus tristeza closterovirus (CTV) isolates by single-strand conformation polymorphism analysis of the coat protein gene. Ann Appl Biol 129:479–489 12. Kong P, Rubio L, Polek M et al (2000) Population structure and genetic diversity within California Citrus tristeza virus (CTV) isolates. Virus Genes 21:139–145 13. Ayllo´n MA, Rubio L, Moya A et al (1999) The haplotype distribution of two genes of Citrus tristeza virus is altered after host change or aphid transmission. Virology 255:32–39 14. D’Urso F, Sambade A, Moya A et al (2003) Variation of haplotype distributions of two genomic regions of Citrus tristeza virus populations from eastern Spain. Mol Ecol 12:517–526 15. Morales J, Acosta O, Tamayo P et al (2013) Characterization of Citrus tristeza virus isolates from Colombia. Rev Proteccio´n Veg 28:45–53 16. Abou Kubaa R, D’Onghia AM, Djelouah K et al (2008) Characterization of Citrus tristeza virus isolates recovered in Syria and Apulia (Southern Italy) using different molecular tools. Phytopathol Mediterr 51:496–504 17. Amin HA, Fonseca F, Santos C et al (2006) Typing of Egyptian Citrus tristeza virus (CTV) isolates based on the capsid protein gene. Phytopathol Mediterr 45:10–14

103

18. Chatzivassiliou EK, Nolasco G (2014) Detection of a new variant of Citrus tristeza virus (CTV) in Greek citrus crops. Phytopathol Mediterr 53:140–147 19. Davino S, Rubio L, Davino M (2005) Molecular analysis suggests that recent Citrus tristeza virus outbreaks in Italy were originated by at least two independent introductions. Eur J Plant Path 111:289–293 20. Ferretti L, Fontana A, Sciarroni R et al (2014) Molecular and biological evidence for a severe seedling yellows strain of Citrus tristeza virus spreading in southern Italy. Phytopathol Mediterr 53:3–13 21. Kim DH, Shim HK, Hyeon JW et al (2006) SSCP analysis of variations in haplotypes of Citrus tristeza virus isolated from yuzu (Citrus junos) in geographically separate regions of Korea. J Plant Biol 49:88–96 22. Lbida B, Fonseca F, Santos C et al (2004) Genomic variability of Citrus tristeza virus (CTV) isolates introduced into Morocco. Phytopathol Mediterr 43:205–210 23. Oliveros-Garay OA, Martinez-Salazar N, TorresRuiz Y et al (1937) CPm gene diversity in field isolates of Citrus tristeza virus from Colombia. Arch Virol 154:1933–1937 24. Papayiannis LC, Santos C, Kyriakou A et al (2007) Molecular characterization of Citrus tristeza virus isolates from Cyprus on the basis of the coat protein gene. J Plant Path 89:291–295 25. Nolasco G, Fonseca F, Silva G (2008) Occurrence of genetic bottlenecks during Citrus tristeza virus acquisition by Toxoptera citricida under field conditions. Arch Virol 153:259–271 26. Cerni S, Ruscic J, Nolasco G et al (2008) Stem pitting and seedling yellows symptoms of Citrus tristeza virus infection may be determined by minor sequence variants. Virus Genes 36:241–249 27. Iglesias NG, Gago-Zachert SP, Robledo G et al (2008) Population structure of Citrus tristeza virus from field Argentinean isolates. Virus Genes 36:199–207 28. Gago-Zachert S, Costa N, Semorile L (1999) Sequence variability in p27 gene of Citrus tristeza virus (CTV) revealed by SSCP analysis. Electron J Biotechnol 215:04 29. Costa AT, Nunes WMC, Zanutto CA et al (2010) Stability of Citrus tristeza virus protective isolates in field conditions. Pesq Agrop Brasileira 45:693–700 30. Temporal WM, Corazza MJ, Zanutto CA et al (2011) SSCP analysis of Citrus tristeza virus protectives isolates in Peˆra sweet orange clones

104

Elisavet K. Chatzivassiliou and Grazia Licciardello

under northern Parana´ state, Brazil conditions. Citrus Res Tech 32:9–16 31. Leonel WMS, Corazza MJ, Zanutto CA et al (2015) Stability of Citrus tristeza virus protective isolate ‘Peˆra IAC’ according to SSCP analysis of old and new lines of three sweet orange varieties. Summa Phytopathol 41:8–12 32. Sambade A, Rubio L, Garnsey SM et al (2002) Comparison of the viral RNA populations of pathogenically distinct isolates of Citrus tristeza virus. Application to monitoring cross protection. Plant Pathol 51:257–265 33. Sambade A, Ambro´s S, Lo´pez C et al (2007) Preferential accumulation of severe variants of Citrus tristeza virus in plants co-inoculated with mild and severe variants. Arch Virol 152:1115–1126 34. Waldecy Matos da Silva L, Corazza MJ, Zanutto CA et al (2015) Stability of Citrus tristeza virus protective isolate ‘Peˆra IAC’ according to SSCP analysis of old and new lines of three sweet orange varieties. Summa Phytopathol 41:8–12 35. Jespersgaard C, Larsen LA, Baba S et al (2006) Optimization of capillary array electrophoresis single-strand conformation polymorphism analysis for routine molecular diagnostics. Electrophoresis 27:3816–3822 36. Larsen LA, Jespersgaard C, Andersen PS (2007) Single-strand conformation

polymorphism analysis using capillary electrophoresis for large-scale mutation detection. Nat Protoc 2:1458–1466 37. Quinto JD, Wang CK (2004) A highthroughput single-stranded conformation polymorphism assay for detection, subtyping and genotyping of influenza viruses. Int Congr Ser 1263:653–657 38. Licciardello G, Raspagliesi D, Bar Joseph M et al (2012) Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms. J Virol Methods 181:139–147 39. Dallot S, Boeglin M, Labonne G (2008) Spatial pattern and genetic structure of PPV-M in a delimited area of stone fruit orchards in southern France. Acta Hort 781:235–242 40. Delaunay A, Dallot S, Filloux D et al (2015) SNaPshot and CE-SSCP: two simple and costeffective methods to reveal genetic variability within a virus species. Method Mol Biol 1302:187–206 41. OEPP/EPPO (2004) Diagnostic protocols for regulated pests/Protocoles de diagnostic pour les organismes re´glemente´s - Citrus tristeza closterovirus. OEPP/EPPO Bull 34:155–157

Chapter 8 Identification and Characterization of Resistance-Breaking (RB) Isolates of Citrus tristeza virus Maria Saponari, Annalisa Giampetruzzi, Vijayanandraj Selvaraj, Yogita Maheshwari, and Raymond Yokomi Abstract Resistance-breaking (RB) strains constitute a clade of biological and genetically distinct isolates of Citrus tristeza virus (CTV) that replicate and move systemically in Poncirus trifoliata (trifoliate orange), resistant to other known strains of CTV. Molecular markers have been developed by comparative genome analysis to allow quick identification of potential RB isolates. Here, methods are described to identify and characterize RB strains by reverse transcription-polymerase chain reaction (RT-PCR), quantitative real-time RT-PCR (RT-qPCR), full-length genome sequencing, and biological indexing. Key words Resistance-breaking, Trifoliate orange, Genotype, Sequence group

1

Introduction The Citrus tristeza virus (CTV) genome consists of ~19,296 nucleotides (nt) that encodes 12 open reading frames (ORFs) and is the largest genome among RNA plant viruses [1]. The virus is readily graft-transmissible and is spread in nature by aphid vectors in a semi-persistent manner. The host range of CTV is generally restricted to the Rutaceae, which are perennial plants distributed in warm temperate to tropical regions. The evolution of CTV has been discussed by Harper [2], and one scenario of CTV diversity is that it evolved in citrus through multiple introductions of one or more proto-closteroviruses and subsequently recombined. Through time, selection, and adaptation, several distinct genotypes have developed which, in general, share common biological attributes [3]. The RB genotype was first described in 2000 as a CTV isolate that can break CTV resistance in Poncirus trifoliata (trifoliate orange) and replicate in roots, bark, and foliage of trifoliate orange. Hence, such isolates were named resistance-breaking or RB strains. Full-length sequencing has shown these resistance-breaking

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_8, © Springer Science+Business Media, LLC, part of Springer Nature 2019

105

106

Maria Saponari et al.

isolates to constitute unique CTV genotype named RB. RB isolates have now been described from New Zealand [4, 5], Dominican Republic [6], Puerto Rico [7], South Pacific [8], South Africa [9], California [10], Brazil [11], and Morocco [12]. Molecular markers have been developed to detect CTV genotypes putatively associated with RB isolates. The markers consist of primers and probes for conventional or real-time PCR. For the latter, the assay based on the primers CP27F/R and TaqMan probe T36NS [13] allows for the simultaneous identification of isolates harboring either the RB-like genotypes or the recently described S1 genotype. However, in case of positive qPCR results, the presence of the RB isolates can be indirectly confirmed using the assay described by Yokomi et al. [14] targeting the exclusive S1 genotype. Negative results with this second assay will, in fact, indirectly confirm the presence of putative RB isolates in samples testing positive with the T36NS TaqMan probe [13]. Isolates belonging to the RB and S1 phylogenetic clusters share some common features like the reactivity to the selective monoclonal antibody MCA13 and mild biological behavior when bio-indexed onto different citrus indicator species.

2 2.1

Materials General

1. Nuclease-free microcentrifuge tubes (0.2 mL, 1.5 mL, and 2 mL). 2. Pipettes for micro-volumes (P20, P200, P1000). 3. Sterile filter tips (20 μL, 200 μL, and 1000 μL). 4. RNase-free water. 5. Refrigerated benchtop centrifuge for 1.5–2 mL microcentrifuge tubes. 6. Vortex mixer. 7. Heat block or water bath at 70
C.

2.2 Leaves and Bark Tissue from Suspect Citrus Tree (See Note 1)

1. Collect leaves or budsticks from different parts of the canopy (samples should be representative of the tree)

2.3 Total Nucleic Acid Extraction for CTV Detection

1. Extraction buffer: 2% CTAB, 0.1 M Tris-HCl (pH 8), 20 mM EDTA (pH 8), 1.4 M NaCl.

2. Store samples avoiding dessication or exposure to high temperature

2. Autoclaved TE buffer: 10 mM Tris-HCl (pH 8.0), 1 mM EDTA (pH 8.0). 3. Extraction bags. 4. Chloroform/isoamyl alcohol (24:1). 5. Cold isopropanol stored at 20
C.

CTV RB Strains

107

6. Ethanol 75% (v/v) stored at 20
C. 7. Extraction platform [Homex (Bioreba) or similar apparatus]. 8. UV Spectrophotometer [e.g., NanoDrop™ Spectrophotometer and/or a Qubit fluorometer]. 2.4 Real-Time Detection by One-Step RT-qPCR

1. Real-time PCR instrument and software. 2. iTaq™ Universal Probes One-Step Kit [Bio-Rad or equivalent products]. 3. Individual tubes/8-strip low-profile tubes and ultra-clear caps/ plates (48- or 96-well) and plate seals. 4. Primers (Desalt) and probes (PAGE or HLPC purification) (Table 1).

2.5 RT-PCR for Specific Identification of RB Strains

1. M-MLV Reverse Transcriptase (200 U/L) [Thermo Fisher Scientific].

2.5.1 cDNA Synthesis

4. 10 mM dNTP mix (each).

2. 5 M-MLV Buffer [Thermo Fisher Scientific]. 3. DTT [Thermo Fisher Scientific]. 5. 40 U/μL RNaseOUT™ RNase Inhibitor. 6. Random hexamers (alternatively gene-specific reverse primer can be used). 7. Heat block (at 70
C and 42
C).

2.5.2 PCR Reactions

1. GoTaq DNA Polymerase with 5 Green GoTaq Reaction Buffer [Promega] (DNA polymerase from other vendors can be used following the manufacturer’s protocol). 2. Primers (Table 2). 3. Thermocycler.

2.5.3 Gel Electrophoresis

1. Ultrapure agarose. 2. 1 TAE: 40 mM Tris base, 20 mM acetic acid, 1 mM EDTA. 3. 6 loading dye: 0.02% bromophenol blue, 0.02% xylene cyanol, 50% glycerol. 4. GelRed™ Nucleic Acid Gel Stain. 5. Electrophoresis apparatus, power supply, tray, and combs. 6. UV transilluminator.

2.5.4 Amplicon Sequencing

1. Any PCR cleanup kit, for example, QIAquick PCR Purification Kit [Qiagen].

108

Maria Saponari et al.

Table 1 Primer and probes for one-step RT-qPCR Target strain Primer/ (s) probe

Name

Sequence

References

Primers and probe for universal detection Broad spectrum

Forward primer Reverse primer Probe

P25F

AGCRGTTAAGAGTTCATCATTRC

P25R

TCGRTCCAAAGTTTGTCAGACA

CP FAMprobe CRCCACGGGYATAACGTACACTCGGBHQ1

Primers and probe for specific identification of the RB strains RB/S1 Forward P27F TACGYGATTTGGGWAAGTAYT primer Reverse P27R GACCCTTAAAGCAGTGCTCA primer Probe-MGB T36NS FAM-CGGTARTATYATRCCATCCT-MGB S1

Forward primer Reverse primer Probe

2.6 Biocharacterization of CTV RB Isolates

[15]

S1F

CGTTGCGCGCTAAGTTT

S1R

GACACTCCAGCTTCGTCTTA

S1

FAM-TCGTCACCGTCTGGGAGATTGTCT BHQ1

[13]

[14]

1. Greenhouse [16] (see Note 2). 2. Citrus indicators (Table 3). 3. Grafting knife and sharpening stone or single edge razor blades for graft. 4. Grafting tape.

2.7 Extraction of the Small RNA Fractions

1. Extraction buffer (EB): 4 M guanidine thiocyanate, 0.2 M sodium acetate, 25 mM ethylenediaminetetraacetic acid sodium salt (Na2EDTA), 2.5% polyvinylpyrrolidone-40 (see Note 3). Adjust pH to 5 with 1 N HCl. Store at 4
C in dark bottle protected against light. 2. 20% (w/v) N-lauroylsarcosine (NLS) (see Note 4). Store at room temperature. 3. Trizol Reagent [Thermo Fisher Scientific]. 4. 2-Mercaptoethanol. 5. 75% (v/v) ethanol stored at 20
C. 6. Chloroform. 7. Cold isopropanol stored at 20
C.

CTV RB Strains

109

Table 2 Strain-specific primers targeting genomic regions of the RB genotypes

Primer

Amplicon size (bp)

Sequence

Tm

[7]

[8]

RB-p65F AAGYTACTTGCACAAGTTGTCACCATCTTA RB-p65R3 TGGTCGATTGATACTGTTTCACTAA TCCCAT

627

60

RB-1404F RB-1404 R RB-K17F RB-K17R RB-7424F RB-7424 R

ACAGTGGGTGCATTTAAGGCTTAT GAGCATTACTTGCTGGTTCTCACT GTTTTCACGTCTGAAACGAAAG CCAACACATCAAAAATAGCCTG GGTTCGAGGTCATGCTAGGG GAACCAACCCATCATTGCAG

1731

57a

409

53a

RBG1F RBG1R RBG2F RBG2R

AGTGGTGGAGATTACGTTG TACACGCGACAAATCGAG CGGAAGGGACTACGTGGT CGTTTGCACGGGTTCAATG

721

References

a

55a

628

60

658

60

[9]

a

Predicted temperature (https://www.idtdna.com/calc/analyzer)

Table 3 Citrus cultivars Madam Vinous (MV) sweet orange (C. sinensis) Duncan grapefruit (DGF) (C. paradisi) Sour orange (SO) (C. aurantium) Mexican lime (ML) (C. aurantifolia) Sweet orange grafted on sour orange rootstock (Swt/SO) Rubidoux Poncirus trifoliata seedlings

8. Liquid nitrogen. 9. Conical tubes (15 mL) (see Note 5). 10. Polycarbonate bottles [Nalgene Tube, 50 mL]. 11. Sterilized mortar/pestles. 12. Refrigerated bench centrifuge [ThermoScientific Heraeus Multicentrifuge 3SR+, rotor swingle 6441 15 mL tubes]. 13. Refrigerated centrifuge for 50 mL tubes [Beckman Coulter Avanti J-25 with rotor JA 25-50].

110

Maria Saponari et al.

2.8 Separation of Low and High Molecular Weight RNAs

1. PEG (MW 8000) solution 20% (w/v). 2. 10 TBE: 1 M Tris base, 1 M boric acid, 25 mM EDTA, pH 8.3. 3. 1 TBE. 4. 1.2% (w/v) agarose gel in 1 TBE. 5. 6 RNA loading buffer, containing xylene cyanol and bromophenol blue. 6. 90% deionized formamide. 7. Spin-X Centrifuge Tube Filters, 0.45 μm [Costar, Corning Inc.]. 8. Ethanol (v/v). 9. Electrophoresis apparatus, power supply, tray, and combs. 10. UV transilluminator.

2.9 Purification of 18–30 nt sRNAs from the LMW RNA Fractions

1. 10% ammonium persulfate (APS) solution (w/v) (see Note 6). 2. N,N,N0 ,N0 -Tetramethylethylenediamine (TEMED). Store at 4
C. 3. 15% acrylamide—8 M urea gel in 0.5 TBE, 40% acrylamide (19:1 acrylamide/bis-acrylamide). 4. DNA ladder: 21 nt long single-stranded DNA at 20 ng/μL. 5. 0.3 M NaCl elution buffer. Autoclave and store at room temperature. 6. Resuspension buffer, 10 mM Tris-HCl (pH 8.5). Autoclave and store at 4
C. 7. Mini-PROTEAN electrophoresis system [Bio-Rad], glass plates, and combs 1 mm thick. 8. Single edge razor blade. 9. 10 mg/mL ethidium bromide solution. 10. Staining tray. 11. 6 RNA loading buffer, containing xylene cyanol and bromophenol blue. 12. Cold isopropanol, stored at 20
C. 13. 70% (v/v) ethanol, stored at 20
C. 14. 15 mg/mL Scientific].

GlycoBlue

15. Needle, 21 gauge. 16. UV transilluminator. 17. Rotating shaker.

Coprecipitant [Thermo

Fisher

CTV RB Strains

2.10 Data Handling Bioinformatic Softwares

111

1. FastQC (http://www.bioinformatics.babraham.ac.uk/projects/ fastqc/). 2. Linux-based operating system. 3. bcl2fastq script of CASAVA pipeline [Illumina]. 4. FastX-Toolkit (http://hannonlab.cshl.edu/fastx_toolkit/). 5. Velvet 1.2.10 [17]. 6. Web-based resources: NCBI GenBank (https://www.ncbi. nlm.nih.gov/genbank/). 7. BLAST+ software package (ftp://ftp.ncbi.nlm.nih.gov/blast/ executables/blast+/).

3

Methods

3.1 Total Nucleic Acid Extraction (See Note 7)

1. Weigh 250–500 mg of leaf or scraped phloem tissue and transfer in extraction bag; add CTAB at 1:10 m/v [18]. Crush with a hammer and homogenize using Homex or equivalent homogenizer. 2. Recover 2 mL of microcentrifuge tube.

clear

sap

and

transfer

into

a

3. Incubate samples at 65
C for 45 min. 4. Centrifuge samples at 10,000  g for 5 min, and transfer 1 mL of supernatant to a clean 2 mL centrifuge tube, without disturbing the pellet. 5. Add 1 mL of chloroform-isoamyl alcohol (24:1) and vigorously vortex for 30 s. 6. Centrifuge samples at 13,200  g for 10 min, and transfer 750 μL to a clean 1.5 mL microcentrifuge tube. 7. Add 450 μL of cold isopropanol. Mix the solution by inverting the tube two times. 8. Incubate on ice or at 20
C from 30–60 min. 9. Centrifuge samples at 13,200  g for 20 min and carefully remove the supernatant. 10. Add 500 μL of 75% ethanol, and centrifuge samples at 13,200  g for 5 min, and carefully remove the supernatant. 11. Dry the pellet and then resuspend in 100 μL of TE or RNasefree water. 12. Determine the total nucleic acids concentration and the quality by measuring absorbance at 260 nm (total nucleic acid content) and at 280 nm (sample purity). 13. Adjust the total nucleic acid concentration to 50–100 ng/μL.

112

Maria Saponari et al.

3.2 Real-Time One-Step RT-qPCR 3.2.1 Universal Detection of CTV

Include in each assay CTV-positive and CVT-negative controls and the non-template control (NTC). 1. Set up 20 μL qPCR reaction according to the following conditions (see Note 8). 2 iTaq Universal Probes reaction mix

10 μL

iScript advanced reverse transcriptase

0.5 μL

10 μM CP25 forward primer

0.6 μL

10 μM CP25 reverse primer

0.6 μL

10 μM CP25 TaqMan probe

0.3 μL

Nuclease-free water

6 μL

Total nucleic acid

2 μL

2. Start the qPCR cycling using the following parameters.

3.2.2 Strain-Specific One-Step RT-qPCR

Step

Temperature (
C)

Time

Number of cycles

Reverse transcription

50

10 min

1

DNA denaturation

95

2 min

1

DNA denaturation Annealing/extension + plate read

95 60

15 s 40 s

40

1. To identify RB- and S1-like isolates, set up 20 μL qPCR reaction according to the following conditions (see Note 8): 2 iTaq Universal Probes reaction mix

10 μL

iScript advanced reverse transcriptase

0.5 μL

10 μM CP27 forward primer

0.6 μL

10 μM CP27 reverse primer

0.6 μL

10 μM CP27T36NS TaqMan probe

0.3 μL

Nuclease-free water

6 μL

Total nucleic acid

2 μL

2. Start the qPCR cycling using the following parameters:

Step

Temperature (
C)

Time

Number of cycles

Reverse transcription

50

10 min

1

DNA denaturation

95

2 min

1 (continued)

CTV RB Strains

Step DNA denaturation Annealing/extension + plate read

Temperature (
C)

Time

95 60

15 s 40 s

113

Number of cycles 40

3. For identification of S1-like strains, set up 20 μL qPCR reaction according to the following conditions (see Note 8): 2 iTaq Universal Probes reaction mix

10 μL

iScript advanced reverse transcriptase

0.5 μL

10 μM primer S1F

0.6 μL

10 μM primer S1R

0.6 μL

10 μM TaqMan probe S1 Probe

0.3 μL

Nuclease-free water

6 μL

Total nucleic acid

2 μL

4. Start the qPCR cycling using the following parameters:

Step

Temperature (
C)

Time

Number of cycles

Reverse transcription

50

10 min

1

DNA denaturation

95

2 min

1

DNA denaturation Annealing/extension + plate read

95 60

15 s 40 s

40

3.3 Conventional RT-PCR

1. Set up the cDNA synthesis reaction according to the following instructions (see Note 8):

3.3.1 cDNA Synthesis and PCR Reactions

50 μM random hexamers or 2 μM reverse primer

1 μL

10 mM dNTP mix (each)

1 μL

CTAB extracts

Up to 11 μL

Nuclease-free water

Up to a final volume of 13 μL

2. Heat reaction mix at 70
C for 5 min, and then cool the reaction to 4
C on ice. 3. Briefly spin down tubes and add reagents listed below:

114

Maria Saponari et al.

Nuclease-free water

Up to a final volume of 20 μL

5 M-MLV Buffer

4.0 μL

100 mM DTT

1.2 μL

RNaseOUT™ RNase Inhibitor

1.0 μL

M-MLV Reverse Transcriptase

0.5 μL

4. Incubate the reaction at 42
C for 45 min. 5. Incubate the reaction at 70
C for 15 min. 6. Set up 25 μL PCR reactions by mixing the following components (see Note 8): 12.5 μL

2 PCR master mix 10 μM forward primer 10 μM reverse primer

0.5 μL

a

0.5 μL

a

cDNA

2.5 μL

Nuclease-free water

4 μL

a

Primers reported in Table 2

Thermocycler program as follow: Step

Temperature (
C)

Time

Initial denaturation

98

2 min

Amplification

98 53–60a 72

30 s 30 s 30 s/kb

Final extension

72

5 min

No. cycles 1 35

1

a

See Table 2 for the melting temperature to be used for each primer pair

3.3.2 Electrophoresis

1. Mix 10 μL of the PCR reaction product with 2–3 μL of loading dye. 2. Analyze PCR reaction products by electrophoresis on 1% agarose gels buffered in 1 TAE and containing GelRed™ (1:100,000, v:v). 3. Load the samples and the DNA ladder (+1 kb) onto the gel. 4. Run gel for approximately 30 min at 110 V. 5. Transfer the gel onto the UV transilluminator to visualize the presence of the DNA bands of the expected size.

CTV RB Strains 3.3.3 Purification of PCR Reaction Product for Sequencing Analysis (See Note 9)

115

1. Use at least 50 μL of PCR product. 2. Add 5 volumes of Buffer PB. 3. Transfer mixture to the QIAquick column. 4. Centrifuge for 30 s at 11,000  g and discard flow-through. 5. Wash column by adding 750 μL of buffer PE and centrifuging for 30 s at 11,000  g. 6. Discard flow-through and centrifuge once more for 1 min at 11,000  g. 7. Place the QIAquick microcentrifuge tube.

column

into

a

clean

1.5

mL

8. Add 50 μL of Buffer EB and incubate at room temperature for 1 min. 9. Centrifuge for 1 min at 11,000  g. 10. The sample is ready for outsource sequencing using either the forward and/or reverse primer. 3.3.4 Sequence Analysis

1. Check the quality of the nucleotide sequences. 2. Trim primer sequences. 3. Blast the sequence, and determine the specificity and nucleotide identity: http://www.ncbi.nlm.nih.gov/. 4. Use MEGA 7 software or other dedicated software for sequence alignment and phylogeny (http://www. megasoftware.net/) (see Fig. 1).

3.4 Small RNA Purification and Sequencing

3.4.1 Extraction of the Total RNA for siRNA Purification

Full-genome sequencing through high-throughput sequencing (HTS) can be achieved using different RNA preparations: purified double-stranded RNA, plant total RNA, purified small RNA (sRNA) fractions, or purified viral RNA. HTS of small RNA fractions from CTV-infected plants has been previously used as tool to investigate, at molecular level, the virus-host interactions and to reconstruct with high coverage the CTV genomes, either with de novo assembling or mapping the short reads against selected reference genomes [19, 20]. 1. Weigh 1 g of citrus plant tissues (leaves with petioles or phloem scrapings). Grind tissues in liquid nitrogen in a mortar/pestle to obtain a fine powder. 2. Transfer the powder to a 15 mL conical tube, and add 10 mL/ 1 g of EB extraction buffer containing 1% of 2-mercaptoethanol (see Note 10). Mix by vortexing for 30 s. 3. Add 1 mL of 20% N-lauroylsarcosine, and incubate the samples at 70
C for 10 min in a water bath, with intermittent shaking. 4. Incubate the samples for 5 min on ice.

116

Maria Saponari et al.

Fig. 1 Maximum parsimony phylogeny for 58 complete genomes of Citrus tristeza virus isolates with its respective GenBank accession number. The percent of replicate trees of taxa that clustered together in the bootstrap test

CTV RB Strains

117

5. Centrifuge the samples at 2500  g for 15 min at 4
C, using a benchtop centrifuge with a swing-bucket rotor. 6. Transfer the supernatant to a clean 15 mL tube and add 0.5 volume of Trizol. 7. Vortex for 5 min and centrifuge at 2500  g for 15 min at 4
C, in a benchtop centrifuge. 8. Transfer the supernatant to a clean 15 mL plastic tube, and add 1/3 volume of chloroform. 9. Vortex for 5 min and then centrifuge at 2500  g for 5 min at 4
C. 10. Repeat steps 8 and 9 if the supernatant is not clear. 11. Transfer the supernatant to a clean 15 mL plastic tube, and add 1 volume of cold isopropanol. Incubate the samples overnight at 20
C or 1 h at 80
C. 12. Aliquot the isopropanol-precipitated samples into 2 mL tubes, and centrifuge the samples at 18,000  g for 20 min at 4
C. 13. Gently discard the supernatant and add 0.5 mL 75% ethanol to each pellet. Centrifuge 18,000  g for 5 min at 4
C, in a benchtop centrifuge. 14. Gently discard supernatant without disturbing the pellet. Air-dry pellet at room temperature (see Note 11). 15. Resuspend pellet in 750 μL of RNase-free water. 1. Add 750 μL of PEG solution to the total RNA (step 15 above), mix by vortexing, and incubate on ice for 30 min.

3.4.2 Separation of Low and High Molecular Weight RNAs

2. Centrifuge the tubes at 16,000  g for 20 min at 4
C in a benchtop centrifuge. 3. Transfer the supernatant containing the low molecular weight (LMW) RNAs to a clean 1.5 mL microcentrifuge tube, and dissolve the pellet, which contains the high molecular weight (HMW) RNAs, in 100 μL of 90% formamide (see Note 12). 4. Add 3 volumes of cold ethanol (stored at 20
C) to the microcentrifuge tube containing the LMW, and incubate overnight at 20
C or 1 h at 80
C. 5. After the incubation centrifuge the tubes at 16,000  g for 25 min at 4
C, in a refrigerated benchtop centrifuge. ä Fig. 1 (continued) (1000 replicates) are shown on each branch. The resistancebreaking (RB) sub-clades (groups) I and II are shown in the RB group. Three RB strains from California are underlined. Reproduced from Yokomi et al. (2017) Phytopathology 107:901–908 [10], with permission from the American Phytopathological Society

118

Maria Saponari et al.

6. Gently discard the supernatant, and add 500 μL of 75% ethanol to each microcentrifuge tube, and centrifuge at 18,000  g for 5 min at 4
C, in a refrigerated benchtop centrifuge. 7. Air-dry the pellet and resuspend in 100 μL of 90% formamide. The resuspended samples contain the LMW RNAs (54  C is advisable. Be careful to avoid the formation of dimers and cross reactivity. Scan the oligonucleotide sequences for internal structures, such as hairpins and self- and heterodimers. Moreover, select primer sequences with a similar GC content. 14. After plugging the IN2 clamp, seal the chip with the Hybr clamp trying to avoid air-balls. 15. Insert the chip with Hybridization area in the upper side of the Falcon tubes filled with washing buffer. 16. The processing time is less than 3 h.

Acknowledgments This work was funded in part by the MIUR and EU through the National Program PON R&C 2007–2013, project “IT-Citrus genomics” (PON 01_01623), led by Science and Technology Park of Sicily, Catania (Italy). References 1. Moreno P, Ambro´s S, Albiach-Martı´ MR et al (2008) Citrus tristeza virus: a pathogen that changed the course of the citrus industry. Mol Plant Pathol 9:251–268

2. Bar-Joseph M, Dawson WO (2008) Citrus tristeza virus. In: Mahy BWJ, van Regenmortel MHV (eds) Encyclopedia of virology, 3rd edn, Evolutionary biology of viruses, vol 1. Elsevier Ltd, Amsterdam, pp 161–184

LoC Characterization of CTV 3. Dawson WO (2010) Molecular genetics of Citrus tristeza virus. In: Karasev AV, Hilf ME (eds) Citrus tristeza virus complex and tristeza disease. St. Paul American Phytopathological Society, St. Paul, MN, pp 53–72 4. Karasev AV, Boyko VP, Gowda S et al (1995) Complete sequence of the Citrus tristeza virus RNA genome. Virology 208:511–520 5. Lu R, Folimonov A, Shintaku M et al (2004) Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome. Proc Natl Acad Sci USA 101:15742–15747 6. Satyanarayana T, Gowda S, Mawassi M et al (2000) Closterovirus encoded HSP70 homolog and p61 in addition to both coat proteins function in efficient virion assembly. Virology 278:253–265 7. Tatineni S, Robertson CJ, Garnsey SM et al (2011) A plant virus evolved by acquiring multiple nonconserved genes to extend its host range. Proc Natl Acad Sci USA 108:17366–17371 8. Harper SJ (2013) Citrus tristeza virus: evolution of complex and varied genotypic groups. Front Microbiol 4:1–18 9. Rosner A, Bar-Joseph M (1984) Diversity of Citrus tristeza virus strains indicated by hybridization with cloned cDNA sequences. Virology 39:89–93 10. Gillings M, Broadbent P, Indsto J et al (1993) Characterization of isolates and strains of Citrus tristeza closterovirus using restriction analysis of the coat protein gene amplified by the polymerase chain reaction. J Virol Methods 44:305–317 11. Licciardello G, Raspagliesi D, Bar-Joseph M et al (2012) Characterization of isolates of Citrus tristeza virus by sequential analyses of enzyme immunoassays and capillary electrophoresis-single-strand conformation polymorphisms. J Virol Methods 181:139–147 12. Hilf ME, Mavrodieva VA, Garnsey SM (2005) Genetic marker analysis of a global collection of isolates of Citrus tristeza virus: characterization and distribution of CTV genotypes and association with symptoms. Phytopathology 95:909–917 13. Roy A, Ananthakrishnan G, Hartung JS et al (2010) Development and application of a multiplex reverse-transcription polymerase chain reaction assay for screening a global collection of Citrus tristeza virus isolates. Phytopathology 100:1077–1088 14. Ruiz-Ruiz S, Moreno P, Guerri J et al (2009) Discrimination between mild and severe Citrus tristeza virus isolates with a rapid and highly

141

specific real-time reverse transcriptionpolymerase chain reaction method using TaqMan LNA probes. Phytopathology 99:307–315 15. Yokomi RK, Saponari M, Sieburth PJ (2010) Rapid differentiation and identification of potential severe strains of Citrus tristeza virus by real-time reverse transcription-polymerase chain reaction assays. Phytopathology 100:319–327 16. Weng Z, Barthelson R, Gowda S et al (2007) Persistent infection and promiscuous recombination of multiple genotypes of an RNA virus within a single host generate extensive diversity. PLoS One 2(9):e917. https://doi.org/10. 1371/journal.pone.0000917 17. Ruiz-Ruiz S, Navarro B, Gisel A et al (2011) Citrus tristeza virus infection induces the accumulation of viral small RNAs (21–24-nt) mapping preferentially at the 30 -terminal region of the genomic RNA and affects the host small RNA profile. Plant Mol Biol 75:607–619 18. Licciardello G, Scuderi G, Ferraro R et al (2015) Deep sequencing and analysis of small-RNAs in sweet orange grafted on sour orange infected with two Citrus tristeza virus isolates prevalent in Sicily. Arch Virol 160:2583–2589 19. Levy A, El-Mochtar C, Wang C et al (2018) A new toolset for protein expression and subcellular localization studies in citrus and its application to Citrus tristeza virus proteins. Plant Methods 14:2. https://doi.org/10.1186/ s13007-017-0270-7 20. Templier V, Livache T, Boisset S et al (2011) Biochips for direct detection and identification of bacteria in blood culture-like conditions. Sci Rep 7:9457 21. Primiceri E, Chiriaco` MS, de Feo F et al (2016) A multipurpose biochip for food pathogen detection. Anal Methods 8:3055–3060 22. Julich S, Riedel M, Kielpinski M et al (2011) Development of a lab-on-a-chip device for diagnosis of plant pathogens. Biosens Bioelectron 26:4070–4075 23. Chiriaco` MS, Luvisi A, Primiceri E et al (2018) Development of a lab-on-a-chip method for rapid assay of Xylella fastidiosa subsp. pauca strain CoDiRO. Sci Rep 8:7376 24. Scuderi G, Lombardo A, Raspagliesi D et al (2016) Development and evaluation of a novel probe microarray for genotyping Citrus tristeza virus using an integrated lab-on-chip device. J Plant Pathol 98:25–34 25. Teo J, Di Pietro P, San Biagio F et al (2011) VereFluTM: an integrated multiplex RT-PCR

142

Giuseppe Scuderi et al.

and microarray assay for rapid detection and identification of human influenza A and B viruses using lab-on-chip technology. Arch Virol 156:1371–1378 26. Conoci S, Di Pietro P, Petralia S et al (2006) Fast and efficient nucleic acid testing by ST’s In-Check™ lab-on-chip platform. NSTINanotech 2:562–565

27. Petralia S, Alessi E, Amore MG et al (2012) In-Check system: a highly integrated silicon lab-on-chip for sample preparation, PCR amplification and microarray detection towards the molecular diagnostics point-of-care. In Proceedings of the 14th international meeting on chemical sensors, Nuremberg, Germany, 2012, pp 341–343

Chapter 10 Rapid and Sensitive Detection of Citrus tristeza virus Using Reverse Transcription Loop-Mediated Isothermal Amplification (RT-LAMP) Assay Dilip Kumar Ghosh, Ashish Warghane, and Kajal Kumar Biswas Abstract Loop-mediated isothermal amplification (LAMP) is one recently developed gene amplification technique that emerges as a simple and quick diagnostic tool for early detection of nucleic acid targets. The LAMP technique works on the principle of strand displacement activity of Bst polymerase. It contains a set of four specially designed primers, which recognizes six different regions on the target nucleotide sequence. In the LAMP reaction, amplification is carried out in an isothermal conditions (60–65
C) using simple and inexpensive device like water bath or dry bath. Additional benefits of LAMP technique are that final results can be seen directly with naked eyes by adding intercalating dye SYBR Green I in the reaction tube. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) is one of the novel techniques used for detection of RNA targets. The technology has been successfully applied for rapid and sensitive detection of Citrus tristeza virus (CTV) by using four oligo-primers, targeting a conserved coat protein gene (CPG) of an Indian CTV isolate. The result of assay is visible in naked eyes easily in the presence of SYBR Green I (100) or on 1.5% agarose gel electrophoresis. CTV-RT-LAMP could be used away from plant pathology laboratories even in remote location. Key words Citrus, Tristeza disease, RT-LAMP, SYBR Green I, Bst DNA polymerase

1

Introduction Citrus tristeza virus (CTV), classified in genus Closterovirus in the family Closteroviridae, is the most destructive viral pathogen of citrus industry worldwide, responsible to cause a most important and damaging disease of citrus known as Tristeza, destroying millions of citrus trees globally [1–3]. CTV is a phloem-inhabiting, long flexuous virus measuring 2000  11 nm in size and transmitted by several aphid species, predominantly by brown citrus aphid (Toxoptera citricidus) in a semi-persistent manner [1, 4]. The CTV genome contains a positive-sense single-stranded RNA of about 20 kb with 12 open reading frames (ORFs) potentially encoding at least 19 proteins [1, 5]. The virus induces three syndromes

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_10, © Springer Science+Business Media, LLC, part of Springer Nature 2019

143

144

Dilip Kumar Ghosh et al.

including (1) decline of citrus species grafted on sour orange; (2) yellowing and growth cessation of sour orange, lemon, and grapefruit; and (3) stunting and stem pitting with poor fruit yield and quality of different citrus species [5, 6]. The differential display of symptoms, mixed infection of field samples, excessive time requirement to complete the assay, and non-symptomatic incidences in citrus are some of the reasons for hindrance in biological indexing of CTV [2]. Again, currently available techniques for CTV detection, viz., RT-PCR, IC-PCR, real-time PCR, ELISA, electron microscopy, etc., either are expensive and time-consuming or require highly skilled workers [7, 8]. Therefore, attempts are made to set up newer molecular diagnostic methods that are robust, easy-to-handle, and reliable. Recent discovery of loopmediated isothermal amplification (LAMP), an effective DNA amplification method, is a landmark development in this direction as it is simple, quick, sensitive, and cost-effective [9–11]. LAMP technique works on the principle of auto-cycling and strand displacement activity of the Bst DNA polymerase [12–14]. Additional advantage of LAMP technique is that final results can be seen directly by naked eyes by adding popular intercalating dye SYBR Green I. It has been applied for detection of many plant viruses, bacteria, and fungi, including CTV [12, 15]. This chapter describes a protocol used to apply the technology for rapid and sensitive detection of CTV [12] carried out on the isothermal temperature at 65
C for 60 min using simple and inexpensive device like water bath or dry bath. It requires a set of four specially designed primers (forward internal primer (FIP) and backward internal primer (BIP) and outer primers, F3 and B3) which recognizes six different regions on the target nucleotide sequences [12, 16, 17] designed on CPG sequence of a Indian CTV isolate (Accession No. GQ475539). CTV-RT-LAMP can be used for rapid and simple detection of CTV in pathology laboratories having limited facility and resources. Moreover, this technique can be incorporated for the implementation of citrus budwood certification program to screen CTV even by citrus nurseries situated in remote locations.

2

Materials 1. Razor blades. 2. Disposable gloves. 3. Pipettes for micro volume. 4. Sterilized long filter tips (10 μL, 200 μL). 5. Nuclease free PCR tubes (0.2 mL). 6. Eppendorf tubes (1.5 mL).

RT-Lamp Detection of CTV

145

7. Brown color microcentrifuge tube (1.5 mL). 8. Water bath/dry bath to maintain the constant temperature of 65
C (see Note 1). 9. Ultrapure water (prepared by purifying deionized water, to attain a sensitivity of 18 MΩ cm at 25
C). 10. Liquid nitrogen. 11. Sterilized pestles and mortars. 12. 70% ethanol. 13. RNeasy® plant mini kit (Qiagen, Germany) or similar compounds for extraction of RNA (see Note 2). 14. 40 μM (inner primers) and 10 μM (outer) LAMP primers specific for CTV (Table 1) (see Notes 3–5). 15. Bst polymerase (Warm start) (see Note 6). 16. 10 Thermopol® isothermal buffer [New England BioLabs]: 20 mM Tris-HCl, 2 mM MgSO4, 0.1% Tween 20. 17. 10 mM dNTPs mix (each). 18. Ethidium bromide. 19. AMV RT (Avian Myeloblastosis Virus Reverse Transcriptase). 20. Betaine. 21. 10,000 SYBR® Green I nucleic acid gel stain (see Note 7). 22. 6 gel loading dye. 23. Sterilized TE buffer: 0.2 M Tris, 20 mM EDTA (pH 7.5 at 25
C). 24. 1 TAE buffer: 40 mM Tris, 20 mM acetic acid, 1 mM EDTA at pH 8.6. 25. Electrophoresis grade agarose (low EEO). 26. Laminar air flow/biosafety cabinet. 27. Agarose gel electrophoresis apparatus. 28. Gel documentation system.

Table 1 CTV-RT-LAMP primers used for detection of Citrus tristeza virus Sr. no

Name of primer

Sequence

1

CTV-F3

50 -CGAAGTGGATTTGTCTGACA-30

2

CTV-B3

50 -G GAATCCCTGCATCTAGCG-30

3

CTV-FIP

50 -ACTCGAAGGGCGTTAGTACGGCTTTGGACTGACGTCGTGTT-30

4

CTV-BIP

50 -CTGGGGTAGGACTAACGATGCCGACGTCCGCCATAACTCAA-30

146

3

Dilip Kumar Ghosh et al.

Methods

3.1 Sample Preparation and RNA Extraction

Collect symptomatic leaves (symptoms including vein clearing, vein corking, leaf cupping, vein flecking, sparse foliage, yellow leaves, and stem pitting) from citrus trees (stunted or partially declined), wash with nuclease-free water, blotter dried, and subsequently wipe using 70% ethanol to minimize surface contamination, if any (see Note 8). Excise midribs of the individual leaf samples, and ground in liquid nitrogen using sterilized pestle and mortar. Utilize about 100 mg of the powdered citrus sample for extraction of the total RNA using a RNeasy® plant mini kit (Qiagen, Germany) following the manufacturer’s protocol. Alternatively, another method which extracts RNA of good quantity and quality can be used (see Note 9).

3.2 CTV Identification by RT-LAMP

All procedures should be carried out at room temperature unless otherwise specified. While performing the reactions, all the reagents should be kept at 4
C in an ice bucket/ice cooler. To avoid contamination, conduct the reaction in laminar air flow/ biosafety cabinet (see Note 10). Before conducting the reaction, disinfect the workplace and all pipettes with 70% ethanol to avoid the carryover contamination (see Notes 2 and 8). While conducting the reaction, use high-quality gloves, and in between wipe the gloves with the 70% ethanol. Prepare the 25 μL reaction mixture using pipettes having filter tips in PCR tubes (transparent) of 0.2 mL capacity (see Notes 11–14), by mixing: 10 Thermopol isothermal buffers

2.5 μL

10 μM outer primer CTV-F3 and CTV-B3 (Each)

0.5 μL

40 μM inner primer CTV-FIP and CTV-BIP (Each)

1 μL

10 mM dNTPs mix

2 μL

10 U Avian Myeloblastosis Virus Reverse Transcriptase

0.5 μL

5 M betaine

4 μL

8 U/μL Bst polymerase

1 μL

Sterilized nuclease-free water

10 μL

1. Add 2 μL total RNA extracted from the citrus leaf. 2. Mix all the reagents in the tube by pipetting (see Note 15). 3. Gently centrifuge the tube for 10 s (see Note 6). 4. Incubate at 65
C for 60 min on water bath/dry bath (see Note 16). Ensure that the tube caps are closed tightly and cannot come open or loose while incubation.

RT-Lamp Detection of CTV

147

5. After incubation, heat the reaction tube at 80
C for 10 min to inactivate the enzyme. 6. Remove 5 μL of RT-LAMP product from the reaction tube, and use it for confirmation of results on 1.5% agarose gel electrophoresis. 7. Melt the agarose in electrophoresis 1 TAE buffer by heating with continuous swirling till a clear solution is obtained. The comb was placed in to the casting tray with the help of a stand. Distance between bottom of comb and casting tray was adjusted with the help of a glass slide. 8. About 2 μL of ethidium bromide was added to the molten agarose as soon as the temperature reaches up to 45
C and molten agarose was poured to the gel casting platform with a comb inserted, ensuring that no air bubbles can be entrapped underneath the comb. Gel was placed in electrophoresis tank. The gel tank was filled with sufficient volume of electrophoresis buffer in which gel should be submerged. 9. Prepare RT-LAMP products in 6 gel loading dye and load into the wells with micro-pipette. 10. Carry out electrophoresis at a constant voltage of 50 V. Gel was allowed to run until marker dye has migrated about 75% toward the positive pole. 11. Visualize and photograph RT-LAMP products in agarose gel by using a gel documentation unit. 12. To visualize the RT-LAMP product, add 2 μL of 100 SYBR Green I in remaining 20 μL volume, and mix properly (see Note 7). 13. In case of positive reaction, there will be change of color (to green) in reaction tube almost immediately after adding the SYBR Green I dye (see Fig. 1a). Negative reaction retains the SYBR Green I dye, i.e., orange. After result interpretation reaction tubes are stored in the ziplock bags (see Note 17). 14. For reconfirmation of results, run LAMP products in 1.5% agarose gel electrophoresis. The presence of ladderlike bands indicates CTV-positive samples, whereas the absence of ladderlike band indicates negative reaction (see Fig.1b). This step is used only for confirmation of the results. To check the specificity of primer, extracted genomic RNA may be amplified by the conventional PCR using RT-LAMP outer primers (CTV-F3/ CTV-B3). An expected 210 bp band will be observed in CTV infected samples.

148

Dilip Kumar Ghosh et al.

Fig. 1 Reverse transcription loop-mediated isothermal amplification (RT-LAMP)-based method for detection of Citrus tristeza virus in citrus plants. (a) Visualization of LAMP reactions using SYBR Green I. (b) Agarose gel electrophoresis of RT-LAMP products amplified from citrus plant samples. Pol14, C1, SK14, and Mir1 represent RNA of four CTV isolates maintained in the insect-proof greenhouse; H1 and H2: healthy samples, L: 100 bp DNA ladder and B: blank (Source: Warghane et al, 2017)

4

Notes 1. The water bath/dry bath will always be connected with an uninterruptible power supply (UPS) to avoid the electrical interruption, which may lead to temperature variations. 2. Always collect fresh citrus leaves and use leaf midribs (as CTV is a phloem-limited virus) for total RNA isolation. Before starting the RNA extraction, working bench should be properly cleaned with RNaseZap solution to remove the RNase (which degrades RNA) contamination.

RT-Lamp Detection of CTV

149

3. During primer reconstitution, first master stock, i.e., 100 μM, was diluted in the TE buffer, while working stock is diluted with nuclease-free water (10 μM or more). Always prepare 40 μM working stock for inner primers. If we prepare 10 μM working stock, the volume of these primers will be very high and finally very less quantity of nuclease-free water to be added for volume make-up. 4. Primer designing is the most complicated procedure in LAMP technique. Choose the most conserved genomic region of the virus. For plant viruses, mostly CPG sequence is preferred. While designing the primers strictly, follow the guidelines mentioned in primer explorer software pdf: A Guide to LAMP primer designing. Design two or three sets of primes (primer explorer.jp/e/v4_manual/pdf/PrimerExplorerV4_Manual_1.pdf). 5. Working stock of primers should be kept at 4
C temperature. 6. After addition of all the reagents and enzyme, mix by three- to four-time pipetting out and in, and then centrifuge the reaction tube for 3–5 s on 92 RCF. Do not centrifuge the reaction tube at high rpm for longer time as it will destabilize the Bst polymerase. 7. SYBR® Green I nucleic acid gel stain 10,000 is diluted to 100 (take 10 μL 10,000 stain and add into 90 μL nucleasefree water in brown colored Eppendorf tube of 1.5 mL capacity). Always prepare the SYBR green dye in the brown color tube, because it is light sensitive. Perform the visualization of result at different place from the reaction place, preferably in a different room, to avoid aerosol contamination. 8. Use high-quality gloves during RNA extraction, and after every steps, wipe them with 70% ethanol to avoid the carryover contamination. 9. After RNA extraction, immediately store the isolated RNA at 80
C deep freezer. 10. If possible, perform the CTV-RT-LAMP reaction under laminar air flow hood/biosafety cabinet to avoid carryover contamination. Otherwise, perform the reactions on different workbench (do not perform the reactions at a place where the RNA extraction protocol was conducted). 11. Sterilize all consumables (transparent PCR tubes, filter tips, 1.5 mL tubes) before starting the reactions. Do not use colored PCR tube, which may create confusion during result interpretation. 12. The use of high-quality filter tips during reaction setup avoids carryover contamination.

150

Dilip Kumar Ghosh et al.

13. During reaction setup, always use positive, negative, and reaction control to check the robustness and false-positive results. 14. During the reaction, strictly follow the steps described in methods. 15. Be careful, and do not allow any bubble formation while mixing. 16. Before putting the sample for incubation, clean the dry bath with 70% ethanol, or place under UV light for 15 min, and preheat the water bath or dry bath to 65
C. 17. Always store the LAMP product in ziplock bag or sealed container to avoid the aerosol contamination. References 1. Bar-Joseph M, Dawson WO (2008) Citrus tristeza virus. In: Mahy BWJ and Van Regenmortel MHV (eds) Encyclopedia of Virolology, Elsevier, Oxford 2. Ahlawat Y (2012) Virus Diseases of Citrus and Management. Stadium Press, Delhi 3. Ghosh DK, Aglave B, Roy A et al (2009) Molecular cloning, sequencing and phylogenetic analysis of coat protein gene of a biologically distinct Citrus tristeza virus isolate occurring in central India. J Plant Biochem Biotechnol 18:105–108 4. Ayllon MA, Lopez C, Navas-Castillo J et al (2001) Polymorphism of the 5’ terminal region of Citrus tristeza virus (CTV) RNA: Incidence of three sequence types in isolates of different origin and Pathogenicity. Arch Virol 146:27–40 5. Biswas KK, Tarafdar A, Sharma SK (2012) Complete genome of mandarin decline Citrus tristeza virus of Northeastern Himalayan hill region of India: comparative analyses determine recombinant. Arch Virol 157:579–583 6. Biswas KK, Palchoudhury S, Sharma SK et al (2018) Analyses of 3’ half genome of citrus tristeza virus reveal existence of distinct virus genotypes in citrus growing regions of India. Virus Dis 29(3). https://doi.org/10.1007/ s13337-018-0456-2 7. Ward LI, Harper SJ (2012) Loop-mediated isothermal amplification for the detection of plant pathogens. Methods Mol Biol 862:161–170 8. Rigano LA, Malamud F, Orce IG et al (2014) Rapid and sensitive detection of Candidatus Liberibacter asiaticus by loop mediated isothermal amplification combined with a lateral flow dipstick. BMC Microbiol 14:86 9. Varga A, James D (2006) Use of reverse transcription loop mediated isothermal

amplification for the detection of Plum pox virus. J Virol Methods. 138:184–190 10. Fukuda S, Takao S, Kuwayama M et al (2006) Rapid detection of norovirus from fecal specimens by real-time reverse transcription-loopmediated isothermal amplification assay. J Clin Microbiol 44:1376–1381 11. Dukes JP, King DP, Alexandersen S (2006) Novel reverse transcription loop-mediated isothermal amplification for rapid detection of foot-and-mouth disease virus. Arch Virol 151:1093–1106 12. Warghane A, Misra P, Bhose S et al (2017) Development of a simple and rapid reverse transcription-loop mediated isothermal amplification (RT-LAMP) assay for sensitive detection of Citrus tristeza virus. J Virol Methods 250:6–10 13. Kuboki N, Inoue N, Sakura FD et al (2003) Loop-mediated isothermal amplification for detection of African trypanosomes. J Clin Microbiol 41:5517–5524 14. Mori Y, Nagamine K, Tomita N et al (2001) Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem Bioph Res Commun 289:150–154 15. Wang YJ, Zhou Y, Li Z et al (2013) A RT LAMP Assay for detection of Citrus tristeza virus. Scie agri sincia 46:517–524 16. Notomi T, Okayama H, Masubuchi H et al (2000) Loop mediated isothermal amplification of DNA. Nucleic Acids Res 28(12):E63 17. Fernandez-Soto P, Mvoulouga PO, Akue JP et al (2014) Development of a highly sensitive loop-mediated isothermal amplification (LAMP) method for the detection of Loaloa. PLoS One 9:e94664

Chapter 11 Amplification and Cloning of Large cDNA Fragments of the Citrus tristeza virus Genome Munir Mawassi, Sabrina Haviv, and Ludmila Maslenin Abstract Citrus tristeza virus (CTV) is probably the most destructive viral pathogen of citrus. It causes chronic losses to commercial citrus production in all citrus-growing areas. The complete sequences of at least 42 genomes of different CTV strains have been obtained using different technologies including sequencing of multiple overlapped RT-PCR-amplified fragments with sizes of less than 4 kb, or from small viral RNA (svRNA), through next-generation high-throughput sequencing (NGS) technologies. The large size of CTV genome (>19.2 kb) makes it impractical to obtain and amplify full-length cDNA in a single step. The strategy of ligation of multiple cDNA fragments to assemble a full-length cDNA clone involves several serial cloning steps and sometimes subcloning phases using enzymatic digestion with restriction nucleases and ligation reactions. In this protocol, we describe a strategy to clone the entire genome of CTV obtained from two RT-PCR amplified products. These 50 - and 30 -genomic halves, which were designed to be overlapped in 15 nt in their 30 - and 50 -ends, respectively, were used as templates for further overlapped PCR to amplify the entire ~20 kb CTV genome. The resultant full cDNA PCR product was then inserted into pCAMBIAbinary vector. Key words RNA extraction, cDNA synthesis, Large PCR fragments, Overlapped PCR, Ligation, E. coli transformation

1

Introduction Citrus tristeza virus (CTV) is considered as the most destructive viral pathogen of citrus. The virus causes chronic losses to commercial citrus production in all citrus-growing areas, due to induction of various disease syndromes, depending on the citrus host and the virus strain. Among these, quick decline of most citrus species grafted onto sour orange (Citrus aurantium L.) rootstock and stem pitting (SP), a devastating disease that reduces fruit yield and quality of several citrus species regardless of the rootstock. In addition, some CTV variants induce seedling yellows (SY), a syndrome, which occurs in young seedlings of grapefruit and sour orange under greenhouse conditions. Yet, some strains of CTV,

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_11, © Springer Science+Business Media, LLC, part of Springer Nature 2019

151

152

Munir Mawassi et al.

named as mild strains, do not elicit noticeable symptoms on most commercial citrus hosts [1, 2]. CTV is a member of the family Closteroviridae [3], genus Closterovirus. The virion is long and flexuous (2000 nm  10–12 nm) [4] and has a ~19.3 kb single-stranded, positive-sense RNA genome [5]. The virus genome consists of 12 open reading frames (ORFs), which potentially encode at least 19 protein products [5]. ORF1a and ORF1b are translated directly from the genomic RNA and encode CTV replication-related proteins. The other ORFs are expressed via 30 -coterminal sub-genomic RNAs. The complete sequences of at least 42 genomes of different CTV strains have been obtained. Based on analysis of nucleotide sequences of the ORF1a, there now appear to be at least six major sequence or genotype groups, represented by type strains T36, T3, T30, T68, VT, and RB [6]. Each genotype group is composed of variants with minor sequence divergence, generally less than 5% throughout the entire genome [7–9]. The complete sequences of most genomes of CTV strains have been obtained using different technologies including sequencing of amplified RT-PCR and next-generation high-throughput sequencing (NGS) [10]. The large size of CTV genome (>19.2 kb) makes it impractical to obtain and amplify full-length cDNA in a single step. Therefore, CTV genomes were sequenced from multiple overlapped RT-PCR-amplified fragments with sizes of less than 4 kb, or from small viral RNA (svRNA), through NGS technologies. The strategy of ligation of multiple cDNA fragments to assemble a fulllength cDNA clone, which involves enzymatic restriction and ligation reactions, is complex, laborious, and time-consuming. This approach, in which the first infectious clone of CTV-T36 isolate T36 from Florida was produced in 1999 [11], usually involves several serial cloning steps and sometimes subcloning phases using enzymatic digestion with restriction nucleases and ligation reactions. The presence of very few unique enzymatic restriction sites into the large CTV genome makes the cloning of the large virus genome even more challenging and frustrating. Additionally, in the case of mixed infection of various CTV genotypes into the single plant, it is likely to acquire chimeric full-length CTV genomes gathered from few genotypes. In recent years, novel cloning procedures and commercial kits have been employed for cloning of cDNAs into plasmids with no need for the use of restriction enzymes. Nowadays, a number of different kits allowing amplification of large DNA fragments are commercially available and can be used for assembling full-length viral cDNA clones in less number of steps. Using these advanced tools, we have optimized protocols for PCR amplification of up to 20 kb cDNA fragments and for cloning of such large cDNAs directly into binary vectors without the need to rely on the use of restriction enzymes. With the use of such

Cloning of Full-CTV Genome

153

Fig. 1 RT-PCR amplification of CTV genomic fragments: (1) entire genome (overlapped PCR); (2) 50 half fragment about 9.3 kb in length; and (3) 30 half fragment about 10 kb in length

protocols, we have assembled several full-length cDNA clones of CTV strains (Haviv et al., data not published). In this protocol, we describe a strategy to clone the entire genome of CTV obtained from two RT-PCR-amplified products. Commercial kits are employed for synthesis of large cDNA fragments (up to 20 kb), and cloning of large amplified cDNAs into plasmids are performed with no need for the use of restriction enzymes. The 50 -terminal 10 kb fragment and the 30 -terminal 10 kb fragment of CTV genome were amplified by RT-PCR with the use of the Herculase II fusion DNA high-fidelity polymerase (Agilent Technologies). These 50 - and 30 -genomic halves, which were designed to be overlapped in 15 nt in their 30 - and 50 -ends, respectively, are used as templates for further overlapped PCR to amplify the entire ~20 kb CTV genome (see Fig. 1). The PCR product is then inserted into pCAMBIA-binary vector, in between CaMV 35S promoter and terminator, using traditional restriction enzymatic digestion followed by ligation or using the In-Fusion HD Cloning Kits (Clontech).

2 2.1

Materials RNA Extraction

1. Sterile mortars and pestles. 2. 1.5 mL Eppendorf tubes. 3. Microcentrifuge. 4. Vortex. 5. Freezer 20  C. 6. Vacuum desiccator. 7. Heating water baths (65  C, 42  C). 8. Homogenizer. 9. BIOREBA bags.

154

Munir Mawassi et al.

10. Deep freeze 80  C. 11. Liquid nitrogen. 12. TRI Reagent [Sigma]. 13. Chloroform. 14. Glycogen. 15. 75% Ethanol. 16. 2-propanol. 17. Nuclease-free H2O. 18. Sodium bisulfate powder (NaHSO3). 19. 10 extraction buffer; dissolve in 1 L of distilled water: TRIS 2.40 g, NaCl 8 g, PVP K25 (MW 24,000) 20 g, Tween 20 0.50 g, KCl 0.2 g, NaN3 0.2 g pH 7.4. 20. AccuPrep® Viral RNA Extraction Kit [BiONEER]. 2.2 RT-PCR Amplification

1. Thermal cycler. 2. 0.2 mL PCR tubes. 3. Maxima H minus Reverse Transcriptase kit [Thermo Scientific]. 4. Random Hexamer primer. 5. 10 mM dNTP Mix (each). 6. Ice. 7. RiboLock RNase Inhibitor [Thermo Scientific]. 8. Herculase II fusion DNA polymerase with dNTPs Combo [Agilent Technologies]. 9. 5 μM forward and reverse primers (each): CTV Start F: 50 -AATTTCTCAAATTCACCCGTACC-30 . CTV 9501 R: 50 -GAAATTTTCGGGCCCCACAAATC-30 . CTV 9432 F: 50 TCTTCTGTCGTACGAAAGTCG-30 . AfeI CTV END PacI R: 50 -CGTACCGAATTCAGCttaattaaTGGACCTATG TTGGCCCC-30 10. NucleoSpin Gel and PCR clean-up kit [Macherey-Nagel] or any other PCR clean kit.

2.3 Cloning of Amplified PCR Products

1. PucI digestion enzyme and its suitable 10 buffer. 2. PucI: Blunt-ended digested pCAMBIA-based vector (modified to include PucI site in the multi-cloning fragment). 3. 3 M NaAcetate (pH 5.2). 4. T4 DNA ligase. 5. PEG 4000. 6. E. coli Stellar Competent Cells [Takara].

Cloning of Full-CTV Genome

155

7. SOC medium. 8. Shaker set at 160–225 rpm and 37  C. 9. LB plates with kanamycin at concentration of 50 μg/mL.

3

Methods

3.1 RNA Extraction from CTV-Infected Citrus Seedlings

The citrus plants used in this protocol are initially examined for CTV infection by ELISA or by a standard RT-PCR assay. For amplification and cloning of large cDNA fragments of the virus genome, we used a single-infected citrus plant as a source for RNA extraction. Bark tissue was peeled from young stems of the citrus plant. The bark tissue should be used upon collection; alternatively it can be frozen in liquid nitrogen and stored at 80  C prior to analysis (see Note 1). Principally, one of the following two protocols can be used for RNA extraction from CTV-infected tissues. Both protocols end up with RNA extracts ideal for further analysis. TRI based protocol: 1. Peel the bark from relative newly grown branches. 2. Grind the bark in a mortar with a pestle in the presence of liquid nitrogen. 3. Transfer 500 mg of the bark powder to an Eppendorf, containing 1 mL of TRI Reagent [Sigma]. 4. Vortex vigorously for 15 s. 5. Allow samples to stand for 5 min at room temperature. 6. Add 0.2 mL of chloroform per mL of TRI Reagent used. 7. Shake vigorously for 15 s. 8. Allow to stand for 15 min at room temperature. 9. Centrifuge the resulting mixture at 12,000  g for 15 min at 4–8  C. 10. Transfer the aqueous phase to a fresh tube, and add 1 mL of 2-propanol per mL of TRI Reagent used in sample preparation and mix. 11. Add 2 μL of glycogen [Thermo Scientific]. 12. Place O.N. in 20  C. 13. Centrifuge at 12,000  g for 15 min at 4–8  C. 14. Remove the supernatant, and wash the RNA pellet by adding 1 mL of 75% ethanol (see Note 2). 15. Centrifuge at 12,000  g for 10 min at 4–8  C. 16. Dry the pellet for 10 min by air drying or under a vacuum. 17. Add 40 μL of 65  C heated ddH2O.

156

Munir Mawassi et al.

18. Transfer the Eppendorf to 65  C for 10–15 min. 19. Divide the RNA to aliquots and store in 80  C. AccuPrep® Viral RNA-based Extraction protocol: In this protocol, the AccuPrep® Viral RNA Extraction Kit from BiONEER is used, with modifications of the commercial protocol: 1. Peel the bark from relative newly grown branches. 2. Into a BIOREBA bag add 40 mg of Sodium bisulfate powder. 3. Grind the bark in the BIOREBA bag with Homogenizer with 2 mL of the 1 extraction buffer “Generals” [BIOREBA]. 4. Transfer 400 μL of the homogenate to a clean 1.5 mL tube. 5. Add 200 μL of binding buffer (VB) (provided with AccuPrep® Viral RNA Extraction Kit) in the tube, and mix by lightly vortexing for 5 s. 6. Incubate for 10 min at room temperature. 7. Add 100 μL of 2-propanol, lightly vortex for about 5 s. 8. Fit the binding column into a 2 mL collection tube. Transfer the liquid into the binding column, without getting the lid wet. 9. Centrifuge for 1 min at 6200  g. 10. Add 500 μL of W1 buffer (provided with AccuPrep® Viral RNA Extraction Kit) to the column and centrifuge for 1 min at 6200  g. 11. Add 500 μL of W2 (provided with AccuPrep® Viral RNA Extraction Kit) buffer and centrifuge for 1 min at 6200  g. 12. Spin down once more at 16,200  g for 1 min. 13. Transfer the binding column to a 1.5 mL collection tube, add ~30 μL of 65  C heated ddH2O, and let stand for 10 min. 14. Elute by spinning down at 8000 rpm for 1 min. The eluted RNA solution can directly be used, or stored at 80  C for longer storage. 3.2 Reverse Transcription

The synthesis of long CTV-cDNA species is an essential step in the amplification of large PCR fragments. Different sources of reverse transcriptase are commercially available; however, by using the following protocol and the Maxima H minus Reverse Transcriptase kit (Thermo Scientific), large cDNA molecules with a size of ~20 kb can be obtained: 1. In a 0.2 mL PCR tube, include 1 μg of RNA and add: Random Hexamer primer

1 μL

10 mM dNTP Mix (each)

1 μL

Nuclease-free H2O

Up to 14.5 μL

Cloning of Full-CTV Genome

157

2. Mix gently, centrifuge briefly, and incubate at 65  C for 5 min. 3. Chill on ice, briefly centrifuge again, and place on ice. 4. Add the following reaction components: 5 RT Buffer

4 μL

RiboLock RNase Inhibitor

0.5 μL

Maxima H Minus Reverse Transcriptase

1 μL

5. Incubate for 10 min. at 25  C. 6. Incubate the tube contents, using a thermal cycler machine, at gradient of temperatures ranged from 42  C to 65  C, which includes 23 phases, with an increase of 1  C at every 150 s. 7. Terminate the reaction by incubating the reaction contents at 85  C for 5 min (see Note 2). 3.3 PCR Amplification of Large CTV cDNAs

The following protocol is used to amplify two large PCR fragments of ~10 kb each to cover the entire CTV genome (see Note 3).

3.3.1 Amplification of the 50 10 kb

Prepare the RT-PCR mixture according the following conditions in a 0.2 mL PCR (see Note 4):

3.3.2 Amplification of the 30 10 kb (See Note 3)

5 Herculase II Reaction Buffer

10 μL

10 mM dNTP Mix (each)

2 μL

5 μM primers CTV Start F and CTV 9432 F (each)

2 μL

Herculase II Fusion DNA Polymerase

1 μL

CTV cDNA

4 μL

Nuclease-free water

Up to 50 μL

Prepare the RT-PCR mixture according to the following conditions in a 0.2 mL PCR (see Note 4): 5 Herculase II Reaction Buffer

10 μL

10 mM dNTP Mix (each)

2 μL

5 μM primers CTV 9432 F and AfeI CTV END PacI R (each) 2 μL Herculase II Fusion DNA Polymerase

1 μL

CTV cDNA

4 μL

Nuclease-free water

Up to 50 μL

158

Munir Mawassi et al.

PCR Procedure: Mix gently the all components, and place the PCR tubes into thermal cycler with a heated lid. Run a PCR program with the following steps: 95  C for 2 min 95  C for 20 s 52  C for 20 s 68  C for 10 min

 30

68  C for 5 min

Following the amplification reaction, clean the PCR products with NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel) or with the use of any other PCR clean kit. 3.3.3 Amplification of Overlapped PCR Products

To amplify the entire 20 kb CTV genome, an overlapped PCR should be conducted by following this protocol. In a 0.2 mL PCR tube, include 100 ng from each of the 50 10 kb and the 30 10 kb PCR products and add (see Note 4): 5 Herculase II Reaction Buffer

10 μL

10 mM dNTP Mix (each)

2 μL

5 μM primers CTV Start F and AfeI CTV END PacI R (each) 2 μL Herculase II Fusion DNA Polymerase

1 μL

CTV cDNA

4 μL

Nuclease-free water

Up to 50 μL

PCR Procedure. Mix gently the all components, and place the PCR tubes into thermal cycler with a heated lid. Run a PCR program with the following steps: 95  C for 2 min 95  C for 30 s 90  C for 30 s 85  C for 30 s 80  C for 30 s 75  C for 30 s 70  C for 30 s 65  C for 30 s (continued)

Cloning of Full-CTV Genome 95  C for 20 s 52  C for 20 s 68  C for 15 min

159

 30

68  C for 5 min

Following the amplification, clean the PCR product with the use of the NucleoSpin Gel and PCR clean-up kit (Macherey-Nagel) or with any other PCR clean kit. 3.4 Ligation of the Entire CTV Genome Into a Plasmid Vector

1. Digest the DNA in a total of 400 μL reaction contents with the PucI digestion enzyme according to the manufacturer’s instructions (see Notes 5–7). 2. Clean the digested DNA with the use of any PCR clean kit. 3. Concentrate the PCR product by precipitation by of the DNA with ethanol, with the presence of the 3 M NaAcetate (pH 5.2) and glycogen. 4. Resuspend the DNA with 10 μL H2O. 5. In a 1.5 mL tube, include PucI digested PCR product and DNA of PucI:blunt-ended digested plasmid vector, in a concentration ratio of 2:1 according to the fusion ligation calculator (http://bioinfo.clontech.com/infusion/molarRatio.do) to the following ligation contents (see Note 7): 10 T4 DNA ligase buffer

1 μL

PEG 4000

1 μL

T4 DNA ligase

1 μL

Nuclease-free water

Up to 10 μL

6. Incubate tube with ligation reaction at 4  C for O.N. 3.5 Transformation of Escherichia coli

For efficient transformation, use the commercial E. coli Stellar Competent Cells (see Note 8). 1. Thaw Stellar Competent Cells on ice just before use. 2. After thawing, mix gently to ensure even distribution, and then move 50 μL of competent cells into a 1.5 mL Eppendorf. 3. Add 2.5–5 μL of the ligation reaction mixture to the competent cells (see Note 9). 4. Place the tubes on ice for 30 min. 5. Heat shock the cells for exactly 45 s at 42  C. 6. Place tubes on ice for 1–2 min. 7. Add SOC medium to bring the final volume to 500 μL. SOC medium should be warmed to 37  C before using.

160

Munir Mawassi et al.

8. Incubate by shaking (160–225 rpm) for 1 h at 37  C. 9. Spread the transformation reaction on an LB plate containing an antibiotic appropriate for the cloning vector. 10. Incubate all of the plates overnight at 37  C. 11. Select bacterial colonies for further screening (see Note 10).

4

Notes 1. For efficient viral RNA extraction, choose shoots which can be easily peeled. Fresh growth of shoots from citrus seedlings, which are maintained in 28  C, are preferable for viral RNA extraction. 2. The genome of the CTV is a long RNA and can easily be damaged, throughout avoid any aggressive vortex during RNA extraction and cDNA synthesis procedures. 3. The 50 and the 30 terminal sequences of the genomes of CTV strains and isolates can be remarkably variable [12]; therefore, for cDNA and PCR amplifications, make sure to use primers with sequences specific to the appropriate CTV genotype. The primers described in this protocol designed to be specific to the VT-CTV genotype [13]. 4. A key component of amplification of large DNA fragments is the DNA polymerase. In this protocol we rely on the use of Herculase II fusion DNA polymerase with dNTPs Combo (Agilent Technologies). Herculase II fusion DNA polymerase produces large PCR products, up to 23 kb, with short extension times (~15 s/kb). This enzyme can easily amplify low abundance DNA, even with GC-rich targets. 5. Ligation of large PCR-amplified fragments can be cloned into plasmid vector digested with suitable enzymatic digestion enzymes, followed by ligation reaction as described in this protocol or, alternatively, can be cloned with the use of In-Fusion® HD Cloning Kit [Clontech]. 6. Digestion of the amplified PCR product should be done with the restriction enzyme for which the specific digestion site sequence is included in the primer. Here, we used the PucI digestion enzyme because we routinely use a modified pCAMBIA2301 vector that was design to include multi-cloning sites such as PucI, AfeI, StuI, and more [14]. 7. For efficient ligation, use a plasmid vector capable of harboring large DNA fragments. From our experience, the pCAMBIAbased vectors are preferable of pUC19-based vectors, for cloning of 20 kb DNA fragments. 8. Do not vortex, and then gently mix the Stellar Competent Cells with ligation reaction contents; do not vortex.

Cloning of Full-CTV Genome

161

9. Do not add more than 5 μL of the ligation reaction to 50 μL of competent cells. More is not better. Using too much of the ligation reaction mixture inhibits the transformation. 10. The E. coli colonies on the LB plates might be extremely small, probably due to toxicity [15]; therefore these colonies should not be ignored.

Acknowledgments This work was supported by the Israeli Chief Scientist of Agriculture grants No: 20-15-0038, 132-1713, 132-1538. References 1. Bar-Joseph M, Marcus R, Lee RF (1989) The continuous challenge of Citrus tristeza virus control. Annu Rev Phytopathol 27:291–316 2. Roistacher CN, Moreno P (1991) The worldwide threat from destructive isolates of citrus tristeza virus: a review. In: Brlansky RH, Lee RF, Timmer LW (eds) 11th proceedings of international organization of citrus virolologists. University of California, Riverside, pp 7–12 3. Bar-Joseph M, Loebenstein G, Cohen J (1972) Further purification and characterization of threadlike particles associated with the citrus tristeza disease. Virology 50:821–828 4. Kitajima EW, Silva DM, Oliveira AR et al (1963) Thread-like particles associated with tristeza disease of citrus. Nature 201:1011–1012 5. Karasev AV, Boyko VP, Gowda S et al (1995) Complete sequence of the citrus tristeza virus RNA genome. Virology 208:511–520 6. Harper SJ (2013) Citrus tristeza virus: evolution of complex and varied genotypic groups. Front Microbiol 4:93 7. Hilf ME, Mavrodieva VA, Garnsey SM (2005) Genetic marker analysis of a global collection of isolates of Citrus tristeza virus: characterization and distribution of CTV genotypes and association with symptoms. Phytopathology 95:909–917 8. Moreno P, Ambros S, Albiach-Marti MR et al (2008) Citrus tristeza virus: a pathogen that changed the course of the citrus industry. Mol Plant Pathol 9:251–268

9. Harper SJ, Dawson TE, Pearson MN (2010) Isolates of Citrus tristeza virus that overcome Poncirus trifoliata resistance comprise a novel strain. Arch Virol 155:471–480 10. Visser M, Bester R, Burger JT et al (2016) Next-generation sequencing for virus detection: covering all the bases. Virol J 13:85. https://doi.org/10.1186/s12985-016-0539x 11. Satyanarayana T, Gowda S, Boyko VP et al (1999) An engineered closterovirus RNA replicon and analysis of heterologous terminal sequences for replication. Proc Natl Acad Sci U S A 96:7432–7433 12. Chen AYS, Watanabe S, Yokomi R et al (2018) Nucleotide heterogeneity at the terminal ends of the genomes of two California Citrus tristeza virus strains and their complete genome sequence analysis. Virol J 15:141 13. Mawassi M, Mietkiewska E, Gofman R et al (1996) Unusual sequence relationships between two isolates of citrus tristeza virus. J Gen Virol 77:2359–2364 14. Moskovitz Y, Goszczynski DE, Bir L et al (2008) Sequencing and assembly of a fulllength infectious clone of grapevine virus B and its infectivity on herbaceous plants. Arch Virol 153:323–328 15. Satyanarayana T, Gowda S, Ayllo´n MA et al (2003) Frameshift mutations in infectious cDNA clones of Citrus tristeza virus: a strategy to minimize the toxicity of viral sequences to Escherichia coli. Virology 313:481–491

Chapter 12 Bioinformatic Tools and Genome Analysis of Citrus tristeza virus Ana Bele´n Ruiz-Garcı´a, Rachelle Bester, Antonio Olmos, and Hans Jacob Maree Abstract High-throughput sequencing (HTS) is a powerful tool employed by plant virologists for the detection of viruses, the characterization of virus genomes and the study of host-pathogen interactions. Virus detection has been an important application of this technology, which has resulted in the discovery of novel viruses or viral strains as well as for the detection of known viruses in a plant sample. Here we describe the entire process that needs to be considered for the genome analysis of Citrus tristeza virus (CTV) by HTS, including the experimental design, sample preparation, nucleic acid purification, HTS library construction, and bioinformatic analysis. Key words High-throughput sequencing (HTS), Next-generation sequencing (NGS), CTV, Bioinformatic pipelines

1

Introduction High-throughput sequencing (HTS) represents a powerful approach in the plant virology field and has been used in the last few years for the diagnosis and characterization of Citrus tristeza virus (CTV). To unlock the full potential of HTS technologies, the whole experiment needs to be considered, from sample preparation all the way through to bioinformatic data analysis. Therefore, in the design of an HTS experiment, it is critical to remember that the wet-lab portion of the assay determines the bioinformatic data analyses that can be conducted. Careful considerations should be given to the number of biological and/or technical replicates, as this will determine the ability to perform statistical analyses. The first step in an HTS experiment is the sample preparation and the extraction of the nucleic acids to be sequenced. The tissue type selected for the experiment needs to be appropriate for the pathosystem of study. In this case, the detection of CTV, a phloemlimited virus, will require the extraction of nucleic acids from

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_12, © Springer Science+Business Media, LLC, part of Springer Nature 2019

163

164

Ana Bele´n Ruiz-Garcı´a et al.

phloem-rich tissues. Different nucleic acid extraction protocols have been applied for CTV detection by HTS, including virusderived small interfering RNA (siRNAs), double-stranded RNA (dsRNA), and total RNA [1–7]. However, total RNA has been shown to be an effective HTS target for the recovery of full genome sequences of CTV [8]. In total RNA approaches, there are several enrichment options that can be considered. Specifically, for virus detection from total RNA, the low viral read count can be compensated for by ribosomal RNA depletion before library construction. The library that is constructed from the selected RNA fraction is application and platform specific. In the current protocol, we have selected the Illumina platform and the TruSeq Stranded Total RNA Ribo-Zero Plant kit to sequence the ribo-depleted RNA extracted from infected CTV plant material. The sequencing strategy (singleend or paired-end) and sequencing depth are important decisions. Single-end sequencing involves sequencing the nucleic acid fragment from only one end. This is the simplest way to perform Illumina sequencing to deliver large volumes of data economically. In paired-end sequencing, the nucleic acid fragment is sequenced from both ends, providing longer sequences that can be assembled easier into large contigs and scaffolds that facilitate the detection of genomic rearrangements, repetitive sequence elements, and novel transcripts. Multiplexing of samples by adding individual barcode sequences to each DNA fragment during library preparation allows for multiple libraries to be pooled and sequenced simultaneously during a single run on a high-throughput instrument. Sample multiplexing increases the number of samples that can be analyzed without drastically increasing cost or time. The bioinformatic analysis of the HTS data can be performed using commercial software packages, such as CLC Genomics Workbench (Qiagen) or Geneious (Biomatters Ltd.) or with free software. There is also a continuous development of automatic pipelines for the identification of viral sequences [9]. In the protocol described here, we present bioinformatic pipelines based on CLC Genomics Workbench (Qiagen) and Geneious (Biomatters Ltd.) as well as other free software tools. Here we provide a detailed protocol for the detection and genome characterization of CTV using HTS and bioinformatic analysis. The protocol describes all the steps, from sample preparation to bioinformatic pipelines that can be used to detect, assemble, and analyze the CTV genome using HTS data. A general workflow diagram of the whole process is shown in Fig. 1.

Analysis of CTV by HTS

165

Fig. 1 General workflow diagram of the whole HTS process for the detection and characterization of CTV

166

2

Ana Bele´n Ruiz-Garcı´a et al.

Materials

2.1 Total RNA Extractions

1. Bioreba extraction bag. 2. CTAB buffer: 2% CTAB, 2.5% PVP-40, 100 mM Tris–HCl (pH 8), 2 M NaCl, 25 mM EDTA (pH 8). 3. β-Mercaptoethanol. 4. Bioreba homogenizer. 5. Cold aluminum block. 6. Paperclips. 7. 65
C waterbath. 8. 50 mL centrifuge sterile tubes. 9. Chloroform–isoamyl alcohol (C–I) (premixed in a 24:1 ratio). 10. 8 M LiCl. 11. 70% ethanol. 12. 4
C Benchtop centrifuge. 13. Agarose. 14. 1 TAE: 40 mM Tris–HCl, 20 mM acetic acid, 1 mM EDTA. 15. DNA molecular marker (GeneRuler 1 kb ladder). 16. 6 DNA loading dye. 17. NanoDrop spectrophotometer.

2.2 Library Construction and Sequencing 2.3

Bioinformatics

Reagents and materials required are listed in the TruSeq Stranded Total RNA Ribo-Zero Plant kit (Illumina) (see Note 1).

1. Hardware: CLC Genomics Workbench [Qiagen] requires a 64-bit operating system with at least 2 GB RAM and a 1024  768 display; however, 4 GB RAM and a 1600  1200 display are recommended. Geneious [Biomatters Ltd.] requires a processor based on 86/86_64 instructions set architecture with at least 2GB RAM and 1024  768 of video resolution, although higher specifications are recommended. Supported operating systems include Windows 7, 8, 8.1, and 10, Linux, and MacOS 10.8-10.13. For most command line tools, a UNIX-based operating system with at least 8 GB RAM is recommended. Access to a high-performance computer (HPC) is recommended for all command line tools (see Note 2). 2. Software: Data quality control and filtering/trimming tools include FastQC and Trimmomatic. Geneious (Biomatters Ltd.) can also be used for extensive preprocessing (see Note 3). CLC Genomics Workbench (Qiagen) or

Analysis of CTV by HTS

167

Geneious (Biomatters Ltd) are required for de novo assembly (see Note 4). Read mapping tools include CLC Genomics Workbench (Qiagen) and Geneious (Biomatters Ltd) (see Note 5). Contig and/or scaffold identification requires BLAST+ standalone (see Note 6).

3

Methods

3.1 Sample Preparation

Green shoots from a potentially CTV infected tree can be selected and bark, containing the phloem layer, sampled by peeling it from the shoot. The leaf petiole and main vein can also be collected for the detection of phloem-limited RNA viruses like CTV. The green shoots can be stored at 4
C for a week before processing, but once the bark layer has been removed, the sample must be stored at 80
C until required for the RNA extraction.

3.2 Total RNA Extraction

Total RNA is extracted using a modified CTAB protocol as described in White et al. [10]. High-quality RNA is needed for HTS, and RNA integrity should be analyzed using gel electrophoresis and a Bioanalyzer. Spectrophotometry (NanoDrop ND-100p) can be used to determine the RNA purity and concentration. We recommend A260/A280 and A260/A230 ratios to be above 1.9 to ensure successful library construction. 1. Prepare the CTAB buffer, and add 3% β-mercaptoethanol to CTAB buffer before use (see Note 7). 2. Add 1 g of plant material to Bioreba extraction bag. 3. Add 10 mL CTAB buffer (with 3% β-mercaptoethanol) to extraction bag. 4. Grind plant material with homogenizer on cold aluminum block. 5. Add an additional 5 mL of CTAB buffer (with 3% β-mercaptoethanol), and mix using the homogenizer. 6. Close bag by folding twice and secure with paperclip. 7. Incubate at 65
C for 30 min. 8. Decant liquid into 50 mL tube. 9. Centrifuge at 4
C at 5000  g for 10 min, and transfer the supernatant to a new 50 mL tube (see Note 8). 10. Add an equal volume of chloroform–isoamyl alcohol (C–I) (premixed in a 24:1 ratio) to the supernatant, vortex, and spin down for 10 min at 4
C at maximum speed, and transfer the supernatant to a new tube using a pipette. 11. Repeat the C–I step, and transfer 5 mL of the supernatant to a new tube (15 mL).

168

Ana Bele´n Ruiz-Garcı´a et al.

12. Add 8 M LiCl to a final concentration of 2 M. 13. Incubate at 4
C for 1 h. 14. Divide the RNA extract in 3  2 mL in micro centrifuge tubes. 15. Centrifuge at 4
C at 16,000  g for 60 min. 16. Discard supernatant and add 500 μL 70% ethanol to the pellet. 17. Centrifuge at 4
C at 16,000  g for 10 min. 18. Aspirate ethanol and air-dry the pellet for 10 min. 19. Resuspend the pellet in 33 μL H2O, and combine tubes for each sample to obtain a total of 100 μL per sample. 20. Determine purity and concentration of RNA using a NanoDrop spectrophotometer. 21. Use gel electrophoresis to assess integrity of RNA: Run 1 μg of RNA on a 1% Agarose-TAE gel at 100 V for 60 min. Visualize the gel on a UV transilluminator. 22. Optional: BioAnalyzer can be used to assess the RNA quality. 3.3 HTS Library Construction and Sequencing

Each of the sequencing platforms has their own range of library construction kits to select from that were specifically developed for the platform. Some service providers will make use of third-party kits or in-house developed protocols. In our experience the Illumina platform and the TruSeq Stranded Total RNA Ribo-Zero Plant kit perform satisfactory for the detection of citrus viruses and viroids, including CTV. The methods for library construction are listed in the TruSeq Stranded Total RNA Ribo-Zero Plant kit (Illumina) instruction manual (see Note 9). We also found that for the accurate detection of CTV, at least one million unique reads are required, meaning one million singleend reads or two million paired-end reads need to be generated per sample [8].

3.4 Bioinformatic Data Analysis

A critical first step in bioinformatic data analysis is to assess the quality of the data and perform trimming and filtering to remove low-quality reads/nucleotides and other contaminating sequences such as adapters. Some service providers might supply data that has undergone some basic clean-up. This however does not negate the need to evaluate the data before proceeding with downstream analysis. A small graphical user interface software package, named FastQC, is very useful to assess the data quality and the presence of contaminating sequences in user-friendly easy to interpret modules. The “Per base sequence quality” module can be used to visualize where the mean quality drops off. This information is then used to determine from which nucleotide a hard trim (deletion of a specific number of nucleotides from the 50 or 30 end of all reads) in the data is required. The “Per base sequence content” module

3.4.1 Raw Data Analysis and Clean-Up

Analysis of CTV by HTS

169

can also indicate an imbalance in nucleotide compositions, which will be likely in the beginning of the read (9 nucleotides) (see Note 10). FastQC will also identify sequences that are overexpressed (i.e., adapters) in the “overrepresented sequences” module, and the “Per tile sequence quality” module will indicate the quality scores from each tile across all of the bases to see if there was a loss in quality associated with a part of the flow cell. After the initial quality assessment with FastQC, data can be trimmed and filtered for quality and contamination sequences/ nucleotides removed. Trimmomatic is a useful software package that can be used to trim adapters and low-quality bases from both the 50 and 30 ends of reads. We run trimmomatic in command line on a HPC and recommend the following parameters: 1. Trimming of adapters is performed using the ILLUMINACLIP option with default parameters (see Note 11). 2. A quality trim is performed using the SLIDINGWINDOW option with a window size of 3 and an average quality of 20 (see Note 12). 3. Only reads longer than 20 nucleotides are retained using the MINLEN option. An example run command is provided (see Note 13). Preprocessing can also be done using Geneious [Biomatters Ltd.] as follows: 1. The first step to manage raw data is to know if paired-end reads were generated. If this is the case, the setting “paired-end process” is performed prior assembly. Thus, paired-end reads can be combined during the FastQC import process or by selecting the files containing the paired-end reads and selecting “Set Paired Reads” from the “Sequence menu.” Depending on the data source, reads could be in parallel sets of sequences, or interlaced, that have to be indicated to Geneious software. 2. The second step is trimming ends. Trimming low-quality ends of sequences is also performed before assembling a contig. Trimming vectors, adapters, and poor-quality bases can be done by Geneious tools, highlighting the sequences and selecting in the menu “Annotate and Predict ! Trim Ends.” Geneious R9 and above also have a plugin for trimming using the BBDuk algorithm from the BBTools suite that includes all TruSeq, Nextera, and PhiX sequences of adapters. By default, k-mer 27 is used. In addition, in the same menu, it is possible to discard short reads (lower than, e.g., 75, if the length of reads is 100). 3. Merging paired-end reads uses “BBMerge” module from the BBtools suite, and it can be performed using default parameters in Geneious.

170

Ana Bele´n Ruiz-Garcı´a et al.

4. Removing duplicate reads is located also in the “Sequence menu.” This function uses “Dedupe plugin,” and removes duplicate sequences that can be exact matches, subsequences, or sequences within some percent identity. K-mer seed length 31, maximum edits 0, and maximum substitution 0 are recommended for total RNA sequencing with an average read length of 100 nucleotides or higher. 5. Removing chimeric reads is located in “Sequence menu” and runs “UCHIME plugin” that can be used by default parameters in Geneious. 6. Error correction and normalization are performed before de novo assembly by discarding reads in regions of high coverage that can be done using the tool “Error Correct and Normalize Reads” from the “Sequence menu” with the “BBNorm plugin” from the BBtools suite, which requires Java 7 or later in order to run, using default settings. 7. Finally multiplex or barcode data can be separated using “Separate Reads by Barcode” tool from the “Sequence menu.” This function copies all sequences matching a given barcode to a correspondingly named sequence list document. By default settings, 454 standard and Titanium MID barcodes are provided. However, to select a custom barcode set, it is possible to select “Custom” settings and select “Edit barcode sets,” adding specific list of barcodes. 3.4.2 De Novo Assembly

The de novo assembly can be performed in CLC Genomics Workbench 10.1.1 [Qiagen] as follows: 1. Quality trimmed data is imported into CLC Genomics Workbench. If paired-end data is provided in two separate files, both files should be selected at the same time during the Illumina import and the “paired-end” option selected. 2. An optional plant host filtering step can be performed before de novo assembly to remove the majority of the host reads. The reads are mapped to the reference genome of Citrus sinensis (NC_023046 to NC_023054), as well as the Citrus sinensis plastid genome (NC_008334) simultaneously using the default parameters and handling nonspecific matches by mapping randomly. Unmapped reads should be collected for further analysis (see Note 14). 3. De novo assembly can be performed on the host-filtered dataset using default settings including automatic calculation of word and bubble size. The recommended minimum contig length is 2 the read length + 1 to obtain contigs where at least three reads were used to assemble the contig.

Analysis of CTV by HTS

171

Alternatively, de novo assembly can be performed using Geneious 9.1.8 and higher [Biomatters Ltd.] software. After preprocessing of data described in Subheading 3.4.1, de novo assembly process is described as follows: 1. Plant host filtering step can be performed selecting the tool “Align/Assemble!Map to References” (Citrus sinensis (NC_023046 to NC_023054) or Citrus sinensis plastid genome (NC_008334) (see Note 14) from 80 to 99% of similarity. 2. Geneious software provides de novo assemblers based on overlap or k-mer (De Bruijn graph). The Geneious de novo assembler is an overlap assembler which uses a greedy algorithm similar to that used in multiple sequence alignment, while MIRA, SPAdes, Tadpole, or Velvet are based on k-mer and provided as plugins. In the case of de novo assembly using Geneious assembler, select the tool “Align/Assemble!De Novo Assemble.” Minimum overlap identity of 95% is initially recommended with a minimum overlap of 30 nucleotides for reads between 100 and 150 nucleotides. Maximum mismatches per read 10%, word length 24, and index word length 14 are initially recommended (see Note 15). 3.4.3 Contig Identification

The de novo assembled contigs can be identified using BLAST+ standalone. 1. Contigs can be exported from CLC Genomics Workbench as a multiple fasta file. 2. The BLASTn algorithm can be used for the first round of contig identification using a local copy of NCBI’s nucleotide database as subject to search against (see Note 16). 3. The tBLASTx algorithm can then be used on the remaining unidentified contigs to identify the more distantly related viruses or variants. 4. We recommend that the BLAST hits written to the results file have a cut-off e-value of 0.001 and the number of aligned sequences to keep is 1. The standard tabular output including query length, subject title, and query coverage produces a result that is easy to interpret (see Note 17). Alternatively, CLC Genomics Workbench [Qiagen] and Geneious [Biomatters Ltd.] provide BLAST search online and offline facilitating the download of Genbank databases on the HPC and to perform contig identification in the software.

3.4.4 Reads Mapping

Map to reference is used to assemble sequences to a known sequence, for example, to recover genomes and locate differences or single nucleotide polymorphisms (SNPs). The first application of

172

Ana Bele´n Ruiz-Garcı´a et al.

reads mapping in virus detection is to map reads or contigs to a known virus database created to include all viruses known to infect citrus. Viruses present in the data can then be identified when a high number of reads map to reference sequences with a high percentage genome coverage. The reads mapping can be performed in CLC Genomics Workbench 10.1.1. as follows: 1. The reference sequences can be imported in CLC Genomics Workbench as a multifasta file or as separate fasta files. Reads or contigs can then be mapped to the reference sequences using the “map reads to reference” tool with default settings in CLC Genomic Workbench (see Note 18). To make a positive identification based on reads mapping alone is not advised, as baseline sample/read cross contamination and shared sequence similarities might bias the results. There are also no accepted criteria to base the detection call on (see Note 19). 2. The “map reads to reference” tool can also be used to investigate sequence variation between sequence variants. Reads are mapped to the reference genomes of all CTV genetic variants simultaneously with strict mapping parameters (see Note 18). The number of mappings for each reference can be used to identify the virus variants present at a high concentration in a sample; however, virus variants present at low concentrations will display the same result as viruses not necessarily present. 3. The “map reads to reference” tool can also be used to map contigs to a reference genome in order to investigate sequence variation or to extend contigs to construct a draft genome of a putative new virus or virus variant. Alternatively, the reads mapping can also be performed using Geneious 9.1.8 and higher as follows: 1. The first step is to select the reference sequence and the dataset to map and click in the menu “Align/Assemble” choosing the tool “Map to Reference.” Batch assemblies where each read gets mapped to each reference sequence can be done by using selecting “Workflows ! Map reads to each reference sequence.” 2. Select Geneious RNA as mapper and custom sensitivity. 3. The following parameters are recommended as starting point for mapping: minimum mapping quality 20, do not allow gaps, minimum overlap 20, minimum overlap identity 80%, word index 20, index word length 14, maximum mismatches per read 10%, and search more thoroughly for poor matching reads. 4. For calling SNPs, select the contig document, and choose in the menu “Annotate and Predict!Find Variations/SNPs.”

Analysis of CTV by HTS

173

Option find polymorphisms inside and outside CDS. Select the expected coverage that is the minimum number of reads that must cover a nucleotide to consider calling a variation. This is directly dependent on the number of reads of the dataset. Select the minimum variant frequency or fraction of reads that must contain a base to be called a variation. In advance menu, select only find SNPs. 3.4.5 Alternative to Reads Mapping to Identify Contigs

CLC Genomics Workbench and Geneious can be used to create a BLAST database from de novo assembled contigs. All CTV contigs can then be identified by using the BLAST tool to compare the CTV reference genomes against the de novo assembled contig database.

3.4.6 Sequence Validation

After confirming the presence of a CTV genetic variant or multiple variants in the sample, the results need to be validated using a second method (i.e., RT-PCR). Primers sets that are able to differentiate between variants can be designed. These primers can then be used in RT-PCRs and the amplicons validated by Sanger sequencing (see Note 20). The complete genome sequence of newly identified variants can also be validated by Sanger sequencing by designing multiple primer sets that will produce overlapping amplicons that will span the complete genome (see Note 20).

4

Notes 1. Depending on the sequencing approach decided on, various nucleic acid extracts can be used for library construction. For the detection of plant viruses, dsRNA, siRNAs, and total RNA are the most commonly used. DsRNA and siRNAs are used because they enrich for viral RNA. DsRNA enriches for actively replicating viruses, while a siRNAs approach enriches for viruses that activate the plant host defense response. The RNA species enrichment may also represent limitations that need to be considered during data analysis and interpretation. Total RNA extracts can be enriched for by depleting the host ribosomal RNA. This approach might require more data but should be able to detect actively replicating and latent viruses as well as viruses that do not elicit a strong host defense response. We recommend the use of ribo-depleted RNA for the detection of CTV as this approach has been shown to provide consistent results irrespective of the bioinformatic pipeline selected [8]. 2. The CLC Genomics Workbench and Geneious used in the analysis were installed on a HPC. Although most of the software listed here can be used with limited computational power, it is advised that these operations are performed on a HPC. De

174

Ana Bele´n Ruiz-Garcı´a et al.

novo assembly and the BLAST runs have high resource demands and their runtime is greatly reduced when a HPC is used. 3. The data quality control tools have different strategies for the trimming of adapters. Trimmomatic provide an efficient and elegant way to trim adapters while maintaining the paired-end arrangement of reads. Similar tools that can perform the same task include: cutadapt (https://cutadapt.readthedocs.io/en/ stable/guide.htmL) and FASTX-Toolkit (http://hannonlab. cshl.edu/fastx_toolkit/commandline.htmL); CLC Genomics Workbench also includes a quality viewer and trimming/filtering tool. However, we recommend the use of FastQC (https://www. bioinformatics.babraham.ac.uk/projects/fastqc/)andTrimmomatic (http://www.usadellab.org/cms/?page¼trimmomatic). FastQC provides better visualization and Trimmomatic a welldefineddescriptionofeachtrimmingmodule.Alternatively,Geneioussoftwareincludesextensivepreprocessingtoolssuchasdemultiplexing/split by barcode, trim and filter by read quality, trim adapters, merge paired ends, de-duplicate, error correct, and normalize and filter out chimeras (https://www.geneious.com/ features/assembly-mapping/). 4. For a customized de novo assembly, command line tools like Velvet (https://www.ebi.ac.uk/~zerbino/velvet/) and SPAdes (http://cab.spbu.ru/files/release3.12.0/manual.htmL) can be used. However, for the assembly of the complete genome of CTV, CLC Genomics Workbench performed comparable with default parameters [8]. Geneious software can also be used for de novo assembly using the Geneious assembler that is able to manage reads of any length and includes as plugins MIRA, SPAdes, Tadpole, or Velvet as alternatives. The Geneious assembler allows automatic iterations to extend the initial contigs (https://www.geneious.com/tutorials/de-novoassembly/). 5. An alternative free command line tool for reference read mapping is Bowtie2 (http://bowtie-bio.sourceforge.net/ bowtie2/manual.shtmL). Bowtie2 is a memory-efficient tool for aligning sequencing reads longer than 50 nucleotides. It is flexible and can also perform both local and global alignments. Geneious (Biomatters Ltd.) can be used for reference mapping using the Geneious read mapper with its iterative approach or the plugins included in the software (Bowtie, Bowtie2, TopHat, and BBMap). 6. The number of contigs assembled per RNA dataset exceeds the limits of NCBI’s online BLAST tool. Therefore, it is necessary to create a local database that can be searched using NCBI’s BLAST+ standalone application (https://www.ncbi.nlm.nih.

Analysis of CTV by HTS

175

gov/books/NBK279690/). CLC Genomics Workbench (Qiagen) and Geneious (Biomatters Ltd.) have the possibility to download NCBI databases and perform the blast analysis offline. 7. β-Mercaptoethanol is toxic if inhaled and should not be used outside of a fume hood. 8. The supernatant should be clear and there should be a solid pellet that when the supernatant is decanted to a new tube no debris is transferred. 9. The TruSeq Stranded Total RNA Ribo-Zero Plant kit (Illumina) instruction manual can be found at https://support. illumina.com/content/dam/illumina-support/documents/ documentation/chemistry_documentation/samplepreps_ truseq/truseq-stranded-total-rna-workflow/truseq-strandedtotal-rna-workflow-reference-1000000040499-00.pdf. If library construction and sequencing are outsourced, total RNA can be send to service provider in 0.1 3 M NaOAc and 2.5 100% ethanol on an icepack. 10. RNA sequencing libraries can have a bias if random hexamers were used to synthesize the cDNA. Theoretically these primers should have good diversity in the sequence; however, in our experience the libraries have a selection bias in the first few bases of each run. Although this is true sequence, it is possible that it will influence de novo assemblies if short k-mers are selected. An optional hard trim of the first 9 nts can be performed using the HEADCROP module from Trimmomatic. 11. Illumina adapter sequences are copyrighted by Illumina, but Trimmomatic has been granted permission to distribute them with Trimmomatic. The suggested adapter sequences for paired-end reads generated with the HiSeq machine are provided in a fasta file named TruSeq3-PE.fa. The “overrepresented sequences” module of FastQC can help to indicate which adapter file is best suited for your data. 12. It is important to retain only the high-quality data if the aim is to assemble complete CTV genomes for sequence variation studies. Low-quality data can influence SNP analysis and lead to the assembly of chimeric contigs that will increase the false detection rate of recombinant sequence variants. 13. Trimmomatic example command: java -jar trimmomatic-0.36.jar PE file1.fastq file2.fastq.gz file1_trim_paired.fastq file1_unpaired.fastq file2_trim_paired.fastq file2_unpaired.fastq ILLUMINACLIP: TruSeq3-PE. fa:2:30:10 SLIDINGWINDOW:3:20 MINLEN:20

176

Ana Bele´n Ruiz-Garcı´a et al.

14. The removal of plant host reads before de novo assembly should be performed with caution if the aim is to identify novel viruses from citrus plants. Endogenous pararetroviruses that can give rise to episomal viruses from the integrated virus genome can be missed if a host removal strategy is selected. 15. In Geneious software [Biomatters Ltd.], the minimum overlap identity corresponds to the minimum percentage of nucleotides that have to be identical in the overlap region for a sequence to be assembled. The value for this parameter is recommended to be higher than 90% to avoid assembling of reads from different isolates or divergent CTV sequences that gives contigs with mixed sequences. Higher stringency provides higher specificity. The minimum overlap identity corresponds to the overlap of nucleotides required for a sequence to be assembled. The value of the parameter can decrease but it is not recommended to decrease the value more than 20 nucleotides for reads longer than 100 nucleotides. Maximum mismatches per read correspond to the maximum number of nucleotide mismatches allowed per read as a percentage of the overlap of two reads. Word length is the minimum number of consecutive nucleotides that match perfectly between two reads, and the index word length is the number of consecutive nucleotides to put into an index to find sequences with the same nucleotide sequence. 16. Identification of viral contigs using NCBI BLAST is bioinformatically challenging due to the abundant non-viral sequences included in the Genbank nucleotide or nonredundant databases, which extend runtime and obscure viral hits. We recommend creating a local database of GenBank’s nucleotide database and using BLASTn for a first round of contig identification. To identify the remaining contigs, a BLAST database can be created from the Reference Viral DataBase (RVDB) of Goodacre et al. [11]. This viral database includes all viral and virus-related and virus-like nucleotide sequences as well as endogenous nonretroviral elements, endogenous retroviruses, and retrotransposons to make the detection of unknown viruses possible. It should however be noted that NCBI Genbank is updated every second month and therefore the viral database should also be updated to ensure completeness. A pipeline to update the RVDB is provided by Goodacre et al. [11]. 17. Example of BLAST commands: (a) To create local NCBI nt database (download fasta sequences from ftp://ftp.ncbi.nlm.nih.gov/blast/db/): makeblastdb -in NCBI_nt.fasta -dbtype ’nucl’ -out nt

Analysis of CTV by HTS

177

(b) BLASTn example command: blastn -query contigs.fa -db nt -out results.txt -evalue 0.001 -max_target_seqs 1 -outfmt "6 std qlen stitle qcovs"

(c) To create a local copy of the Reference Viral DataBase (RVDB) of Goodacre et al. [11]: makeblastdb -in C-RVDBv13.0.fasta -dbtype ’nucl’ -out C_RVDBv13

(d) tBLASTx example command: tblastx -query contigs.fa -db C_RVDBv13 -out results.txt -evalue 0.001 -max_target_seqs 1 -outfmt "6 std qlen stitle qcovs"

18. The default identity settings (at least 50% of the total alignment length should match at least 80% of the reference) are sufficient for the detection of diverse viruses. However, for the differentiation of CTV genetic variants, it will be more applicable to make the mapping more stringent and to ignore reads that can have more than one match. The sequence identity between the known complete genomes of CTV within a genotype can differ by 2–9%. Therefore, we recommend increasing the similarity fraction to 95% over at least 90% of the total alignment length. Also by ignoring reads that can map more than once, the results obtained will only include unique mappings. The number of reads mapped per reference sequence and the percentage genome coverage can then be used as a measure to identify a variant. With simulated data of single genotype infections, we observed that it is possible to obtain 70% genome coverage for nontarget genotypes and up to 90% coverage for nontarget genotypes in mixed infections. We observed that read mapping across more than 95% of the genome is indicative of the presence of a variant. The simulated data also showed that the 95% percentile is attainable if more than 10,000 reads map to the specific genotype. The presence of recombinant virus genomes will complicate the identification of variants, and the number of variants identified can be an overestimation. 19. Genome coverage refers to the percentage of the CTV genome that is covered by at least one read, and read depth is the number of times a given nucleotide of the genome is covered by independent reads. The thresholds to make a positive identification of a virus based on genome coverage and read depth have not been determined, and these thresholds will depend on multiple factors including virus species, mix variant infections, virus concentration, and sequencing depth of the library. 20. To claim the identification of a novel genetic variant, the presence of the sequence needs to be validated with a second molecular technique and detected in additional samples. The

178

Ana Bele´n Ruiz-Garcı´a et al.

validation of the complete genome sequence with Sanger sequencing is recommended.

Acknowledgments The authors would like to acknowledge Citrus Research International (CRI), Instituto Nacional de Investigaciones Agrarias (INIA), and Instituto Valenciano de Investigaciones Agrarias (IVIA) for sample collection and project funding. The financial assistance of the National Research Foundation (NRF) toward this research is hereby acknowledged. The opinions expressed and conclusions arrived at are those of the authors and are not necessarily to be attributed to the NRF, INIA, IVIA, or CRI. References 1. Zablocki O, Pietersen G (2014) Characterization of a novel Citrus tristeza virus genotype within three cross-protecting source GFMS12 sub-isolates in South Africa by means of Illumina sequencing. Arch Virol 159:2133–2139 2. Read D, Pietersen G (2017) Diversity of Citrus tristeza virus populations in commercial grapefruit orchards in Southern Africa, determined using Illumina MiSeq technology. Eur J Plant Pathol 148:379–391 3. Visser M, Cook G, Burger JT et al (2017) In silico analysis of the grapefruit sRNAome, transcriptome and gene regulation in response to CTV-CDVd co-infection. Virol J 14:200 4. Yokomi RK, Selvaraj V, Maheshwari Y et al (2017) Identification and characterization of Citrus tristeza virus isolates breaking resistance in trifoliate orange in California. Phytopathology 107:901–908 5. Licciardello G, Scuderi G, Ferraro R et al (2015) Deep sequencing and analysis of small RNAs in sweet orange grafted on sour orange infected with two Citrus tristeza virus isolates prevalent in Sicily. Arch Virol 160:2583–2589 6. Varveri C, Olmos A, Pina JA et al (2015) Biological and molecular characterization of a

distinct Citrus tristeza virus isolate originating from a lemon tree in Greece. Plant Pathol 64:792–798 7. Maliogka VI, Minafra A, Saldarelli P et al (2018) Recent advances on detection and characterization of fruit tree viruses using highthroughput sequencing technologies. Viruses 10:E436 8. Visser M, Bester R, Burger JT et al (2016) Next-generation sequencing for virus detection: covering all the bases. Virol J 13:85 9. Jones S, Baizan-Edge A, MacFarlane S et al (2017) Viral diagnostics in plants using next generation sequencing: computational analysis in practice. Front Plant Sci 8:1770 10. White EJ, Venter M, Hiten NF et al (2008) Modified Cetyltrimethylammonium bromide method improves robustness and versatility: the benchmark for plant RNA extraction. Biotechnol J 3:142–1428 11. Goodacre N, Aljanahi A, Nandakumar S et al (2018) A reference viral database (RVDB) to enhance bioinformatics analysis of highthroughput sequencing for novel virus detection. mSphere 3:e00069–e00018

Chapter 13 Analysis of Genotype Composition of Citrus tristeza virus Populations Using Illumina Miseq Technology David A. Read and Gerhard Pietersen Abstract Recent research describing the strain-specific mechanisms underlying experimental CTV superinfection exclusion has far-reaching implications for the manner in which cross-protecting sources should be selected for. The strain composition of both cross-protecting sources and field populations needs to be sufficiently characterized to improve control of severe stem-pitting and decline isolates. Many of the biological, serological, and molecular techniques used in previous studies yield very limited information about the strain composition of populations and the relative titer of their components. In this chapter we describe a protocol for the characterization of CTV populations, based on the use of the next-generation sequencing Illumina MiSeq platform of p33 gene amplicons. Key words Cross-protection, p33 gene, Illumina sequencing, Viral populations, Bioinformatics, Amplicon sequencing

1

Introduction The use of mild-strain cross-protection is one of the few strategies keeping citrus production economically viable in regions where severe CTV strains are endemic [1], especially those responsible for severe stem-pitting symptoms [2]. Cross-protection against CTV involves the intentional inoculation of citrus budwood material, with populations of CTV which have been shown to elicit only mild symptoms [3]. The purpose of this intentional inoculation is to partially or completely [4] prevent secondary inoculations of more severe strains of the virus through a mechanism known as “superinfection exclusion” [5]. The selection of cross-protecting sources has typically involved the grafting of candidate crossprotecting sources onto indicator hosts [1]. This however provides no information on the genotype compositions of the strains present in these populations [6], while recent work has shown that superinfection exclusion of CTV secondary inoculations occurs in a strain-dependent manner [5, 7, 8]. Strain-specific superinfection

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_13, © Springer Science+Business Media, LLC, part of Springer Nature 2019

179

180

David A. Read and Gerhard Pietersen

exclusion of CTV relies on the functional product encoded for by the p33 gene. It is therefore essential to characterize crossprotecting sources at the genetic level, as well as to determine the diversity of strains present with commercial citrus plantings [9]. A number of molecular tools have been used to characterize both cross-protecting sources and field isolates. Among these are cDNA probes [10], single-strand conformation polymorphism (SSCP) [11], and restriction fragment length polymorphism (RFLP) [12]. While these techniques provide a greater depth of characterization when compared with biological analyses, only a limited number of known strains can be detected, and relative titers of each component cannot be determined [9]. The use of conserved primers, targeting various gene regions of the CTV genome, followed by plasmid cloning of the resulting amplicons, has been used extensively to characterize CTV populations [6, 13, 14]. A number of CTV gene regions have been used to characterize populations, ranging from the highly heterogenous 50 end of the genome to the more conserved genes in the 30 end [14–17]. Generally, gene regions within the more diverse 50 half of the genome offer greater phylogenetic resolution between different CTV genotypes; however it can lead to a bias toward the amplification of certain genotypes, when making use of conserved primers [18]. The p33 gene primers have been shown to have reduced bias toward certain genotypes, when compared with other published primers targeting 50 gene regions while retaining similar levels of resolution to differentiate between characterized CTV genotypes [18]. The cloning and sequencing of amplicons allows for the detection of a larger number of strains when compared with techniques such as SSCP and RFLP, as well as providing some indication of the relative titers of the most abundant components. However, amplicon cloning is laborious, carries a high per base sequencing cost, and often leads to a biased interpretation of population structures [18]. The ability to sequence tens of millions of reads in parallel through the use of next-generation sequencing technologies has allowed researchers to study biological systems at levels that were not possible just a decade ago [19] and includes studies on plant viruses [20]. Nextgeneration sequencing has already been used to characterize populations of CTV [9, 21–24] and is likely to have a significant impact on the way in which cross-protecting sources are evaluated, as well as the determination of strain diversity in the field. In this chapter, we present a detailed protocol for the next-generation sequencing of p33 gene amplicons derived from CTV populations. Due to its importance in the functioning of superinfection exclusion [5, 7], the p33 gene was selected as a phylogenetic marker for CTV population characterization.

Analysis of CTV Populations

2

181

Materials All solutions requiring preparation in the laboratory should be done so, using reagents that are rated as molecular grade. Any dilutions of reagents and the preparation of oligos need to be done using molecular grade, nuclease-free water.

2.1 General Laboratory Equipment and Consumables

1. Full range of micropipettes (0.2–1 μL, 1–10 μL, 10–100 μL, 100–1000 μL). 2. Presterilized barrier tips, compatible with micropipettes. 3. Tube racks capable of holding 0.2 mL and 1.5 mL tubes. 4. Nanodrop spectrophotometer. 5. 0.2 mL thin-wall PCR tubes. 6. 1.5 mL nuclease-free tubes. 7. Thermal cycler. 8. Agarose gel (for electrophoresis). 9. Gel electrophoresis tanks. 10. Nitrile or latex gloves. 11. Molecular grade ethanol. 12. Molecular grade water.

2.2 Collection and Storage of Plant Material

1. Ziploc plastic collection bags. 2. Liquid nitrogen. 3. Device capable of recording GPS coordinates (handheld GPS device or cellphone application). 4. Scalpel. 5. Refrigerator capable cooling to 4  C. 6. Freezer capable of reaching 70  C.

2.3 RNA Isolation, Reverse Transcription, and PCR Amplification

1. Plant RNA isolation kit [Thermo GeneJET] (see Note 1). 2. AMV reverse transcriptase. 3. RNase inhibitor. 4. 10 mM dNTP mix (each). 5. Reverse-transcriptase buffer. 6. Taq DNA polymerase. 7. PCR grade water. 8. 10 μM p33 gene forward primer (50 GATGTTTGCCTTCGCGAGC 30 ) (see Note 2). 9. 10 μM p33 gene reverse primer (50 CCCGTTTAAACAGAGTCAAACGG 30 ).

182

David A. Read and Gerhard Pietersen

2.4 PCR Product Purification

1. 20 U/μL exonuclease I. 2. 1 U/μL thermosensitive alkaline phosphatase. 3. Column-based PCR purification kit.

2.5 Sanger Sequencing of PCR Amplicons

1. Big Terminator Fisher, USA].

v3.1

cycler

sequencing

kit

[Thermo

2. 125 mM EDTA solution. 3. 3 M ammonium acetate solution.

2.6 Illumina Miseq Sequencing of PCR Amplicons

The apparatus and consumables listed below are usually supplied by a sequencing service provider: 1. Illumina MiSeq sequencer (see Note 3). 2. Nextera XT, DNA library preparation kit [Illumina, USA]. 3. MiSeq reagent kit v3 [Illumina, USA].

2.7 Bioinformatics Analysis of Sequencing Data

1. CLC Genomics Workbench (see Note 4). 2. Desktop computer capable of running CLC Genomics Workbench. 3. BioEdit with ClustalW included. 4. FastQC software.

2.8 Interpretation and Visualization of Results

3

1. Microsoft Excel. 2. R studio with ggplot package installed (optional).

Methods

3.1 Collection of Sample Material and Sample Preparation

1. Collect leaves from various parts of the tree (see Note 5). 2. Record keeping of GPS coordinates from each sampled tree assists with returning to specific trees for additional sample material. 3. Place plant material in a Ziploc plastic bag, and store at 4  C as soon as possible, after sampling. Immediately prior to sample processing, leaf midribs can be excised from the leaf blades with a scalpel and sectioned into ~10 mm pieces. 4. Sectioned pieces can then be macerated using liquid nitrogen (LN2) (see Note 6).

3.2 Isolation of Total RNA

1. Weigh out up to 200 mg of macerated material, and place in a 1.5 mL tube.

Analysis of CTV Populations

183

2. Extract total RNA using a Thermo GeneJET plant RNA isolation kit, following the instructions described within the manufacturer’s manual. 3.3 Reverse Transcription and PCR Amplification

1. Set up the reverse transcription reaction by adding the following reagents to a 0.2 mL PCR reaction tube, and hold at 42  C for 1 h in a suitable thermocycler: 10 μM p33 reverse

5 μL

Total RNA extract

12 μL

20 U/μL AMV reverse transcriptase

2 μL

40 U/μL RNase inhibitor

0.5 μL

1 reverse-transcriptase buffer

4 μL

10 mM each dNTP mix

2 μL

PCR grade water

Up to 20 μL reaction volume

2. The PCR reactions for the amplification of the p33 gene of each sample are set up by adding the following to a fresh 0.2 mL PCR tube: 5 Buffer (see Note 7)

10 μL

10 μM p33 forward primer (see Note 8) 0.5 μL 10 μM p33 reverse primer (see Note 8) 0.5 μL 10 mM dNTP mix (each)

0.5 μL

DNA polymerase

0.125 μL

cDNA product from the previous step

2 μL

PCR grade water

Up to 25 μL reaction volume

3. PCR reaction conditions are as follows: l

Initial denaturation: 92  C for 2 min.

l

PCR amplification (35 cycles). 92  C for 30 s. 65 C for 45 s. 68  C for 1 min.

l

Final extension at 68  C for 10 min.

4. PCR products must be visualized on an agarose gel, which should be visible as ~1000 bp bands (see Note 9). 3.4 Purification of PCR Amplicons (See Note 10)

1. PCR products that are shown to be associated with single bands on an agarose gel should be enzymatically purified

184

David A. Read and Gerhard Pietersen

through adding the following components to a fresh 0.2 mL PCR tube: 1 U/μL thermosensitive alkaline phosphatase

2 μL

Exonuclease I

0.5 μL

PCR product from previous step

19 μL

2. Reaction conditions are as follows: 37  C for 15 min followed by a denaturation step of 85  C for 15 min. These enzymatically purified products are suitable for direct addition to Sanger sequencing reactions. Amplicons that are to be entered into a cloning or NGS pipeline should be purified using a columnbased PCR product purification kit (see Note 11). 3.5 Direct Sanger Sequencing of PCR Amplicons (Optional, See Note 12)

1. Reaction mixtures are set up by adding the following reagents to a 0.2 mL PCR tube: 5 BigDye® v3.1 sequencing buffer

2.25 μL

BigDye® Terminator mix v3.1

1 μL

2 μM p33 gene forward primer ()

0.75 μL

Purified PCR product

2 μL

PCR grade water

4 μL

2. Sequencing reaction conditions are as follows, using a suitable thermal cycler: l Initial denaturation: 94  C for 1 min. l

Dye termination reaction (30 cycles). 94  C for 10 s. 50  C for 5 s. 60  C for 4 min.

3. Sequencing products are then purified through the addition of the following reagents to the complete sequencing reaction tube, in the following order: 125 mM EDTA solution

1 μL

3 M sodium acetate solution

1 μL

100% ethanol (molecular grade)

25 μL

4. Samples should then be centrifuged for 30 min at 14,000  g. 5. The supernatant should then be drawn off (see Note 13) with a pipette. 6. 100 μL of 70% ethanol (prepared with both molecular grade ethanol and water) can be added to the pellet.

Analysis of CTV Populations

185

7. Tube should then be centrifuged for 15 min at 14,000  g. 8. The ethanol supernatant should then be drawn off as completely as possible by pipetting. 9. The pellet (typically not visible) can be air dried (with tube cap open) until no visible remnants of ethanol remain or heated at 95  C for no longer than 1 min. 3.6 Library Preparation and NGS Sequencing of CTV Amplicons

The main advantage of employing a next-generation sequencing approach for characterizing CTV populations is the ability to sequence millions of amplicon products in parallel, as opposed to the tens to hundreds of sequences that are yielded from the cloning and subsequent Sanger sequencing of the resulting inserts [19]. A multitude of nucleic acid templates can be utilized for the metagenomic characterization of plant viruses [20]; however targeted sequencing of amplicons is often favorable when characterizing the population of a known virus [9] (see Note 14). In addition to the multitude of options regarding the starting template for characterizing plant viral populations, a suitable NGS platform needs to be selected (see Note 3).The PCR amplicons produced at the end of Subheading 3.5 can be used directly as a template for NGS library preparation, subject to addition quality control criteria. The use of the Illumina MiSeq platform to characterize p33 gene amplicons will be described in the following protocols (see Notes 15): 1. Determine the purity of each sample, using a UV absorbance method, such as the Nanodrop instrument (see Notes 16). 2. Subsequent Nextera XT library preparation and Illumina MiSeq sequencing require specialist technical knowledge of lengthy protocols. These steps are typically carried out by sequencing service providers (see Note 17). Users with access to their own sequencing platforms and who wish to perform their own library preparations and sequencing should consult the comprehensive instructions provided by the manufacturer (www.illumina.com). The description of these protocols is outside the scope of this chapter.

3.7 Bioinformatic Analysis of NGS Data

The output files generated from an Illumina MiSeq run will be in the FASTQ format, as forward and reverse paired-end reads as separate files. The CLC Genomics Workbench suite of software contains all the tools necessary for analyzing NGS data generated from CTV-derived amplicons (see Note 4). CLC Genomics Workbench is constantly being upgraded. The steps described in the following protocol are specific to version 10. Should subsequent versions differ significantly, users should consult the manual available on the software distributor’s website (www.qiagenbioinformatics. com). Data should be imported and analyzed by CLC Genomics Workbench, using the following steps:

186

David A. Read and Gerhard Pietersen

1. Import paired-end reads into CLC Genomics Workbench through the import Illumina data function, ensuring that the paired-end option is selected, which will merge the reads into a single file. The file name containing the term “_R1_” contains the forward reads, and conversely the file containing the term “_R2_” contains the reverse reads. 2. Select files in the correct order (forward first, reverse second) using the “ctrl”/“cmd” functions. It is recommended that the additional import options are included—“Remove failed reads” and “Quality scores”—set as “Illumina pipeline 1.8 and later.” The “paired read information” can be left with default values, as these are calculated at subsequent steps in the analysis. 3. Once the forward and reverse reads have been imported as a single-paired reads file, the remaining functions required for the analysis can be found within the “NGS Core Tools” menu within CLC Genomics Workbench. 4. Read trimming should then be carried out using the “Trim Sequences” function. Prior to the start of trimming, an adapter list should be imported into CLC Genomics Workbench (see Note 18). Preliminary quality control should be carried out using the “Create Sequencing QC Report” function. The sequence quality report of FastQC is more intuitive than that of CLC Genomics Workbench. Trimmed files can be exported as FASTQ files and analyzed using FastQC. Critical quality control metrics include “Per base sequence quality” and “Adapter content.” Should trimmed sequences fail to pass these two basic metrics, additional trimming is required. 5. Reference sequences are made using the cognate p33 gene region derived from CTV whole genomes available on the NCBI GenBank database. If other CTV gene regions have been selected as phylogenetic markers, the cognate sequences of these gene regions can be used in the same fashion as that of the p33 gene region described here. Cognate gene sequences are extracted from CTV whole genomes through their alignment to the primer sequences that were used to amplify the gene region, using alignment software such as CLUSTAL W within the BioEdit suite of tools [25]. The cognate p33 gene sequences have been grouped into “sequence types” based on the way in which they group within a dendrogram (Table 1). 6. Cognate reference sequences can be compiled as a single FASTA file and imported through the standard import function. 7. Reads that have passed quality control can then be mapped to reference sequences using the “Map Reads to Reference” function within CLC Genomics Workbench. Reference mapping

Analysis of CTV Populations

187

Table 1 Comprehensive list of CTV genome sequences, available on the NCBI GenBank database. These sequences have been grouped into “sequence types” according to the way in which they group within a dendrogram Sequence type

Isolate name

GenBank accession number

VT

CT11A FL202-VT VT FS703-VT VT FS701-VT L192GR T318A CTZA3

JQ911664 KC517493 U56902 KC517492 EU937519 KC517494 KC262793 DQ151548 KC333868

T36

T36 T36 T36 Qaha Mexico FS674-T36 FS701-T36 FS703-T36 FS577

NC_001661 U16304 EU937521 AY 340974 AY170468 KC517485 KC517486 KC517487 KC517488

RB

B301 NZRB-G90 HA 18-9 NZRB-M17 Taiwan-Pum/SP/T1 NZRB-M12 NZRB-TH28 NZRB-TH30

JF957196 GQ454869 GQ454869 FJ525435 JX266712 FJ525431 FJ525433 FJ525434

T30

T30 SY568 T385 FS701-T30 FL278-T30 FS703-T30

AF260651 AF001623 Y18420 KC517489 KC517490 KC517491

B165

B165 CT14A T68 NZ-B18

EU076703 JQ911663 JQ965169 FJ525436

Kpg3/SP/T3

Kpg3 SP T3

HM573451 EU857538 KC525952

HA 16-5 (1)

HA 16-5

GQ454870

AT-1 (1)

AT-1

JQ061137

Taiwan-Pum/M/T5 (1)

Taiwan-Pum/M/T5

JX266713

188

David A. Read and Gerhard Pietersen

settings can be set to the default settings with the exception of the following: “Length fraction,” 0.9; “Similarity fraction,” 0.9 (see Note 19); “Non-specific match handling,” Ignore; and “Output options,” Create stand-alone read mappings. 8. Read mapping outputs can then be exported as .xlsx files for further analysis. 9. These files can be opened with Microsoft Excel, and the numbers of read mapping to each reference sequence can be further grouped within the nine groups of sequence types described within the reference sequence list. 3.8 Interpretation and Visualization of Results

1. The relative number of mapped reads (percentage) per reference sequence can be determined by dividing the number of mapped reads to a specific reference sequence by the total number of read mapping CTV. 2. Any reference sequences where the relative percentage of mapped reads is 0.1% should be discarded from any further analyses. This accounts for potential false index assignment within the dataset (see Note 20). 3. In order to determine the CTV population composition of each sequence type, percentages of read mapping to each reference sequence should be added together, according to the sequence type groups represented in Table 1. 4. Stacked percentage barplots can be generated using Microsoft Excel (see Fig. 1) or the ggplot function within R Studio to produce a more visual representation of the sequence type composition of each CTV population.

4

Notes 1. The choice of the Thermo GeneJET plant RNA isolation kit was made due to its immediate availability and costeffectiveness. Successful isolation and amplification of CTV genes can also be achieved with the non-kit-based protocol previously described [26]. 2. Primer sequences should be regularly aligned against newly added CTV genomes on GenBank, to ensure that no significant new variation occurs between the primers and potential primer binding sites. Should new sequence data show that primers exhibit significant variation, the primer sequences provided here should be modified or redesigned. 3. At the time of writing, five commercially available NGS platforms, namely, Illumina, SOLiD, Ion Torrent, Oxford Nanopore, and PacBio, are available (Roche 454 sequencing platforms became defunct in 2016, although some providers

Analysis of CTV Populations

189

100% 90% 80% 70% Taiwan-Pum/M/T5 T36 AT-1 VT HA 16-5 SP/Kpg3/T3 RB

60% 50% 40% 30% 20% 10% 0% 13-3023

13-3067

13-3040

13-3042

13-3015

13-3059

13-3013

13-3062

Fig. 1 Graph representing the percentage of Illumina sequencing reads that are mapped back to each reference group for the samples from the Hoedspruit 1 orchard, which was 18 years old at the time of collection. Each bar represents the CTV population from a sample collected from a tree in the field. The reference groups are indicated in the figure legend. A total of 1,052,616 reads mapped to the reference set

may still be offering this service). Each of these manufacturers also offers a number sequencers offering variable levels of sequencing outputs and read lengths. Ultra-long read length platforms, such as Oxford Nanopore and PacBio, are currently expensive and typically used to supplement short read length data, such as Illumina HiSeq in applications such as wholegenome assemblies. Despite this, longer read length platforms are preferable for NGS amplicon sequencing [20], as this negates the need to fragment the DNA, prior to library preparation, which can lead to the production of chimeric contigs in subsequent data analyses. Currently, the Illumina MiSeq platform offers the longest read length (2  300 bp) among the “short read” platforms, as well as relatively short turnaround times. The choice of NGS platform may often lie in the availability of instruments and budgets available for sequencing. In many cases NGS platforms are owned by providers who offer full service library preparation and sequencing. Service providers are usually able to advise users on the most suitable platform for specific applications. The MiSeq platform has previously been used to characterize populations of CTV [9, 21, 22, 27], and its continued use for this application is advocated. 4. CLC Genomics Workbench has a graphical user interface with an intuitive layout, aimed at users with limited bioinformatics expertise [28], having all of the necessary tools to complete the

190

David A. Read and Gerhard Pietersen

bioinformatics analysis of CTV amplicon sequences. Despite its appeal as a “one-stop” bioinformatics toolkit, the cost of the software can put it out of reach of many research groups with the price of a single license exceeding US$5000 [28]. In this note, a number of alternative, individual software packages will be presented which are able to substitute for specific functions available within the CLC Genomics software package. It should be noted that many of these alternative software packages require advanced bioinformatics expertise and access to the programs in a Linux command line environment. Trimming of sequences can be carried out using Trimmomatic [29]. Trimmed forward and reverse reads will need to be merged using a tool such as “FASTQ joiner” within the Galaxy workflow (usegalaxy.org). Post-trimming quality control can be done using the FastQC software package (www.bioinformat ics.babraham.ac.uk/projects/fastqc). Reference mapping within CLC Genomics Workbench can be substituted using the “blastn” function within the BLAST command line application suite [30]. A reference database of the cognate gene region sequences (see Note 19) can be created using the “makeblastdb.” The “blastn” command can then be used to identify the identities of each read within the datasets. Ensure that the “blastn” output format is set to “tabular with comment lines.” This output can then be opened with Microsoft Excel and analyzed in much the same way as the CLC Genomics Workbench output. 5. Collect leaf material from as many different points as possible around individual trees. This will assist with reducing bias that could arise from varying strain titers. If leaf material is wet, ensure that it is dried before placing into sampling bags to avoid accelerated sample degradation. If material has been properly dried, fresh leaf material can be stored at 4  C for up to 1 month, without any significant decay. 6. Sectioned leaf midribs or material macerated in liquid nitrogen material can be stored at 80  C indefinitely and used for additional RNA isolations, as needed. 7. The amplification of CTV p33 gene cDNA products should be compatible with a multitude of available DNA polymerase enzymes and their additional components. The use of highfidelity proofreading enzymes is highly recommended at this juncture of the protocol, to avoid introducing PCR amplification errors into amplicons, which will be carried over to any type of subsequent sequencing data generation. 8. It is good practice to aliquot small volumes of primer working solutions, which are sufficient in volume for a limited number

Analysis of CTV Populations

191

of PCR master mixes. This practice also reduces the risk of contamination and should be practiced on all PCR reagents. 9. Ensure that only single bands are visible for each sample. If multiple bands are present, these spurious products will negatively affect downstream analyses. These products are often smaller than the band of interest and may be produced from the use of primers which have degraded due to excessive freeze/thaw cycles or any number of other external influences. The p33 gene primers produce visible primer dimer products on an agarose gel, which are removed during the subsequent enzymatic cleanup step. 10. PCR product purification is essential to remove excess primers and free nucleotides. 11. The Macherey-Nagel NucleoSpin Gel and PCR Clean-Up and Promega Wizard SV Gel and PCR Clean-Up System kits are effective column-based kits for the purification of amplicons generated from CTV-specific templates. 12. Direct sequencing of PCR amplicons can be done as an initial screening method to determine the identity of the dominant component of a CTV population. This approach can be used in studies where the cost of NGS precludes the sequencing of large number of samples from a survey. Since CTV populations are often heterogeneous, being made up of various disparate strains, Sanger sequences may contain multiple ambiguous base calls [31]. For this reason, the interpretation of data generated from the direct Sanger sequencing of CTV populations should be interpreted with caution. An alternative to direct sequencing is the cloning of PCR amplicons into an appropriate vector, transforming competent cells and isolating and sequencing the resulting cloned inserts. This approach is, however, very laborious and has low throughput and should be replaced with the NGS of amplicons wherever possible. Should downstream cloning applications be planned, amplicons that were amplified with a proofreading DNA polymerase will require A-tailing for cloning into vectors that rely on TA cloning. 13. When drawing off the supernatant, be sure not to aspirate the sequencing pellet, which is usually not visible. 14. The use of total RNA for the characterization of viral populations is attractive since it provides sequencing data on viruses for which little sequencing information is available. However, the major disadvantage of this approach is that along with yielding potential RNA and DNA (from the RNA stage) viral sequences, the trancriptomes of the host plant and any additional microorganisms will also be sequenced, which can significantly diminish the sequence coverage of the virus of

192

David A. Read and Gerhard Pietersen

interest. For this reason, when population compositions of CTV are being considered, the sequencing of amplicons is advocated in order to maximize the coverage of sequences of interest. 15. The Illumina Nextera XT library preparation kit requires only 1 ng of input DNA. Despite this, some NGS service providers require submitted samples to have concentrations as high as 50 ng/μL and a total sample volume of 50 μL. Service providers usually run in house quality control assays and will exclude samples which fail to comply with quantity and quality standards, from further processing. 16. Absorbance ratios of 260 nm/280 nm should be in the range of 1.8–2.0, while 260 nm/230 nm should fall between 2.0 and 2.2. Values outside of these ranges indicate the presence of potential contaminants that may negatively influence downstream library preparation steps. In these cases, additional DNA purification steps should be carried out. Although UV absorbance-based instruments provide information regarding the concentrations of total DNA, these values are often overestimated due to the presence of free nucleotides and singlestranded DNA. Fluorometric-based assays provide a more accurate estimation of concentrations by quantifying the amount of dsDNA present in a sample. This in turn allows for the improved estimation of starting material into the library preparation process. DNA samples deemed sufficiently free from contaminants by an initial UV absorbance assay should then be quantified with a fluorometric assay, such as the Thermo Qubit fluorometer and Broad Range dsDNA assay kit. 17. Arrangements between users and service providers vary greatly. Generally, providers offer a full service, where DNA samples are submitted and resulting NGS data is returned to the user. Some service providers offer reduced service charges if users prepare sample libraries in advance but will often not take responsibility for failed sequencing runs. 18. Sequencing service providers may provide data which has already been trimmed of adapter sequences or alternatively will be able to provide a FASTA file containing these sequences for users to perform their own trimming. If neither of these options are provided by the service provider, users will be required to obtain adapter sequences and generate a FASTA file containing these. Service providers should explicitly state which library preparation kits were used, as adapter sequences vary between different kits. 19. Increasing or decreasing the length and similarity fractions increases and decreases the stringency of read mapping, respectively. Increasing these values beyond the stated values leads to

Analysis of CTV Populations

193

an exponential increase in reads that fail to map to a reference sequence and hence a reduction in informative data yielded from the analysis. 20. Inherent sequencing errors can be incorporated into the index sequence of reads, leading to the erroneous assignment of that specific read during the process of data demultiplexing. This process is known as false index assignment [32]. The sequencing of a non-CTV amplicon on the same flow cell as a set of CTV p33 gene amplicons resulted in up to 0.1% of these sequences being erroneously assigned to CTV population datasets [9]. It is therefore recommended that any references associated with reads at levels of 0.1% or less be discarded from further analyses. References 1. Moreno P, Ambros S, Albiach-Marti MR et al (2008) Citrus tristeza virus: a pathogen that changed the course of the citrus industry. Mol Plant Pathol 9:251–268 2. Bar-Joseph M, Marcus R, Lee RF (1989) The continuous challenge of Citrus tristeza virus Control. Annu Rev Phytopathol 27:291–316 3. van Vuuren SP, Manicom BQ (2005) The response of star ruby grapefruit to different citrus tristeza virus isolates. In: Hilf ME, ˜ a MA (eds) ProceedDuran-Vila N, Rocha-Pen ings of the sixteenth conference of the international organization of citrus virologists, Mexico, 2004. IOCV, Riverside, CA, pp 112–116 4. Gal-On A, Shiboleth YM (2005) Crossprotection. In: Loebenstein G, Carr JP (eds) Natural resistance mechanisms of plants to viruses. Springer, Dordrecht, pp 261–288 5. Folimonova SY, Robertson CJ, Shilts T et al (2010) Infection with strains of Citrus tristeza virus does not exclude superinfection by other strains of the virus. J Virol 84:1314–1325 6. Read DA, Pietersen G (2015) Genotypic diversity of Citrus tristeza virus within red grapefruit, in a field trial site in South Africa. Eur J Plant Pathol 141:531–545 7. Folimonova SY (2012) Superinfection exclusion is an active virus-controlled function that requires a specific viral protein. J Virol 86:5554–5561 8. Folimonova SY (2013) Developing an understanding of cross-protection by Citrus tristeza virus. Front Microbiol 4:76 9. Read DA, Pietersen G (2016) Diversity of Citrus tristeza virus populations in commercial grapefruit orchards in Southern Africa,

determined using Illumina MiSeq technology. Eur J Plant Pathol 148:379–391 10. Albiach MR et al (1996) The effects of different hosts and natural disease pressure on molecular profiles of mild isolates of Citrus tristeza virus (CTV). In: daGrac¸a JV, Moreno P, Yokomi RK (eds) Proceedings of the thirteenth conference of the international organization of citrus virologists, China, 1995. IOCV, Riverside, CA, pp 147–153 11. Luttig M, van Vuuren SP, van der Vyver JB (2002) Differentiation of single aphid cultured sub-isolates of two South African Citrus tristeza virus isolates from grapefruit by singlestrand conformation polymorphism. In: Duran-Vila N, Milne RG, daGrac¸a JV (eds) Proceedings of the fifteenth conference of the international organization of citrus virologists, Cyprus, 2001. IOCV, Riverside, CA, pp 186–196 12. Souza AA, Mu¨ller GG, Targon M et al (2000) Evaluation of changes which occurred in a mild protective Citrus tristeza virus isolate in Pera sweet orange trees using RFLP and SSCP analyses of the coat protein gene. In: daGrac¸a JV, Lee RF, Yokomi RK (eds) Proceedings of the fourteenth conference of the international organization of citrus virologists, Brazil, 1998. IOCV, Riverside, CA, pp 136–139 13. Scott KA, Hlela Q, Zablocki O et al (2012) Genotype composition of populations of grapefruit-cross-protecting Citrus tristeza virus strain GFMS12 in different host plants and aphid-transmitted sub-isolates. Arch Virol 158:27–37 14. Iglesias NG, Gago-Zachert SP, Robledo G et al (2008) Population structure of Citrus tristeza

194

David A. Read and Gerhard Pietersen

virus from field Argentinean isolates. Virus Genes 36:199–207 15. Rubio L, Ayllo´n MA, Kong P et al (2001) Genetic variation of Citrus tristeza virus isolates from California and Spain: evidence for mixed infections and recombination. J Virol 75:8054–8062 16. Sambade A, Lopez C, Rubio L et al (2003) Polymorphism of a specific region in gene p23 of Citrus tristeza virus allows for the discrimination between mild and severe isolates. Arch Virol 148:2325–2340 17. Ayllo´n MA, Rubio L, Sentandreu V et al (2006) Variation in the population of two genes of Citrus tristeza virus after aphid transmission or passage to a new host. Virus Genes 32:119–128 18. Read DA, Pietersen G (2016) PCR bias associated with conserved primer binding sites, used to determine genotype diversity within Citrus tristeza virus populations. J Virol Methods 237:107–113 19. van Dijk EL, Auger H, Jaszczyszyn Y et al (2014) Ten years of next-generation sequencing technology. Trends Genet 30:418–426 20. Barba M, Czosnek H, Hadidi A (2014) Historical perspective, development and applications of next-generation sequencing in plant virology. Viruses 6:106–136 21. Read DA, Palacios MF, Kleynhans J et al (2017) Survey of Citrus tristeza virus (CTV) diversity in pigmented Citrus x paradisi (Macfad.) (Grapefruit) trees in north-western Argentina. Eur J Plant Pathol 151:329:340 22. Read DA, Palacios MF, Figueroa J et al (2018) Survey of Citrus tristeza virus (CTV) on Citrus paradisi (Macfad.) cv. “Marsh” in South Africa. Eur J Plant Pathol 151:1101–1105 23. Zablocki O, Pietersen G (2014) Characterization of a novel Citrus tristeza virus genotype within three cross-protecting source GFMS12

sub-isolates in South Africa by means of Illumina sequencing. Arch Virol 158:2133–2139 24. Varveri C, Olmos A, Pina JA et al (2014) Biological and molecular characterization of a distinct Citrus tristeza virus isolate originating from a lemon tree in Greece. Plant Pathol 64:792–798 25. Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98 26. White EJ, Venter M, Hiten NF et al (2008) Modified Cetyltrimethylammonium bromide method improves robustness and versatility: the benchmark for plant RNA extraction. Biotechnol J 3:1424–1428 27. Kleynhans J, Pietersen G (2016) Comparison of multiple viral population characterization methods on a candidate cross-protection Citrus tristeza virus (CTV) source. J Virol Methods 237:92–100 28. Smith DR (2015) Buying in to bioinformatics: an introduction to commercial sequence analysis software. Brief Bioinform 16:700–709 29. Bolger AM, Lohse M, Usadel B (2014) Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30:2114–2120 30. Camacho C, Coulouris G, Avagyan V (2009) BLAST+: architecture and applications. BMC Bioinformatics 10:421 31. Fontana A, Debreczeni DE, Albanese G et al (2014) Evolutionary analysis of Citrus tristeza virus outbreaks in Calabria, Italy: two rapidly spreading and independent introductions of mild and severe isolates. Eur J Plant Pathol 140:607–613 32. Kircher M, Sawyer S, Meyer M (2012) Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform. Nucleic Acids Res 40:e3

Chapter 14 Citrus tristeza virus: Host RNA Silencing and Virus Counteraction Susana Ruiz-Ruiz, Beatriz Navarro, Leandro Pen˜a, Luis Navarro, Pedro Moreno, Francesco Di Serio, and Ricardo Flores Abstract To dissect the host RNA silencing response incited by citrus tristeza virus (CTV, genus Closterovirus), a (+) ssRNA of ~19300 nt, and the counter reaction deployed by the virus via its three RNA silencing suppressors (RSS), the small RNAs (sRNAs) of three virus-host combinations were deep sequenced. The subsequent analysis indicated that CTV sRNAs (1) constitute more than half of the total sRNAs in the susceptible Mexican lime and sweet orange, while only 3.5% in the restrictive sour orange; (2) are mostly of 21–22 nt, with those of (+) sense predominating slightly; and (3) derive from all the CTV genome, as evidenced by its entire recomposition from viral sRNA contigs but adopt an asymmetric pattern with a hotspot mapping at the 30 -terminal ~2500 nt. The citrus homologues of Arabidopsis Dicer-like (DCL) 4 and 2 most likely generate the 21 and 22 nt CTV sRNAs, respectively, by dicing the gRNA and the 30 co-terminal sgRNAs and, particularly, their double-stranded forms accumulating in infected cells. The plant sRNA profile, very similar and dominated by the 24 nt sRNAs in the three mock-inoculated controls, displayed a major reduction of the 24 nt sRNAs in Mexican lime and sweet orange, but not in sour orange. CTV infection also influences the levels of certain microRNAs. The high accumulation of CTV sRNAs in two of the citrus hosts examined suggests that it is not their synthesis, but their function, the target of the RSS encoded by CTV: p25 (intercellular), p23 (intracellular) and p20 (both). The two latter might block the loading of CTV sRNAs into the RNA silencing complex or interfere with it through alternative mechanisms. Of the three CTV RSS, p23 is the one that has been more thoroughly studied. It is a multifunctional RNA-binding protein with a putative Zn finger domain and basic motifs that (1) has no homologues in other closteroviruses, (2) accumulates in the nucleolus and plasmodesmata, (3) regulates the asymmetric balance of CTV (+) and () RNA strands, and (4) induces CTV syndromes and stimulates systemic infection in certain citrus species when expressed as a transgene ectopically or in phloem-associated cells. Key words Closteroviruses, MicroRNAs, RNA silencing, Small interfering RNAs

1

The Virus and Its Main Features Virions of citrus tristeza virus (CTV), a phloem-restricted aphidtransmissible member of the genus Closterovirus, within family Closteroviridae, are flexuous filaments of 2000 nm in length

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_14, © Springer Science+Business Media, LLC, part of Springer Nature 2019

195

196

Susana Ruiz-Ruiz et al.

Virion assembly and cell-to-cell movement

Replication ORF 1a

1b

2

3

4

5

6

7

8 9 10 11

PRO MT

HEL

p33

HSP70

CPm

p18

p20

5'

3' UTR

UTR RdRp

p6

p61

CP

p13

p23

RNA silencing suppressors

Fig. 1 Scheme of the CTV gRNA with boxes denoting ORF flanked by 50 and 30 UTRs. ORFs 1a and 1b contain several domains: PRO (papain-like protease), MT (methyltransferase), HEL (helicase), and RdRp (RNA-dependent RNA polymerase). The functional role of some of the protein products is indicated. HSP70, CPm, and CP refer to a homologue of the plant heat-shock protein 70 and to the minor and major coat proteins, respectively. “Reproduced from Flores et al., 2013 with permission from Frontiers Media SA”

composed by a single-stranded (ss) RNA of (+) sense and two coat proteins [1–3]. The genomic RNA (gRNA), of ~19300 nucleotides (nt), is organized in 12 open reading frames (ORF1a and b, p33, p6, p65, p61, p27, p25, p18, p13, p20, and p23, potentially encoding at least 19 proteins), flanked by two untranslated terminal regions (50 -UTR and 30 -UTR) of ~100 and ~300 nt, respectively (see Fig. 1) [4–8]. ORF1 codes for the replicase complex [5] and is expressed from the gRNA, whereas the other ten 30 ORFs are expressed from a set of nested 30 coterminal subgenomic RNAs (sgRNA) [9]; this particular expression pattern is reflected in the RNA silencing response mounted by the host (see below). Proteins p6, p65 (a homologous of the heat-shock protein 70, HSP70), and p61 mediate the efficient movement and virion assembly [10], the capsid of which is formed by p25, the main coat protein [11] covering 97% of the virion length, and by p27, a second coat protein covering the remaining 3% [12–14]. In some hosts, CTV additionally needs for systemic infection the leader protease L2 encoded in the ORF1 [15]. Protein p20 accumulates in amorphous inclusions [16], while p23 is a multifunctional protein with RNA-binding properties [17] that control the asymmetrical accumulation of the (+) and () viral strands during replication [18]. The ectopic expression of p23 in transgenic plants of Mexican lime (Citrus aurantifolia Christm. Swing.), sweet orange (C. sinensis L. Osb.), sour orange (C. aurantium L.), and trifoliate orange (Poncirus trifoliata L. Raf.) incites symptoms similar to those induced by CTV infection in the first host [19–21], wherein symptoms become even more similar when the transgenic expression of p23 is under the control of a phloem-specific heterologous

CTV Interference by Host RNA Silencing

197

promoter [22]. Proteins p25, p20, and p23 are suppressors of RNA silencing (see below), and transformation of Mexican lime with an intron-hairpin construct expressing non-translatable versions of their corresponding genes confers complete resistance to CTV [23]. Proteins p33, p18, and p13 are dispensable for systemic infection of certain citrus hosts, but not of others [24, 25]. These three genes are involved in expression of the stem-pitting syndrome [26]. Additionally, p33 plays a role in superinfection exclusion [27, 28], an aspect with potential applications in cross protection (the deliberate preinfection with CTV mild strains to protect the plant against subsequent infections with severe strains of the same virus). Lastly, the 30 -UTR, highly conserved in all isolates examined [29], contains elements of primary and secondary structure involved in viral RNA replication [30]. In contrast, the 50 -UTR sequence is very variable but adopts a conserved secondary structure [29–31] that is very important for replication and proper encapsidation [32].

2

Virus Infection Triggers in Plants an RNA Silencing-Mediated Antiviral Response RNA silencing most likely evolved in higher eukaryotes as a defense mechanism against invading nucleic acids and later was co-opted for regulating gene expression and maintenance of genomic stability [33]. In plants, RNA silencing is particularly sophisticated and redundant because they lack interferon-induced and antibodybased antiviral responses. The initial elicitors of RNA silencing, double-stranded (ds) RNAs or ssRNAs adopting a fold-back structure resembling imperfect dsRNAs, are recognized and diced by Dicer-like (DCL) RNases into small RNAs (sRNAs) of the following classes: (1) microRNAs (miRNAs) of 21–22 nt of endogenous origin and (2) small interfering RNAs (siRNAs) of endogenous origin and virus-derived small RNAs (vsRNAs) of 21, 22, and 24 nt [34, 35], with the latter being amplified into secondary vsRNAs by host RNA-directed RNA polymerases (RDRs) [36]. The resulting miRNAs and vsRNAs prime and guide a second class of RNases (Argonaute, AGO) at the core of the RNA-induced silencing complex (RISC) [37–39], to cleave or repress translation of their cognate viral ssRNAs [40, 41]. Essentially all plant RNA viruses have developed a counterattack strategy by encoding in their genome suppressors of RNA silencing [42, 43], as will be illustrated later in this chapter for CTV. Since many suppressors sequester sRNAs, including miRNAs mediating key developmental steps, these viral proteins are deemed as major players in symptom induction, although such view may not hold true in some instances [44, 45].

198

Susana Ruiz-Ruiz et al.

3 CTV sRNAs (21–22 Nt) Accumulate at Very High Levels in the Total sRNA Population of Some Citrus Hosts In the initial study addressing by deep sequencing the characterization of the sRNAs from healthy and CTV-infected plants, nucleic acid preparations from young stem bark of Mexican lime, sweet orange, and sour orange were examined with the Illumina platform [46]. Around 55% of the 18–26 nt sRNAs were CTV sRNAs matching perfectly the parental sequence of the severe CTV isolate T318 infecting Mexican lime and sweet orange, while this fraction was reduced to 3.5% in sour orange (see Fig. 2). These differences most likely resulted from the virus titer, as revealed by RNA gel-blot hybridization (the signals produced by the gRNA and the three more abundant sgRNAs, coding for p23, p20, and p25, were less intense in sour orange than in the other two hosts) and by RT-qPCR (the number of CTV gRNA copies was similar for Mexican lime and sweet orange, around 106 molecules per ng of total RNA, but 100-fold lower in sour orange). The high levels of vsRNAs in Mexican lime and sweet orange were a surprise assuming that virus titers in woody plants are generally low, although the analyzed sampled tissue was young stem bark wherein the phloemrestricted CTV accumulates predominantly. Regarding size distribution, the CTV sRNAs of 21 and 22 nt were the most abundant, particularly in the infected Mexican lime and sweet orange, with those of (+) sense appearing in a modest surplus with respect to their () counterparts. This relative increase might be the consequence of their binding and stabilization by one or more of the three CTV-encoded suppressors of RNA silencing [42, 43]. Intriguingly, while accumulation of the 21 and 22 nt vsRNAs in the last two hosts had no major effect on the plant MAC8 sRNA

1800000

1600000

1600000 1400000

1400000

1200000

1200000

CTV CTV plant plant

800000 600000

1000000 800000 600000

400000

400000

200000

200000

0

0 18

19

20

21

22

23

24

25

CTV CTV plant plant

1000000

600000

200000

19

20

21

22

23

24

25

0

26

18

MAC7 bis sRNA

Mock-inoculated Mexican lime

1800000

1600000

1600000

1400000

1400000

1200000

600000

600000 400000

200000

200000

0

0

22 size (nt) Size (nt)

23

24

25

26

CTV CTV plant plant

800000

400000

24

25

26

1200000

1000000

counts reads

800000

counts reads

CTV CTV plant plant

23

1400000

1200000

1000000

22

Mock-inoculated sweet orange

Mock-inoculated sour orange 1800000

21

21

MAC15 sRNA

1600000

20

20

size Size(nt) (nt)

MAC9 sRNA

1800000

19

19

size (nt) Size (nt)

size(nt) (nt) Size

18

CTV CTV plant plant

800000

400000

18

26

counts reads

1200000

1000000

counts reads

reads counts

CTV-infected sweet orange

1800000

1600000 1400000

reads counts

MAC16 sRNA

MAC10 sRNA CTV-infected sour orange

CTV-infected Mexican lime 1800000

1000000

CTV CTV plant plant

800000 600000 400000 200000 0

18

19

20

21

22 size (nt) Size (nt)

23

24

25

26

18

19

20

21

22

23

24

25

26

size (nt)

Size (nt)

Fig. 2 Histograms displaying the number of reads of CTV and plant sRNAs (orange and green, respectively) of 18 to 26 nt from young bark of CTV-infected and mock-inoculated Mexican lime, sour orange, and sweet orange. “Reproduced from Ruiz-Ruiz et al., 2011 with permission from Springer Nature”

CTV Interference by Host RNA Silencing

199

sRNAs of the same size, it induced a significant reduction of the 24 nt plant sRNAs, the dominant species in angiosperms [47, 48] (see Fig. 2). The citrus DCL4 and DCL2 are the best candidates for producing the 21 and 22 nt CTV RNAs, respectively, presuming for them the same size specificity as their homologs from Arabidopsis [46]. With respect to the 50 -terminal nucleotide, the most abundant 21 and 22 nt CTV sRNAs of either polarity had a C or U, while those with a G were underrepresented. The differential accessibility to DCLs of certain regions of their RNA substrates, the binding (and protection) afforded to sRNAs by AGOs with a specific 50 -terminal nucleotide [49, 50], and the preference of exoribonucleases for certain ends, could explain the biased distribution observed.

4 CTV sRNAs Display an Asymmetric Distribution Mapping Preferentially at the 30 -Terminal Region of the Viral Genome When the reads corresponding to the CTV sRNAs were represented along the CTV gRNA, they displayed in the three hosts a skewed distribution with a major hotspot spanning approximately the 30 -terminal 2500 nt, with the reads increasing gradually from gene p25 up to gene p23 and then, remarkably, dropping at the 30 -UTR (see Fig. 3). The hotspot had essentially the same shape for the 21 and 22 nt CTV sRNAs of either polarity, suggesting for the citrus homologs of DCL4 and DCL2 a preference toward certain regions of the RNA substrates, the nature of which is discussed below. Such an asymmetric profile was further confirmed by RNA gel-blot hybridization (see Fig. 3). Moreover, the vsRNA density (reads per nucleotide) showed the same profile in the three hosts, with a maximum at p23 and a minimum at the 30 -UTR, and also revealed that the moderate overabundance of (+) versus () CTV sRNAs was mostly caused by those derived from p20 and p23 [46]. Even if a similar bias had been previously observed in other viruses [51, 52], the extreme accumulation of CTV sRNAs mapping at the 30 -moiety of the CTV gRNA had no precedent. The most likely interpretation for this marked asymmetric pattern is that the hotspot of CTV sRNAs results from dicing of the ten 30 coterminal CTV sgRNAs and, specially, from their dsRNAs identified in nucleic acid preparations from infected tissue [53–55]. The lower density of vsRNAs derived from the 30 -UTR could be the consequence of the protecting effects of proteins— mediating transcription of () strands or translation of the sgRNAs—that may display high affinity for this region and, in particular, for the 50 nt at the 30 terminus at which very few CTV sRNAs were mapped [46].

200

Susana Ruiz-Ruiz et al.

Fig. 3 Mapping the frequency of the 50 termini of (+) and () vsRNA reads from three citrus hosts (bars above and below the x-axis, respectively) along the CTV gRNA shows their preferential accumulation at the 30 -terminal moiety. The ORFs, and 50 - and 30 -UTRs, are indicated on top with boxes and lines, respectively. Note that the read scale is different and that the same numbering is used in the (+) polarity (50 ! 30 orientation is from left to right) and in the () polarity (50 ! 30 orientation is from right to left). The signals generated by the vsRNAs from CTV-infected sweet orange when hybridized with eight equalized ~1500 nt digoxigenin-labeled riboprobes, spanning the gRNA, are shown in the bottom. The nucleotide coordinates of

CTV Interference by Host RNA Silencing

201

Subsequent work with other CTV isolates and hosts have confirmed a similar asymmetric profile of the 21 and 22 nt vsRNA accumulation in all cases [56–60]. These deep sequencing analyses have additionally allowed, following an approach developed previously [52], the reconstruction of complete CTV genomes from the assembly of overlapping vsRNAs, correcting miss-annotations and providing insights on CTV variability.

5

CTV Infection Affects the Profile of Host sRNAs Setting aside that deep sequencing of sRNA libraries from mockinoculated and CTV-infected Mexican lime, sweet orange and sour orange, led to identification of new citrus miRNAs [46], comparative studies also afforded a view on how virus infection modulates the relative accumulation of miRNAs. Focusing on the 28 citrus miRNAs with a minimum of ten reads in at least one of the three hosts, most of their target mRNAs encode transcription factors or other key regulators [46, 61]. Of particular note is miR168 (upregulated by CTV in the three hosts) targeting the mRNA coding for AGO1, which mediates miRNA- and vsRNA-directed gene silencing [62–64]. AGO1 mRNA and miR168 are co-regulated transcriptionally [65], with data supporting that while induction of AGO1 mRNA (and the accompanying AGO1 accumulation) is part of the host defense response, induction of miR168 is a counter-defensive measure promoted by the virus [66]. On the other hand, it was remarkable to observe that 1–4% of all plant sRNAs derived from a 282-kb region of the trifoliate orange genome harboring the Ctv locus for CTV resistance and particularly from the putative gene CTV 20. Furthermore, the accumulation of the 24 nt plant sRNAs homologous to the 282-kb region was increased by CTV infection in sour orange while in Mexican lime and sweet orange was reduced [46]. This region has 22 putative genes, including a cluster of seven disease resistance (R) genes, two transposons, and eight retrotransposons [67], with our data suggesting that CTV infection might affect differentially their expression in highly susceptible hosts (Mexican lime and sweet orange) and in sour orange (a host restricting virus accumulation).

ä Fig. 3 (continued) the probes along the CTV genome are indicated, and the number of (+) CTV sRNAs reads within each of the eight regions analyzed is within parentheses. Prior to hybridization, aliquots of the RNA preparation from CTV-infected sweet orange were fractionated by electrophoresis in 17% polyacrylamide/urea gels and blotted to membranes. After hybridization, the membranes were washed, revealed with the chemiluminescent substrate CSPD, and exposed to X-ray film. A 23 nt RNA marker, homologous to positions 18692–18714 of the CTV gRNA, was also included (lane M). “Reproduced from Ruiz-Ruiz et al., 2011 with permission from Springer Nature”

202

6

Susana Ruiz-Ruiz et al.

CTV Counteracts by Encoding Three RNA Silencing Suppressors (RSS) As indicated above, to defend themselves against the RNA silencing triggered in their hosts, essentially all plant RNA viruses have evolved to encode RSS in their genomes [42, 43]. To pinpoint those of CTV (more than one was anticipated considering the complexity of the virus), nine of the proteins encoded in the 30 -terminal region of the gRNA were expressed, via Agrobacterium tumefaciens, along with the green fluorescent protein (GFP) in a transgenic line of Nicotiana benthamiana (16c) constitutively expressing the green fluorescent protein (GFP) [68]. RNA gel-blot hybridization and analysis of the fluorescence emitted by GFP in the infiltrated leaves disclosed moderate and strong RSS activity for p20 and p23, respectively, while no such activity was found in the leaves co-infiltrated with the p25 construct although, intriguingly, partial suppression of systemic silencing was occasionally observed. This issue was examined in more detail using an independent silencing system based on the GUS (beta-glucuronidase) transgene in a tobacco line (6b5), in which silencing of the transgene occurs autonomously and recurrently in each generation. The F1 progeny resulting from the introduction by genetic crosses of the p23, p20, and p25 constructs into this line revealed abundant accumulation of the GUS mRNA in p20  6b5 and, specially, in p23  6b5 plants, but not in p25  6b5 plants, thus showing that p20 and p23, but not p25, act as intracellular RSS. Propagation of the tobacco line T19 expressing GUS onto control 6b5 and p23  6b5 rootstocks revealed that the corresponding scions became silenced (as denoted by the accumulation of GUS-specific siRNAs and the decrease of GUS-mRNA). Therefore, p23 did not interfere with the production or export of the GUS-specific silencing signal from the 6b5 rootstock locus into the T19 scions; in contrast, lack of GUS-siRNAs and accumulation of GUS-mRNA in T19 scions grafted onto either p20  6b5 or p25  6b5 rootstocks were observed. To sum up, p23 is an RSS of intracellular silencing, p25 of intercellular silencing, and p20 of both, thus disclosing the sophisticated counter-defense mounted by CTV against more than one steps of the antiviral silencing route, a solution most likely evolved for protecting such a large gRNA [68].

7

Fine Dissection of the RSS Activity of p23 Because p23 is a unique protein of CTV, with no homologues in other closteroviruses [69], its properties including the RSS activity have been further examined. The initial results revealing that p23 behaves as an RSS [68] have been described in the preceding section. Subsequent work showed that while the GFP fluorescence

CTV Interference by Host RNA Silencing

203

in leaves of the same N. benthamiana transgenic line 16c remained intense for 6–7 days after co-infiltration with plasmids expressing GFP and p23, the emitted signal turned imperceptible in leaves infiltrated with only the plasmid expressing GFP, or co-infiltrated with either the empty plasmid or any of the plasmids expressing seven deletion and nine substitution mutants of p23 [70]. Consistently with these data, RNA preparations from leaves emitting strong fluorescence analyzed by gel-blot hybridizations with a GFP-specific probe showed high and low accumulation of GFP-mRNA and GFP-siRNAs, respectively, whereas the opposite situation was observed with RNA preparations from leaves with imperceptible fluorescence. An additional corollary of these results is that the RSS activity of p23 involves most regions of the protein [70]. It is improbable that p23 may operate by binding dsRNAs and prevent their subsequent DCL-mediated processing into vsRNAs, because they reach high titers in some CTV-infected citrus hosts [21, 46]. Thus, impairment of one or more AGO by vsRNA seems a more likely alternative. However, the accumulation of siRNAs derived from a CTV transgene is not enough to confer protection against the virus in Mexican lime [23, 71].

8

In Addition to Its RSS Role, p23 Mediates Other Functions in CTV Biology Because p23 has no counterpart in other closteroviruses, this RNA-binding protein of 209 amino acids with a putative Zn-finger domain and some basic motifs [17] might have been captured by an ancestor of CTV to facilitate its specific interaction with citrus hosts. A similar situation could be envisaged for p33, p18, and p13, which are required for the systemic infection of only some citrus hosts (see above). Intriguingly, the location of the ORF corresponding to p23 is adjacent to the 30 -UTR, a feature shared by some other (+) sense ssRNA plant viruses with filamentous morphology that also encode in the 30 -proximal region of their genomes proteins with basic amino acid motifs and cysteines forming a putative Zn-finger domain [72]. Further highlighting its singularity, from a cellular perspective, p23 accumulates predominantly in the nucleolus, being the only closterovirus protein with such a subcellular localization, as well as in plasmodesmata [70]. These major accumulation sites most likely have an influence on some of the functional roles of p23, which, apart from its intracellular RSS activity, include (1) regulating the asymmetrical accumulation of CTV (+) and () RNA strands (see above), (2) inducing in sour orange and grapefruit the seedling yellows syndrome [73], (3) eliciting CTV-like symptoms in several citrus species when expressed as a transgene ectopically or under the control of a phloem-specific promotor (see above), and (4) enhancing systemic infection (and concurrent CTV

204

Susana Ruiz-Ruiz et al.

accumulation) in sour orange and virus release from the phloem in p23-expressing transgenic sweet and sour orange [74]. Thus, p23 appears to play a role in pathogenesis, and, in fact, the polymorphism observed in a specific region allows discrimination between mild and severe CTV isolates [75]. Moreover, recent results indicate that, like other viruses, CTV seems to co-opt the cytosolic glyceraldehyde 3-phosphate dehydrogenase, via interaction with p23, to facilitate its infectious cycle [76].

Acknowledgments This research was supported by a grant (Prometeo/2008/121) from the Generalitat Valenciana, Spain, and by a grant (AGL2009-08052) from the Ministerio de Ciencia e Innovacio´nFondo Europeo de Desarrollo Regional. S. Ruiz-Ruiz was additionally supported by a postdoctoral contract from the Generalitat Valenciana (APOSTD/2012/020, Program VALi+d). References 1. Bar-Joseph M, Garnsey SM, Gonsalves D (1979) The closteroviruses: a distinct group of elongated plant viruses. Adv Virus Res 25:93–168 2. Moreno P, Ambro´s S, Albiach-Martı´ MR et al (2008) Citrus tristeza virus: a pathogen that changed the course of the citrus industry. Mol Plant Pathol 9:251–268 3. Dawson WO, Garnsey SM, Tatineni S et al (2013) Citrus tristeza virus-host interactions. Front Microbiol 4:88 4. Pappu HR, Karasev AV, Anderson EJ et al (1994) Nucleotide sequence and organization of eight 30 open reading frames of the citrus tristeza closterovirus genome. Virology 199:35–46 5. Karasev AV, Boyko VP, Gowda S et al (1995) Complete sequence of the Citrus tristeza virus RNA genome. Virology 208:511–520 6. Mawassi M, Mietkiewska E, Gofman R et al (1996) Unusual sequence relationships between two isolates of Citrus tristeza virus. J Gen Virol 77:2359–2364 7. Vives MC, Rubio L, Lo´pez C et al (1999) The complete genome sequence of the major component of a mild Citrus tristeza virus isolate. J Gen Virol 80:811–816 8. Yang ZN, Mathews DH, Dodds JA et al (1999) Molecular characterization of an isolate of Citrus tristeza virus that causes severe symptoms in sweet orange. Virus Genes 19:131–142

9. Hilf M, Karasev AV, Pappu HR et al (1995) Characterization of Citrus tristeza virus subgenomic RNAs in infected tissue. Virology 208:576–582 10. Satyanarayana T, Gowda S, Mawassi M et al (2000) Closterovirus encoded HSP70 homolog and p61 in addition to both coat proteins function in efficient virion assembly. Virology 278:253–265 11. Sekiya ME, Lawrence SD, Mccaffery M et al (1991) Molecular cloning and nucleotide sequencing of the coat protein gene of Citrus tristeza virus. J Gen Virol 72:1013–1020 12. Febres VJ, Pappu HR, Anderson EJ et al (1994) The diverged copy of the Citrus tristeza virus coat protein is expressed in vivo. Virology 201:178–181 13. Febres VJ, Ashoulin L, Mawassi M et al (1996) The p27 protein is present at one end of Citrus tristeza virus particles. Phytopathology 86:1331–1335 14. Satyanarayana T, Gowda S, Ayllon M et al (2004) Closterovirus bipolar virion: Evidence for initiation of assembly by minor coat protein and its restriction to the genomic RNA 50 region. Proc Natl Acad Sci U S A 101:799–804 15. Kang SH, Atallah OO, Sun YD et al (2018) Functional diversification upon leader protease domain duplication in the Citrus tristeza virus genome: Role of RNA sequences and the encoded proteins. Virology 514:192–202

CTV Interference by Host RNA Silencing 16. Gowda S, Satyanarayana T, Davis CL et al (2000) The p20 gene product of Citrus tristeza virus accumulates in the amorphous inclusion bodies. Virology 274:246–254 17. Lo´pez C, Navas-Castillo J, Gowda S et al (2000) The 23 kDa protein coded by the 30 -terminal gene of Citrus tristeza virus is an RNA-binding protein. Virology 269:462–470 18. Satyanarayana T, Gowda S, Ayllon MA et al (2002a) The p23 protein of Citrus tristeza virus controls asymmetrical RNA accumulation. J Virol 76:473–483 19. Ghorbel R, Lo´pez C, Fagoaga C et al (2001) Transgenic citrus plants expressing the Citrus tristeza virus p23 protein exhibit viral-like symptoms. Mol Plant Pathol 2:27–36 20. Fagoaga C, Lopez C, Moreno P et al (2005) Viral-like symptoms induced by the ectopic expression of the p23 gene of Citrus tristeza virus are citrus specific and do not correlate with the pathogenicity of the virus strain. Mol Plant-Microbe Interact 18:435–445 21. Fagoaga C, Lopez C, de Mendoza AH et al (2006) Post-transcriptional gene silencing of the p23 silencing suppressor of Citrus tristeza virus confers resistance to the virus in transgenic Mexican lime. Plant Mol Biol 60:153–165 22. Soler N, Fagoaga C, Lopez C et al (2015) Symptoms induced by transgenic expression of p23 from Citrus tristeza virus in phloemassociated cells of Mexican lime mimic virus infection without the aberrations accompanying constitutive expression. Mol Plant Pathol 16:388–399 23. Soler N, Plomer M, Fagoaga C et al (2012) Transformation of Mexican lime with an intron-hairpin construct expressing untranslatable versions of the genes coding for the three silencing suppressors of Citrus tristeza virus confers complete resistance to the virus. Plant Biotechnol J 10:597–608 24. Tatineni S, Robertson CJ, Garnsey SM et al (2008) Three genes of Citrus tristeza virus are dispensable for infection and movement throughout some varieties of citrus trees. Virology 376:297–307 25. Tatineni S, Robertson CJ, Garnsey SM et al (2011) A plant virus evolved by acquiring multiple nonconserved genes to extend its host range. Proc Natl Acad Sci U S A 108:17366–17371 26. Tatineni S, Dawson WO (2012) Enhancement or attenuation of disease by deletion of genes from Citrus tristeza virus. J Virol 86:7850–7857 27. Folimonova SY (2012) Superinfection exclusion is an active virus-controlled function that

205

requires a specific viral protein. J Virol 86:5554–5561 28. Atallah OO, Kang SH, El-Mohtar C et al (2016) A 50 -proximal region of the Citrus tristeza virus genome encoding two leader proteases is involved in virus superinfection exclusion. Virology 489:108–115 29. Lo´pez C, Ayllo´n MA, Navas-Castillo J et al (1998) Sequence polymorphism in the 50 and 30 terminal regions of tristeza virus RNA. Phytopathology 88:685–691 30. Satyanarayana T, Gowda S, Ayllon MA et al (2002b) Mutational analysis of the replication signals in the 30 -nontranslated region of Citrus tristeza virus. Virology 300:140–152 31. Ayllo´n MA, Lo´pez C, Navas-Castillo J et al (2001) Polymorphism of the 50 -terminal region of Citrus tristeza virus (CTV) RNA: Incidence of three sequence types in isolates of different origin and pathogenicity. Arch Virol 146:27–40 32. Gowda S, Satyanarayana T, Ayllo´n MA et al (2003) The conserved structures of the 50 nontranslated region of Citrus tristeza virus are involved in replication and virion assembly. Virology 317:50–64 33. Carthew RW, Sontheimer EJ (2009) Origins and mechanisms of miRNAs and siRNAs. Cell 136:642–655 34. Molnar A, Csorba T, Lakatos L et al (2005) Plant virus-derived small interfering RNAs originate predominantly from highly structured single-stranded viral RNAs. J Virol 79:7812–7818 35. Qi Y, Denli AM, Hannon GJ (2005) Biochemical specialization within Arabidopsis RNA silencing pathways. Mol Cell 19:421–428 36. Dalmay T, Hamilton A, Rudd S et al (2000) An RNA-dependent RNA polymerase gene in Arabidopsis is required for posttranscriptional gene silencing mediated by a transgene but not by a virus. Cell 101:543–553 37. Hamilton AJ, Baulcombe DC (1999) A species of small antisense RNA in posttranscriptional gene silencing in plants. Science 286:950–952 38. Mallory A, Vaucheret H (2010) Form, function, and regulation of ARGONAUTE proteins. Plant Cell 22:3879–3889 39. Ma Z, Zhang X (2018) Actions of plant Argonautes: predictable or unpredictable? Curr Opin Plant Biol 45:59–67 40. Omarov RT, Cioperlik JJ, Sholthof HB (2007) RNAi-associated ssRNA-specific ribonucleases in tombusvirus P19 mutant-infected plants and evidence for a discrete siRNA-containing effector complex. Proc Natl Acad Sci U S A 104:1714–1719

206

Susana Ruiz-Ruiz et al.

41. Pantaleo V, Szittya G, Burgya´n J (2007) Molecular bases of viral RNA targeting by viral small interfering RNA-programmed RISC. J Virol 81:3797–3806 42. Ding SW (2010) RNA-based antiviral immunity. Nat Rev Immunol 10:632–644 43. Csorba T, Kontra L, Burgya´n J (2015) Viral silencing suppressors: tools forged to fine-tune host-pathogen coexistence. Virology 479-480:85–103 44. Dı´az-Pendo´n JA, Ding SW (2008) Direct and indirect roles of viral suppressors of RNA silencing in pathogenesis. Annu Rev Phytopathol 46:303–326 45. Kontra L, Csorba T, Tavazza M et al (2016) Distinct effects of p19 RNA silencing suppressor on small RNA mediated pathways in plants. PloS Path 12:e1005935 46. Ruiz-Ruiz S, Navarro B, Gisel A et al (2011) Citrus tristeza virus infection induces the accumulation of viral small RNAs (21-24-nt) mapping preferentially at the 30 -terminal region of the genomic RNA and affects the host small RNA profile. Plant Mol Biol 75:607–619 47. Dolgosheina EV, Morin RD, Aksay G et al (2008) Conifers have a unique small RNA silencing signature. RNA 14:1508–1515 48. Morin RD, Aksay G, Dolgosheina E et al (2008) Comparative analysis of the small RNA transcriptomes of Pinus contorta and Oryza sativa. Genome Res 18:571–584 49. Mi S, Cai T, Hu Y et al (2008) Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 50 terminal nucleotide. Cell 133:116–127 50. Montgomery TA, Howell MD, Cuperus JT et al (2008) Specificity of ARGONAUTE7miR390 interaction and dual functionality in TAS3 trans-acting siRNA formation. Cell 133:128–141 51. Donaire L, Wang Y, Gonza´lez-Ibeas D et al (2009) Deep-sequencing of plant viral small RNAs reveals effective and widespread targeting of viral genomes. Virology 392:203–214 52. Kreuze JF, Pe´rez A, Untiveros M et al (2009) Complete viral genome sequence and discovery of novel viruses by deep sequencing of small RNAs: a generic method for diagnosis, discovery and sequencing of viruses. Virology 388:1–7 ˜ oz N (1990) Identifi53. Moreno P, Guerri J, Mun cation of Spanish strains of Citrus tristeza virus (CTV) by analysis of double-stranded RNAs. Phytopathology 80:477–482 54. Aramburu J, Navas-Castillo J, Moreno P et al (1991) Detection of double-stranded RNA by

ELISA and dot immunobinding assay using an antiserum to synthetic polynucleotides. J Virol Methods 33:1–11 55. Bar-Joseph M, Dawson WO (2008) Citrus tristeza virus. In: Mahy BWJ, Van Regenmortel MHV (eds) Encyclopedia of virology, 3rd edn. Elsevier, Oxford, pp 520–525 56. Folimonova SY, Harper SJ, Leonard MT et al (2014) Superinfection exclusion by Citrus tristeza virus does not correlate with the production of viral small RNAs. Virology 468-470:462–471 57. Licciardello G, Scuderi G, Ferraro R et al (2015) Deep sequencing and analysis of small RNAs in sweet orange grafted on sour orange infected with two Citrus tristeza virus isolates prevalent in Sicily. Arch Virol 160:2583–2589 58. Matsumura EE, Coletta-Filho HD, Nouri S et al (2017) Deep sequencing analysis of RNAs from citrus plants grown in a citrus sudden death-affected area reveals diverse known and putative novel viruses. Viruses 9:92 59. Yokomi RK, Selvaraj V, Maheshwari Y et al (2017) Identification and characterization of Citrus tristeza virus isolates breaking resistance in trifoliate orange in California. Phytopathology 107:901–908 60. Visser M, Cook G, Burger JT et al (2017) In silico analysis of the grapefruit sRNAome, transcriptome and gene regulation in response to CTV-CDVd co-infection. Virol J 14:200 61. Song C, Fang J, Li X et al (2007) Identification and characterization of 27 conserved microRNAs in citrus. Planta 230:671–685 62. Morel JB, Godon C, Mourrain P et al (2002) Fertile hypomorphic ARGONAUTE (ago1) mutants impaired in posttranscriptional gene silencing and virus resistance. Plant Cell 14:629–639 63. Baumberger N, Baulcombe DC (2005) Arabidopsis ARGONAUTE1 is an RNA slicer that selectively recruits microRNAs and short interfering RNAs. Proc Natl Acad Sci U S A 102:11928–11933 64. Qu F, Ye X, Morris TJ (2008) Arabidopsis DRB4, AGO1, AGO7, and RDR6 participate in a DCL4-initiated antiviral RNA silencing pathway negatively regulated by DCL1. Proc Natl Acad Sci U S A 105:14732–14737 65. Vaucheret H, Mallory AC, Bartel DP (2006) AGO1 homeostasis entails coexpression of miR168 and AGO1 and preferential stabilization of miR168 by AGO1. Mol Cell 22:129–136 66. Varallyay E, Valoczi A, Agyi A et al (2010) Plant virus-mediated induction of miR168 is

CTV Interference by Host RNA Silencing associated with repression of ARGONAUTE1 accumulation. EMBO J 29:3507–3519 67. Yang ZN, Ye XR, Molina J et al (2003) Sequence analysis of a 282-kilobase region surrounding the Citrus tristeza virus resistance gene (Ctv) locus in Poncirus trifoliata L. Raf. Plant Physiol 131:482–492 68. Lu R, Folimonov A, Shintaku M et al (2004) Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome. Proc Natl Acad Sci U S A 101:15742–15747 69. Flores R, Ruiz-Ruiz S, Soler N et al (2013) Citrus tristeza virus p23: a unique protein mediating key virus-host interactions. Front Microbiol 4:98 70. Ruiz-Ruiz S, Soler N, Sa´nchez-Navarro J et al (2013) Citrus tristeza virus p23: determinants for nucleolar localization and their influence on suppression of RNA silencing and pathogenesis. Mol Plant-Microbe Interact 26:306–318 71. Lo´pez C, Cervera M, Fagoaga C et al (2010) Accumulation of transgene-derived siRNAs is not sufficient for RNAi-mediated protection against Citrus tristeza virus (CTV) in transgenic Mexican lime. Mol Plant Pathol 11:33–41

207

72. Chiba M, Reed JC, Prokhnevsky AI et al (2006) Diverse suppressors of RNA silencing enhance agroinfection by a viral replicon. Virology 346:7–14 73. Albiach-Marti MR, Robertson C, Gowda S et al (2010) The pathogenicity determinant of Citrus tristeza virus causing the seedling yellows syndrome maps at the 30 -terminal region of the viral genome. Mol Plant Pathol 11:55–67 74. Fagoaga C, Pensabene-Bellavia G, Moreno P et al (2011) Ectopic expression of the p23 silencing suppressor of Citrus tristeza virus differentially modifies viral accumulation and tropism in two transgenic woody hosts. Mol Plant Pathol 12:898–910 75. Sambade A, Lo´pez C, Rubio L et al (2003) Polymorphism of a specific region in gene p23 of Citrus tristeza virus allows discrimination between mild and severe isolates. Arch Virol 148:2325–2340 76. Ruiz-Ruiz S, Spa`no R, Navarro L et al (2018) Citrus tristeza virus co-opts glyceraldehyde 3-phosphate dehydrogenase for its infectious cycle by interacting with the viral-encoded protein p23. Plant Mol Biol 98:363–373

Chapter 15 Proteomic Response of Host Plants to Citrus tristeza virus Milena Santos Do´ria and Carlos Priminho Pirovani Abstract Proteomics is an excellent technique for detecting proteins involved in plant responses infected with the Citrus tristeza virus. Here we describe the process to extract proteins to obtain two-dimensional gels with a large number of spots, well distributed, and with good quality. The extraction process that associates successive washes with ultrasonication steps proved to be efficient for the detection of proteins. With this technique it was possible to obtain clear gels which were detected in about 600 spots distributed throughout the gel without the presence of drag. Key words Proteins, Extraction, Virus, 2D PAGE

1

Introduction Proteomics involves the analysis of the protein content and the identification of the amino acid sequences that form these proteins [1]. It can be defined as a systematic analysis of the proteome of an organism, that is, the protein complement of the genome. This technique allows the qualitative and quantitative recognition of the large number of proteins that directly influences the biochemical functioning of the cells, in addition to understanding the organism during its growth, development, and behavior against environmental stimuli or when subjected to biotic or abiotic stress situations [2]. Among the techniques used in proteomic analysis, the extraction of proteins is considered one of the main steps, since many of the contaminants present in the samples can interfere in the final result and can interfere in the processes that follow the extraction as 2D gel separation and analysis by mass spectrometry [3]. Several methods can be used to obtain proteins from plant phloem. Cantu´ et al. [1] extracted total proteins from 1 g of bark from Citrus plant affected by the disease “sudden death of Citrus” using a 50 mM Tris–HCl pH 8.9 solution containing polyvinylpyrrolidone (PVPP), dodecyl sulfate sodium (SDS), and dithiothreitol

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_15, © Springer Science+Business Media, LLC, part of Springer Nature 2019

209

210

Milena Santos Do´ria and Carlos Priminho Pirovani

(DTT), with successive washes using ice-cold and acetone containing β-mercaptoethanol. The Citrus tristeza virus (CTV) is restricted to the phloem tissue of the plants and can cause necrosis and lead to death [4]. Thus, in the process of extracting proteins from plants infected with this virus, the bark of the plant branches is used. Due to its characteristics, this tissue has a recalcitrant potential [5]. Therefore, pure acetone and trichloroacetic acid (TCA) in acetone, followed by SDS-dense and phenol, were used to extract proteins from the bark of the branches (this tissue is used because the main symptom, the stem pitting, develops mainly on the branches). The extraction process should be performed by associating sonication steps in specific steps to place all the material in suspension. This method is considered very efficient for extracting proteins from recalcitrant tissues [6, 7]. After extraction, the proteins are separated according to their isoelectric point and their molecular masses, using isoelectric focusing and polyacrylamide gel electrophoresis, respectively [2]. The results obtained with the 2D gel (see Figs. 1 and 2) are analyzed by mass spectrometry. This technique generates results that must be

Fig. 1 Protein profile of orange variety Westin non-infected with Citrus tristeza virus (obtained at Estac¸a˜o Experimental da EMBRAPA—Petrolina Bebedouro). The spots present a good definition without the presence of drag and the proteins are distributed throughout for all range of molecular weight. This protein profile shows that this protocol is a good option to obtain a good protein profile

Host Proteome Analysis

211

Fig. 2 Protein profile of orange variety Pera C21 infected with Citrus tristeza virus (obtained at Estac¸a˜o Experimental da EMBRAPA—Petrolina Bebedouro). It is possible to observe on this profile that some proteins increased their accumulation in response to the infectious process

compared with a database so that it is possible to recognize the proteins detected [8].

2

Materials All the solutions to be used should be prepared with ultrapure water. After preparation, some reagents should be stored in a refrigerator and others in a freezer depending on the specific indication of each reagent. Disposal of the material should be carried according to regulations for disposal of toxic waste because many toxic reagents are used in the process of extracting proteins.

2.1 Protein Extraction

1. 100% and 80% acetone and diluted in water containing 0.07% β-mercaptoethanol. 2. 10% trichloroacetic acid (TCA) diluted in acetone and in water, both containing 0.07% β-mercaptoethanol. 3. Phenol buffered with Tris–HCl, pH 8.0. 4. SDS-dense: 2% SDS solution, 30% sucrose, 0.1 M Tris pH 8.0, and 5% of β-mercaptoethanol. 5. Methanol containing 0.1 M ammonium acetate.

212

Milena Santos Do´ria and Carlos Priminho Pirovani

6. Rehydration buffer: 6 M urea, 2 M thiourea, 2% CHAPS. 7. Eppendorf tubes. 8. Liquid nitrogen. 9. PVPP. 10. Benchtop centrifuge. 11. Vortex. 12. Ice bath. 13. Probe ultrasonicator. 2.2 Isoelectric Focusing (First Dimension)

1. 50 mM DTT diluted in water. 2. 0.5% ampholytes for pH of 3–10 NL. 3. Immobilized pH gel strips. 4. DryStrip Cover Fluid. 5. Strip holder (specific support). 6. Buffer: 6 M urea, 75 mM Tris–HCl pH 8.8, 30% glycerol, 2% SDS, 0.002% bromophenol blue. It should be stored at 80  C until use. 7. Ethan IPGphor III Isoelectric Focal Unit.

2.3 2D-PAGE (Second Dimension)

1. 12.5% two-dimensional polyacrylamide gel. 2. 10 mg/mL DTT: diluted in 7 mL of equilibration buffer. 3. 25 mg/mL iodoacetamide: diluted in 7 mL of equilibration buffer. 4. Hoefer SE 600 Ruby vertical electrophoresis system. 5. Water bath. 6. Molecular mass markers. 7. Agarose sealant solution: 25 mM of Tris base, 192 mM of glycine, 0.1% of SDS, 0.5% of agarose, 0.002% of bromophenol blue. 8. Fixing buffer: 40% ethanol and 10% acetic acid. 9. Dye: 8% ammonium sulfate, 0.8% phosphoric acid, 0.08% Coomassie Blue G-250, and 20% methanol. 10. 7% acetic acid diluted in water. 11. Orbital shaker. 12. Filter paper.

2.4 Treatment of Spots and Data Analysis

1. 100% NH4HCO3 containing 50% of acetonitrile. 2. 100 and 50% acetonitrile containing 5% formic acid. 3. Gold Trypsin [Promega] diluted in 100% of NH4HCO3. 4. 25 mM NH4HCO3.

Host Proteome Analysis

213

5. Scalpel. 6. SpeedVac. 7. LabScanner [Amersham Bioscience]. 8. ImageMaster 2D Platinum 7.0 [GE Healthcare]. 9. Micromass Q-TOF micro nano UPLC spectrometer [Waters]. 10. ProteinLynx v2.3 software.

3

Methods

3.1 Protein Extraction

1. Use two samples of young stem branches from each plant. Cut the branches in pieces of approximately 5 cm, and immediately insert liquid nitrogen. Then, subject these branches to lyophilization, and store at 20  C until the extraction. 2. Detach the barks from lyophilized shoots, and macerate in liquid nitrogen with 0.014 g PVPP (see Note 1). Resuspend a mass of 0.4 g of tissue powder (see Note 2) in 100% acetone, and vortex for 30 s, and then centrifuge at 10,000  g at 4  C. Repeat this wash two times. After washing with acetone, the precipitate has to be air-dried in an ice bath for about 20 min (see Note 3). 3. Resuspend the dry mass in 10% trichloroacetic acid (TCA) dissolved in acetone containing 0.07% β-mercaptoethanol. Repeat this wash 3–4 times until the coloration is lost. Between one wash and another, vortex the precipitate, and subject to centrifugation at 10,000  g 4  C. The second type of lavage is performed using 10% TCA dissolved in water with 0.07% β-mercaptoethanol. At this stage resuspend the precipitate with the aid of a probe ultrasonicator (Gex 130, 130 W) (see Note 4) under 70% amplitude, 3 pulses of 10 s with 15 s of breaks (see Note 5). Perform the last washing procedure with 80% acetone. Always centrifuge the precipitate under the same conditions (see Note 6) always maintained in ice (see Note 3). 4. Resuspend the dry powder in 0.8 mL of phenol and 0.8 mL of SDS-dense (see Note 7). Vortex for 2–5 min, and then subject the precipitate to centrifugation for 3 min at 10,000  g for phase separation. Collect the supernatant, and add to this volume 5 volumes of cold methanol containing 0.1 M of ammonium acetate. Homogenize the sample, and store at 20  C for 30 min for protein precipitation. 5. Recover proteins by centrifugation at 10,000  g for 5 min, and wash the precipitate with ammonium acetate in cold methanol, and after wash using 80% acetone twice (see Note 8).

214

Milena Santos Do´ria and Carlos Priminho Pirovani

6. For rehydration of proteins, use 800 μL of rehydration buffer (see Note 9), and store the sample at 20  C until use (see Note 10). 3.2 Separation of Proteins According to Isoelectric Point

1. Mix a 500 μg protein mass (see Note 11) in rehydration buffer containing DTT (50 mM) and 0.5% of ampholytes for strips with pH 3–10 NL (nonlinear). Adjust the volume to 250 μL using rehydration buffer without DTT. 2. Insert the mixture into a strip holder, and after insert the strips (strips of gel with immobilized pH) of 13 cm long with pH ranging from 3 to 10 NL (see Note 12). 3. Add DryStrip cover fluid on the strip to prevent gel from drying. 4. Close the strip holder, and insert into the specific focusing unit controlled by a software program that must follow the following schedule: 12 h of rehydration at 20  C and about 5 h of focusing (500 V, 60 min; 1000 V, 64 min; 8000 V, 150 min; 8000 V, 40 min). 5. Store the strip in a test tube closed at

3.3 Separation of Proteins at Second Dimension

80  C until use.

1. Unfreeze the test tube containing the strips, and insert 7 mL of equilibration buffer containing 10 mg/mL of DTT into the test tube, and leave for 15 min under gentle shaking. After 15 min discard the buffer. 2. Insert 7 mL of equilibration buffer containing 25 mg/mL of iodoacetamide, and shake again for 15 min. 3. Place the strip on the gel, and on the side of the strip, add a filter paper soaked with 7 μL of the molecular mass markers. 4. Cover the strip with 1 mL of the agarose sealant solution. 5. Insert the plates containing the two-dimensional gel into the vertical system. 6. Submit each gel to a current of: – 15 mA for 15 min. – 40 mA for 30 min. – 50 mA for 3 h. 7. Keep the system at 11 overheating.



C using a water bath to avoid

8. Fix the spots by adding 300 mL of fixation buffer, and incubate for 1 h in room temperature. 9. Dye the gel for 7 days using Coomassie Blue. 10. Discolor the gel by subjecting it to successive washes with water.

Host Proteome Analysis

215

11. Keep the gels in acetic acid until the spots are excised (see Note 13). 3.4 Treatment of Spots

1. Scan the gels using LabScanner [Amersham Bioscience] (see Note 14), and analyze with ImageMaster 2D Platinum 7.0 [GE Healthcare] software (see Note 15). 2. Produce three gels of each sample to be analyzed to increase the reproducibility of the analysis, and from each treatment a gel needs to be chosen as reference (see Note 16). 3. Cut the spots from the gel, place them in 1.5 mL Eppendorf tubes, and shred them using a scalpel (see Note 17). 4. Wash the spots three times (see Note 18) with 200 μL of 100% NH4HCO3 containing 50% acetonitrile, and then discard the supernatant (see Note 19). 5. Wash the fragments with 200 μL of ultrapure water. 6. Dilute the spots using 100 μL of 100% acetonitrile, and incubate for 5 min at room temperature, and then dry in SpeedVac for 20 min or until complete drying. 7. Add 4 μL of cold solution of Gold Trypsin (Promega) to the gel fragments (see Note 20). 8. Add 25 mM NH4HCO3 to cover the gel. 9. Incubate the spots containing trypsin for 16 h at a temperature of 37  C. 10. Collect the supernatant (peptides) from each tube, and transfer to a new tube. 11. Wash the fragments twice with 50 μL of 50% acetonitrile containing 5% formic acid under shaking for 30 min. 12. Reduce the volume of the new tube under vacuum to approximately 20 μL (see Notes 21 and 22).

3.5

Data Analysis

1. Fraction the digested sample by phase-reversed chromatography on nanoAcquity UPLC [Waters] coupled to the mass spectrometer Q-Tof micro [Waters]. 2. Analyze obtained spectra using the ProteinLynx v2.3 software, and compare with the NCBI nonredundant and SWISSPROT database setting the parameter according to the material to be analyzed (see Note 23). 3. Use MASCOT MS/MS IonSearch (www.matrixscience.com) to the protein identification with the following parameters: trypsin enzyme digestion, 1-cleavage site lost, cysteinecarbamidomethylation (Cys) as fixed modification and as methionine oxidation (Met) modification, error tolerance of 30 ppm, tolerance for mass error equal to 0.3 Da, and 0.1 Da for the error of the fragmented ions.

216

4

Milena Santos Do´ria and Carlos Priminho Pirovani

Notes 1. The stem branches should measure approximately 5 cm. After cutting, these branches need to be frozen immediately and then lyophilized. Lyophilization by dehydrating the tissue facilitates removal of the bark from the shoots which should be performed with the aid of a scalpel. Make a small cut with the scalpel to open the shell, and later it should be detached from the stem. 2. The process can be carried out in tubes of 5 mL or two tubes of 2 mL in each extraction for loss of material to not occur and to facilitate the insertion of the washing solutions avoiding leaks. The volume of solutions used should always be 2 mL in each wash for this mass of material used, in this case 0.4 g. 3. At this point the tissue mass should be spread on the wall of the tube with the aid of a 100 μL tip to facilitate evaporation of the acetone. The entire extraction process must be performed inside the exhaust hood. 4. During the sonication steps, the tubes containing the samples should always be kept in an ice bath. 5. Other equipment may be used, but take into account the power setting, pulse duration, and interval between the pulses in order to avoid the heating of sample or formation of bubble. 6. Washing should be performed carefully, especially at the time of discarding the supernatant. At this stage the finer part of the sample macerated, even after centrifugation, can be resuspended at the interface between the liquid phase and the pellet, and at the time of disposal, if not careful, part of the sample can be lost. 7. Initially homogenize the sample in SDS-dense and then add the phenol. When shake sample is in the vortex, pay attention if the tubes are not open. It is recommended to use marks of tubes that provide good sealing. 8. Washing with ammonium acetate and methanol is very important because it is made with the intention to remove waste from the previously used solution. This step should be performed carefully, because at this stage you can already see the protein pellet. If the washes are not done carefully, the pellet can disintegrate, and the proteins will be lost. 9. This extraction method can also be used to perform gel-free proteomics. In this case, the protein precipitate must be solubilized in the appropriate solution.

Host Proteome Analysis

217

10. Proteins should be quantified with kits suitable for protein dosing in the presence of the interferents in the rehydration buffer. 11. The ideal minimum yield of proteins for the production of two-dimensional gel containing 500 μg of proteins is 2 μg/μ L of the sample. 12. Other strip lengths and other pH ranges may be used, but the protein mass to be used varies for each case. 13. For storage of gels, avoid porous containers. Give preference to glass containers. 14. The obtained gels can be scanned in other equipment considering the correct format for analysis in the software. 15. Other software for the analysis of two-dimensional gels can be used, as long as they are accurate in detecting the spot and allow obtaining the level of accumulation of these spots and characterization of the values of isoelectric point and molecular mass. 16. Three replicates of each gel should be performed to increase the reproducibility of the analysis. The gel chosen as reference should be the one considered as the best gel of the three replicates. 17. The spots should be cut according to the interest of the researcher. Tear the spots into the tube carefully for it not to be scraped, and contaminate the sample with the plastic coming from the tube. In addition, the chosen tube must be of good quality to not release undesirable material into the sample and consequently to not prejudice the identification of the proteins. 18. Another option is to leave the spots in solution overnight and continue the process later. 19. Be careful when discarding the supernatant to not lose the spots of perforated spots. 20. The spots should be kept at room temperature for 10 min so that the fragments absorb the solution and the peptides are extracted. 21. The volume should only be reduced near the moment of injection of the samples in the mass spectrometer to identify the peptide sequence. 22. Other protocols for extracting peptides can be performed. This one described can be used for the analysis of peptides in the Micromass Q-TOF micro nano UPLC spectrometer. In this spectrometer the separated peptides are ionized in a capillary under voltage of 3000 V, fragmented in the positive mode with selection of the minimum relative intensity of 10 counts, being

218

Milena Santos Do´ria and Carlos Priminho Pirovani

analyzed the three more intense ions per scan of 1 s, with collision energy varying between 20 and 95 V according to the mass/charge (m/z) ratio of the peptides. 23. Other databases may be used. The chosen parameters must be according to the species used.

Acknowledgments This work was funded by the Conselho Nacional de Desenvolvimento Cientı´fico e Tecnolo´gico(CNPq), process N 304536/ 2015-6. References 1. Cantu´ MD, Mariano AG, Palma MS et al (2008) Proteomic analysis reveals suppression of bark chitinases and proteinase inhibitors in citrus plants affected by the citrus sudden death disease. Phytopathology 98:1084–1092 2. Chen SX, Harmon AC (2006) Advances in plant proteomic. Proteomics 6:5504–5516 3. Newton RP, Brenton AG, Smith CJ et al (2004) Plant proteome analysis by mass spectrometry: principles, problems, pitfalls and recent developments. Phytochemistry 65:1449–1485 4. Bar-Joseph M, Lee RF (1989) Citrus tristeza virus. AAB Descr Pl Viruses 353:7 5. Do´ria MS, de Sousa AO, Barbosa CJ et al (2015) Citrus tristeza virus (CTV) causing proteomic

and enzymatic changes in sweet orange variety “Westin”. PLoS One 10:7 6. Pirovani CP, Carvalho HAS, Machado RCR et al (2008) Protein extraction for proteome analysis from cacao leaves and meristems, organs infected by Moniliophthora perniciosa, the causal agent of the witches’ broom disease. Electrophoresis 29:2391–2401 7. Bertolde FZ, Almeida AA, Silva FA et al (2014) Efficient method of protein extraction from Theobroma cacao L. roots for two-dimensional gel electrophoresis and mass spectrometry analyses. Genet Mol Res 13:5036–5047 8. Chalmers MJ, Gaskell SJ (2000) Advances in mass spectrometry for proteome analysis. Curr Opin Biotechnol 1:384–390

Chapter 16 Gene Expression in Citrus Plant Cells Using Helios® Gene Gun System for Particle Bombardment Yosvanis Acanda, Chunxia Wang, and Amit Levy Abstract To understand how Citrus tristeza virus (CTV) replicates and moves inside the plant, it is critical to study the cellular interactions and localization of its encoded proteins. However, due to technical limitations, so far these studies have been limited to the nonnatural host Nicotiana benthamiana. Particle bombardment is a physical method to deliver nucleic acid and other biomolecules into the cells directly. The Helios® gene gun (Bio-Rad, Hercules, CA) is a handheld device that uses a low-pressure helium pulse to accelerate high-density, subcellular-sized particles into a wide variety of targets for in vivo and in vitro applications. Here, we describe a detail protocol for either transient or stable gene expression in citrus leaf cells using this gene gun. This protocol can be used to study protein-protein interactions and subcellular localization in different kinds of plant cells. Key words Biolistic, Particle bombardment, Helios gene gun, Genetic transformation, Heterologous protein expression

1

Introduction Citrus tristeza virus (CTV) is a member of the complex Closteroviridae family, which contains viruses with one, two, or three RNA genomes [1]. It is a single-strand-positive RNA virus of 19.3 kb and has a very long and flexuous virion (2 μm long). The capsid is made up from mainly the coat protein (~97%) and the minor coat protein (~3%) [2]. CTV affects almost all citrus varieties but causes different disease symptoms on citrus plants depending on the virus strain, the citrus variety, and the scion-rootstock combination [3]. CTV contains 12 reading frames, making it one of the most complicated known viruses so far. As intracellular pathogens, viruses depend on the host cell for completing its lifecycle. Therefore, in order to gain deeper understanding of the virus infectious cycle, there is a need to unravel the cellular and molecular interactions of the viral proteins. The cellular localization of different CTV proteins was partially studied using Agrobacterium transient expression systems

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_16, © Springer Science+Business Media, LLC, part of Springer Nature 2019

219

220

Yosvanis Acanda et al.

[4–6]. However, these studies were conducted in the nonnatural host Nicotiana benthamiana, since no efficient transient expression system was available for citrus. Here, we describe a protocol for highly efficient transient expression system in citrus using the handheld Helios® gene gun. This system allows protein localization studies to be conducted in the host plant of CTV, including the phloem-associated cells. Moreover, it allows protein-protein interaction studies to be conducted in citrus using the bimolecular fluorescence complementation (BiFC) method. Particle bombardment was first described as a method for gene transfer into plant cells in the late 1980s [7–9] and subsequently shown to be applicable to a wide variety of target like animal cells, bacteria, and fungi [10–12]. Because it is a physical method, it does not depend on biochemical features of structural components typically present on cell surfaces, and it can overcome structural barriers such as the stratum corneum of animal epidermis and the cell wall of plants. The Helios® gene gun system is suitable for particle bombardment delivery of different types of nucleic acids (plasmids, mRNA, siRNA, cDNA, etc.) to a wide range of cells and tissues that could be difficult to transfect. As it is a handheld device, which does not require a vacuum chamber, it can be used for both in vitro and in vivo applications. This system has been shown to be suitable for gene transfection and protein expression in neuronal cultures and inner ear sensory hair cells [13, 14]. In plants, the Helios® gene gun system can be used for transient and stable gene expression [15, 16] and could be particularly convenient to use for transient expression in plants that are difficult to agro-infiltrate, like Arabidopsis and Citrus [17]. This system is also suitable to transfect viral genomic RNA and DNA into plant cells. For instance, the soybean dwarf virus was successfully replicated and systemically infected soybean plants after biolisticmediated inoculation of its RNA using the Helios® gene gun [18]. Here, we describe an easy and rapid method for direct delivery of nucleic acids into citrus leaf cells and bark that has been proved useful to study transient gene expression and protein subcellular localization in citrus [19].

2

Materials 1. Nuclease free water. 2. New absolute ethanol (200 proof) from an unopened bottle (see Note 1). 3. Biolistic® 0.6 μm gold particles (Bio-Rad). 4. 1 μg/μL concentrated high purity plasmid DNA (50 μL) (see Note 2).

Gene Expression in Citrus by Particle Bombardment

221

5. 1 M spermidine stock solution: dissolve 78.5 μL of spermidine 99% [Sigma] in 421.5 μL of water. Make 5 μL aliquots in 1.5 mL Eppendorf tubes, and store them at 20  C) (see Note 3). 6. 50 mM spermidine working solution: add 95 μL of water to a tube containing 5 μL of 1 M spermidine stock solution. Working solutions should be freshly prepared only before use. 7. 1 M CaCl2 stock solution: dissolve 150 mg of CaCl2 in 1 mL of water. 8. 100 Ethanol/PVP stock solution: dissolve 5 mg of PVP in 1 mL of absolute ethanol and store at 20  C for no longer than 1 month (see Note 4). 9. 1 (0.05 mg/mL) Ethanol/PVP working solution: take 100 μL of the 100 ethanol-PVP stock solution and dissolve in 9.9 mL of absolute ethanol. 10. Tefzel tubing for coating with DNA-gold microcarrier complex compatible with the Helios® gene gun (3.175 mm OD, 2.36 mm ID).

3

Methods Carry out all procedures at room temperature. PVP is essential for gold-DNA microparticles to get attached to the inner surface of the Tefzel tubing. In order to get Tefzel tubing coated evenly, it is important to make a fresh 1 ethanol/PVP working solution using an 100 ethanol/PVP stock solution stored for no longer than 1 month when preparing gold-DNA microparticles. It is important to work in a very dry environment and use an unopened ethanol bottle every time to avoid hydration of the DNA-coated gold microparticles, which could cause particles to cluster. To keep gold particle in suspension and avoid them to cluster, it is important to vortex and sonicate when mixing with spermidine. However, some authors recommend omitting sonication especially in those steps where DNA is present. In this protocol, we recommend a brief sonication (for no more than 3 s) when DNA is present in the gold suspension.

3.1 Tefzel Tubing Dry Out

1. Cut 76 cm of Tefzel tubing, insert it into the tubing preparation station, and allow nitrogen to pass through the tubing for 5–10 min at a flow speed of 0.3–0.4 LPM (see Note 5).

3.2 DNA Precipitation into Gold Microparticles

1. Weigh 12 mg of gold microparticles (0.6 μm) in 1.5 mL microcentrifuge tube. Add 100 μL of freshly made 50 mM spermidine, and vortex vigorously for 10 s, and then sonicate the mixture for 10 s to keep gold microparticles in suspension.

222

Yosvanis Acanda et al.

2. Add 50 μL of 1 μg/μL plasmid DNA, and vortex vigorously for 3 s, and then sonicate for 3 s more (see Note 6). 3. Lower the vortex speed and while mixing slowly add 100 μL of 1 M CaCl2 drop by drop (add a drop every 3 s) and allow suspension to settle for 10 min. 4. Centrifuge at 9400  g for 15 s and remove the supernatant without disrupting the pellet. 5. Add 1 mL absolute ethanol, vortex to resuspend the pellet, and sonicate for 3 s. Centrifuge at 9400  g for 15 s, and repeat this step twice. Avoid the pellet to dry out after centrifuging. 6. Vortex to resuspend the DNA-gold pellet in 1 mL of freshly made 1 ethanol/PVP solution, carefully transfer the suspension to a 15 mL of conical tube without taking the precipitate if present, and make up to 3 mL with 1 ethanol/PVP solution (see Note 7). 3.3 Preparation of Cartridges

1. Turn off the nitrogen flow, and take the Tefzel tubing out from the preparation station, and then connect a 10 mL syringe with a syringe adapter tubing directly to one end of the Tefzel tubing. Sonicate the DNA-gold particle suspension for 3 s and transfer directly into the Tefzel tubing by suctioning with the syringe. Immediately insert the Tefzel tubing again into the preparation station with the syringe still attached to it. Allow gold-DNA microparticles to settle along the Tefzel tubing for 12 min and then remove the ethanol-PVP solution by slowly suctioning with the syringe (see Note 8). 2. Disconnect the syringe and the Tefzel tubing and rotate 180 , wait for 5 s to make sure that gold-DNA microparticles slur through the inner surface of the tubing. Turn on the rotation and allow the gold-DNA microparticles to smear into the tubing for 20–30 s. While rotating, open the valve on the flowmeter to allow 0.35–0.4 LPM of nitrogen to dry the tubing for 10 min. 3. Turn both rotation and flowmeter off, take the gold-DNAcoated Tefzel tubing out of the preparation station, then use the tubing cutter to cut it into small sections (2.54 cm), and store cartridges at 20  C in the bullet storage container with a desiccation pellet. Under these conditions, cartridges can be stored up to 2 years.

3.4 Microparticle Bombardment into the Plant Cells

Keep the cartridge container at room temperature for 15 min before opening to avoid cartridges to absorb humidity. 1. Collect a fully expanded citrus young leaf and put in it over a Styrofoam platform with the underside of the leaf up (see Note 9). For studying the expression of CTV protein in the

Gene Expression in Citrus by Particle Bombardment

223

natural phloem tissue, peal a 3–6 cm bark section from a young stem, and place it over the Styrofoam platform with the inner side of the bark facing up (see Note 10). 2. Load cartridges into the cartridge holder leaving the position number 1 empty. 3. If necessary, clean and/or disinfect the gene gun and barrel line (see Note 11). 4. Insert cartridge holder, barrel liner, and battery into the gene gun, connect to the quick-connect hose, and set pressure at 275 psi on the helium tank regulator (see Note 12). 5. Make a “pre-shut” by engaging the safety interlock and firing the trigger. Recharge the gene gun again by pressing the cylinder advance lever. 6. Hold the gene gun perpendicularly to the leaf with the spacer touching the target area (see Fig. 1), activate the safety interlock switch, and press the trigger button to deliver the gold-DNA particles to the leaf cells. 7. After discharging the last cartridge, turn off the helium pressure by closing the valve on the helium tank and turning the regulator valve counterclockwise. 8. Keep the leaf in the dark inside a Petri dish with a wet filter paper to maintain humid conditions (see Fig. 1). Depending on the construct, GFP transient expression can be visualized 36–48 h after bombardment (see Note 13). Examples of transient and stable gene expression, and advanced application of

Fig. 1 Particle bombardment into citrus leaf and bark using the Helios® gene gun. (a, b) Positioning the gene gun and targeting the abaxial surface of a citrus leaf; (c) peeling a bark section from a citrus plant stem for phloem-associated cells bombardment; (d, e) targeting the bark inner surface for ex situ and in situ bombardment of phloem-associated cells; (f) inserting the bark section back to the stem after bombardment of phloem-associated cells; (g) incubation of a citrus leaf and bark section for protein expression after bombardment with the Helios® gene gun

224

Yosvanis Acanda et al.

Fig. 2 GFP expression in citrus leaves after bombardment using the Helios® gene gun. (a) eGFP-HDEL stable expression in Valencia sweet orange leaf under the control of rd29A gene promoter from A. thaliana 1 week after bombardment at 270 psi helium pressure; (b) eGFP-HDEL transient expression in Citrus macrophylla leaves 40 h after bombardment; (c, d) YFP transient expression in C. macrophylla bark tissue 40 h after bombardment. Sieve plate callose was stained with aniline blue and is shown in red in (d), to indicate phloem association of the transiently expressing cell

this system, including transient expression in the bark, co-localization studies, and protein-protein interaction studies, are shown in Figs. 2 and 3.

4

Notes 1. Use a new unopened bottle of 100% ethanol (200 proof) every time for bullet preparation. It is very important that the ethanol does not contain water to ensure a good drying out of the DNA-coated gold microparticles inside the Tefzel tubing and to avoid them to cluster. 2. Plasmid DNA can be purified from a 500 mL overnight E. coli culture using QIAGEN Plasmid Maxi Kit or another similar kit and adjusted to 1 μg/μL concentration. To use a larger volume

Gene Expression in Citrus by Particle Bombardment

225

Fig. 3 CTV coat protein (CPCTV) localization study in citrus. (a) Transient expression of CPCTV-GFP in C. macrophylla leaves; (b, c) transient expression of CPCTVGFP (green) in Duncan grapefruit leaves that are stably expressing Histone2BRFP (red). Yellow color is indicating nuclear localization of CPCTV-GFP; (d) transient expression of CPCTV-nEYFP and CPCTV-cEYFP in epidermal cells of C. macrophylla leaves. Yellow fluorescence is the result of bimolecular fluorescence complementation (BiFC) of the two constructs, indicating that CPCTV selfinteracts to forms oligomers in the nucleus and cytoplasm of the cells

of a less concentrated plasmid DNA preparation, use the same volume of spermidine but do not use volumes larger than 150 μL. More concentrated or impure plasmid DNA (>1 μg/μL) can lead to gold particle to cluster and inefficient transfection. 3. Do not store spermidine solution for more than 1 month even at 20  C. Spermidine deaminates with time, and old spermidine may decrease DNA precipitation onto gold microparticles and subsequently reduce gene transfection. 4. Ethanol/PVP working solution should be freshly prepared only before use at 0.01–0.05 mg/mL of PVP. Higher concentration of PVP does not lead to an increasing on transient expression. PVP at concentrations higher than 0.1 mg/mL may cause uneven coating of the Tefzel tubing. Do not keep

226

Yosvanis Acanda et al.

diluted PVP for more than 1 month. Old PVP also leads to uneven gold coating of the Tefzel tubing and lower transfection efficiency. 5. Insufficient dry out also can lead to uneven coating of the Tefzel tubing. 6. Do not sonicate for longer than 3 s when DNA is present to avoid the potential destructive effects of sonication on DNA. 7. Gold particles can cluster and precipitate during the washing steps. Do not leave the ethanol bottle open when preparing microcarriers and try to work quickly to avoid gold particle to cluster and precipitate. Avoid taking precipitated clustered particles because they can cause a lot of cell damage when shot into the tissue and dramatically reduce gene expression efficiency. 8. While transferring DNA-gold suspension from the 15 mL conical tube to the Tefzel tubing, do not take any air bubble or clustered particles settled at the bottom of the tube. Try to transfer the suspension as quick as possible to avoid it to settle. To remove the ethanol/PVP solution from the Tefzel tubing, you also can use a peristaltic pump at a flow rate of 3–4 mL/ min. 9. Collect a young leaf near by the end of the shoot. The leaf should have the same size than the mature leaves but lighter green color. Usually, those are the second and third newest leaves of the citrus plant. Alternatively, it is possible to shoot a leaf and keep it attached to the plant. When shooting citrus leave in situ, try to keep the plant in a high humidity environment. 10. When bombarding DNA into the bark phloem-rich tissue, it is important to use a very low pressure. We routinely use 100–150 psi when bombarding the bark tissue. High pressure will result in tissue damage and no expression. 11. The barrel liner can be disinfected in a 2% of sodium hypochlorite or 75% of alcohol solution for 10 min, rinsed with sterile water and dried out in the flow bench before used for in vitro applications. Use a clean barrel liner for each DNA or RNA to avoid contamination. Barrel liners can be cleaned by soaking in hot water and detergent for 2 h and rinsed with DI water. 12. DNA-gold particles can be delivered into young leaf cells of different citrus varieties using a helium pressure of 260–280 psi [19]. Helium pressure should be optimized for each experimental condition and target tissue. If the pressure is too high, the damage caused in the tissue could compromise the transfection efficiency. To avoid tissue damage when using a high helium pressure (350 psi), it is possible to use a diffusion screen (BioRad, cat# 165-2475) which can be placed over the

Gene Expression in Citrus by Particle Bombardment

227

opening of the barrel and between the spacer arms. Diffusion screens can be used also to reduce tissue damage when bombarding culture cells. 13. When bombardment conditions were optimized for our standard protocol, we obtained a good GFP transient expression in citrus leaves 48 h after bombardment (see Fig. 2). Stable expression using GUS as a reporter gene was detected 1 week after leaf bombardment in situ.

Acknowledgments Support for this work was provided by the Specialty Crop Research Initiative (SCRI) Citrus Disease Research and Extension Program (CDRE) grant number P0066064 and by the Florida State legislative funding for the UF/IFAS Citrus Initiative. References 1. Dolja VV, Kreuze JF, Valkonen JPT (2006) Comparative and functional genomics of closteroviruses. Virus Res 117:38–51 2. Satyanarayana T, Gowda S, Ayllo´n MA et al (2003) Closterovirus bipolar virion: evidence for initiation of assembly by minor coat protein and its restriction to the genomic RNA5´ region. PNAS 101(3):799–804 3. Moreno P, Ambro´s S, Albiach-Martı´ MR et al (2008) Citrus triseza virus: a pathogen that changed the course of the citrus industry. Mol Plant Pathol 9(2):251–268 4. Bak A, Folimonova SY (2015) The conundrum of a unique protein encoded by citrus tristeza virus that is dispensable for infection of most hosts yet shows characteristics of a viral movement protein. Virology 485:86–95 5. Kang S-H, Dao TNM, Kim O-K et al (2017) Self-interaction of Citrus tristeza virus p33 protein via N-terminal helix. Virus Res 233:29–34 6. Ruiz-Ruiz S, Soler N, Sa´nchez-Navarro J et al (2013) Citrus tristeza virus p23: determinants for nucleolar localization and their influence on suppression of RNA silencing and phatogenesis. Mol Plant-Microbe Interact 26 (3):306–318 7. Klein TM, Wolf ED, Wu R et al (1987) Highvelocity microprojectiles for delivering nucleic acids into living cells. Nature 327:70–73 8. Klein TM, Fromm M, Weissinger A et al (1988) Transfer of foreign genes into intact maize cells with high-velocity microprojectiles. Proc Natl Acad Sci U S A 85:4305–4309

9. McCabe DE, Swain WF, Martinell BJ et al (1988) Stable transformation of soy bean (Glycine max) by particle acceleration. Nat Biotechnol 6:923–926 10. Yang NS, Burkholder J, Roberts B et al (1990) In vivo and in vitro gene transfer to mammalian somatic cells by particle bombardment. Proc Natl Acad Sci U S A 87:9568–9572 11. Smith FD, Harpending PR, Sanford JC (1992) Biolistic transformation of prokaryotes: factors that affect biolistic transformation of very small cells. J Gen Microbiol 138:239–248 12. Armaleo D, Ye G-N, Klein TM et al (1990) Biolistic nuclear transformation of Saccharomyces cerevisiae and other fungi. Curr Genet 17:97–103 13. O’Brien JA, Lummis SCR (2009) Biolistic transfection of neuronal cultures using a hand-held gene gun. Nat Protoc 1(2):977–981 14. Belyantseva IA (2016) Helios® gene gun-mediated transfection of the inner ear sensory epithelium: recent updates. In: Sokolowski B (ed) Auditory and vestibular research, Methods in molecular biology, vol 1427. Humana Press, New York, NY 15. Carsono N, Yoshida T (2008) Transient expression of green florescent protein in rice calluses: optimization of parameters for Helios gene gun device. Plant Prod Sci 11:88–95 16. Kuriakose B, Du Toit ES, Jordaan A (2012) Transient gene expression assays in rose tissues using a bio-rad Helios® hand-held gene gun. S Afr J Bot 78:307–311

228

Yosvanis Acanda et al.

17. Ueki S, Magori S, Lacroix B et al (2013) Transient gene expression in epidermal cells of plant leaves by biolistic DNA delivery. Methods Mol Biol 940:17–26 18. Yamagishi N, Terauchi H, Kanematsu S et al (2006) Biolistic inoculation of soybean plants

with soybean dwarf virus. J Virol Methods 137:164–167 19. Levy A, El Mochtar C, Wang C et al (2018) A new toolset for protein expression and subcellular localization studies in citrus and its application to Citrus tristeza virus proteins. Plant Methods 14:2

Chapter 17 Methods for Producing Transgenic Plants Resistant to CTV Nuria Soler, Montserrat Plomer, Carmen Fagoaga, Pedro Moreno, Luis Navarro, Ricardo Flores, and Leandro Pen˜a Abstract Conventional breeding of citrus types demands a long-term effort due to their complex reproductive biology and long juvenile period. As a compelling alternative, genetic engineering of mature tissues allows the insertion of specific traits into specific elite cultivars, including well-known and widely grown varieties and rootstocks, thus reducing the time and costs involved in improving and evaluating them. Conventional breeding for resistance to CTV in citrus varieties has been largely unsuccessful as well as cloning of the genes conferring resistance to specific citrus types. RNA interference (RNAi), based on producing dsRNAs (usually using intron-hairpin constructs) highly homologous to specific CTV sequences to trigger RNA silencing, has been employed to produce virus-resistant transgenic citrus plants. The most successful construct has been an intron-hairpin vector carrying full-length, untranslatable versions of the genes p25, p20, and p23 from the virus. Using it, we have generated full resistance against CTV in Mexican lime. Moreover, this strategy is applicable to all those citrus varieties amenable to mature transformation, including sweet oranges, sour oranges, mandarins, Citrus macrophylla, and limes. Key words Citrus, In vitro culture, Genetic engineering, Mature tissue transformation, RNA silencing, Virus resistance

1

Introduction Conventional citrus breeding is a long-term endeavor due to the complex reproductive biology of most types. Most of them are facultative apomictic, some commercially important genotypes have total or partial pollen and/or ovule sterility and cannot be used as parents in breeding programs, and there are many cases of cross- and self-incompatibility. Additionally, citrus have a long juvenile period, and most types need at least 5 years to start flowering in subtropical areas and usually several years more to achieve fully mature characteristics. Citrus types have high heterozygosis, and there is a lack of basic knowledge about how the most important horticultural traits are inherited, some of which, as those related to fruit quality and maturity time, show quantitative inheritance. All these features, together with their large plant size, have

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5_17, © Springer Science+Business Media, LLC, part of Springer Nature 2019

229

230

Nuria Soler et al.

greatly delayed genetic improvement of citrus through conventional breeding. Genetic engineering allows the insertion, activation, deletion, or silencing of specific genes into the genetic background of elite varieties, theoretically adding desirable traits without affecting their already existing and favorable horticultural characteristics. Also, transformation procedures applied to adult material reduce the time and costs involved in improving and evaluating transgenic fruit tree cultivars. This is the case of important citrus genotypes, as sweet oranges, for which up to 20 years may be needed to lose the juvenile characters. Citrus tristeza virus (CTV), a member of the genus Closterovirus, family Closteroviridae, is the causal agent of devastating epidemics worldwide [1]. Most citrus genotypes are hosts for CTV, but there is an ample diversity in their response against viral infection, which depends on the genotype and CTV strain. Breeding for resistance to CTV in scion varieties has failed mainly due to their complex reproductive biology, as mentioned above. The only successful results in this respect are the hybrid rootstocks citranges [sweet orange (Citrus sinensis L. Osb.)
Poncirus trifoliata L. Raf.] and citrumelos [grapefruit (C. paradisi Macfad.)
P. trifoliata L. Raf.], widely used by the citrus industry owing to their resistance to CTV-induced decline and stem pitting. Although resistance to CTV has been mapped in P. trifoliata [2–4] and other citrus types, identification and cloning of the specific genes responsible of that trait have been ineffective so far. RNA interference (RNAi), an approach based on using dsRNA highly homologous to a target RNA sequence to trigger its silencing [5], has been exploited in plants by genetic transformation with sense and antisense cDNAs derived from the specific target viral sequences separated by an intron (intron-hairpin constructs) [6]. This strategy has been applied to different citrus types in our group with vectors carrying untranslatable versions of specific CTV sequences [7], our unpublished results. Among them, the construct harboring the full untranslatable versions of genes p25, p20, and p23 plus the 30 -UTR in sense and antisense orientation separated by an intron [Sense-Intron-AntiSense (SIAS)] has provided the best level of resistance against CTV achieved in citrus [8]. Citrus hosts have developed a strong antiviral response to CTV infection through RNA silencing, as inferred from the high accumulation of CTV-specific small RNAs present in infected cells [9, 10]. As a counter-defense, CTV encodes three silencing suppressor proteins (p25, p20, and p23), suggesting complex virus–host interactions in the course of infection [11]. Our approach has been based on blocking the expression of the CTV genes p25, p20, and p23 simultaneously in transgenic cells. Mexican lime (C. aurantifolia (Christm.) Swing.) was chosen as a citrus model in most of our studies because of its high sensitivity to CTV, with the potential

Transgenic Plants Resistant to CTV

231

resistance of transgenic plants being easily assessed by symptom observation, ELISA, qPCR, and RNA blots in the greenhouse within a year after challenge inoculation. In our laboratory, genetic transformation procedures have been applied to either juvenile or adult material of many different citrus types, including those showing high sensitivity to CTV (limes, C. macrophylla Wester, certain sweet oranges, etc.) as well as those showing different levels of resistance or tolerance (P. trifoliata, sour orange (C. aurantium L.), citranges, citrumelos, mandarins (C. reticulata Blanco; C. clementina Hort. Ex. Tan.), sweet oranges, etc.) [12]. The general procedure described here includes details about the preparation of the invigorated source plant material, the tissue culture conditions, and media required to shift citrus cells at the explants to a competent state for Agrobacterium-mediated transformation and regeneration, as well as the methods to generate whole transgenic plants by grafting first in vitro the regenerating shoots onto decapitated seedlings and later in the greenhouse on vigorous rootstocks as a high efficient alternative to shoot elongation and rooting. Methods for evaluating the transgenic nature of the regenerated plants, as well as analyzing resistance of the transgenic lines against CTV, are also described.

2 2.1

Materials General

1. Falcon tubes 50 mL. 2. Flasks. 3. Petri dishes. 4. Eppendorf tubes 1.5 mL. 5. Brush. 6. 25
125 mm glass tubes. 7. Test tubes (90 mm). 8. Pipettes. 9. Autoclave. 10. Sodium hypochlorite. 11. Tween 20. 12. Parafilm. 13. Tweezers and scalpel. 14. Sterile filter paper. 15. 0.2 μm membrane filters. 16. Ethanol (30%, 50%, 70%, 90%, 100%). 17. 1 M NaOH. 18. 1 N HCl.

232

Nuria Soler et al.

19. Aluminum foils. 2.2

Plants

1. For juvenile transformation: 12-month-old citrus seedlings grown in a temperature-controlled greenhouse for transgenic plants with 24–27/18–20  C day/night temperature and a relative humidity between 60 and 80%. 2. For mature transformation, plants propagated in the greenhouse (18–27  C) by grafting of buds from adult citrus trees on a vigorous rootstock, such as rough lemon (C. jambhiri Lush.) or C. volkameriana Ten. and Pasq (see Note 1). 3. For in vitro grafting: seedlings of Troyer citrange germinated in vitro on seed germination medium (SGM) and grown in the dark for 2 weeks (see Note 2). 4. For greenhouse grafting: seedlings of a vigorous rootstock, such as Carrizo citrange or rough lemon germinated in nursery and grown under greenhouse conditions (18–27  C) for approx. 5 months.

2.3 Tissue Culture Media and Components

1. Inoculation medium (IM) (pH 5.7). MS salts [13] (see Note 3), 100 mg/L myoinositol, 0.2 mg/L thiamine hydrochloride, 1 mg/L pyridoxine hydrochloride, 1 mg/L nicotinic acid (see Note 4), and 3% (w/v) sucrose. 2. Co-cultivation medium (CM) (pH 5.7): MS salts [13] (see Note 3), 100 mg/L myoinositol, 0.2 mg/L thiamine hydrochloride, 1 mg/L pyridoxine hydrochloride, 1 mg/L nicotinic acid (see Note 4), 3% (w/v) sucrose, 2 mg/L indole-3-acetic acid, 1 mg/L 2-isopentenyl-adenine, and 2 mg/L 2,4-dichlorophenoxyacetic acid (2,4-D) (see Note 5), 0.8% (w/v) agar. 3. Shoot regeneration medium (SRM) (pH 5.7): MS salts [13] (see Note 3), 100 mg/L myoinositol, 0.2 mg/L thiamine hydrochloride, 1 mg/L pyridoxine hydrochloride, 1 mg/L nicotinic acid (see Note 4), and 3% (w/v) sucrose. Add the hormones according to the citrus type used, for example, 1 mg/L benzylaminopurine (BAP) (see Note 5) for Mexican lime, 1 mg/L benzylaminopurine (BAP) plus 0.3 mg/L naphthalene-acetic acid (NAA) for sour orange, and 3 mg/L benzylaminopurine (BAP) plus 0.5 mg/L naphthalene-acetic acid (NAA) for navel sweet orange, 1% (w/v) agar. After the sterilization, add 100 mg/L kanamycin, 250 mg/L vancomycin and 250 mg/L cefotaxime (see Note 6). 4. Seed germination medium (SGM) (pH 5.7): MS salts [13] (see Note 3), 1% (w/v) agar. Cover the flask with aluminum foil, and melt the medium in an autoclave during 7 min, at 121  C. Distribute on 25
125 mm glass tubes, 25 mL of medium per tube, and cover the tubes with caps. Then, proceed to

Transgenic Plants Resistant to CTV

233

sterilization of the tubes with the medium in an autoclave during 15 min, at 121  C. 5. Micrografting medium (pH 5.7): MS salts [13] (see Note 3), 100 mg/L myoinositol, 0.2 mg/L thiamine hydrochloride, 1 mg/L pyridoxine hydrochloride, 1 mg/L nicotinic acid (see Note 4), and 7.5% (w/v) sucrose. Shake the flask and its contents gently by hand, and distribute on glass tubes, 25 mL of medium per tube. Prepare pieces of circular papers with the diameter a bit larger than that of the test tubes (90 mm), and make two small holes in the center of each. These pieces of paper should serve as brackets for the grafts. Insert the paper inside each tube and cover the tubes with caps. Then, proceed to the sterilization of the tubes with the medium and paper pieces in an autoclave during 15 min, at 121  C. 6. 5 mg/100 mL 2,4-dichlorophenoxyacetic acid (2,4-D) stock solution: dissolve in few drops of dimethyl sulfoxide (DMSO). Adjust volume with double-distilled water. Store at 4  C (see Note 5). 7. 5 mg/100 mL indole-3-acetic acid (IAA) stock solution (see Note 5). 8. 5 mg/100 mL 2-isopentenyl-adenine stock solution (see Note 5). 9. 5 mg/100 mL benzylaminopurine (BAP) stock solution: dissolve the powder in a few drops of 1 M NaOH. Complete final volume with double-distilled water. Store at 4  C (see Note 5). 10. 5 mg/100 mL naphthalene-acetic acid (NAA) stock solution: dissolve the powder in a few drops of 1 M NaOH. Complete final volume with double-distilled water. Store at 4  C (see Note 5). 11. 100 mg/mL kanamycin sulfate stock solution: dissolve 1 g of powder in 10 mL of double-distilled water. Sterilize by filtration through a 0.2 μm membrane, make 1 mL aliquots in sterile Eppendorf tubes, and store at 20  C (see Note 6). 12. 250 mg/mL cefotaxime stock solution: dissolve 1 g of powder in 4 mL of double-distilled water. Sterilize by filtration through a 0.2 μm membrane, make 1 mL aliquots in sterile Eppendorf tubes, and store at 20  C (see Note 6). 13. 250 mg/mL vancomycin stock solution (see Note 6). 2.4 Bacterial Strain and Vector

1. Bacterial strain: Agrobacterium tumefaciens EHA105, which is a disarmed derivative of A. tumefaciens A281 (see Note 7). This strain holds chromosomic resistance to nalidixic acid and rifampicin. 2. Binary vector: the T-DNA of the binary plasmid usually contains, apart from the expression cassette/s of interest, a

234

Nuria Soler et al.

selectable marker gene, such as neomycin phosphotransferase II (nptII), which confers resistance to kanamycin, and a reporter marker gene, such as β-D-glucuronidase (uidA) or green fluorescent protein (gfp), under the control of constitutive promoter and terminator sequences. The binary plasmid is introduced into Agrobacterium by electroporation (see Note 8). 2.5 Culture Media for A. tumefaciens

1. Luria broth (LB) medium: dissolve 20 g of LB medium (see Note 9) in 1 L of distilled water solution. Distribute 100 mL of the medium on 200 mL flasks, cover with aluminum foil, and proceed to the sterilization in an autoclave during 15 min, at 121  C. Before using it, add 25 mg/L each of kanamycin and nalidixic acid (or rifampicin) (see Note 6), under sterile conditions in a laminar flow cabinet (see Note 10). In the case of solid LB medium to be distributed in plates, transfer the LB solution to a 2 L flask, and add 1% (w/v) agar. 2. 100 mg/mL kanamycin sulfate stock solution (see Note 6). 3. 25 mg/mL nalidixic acid stock solution: dissolve 250 mg of powder in a few drops of 1 M NaOH, and then add water to complete 10 mL. Sterilize by filtration, make 1 mL aliquots in sterile Eppendorf tubes, and store at –20  C (see Note 6).

2.6

Other Solutions

1. Disinfection solution: To prepare 1 L of solution, add about 600 mL of distilled water to a 1 L glass, and add 2% (v/v) (stems) or 0.5% (v/v) (seeds) sodium hypochlorite plus 0.1% (v/v) Tween 20. Transfer the solution to a 1 L test tube, and make up to 1 L with water. Mix the solution in the 1 L glass with a magnetic stirrer. 2. X-Gluc (5-bromo-4-chloro-3-indolyl-beta-D-glucuronic acid) solution: 100 mM Tris–HCL buffer pH 7, 50 mM NaCl, 0.01% Triton X-100, 0.65 g/L potassium ferricyanide, and 10.41 g/L X-Gluc substrate (dissolved in 40 mL/L of dimethylformamide).

2.7

Equipments

1. Laminar flow cabinet. 2. Culture chamber allowing temperature, humidity, and illumination control. Standard conditions are fixed at 26  C, 60% relative humidity, and a 16-h photoperiod at 45 μEm2 s1 illumination. 3. Incubators allowing temperature control at 26–28  C. 4. Incubators allowing low irradiance (20 μmol m2 s1), 16-h photoperiod, 60% relative humidity, and 24  C. 5. Orbital shaker allowing temperature and speed control. 6. Spectrophotometer.

Transgenic Plants Resistant to CTV

235

7. Electroporator. 8. Stereomicroscope. 9. Stereomicroscope equipped with a 480/40 nm (460–500 nm) exciter filter, a 505 nm dichromatic beam splitter, and a 510 nm barrier to check GFP fluorescence.

3

Methods

3.1 Agrobacterium Preparation

Carry out the procedures with the bacterium under sterile conditions in a laminar flow cabinet. 1. From a stock of Agrobacterium cultured with the corresponding construct in a binary plasmid, take a loopful of bacteria, and streak in a Petri dish with solid LB medium plus kanamycin and nalidixic acid. Cultivate Agrobacterium during 48 h, at 28  C. 2. Sub-cultivate an isolated bacterial colony in 100 mL of liquid LB medium with kanamycin and nalidixic acid, during 48 h in an orbital shaker at 200 rpm and 28  C. Repeat sub-cultivation of an aliquot. 3. Read the absorbance (OD) at 600 nm in a spectrophotometer until the exponential growth reaches values between 0.4 and 0.8. Calculate bacterial concentration using the growth curve (see Note 11). 4. Pellet the bacterial culture at 1900
g for 10 min in 40 mL sterile centrifuge tubes with cap, discard the supernatant, and resuspend and dilute the pellet with IM to a concentration of approximately 3
107 cells/mL.

3.2 Plant Material Preparation

1. Cut stem pieces of about 20 cm in length, and strip them of leaves and thorns (see Note 12). 2. Rub the stem pieces with a brush in soapy water, and rinse with water. 3. Transfer the stem pieces to a 1 L test tube. Carry out the following procedures under sterile conditions in a laminar flow cabinet. 4. For disinfection, add the disinfection solution with sodium hypochlorite plus Tween 20, cover the test tube with Parafilm, shake it gently by hand several times during 10 min, and rinse three times with sterile distilled water. 5. Cut each stem piece transversely in internodal stem segments of 1 cm, using tweezers and small garden scissors (or scalpel) on sterile paper, and keep explants in sterile humid plates until all stem pieces have been prepared.

236

Nuria Soler et al.

3.3 Inoculation, Co-cultivation, and Selection

Carry out the following procedures under sterile conditions in a laminar flow cabinet, using sterile tweezers. 1. Place the internodal stem segments in sterile 100 mm diameter Petri dishes containing 15 mL of the bacterial suspension in inoculation medium, using sterile tweezers. 2. Incubate with gentle shaking for 15 min at room temperature. 3. Blot dry the infected explants on sterile filter paper (see Note 13). 4. Place the explants horizontally on 90 mm Petri dishes containing CM, and seal the plates with Parafilm. 5. Incubate for a 3-day co-cultivation period, under low irradiance (20 μmol m2 s1), 16-h photoperiod, 60% relative humidity, and 24  C. 6. After the 3-day co-cultivation period, transfer the explants to Petri dishes with SRM (10 explants per dish), at 26  C for 4 weeks under dark conditions (see Note 14). 7. Transfer the Petri dishes to 16-h photoperiod, 45 μmol m2 s1 illumination, 60% RH, and 26  C. 8. Transfer the explants to fresh SRM each 3–4 weeks. Any contaminated explant should be discarded.

3.4 Recovery of Whole Transgenic Plants

1. Shoots should develop from cambial callus at the cut ends of explants about 3–5 weeks after co-cultivation (see Fig. 1a). Screen the transgenic nature of the regenerated shoots according to the reporter marker included in the binary vector, β-Dglucuronidase (uidA), or green fluorescent protein (gfp): (a) Histochemical β-D-glucuronidase (GUS) assay: l

Cut a small piece of the regenerated shoot under sterile conditions. Perform a GUS assay incubating the plant material at 37  C in 2 mM X-Gluc solution, overnight [14]. After that, rinse the piece with 100 mM Tris–HCL buffer, pH 7, in order to stop the reaction.

l

Fix the tissue with 1% glutaraldehyde in the same buffer during 2–3 h.

l

Rinse three times with 100 mM Tris–HCl buffer, pH 7.

l

Rinse with ethanol dilutions (30%, 50%, 70%, 90%, 100%).

l

Examine the explants under a stereomicroscope, and select the shoots exhibiting blue color (see Fig. 1b).

(b) Testing green fluorescent protein (GFP) expression: l Examine under a stereomicroscope equipped with a GFP-Plus Fluorescence module. Select the shoots exhibiting bright green fluorescence (see Fig. 1c).

Transgenic Plants Resistant to CTV

237

Fig. 1 (a) Callus formation at the cut ends of explants; (b) after performing the histochemical β-D-glucuronidase (GUS) assay, each blue spot indicates a transgenic event at the cambial callus; (c) GFP-positive shoot exhibiting bright green fluorescence; (d) shoot grafted in vitro onto a Troyer citrange decapitated seedling

GUS- or GFP-negative shoots are considered as non-transformed or transgene silenced (see Note 15). 2. Graft in vitro apical portions of the GUS- or GFP-positive shoots onto decapitated seedlings of Troyer citrange (see Fig. 1d). Rootstock preparation is as follows: peel seeds, remove both seed coats, disinfect for 10 min in disinfection solution, and rinse three times with sterile distilled water. Sow individual seeds onto 25 mL aliquots of SGM contained in 25
150 mm glass tubes, and incubate at 27  C in the dark for 2 weeks. Decapitate seedlings leaving 1–1.5 cm of the epicotyls. Shorten the roots to 4–6 cm, and remove the cotyledons and their axillary buds, and insert the decapitated seedlings in one of the holes of the piece of paper leaving just the roots immersed in the SGM below the paper. Place the regenerated shoot onto the apical end of the cut surface of the decapitated epicotyls (see Note 16). 3. Culture grafted plants in micrografting medium, and maintain at 25  C, 16 h photoperiod, and 45 μEm2 s1 of illumination

238

Nuria Soler et al.

(see Note 17). Scions develop two to four expanded leaves 3–4 weeks after grafting. 4. Graft the in vitro grown plants onto vigorous rootstocks germinated in nursery and grown under greenhouse conditions (see Note 18). 5. Putative transgenic plants should be assayed by polymerase chain reaction (PCR) to detect the presence of the transgene (s) (see Note 19). Southern blot analyses must be performed to confirm the stable integration of the transgene(s), as well as the number of copies integrated in the genome. In the case of the intron-hairpin construction carrying full-length, untranslatable versions of the genes p25, p20, and p23 from CTV, analysis of the accumulation of transgene-derived siRNAs by northern blot is recommendable in order to determinate the siRNA accumulation levels derived from p25, p20, and p23 transgenes (see Note 20). 3.5 Virus Resistance Analyses

1. Propagate 10–20 buds from each transgenic line by grafting onto Carrizo citrange seedlings, and keep in a greenhouse at 24–26  C/16–18  C (day/night), 60–80% relative humidity, and natural light. 2. When new shoots are 30–40 cm long, graft-inoculate the homogeneous propagations from each transgenic line plus empty-vector and non-transgenic controls with two bark chips of 0.75–1 cm2 in size from a CTV-infected source plant (e.g., infected with CTV T36) (see Note 21). 3. Three months after challenge inoculation, remove one inoculum bark chipper challenged plant. Confirm the presence of the virus in the inoculum bark chip by RT-qPCR with specific primers [15]. 4. Evaluate virus accumulation in leaves by DAS-ELISA with the monoclonal antibodies 3DF1 + 3CA5 [16] and RT-qPCR in at least three consecutive flushes spanning over a 1-year period. A plant is considered CTV-infected when the absorbance at 405 nm is at least twofold that of non-inoculated controls in DAS-ELISA tests. 5. Monitor CTV symptoms in at least three consecutive flushes spanning over a 1-year period. Symptom intensity in Mexican lime can be rated on a 0–3 scale in which 0 indicates a complete absence of symptoms, 1 mild vein clearing, 2 moderate vein clearing with young leaf epinasty and adult leaf cupping/distortion, and 3 severe symptoms including vein corking and stunting (see Fig. 2).

Transgenic Plants Resistant to CTV

239

Fig. 2 (a, b) CTV symptoms in leaves and shoots from control Mexican lime lines graft-inoculated with (a) CTV-T36 and (b) CTV-T318a, showing vein clearing (top), vein corking (middle), and leaf distortion (bottom right) or epinasty (bottom left); (c) asymptomatic leaves and shoots from resistant transgenic Mexican lime lines carrying full untranslatable versions of genes p25, p20, and p23 plus the 30 -UTR in sense and antisense orientation separated by an intron

4

Notes 1. From these invigorated mature plants, it is recommended to use the newly elongated first flushes, in order to achieve the maximum transformation and regeneration frequency. 2. The seeds are peeled and put in small nets before the disinfection process, to facilitate manipulation. After 2 weeks in the dark at 27  C, the seedlings should be transferred to the refrigerator at 4–8  C to slow growth. They can be used within 15 days to a 1 month. 3. In order to make easier the preparation of the media, we usually maintain separate stock solutions of MS macroelements, microelements, and FeNa-EDTA. These stock solutions are maintained at 4  C, and check for contamination before each use. A

240

Nuria Soler et al.

convenient alternative is using commercial MS salts, weighed and presented in individual bags for 1 L. 4. We usually prepare a vitamin stock solution with the mix of thiamine hydrochloride, pyridoxine hydrochloride, and nicotinic acid at the proper concentration. This stock solution is maintained at 4  C and checked for contamination before each use. 5. The hormone stock solutions are maintained at 4  C and checked for contamination before each use. It is not recommended to maintain the hormone stock solutions more than 1 month. The concentration of auxins in CM can be increased slightly if no or low cambial callus is induced in the explants, depending of the citrus type used. Hormones in SRM could be added (NAA) or their concentration increased (BAP) if shoot regeneration from the cambial callus is insufficient, depending on the citrus type used. 6. Kanamycin is used for the selection of transgenic events, whereas vancomycin and cefotaxime to control bacterial growth. We prefer to make 1 mL aliquots of antibiotic solutions to avoid possible contaminations. In the case of tissue culture media, one or two full aliquots will serve to reach the final desired concentration for 1 L of medium. 7. Agrobacterium strain A281 was shown to be the most virulent in the infection of citrus types. This is the reason of using a disarmed derivative of A281 for our transformation experiments. 8. Bacterial resistance to kanamycin (or any other present in the corresponding binary plasmid), together with the chromosomic resistance of EHA105 to nalidixic acid (or rifampicin), is used to select the bacteria. As example of expression cassette with the aim of achieving resistance to CTV, the preferred strategy adopted was the transformation with an intron-hairpin vector carrying full-length, untranslatable versions of the genes p25, p20, and p23 from CTV strain T36 to silence the expression of these viral genes in CTV-infected cells [8].This expression cassette was cloned in a pCAMBIA binary vector, carrying the selectable marker gene neomycin phosphotransferase II (nptII) and the reporter marker gene β-D-glucuronidase (uidA). 9. Luria broth (LB) medium: 10 g/L of tryptone, 5 g/L of yeast extract, 10 g/L of NaCl, and pH 7.5. 10. The LB liquid medium can be maintained at RT and checked for contamination before each use. Before use, add the antibiotics to select for binary plasmid and Agrobacterium resistance.

Transgenic Plants Resistant to CTV

241

11. It is convenient to determine the growth curve (A600 vs. bacterial cell concentration) for the bacterial strain used in the transformation experiment. Bacterial culture should grow to the exponential phase to play all its infectious potential (A600 between 0.1 and 1.0 in the case of strain EHA105). 12. Flushes should be in a good ontological state, neither too tender (they would not bear Agrobacterium infection) nor too lignified, as to keep an acceptable regenerative potential. 13. We use sterile soft paper towels to help explants to dry. It is important to eliminate any bacterial liquid residue, as it can be a source of bacterial overgrowth during co-cultivation. 14. Culture of explants in the dark improves callus formation and the progress of transformation events to regenerate transgenic shoots. Four weeks in the dark is usually the most frequent period for callus formation, but it depends on the citrus genotype used. It is recommended to keep the explants in darkness until they develop a prominent visible callus formed at the cambial ring. 15. We must take into consideration that GUS- or GFP-positive explants could show different levels of expression, chimeric tissues, and false negatives (with gene silencing affecting to the reporter transgene). PCR analysis could provide accurate results, but it may also involve selection of regenerants with silenced transgenes. For a first screening, GUS and GFP are the most appropriate reporters. 16. For the in vitro grafting of long shoots (0.5–1 cm), cutting the basal end as a wedge and introducing it into a small longitudinal incision practiced on the upper part of the rootstock can also be helpful to facilitate vascular contact and success of the graft. 17. During development of the grafts, it is necessary to check them periodically and to remove, by using sterile small scissors, any shoot coming from the rootstock. The growth of other shoots could weaken the connection between rootstock and transgenic scion. 18. To ensure a rapid and successful acclimatization, it is important to follow good greenhouse practices. We recommend working with sterile potting substrate, vigorous seedlings, and keeping grafted plants in plastic bags that will be progressively opened over approximately 1 month. This will help to maintain optimal moisture and temperature and will facilitate a gradual process of acclimatization. 19. PCR analysis could be carried before grafting of the in vitro grown plants onto vigorous rootstocks in the greenhouse.

242

Nuria Soler et al.

After that process, PCR analysis could be repeated in order to assure the transgenic nature of each line after the in vitro growth. 20. The extent of transgene silencing is assessed by Northern blot analysis of siRNAs derived from p25, p20, and p23, with transformants of interest usually requiring high siRNA levels of the three transgene fragments. This strategy shows that targeting by RNAi the three viral silencing suppressors simultaneously is critical for developing transgenic resistance to CTV, although the involvement of other concurrent mechanisms cannot be excluded [8]. 21. Resistance to CTV of a transgenic Mexican lime line carrying an intron-hairpin construct is very much influenced by the sequence identity between the transgene and the challenging CTV strain used [8]. Moreover, CTV causes different symptoms depending on the strain used for challenge inoculation (see Fig. 2) [8]. References 1. Moreno P, Ambro´s S, Albiach-Martı´ MR et al (2008) Citrus tristeza virus: a pathogen that changed the course of the citrus industry. Mol Plant Pathol 9:251–268 2. Yoshida Y (1985) Inheritance of susceptibility to Citrus tristeza virus in trifoliate orange. Bull Fruit Tree Res Stn 12:17–25 3. Yoshida T (1993) Inheritance of immunity to Citrus tristeza virus of trifoliate orange in some citrus intergeneric hybrids. Bull Fruit Tree Res Stn 25:33–43 4. Gmitter FG, Xiao SY, Huang S et al (1996) A localized linkage map of the Citrus tristeza virus resistance gene region. Theor Appl Genet 92:688–695 5. Fire A, Xu S, Montgomery MK et al (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806–811 6. Smith NA, Singh SP, Wang MB et al (2000) Total silencing by intron-spliced hairpin RNAs. Nature 407:319–320 7. Soler N, Fagoaga C, Chiibi S et al (2011) RNAi-mediated protection against Citrus tristeza virus in transgenic Citrus plants. In: Erdmann V, Barciszewski J (eds) Non coding RNAs in plants. RNA Technologies. Springer, Berlin, Heidelberg 8. Soler N, Plomer M, Fagoaga C et al (2012) Transformation of Mexican lime with an intron-hairpin construct expressing untranslatable versions of the genes coding for the three

silencing suppressors of Citrus tristeza virus confers complete resistance to the virus. Plant Biotechnol J 10:597–608 9. Fagoaga C, Lo´pez C, Hermoso de Mendoza A et al (2006) Post-transcriptional gene silencing of the p23 silencing suppressor of Citrus tristeza virus confers resistance to the virus in transgenic Mexican lime. Plant Mol Biol 60:153–165 10. Ruiz-Ruiz S, Navarro B, Gisel A et al (2011) Citrus tristeza virus infection induces the accumulation of viral small RNAs (21–24-nt) mapping preferentially at the 30 -terminal region of the genomic RNA and affects the host small RNA profile. Plant Mol Biol 75:607–619 11. Lu R, Folimonov A, Shintaku M et al (2004) Three distinct suppressors of RNA silencing encoded by a 20-kb viral RNA genome. Proc Natl Acad Sci U S A 101:15742–15747 ˜ a L, Cervera M, Fagoaga C et al (2008) 12. Pen Citrus. In: Kole C, Hall TC (eds) Compendium of transgenic crop plants: tropical and subtropical fruits and nuts. Blackwell Publishing, Oxford, pp 1–62 13. Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassay with tobacco tissue cultures. Physiol Plant 15:473–479 14. Jefferson RA, Kavanagh TA, Bevan MW (1987) GUS fusions: b-glucuronidase as a

Transgenic Plants Resistant to CTV sensitive and versatile gene fusion marker in higher plants. EMBO J 6:3901–3907 15. Domı´nguez A, Hermoso de Mendoza A, Guerri J et al (2002) Pathogen-derived resistance to Citrus tristeza virus (CTV) in transgenic Mexican lime (Citrus aurantifolia

243

(Christ.) swing.) plants expressing its p25 coat protein gene. Mol Breed 10:1–10 16. Cambra M, Garnsey SM, Permar TA et al (1990) Detection of Citrus tristeza virus (CTV) with a mixture of monoclonal antibodies. Phytopathology 80:103

INDEX A Antibodies MCA13 ............................................................. 16, 106 monoclonal........................... 16, 55, 57, 98, 106, 237 polyclonal................................................................... 98 Aphid brown citrus aphid (Toxoptera citricidus) ....... 29, 143 capturing and identification...................................... 38 cotton aphid (Aphis gossypii) ................ 29, 30, 32, 40 identification........................................................38, 39 rearing aphid colonies ............................................... 40 RT-qPCR from aphids ........................................47, 48 total RNA extraction from aphids............................ 47 vector transmission ............................... 31, 32, 42, 43

B Bioinformatic analysis ...................................................121, 163–178, 182, 185–188, 190 pipelines .......................................................... 164, 172 software.................................................................... 111 tool.................................................................. 163–178 Biological indexing ............................. v, 55, 80, 122, 144

seedling yellows (SY-CTV) ................................15, 16, 19, 23, 67, 79, 121, 127, 151, 203 severe strain .................................................... 179, 197 stem pitting (SP-CTV) ............................................. 19 Closteroviridae family ........................................... v, 2, 7–9, 127, 143, 152, 195, 219, 230 Cross-protection .............................. 16, 25, 80, 179, 197 CTV strain characterization capillary electrophoresis-single-strand conformation polymorphisms (CE-SSCP) data analysis ......................................................... 97 primer design.................................................94, 95 multiple molecular marker (MMM) ...................... 129 phylogenetic markers ..................................... 180, 186 restriction fragment length polymorphism (RFLP) ................................................ 128, 180 single nucleotide polymorphisms (SNPs).......................................................... 175 single-strand conformation polymorphism (SSCP).................. vi, 80, 81, 89–94, 128, 180

E Electron microscopy ..................................................... 144

G

C cDNA fragments ..........................................v, 2, 80, 151–161 probes ...........................................................................v synthesis ............................................... v, 3, 36, 37, 45, 71, 72, 74, 80, 82, 88, 89, 107, 113, 153, 160 Citrus tristeza virus (CTV) complex.....................................................79, 219, 230 detection .....................................................v, 2, 43–48, 56, 57, 64, 82, 106, 128, 144, 164 diagnosis .............................................v, 2, 56, 57, 163 exotic isolates............................................................. 56 genome ...................................................... v, 105, 115, 127, 132, 143, 152, 153, 157–159, 164, 175, 177, 180, 186, 187, 201 genotypes...................................................16, 43, 106, 129, 134, 140, 152, 160, 180 interference..................................................... 195–204 mild strain....................................................... 152, 197 resistance breaking (RB) .......................... 15, 105–125

Gel electrophoresis agarose gel electrophoresis ................................82, 90, 91, 145, 147, 148 capillary electrophoresis ...................................... vi, 81, 83, 87, 88, 96 non-denaturing polyacrylamide gel preparation........................................ 83, 91–92 polyacrylamide gel electrophoresis....... vi, 91–92, 210 silver staining of SSCP gel ........................... 83, 92–93 SSCP gel analysis of electrophoretic patterns ....................................................93, 94 2D PAGE................................................................. 212

H Host plants alemow (C. macrophylla) ...................................16, 17, 21, 22, 25, 32, 43 citranges....................................................15, 230, 231 citron (C.medica) .................................. 17, 21, 22, 25

Antonino F. Catara et al. (eds.), Citrus Tristeza Virus: Methods and Protocols, Methods in Molecular Biology, vol. 2015, https://doi.org/10.1007/978-1-4939-9558-5, © Springer Science+Business Media, LLC, part of Springer Nature 2019

245

CITRUS TRISTEZA VIRUS: METHODS

246 Index

AND

PROTOCOLS

Host plants (cont.) citrumelo ..................................................15, 230, 231 Citrus excelsa ............................................................. 17 Duncan grapefruit (C. paradisi) .......................38, 49, 109, 122, 225, 230 Eureka lemon ............................................................ 23 Fortunella ...............................................................v, 15 lisbon lemon .............................................................. 23 Madam Vinous sweet orange (C. sinensis) ........................................... 38, 109 mandarin (C. reticulate) ................................ 127, 231 mexican lime (C. aurantifolia) .........................32, 33, 38, 49, 68, 109, 196–198, 201, 203, 230, 237, 239, 242 Poncirus trifoliata .................. 32, 105, 109, 196, 230 rough lemon (C. jambhiri) .......................16, 17, 232 sour orange (C. aurantium) ................................. 1, 2, 15–17, 19, 21–24, 38, 49, 109, 127, 144, 151, 196, 198, 201, 203, 231 trifoliate orange ................................................... vi, 15, 105, 122, 196, 201 volkameriana lemon (C. volkameriana)................... 17 Host RNA silencing ........................................ vi, 195–204

L Lab-on-chip (LoC) microarray hybridization.................................... vi, 127 optical detection...................................................... 137 primer and probe design................................ 132–135 Loop mediated isothermal amplification (LAMP)..............................144, 145, 147–150

M MicroRNAs (miRNAs) ..................................67, 197, 201

N Next generation sequencing (NGS) bioinformatic data analysis.....................163, 168–172 contig identification ....................................... 171, 176 de novo assembly .......................... 169–171, 174, 176 high throughput sequencing (HTS).........................vi, 115, 152, 163 Illumina Miseq technology............................ 179–193 raw data analysis and clean-up....................... 168–170 reads mapping ........................................171–173, 186 separation of low and high molecular weight RNAs ..............................110, 117–118 small RNA library construction ............................. 120 small RNA purification and sequencing ....... 115–121

P PCR amplification of large CTV cDNAs............... 156–159

asymmetric labeled RT-PCR .................................. 136 colony PCR ............................................................... 89 IC Nested RT-PCR................................................... 56 multiplex Real-Time RT-PCR............................73, 74 multiplex RT-PCR ......................................... 127, 140 overlapped-PCR ............................................. 153, 158 quadruplex RT-PCR ...................................... 134, 136 quantitative Real-Time RT PCR (RT-qPCR) .............................................37, 45, 47, 48, 69, 107, 108, 112, 122, 198, 237 reverse-transcription polymerase chain (RT-PCR) ............................................ v, vi, 45, 55–64, 71–77, 80, 81, 87–89, 95, 100, 107, 113–115, 127, 144, 152–155, 157, 172 Phenotyping, see Biological indexing Plant inoculation grafting and budding inoculation ...................... 17–19 graft inoculation ........................................... 21, 37, 48 growing plants........................................................... 42 leaf disc inoculation ............................................20, 21 leaf grafting..........................................................20, 21 leaf-piece graft ....................................................19, 20, 37, 42, 122 mechanical transmission .....................................18, 21 micro-grafting ................................................ 233, 237 seedling preparation .................................................. 18 soil and fertigation system ........................................ 42 symptom assessment ........................................... 22–23 testing cross protective isolates ................................ 21 Probe hybridization ...................................................... v, 129, 131, 132, 135, 203 TaqMan ....................................................... 46, 48, 59, 64, 68, 73, 76, 106, 112, 113 Protein expression ....................................................... 220, 223 extraction ........................................................ 211–214 host proteome analysis................................... 209–218 isoelectric focusing .................................................. 210 proteomic response ........................................ 209–218 separation of proteins..................................... 214–215 treatment of spots .......................................... 212, 215

R RNA double strands (ds)-RNA ...................................... 2, 3, 87, 92, 98, 164, 172, 197, 199, 203, 230 extraction/isolation ...........................................36, 37, 47, 82, 108–109, 115–117, 132, 145, 146, 148, 149, 153–156, 160, 166–168 interference (RNAi) ....................................... 230, 242 RNA silencing ..................................................... vi, 67, 68, 140, 195–204, 230 silencing suppressor ...................................67, 68, 202

CITRUS TRISTEZA VIRUS: METHODS S Sanger sequencing............................................... 172, 178, 182, 184, 185, 191 Serological assay DASI-ELISA ............................................................. 43 DTBIA .................................................................87, 89 enzyme-linked immunosorbent assay (ELISA)....................................................43, 55 immunocapture (IC)............................. 33, 45, 51, 56 virus release procedure after ELISA or DTBIA ........................................................... 87 Silencing suppressor proteins ................................ 67, 230 Small interfering RNA (siRNAs)........................ 115–117, 164, 172, 197, 202, 203, 220, 238, 242 Super-Infection exclusion, see Cross-protection

T Tissue print and squash ............................................55–64 Total nucleic acid (TNA) extraction ............................. 69, 72, 73, 106, 111 Transformation agrobacterium-mediated transformation ............... 231 biolistic bombardment................................................vi electroporation ........................................................ 234 Escherichia coli transformation ...................... 159, 160 green fluorescent protein (GFP) ............................ 234 Gus (beta-glucuronidase) ....................................... 202 intron-hairpin vector............................................... 240 mature tissue transformation.................................. 232

AND

PROTOCOLS Index 247

transgenic plants resistant to CTV ........... vi, 229–242 transient protein expression............................... vi, 220

V Viroid Apscaviroid ................................................................ 68 Citrus bark cracking viroid (CBCVd)...................... 68 Citrus bent leaf viroid (CBLVd) .............................. 68 Citrus dwarfing viroid (CDVd) ............................... 68 Citrus exocortis viroid (CEVd) ...................... v, 67–69, 71, 73, 74 Citrus viroid V (CVd-V)........................................... 68 Citrus viroid VI (CVd-VI) ....................................... 68 differentiation of HSVd variants ............................. 68, 71, 72, 74–77 Hop stunt viroid (HSVd) ................................ v, 68–77 Hostuviroid ................................................................ 68 Pospiviroid.................................................................. 67 viroid detection ................................................... 67–77 Virus beet yellows virus (BYV) .................................v, 2, 7, 11 Crinivirus .............................................................. 8–11 Grapevine leafroll-associated virus 2 (GLRaV-2).................................................8, 11 Grapevine leafroll-associated virus 7 (GLRaV-7).......................................... 8, 10, 12 plum pox virus (PPV) ................................................ 81 velarivirus ....................................................... 8, 10, 12