CBSE Class 12 LMP Last Minute Preparation System SCIENCE 9789356342927

Table of contents :
Cover
Title Cover
Copyright Page
Contents
Tips & Tricks
Physics
● Revision Notes & Mind Maps
● Board Sample Papers (Issued by Board on 16th Sep., 2022)
Chemistry
● Revision Notes & Mind Maps
● Board Sample Papers (Issued by Board on 16th Sep., 2022)
Mathematics
● Revision Notes & Mind Maps
● Board Sample Papers (Issued by Board on 16th Sep., 2022)
Biology
● Revision Notes & Mind Maps
● Board Sample Papers (Issued by Board on 16th Sep., 2022)
English Core
● Revision Notes & Mind Maps
● Board Sample Papers (Issued by Board on 16th Sep., 2022)

Citation preview

2023

HIGHLY RECOMMENDED HIGHLY RECOMMENDED

CBSE

LMP LMR

LAST MINUTE LAST MINUTE

REVISION SYSTEM

PREPARATION CLASS12 10 CLASS

SCIENCE STREAM

MATHS STANDARD Physics, Chemistry, Mathematics, Biology & English Core

The system you need to #WinTheBoards

1

2

3

4

5

100% Boards Ready

Fill Learning Gaps

Crisp Recap

Effective Retention

Final Boost

with Mind Maps

with Mnemonics

With Concept Videos

with CBSE Sample Paper for 2023 Exam Fully Solved

with Concise Revision Notes

(1)

1st edition

I SB N SYLLABUS COVERED

year 2022-23 "9789356342927"

CENTRAL BOARD OF SECONDARY EDUCATION DELHI

Published by OSWAAL BOOKS & LEARNING PVT. LTD.

COP YR IGHT

RE S ER V E D

1/11, Sahitya Kunj, M.G. Road, Agra - 282002, (UP) India

BY THE PUBLISHERS

All rights reserved. No part of this book may be reproduced, stored in a retrieval system, or transmitted, in any form or by any means, without written permission from the publishers. The author and publisher will gladly receive information enabling them to rectify any error or omission in subsequent editions.

1010, Cambourne Business Centre Cambridge, Cambridgeshire CB 236DP, United kingdom

0562-2857671

[email protected]

www.OswaalBooks.com

D ISC L A IMER This book is published by Oswaal Books and Learning Pvt Ltd (“Publisher”) and is intended solely for educational use, to enable students to practice for examinations/tests and reference. The contents of this book primarily comprise a collection of questions that have been sourced from previous examination papers. Any practice questions and/or notes included by the Publisher are formulated by placing reliance on previous question papers and are in keeping with the format/pattern/guidelines applicable to such papers. The Publisher expressly disclaims any liability for the use of, or references to, any terms or terminology in the book, which may not be considered appropriate or may be considered offensive, in light of societal changes. Further, the contents of this book, including references to any persons, corporations, brands, political parties, incidents, historical events and/or terminology within the book, if any, are not intended to be offensive, and/or to hurt, insult or defame any person (whether living or dead), entity, gender, caste, religion, race, etc. and any interpretation to this effect is unintended and purely incidental. While we try to keep our publications as updated and accurate as possible, human error may creep in. We expressly disclaim liability for errors and/or omissions in the content, if any, and further disclaim any liability for any loss or damages in connection with the use of the book and reference to its contents”.

Kindle Edition

LMP LMR Preface

Zig Ziglar rightly said- “You were born to Win, but to be a Winner, you must Plan to Win, Prepare to Win, and Expect to Win.” Oswaal Books presents its most formidable tool for the Board Exam Winner in you- LMP. LAST MINUTE PREPARATION (LMP) has been curated for each student to Win! Win over fear, Win over self doubt, Win over anxiety & above all win the Boards. We all know, last-minute revision can be as overwhelming as it is necessary. While everything seems important to revise at the eleventh hour, it is practically impossible to go through the entire book yet again. Taking cognizance of this dilemma and the underlying importance of revision in bolstering students’ confidence, LMP offer just the right mix of Exam Tools that you will require to get 100% Exam ready, just in time!! This book titled; Oswaal CBSE Last-Minute Preparation stands true to its name by providing students with everything they need to make their last-minute revision a piece of cake. What does LMP have in it to make you a Board Winner? • Latest CBSE Sample Paper for 2023 Exam to help students gain 100% understanding of the Expected Board Paper • Chapter-wise/Topic-wise Revision Notes to help recall the most important details of the topic studied. • Mind Maps to give a visual depiction of every nuance of the chapter thereby facilitating longer retention. • Mnemonics to enable quicker memorising of tricky concepts • Concept Videos to brush up concepts one last time We, at Oswaal books, are confident that every student who gets his hands on LMP, will surely emerge a Winner. For now is the time to Train and be a Winner rather than Complain and be a Looser!! We express our gratitude to the many teachers who have contributed to the book, for their experience and their knowledge. Their contributions will help our students gain valuable insights and knowledge and secure their dream marks in the board exams. All the best Students!! Go Win the Boards!! Team Oswaal

(3)

EXCLUSIVE SCHOOL BOOKS SUPPLIERS Sri Vikas Book Centre, 9848571114, 9440715700,

PUNE DHULE

Pravin Sales, 9890683475, Sai Shubham, 9975687687

ASSAM

JALNA

Anil Paper Mart, 9422722522, (02482) 230733

JHARKHAND

AGRA

KARNATAKA

CHENNAI

Bookmark-IT, 7305151653

HYDERABAD

Sri Balaji Book Depot , 9676996199, (040) 27613300,

KOLKATA WEST KEVVERY

United Book House, 9831344622 Schoolwale & Company, 9731715655

ANDHRA PRADESH

WEST KAMENG DEOGHAR

Sri Kanka Durga Book Stall, 9603491009

Dutta Book Stall, 8729948473 Bharti International, 06432359136, 9431132051

TUMKUR BANGLORE

Palasandra Promoters, 9448214377, (0816 ) 2273220 Sree byraveshawara book Depot, 9880561081,

INDORE

Adithi Distributor, 9229171880

KOLHAPUR

Ashish Book Depot, 7798420420

VISAKHAPATHAM

PORTBLAIR

GUWAHATI

PATNA

MADHUBANI PURNEA RAIPUR RAIGARH DELHI

MADHYA PRADESH MAHARASHTRA

AHMEDABAD

VAPI VALSAD NAVSARI SURAT ROHTAK BALLABGARH FARIDABAD BOKARO DHANBAD RANCHI

ANDAMAN & NICOBAR ISLAND

NASHIK

New India book House, 9623123458, 7448123456

Krishna Book Centre, 9474205570

NAGPUR

ASSAM

DHULE YAVATMAL

Laxmi Pustakalay and Stationers, (0712) 2727354, Vijay Book Depot, 9860122094, (0712) 2534217, Renuka Book distributor, 9765406133, Novelty Book Depot, 9657690220 Navjeevan Book Stall, 7020525561 Shri Ganesh Pustkalaya, 9423131275

BIHAR

Bokaro Student Friends, (0612) 2300600, 2618400, Gyan Ganga Ltd., 9304826651

CUTTACK BHUBANESHWAR

Nova Publisher & Distributors, (0612) 2666404, Shri Durga Pustak Mandir, 9334477386, Vikas Book Depot, 9504780402 Sharda Pustak Bhandar, 9334259293

BARIPADA KEONJHAR RAIGARH

Book Emporium, 9675972993, 6000763186, Ashok Publication, 7896141127 Kayaan Enterprises, (0361) 2630443, Central Book Agency, 99547107165, Orchid Book house, 9864624209

Krishna Book Agency, 9801019292

BRAHMAPUR

CHATTISGARH

PATIALA

Chaurasia book centre, 7004456102

Shri Ramdev Traders, 9981761797

JALANDHAR

DELHI

Mittal Books, (011) 23288887, 9899037390, Shyam Brother, 9313619935 Bokaro,Student Friends Pvt Ltd., 7004074900, R. D. Chawla & Sons, 9899445522 Golden Heart Emporium, (0832) 2725208, 9370273479

PUNE

AHMED NAGAR MUMBAI

Adarsh Entreprises, 9814347613

Cheap Book Store, 9872223458, 9878258592, City Book Shop, 9417440753 Gaurav Book World, 9478821183, Subhash Book Depot, 9876453625

RAJASTHAN

Vardhman Book Depot, 9571365020, Bhandari Stationers, 9001094271 J K Enterprises, 9460983939, 9414782130, Ravi Enterprises, 9829060694 Saraswati Book House, (0141) 2610823, 9829811155

TRIPURA

Mahavir Stationers, 9429474177

COIMBATORE CHENNAI

Goutam Book Sellers, 9081790813

College Store, 8141913750, 9825099121

Kazi Brothers, 7984880995, Shopping Point, 0261-2230097

HARYANA

Swami Kitab Ghar, 9255121948 Kashi Ram Kishan lal, 9289504004, 8920567245 Agarwal Book House, 9810657456

PUDUCHERRY

Bokaro Student Friends, (0654) 2233094, 7360021503

SALEM TRICHY

JHARKHAND

Bokaro Student Friends, (0326) 3590527

THENI

HYDERABAD SECUNDERABAD

Book Corner, 8794894165, 8984657146

TAMIL NADU

Majestic Book House, (0422) 2384333 Arraba Book Traders, (044) 25387868, 9841459105, M.R. Book Store (044) 25364596, Indian Book House, (044) 24327784, 9094129595, Kalaimagal Store, (044) 5544072, 9940619404, Vijaya Stores, 9381037417 Bookmark It-Books & Stat. Store, 7305151653, M.K. Store, 9840030099 Tiger Books Pvt. Ltd., 9710447000 Sri Saraswathi Book Stall, (04132) 222283, 9092626287 Pattu book centre, 9894816280 Rasi Publication, 9894816280

Maya Book Centre, 9443929274

TELANGANA

Sri Balaji Book Depot, (040) 27613300, 9866355473,

Central Book Shop, 9121152053, Shah Book House, 9849564564 Shraddha Books & Stationery, 9849451558

UTTAR PRADESH

Renuka Book Distributor, (0836) 2244124 Hema Book world, 8040105110, Krishna book house, 9739847334 Chaitanya Exhibition, 9886393971

ALLAHABAD AZAMGARH ALIGARH BAREILLY

Sparsh Book Agency, 9412257817, Manav Book world, 9358429663 Om Pustak Mandir, (0562) 2464014, 9319117771, Panchsheel Books, 9412257961, 9412257962, Mehrotra Book Agency, (0532) 2266865, 9415636890 Sasta Sahitya Sadan, 9450029674, Shree Pustak Vatika, 6392555866 K.B.C.L. Agarwal, 9897124960 Deepak Book store, 9837027416, Bunty Stationers, 9412048717

ETAWAH GORAKHPUR

Radhika Competition, 8923681800 Central Book House, 9935454590

JHANSI KANPUR LUCKNOW

Raj Book Dist., 9235616506

AGRA

Akshile Marketing, 9945891555

KERALA

Asad Book Centre, (0484) 2370431, 9447314548, Academic Book House, (0484) 2376613 Surya Book Centre, 9847238314, H & C Store, 9864196344, Surya Book House, 9847124217, 9847238314 Book Centre, (0481) 2566992 Academic Book House, (0471) 2333349, 9447063349, T.B.S. Publisher Distributors, (0471) 2570504 T.B.S. Publisher Distributors, 755982223 Aman Book Stall, (0495) 2721282,

MADHYA PRADESH

Agarwal Book Depot, 9425116210, Bharti Publishers and Distributors, 7000989901 Sushil Prakashan,(0731) 2503333, 2535892, 9425322330, Bhaiya Store, 9425318103

Vinay Pustak Sadan, 8962362667, New Radhika Book Palace, 9425411533-66 Vidya Sagar Stationery Mart, 9425451565

MEERUT MATHURA NOIDA RENUKOOT VARANASI

MAHARASHTRA

Bhanu Book Depot, 9415031340 Vyapar Sadan, 7607102462, Om Book Depot, 7705871398

Vidyarthi kendra Publisher & Distributor, 9554967415

Azad Book Depot Pvt. Ltd., 7317000250, Book Sadan, 9839487327, Universal Books, 8881093333, 7652043110

Ideal Book Depot, (0121) 4059252, 9837066307 Goyal Book Center, 9458766132, Prozo (Global Edu4 Share Pvt. Ltd), 9318395520 Goyal Books Overseas, (0120) 4655555, 9873387003 Om Stationers, 9838186991 Bokaro Student Friends, (0542) 2401250, 8299344607 Bookman & Company, 9935194495, Gupta Books, 9918155500

UTTARAKHAND

Natraj Book Depot, (020) 24485054, 9890054092, Vikas Book House, 9921331187, Sai Shubham, 9975687687, 9890043496, Pravin Sales, 9890683475, New Saraswati Granth Bhandar, 9422323859, Akshar Books & Stationary, 7385089789, Vandhaman

DEHRADUN

Educational, 9860574354 The Wisdom Store, 9822588775, 02025433344 Hira Stationers, 9423755472

Vidyarthi Sales Agencies, 9819776110, New Student Agencies, 7045065799, Shivam Books & Stationery, (022) 28230897, 9892935799

PUNJAB

Nakoda Book Depot, (01482) 243653, 9214983594

JAIPUR

KARNATAKA

INDORE JABALPUR SAGAR

Sindhu book Depot, 9425275763, 9981935763

Sibani Book Store, 8763340822

Perfect Stationers & Gen. Shoppe, 9829863904

AGARTALA

Adithya book house, 8606005600

Trimurti Book World, 9437034735

Students corner, 7008435418

BHILWARA

Patel Book, 9898184248, 9824386112, 9825900335

PERUMBAVOOR

A. K. Mishra Agencies, 9437025991, 9437081319 M/s Pragnya, 8847888616, 9437943777, Padmalaya, 9437026922

Bidyashree, 9937017070

KOTA

Shalibhadra Stationers, 9904477855, Zaveri Agency, 9979897312, 9979890330

Vasantha Book Stall, 9895072023

ODISHA

CHANDIGARH

GUJARAT

KOZHIKODE CALICUT KOLLAM

Granth the Book World, 9922295522

Gupta Brother, 988200206, Amit Book, 9815807871 Mahindra Book Depot, 9814920226

LUDHIANA

Sindhu Book Depot, 9425275763, 9981935763

Navyug Sahitya Mandir, 9334375509, 9431367981

GWALIOR

Shri Sharada Store & Stationers, 9000400069

WEST BENGAL

Yash Book House, 9637936999

DEOGHAR

KOTTAYAM TRIVANDRUM

TELANGANA

LATUR KOLHAPUR

DUMKA

ERNAKULAM

Maheshwari Pustak Bhandar, 9760602503

TAMIL NADU

OUR DISTRIBUTORS

Bokaro Student Friends, 9234628152, Gyan Ganga Ltd., 9117889900, Crown Book Distributor & Publishers, (0651) 2213735, 9431173904 Pustak Mandir, 9431115138, Jayshree Book House, 9431350775 Vidyanthi Pustak Bhandar, 9431310228

HUBLI BANGLORE BELLARY KARWAR

UTTAR PRADESH

JBD Educational, 9246632691, 9246633693

ANDHRA PRADESH

GOA GOA

Navjeevan Book Stall, 9422296434

Brother Pustak Bhandar, 9897833882

WEST BENGAL KOLKATA

COOCH BEHAR

(4)

Oriental Publishers & Distributor (033) 40628367, Katha 'O' Kahini, (033) 22196313, 22419071, Saha Book House, (033), 22193671, 9333416484, United Book House, 9831344622, Bijay Pustak Bhandar, 8961260603, Krishna Book House, 8420431083 S.B. Book Distributor, Cooch behar, 9002670771

1110

VIJAYAWADA

CONTENTS



7 - 7



Tips & Tricks

g

93 179

- 178 - 190

191 242

- 241 - 256

257 333

- 332 - 344

345

- 392

393

- 424





- 76 - 92



1 77





Revision Notes & Mind Maps Board Sample Papers (Issued by Board on 16th Sep., 2022)





l l



PHYSICS

Scan the QR Code to download the Syllabus of Physics











Revision Notes & Mind Maps Board Sample Papers (Issued by Board on 16th Sep., 2022)







CHEMISTRY

l l

Scan the QR Code to download the Syllabus of Chemistry

Scan the QR Code to download the Syllabus of Mathematics









Revision Notes & Mind Maps Board Sample Papers (Issued by Board on 16th Sep., 2022)







BIOLOGY

l l

Scan the QR Code to download the Syllabus of English Core

(5)





Board Sample Papers (Issued by Board on 16th Sep., 2022)





ENGLISH CORE

Revision Notes & Mind Maps



l



l



Scan the QR Code to download the Syllabus of Biology











Revision Notes & Mind Maps Board Sample Papers (Issued by Board on 16th Sep., 2022)







MATHEMATICS

l l

FEEDBACK Fantasc Book!

Looks Good!

Don't think too much. Just go for it. I think this is the best quesons bank for class 10. It covers all the topics with so many quesons.

My son says that this is an excellent book to revise important concepts with previous years ' queson papers

Krish Kumar Singh

Rajeev Veni

Apt for Students Oswal books is apt for students pursuing class 10th,as it's completely as per its latest sample papers released by the board.Very sasfied.Hoping for the best.

Shreena S.

Priya

With Latest Exam Pa ern and format Easy to understand! Studying chemistry is so easy with Oswaal. Easy to understand concepts with prac ce ques ons are given in this book.....Must buy this book…thank u so much Oswaal!

As we all know the exam pa€ ern is totally changed now. This book gives you all the previous year queson paper along with proper format of MCQ, VSQ, LQ and topicwise quesons. This book help you a lot.

Harsh Mondwal

Awesome Content The book content is awesome and best for the exam prepara on.' On ps notes' and Revision notes are good for last me exam prepara on.

Rishabh Gupta Helpful and Easy to use!

Latest CBSE pa ern based ques on and exercise is excellent. It is one of the best book in the market. Thanks for your best efforts. Congrats for your great achievements and success !

These sample ques on papers are very helpful! 5 of them are solved and the other 5 are unsolved. For the unsolved ones, we get hints. Apart from the sample ques on papers, there are also mindmaps for every chapter which would make it easy to revise. The books are in perfect condi on!

Abdul Asad

Ishranuu

Latest Pa ern

Simple Language & Visually Effecve! Just read this book and you will top in your exam with the best ques ons and best notes. It has all the necessary points and ques ons. This Colourful book with flowcharts makes it more interes ng as all the other publishers books were black & white making the readers gets bored

Manpreet Singh

(6)

LMP LMR

Oswaal Books Expert Tips & Tricks to Crack CBSE Board Exams

Curious to know how some of your friends remain calm and composed before an exam? What are the magic powers they possess or their secrets of peace and positivity? As they say, don't do different things rather they do things differently and that's what makes the difference we all want to achieve. Read any story of a successful journey or a journey of self-improvement and you would come across people emphasizing the importance of a positive attitude, extreme self-control, perseverance, and a sharp focus. We have tried to enlist a few more, simple yet extremely important ways in which you can create a mark for yourself and be at peace before an exam. Behold and be enlightened!

1

The Pomodoro Technique According to this very popular technique, the secret to effective time management is thinking in tomatoes rather than hours. The technique asks you to alternate focused study sessions with frequent short breaks to boost sustained concentration and keep off mental fatigue. Therefore, it is not important whether you study for 15 hours a day or 5 hours a day. The key mantra to success is being consistent.

Seek to Read Between the Lines CBSE Board now focuses on testing students' deep understanding of a concept and its application in real life. It is therefore important for you to decode the bigger picture of whatever you are trying to study and not just memorize.

3

The Power of Visualization Nothing beats the power of visualization while learning. You may use different colors of highlighters and colorful sticky notes to mark important topics or sentences. Also, with colorful cues and neat segregation, studying becomes a lot more fun.

Gather knowledge from Wherever Possible It's imperative you pay attention to all ways of preparation, be it school, coaching, or self-study, as everything has its importance and is a unique method of getting you ready for board exams.

5

2 4

The 3 Rs – Revise, Revise, Revise! The last month before the board exams should be entirely dedicated to revision and practice. While it may be a little impossible for you to revise the entire book completely, you may use tools like mnemonics, mind maps, and flashcards for quick and steady revision at the eleventh hour.

(7)

Be mindful. Be grateful. Be positive. Be true. Be kind Three things that make you special

Three people you are grateful for and why

Three simple things you are grateful for

A challenging experience that made you stronger

Three ways to inject gratitude into a current challenge

Describe the last time you did something nice for someone

A fear you have overcome

Three activities you enjoy most and why

What made you smile today?

Three things you love about your family

What is your favorite place, and why?

Three things you love most about yourself

The last time you were overcome with joy

A risk you are grateful you took and why

Three everyday items you are grateful for

Three songs that bring you joy

What skill do you have that you are grateful for and why?

One luxury you are thankful for

Describe a rejection you are grateful for

Three things about your body you are grateful for

What are you most grateful for in your daily life?

Three things you are grateful for about where you live

Three items in your home you are grateful for

Say thank you to someone

Something in nature you are grateful for

A person in your past you are grateful for

Something at school you’re grateful for

What is your proudest accomplishment?

Three things you want to manifest

Describe the last time you laughed so hard you cried

(8)

Physics

EXAM BITES

This Pdf Is Downloaded From www.exambites.in

Visit www.exambites.in for More Premium Stuffs,Latest Books,Test Papers,Lectures etc. jeeneetadda jna_official

jeeneetadda VISIT NOW !!

I

Unit- : electrostatics

1

electric charges and fields Electric Field and Dipole

Topic-1

Concepts Covered

 Electric charge,  Electrostatic charge,  Properties of electric charge, Coulomb’s law,  Principle of superposition,  Electric field,  Electric field lines,  Electric dipole,  Torque on a dipole,  Electric dipole moment,  Electric field due to dipole 

Revision Notes

Key Words lectric harge: Electric charge is the physical property of matter that causes it to experience a force when placed in an electromagnetic field. Friction: It is the opposing force. eutral metal: Metal having no net charge. C

































Electrostatic Charge Electrostatic charge means the charge is at rest. Electrostatic charge is a fundamental physical quantity like length, mass and time.

Charge on a body is expressed as q = ± ne The magnitude of charge is independent of the speed of the particle. Based on the flow of charge across them, materials are classified as: • Conductors: Allow electric charge to flow freely, e.g., metals. • Semi-conductors: Behave as the conductor or insulator depending on the number of free electrons and holes availability. e.g., silicon. • Insulators: Do not allow electric charge to flow, e.g., rubber, wood, plastic, etc. Net charge on a body is given by: • Charging by friction: Charging insulators • Charging by conduction: Charging metals and other conductors • Charging by induction: Wireless charging Charging by Rubbing On rubbing a glass rod and silk cloth piece together, glass rod gets positively charged whereas silk cloth gets negatively charged. If a plastic rod is rubbed with wool, it becomes negatively charged. Charging by Induction Charging by induction means charging without contact. If a negatively charged rod is brought near neutral metal with insulator mounting, it repels free electrons and attracts positive charges on metal.

E





Electric charge is the property of a matter due to which, it experiences a force when placed in an electromagnetic field. Scan to know more about Point charge is an accumulation of the this topic electric charges at a point, without spatial extent. Electrons are the smallest and lightest fundamental particles in an atom having negative charge as these are Electric Charges & Field surrounded by invisible field known as electrostatic field. Protons are comparatively larger and heavier than electrons with positive electrical charge which is similar in strength as electrostatic field in an electron with opposite polarity. Scan to know more about Two electrons or two protons will this topic tend to repel each other as they carry like charges, negative and positive respectively. The electron and proton will get Electric Field attracted towards each other due to their unlike charges. The charge present on the electron is equal and opposite to charge on the proton. Charge on a proton =+ 1.6 × 10–19 C and, charge on an electron = – 1.6 × 10–19 C

N



















Electric Charge

4

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

5























Principle of Superposition The force on any charge due to other charges at rest is the vector sum of all the forces on that charge due to the other charges, taken one at a time. The individual forces are unaffected due to presence of other charges. →

| q1 || q2 | r2

=















→



Electric field The space around a charge up to which its electric force can be experienced is called electric field.





→

Net force exerted on q3 is vector sum of F 13 and F 23



4 πK ' ε0

 

 

 

 









If a test charge q0 is placed at a point where electric field is E, then force on the test charge is F = q0E The electric field strength due to a point source charge ‘q’ at an observation point ‘A’ at a distance ‘r’ from the source charge is given by: →

The unit coulomb (C) is derived from the SI unit ampere (A) of the electric current.

E =





1 . q1 q 2 F= (medium) 4 πε0 εr r 2



 











 



e0 = Permittivity of vacuum or free space = 8.854 × 10–12 F/m K’ = Relative permittivity of medium or dielectric constant. For vacuum, relative permittivity, K’ = 1, As e = K’ e0, therefore the force of attraction/repulsion between two electric charges q1, q2 placed in the vacuum and medium will be: 1 . q1 q 2 F = (vacuum) and 3 4 πε0 r 2  











Force exerted by q2 on q3 = F 23

1 | q1 || q2 | 4πε0 r2

where, F = Force of attraction/repulsion between charge q1 and q2. q1, q2 = Magnitudes of charge 1 and charge2 respectively r = Distance between charges q1, q2 k = Constant whose value depends on 1 medium where charges are kept, k = 4 πε0 1 As e = K’e0, k =









→













F =k

Force exerted by q1 on q3 = F 13









 1 q1q2  1 q1q2  . r 21 r 12 and F21 = 2 4 πε0 r 2 4 πε0 r   ⇒ F21 = − F12

 F12 =





Current is the rate at which charge moves past a point dq or through a region, i = , hence 1 C=(1 A) × (1 s). dt The vector form of Coulomb force with r 12 = unit vector from q1 to q2 is given as:











If far end is connected to Earth by a wire, electrons will flow towards ground while positive charges are kept captive by the rod. When the rod is removed, the captive positive charge is distributed evenly. Properties of Electric Charge Addition of charges If a system contains three point charges q1, q2, and q3, then the total charge of the system will be the algebraic addition of q1, q2 and q3, i.e., charges will add up. q = q1 + q2 + q3 Conservation of charges Scan to know more about Electric charge is always conserved. this topic It is the sum of positive and negative charges present in an isolated system, which remains constant. Charge can neither be created nor destroyed in the process, but only Electric Dipole exists in positive-negative pairs. Quantization of charges Electric charge is always quantized i.e., electric charge is always an integral multiple of charge ‘e’. Net charge qnet of an object having Ne electrons, Np protons and Nn neutrons is: qnet = – eNe + eNp + 0Nn = e(Np – Ne) = ± ne Neutron (n): m = 1.675 × 10–27 kg; q = 0 Proton (p): m = 1.673 × 10–27 kg; q = +1.6 × 10–19 C Electron (e): m = 9.11 × 10–31 kg; q = –1.6 × 10–19 C Coulomb’s Law The force of attraction or repulsion between two point charges q1 and q2 separated by a distance r is directly proportional to product of magnitude of charges and inversely proportional to square of the distance between charges, written as:



Physics

1 . q → 1 . q r or E = 4 πε0 r 3 4 πε 0 r 2

Oswaal CBSE LMP (Last Minute Preparation), Class-XII







t = F dsin q = qE dsin q = pEsin q    τ = p×E d = 2a

•



• If q = 0o or 360o, dipole exists in stable equilibrium state. • If q = 180o, dipole exists in an unstable equilibrium state. In the uniform electric field, the dipole experiences torque, the net force on dipole is zero. In the uniform electric field, the dipole experiences a rotatory motion. In the non-uniform electric field, dipole experiences torque and net force. In the non-uniform electric field, dipole experiences rotatory and translatory motion. • The torque aligns the dipole with the electric field and it becomes zero. • The direction of the torque is normal to the plane going inward.

















Electric field lines Electric field lines are imaginary lines that originates from the positive charge and terminates at negative charge. Direction of electric field lines around positive charge is imagined by positive test charge q0 located around source charge.



















Electric field inside the cavity of a charged conductor is zero. If a charged/uncharged conductor is placed in an external field, the field in the conductor is zero. In the case of a charged conductor, electric field is independent of the shape of the conductor.





The unit of electric field is N/C.







6

Electric Dipole Moment

















Electric field has the same direction as force on the positive test charge. Electric field lines linked with negative charge are directed inward described by force on positive test charge q0. The electric field lines never intersect each other. Strength of electric field is encoded in density of field lines. Electric Dipole The system formed by two equal and opposite charges separated by a small distance is called an electric dipole.







Dipole moment is a vector quantity whose unit is coulomb-metre (Cm).   Dipole moment vector of electric dipole is p = q × 2 a between pair of charges q, –q, along the line, separated by distance 2a. Electric field due to a dipole







E=



1 . 2p (if a >a, total field at point P is

1 p 4 πε0 r 3

7

Physics

Topic-2

Gauss’ Theorem and its Applications Concepts Covered



Electric flux,  Continuous charge distribution,  Gauss’ theorem

Revision Notes Electric flux is proportional to algebraic number of electric field lines passing through the surface, outgoing lines with positive sign, incoming lines with negative sign.



q0

λ 

x





dr For linear charge distribution (l), F = 4 πε0 ∫ r 2 (Where, l = linear charge density)

∫

s

σ r2

dSr

∫

V

ρ r2

dV r

Gauss' theorem

The net outward normal electric flux through any closed surface of any shape is equal to 1/e0 times to net charge enclosed by the surface.





Continuous Charge Distribution It is a system in which the charge is uniformly distributed over the material. In this system, infinite number of charges are closely packed and have minor space among them. Unlike the discrete charge system, the continuous charge distribution is uninterrupted and continuous in the material. There are three types of continuous charge distribution system.

 q For volume charge distribution (ρ), F = 0 4πε 0 (Where, = volume charge density) r











Due to arbitrary arrangement of electric field lines, electric flux can be quantified as fE=EA If vector A is perpendicular to the surface, magnitude of vector A parallel to electric field is Acos q AII = A cos q fE = EAII = EAcos q In non-uniform electric field, the flux will be fE=∫E.dA

 q For surface charge distribution (s), F = 0 4πε 0 (Where, s = surface charge density)







Electric Flux

The electric field flux at all points on Gaussian surface is φ = E ∫ dA =

q . ε0

Mnemonics Concept: Characteristics of Electric field lines Mnemonic: India Starts Playing Night Cricket Tournament Daily with New Inspiration. Interpretation:

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

If there is a positive flux, net positive charge is enclosed. If there is a negative flux, net negative charge is enclosed. If there is zero flux, no net charge is enclosed. The expression for electric field due to a point charge q on Gaussian surface is E = 4 πε0 r 2





Electric flux through a Gaussian surface: φ = qenc Gauss’s Law: φ = ε0

∫ E.dS

Electric Field due to an infinite line of charge: 2kλ λ E= = 2 πε 0 r r where, E = electric field [N/C], l = charge per unit length [C/m]

λ  n, which depends on distance from wire, E = 2 πε0 r →

e0 = permittivity of free space = 8.85 × 10–12 [C2/N m2], r = distance (m), k = 9 × 109 Nm2C–2





where, l is linear charge density.

Closed surface: It is a surface which divides the space inside and outside region, where Scan to know more about one can’t move from one region this topic to another without crossing the surface. Gaussian surface: It is a hypothetical closed surface having similar symmetry as problem on which we Gauss Theorem are working. Electrostatic Shielding: It is the phenomenon of protecting a certain region of space from external electric field. Dielectric: The non-conducting material in which charges are easily produced on the application of electric field is called dielectric. e.g., air, H2 gas, glass, mica, paraffin wax, transformer oil, etc.

Electric flux through an area A: f = E.A = EAcos q





In an insulating sheet, the charge remains in the sheet, σ so electric field, E = 2ε0 Gauss theorem works in cases of cylindrical, spherical and rectangular symmetries. The field outside the wire points radially outward

Torque on an electric dipole placed in an electric field, τ = pE sin θ























8

Electric field due to a ring at a distance x is:













E=

(

)

3/2

When, x>>>r: E =

1 . q 4 πε0 x 2

When xa ) axis: E = 4 πε0 r 3 Electric field due to a dipole at a point on an 1 .p (r >>>a ) equatorial plane: E = 4 πε0 r 3

where, E = electric field [N/C]



=



r

2



s = charge per unit area [C/m2]



e0 = 8.85 × 10–12 [C2/Nm2] x = distance from charge [m] R = radius of the disc [m]



kq





E=





where all alphabets have their usual meanings.





Key Formulae

 σ n Electric field due to a thin infinite sheet: E = 2 ε0

electrostatic potential and capacitance



2

Topic-1

Electric Potential Concepts Covered Electric potential, potential difference, equipotential surfaces. Electrical potential energy of system of two point charges and of electric dipole.

Revision Notes between A and B is given by,

Scan to know more about this topic







It is written as

B

→ →

B

B

A

A

∆V = VB − VA = − ∫ E . dl = − ∫ Edl cos0° = − E ∫ dl A







Electric potential Electric potential is the amount of work done by an external force in moving a unit positive charge from infinity to a point in an electrostatic field without producing an acceleration.

Electric Potential

W V= q

The SI units of electric potential are

J Nm . , Volt, C C

where, E is the field due to a point charge, dI = dr, so that,



rB

VB − VA = − ∫





Potential difference Electric potential difference is defined as the amount of work done in carrying a unit charge from one point to another in an electric field. Electric potential difference Work ∆PE W = = = Charge Charge q Between two points A and B, WAB = – VAB × q where, VAB = VB – VA is potential difference between A and B. In a region of space having an electric field, the work done by electric field dW, when test charge q, is displaced by a distance dI, then,









where, W = work done in moving charge q through the field, q = charge being moved through the field.

r

q 1 1 1 B  r  = 4 πε  r − r    rA 0  B A



If rB = ∞, then VB = 0 so,







rA

q . dr q = 2 4 πε 0 r 4 πε 0

A







E











Electric Potential

Due to Point where, e0 is absolute electrical Charge permittivity of vacuum (free space). lectric potential is a scalar quantity. Dimension of Electric potential is [M L2T–3A–1]. For a single point charge q, the potential difference



→

1 . p .r 1 . p cos θ = ( r >> a ) given by, V = 4 πε 0 r 2 4 πε 0 r2



Scan to know more about this topic





Electric potential due to point charge The electric potential by point charge q, at a distance r from the charge, can be written as, 1 q VE = · 4 πε 0 r



→ →



B

= − ∫ E . dl



WAB =−A q q



∆V = VAB = VB − VA = −

→ →

∫ q E . dl





B

l

→ →

dW = q E . dl

1 . q kq = 4 πε 0 rA rA

Dipole and system of charges Electric dipole consists of two equal but opposite electric charges which are separated by a certain or least distance. The net potential due to a dipole at any point on its equatorial line is always zero. So, work done in moving a charge on an equatorial line is always zero. Electric potential due to dipole at a point at distance r and making an angle q with the dipole moment p is l







VA =

Potential at a point due to system of charges is the sum of potentials due to individual charges. In a system of charges q1, q2, q3, …qn having positive vectors r1, r2, r3,…..rn relative to point P, the potential at point P due to total charge configuration is algebraic sum of potentials due to individual charges, so,

10

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

11

1 n qi ∑ 4 πε0 i =1 ri

It is known that in a uniformly charged spherical shell, electric potential outside the shell is given as: 1 .q V= (r ≥ R ) 4 πε0 r











V=



Physics

qn  1  q1 q2 q3  + + + .... +  πε r r r rn  4 0 1 2 3



=

where, q is the total charge on shell and R is the shell radius.





V = V1 + V2 + V3 + ….. + Vn

Key Words E

lectric potential: The amount of work needed to move a unit charge from a reference point to a specific point against an electric field. Dipole: A pair of equal and oppositely charged or magnetized poles separated by a certain distance.







Equipotential surfaces Equipotential surface is a surface in space on which all points have same potential. It requires no work to move the charge on such surface, hence the surface



l

Potential energy due to single charge in an external field:

Potential energy of a charge q at a distance r in an external field, →



U = qV ( r ) →



Here, V ( r ) is the external potential at point r.

Potential energy due to two charges in an external field, l













→

will have no electric field, so E will be at right angle to the surface. Work done in moving a charge over equipotential surface is always zero. Electric field is always perpendicular to the equipotential surface. Spacing among equipotential surfaces allows to locate regions of strong and weak electric field. Equipotential surfaces never intersect each other. If they intersect then the intersecting point of two equipotential surfaces results in two values of electric potential at that point, which is impossible.

→

→

1 q1q2 . 4 πε0 r12



U = q1V ( r1 ) + q2V ( r2 ) +



l

Potential energy of a system of two charges, 1 q1q2 4 πε0 r12

l





Potential energy of a dipole in an external field:



U=

When a dipole of charge q1 = + q and q2 = – q having





U=

  1  q1q2 q1q3 q2 q3  + + → → 4 πε 0  r→ r13 r23   12



l



Potential energy of a system of three charges,



→

separation '2a' is placed in an external field ( E ). U(q) = –pEcos q Here, p = 2aq and q is the angle between electric field and dipole.

12

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Topic-2

Capacitance Concepts Covered Dielectrics, electric polarization, capacitor and capacitance, combination of capacitor, energy stored in capacitor.

Revision Notes Key Word



E

lectric polarization: It is the separation of center of positive charge and the center of negative charge in a material. The separation can be caused by a sufficiently high electric field.



80

-

In dielectric, polarization and production of induced charge takes place when dielectric is kept in an external electric field.

































Scan to know more about this topic

What is Capacitance?











Where, stat-Farad is electrostatic unit of capacitance in C.G.S. system Capacitance of a conductor depends on size, shape, medium and other conductors in surrounding. Parallel plate capacitor with dielectric among its plates has capacitance which is given as: A C = κε0 , d where, e0 = 8.85 × 10−12 F/m















Water



14



5.6



Pyrex Glass



16



3.7



1.00059

Paper



Air

Dielectric strength (106 V/m) 3

Capacitor having capacitance of 1 Farad is too large for electronics applications, so components with lesser values of capacitance such as µ (micro), n (nano) and p (pico) are applied such as:

Dielectric Constant (k)

Capacitance Capacitance of a capacitor is ratio of magnitude of charge stored on the plate to potential difference Q between the plates, written as C = . DV where, C = capacitance in Farads (F), Q = charge in Coulombs (C), ΔV = electric potential difference in Volts (V), SI unit of capacitance is Farad (F) 1C = 9 × 1011 stat Farad, 1F= 1V











Material

Electric polarization Electric polarization P is the difference between electric fields D (induced) and E (imposed) in dielectric D−E due to bound and free charges written as P = 4π c In term of electric susceptibility: P = eE In MKS: P = e0ceE, The dielectric constant k is always greater than 1 as ce >0



Q = CV where, C = Capacitance of capacitor, V= potential difference between the plates In capacitor, energy is stored in the form of electrical energy, in the space between the plates.









Electrical displacement or electrical flux density, D = ere0E. where, er= Electrical relative permittivity, e0 = Electrical permittivity of free space and E is electric field. If a dielectric is kept in between the plates of capacitor, capacitance increases by factor ‘k’ (kappa) known as A dielectric constant, so C = κε 0 d where, A = area of plates k = dielectric constant of material is also called relative ε permittivity κ = ε r = ε0

Capacitor A capacitor is a device which is used to store charge. Amount of charge ‘Q’ stored by the capacitor depends on voltage applied and size of capacitor. Capacitor consists of two similar conducting plates placed in front of each other where one plate is connected to positive terminal while other plate is connected to negative terminal. Electric charge stored between plates of capacitor is directly proportional to potential difference between its plates, i.e.,











Conductors and insulators Conductors are the materials through which charge can move freely. Examples: Metals, semi-metals as carbon, graphite, antimony and arsenic. Insulators are materials in which the electrical current does not not flow easily. Examples: Plastics and glass. Dielectrics These are the materials in which induced dipole moment is linearly proportional to the applied electric field.

Physics

PREFIX

13

MULTIPLIER

µ

10–6 (millionth)

1 µF = 10–6 F

n

10–9 (thousand-millionth) 1 nF = 10–9 F

p

10–12 (million-millionth)

1 pF = 10–12 F

Combination of capacitors in series and parallel







1 1 1 + 1 + 1 + ………………. = Cs C1 Cn C2 C3











Capacitors in series (i) If a number of capacitors of capacitances C1, C2, C3, .................. Cn are connected in series, then their equivalent capacitance is given by: while the charge on different capacitors may be different. If q1, q2, q3, .............., qn be the charges on the different



As potential drop across each capacitor is same, so











In series, potential difference across largest capacitance is minimum. The equivalent capacitance in series combination is less than the smallest capacitance in combination.



1 C

Capacitance of parallel plate capacitor with and without dielectric medium between the plates Parallel plate capacitor is a capacitor with two identical plane parallel plates separated by a small distance where space between them is filled by dielectric medium. The electric field between two large parallel plates is given as:























µ

The charges on capacitors are directly proportional to capacitances, i.e., q µ C Parallel combination is useful when large capacitance with large charge gets accumulated on combination. Force of attraction between parallel plate capacitor 1  QV  1 will be F =  QE where Q is charge on =  2 d  2 capacitor.

E=

σ , ε0







V

q q1 = q2 = q3 = …….. = n C C1 n C2 C3











q1= q2 = q3 ………….. qn = q If V1, V2, V3, .........., Vn be the potential differences across the capacitors and V be the emf of the charging battery, then V = V1 + V2 + V3 + ............. + Vn As charge on each capacitor is same, therefore q = V1C1 = V2C2 = V3C3 ............. the potential difference is inversely proportional to the capacitance, i.e.,





In series combination, the charge on each capacitor is same, but the potential difference on each capacitor depends on their respective capacitance, i.e.,



Þ V=





capacitors, then q1 + q2 + q3 +….……….. + qn = VCp

(i) If a number of capacitors of capacitances C1, C2, C3................Cn are connected in parallel, then their equivalent capacitance is given by, Cp = C1 + C2 + C3 +................ + Cn







In parallel combination, the potential difference across each capacitor is same and equal to the emf of the charging battery, i.e.,

V1= V2 = V3 = …………… = Vn = V















Capacitors in parallel

Where, s = charge density and e0 = permittivity of free space

14





Surface charge density, Q , A where, Q = charge on plate and A = plate area



Oswaal CBSE LMP (Last Minute Preparation), Class-XII



C=

ε0 A

t d−t+ κ

=

ε0 A  1 d − t 1 −   κ

When there is no medium between the plates, then k ε A =1, so Cvacuum = 0 d Capacitance of spherical conductor of radius R in a medium of dielectric constant k is given by,

A d



C = εr ε0





Capacitance of parallel-plate capacitor with area A separated by a distance d is written as









σ=

When space between the plates is partly filled with medium of thickness t and dielectric constant k, then capacitance will be:

C = 4pe0kR





Energy stored in capacitor In capacitor, energy gets stored when a work is done on moving a positive charge from negative conductor to positive conductor against the repulsive forces. 1 Q2









Where, d = t1 + t2 + t3 + ..... If slab of conductor of thickness t is introduced between the plates, then



C=

ε0 A d −t





ε0 A ε0 A C = t (d − t) = t (d − t ) + + κ 1 ∞ 1 ( k = ¥ for a conductor)

When the medium between the plates consists of slabs of same thickness but areas A1, A2, A3,... and dielectric constants k1, k2, k3..., then capacitance is given by ε0 ( κ1 A1 + κ 2 A2 + κ3 A3 ....) d Cm Capacitance in medium = \k= C0 Capacitance in vacuum

C=





1

Polar atom: Atom in which positive and negative charges possess asymmetric charge distribution about its centre. Polarisation: The stretching of atoms of a dielectric slab under an applied electric field. Dielectric strength: The maximum value of electric field that can be applied to dielectric without its electric breakdown. Dielectric: It is an electrically insulated or nonconducting material considered for its electric susceptibility. Permittivity: It is a property of a dielectric medium that shows the forces which electric charges placed in medium exerts on each other. OR It is the measure of resistance that is encountered when forming an electric field in a particular medium. More specifically, permittivity describes the amount of charge needed to generate one unit of electric flux in a particular medium.

Mnemonics

































ε0 A t1 t2 t3 + + + .... κ1 κ 2 κ 3





C=













If a dielectric slab is placed in between the plates of a capacitor, then its capacitance will increase by certain amount. Capacitance of parallel plate capacitor depends on plate area A, distance d between the plates, medium between the plates (k) and not on charge on the plates or potential difference between the plates. If we have number of dielectric slabs of same area as the plates of the capacitor and thicknesses t1, t2, t3,.... and dielectric constant k1, k2, k3...... between the plates, then the capacitance of the capacitor is given by

1

2 U = 2 C = 2 QV = 2 CV

Concept: Characteristics of equi-potential surface Mnemonics: Exclusive peace and No war; Noble India is super power Interpretations: Exclusive peace: Electric field is perpendicular to the surface No war: No Work is done on moving a charge on the surface Noble India: Never Intersects Super Power: Same potential everywhere on the surface

Physics

15











Key Formulae W , measured in volt; 1 volt = 1 Joule / coulomb. q ∆U W Electric potential difference or “voltage” ( ∆V ) = V f − Vi = . = q q Electric Potential, V =

Electric potential due to a point charge q at a distance r away: V =





f

→

1 q · 4 πε0 r

→

Finding V from E: Vf – Vi = – ∫ E .d S

Capacitance, C =







C = 2pke0



Cylindrical capacitor:







A d

C = ke0





q1q2 4 πε0 r12

L ln( b / a )

where, L = length, b = radius of the outer conductor, a = radius of the inner conductor. Spherical capacitor:



 ab  C = 4pk e0   b-a where, b = radius of the outer conductor, a = radius of the inner conductor Maximum charge on a capacitor: Q = VC For capacitors connected in series, the charge Q is equal for each capacitor as well as for the total equivalent. If the dielectric constant k is changed, the capacitance is multiplied by k, the voltage is divided by k and Q is unchanged. In vacuum, k = 1 and when dielectrics are used, replace e0 with k e0. Electrical energy stored in a capacitor: [Joules (J)]

Q2 CV 2 QV = = 2C 2 2

Surface charge density or Charge per unit area: [C/m2]







UE=









 q1q2     r12 

Q , measured in Farad; 1 F = 1 coulomb/volt V

Parallel plate capacitor:















1 4 πε0

Potential energy of two point charges in presence of external electric field: q1V ( r1 ) + q2V ( r2 ) +





Potential energy of two point charges in absence of external electric field: U =





i



s=

q A



U=











1 E = e0 E2 2 A×d







Energy density: • Electric energy density is also called Electrostatic pressure. • Electric force between plates of capacitor, 1 F = e0 E2·A 2 • Energy stored in terms of Energy density,

1 e0 E2 2

















where, U = energy per unit volume [J/m3], e0= permittivity of free space, = 8.854 × 10–12 C2/Nm2, E = energy [J] • Capacitors in series: 1 1 1 = ... + Ceff C1 C2 • Capacitors in parallel: Ceff = C1 + C2...

u

II

Unit- : c rrent electricity

3 Topic-1

E

C

urrent lectricity Electric Current & Cells Concepts Covered

 Electric current,  drift velocity,  Ohm’s law,  V-I characteristics, Resistivity and conductivity,  Temperature dependence of resistance,  Cells and their combinations.

















Electrical resistivity and conductivity Resistivity is the specific resistance that is given by the conductor having unit length and unit area of crosssection. m ne 2 τ

Conductivity is the reciprocal of resistivity shown as :





ρ=

σ=

1 ne 2 τ = ρ m







I=







or

1 V R

Ohm's law







or V = IR where, R = resistance of conductor V-I characteristics (linear and non-linear) V-I characteristic curves show the relationship between the current flowing through an electronic device and applied voltage across its terminals.

When electric current is set up in a conductor, electrons drift through the conductor with velocity vd, is given as I vd = or I = neAvd neA











Ohm’s law The flow of current through conductor is directly proportional to the potential difference established across the conductor, provided other physical conditions remain constant. or, Iµ V Scan to know more about this topic or, I = GV 1 Here, G= R













e τE / m e τ = E m





or m =





where, I = Electric current through conductor, n = Number of free electrons per unit volume, A = Area of cross-section, e = Charge of electron Drift velocity of electrons under ordinary conditions is of the order of 0.1 mm/s. Mobility is the drift velocity of an electron when applied electric field is unity. v Mobility, µ = d E























Conventional current in an external circuit flows from positive terminal to negative terminal. Free electrons flow from the negative terminal to the positive terminal in the external circuit. 1 Ampere current = 6.25 × 1018 electrons flowing per second. Direct current is unidirectional flow of electric charge. Flow of electric charges in metallic conductor When an electric field is applied to a metal at certain points, free electrons experience force and start moving. Without external applied electric field, free electrons will move randomly through metal from one point to other giving zero net current. Motion of conducting electrons in electric field is a combination of motion due to random collisions. Drift velocity, mobility and their relation with electric current Drift velocity is an average velocity which is obtained by certain particles like electrons due to the presence of electric field. Drift velocity is written as :  eE  vd = − τ m λ where, relaxation time, τ = , v here e = charge, m = mass, λ = mean free path



When charge flows at a constant rate, the corresponding q electric current can be written as : I = t









Electric current Electric current is defined as the rate of flow of charge, dq across the cross section of conductor i.e., I = dt



Revision Notes

Physics

17

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



Power is the work done per unit time which is the rate of energy consumed in a circuit. W P= t







Linear V-I Characteristics A linear V-I curve has a constant slope and hence a constant resistance. Carbon resistors and metals obey the Ohm's law and have a constant resistance. This means that the V-I curve is a straight line passing through the origin.



18

W , q q P = V = VI t

Since, Voltage V = So

V2 R

P = I 2 R or

 q Here, I =  t 



or







E = V × i × t = i2 × R × t =

V2 ×t R

where, E = Electrical energy, V = Potential difference, t = Time taken, i = Current, R = Resistance The SI unit of energy is Joule (J).

∆

 

 

 























E = V + Ir E−V ⇒ I= r So V = E – Ir ∴ V < E. (if there is flow of current) When current is drawn from a cell, its terminal potential difference is less than the emf. Combination of cells in series and parallel (i) Series combination of cells : This combination is used when an external resistance (R) of the circuit is much larger as compared to the internal resistance (r) of the cell i.e., R>>r Let n cells, each of emf E and internal resistance r be connected in series across an external resistance R, then the current in the circuit will be









Note that in the graph above, we can also see the maximum forward and reverse voltage in which the diode can be operated without causing breakdown and burning up of the diode. Electrical energy and power Electrical energy due to conduction of charged particles in a conductor causing electric current (i) is given as

 

 

 

















An electronic component may exhibit linear characteristic only in a particular region. For example, a resistance shows linear behaviour mostly in its operating region. Non-linear V-I Characteristics A circuit component has a non-linear characteristic if the resistance is not constant throughout and is some function of voltage or current. The diode, for example, has varying resistance for different values of voltage. However, it has linear characteristic for a narrow operating region.















The unit of power is J/s or W (Watt). Temperature dependence of resistivity With small change in temperature, resistivity varies with temperature as : r = r0(1 + a T) where, a = temperature coefficient of resistivity. Internal resistance of cell Cell is a device that maintains the Scan to know more about potential difference that is present this topic between the two electrodes as a result of chemical reaction. Internal resistance is the resistance of electrolyte that is present in a battery which resists the flow of Cell and EMF and Internal current when connected to a circuit. Resistance Emf E is the potential difference between the electrodes of cell, when no current flows through it. Potential difference and emf of a cell The emf and terminal potential difference of a cell : Let emf of a cell be E and its internal resistance, r. If an external resistance R be connected across the cell through a key, then IR = V = potential difference across the external resistance R. This is equal to the terminal potential difference across the cell.

Physics

Topic-2





E1 E2 E3 E + + ..... + m r1 r2 r3 rm IP = 1 1 1 1 R +  + + + .... +  rm   r1 r2 r3

Conductance : The reciprocal of resistance with unit as Siemen, “S.







(ii) Parallel combination of cells : This combination is used when the external resistance R is much smaller as compared to the internal resistance (r) of the cell, i.e., R1).

Physics

3.

Susceptibility

is

small, Susceptibility is small and positive Susceptibility is large and positive

negative, and independent of and inversely proportional to temperature.

29

1 the absolute temperature, χ ∝ T (Curie’s Law)

1 and follow Curie’s Law, χ ∝ T (Curie’s Law)

At

Curie

temperature,

ferromagnetic substance changes to paramagnetic substance.

Mnemonics Concept: Four characteristics of magnetic field lines

(i) Imaginary Lines

Mnemonics: I love new stories Tina found new Cook-

(ii) Extended from North to South pole

ies.

(iii) Tangent gives (magnetic) field direction

Interpretations:

(iv) Never Cross each other







Key Formulae Magnetic field due to short dipole at distance ‘d’ on axial line:

Baxial =

µ0 2 M 4 πd 3

Magnetic field due to short dipole at distance ‘d’ on equatorial line:

Bequi =

µ0 M 4 πd 3

Torque on a magnetic dipole in uniform magnetic field: t = MB sin q

6

u

d

ction an alternating c rrents

du

I

Unit- V : elecromagnetic in

Topic-1

I

m

E

lectro agnetic nduction Magnetic Flux and Faraday's Laws Concepts Covered



Electromagnetic induction, Faraday's laws & Lenz's Law.

another when they are in fluctuating magnetic field. The current produced by electromagnetic induction is more when the magnet or coil moves faster. When magnet or coil moves back and forth repeatedly, then alternating current is produced. If magnetic field is changing, the changing magnetic flux will be fB= NBA cos θ, where, θ is the angle between magnetic field and normal to the plane.





df = B(dA)cos 0° = B(dA)

The change in magnetic flux per unit change in area is called magnetic flux density.

dφ dA

....(i)







Therefore, B =





Introduction to Electromagnetism

Magnetic flux density





Scan to know more about this topic







Electromagnetic induction Electromagnetic induction is the process of generating the electric current with a changing magnetic field. It takes place whenever a magnetic field is changing or electric conductors move relative to one



Revision Notes

i.e., magnetic induction is equal to the magnetic flux density. In other words, the magnetic field may be measured in terms of magnetic flux density. From equation (i), we find: B =

Or,

T =



Unit of

Unit of dφ Unit of dA







Wb m2



→



→



→

For B parallel to dA , we have







→

df = B . dA



i.e., Tesla = Weber per square metre. Faraday’s Laws of Electromagnetic Induction

Magnetic flux is given by:









Magnetic flux: Magnetic flux is a measurement of the total magnetic field which passes through a given area. It is the number of magnetic field lines passing through a given closed surface. It is the product of the average magnetic field and the perpendicular area that it penetrates.





Key Word

The induced emf in a closed loop due to a change in magnetic flux through the loop is known as Faraday’s law.

Physics

31

32

dφ B dt

fB is magnetic flux through the circuit and is represented as

Scan to know more about this topic

→





Motional emf The relationship between an induced emf e in a wire or a conductor moving at a constant speed v through a magnetic field B is given by: fB = Blx  





e=

If there is no change in magnetic flux, no emf is induced.







The negative sign indicates that e opposes its cause.

 

t = Change in time [s]

 



∆



−dφ B −d ( Blx ) = dt dt



= −Bl

A wire moving in the field induces a current which acts same as current provided by a battery.

dx dt

 dx

Changing magnetic flux and induced electric field are related to induced emf as per Faraday’s law. The induced EMF in a conductor moving is related to the magnetic field as E = B.l.vsin q

 = −v   dt 

= Blv 













Induced emf and current A changing magnetic flux induces an electric field which induces a current in the circuit.

 

f = Change in the magnetic flux [Wb],

When a magnet is moved away from the loop, the ammeter shows opposite current induced in the loop.



where, e = Induced emf [V], N = Number of turns in the coil







With N loops of similar area in Electromagnetic a circuit and fB being the flux Induction through each loop, emf is induced in every loop. Writing the formula for Faraday's law as ∆φ ε = −N ∆t

∆







φB = ∫ B .d A

 

→

When a magnet is held stationary, there will be no induced current in the loop, even though the magnet is inside the loop.

 







ε=−

connected to an ammeter, ammeter shows current induced in the loop.





Faraday’s First Law of Electromagnetic Induction states that whenever a conductor is placed in varying magnetic field, an emf is induced which is known as induced emf and if the conductor circuit is closed, current is also induced which is called induced current. Faraday’s Second Law of Electromagnetic Induction states that the induced emf is equal to the rate of change of flux linkage where flux linkage is the product of number of turns in the coil and flux associated with the coil.







Oswaal CBSE LMP (Last Minute Preparation), Class-XII



nduced emf: A short-lived voltage generated by a conductor or coil, moving in a magnetic field.

An induced emf from Faraday’s law is generated from a motional emf that opposes the change in flux. Magnetic and electric forces on charges in a rod moving perpendicular to magnetic field is given as: FE = FB

At equilibrium,













Induced current When a conductor moves across flux lines, magnetic forces on the free electrons induce an electric current. When a magnet is moved towards a loop of wire



Induced electric field: Field generated due to changing magnetic flux with time.







I



Key Words

33

Physics





qE = qvB



E = vB [Here, E =







V = vB l

V ] l







V = Bvl

G

Electric generator rotates a coil in a magnetic field inducing an emf which is given as a function of time e = NBAw sin (wt). where, A = Area of N-turn coil rotated at constant →





dφB showing that the polarity of induced emf dt tends to produce a current that opposes the cause i.e., change in magnetic flux. As per conservation of energy, induced emf opposes its cause, making mechanical work to continue with the process which gets converted into electrical energy. Slide wire containing induced current, magnetic field and magnetic force:

 

 

Key Words

E

lectric generator: Device for converting mechanical work into electrical energy that induces an emf by rotating a coil in magnetic field. otional emf: Voltage produced by the movement of conducting wire or a conductor in a magnetic field. Peak emf: The maximum emf produced by a generator. Back emf: The emf generated by a running motor due to coil that turns in a magnetic field which opposes the voltage that powers the motor.



M



















ε=−

Topic-2

 

angular velocity w in uniform magnetic field B . The peak emf of a generator is, e0 = NBAw Any rotating coil produces an induced emf. In motors, it is known as back emf as it opposes the emf input to the motor.  













Lenz’s law Lenz’s law is used to determine the direction of induced magnetic fields, currents and emfs. The direction of an induced emf always opposes the change in magnetic flux which causes the emf. It explains the negative sign in Faraday’s rule,

 





 





E

lectric enerators and Back Emf

Self and Mutual Induction Concepts Covered



Self Inductance  Mutual Inductance.

Revision Notes

l

















The shape, size or geometry of the two coils. i.e., the area of cross-section and the length of the coils. Coefficient of mutual induction: Suppose, the instantaneous current in the primary coil is I. Let the magnetic flux linked with the secondary coil be f. It is found that the magnetic flux is proportional to the current. i.e., f µ I or f = MI ...(i) where, M is the constant of proportionality. It is called coefficient of mutual induction. The induced emf e in the secondary coil is given by









e =–

dφ dI = −M dt dt







l









Mutual Induction The production of induced emf in Scan to know more about a circuit, when the current in the this topic neighbouring circuit changes is called mutual induction. When the circuit of the primary coil is closed or opened, deflection Electromegnetic Induction is produced in the galvanometer of (Numerical the secondary coil. This is due to the based) mutual induction. The mutual induction between two coils depends on the following factors: The number of turns of primary and secondary coils.

...(ii)

34

Oswaal CBSE LMP (Last Minute Preparation), Class-XII









Unit of induction,

H=





L=

µ0 N 2 µ N2 A= 0 × πr 2 2r 2r

L=

µ0 N 2 πr 2



The self inductance of a solenoid of length l is given by L=







L=



or





Then, the coefficient of self-induction is the ratio of induced emf in the circuit to the rate of change of the current in the circuit.







...(iii)

Unit of L: The unit of self-induction is called henry (symbol H).

θ

µ ( 2 πNI ) φ BAN = = 0. × AN 4π I I rI µ0 2 πNI   ∵ B = 4 π . r   





L = e / (dI / dt)







Taking the magnitude of the induced emf from the equation (ii), we find:

Wb Vs = = Ω.s A A

The self inductance of a circular coil is given by:

...(ii)

The negative sign is in accordance with the Lenz’s law i.e., the induced emf opposes the variation of current in the coil.







• permeability of the core.



dφ dI = −L dt dt

The inductance of a coil depends on the following factors:





e =–





The induced emf e in the coil is given by

When a bar magnet is dropped into a coil, the electromagnetic induction in the coil opposes its motion, so the magnet falls with acceleration less than that due to gravity.





where, L is the constant of proportionality. It is called coefficient of self-induction.

Inductance in the electrical circuit is equivalent to the inertia (mass) in mechanics.

• area of cross-section, • number of turns

...(i)





f µ I or f = LI











Suppose the instantaneous current in the circuit is I and if the magnetic flux linked with the solenoid is f, then it is found that:







The production of induced emf in a circuit, when the current in the same circuit changes is known as self-induction.





The unit of inductance is the henry (H),





A = pl2 = area of circle and f = frequency of rotation.

Inductance is defined as the ratio of the induced voltage to the rate of change of current causing it. .

Self-Induction:

Bωl 2 B2 πfl 2 = = BAf 2 2

Here, w = angular velocity of rotation,



I

nductance: Inductance is the tendency of an

electrical conductor to oppose a change in electric current flowing through it.











e=

m







Key Word



If a metallic rod of length l rotates about one of its ends in a plane perpendicular to the magnetic field, then the induced emf produced across its ends is given by





If n1, n2 be the number of turns per unit length in primary and secondary coils per unit length and r be their radius, then coefficient of mutual inductance is given as M = 0n1n2pr2l













As−1

e = vBl In general, we have, e = Blv sin

= VA–1s

V

Therefore, Unit of M =

If a rod of length l moves perpendicular to a magnetic field B with a velocity v, then the induced emf produced across it, is given by











ε ( dI / dt )

M=

L = 1 H Þ 1 VA–1s





then



Taking magnitude of induced emf from the equation (ii), we find:

dI/dt = 1 As–1 and e = 1 V,







From equation (ii), we find that if





The negative sign is in accordance with the Lenz’s law i.e., the induced emf in the secondary coil opposes the variation of current in the primary coil.

φ BAN  µ0 NI  AN = =  I I  l  I

µ0 NI   ∵ B = l   



N  ∵n = l   



µ0 N 2 A = µ0 n 2 Al = µ0 n 2V l





L=





Here, n = N / l = Number of turns per unit length and V = Al = Volume of the solenoid. If two coils of inductance L1 and L2 are coupled together, then their mutual inductance is given by

35

The value of k lies between 0 and 1. For perfectly coupled coils, k = 1, it means that the magnetic flux of primary coil is completely linked with the secondary coil. If a current I is set up in a coil of inductance L, then the magnetic field energy stored in it is given by

 











or



Physics

Um =

1 2 LI 2













M = k L1L2



where, k is called the coupling constant.

Mnemonics Plain: product of Loaf: Length of Conductor Boiled: B (magnetic field) Vegetables: V (Velocity) Induced emf = Blv

Concept: Induced emf in a conductor moving in a magnetic field: Mnemonics: I eat Plain Loaf and Boiled Vegetables Interpretations: I: Induce eat: emf







1 1 1 1 = + + + .... Lp L1 L2 L3





NP is number of turns in primary coil.



AP is the cross-sectional area of primary coil in m2. AS is the cross-sectional area of secondary coil in m2.



Ls = L1 + L2 + L3 +....



I is the coil current.

The inductance in series is given by

IP

mr is the relative permeability of the soft iron core.





dφ dI = −M dt dt







For Mutual Induction





dI dφ = −L dt dt

n0 nr N P N S AS

NS is number of turns in secondary coil.





For Self Induction

IP

=

where, m0 is the permeability of free space (4p × 10–7).



e = NBA sin wt

µ 0 µ r N P N S AP

For a.c. Generator e = e0 sin t or e = e0 sin 2pnt w

d φm dt

emf produced by an electric generator

e=–

Mutual Inductance of two coils is given by M=





∫ E.dl = −

e=–

The inductance in parallel is given by





d φm dt

Motional emf around a circuit: e=



→



e = Blv









Motional induced emf:





e = −N





→

∫ B . dA

Faraday’s law:



fm =

Magnetic flux:













Key Formulae

A

lternating

urrent

C

7 Alternating Current

Topic-1

Concepts Covered

impedance,



Alternating current, its peak and rms value, reactance and

Revision Notes









 

w

 

w

w







 π I = Im  sin ωt −   2





[which shows current lags the voltage by



p ] 2

I m Vm [sin (2 t)] = 0 2





Average PL =

w







= 0.707 V0

V = Vmsin t





2

AC voltage applied to pure inductive circuits:





V0





Vrms =







Alternating current Alternating current changes continuously in magnitude and periodically in direction. It is represented by sine curve or cosine curve as I = I0sin t or I = I0cos t where, I0 is peak value of current and I is instantaneous value of current. Frequency of an alternating current supply f, is defined as the number of cycles completed per second. It is measured in Hertz (Hz). In India, the frequency of ac current is 50 Hz. The time period T, of an alternating supply, is time Scan to know taken to complete one cycle. more about The behaviour of ohmic resistance this topic R in ac circuit is the same as in dc circuit. Alternating current can be produced by using a device called as an Alternating alternator. Current AC waveforms are:

w

[Since average of sin 2 t over a complete cycle is zero]

Key Words

I

C

I

nductive circuits: A Pure inductive circuit is one in which the only quantity in the circuit is inductance (L), with no other components such as resistance or capacitance. apacitive circuit: A Pure capacitor circuit is a circuit that contains a pure capacitor with capacitance C farads. mpedance: For A.C. circuits, Impedance is the measure of the total opposition that a circuit presents to electric current. Impedance includes both resistance and reactance.

 

I0 2

= 0.707I0







I rms =

rms voltage value is the square root of averages of the squares of instantaneous voltages in a time varying waveform.

l

rms value of ac is also called effective value or virtual value of ac represented as Irms, Ieff or Iv shown as

Thus the average power supplied to an inductor over one complete cycle is zero.



rms value is the standard way of measuring alternating current and voltage as it gives the dc equivalent values.











Peak and rms value of alternating current/voltage: Root mean square or rms is the root mean square of voltage or current in an ac circuit for one complete cycle denoted by Vrms or Irms.

AC applied to pure capacitive circuit:

Physics

37

38

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

w

 











Thus, the average power supplied to a capacitor over one complete cycle is zero. Phasor-diagram: A phasor diagram represents sinusoidal ac current and sinusoidal voltage in a circuit along with the phase difference between current and voltage. The length of phasor is proportional to the instantaneous values of V, I and the maximum length is proportional to V0 and I0.















w

sin 2 t over a complete cycle is zero]

voltage drop is produced which is in phase with the current and is measured in ohms (Ω). Reactance is the inertia against the motion of electrons where an alternating current after passing through it produces a voltage drop which is 90° out of phase with the current. Reactance is shown by “X” and is measured in ohms (Ω). Reactance is of two types: inductive and capacitive. Inductive reactance is linked with varying magnetic field that surrounds a wire or a coil carrying a current. Inductive reactance (XL) is the resistance offered by an inductor and is given by XL = L = 2pfL Through a pure inductor, alternating current lags behind the alternating emf by phase angle of 90o. Capacitive reactance is linked with changing electric field between two conducting surfaces separated from each other by an insulating medium. Capacitive reactance (XC) is the resistance offered by a capacitor and is given by 1 1 XC = = ωC 2 πfC  



ImVm sin( 2ωt ) = 0 [Since average of 2



p ] 2

[which shows current leads the voltage by Average PC =









p  2





I = Im sin  ωt +



w



V = Vm sin t



Z = R 2 + XC 2





where, Z = Impedance of circuit, R = Resistance, X = Reactance mpedance: In an ac, the impedance is analogous to resistance in a dc circuit that measures the combined effect of resistance, capacitive reactance and inductive reactance. I





Phasor diagram of purely Inductive circuit

Through a pure capacitor, alternating current leads the alternating emf by a phase angle of 90o. Impedance is the comprehensive expression of all forms of opposition to electron flow, including resistance and reactance, where an alternating current after passing through it produces a voltage drop between 0o and 90o which will be out of phase with current given as,

Magnetic field due to short dipole at distance ‘d’ on equatorial line:

Bequi = w

Graphical representation of V and i versus t.

Torque on a magnetic dipole in uniform magnetic field: t = MB sin q





Reactance and Impedance When an ac current is passed through a resistor, a

µ0 M 4 πd 3

Topic-2

LCR Series Circuit Concepts Covered  LCR series circuit (phasors only), resonance, power in AC circuits, power factor, wattless current.

Revision Notes



LCR series circuit In an LCR series circuit with resistor, inductor and capacitor, the expression for the instantaneous potential difference between the terminals a and b is given as

Physics

39

Key Word



The potential difference in this will be equal to the sum of the magnitudes of potential differences across R, L and C elements as



Z







Scan to know more about this topic

In an LCR circuit, impedance triangle is a rightangled triangle in which base is ohmic resistance R, perpendicular is reactance (XL – XC) and hypotenuse is impedance (Z)

XL–XC

where, q is the charge on capacitor. The steady state situation will be Vm i= sin( ωt − φ) 2 1  and 2  R +  ωL − ωC  

X L − XC R 

dI 1 + q dt C



V = Vm sin ωt = RI + L

The angle by which alternating voltage leads the alternating current in LCR circuit is given by tan φ =











S

teady state: As in the case of forced oscillations of a spring-mass system with damping, we call Qp the steady state charge on the capacitor of the RLC circuit. Since I=Q'=Q'c + Q'p and Q'c also tends to zero exponentially as t'→ ∞, we say that Ic = Q'c is the transient current and Ip = Q'p is the steady state current.

LCR Series Circuit

R

Vm Z







Z = R 2 + ( X L − X C )2

w

w











Total effective resistance of LCR circuit is called Impedance (Z) of the circuit given as

In this, frequency of ac fed to circuit will be equal to natural frequency of energy oscillations in the circuit under conditions, Z=R

I0 =





 

 

 

 



 

=



R +X

2

Here, Z = Impedance of the circuit, X = Reactance of the circuit, XL and XC = Inductive and Capacitive reactance. For steady-state currents, maximum current Im is related to maximum potential difference Vm by V Im = m Z  







 

Vm 2



Z = R2 + X 2 Vm = Im = 2 R + ( X L − X C )2







 

R From the equation, steady-state current varies sinusoidal with time, so steady-state current can be written as I = Im sin ( t – f) In an LCR circuit: X L = ωL 1 XC = ωC 1 X = X L − X C = ωL − ωC



1 ωC



φ = tan

ωL −

w





where,

−1

When a condenser of capacity C charged to certain potential is connected to inductor L, energy stored in C oscillates between L and C where frequency of energy oscillations is given by 1 XL = XC or f = 2π LC In LCR circuit, if there is no loss of energy, then total energy in L and C at every instant will remain constant. Sign for phase difference (f) between I and V for a series LCR circuit: f is positive, when XL > XC. f is negative, when XL < XC. f is zero, when XL = XC. f = p/2, when = f. f = –p/2, when = 0. Resonance Circuit in which inductance L, capacitance C and resistance R are connected in series and the circuit admits maximum current, such circuit is called as series resonant circuit. The necessary condition for resonance in LCR series circuit is: VC = VL 1 1 2 or f = XL = XC which gives ω = LC 2 π LC



1   R 2 +  ωL − ωC  



Vm





im =

E0 E0 = Z R

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

1 L R C

=







cos φ =









w

w







power

Resonance in LCR Circuit

w

w

Pin = V × i = V0i0sin t.sin ( t – f)





2

×

i0 2

cosφ

where, cos f is known as power factor. Power factor (cos f) is important in power systems as it shows how closely the effective power equals the apparent power which is given as:











Power in AC circuits When the current is out of phase with the voltage, the power indicated by the product of the applied voltage and the total current gives apparent power. If the instantaneous values of the voltage and current in an ac circuit are given by V = V0sin t Scan to know more about i = i0sin ( t – f) this topic where f is the phase difference between voltage and the current. Then, the instantaneous

V0





V R

I max =

1 V0i0 cosφ 2

= Vrms × Irms × cos f



At series LCR resonance or acceptor circuit, current is maximum.







Q=

or average power Pavg =

Effective power Apparent power

The value of power factor varies from 0 to 1. The instantaneous rate at which energy is supplied to an electrical device by ac circuit is P = VI Average power in LCR where, XL = XC over a complete cycle in a non-inductive circuit or pure resistive circuit is given as P = V0I0 or I02R The current in an AC circuit is said to be Wattless Current when the average power consumed in such circuit corresponds to Zero. This happens in case of pure inductive and capacitive circuits.  

The sharpness of tuning at resonance is measured by Q factor or quality factor of the circuit given as







40

Key Word I

nstantaneous power: The amount of power in a circuit at any instant of time is called the instantaneous power and is given by the well-known relationship of power equals volts times amps (P = V × I)

Mnemonics Concept: Current leads in pure capacitive circuit, voltage leads in pure inductive circuit. Mnemonics: Chocolate Cookies are Very Interesting ! Interpretations:

Topic-3

C: Current leads C: Capacitive circuit V: Voltage leads I: Inductive circuit

AC Generator and Transformer Concepts Covered



AC generator and transformer.

Revision Notes

w

w

w



AC generator An AC generator is an electrical Scan to know more about machine which converts mechanthis topic ical energy into alternating electrical energy. AC generator or a synchronous generator has a stator and rotor. AC generator It is similar to the basic working principle of a dc generator. It works on the principle of electromagnetic induction where a coil gets rotated in uniform magnetic field, sets an induced emf given as: e = e0 sin t = NBA sin t

Transformer Transformer is an electrical device used for changing the alternating voltages. It is Scan to know more about based on the phenomenon of this topic mutual induction. The main use of transformer is in transmission of ac over long Transformer distances at extremely high voltages which reduces the energy losses in transmission. It comprises of two sets of coils which are insulated from each other and are wound on soft-iron core.

Physics



Step-up transformer: If secondary coil has more number of turns than primary (Ns > Np), voltage gets stepped up (Vs > Vp). In this, there is less current in secondary as compared N to primary ( s > 1 and Is < Ip). Np



In this, one of the coil is called as primary (input coil) having Np turns while other coil is secondary (output coil) having Ns turns, so we have Es I p N s = = =k Ep I s N p

The value of transformation ratio k > 1



Transformation Ratio: N   Np   I p Es =  s  Ep and I s =  N   Ns   p

Step-down transformer: In this, the secondary coil has less number of turns than primary (Ns < Np). In this, Vs < Vp and Is > Ip as voltage gets stepped down or reduced with increase in current.



N s Vs = is defined as the transformation ratio. N p Vp

In this, value of transformation ratio k1, then it is a step-up transformer. If k < 1, then it is a step-down transformer.

Soft iron: Iron that has a low carbon content and is easily magnetized and demagnetized, used to make the cores of solenoids and other electrical equipment.

Electrical power: Electric power is the rate, per unit time, at which electrical energy is transferred by an electric circuit. The efficiency in a transformer is usually above 90%.

Electric power can be transmitted efficiently at high voltages than at low voltages due to less (I2R) heat loss in a high voltage / low current transmission. Efficiency of transformer: Output power h = Input power

An ideal transformer is 100% efficient as it delivers all energy it receives.



Real transformer is not 100% efficient and at full load, its efficiency lies between 94% to 96%. A transformer operating with constant voltage and frequency with very high capacity, efficiency results as 98%.

Es I s Ep I p

Soft iron-core

2. Resistance of windings



1. Flux Leakage 3. Eddy currents 4. Hysteresis

Secondary

Primary

Primary

Secondary



Energy losses in transformers:







h=

Key Word Hysteresis loss: The hysteresis loss instead is the energy entrapped in magnetic materials exposed to a magnetic field in the form of residual magnetization—a typical behavior of FM materials—which is then lost as heat during the demagnetization step. rr

8

ES

A

W V

ELECTROMAGNETIC

Unit – V :

m

E

lectro agnetic Waves Electromagnetic Waves and Maxwell’s Equations

Topic-1

Concepts Covered  Basic idea of displacement current,Electromagnetic waves and their characteristics, their transverse nature.

Revision Notes







LC











is the electric flux and e0 is the

permittivity of free space. As per Ampere Maxwell law, line integral of magnetic field around any closed path is equal to 0 × (sum of conduction current and displacement current through that path.)







Transverse nature of electromagnetic waves In electromagnetic wave, electric and magnetic field vectors are perpendicular to each other in the direction of propagation of wave which shows its transverse nature.

® ®

ò E . dA

μ







where, fE =



Electric flux: It is the rate of flow of electric field of lines passing through a given area.





Key Word







 dE   I d = ε0 A   dt 









d φE , dt

Example: Electron jumping from its outer to inner orbits radiates EM waves. Electrical oscillations in circuit produce EM waves. Electric sparking generates EM waves. Characteristics of EM waves: EM waves are propagated as electric and magnetic fields oscillating in mutually perpendicular directions. EM waves travel in vacuum along a straight line with the velocity 2.997924591 × 108 m/s which is often assumed as 3 × 108 m/s. EM waves are not affected by electric and magnetic fields. Relation between electric and magnetic field components is: B0 = E0/c 1 where, c @ 3 × 108 m/s. and c = µ 0 ε0 The l and f are related as c = fl. where l is the wavelength and f is the frequency.









Id = ε0











Basic idea of displacement current: Displacement current is a quantity appearing in Maxwell’s equations that is defined in terms of the rate of change of electric flux. Displacement current has the units of electric current and has associated magnetic field similar as actual currents. Displacement current plays an important role in the propagation of electromagnetic radiation, such as light and radio waves, through empty space. Displacement current is defined as:

dφE dt





















A plane EM wave travelling in the x-direction is of the form: E(x, t)= Emaxcos (kx – wt + f) B(x, t)= Bmaxcos (kx – wt + f) where, E = electric field vector, B = magnetic field vector  In this, wave propagates along z-axis, the electric and magnetic field propagation will be: E= E0sin (kz – wt) B= B0sin (kz – wt)

























= m0IC + m0e0 d ( E. A ) dt This proves that change in electric field E, is responsible for the induction of magnetic field. Scan to know Electromagnetic waves more about this topic Waves that can travel through vacuum of outer space and do not need the presence of material medium for transporting energy from one location to another. Electromagnetic Waves EM waves are produced by accelerated charged particles. The electric and magnetic fields produced by accelerated charge change with time, which radiate electromagnetic waves.



= m0IC + m0e0









→ →

∫ B . dl



= m0[Ic + Id]

→ →

∫ B . dl





i.e.,

Key Word

LC circuit: It is a resonating circuit that consists of an inductor and a capacitor.

Physics

43

44

Oswaal CBSE LMP (Last Minute Preparation), Class-XII







 Gauss Law: For electricity, electric flux of closed surface equals to the charge enclosed divided by permittivity. → → Q ∫ E . dA = ε0







→ →

∫ B . dA = 0

→

→





S=

m0

.

1 1 B2 ε0 E 2 + 2 2 µ0

U = ε0 E 2 =

EB

In EM waves, the total energy density of waves is U =









Here, E = Electric field between the plates of the capacitor, V = Potential difference, d = Separation between the plates, C = Capacitance of the capacitor, A = Area of plates. For the EM waves, the energy density is given by

→

Since, E ⊥ B , hence

B . m0





It is given by S = E ´





Displacement current between the plates of a capacitor dE d( EA ) = ε0 A ID = ε 0 dt dt d  V  ε0 A dV dV ID= ε0 A dt  d  = d dt = C dt

®

®

em

®

Key Formulae

1 B2 (Due to magnetic field) 2 m0 The energy transported by EM waves per unit area per second is called Poynting vector ( S ).





1 ε 0 E2 (Due to electric field) 2

UB =



For magnetism, total magnetic flux of the closed surface is zero

UE =

B2 µ0

 B    As, E =  µ 0ε0 

In the EM waves: E = E0sin (wt – kx), B = B0 sin (wt – kx).

Maxwell’s Equations: → →

Q

∫ E . dA = ε0

(Gauss’s law for electricity).

2.

ò B . dA = 0

(Gauss’s law for magnetism).

3.

∫ E . dl = −



1.

® ®



→ →



4.

dφ B (Faraday’s law). dt → → dφ ∫ B . dl = µI c + µ 0ε0 dtE (Ampere-Maxwell law).E = eV

Mnemonics Concept: Electromagnetic spectrum: Arrangement of em waves with increasing frequency (decreasing wavelength) : Mnemonics: Russian magicians introduced and very unusual X-ray eye Game.

Waves

Topic-2

Waves

Electromagnetic Spectrum Concepts Covered  Electromagnetic spectrum (radio waves,microwaves, infrared, visible, UV, X-rays, gamma rays) including elementary facts about their uses



Revision Notes Gamma rays: Rays with smallest wavelengths and highest frequencies having high energy capable of

travelling long distances through air and these are most penetrating.











Frequency (in Hz)





Ultraviolet (UV) radiation: It is a part of electromagnetic spectrum that lies between X-rays and visible light. Visible light: It is a visible spectrum which is part of electromagnetic spectrum which can be seen by human eyes. Infrared (IR) radiation: These are thermal radiations



45

which is the part of electromagnetic spectrum that lie between visible light and microwaves. Radio waves: Waves with long wavelengths used in television, cell phone and radio communications. Electromagnetic spectrum Classification of EM-waves is based on their frequency or wavelength range. EM radiations are classified as per the frequency and wavelength of wave such as radio waves, microwaves, infrared radiation, visible light, ultraviolet radiation, X-rays and gamma rays. Wavelength (in m)

X-rays: These are the rays with long and small wavelengths having higher energy as compared to ultraviolet radiation.





Physics



Electromagnetic waves require no medium to travel or propagate.

Varying electric and magnetic fields are the sources of electromagnetic waves.

a = Amplitude b = wavelength Electromagnetic spectrum is divided into following regions: The electromagnetic spectrum is the distribution of electromagnetic radiation in terms of energy, frequency or wavelength. The electromagnetic radiation can be described as a stream of photons travelling in a wave like pattern, at the speed of light.

Electromagnetic waves are transverse waves which are characterized by their amplitude, wavelength, or distance between highest/lowest points.

















General properties of electromagnetic waves (radio waves, microwaves, infrared, visible, ultraviolet, X-rays, gamma rays)

In electromagnetic waves, a crest is the highest point of the wave and trough the lowest point of wave in a cycle. Type of radiation

Frequency range

Gamma rays

> 3 × 1020

X-rays

3 × 1017 – 3 × 1020 14

Wavelength range 1 mm

Uses of Electromagnetic waves: Band designation

Applications

Audible

Acoustics

Extremely Low Frequency (ELF) Radio

Electronics, Submarine Communications

Infra Low Frequency (ILF)

Not applicable

Very Low Frequency (VLF) Radio

Navigation, Weather System Forecasting

Low Frequency (LF) Radio

Navigation, Maritime Communications, Information and Weather Systems, Time Systems

Medium Frequency (MF) Radio

Navigation, AM Radio, Mobile Radio

High Frequency (HF) Radio

Citizens Band Radio, Mobile Radio, Maritime Radio

Very High Frequency (VHF) Radio

Amateur (Ham) Radio, VHF TV, FM Radio, Mobile Satellite, Mobile Radio, Fixed Radio

Ultra High Frequency (UHF) Radio

Microwave, Satellite, UHF TV, Paging, Cordless Telephone, Cellular and PCS Telephony, Wireless LAN (Wi-Fi)

Super High Frequency (SHF) Radio

Microwave, Satellite, Wireless LAN (Wi-Fi)

Extremely High Frequency (EHF) Radio

Microwave, Satellite, Radiolocation

Infrared Light (IR)

Wireless LAN Bridges, Wireless LANs, Fiber Optics Remote control

Visible Light

Photographic plate, photocells.

Ultraviolet (UV)

Photocells, kill bacteria and germs.

X-Rays

In medical, Geiger tubes, ionization chamber.

Gamma and Cosmic Rays

In medical (cancer cell killing)

Types of Electromagnetic waves, wavelength range, Production and Detection: Type of radiation

Wavelength range –1

Production

Detection

Radio

> 1.0 × 10 m

Rapid acceleration and decelerations Receiver’s aerials of electrons in aerials

Microwave

0.1 m – 1.0 × 10–3 m

Klystron valve or magnetron valve

Point contact diodes

Infra-red

1.0×10–3 m – 700 × 10–9 m

Vibration of atoms and molecules

Thermopiles Bolometer, Infrared photographic film

Light

700 × 10–9 m – 400 × 10–9 m Electrons in atoms emit light when The eyes, Photocells they move from one energy level to a Photographic film lower energy level

Ultraviolet

400 × 10–9 m – 1.0 × 10–9 m

Inner shell electrons in atoms moving from one energy level to a lower level

Photocells Photographic film

X-rays

1.0 × 10–9 m – 1.0 × 10–12 m

X-ray tubes or inner shell electrons

Photographic film, Geiger tubes, Ionization chamber

Gamma rays

v Þ n2 > 1 If a ray of light enters from one medium to another medium in such a way that bending of light happens away from normal, then second medium is optically rarer with respect to the first medium. If bending of light is towards normal, then second medium is optically denser with respect to the first medium.

Principle of Reversibility According to the principle of reversibility, the path of light is reversible even if it is going through several media. It means light follows exactly the same path when its direction is reversed. Applying this rule, we may find that if light travels through several media say medium 1 to medium 2 and then to medium 3, then to medium 1. n21 × n32 × n13 = 1 Though refraction rules are universal but direction of emergent ray depends upon the shape of the medium or in other words, on the shape and angle between incident and emergent interfaces (refracting surfaces). Refraction through Glass Slab In a glass slab, refracting surfaces are plane and parallel to each other. Emergent ray is parallel to the incident ray but it suffers lateral displacement.





















Refraction of light: Refraction is deviation of light when it obliquely travels from one medium to another medium. Snell experimentally found the following laws of refraction. Laws of Refraction of Light The incident ray, the refracted ray and the normal to the interface of two transparent media, at the point of incidence, all lie in the same plane. The ratio of sine of angle of incidence to the sine of angle of refraction is a constant, for the light of a given colour and for the given pair of media. This constant value is called the refractive index of the second medium with respect to the first medium. sin i = constant (n21 ) sin r

The apparent depth of the object is always less than actual depth when looking through glass or water.  1  Rise of image = Real depth  1 −  n 21  

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

n21 =

Real depth Apparent depth

• At minimum deviation stage, it is observed that angle of i1 = i2 (= i) and r1 = r2 (= r) , then A r= ....using (ii) 2











Here,



50

δm + A .... using (i) 2 sin[( A + δm ) / 2] n n21 = 2 = n1 sin[ A / 2] i=







• If the angle of incidence is more than the critical angle, refraction is not possible and incident ray reflects in denser medium. This process is known as total internal reflection. Hence, the conditions for total internal reflection are: • The light should travel from denser medium to the rarer medium. • Angle of incidence should be larger than the critical angle. Optical fibre: Optical fibre is the technology associated with data transmission using light pulses travelling along with a long fibre which is usually made of plastic or glass. • Optical fibre works on the principle of total internal reflection. When light travelling in an optically dense medium hits a boundary at a steep angle (larger than the critical angle for the boundary), the light is completely reflected. This is called total internal reflection.





(i) i + e = d + A. Here, i= e (ii) r1 + r2 = A







• This effect is used in optical fibres to confine light in the core. Light travels through the fibre core, bouncing back and forth off the boundary between the core and cladding. Because the light must strike the boundary with an angle greater than the critical angle, the only light that enters the fibre within a certain range of angles can travel down the fibre without leaking out.













The following phenomena occur due to the refraction of light: • Bottom surface of water pool seems to be raised. • The letter appears to be raised when we observe it through a glass slab. • Object looks bigger than its actual size and raised when we dip it into liquid. • Twinkling of stars. • Delayed sunset and early sunrise. Refraction through Prism In prism, refracting surfaces are planes but inclined to each other. Refracted ray always bends towards the base. Angle of deviation , d = (i – r1) + (e – r2) Angle of minimum deviation: When incident angle is gradually increased, the angle of deviation initially decreases and after obtaining a minimum value, it starts increasing again. This angle obtained at the lowermost point is called angle of minimum deviation dm.









As angle of prism and deviation can be found experimentally, this equation is used to determine the refractive index of the material of prism. For thin prism, dm = (n21 – 1)A. This equation implies that thin prisms do not cause much deviation of light. Total internal reflection: When light travels from an optically denser medium to a rarer medium at the interface, it is reflected into the same medium at a certain angle. This reflection is called total internal reflection. • Critical angle is that value of incident angle for which angle of refraction is 90°. The refracted ray just brushes the surface. The critical angle for waterair, glass-air and diamond-air are 45°, 42° and 24° respectively. 1 n12 = (where, C is critical angle) sin C

...(i) ...(ii)

Refraction at spherical surface: If the rays are incident from a medium of refractive index n1, to another medium of refractive index n2, the formula comes out to be







n2 n1 n2 − n1 − = v u R







Lens maker’s Formula:  n2   where, n21 =  n1  







Height of the image (h') v = Height of the object (h ) u

Power of a lens: The power of a lens is defined as the reciprocal of its focal length. It is represented by the letter P. The power P of a lens of focal length f is given by 1 Scan to know P= more about f this topic

 1 1 1 = ( n21 − 1)  − f  R1 R2 



Power of a lens, P =

1 . f ( m)



•

Position of the object At infinity

Position of the image at focus F2



So, the above formula is used to make lenses of required power. Hence, this formula is known as lens maker’s formula. Image formation in convex lens for different positions of object m=

Relative size of the image Highly diminished, point sized Diminished Same sized Enlarged Infinitely enlarged Enlarged

Nature of the image Real and inverted Real and inverted Real and inverted Real and inverted Real and inverted Virtual and erect

Ø

Ø

Beyond 2F1 Between F2 and 2F2 at 2F2 At 2F1 Beyond 2F2 Between 2F1 and 2F2 At infinity At Focus F1 On the same side of the Between focus F1 and optical centre lens as object Image formation in concave lens for different positions of object Position of the object

Position of the image

Relative size of the image

Nature of the image

At infinity

At focus F1

Highly diminished point sized

Virtual and erect

Between infinity and the optical centre O of the lens

Between focus F1 and optical centre O

Diminished

Virtual and erect

Mnemonics Concept name: Mirror Formula and lens formula:





Go L means Less

1 1 1 + = v u f

irror

L

M



Go M means More

1 1 1 - = v u f

ens

Magnification will have opposite sign: m

=

−

v (For mirror) u







Magnification by lens:

51

The SI unit of power is dioptre when focal length is in metre. It is denoted by D. Hence, 1 dioptre is a power of lens whose focal length is 1 metre. Lens Maker • When two or more lenses are Formula combined, then the power of combined lens is sum of individual power of lenses. P = P1 + P2 + .....













Where, R = Radius of curvature of spherical surface and object is placed at rarer medium. u = Object distance from spherical surface v = Image distance from spherical surface Lens: A lens is a piece of transparent glass which is bounded by two surfaces out of which at least one surface is spherical. There are two types of lenses: • Convex lens: A convex lens is one which is thinner at sides and thick at centre. • Concave lens: A concave lens is one which is thicker at sides and thin at centre. Relation between object distance, image distance with focal length of lens: The relation can be expressed as 1 1 1 − = v u f



Physics

m

=

v (For lens) u

52

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Topic-3

Optical Instruments Concepts Covered

Simple and compound microscope, telescope, astronomical telescope and their magnifying powers.

Revision Notes































Based upon phenomenon of reflecting and refracting properties of mirrors, lenses and prisms, a number of optical devices and instruments have been designed. Microscope is an optical instrument which helps us to see and study micro objects or organisms. It forms magnified image of the object. Telescope is an optical instrument which helps us to see and study far off objects magnified and resolved (with clarity). We generally set these instruments at two different image vision positions and they are as follows: • Image at atleast distance of distinct vision: This is the least distance from eye where we are able to see objects distinctly. For normal human eye, the distance is 25 cm from our eye. • Image at relaxed vision: This is the distance from eye where we are able to see objects distinctly in relaxed vision i.e., no strain to eye . For normal human eye, the distance is infinity from our eye. • Magnification at distinct vision is always greater than magnification at relaxed vision. Simple Microscope: Convex lens behaves as simple microscope. The magnifying power of the simple microscope D (i) For least distance of distinct vision, m = 1 + f where, D is the least distance of distinct vision of the eye and f is focal length of the lens.









From above formulae, it is clear that for larger magnifying power, the focal length of the convex lens should be small.



D f



m=





(ii) For relaxed eye,











The angular magnification by optical instruments is the linear magnification by lenses only. So, magnification of an instrument means how many times it enlarges the image of an object. It can be written as h' m = h where, h is size of object (in one dimension) and h’ is the size of image. Scan to know Compound Microscope: For much more about large magnification, compound this topic microscope is used. It is a combination of two convex lenses when the magnification of each lens is compounded. Compound • The two lenses are placed coMicroscope axially and the distance between them is adjustable. • The lens towards the object is called objective and that towards the eye is called eyepiece. • The final image formed by the compound microscope is magnified and inverted. • Total magnification by compound lens, m = mo × m e where, mo is magnification by objective lens and me is magnification by eyepiece. • For least distance of distinct vision, magnification by objective lens is vo L mo = » uo fo where, L is the distance between the second focal point of the objective and the first focal point of the eyepiece (focal length fe). It is called the tube length of the compound microscope. Eyepiece lens will act as simple microscope. Magnification by eyepiece lens is D me = 1 + fe Hence, Magnification by compound lens

Physics

L  D 1 +  fo  fe 

m=

f α =− o β fe

Properties of astronomical telescope • For larger magnifying power, fo should be large and fe should be small. • The length of the tube of an astronomical telescope is L = fo + fe for relaxed vision adjustment. • When the length of the tube of the telescope increases, fo increases and magnifying power also increases. Limitations of refractive telescope • Large objective lens makes the telescope very heavy. So, it is difficult to handle it by hand. • It has spherical and chromatic aberrations. Modern Telescope (Reflective Telescope) • Reflecting telescope consists of a concave mirror of large radius of curvature in place of objective lens • A secondary convex mirror is used to focus the incident light, which passes through a hole in the objective primary mirror . • The magnifying power of the reflecting telescope is fo m = fe

Hence, the total magnification of microscope in relaxed eye condition is L D m= × fo fe

compound







Properties of Compound Microscope • For large magnification of a compound microscope, both f0 and fe should be small. • If the length of the microscope tube increases, then its magnifying power increases. • Generally fo is much smaller. So, the objective is placed very near to principal focus. • The aperture of the eyepiece is generally small so that whole of the light may enter the eye. • The aperture of the objective is also small, so the field of view may be restricted. Magnification by Telescope • Telescope is an instrument to magnify and resolve far off objects. • Far off objects make much smaller angle at our eye. Telescope makes that angle larger without much intensity loss. • To maximise the intensity, aperture size of objective lens is quite large. It focuses a bright point size image at its focal plane. • Now with eyepiece, we will observe the point size image to final inverted magnified image. This type of telescope is known as astronomical telescope. • For least distance of distinct vision, f  f  m = − o 1 + e  fe  D





For Relaxed Eye (normal adjustment) For relaxed eye, the magnification by objective lens remain same, the magnification by eyepiece will be D + fe













=

53

For Relaxed Eye (normal adjustment)



Advantages of reflective telescope • Very sharp point image by objective mirror removes spherical aberrations. • As it is very light, large aperture of parabolic mirror can be used for desired magnification. • This is based on the principle of reflection and there will be no chromatic aberrations.

10

Wave

Topic-1

O

I

Unit- : electrostatics

ptics

Wave Theory and Huygens' Principle Concepts Covered

 Wave front, Huygens' principle, reflection and refraction of plane wave at a plane surface using wave fronts, proof of laws of reflection and refraction using Huygens' principle.

Revision Notes

waves have same speed and wavelengths as waves by primary sources. At any instant, a common tangential surface on all these wavelets give new wavefronts in forward direction. Shapes of wavefronts: Source







Newton supported ‘Descartes' corpuscular theory’ of light and developed it further. According to the corpuscular theory, “sources of light emit large number of tiny massless particles known as corpuscles in a medium surrounding the source. They are perfectly elastic, rigid and have high speed. This theory could explain reflection and refraction of light but could not explain many other optical phenomenon like interference and diffraction of light. It was unable to explain the concept of partial reflection and refraction through a transparent surface. Huygens' proposed wave theory of light; According to the theory, light travels in the form of longitudinal waves with uniform speed in a homogenous medium. Different wavelengths of light represent different colours of light. As longitudinal and mechanical waves need medium to travel, he assumed a hypothetical medium known as ‘ether’. He also proved that speed of light is slower in optically denser medium. Initially, Huygens' wave theory of light didn't get much success. Its main point of rejection was, that it was considered as longitudinal wave which need medium, but experimentally found that it could also travel in vacuum and there is no medium like ether. But later Maxwell's theory of electromagnetic waves and Young’s famous double slit experiment firmly established this theory. Maxwell explained that light is an electromagnetic wave which does not need medium and its speed in vacuum is 3×108 m/s. Phenomenon of optical interference, diffraction and polarisation can be explained with wave nature of light. It had some points of failure. It could not explain Photoelectric effect and Compton effect. With polarisation, it is established that light is not a longitudinal wave but a transverse wave. Huygens' principle brings concept of formation of new wave fronts and its propagation in forward direction. Wavefront is locus of all points in which light waves are in same phase. Propagation of wave energy is Scan to know perpendicular to the wavefront. more about Huygens' Principle: this topic Every point of a wavefront becomes secondary source of light. These secondary sources give their own light waves. Within small time, they produce their own wave called Theory Huygens Principle secondary wavelets. These secondary

Spherical wavefront

Line source

Cylindrical wavefront

Plane source

Plane wavefront





Concave lens converts plane wavefront to convex wavefront and convex lens convert plane wavefront to concave wavefront. Scan to know Refraction of light by Huygens' Principle: more about Snell's law can be proved by Huygens' this topic principle. sin i v1 = = constant sin r v2



Point source

Point source very far away Plane wavefront

It has also been proved that the velocity of light in denser medium is less than velocity of light in rarer medium.

Refraction of Light





























Wavefronts

AB = incident wavefront EC = refracted wavefront Ði = angle between incident wavefront AB and interface PP’ Ðr = angle between refracted wavefront EC and interface PP’ If medium 2 is optically denser than medium 1 and t is the time in which disturbance from B reaches C. This is the same time t in which disturbance from A reaches

Physics

55

56

Oswaal CBSE LMP (Last Minute Preparation), Class-XII









E where distance AE < BC. DAEC @ DABC BC sin i = AC



sin r =

AE AC

sin i v1τ = sin r v2 τ





Hence sin i v1 = = constant sin r v2







This is law of refraction (Snell’s law).

Reflection of light by Huygens' Principle:

Topic-2









medium 2

AB = incident wavefront EC = reflected wavefront Ði = angle between incident wavefront AB with the interface AC Ðr= angle between reflected wavefront EC with the interface AC If disturbance at A is reflected from the interface AC, then disturbance at B and disturbance at A both travel in same medium. Thus, they will have travelled equal distance in time t, where t is the time in which disturbance from B reaches at C. Now AE = BC = vt (distance travelled in same medium in same time) DAEC @ DABC Ði = Ðr This is law of reflection.





BC = Distance travelled by wave at B in time t in medium 1 AE = Distance travelled by wave at A in time t in









sin i BC = sin r AE

Superposition of Light Waves (Interference and Diffraction) Concepts Covered



Interference, Young's double slit experiment, Coherent sources,

Diffraction due to a single slit.

Revision Notes





point. The resultant amplitude of the wave is the difference of individual amplitudes. (We can generalize this to superposition of more than two waves) a = a1 - a2 Two independent sources can never be coherent. We may create two coherent sources by deriving them from one source. Condition for constructive Interference: Waves would be coherent in nature. Coherent wave means that they should have equal frequency and constant phase difference (0, 2p, --- 2np) with each other at any time interval t.







Path difference between waves at this phase difference = 0 , l, -----nl, Here, n = 0, 1, 2, 3 ...... ar = a1 + a2 if a1 = a2 = a then ar = 2 a





















According to superposition principle, “At a particular point in the medium, the resultant displacement produced by a number of waves is the vector sum of the displacements produced by each wave”. It means that if individual displacement produced at a point by two coherent waves at any instant is given by y1= acos wt and y2 = acos wt. Then, resultant displacement at that point will be y= y1 + y2 = 2acos wt. Hence, the total intensity at that point will be: I = 4I0 where, I0 µ a2; maximum intensity due to one wave. Interference Constructive Interference: If two waves are propagating such that crest and trough of both waves would reach at a point in the same instant, then we say there is constructive interference of two waves at that point. The resultant amplitude of the wave is the sum of individual amplitudes. (We can generalize this to superposition of more than two waves) a = a1 + a 2 Destructive Interference: If two waves are propagating such that crest of one wave and trough of other wave reaching at a point in same instant, then we say that there is destructive interference of two waves at that

∵

I ∝ a2 Ir = 4 a2

Condition for destructive interference: Waves would be coherent in nature. The phase between the waves should be odd multiples of p, i.e., 0, p, .... (2n – 1)p

57



Physics

Path difference between waves at this phase difference λ 3λ λ ,( 2n − 1) , Here, n = 1, 2, 3, 4.... = , 2 2 2 if then

Dλ d

Width of the dark fringe (bD) = xnD – x(n – 1)D =

Dλ d

Width of the central fringe (bC) =

I ∝ a2 Ir = 0

Dλ d

Hence bB = bD = bC Diffraction It is defined as the bending of light around the corners of an obstacle or aperture into the region where we expect shadow of the obstacle.



Young’s double slit Experiment:

If width of the opening = a q is the angle of elevation of point P from principal axis. Path difference between ray from L and ray from N = NQ = asin q a sin θ = λ  for first maxima λ θ= a

At “O” we get central maxima. Here, path difference (S2P – S1P) = 0























∵

ar = a1 − a2 a1 = a2 ar = 0

Width of the bright fringe (bB) = xnB – x(n – 1)B =

(\ sin q @ q) sin q n.  −5 −1 e.g :  8 −9  4 0 3×2 













(vii) Zero matrix or Null matrix: A matrix is said to be a zero matrix or null matrix if each of its elements is ‘0’. 0 0 0  0 0  , [0 0] e.g., : 0 0 0  ,  1×2. 0 0 0  0 0  2 × 2 3×3 

•





If A and B are m × n and n × p matrices, respectively, then the matrix AB will be an m × p matrix i.e., order of matrix AB will be m × p. • In the product AB, A is called the pre-factor and B is called the post-factor. • If two matrices A and B are such that AB is possible then it is not necessary that the product BA is also possible. • If A is a m × n matrix and both AB as well as BA are defined, then B will be a n × m matrix. • If A is a n × n matrix and In be the unit matrix of order n, then A In = In A = A . • Matrix multiplication is associative i.e., A(BC) = (AB)C. • Matrix multiplication is distributive over the addition i.e., A.(B + C) = AB + AC . • Matrix multiplication is not commutative. 7. IDEMPOTENT MATRIX: A square matrix A is said to be an idempotent matrix if A2 = A. For example, 1 0 0  2 −2 −4  4  are idempotent A = 0 1 0  , A =  −1 3 0 0 1  1 −2 −3      matrices. 8. TRANSPOSE OF A MATRIX: If A = [aij]m × n be a m × n matrix, then the matrix obtained by interchanging the rows and columns of matrix A is said to be a transpose of matrix A. The transpose of A is denoted by A’ or AT i.e., if AT = [aji] . n×m For example, 0   5 T  5 − 4 1 =  − 4 5 Scan to know   0 5 3 1 3 more about    this topic



1 0 0 1 0 . e.g : I3 = 0 1 0  , I =  0 0 1 0 1  2 × 2 3×3 

Mnemonics Types of Matrices Ram Charan Says Drink Sprite ¯ ¯ ¯ ¯ ¯ Row Column Square Diagonal Scalar Matrix Matrix Matrix Matrix Matrix and Nescafe Ice Tea ¯ ¯ ¯ Null Identity Triangular Matrix Matrix Matrix Matrix Multiplication No. of columns of first matrix = No. of rows of second matrix u v  a b c  w x  d e f   y z  R×C R×C Class Representative



MATHEMATICS

Topic-2

207

Symmetric, Skew Symmetric and Invertible Matrices Concepts Covered 



Symmetric Matrix,  Skew Symmetric Matrix,  Invertible Matrix

Uniqueness Theorem

h b f

g  2 + i 1 3  f , 1 3 + 2i  2 c   3 3 + 2i 4 

Scan to know more about this topic





AT = –[A] i.e., if A = [aij], then AT = [aji] = – [aij] or AT = – A.  0 1 −5  0 2 5 , For example :  −1 0  5 −5 0   −2 0   



Symmetric Matrix



Skew symmetric matrix: A square matrix A = [aij] is said to be a skew symmetric matrix if

Orthogonal matrix: A matrix A is said to be orthogonal if A.AT = I, where AT is transpose of A.













Note that [aji] = – [aij] or [aii] = – [aii] or 2[aii] = 0 (Replacing j by i). i.e., all the diagonal elements in a skew symmetric matrix are zero. For any matrices, AAT and ATA are symmetric matrices. For a square matrix A, the matrix A + AT is a symmetric matrix and A – AT is always a skewsymmetric matrix. Also note that any square matrix can be expressed as the sum of a symmetric and a skew symmetric matrix i.e., A = P + Q where A + AT P = 2

 5 −2  B =  −2 1     1 2   5 −2  1 0 Now, AB =  2 5   −2 1  = 0 1      







Invertible Matrix: An invertible matrix is a matrix for which matrix inversion operation exists, given that it satisfies the requisite conditions. Any given square matrix A of order n × n is called invertible if there exists another n × n square matrix B such that, AB = BA = In, where In is on identity matrix of order n × n. 1 2 Example: Let matrix A =  2 5  and matrix  

Key Fact



















a h g 

Hence, A–1 = B and B is called the Scan to know more about inverse of A. this topic So, A can also be the inverse of B or B–1 = A. Uniqueness of Inverse of Matrix If there exists an inverse of a Uniqueness of Inverse square matrix, it is always unique. Proof: Let A be a square matrix of order n × n. Let us assume matrices B and C be inverses of matrix A. Now, AB = BA = I, since B is the inverse of matrix D. Similarly, AC = CA = I But, B = BI = B(AC) = (BA)C = IC = C This proves B = C, or B and C are the same matrices.



For example :

 5 −2   1 2  1 0 and BA =  −2 1   2 5  = 0 1      



Symmetric matrix: A square matrix A = [aij] is said to be a symmetric matrix if AT = A. i.e., if A = [aij], then AT = [aji] = [aij] or AT = A.







Revision Notes

and Q =

is a symmetric matrix

A − AT is a skew symmetric matrix. 2

4

DETERMINANTS

Topic-1

Determinants, Minors & Co-factors Concepts Covered 



Determinant value of a matrix,  Co-factor and Minor of a matrix

Inverse of matrix using Adjoint method,  Area of triangle with the help of determinant

Revision Notes





















•







•

•













2.

 15 −10 −1  −2 −1 2   −6 4 −1   SINGULAR MATRIX AND NON-SINGULAR MATRIX: (a) Singular matrix: A square matrix A is said to be singular if |A|= 0 i.e., its determinant is zero.







4.



For example, consider a square matrix of order 3 as 1 2 3 2 3 4  A =   , then in order to find theadjoint 2 0 5 matrix A, we find a matrix B (formed by the cofactors of elements of matrix A as mentioned above in the definition)  15 −2 −6   −10 −1 4  i.e., B =   . Hence, adj A = BT =  −1 2 −1







3.



1. ADJOINT OF A SQUARE MATRIX: Let A = [aij] be a square matrix. Also, assume B = [Aij], where Aij is the cofactor of the elements aij in matrix A. Then the transpose BT of matrix B is called the adjoint of matrix A and it is denoted by “adj (A)”. To find adjoint of a 2 × 2 matrix: Follow this, A = a b   d −b   c d  or adj A =  − c a  .









and its value is given by ad – bc. (b) Minors: Minors of an element aij of a determinant (or a determinant corresponding to matrix A) is the determinant obtained by deleting its ith row and jth column in which aij lies. Minor of aij is denoted by Mij. Hence, we can get 9 minors corresponding to the 9 elements of a third order (i.e., 3 × 3) determinant. (c) Co-factors : Cofactor of an element aij, denoted by Aij, is defined by Aij = (–1)(i + j) Mij, where Mij is minor of aij. Sometimes Cij is used in place of Aij to denote the co-factor of element aij.



a b of matrix A is written as |A| = c d = det (A)

1 2 3  more about this topic e.g. A =  4 5 12  1 1 3    = 1(15 – 12) – 2(12 – 12) + 3(4 – 5) =3–0–3=0 Inverse of a \ A is singular matrix. 3 × 3 Matrix  −3 4  B=  = 12 – 12 = 0 using Adjoint  3 −4  Scan to know \ B is singular matrix. more about (b) Non-singular matrix: A square this topic matrix A is said to be nonsingular if |A| ≠ 0 . 0 1 1 e.g. A =  1 0 1  1 1 0 Matrices   Determinant = 0 (0 – 1) – 1(0 – 1) + 1(1 – 0) Part - 1 =0+1+1=2≠0 Scan to know \ A is non-singular matrix. more about • A square matrix A is invertible this topic if and only if A is non-singular. ALGORITHM TO FIND A–1 BY DETERMINANT METHOD: STEP 1: Find |A|. STEP 2: If |A| = 0, then, write Matrices “A is a singular matrix and hence Determinant Part - 2 not invertible”. Else write “A is a non-singular matrix and hence invertible”. Scan to know STEP 3: Calculate the co-factors of more about this topic elements of matrix A. STEP 4: Write the matrix of co-factors of elements of A and then obtain its transpose to get adj.A (i.e., adjoint A). STEP 5: Find the inverse of A by Matrices . 1 Determinant adj A ( ) –1 using the relation A = | A | Part - 3 AREA OF TRIANGLE: Area of a triangle whose vertices are (x1, y1), (x2 , y2) and (x3, y3) is given by, x y1 1 sq. units 1 1 D = x2 y2 1 2 x y 1 3 3











Scan to know





Determinants, Minors & Co-factors (a) Determinant: A unique number (real or complex) can be associated to every square matrix A = [aij] of order m. This number is called the determinant of the square matrix A, where aij = (i, j)th element of A. a b  For instance, if A =  c d  then, determinant  

Since area is a positive quantity, we take absolute value of the determinant. If the points (x1, y1), (x2 , y2) and (x3, y3) are collinear, then Δ = 0. The equation of a line passing through the points



MATHEMATICS

209

210

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

(x1, y1) and (x2, y2) can be obtained by the expression given here:

y y1 y2

1 1 =0 1



x x1 x2

Solutions of System of Linear Equations

Topic-2

Concepts Covered



Unique Solution,  Consistent System,  Inconsistent System

Revision Notes



Mnemonics-1 Inverse of a Square Matrix



















SOLVING SYSTEM OF EQUATIONS BY MATRIX METHOD [INVERSE MATRIX METHOD] (a) Homogeneous and Non-homogeneous system : A system of equations AX = B is said to be a homogeneous system if B = O. Otherwise it is called a non-homogeneous system of equations. Scan to know more a1x + b1y + c1z = d1, about a2x + b2y + c2z = d2, this topic a3x + b3y + c3z = d3 STEP 1 : Assume  a1 A =  a2 a  3

c1  c2  , B = c3 

b1 b2 b3

 d1  d2  and X = d   3

Matrices – System of Linear Equations (Part 1)





Singular Matrix A square matrix is said to be singular matrix if determinant of matrix denoted by |A| is zero otherwise it is non pingular matrix Inverse Of a Matrix Determinant

"a Determined Artist Can become a Singer, if he is Optimistic.

(Zero)

"a Determined Artist Can Never be Singer if he is Not Optimistic Non Singular if | A | = O, then A is Singular Otherwise, A is non-Singular

≠0 (Zero)













STEP 2 : Find |A|. Now there may be following situations : (i) |A| ¹ 0 ⇒ A–1 exists. It implies that the given system of equations is consistent and therefore, the system has unique solution. In that case, write AX = B ⇒ X = A–1B   1 −1 ( adj A )  where A = A   Then by using the definition of equality of matrices, we can get the values of x, y and z. (ii) |A| = 0 ⇒ A–1 does not exist. It implies that the given system of equations may be consistent or inconsistent. In order to check proceed as follow: ⇒ Find (adj A) B. Now, we may have either (adj A) B ≠ O or (adj A) B = O. Scan to know more • If (adj A)B = O, then the about given system may be this topic consistent or inconsistent. To check, put z = k in the given equations and proceed in the same manner in the new Matrices – System two variables system of of Linear Equations (Part 2) equations assuming di – cik, 1 £ i £ 3 as constant. • And if (adj A) B ¹ O, then the given system is inconsistent with no solutions.























x y . z  

Mnemonics-2

"If Determined Artist is Not Optimistic then ADJust Below International Adjoint

By

Inverse

Musicians" Determinant

Matrix

"A is non-singular i.e. | A | ≠ 0 then A–1 =

1 . (adj A) |A|

Interpretation : Singular & Non Singular Matrix if |A| = 0, then A is singular. Otherwise A is non-singular Inverse of a Matrix– Inverse of a Matrix exists if A is non- singular i.e |A| ≠ 0,and is given by A

−1

=

1

|A|

adj A

UNIT-VI: CALCULUS

5

CONTINUITY & DIFFERENTIABILITY

Topic-1

Continuity Concepts Covered



Left hand Limit,  Right Hand Limit

Revision Notes

(a)



lim cos x = 1

(b) lim

x →0

x →0

sin x =1 x

(c)

tan x =1 x →0 x

(e)

tan −1 x =1 x →0 x

lim

sin −1 x =1 x →0 x



(d) lim

lim f ( x ) is Left Hand Limit x → m− lim f ( x ) of f(x) at x = m and x → m+ is Right Hand Limit of f(x) at x = m. Also f(m) is the value of function f(x) at x = m.  A function f(x) is continuous at x = m (say) if, f(m) =

lim

ax − 1 = log e a , a > 0 x →0 x

(f) lim

f(x) i.e., a function is continuous at a point in its domain if the limit value of the function at that point equals the value of the function at the same point.  For a continuous function













x →m





 For a function f(x), lim f(x) exists if f(x) = lim f(x).

lim f(x) at x = m, x →m f(x) can be directly obtained by evaluating f(m).

lim

x → m−



 A function f(x) is continuous at a point x = lim f ( x ) = lim f ( x ) = f ( m) , where m if,

Scan to know more about this topic

Example : continuity at a point

 Indeterminate forms or meaningless forms: 0 ∞ , , 0 × ∞ , ∞ − ∞ , 1∞ , 0 0 , ∞0 . 0 ∞





x → m+

x → m+



x → m−



x n − an = nan −1 x→a x − a lim



(i)

Definition Continuity



e −1 =1 (g) lim x →0 x



log e (1 + x ) =1 (h) lim x →0 x

x

Scan to know more about this topic

lim

x →m























FORMULAE FOR LIMITS:

Concepts Covered 











d ( k ) = 0 , where k is any constant dx d x (d) (e ) = ex dx d 1 (f) (log e x ) = x dx d (h) (cos x ) = − sin x dx



Introduction to Differentiation Part - 1 Scan to know more about this topic













d (sec x ) = sec x tan x dx d (l) ( cosec x ) = −cosec x cot x dx (j)







d (sin x ) = cos x dx d (i) (tan x ) = sec 2 x dx d (k) (cot x ) = −cosec 2 x dx (g)

Scan to know more about this topic









Left Hand Derivative,  Right Hand Derivative,

(b)





Derivative of Some Standard Functions: d n (a) ( x ) = nx n −1 dx d x (c) ( a ) = a x log e a , a > 0 dx d 1 1 (log = = log a e a x) (e) dx x log e a x



Relation between Continuity and Differentiability



Topic-2

Differentiability

Differentiability

f t ,y

g t be two functions of parameter 't'. dy dy dt dy dy dx  dx  . Then, or dx dx dt dx dt  dy  0  dt dy g ' t (provided f '( t ) π 0) Thus, dx f ' t dx y a eg : if x a then – a sin and d a cos dy dy dy / d a cos , and so – cot . d dx dx / d a sin

(v)

1

1 1 x2

x x2 1

–

(viii)

First Level

Second Level

Third Level

d log x dx

d (vi) cos e c 1 x dx 1 – x x2 1 d x e ex (vii) dx

Trace the Mind Map

d sec 1 x dx

d cot 1 x dx



(iv)

1 1 x2

d (iii) tan 1 x dx



1 – x2

–

1

1 – x2

1

d cos 1 x (ii) dx

d sin -1 x (i) dx



Let y

1 x

f x then dy f ' x , if f ’ x is dx d dy d differentiable, then f ' x i.e., dx dx dx d2y f " x is the second order derivative of y w.r.t.x. dx 2 eg : if y = 3x2+2, then y'= 6x and y"= 6.

Let x

Derivatives of functions in parametric form

ty

ntinuity and o C erentiabi li iff

Some Standard derivatives

y u x

v x

v x

u' x

v ' x log [u(x)]

v ' x log u x

1 u' x u x

v x log u x

e.g. : Let y ax Then log y = x log a 1 dy . log a y dx dy y log a a x log a. dx

dy dx

1 dy . y dx

log y

Let y=f(x)=[u(x)]v(x)

dv dt . . dt dx

or,

dx

dy =– sin x – cos y.

dx

dy or,

dx

dy

(2n+1)

dy d d = cos x – sin y dx dx dx =– sin x / 1 cos y , where y

For example: Let y =cos x – sin y, then

If two variables are expressed by some relation then one will be the implicit function of other, is called Implicit function.

Derivatives of Implicit functions

Logarithmic differentiation

Chain Rule

df dt dv exists, then , dx dx dt

but the converse is not true.

point in its domain. The derivative of f c h –f c f at c is f ' c lim h 0 h Every differentiable function is continuous,

Suppose f is a real function and c is a

If f=vou, t=u(x) and if both

Differentiability

Algebra of continuous functions

Continuous Function

Suppose f and g are two real functions continuous at a real number c, then, f+g, f–g, f.g and f are continuous at g x=c[g(c)

Suppose f is a real function on a subset of the real numbers and let 'c' be a point in the domain of f. f x f c Then f is continuous at c if lim x c A real function f is said to be continuous if it is continuous at every point in the domain of f. 1 eg: The function f x , x 0 is continuous x 1 1 1 Let 'c' be any non-zero real number, then lim f ( x ) lim . For c 0, f c So lim f x f c x c x c x c x c c and hence f is continuous at every point in the domain of f.

Second order derivative

D

212 Oswaal CBSE LMP (Last Minute Preparation), Class-XII

MATHEMATICS





1 d  1 =−     x2 dx x









( x ) = 2 1x

 Quotient Rule of derivatives: d d d  u  v dx (u) − u dx ( v ) vu '− uv ' . = = dx  v  v2 v2



be

Mnemonics



 Left Hand Derivative of f(x) at x = m, f ( x ) − f (m) and, Lf ’(m) = lim x−m x → m− Right Hand Derivative of f(x) at x = m, f ( x ) − f ( m) Rf ’(m) = lim x−m x → m+ For a function to be differentiable at a point, LHD and RHD at that point should be equal. dy δy = lim .  Derivative of y w.r.t. x: dx δx → 0 δx













(ii)

d dx

also



d 1 ( cosec -1x ) = , where x Î( -¥ , -1) È (1, ¥ ) dx x x2 - 1





(r)





d 1 (sec -1 x ) = , where x Î( -¥ , -1) È (1, ¥ ) dx x x2 - 1

(i)













(q)

Following derivatives should memorized by you for quick use:





d 1 (tan −1 x ) = , x ∈R dx 1 + x2 d 1 (p) (cot −1 x ) = − , x ∈R dx 1 + x2

(o)

Relation between Continuity and Differentiability: (i) If a function is differentiable at a point, it is continuous at that point as well. (ii) If a function is not differentiable at a point, it may or may not be continuous at that point. (iii) If a function is continuous at a point, it may or may not differentiable at that point. (iv) If a function is discontinuous at a point, it is not be differentiable at that point. Rules of Derivatives:  Product or Leibniz's rule of derivatives: d d d (uv ) = u ( v ) + v (u) dx dx dx

d 1 (cos−1 x ) = − , x ∈( −1, 1) dx 1 − x2



(n)

213

Also, for very-very small value h, f ’(x) = f ( x + h) − f ( x ) , (as h ® 0) h



d 1 (sin −1 x ) = , x ∈( −1, 1) dx 1 − x2



(m)









Quotient Rule of Derivative Ho D Hi Minus Hi D Ho Over Ho Ho In mathematical notation,

Ho D Hi - Hi D Ho ho ho

where, Ho ® function in numerator Hi ® function in denominator D ® derivative of

6

APPLICATIONS OF DERIVATIVES

Topic-1 Rate of Change of Bodies Revision Notes



Topic-2



Thus, the rate of change of y with respect to x can be calculated by using the rate Scan to know more about of change of y and that of x both this topic with respect to t. Also, if y is a function of x and they are related as y = f(x) then, f'(a), i.e., represents the rate of change of y with respect to x at the instant Interpretation when x = a.



dy as a rate measure: dx If two variables x and y are varying with respect to another variables say t, i.e., if x = f(t), then by the Chain Rule, we have dy dy / dt dx = , ¹0 dx dx / dt dt

Interpretation of

Increasing/Decreasing Functions Concepts Covered 



Increasing function,  Decreasing function,  Constant function

Monotonic function

Revision Notes





3. Finding the intervals of increasing and/or decreasing of a function:





ALGORITHM



Scan to know more about this topic



STEP 1: Consider the function y = f(x).



If f’(x) £ 0 lies in (a, b), then f(x) is a decreasing function in [a, b] provided f(x) is continuous at x = a and x = b.  A function f(x) is a constant function in [a, b] if f ’(x) = 0 for each x Î (a, b).

Scan to know more about this topic



STEP 2: Find f ’(x). STEP 3: Put f ’(x) = 0 and solve to get the critical point(s).



Increasing & Decreasing Functions

Increasing & Decreasing Functions

STEP 4: The value(s) of x for which f ’(x) > 0, f(x) is increasing; and the value(s) of x for which f ’(x) < 0, f(x) is decreasing.





If f ’(x) ³ 0 lies in (a, b), then f(x) is an increasing function in [a, b], provided f(x) is continuous at x = a and x = b. 2. A function f(x) is said to be a decreasing function in [a, b], if, as x increases, f(x) decreases i.e., if a, b Î [a, b] and a > b Þ f(a) < f(b).

 By monotonic function f(x) in interval I, we mean that f is either only increasing in I or only decreasing in I.







1. A function f(x) is said to be an increasing function in [a, b], if as x increases, f(x) also increases i.e., if a, b Î [a, b] and a > b, f(a) > f(b).

Topic-3

Maxima and Minima Concepts Covered 



Local Maxima,  Local Minima,  Absolute Maxima,

Absolute Minima,  First derivative test,  Second derivative test

Revision Notes Key Word



1. Understanding maxima and minima: Consider y = f(x) be a well defined function on an interval I, then

Interval: In mathematics, an interval is a set of real numbers between two given numbers called end points of the interval.



MATHEMATICS

215

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

















Scan to know (a) f is said to have a maximum more about value in I, if there exists a point this topic c in I such that f(c) > f(x), for all x Î I. The value corresponding to f(c) is called the maximum value of f in I and the point c is Maxima and called the point of maximum Minima word value of f in I. Problems (b) f is said to have a minimum value in I, if there exists a point c in I such that f(c)

< f(x), for all x Î I. The value corresponding to f(c) is called the minimum value of f in I and the point c is called the point of minimum value of f in I. (c) f is said to have an extreme value in I, if there exists a point c in I such that f(c) is either a maximum value or a minimum value of f in I. The value f(c) in this case, is called an extreme value of f in I and the point c called an extreme point.

216

Know the Terms through c, then x = c is neither a point of local maximum nor a point of local minimum. Rather in this case, the point x = c is called the point of inflection.

















4. Second Derivative Test: Consider y = f(x) be a well defined function on an open interval I and twice differentiable at a point c in the interval. Then we observe that:  x = c is a point of local maxima if f ’(c) = 0 and f”(c) < 0. The value f(c) is called the local maximum value of f.  x = c is a point of local minima if f ’(c) = 0 and f”(c) > 0 The value f(c) is called the local minimum value of f. This test fails if f ’(c) = 0 and f”(c) = 0. In such a case, we use first derivative test as discussed above. 5. Absolute maxima and absolute minima: If f is a continuous function on a closed interval I, then f has the absolute maximum value and f attains it atleast once in I. Also f has the absolute minimum value and the function attains it atleast once in I.









ALGORITHM STEP 1: Find all the critical points of f in the given interval, i.e., find all the points x where either f’(x) = 0 or f is not differentiable. STEP 2: Take the end points of the given interval. STEP 3: At all these points (i.e., the points found in (STEP 1 and STEP 2) calculate the values of f. STEP 4: Identify the maximum and minimum value of f out of the values calculated in STEP 3. This maximum value will be the absolute maximum value of f and the minimum value will be the absolute minimum value of the function f. Absolute maximum value is also called as globalmaximum value or greatest value. Similarly absolute minimum value is called as global

























1. Let f be a real valued function and also take a point c from its domain, then (i) c is called a point of local maxima if there exists a number h > 0 such that f(c) > f(x), for all x in (c – h, c + h). The value f(c) is called the local maximum value of f. (ii) c is called a point of local minima if there exists a number h > 0 such that f(c) < f(x), for all x in (c – h, c + h). The value f(c) is called the local minimum value of f. 2. Critical points It is a point c (say) in the domain of a function f(x) at which either f ’(x) vanishes i.e., f’(c) = 0 or f is not differentiable. 3. First Derivative Test: Consider y = f(x) be a well defined function on an open interval I. Now proceed as have been mentioned in the following algorithm: dy STEP 1: Find . dx dy STEP 2: Find the critical point(s) by putting = 0. dx Suppose c Î I (where I is the interval) be any critical point point and f be continuous at this point c. Then we may have following situations : dy  changes sign from positive to negative as x dx increases through c, then the function attains a local maximum at x = c. dy  changes sign from negative to positive as x dx increases through c, then the function attains a local minimum at x = c. dy  does not change sign as x increases dx

minimum value or the least value.

7

INTEGRALS Indefinite Integral

Topic-1

Concepts Covered 



Meaning of Integral of function



Integration by Substitution

Integration by partial fraction  Integration by parts  Formulae for indefinite Integral

Revision Notes



polynomial function.  If the degree of numerator i.e., f(x) is greater than or equal Integrals Part 1 to the degree of denominator (Introduction) i.e., g(x) then, this type of rational function is called an improper rational function. And if degree of f(x) is smaller than the degree of denominator i.e., g(x), then this type of rational function is called a proper rational function.  In rational polynomial function if the degree (i.e., highest power of the variable) of numerator (Nr.) is greater than or equal to the degree of denominator (Dr.), then (without any doubt) always perform the division i.e., divide the Nr. by Dr. before doing anything and thereafter use the following: Numerator Remainder = Quotient + Denominator Denominator



∫ f [ g(t )]g ’(t )dt



u=

Table Demonstrating Partial Fractions or Various Forms Form of the Rational Function

Form of the Partial Fraction

px + q ,a ≠ b ( x − a )( x − b )

A B + x−a x−b

px + q ( x − a )2

A B + x − a ( x − a )2

px 2 + qx + r ( x − a )( x − b )( x − c )

A B C + + x−a x−b x−c

px 2 + qx + r ( x − a )2 ( x − b )

A B C + + x − a ( x − a )2 x − b

px 2 + qx + r ( x − a )( x 2 + bx + c )

where x2 + bx + c can't be factorized further.

will

give us the same result as obtained by putting g(t) in place of x and g’(t)dt in place of dx. (b) Integration by Partial Fractions: Scan to know more about f (x) Consider defines a rational this topic g( x )















or

∫ f (x)









∫ f ( x )dx ,

where independent variable is x, to another integral in which independent variable is t (say) different from x such that x and t are related by x = g(t). du = f (x) Let u = ∫ f ( x )dx then, dx dx = g ’(t ) Again as x = g(t) so we have dt du du dx Now = • = f(x)·g’(t) dt dx dt On integrating both sides w.r.t. t, we get  du  ∫  dt  dt = ∫ f ( x ) g ’(t )dt













In this method, we change the integral

∫ f ( x )dx = ∫ f [ g(t )]g ’(t )dt , where x = g(t).

So, it is clear that substituting x = g(t) in



Therefore, we can say that integration is the inverse process of differentiation. Methods of Integration (a) Integration by Substitution Method :



i.e.,







Meaning of Integral of Function If differentiation of a function F(x) is f(x) i.e., if d [F(x)] = f(x), then we say that one integral or dx primitive or anti-derivative of f(x) is F(x) and in symbols, we write, ∫ f ( x )dx = F( x ) + C.

A Bx + C + x − a x 2 + bx + c

–/ 4



/4

2



(ii)  kf x dx  k  f x dx ,

2 x dx  x 3 x 2 c , where c is real.

dx   f x dx   g x dx ,

2

2

1

2

d

1

2

First Level

Second Level

Trace the Mind Map

Let the area function be defined by x A x   f x dxx a , a where f is continuous on a , b  then A ' x  f x x a , b .

1





Integration by parts

Third Level

Definite integral as the limit of a sum

0

 sin

/4 2



2

 0

2

x n 1

–1

x c

–1

2

(x)

 1 x 2  tan (xi) 

P x 

Second fundamental theorem of integral calculus



A B C x – a x – a 2 x – b

of f over the range [a, b], where a and b are called the limits of integration, a being the lower limit and b be the upper limit.

a

Let f be a continuous function of x defined on [a, b] and let F be d F x   f x x domain of f1 then dx b b  f x dx [F x  c[ a  F b – F a . This is called the definite integral

d ( ax 2 bx c ) B dx 2 ax 2 bx c ax bx c

2

x – a  x – b 

px 2 qx r

A Bx C x – a x 2 bx c

(iii)

another function such that

A

x – a x 2 bx c 



A B x – a x – a 2 px 2 qx r



Px q  (v) ax 2 bx c

(iv)

2

x  a 

px q

it in the following forms –

by expressing Q x  px q A B  , a , b  0. (i) x – a x – b  x – a x – b

P1 x 

P1 x

[Q x   0 [  T x  Q x  , Q x 

P1 x  has degree less than that of Q(x). We can integrate

A rational function of the form

(ii)

–1

dx  – cot –1 x c 1 x2 x a (xii)  e x dx  e x c (xiii)  a x dx  c log a dx –1 dx –1 (xiv)   sec x c (xv)  x x 2 – 1  – cosec x c x x2 – 1 (xvi) 1 dx  log x c x

dx

n

/4

 1 sin 2 x    –  x – 4 2 2  0 

 x dx  n 1 c , n  –1 like,  dx  x c (ii)  cos x dx  sin x c (iii)  sin x dx   cos x c (iv)  sec x dx  tan x c (v) cosec x dx =– cotx + c  (vi)  sec x tan x dx  sec x c (vii)  cosec x cot x dx   cosec x c dx dx  sin x c (viii)  (ix)   – cos x c 1 – x2 1 – x2

 1 – cos 2x dx

/4

Some standard integrals

Integration by partial fractions

Example

0

/4  1 – cos 2 x  x dx  2    dx 

Integrals

Integration by substitution

Integration of some special functions

First fundamental theorem of integral calculus

 f x  f x dx  f x  f x dx –   dx f x  f x dx  dx

x

dx 1 a x dx 1 x–a  log c  log c (ii)  2 a – x 2 2a a–x – a 2 2a x a dx dx 1 2 2 –1 x (iii)  x 2 a2  a tan a c (iv)  x 2 – a2  log x x – a c dx x dx  sin –1 c  log x x 2 a 2 c. (v)  2 (vi)  a a – x2 x 2 a2 2 (vii) x 2 – a 2 dx  x x 2 – a 2 – a log x x 2 – a 2 c.  2 2 x 2 a2 2 2 x a 2 log x x 2 a 2 c. (viii)  x a dx  2 2 2 (ix) a 2 – x 2 dx  x a 2 – x 2 a sin –1 x c.  2 2 a

  sec xdx  log sec x tan x c  cosec xdx  log cosec x – cot x c.

The method in which we change the variable to some other variable is called the method of substitution. Below problems can be solved by substitution. tan xdx  log sec x c  cot xdx  log sin x c

 3x

 f x   g x 

eg :

(i)



Integration

sin 2 x dx  2

d F x  f ( x ). Then, f(x)dx=F(x)+c,'c': dx constant of integral. These integrals are called indefinite or general integrals. Properties of indefinite integrals are

It is the inverse of differentiation. Let,



218 Oswaal CBSE LMP (Last Minute Preparation), Class-XII



MATHEMATICS

∫ U , V dx ( I ) ( II )

 dU  = U ∫ Vdx − ∫  ∫ Vdx  dx  dx







(c) Integration by Parts : If U and V be two functions of x, then

219

Key Formulae 1

∫ x dx = log| x | +C

(d)

∫e



(b)

1

∫ tan xdx = log|sec x | +C



(g)

(f)

∫ sin(ax )dx = − a cos( ax ) + C

(h)



or – log|cos x| + C





(e)

1 dx = e ax + C a 1 ∫ cos( ax )dx = a sin( ax ) + C ax

∫ cot xdx = log|sin x | +C

or – log |cosec x| + C























Formulae for Indefinite Integrals x n +1 (a) ∫ x n dx = + C , n ≠ −1 n+1 1 x x (c) ∫ a dx = log a a + C



∫ sec xdx = log|sec x + tan x | +C



(i)

∫ cosec xdx = log|cosec x − cot x | +C

or log tan



(j)

x +C 2

∫ sec xdx = tan x + C ∫ sec x.tan xdx = sec x + C 2



(n)

Scan to know more about this topic







(m)

∫ cosec xdx = − cot x + C ∫ cosec x.cot xdx = −cosec x + C 2

(l)







(k)





π x or log tan  +  + C 4 2

∫

x dx = sin −1   + C a a −x

x−a 1 1 ∫ x 2 − a2 dx = 2a log x + a + C

(t)

∫

(v)

∫ ax + b dx = a log| ax + b | +C

(x)

∫

x 2 − a 2 dx =

x 2 a2 x − a 2 − log x + x 2 − a 2 + C 2 2

∫

a 2 − x 2 dx =

x 2 a2 x a − x 2 + sin −1   + C a 2 2

Topic-2







∫

x 2 + a 2 dx =

x 2 a2 x + a 2 + log x + x 2 + a 2 + C 2 2

2

1 x + a2 2

1

(z)

(y)



∫ λdx = λx + C , where 'l' is a constant.



2

(w)



(r)



dx = log x + x 2 − a 2 + C

1

2

∫a



2

1 1 x dx = tan −1   + C a + x2 a

(p)



x −a 2





1

∫





(u)



dx = sec −1 x + C







(s)



x2 − 1

a+x 1 1 ∫ a2 − x 2 dx = 2a log a − x + C

(q)



1



∫x

(o)

Integrals Part 2 (Introduction Continued)

dx = log x + x 2 + a 2 + C 1

Definite Integral Concepts Covered



Second fundamental theorem,



Properties of definite integral.







Revision Notes Meaning of Definite Integral of Function If ∫ f ( x )dx = F( x ) i.e., F(x), be an integral of f(x), then F(b) – F(a) is called the definite integral of f(x) between the limits a and b and in symbols it b

is written as

∫ f ( x )dx

=

a

[ F( x )]ba .

Moreover,

definite integral gives a unique and definite value (numeric value) of anti-derivative of the function between the given intervals. It acts as a substitute for evaluating the area analytically.

the

Key Formulae (b)

ò

b

f ( x )dx = F( b ) - F( a )

∫ a

a







b

(a)

a

f ( x )dx = − ∫ f ( x )dx b

220

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Key Formulae b

ò

f ( x )dx = F( b ) - F( a )

b

a

b

(b)





(a)

∫ b

c

b

a

c

a

Scan to know more about this topic

b



a

a

f ( x )dx = − ∫ f ( x )dx





∫ f ( x )dx = ∫ f ( x )dx + ∫ f ( x )dx , a < c < b a

b



a

(d)

(dx = dt)



∫ f ( x )dx = ∫ f (t )dt

(c)

0

0





a

a

∫ f ( x )dx = ∫ f ( a + b − x )dx

Definite Integration

 2 f ( x )dx , if f (x ) is an even function i.e., f ( − x ) = f (x ) ∫ f ( x )dx =  ∫0  −a 0 , if f (x ) is an odd function i.e., f ( − x ) = − f (x )  a

∫

−a

∫ 0

a

f ( x )dx = ∫ { f ( x ) + f ( − x )} dx 0

(i)

a

2a

(j)

(f)







(h)



a

a

(g)



a

∫ f ( x )dx = ∫ f ( a − x )dx

b







(e)

b

2a

∫ 0

 a 2 f ( x )dx , if f (2a − x ) = f (x ) f ( x )dx =  ∫  00 ; if f (2a − x ) = − f (x ) 

2a

f ( x )dx = ∫ { f ( x ) + f ( 2 a − x )} dx 0

Mnemonics SeCond FundAmental Theorem of Definite Integration

fcc

Fad

Continuous Closed

anti

FbFa derivative

You can also remember

fcc is small fashionable Clothes Counter For adorable dresses at Fbb Fashion Closed

anti

Continuous derivative F(b) – F(a)

Interpretation : Let f be a continuous function defined on a closed interval [a,b] and F be an anti derivative of f. Then

∫

b a

f ( x ) dx = [ F( x )] ba = F( b ) − F( a ) , where a and b are called limit of Integration.

8

APPLICATIONS OF THE INTEGRALS

Revision Notes



b

b

a

a

Scan to know more about this topic

then f(x) < 0 from x = a to x = b, the area bounded by the curve y = f(x) and the ordinates x = a, x = b and X-axis is negative. But, if the numerical value of the area is to be taken into consideration, then





 Area Under Simple Curves : (i) Let us find the area bounded by the curve y = f(x), X-axis and the ordinates x = a and x = b. Consider the area under the curve as composed by large number of thin vertical strips. Let there be an arbitrary strip of height y and width dx. Area of elementary strip dA = y dx, where y = f(x). Total area A of the region between X-axis ordinates x = a, x = b and the curve y = f(x) = sum of areas of elementary thin strips across the region PQML. A = ∫ y dx = ∫ f ( x ) dx

b

∫a f ( x )dx



Area =

Area under simple curve

Y

dx

L

x=b X

M

y=f(x)

(ii) The area A of the region bounded by the curve x = g(y), y-axis and the lines y = c and y = d is given by

Y

c

c



A = ∫ x dy = ∫ g ( y ) dy Y y=d dy

x

x = g(y)

y=c X

(iii) If the curve under consideration lies below X-axis,





O

(iv) It may also happen that some portion of the curve is above X-axis and Scan to know more about some portion is below X-axis this topic as shown in the figure. Let A1 be the area below x-axis and A2 be the area above Area under the X-axis. Therefore, area simple curve bounded by the curve y = f(x), X-axis and the ordinates x = a and x = b is given by

d



d

X

x=b

x=a

y

O





O

Q

x=a

y=f(x)

P

A = |A1| + |A2|

222

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

9

DIFFERENTIAL EQUATIONS

Topic-1

Basic Differential Equations Concepts Covered 



Order of differential Equation

Degree of differential Equation



Orders and Degrees of Differential Equation : suffix therefore, we use the notation yn for nth We shall prefer to use the following notations dny order derivative for derivatives. dx n . dy d2y d3y Order and degree (if defined) of a differential = y', = y'', = y''' dx dx 2 dx 3 equation are always positive integers. For derivatives of higher order, it will be in convenient to use so many dashes as super Order of a differential equation: It is the order of the highest order derivative appearing in the differential equation. Degree of a differential equation: It is the degree (power) of the highest order derivative, when the differential coefficients are made free from the radicals and the fractions.

l



l





l





l



l







l







Revision Notes

Topic-2

Scan to know more about this topic

Scan to know more about this topic

First order differential equations

Differential Equations Introduction Part-1

Variable Separable Methods Concepts Covered



Method

General Solution,



Particular Solutions ,



Variable Separable

Revision Notes differential equation





(b) Particular Solution : Solution obtained by giving particular values to the arbitrary constants in the general solution of a differential equation is called a particular solution e.g. y = 3 cos x + 2 sin x is a particular solution of the

Topic-3





d2y dx 2

+ y = 0.

(c) Solution of Differential by Variable Separable Method : A variable separable form of the differential equation is the Scan to know one which can be expressed more about this topic in the form of f(x)dx = g(y) dy. The solution is given by ∫ f ( x )dx = ∫ g( y )dy + k , where k is the constant of integration.



 Solutions of differential equations : (a) General Solution : The solution which contains as many as arbitrary constants as the order of the differential equations, e.g. y = a cos x + b sin d2y + y = 0. x is the general solution of dx 2

Linear Differential Equations Concepts Covered



Variable Separable Form

Linear Differential Equations in x only and in y only

Revision Notes Solutions of Differential Equations:  Linear differential equation in y : It is of the







dy + P( x ) y = Q( x ) ,where P(x) and Q(x) dx are functions of x only. form

224

Oswaal CBSE LMP (Last Minute Preparation), Class-XII





Factor (I.F.) = e ∫ P( x )dx . STEP 3 : The solution is given by, y.(I.F.) = Q( x ).( I .F.) dx + k , where ò k is the constant of integration.



 Linear differential equation in x : It is of the form dx + P( y )x = Q( y ) , where dy







P(y) and Q(y) are functions of y only. Solving Linear Differential Equation in x : STEP 1 : Write the given form differential equation in the dx + P( y )x = Q( y ) dy .

225

STEP 3 : The solution is given by, x.(I.F.) = ò Q( y ).( I.F.) dy + l , where l is the constant of integration.



Solving Linear Differential Equation in y : STEP 1 : Write the given differential equation in the dy + P( x ) y = Q( x ). form dx STEP 2 : Find the Integration









MATHEMATICS

Mnemonics

Scan to know more about this topic

Linear Differential Equations

FOLDE - DYBDX - PYQ Linear Differential Equations

Family Of

Scan to know more about this topic

Daily

Yoga

Purana Differential Equations of First Order & First Degree

First

Liladhar Dixit Enjoying By

Yog

Order

Dr.

Xavier

at

Qila

Linear

Differential

Equation

dy + Py = Q dx



STEP 2 : Find the Integration Factor (I.F.) = e∫P(y)dy.

SOLDE-YIF-EIQ-IFC

Son Of Liladhar Dixit Eklavya (SOLDE) & WIFe (Y I F) Exploring Indian Qilla for International Fitness Certificate Integration

y. IF = Q. I F + C S — Solution

D — Differential

O — Of

E — Equation

L — Linear

Interpretation : dy

+py=Q , where P and Q are constants or the function of 'x' is called a first Differential equation is of the form dx order linear differential equations. Its solution is given as

Y.IF= ∫ Q.IF+C

Topic-4

Homogeneous Differential Equations Concepts Covered

first degree



Solution of Homogenous Differential Equation of first order and

 Identifying equation :

Homogeneous Differential Equations and their solution :







Revision Notes a

Homogeneous

Differential

Oswaal CBSE LMP (Last Minute Preparation), Class-XII





x = vy dv dx =v+y dy dy

Homogenous Different Equation

or







Put



CASE II : If

Solving a Homogeneous Differential Equation: dy CASE I : If = f(x, y) dx



Scan to know more about this topic



or



Concept

y = vx dy dv =v+x dx dx dx = f(x, y) dy



Put



STEP 2 : If f(kx, ky) = knf(x, y), then the given differential equation is homogeneous of degree ‘n’.

Scan to know more about this topic



STEP 1 : Write down the given differential equation in the form dy = f (x, y) . dx

Then, we separate the variables to get the required solution.













226

Mnemonics Homogeneous Differential Equation

Hojayega Genius

Dimag Ekdum

Hoshiyar First Floor Wale X, Y (f(x,y) Ground Floor Wale X, Y (g(x,y), apni Same Degree ke saath Forn aao Shree Yoga Vashist Xpert ke pass Homogeneous Differential Equations Homogeneous functions f(x,y) g(x,y) of Same Degree For Solution Substitute Y = Vx

Interpretation : dy

dx

=g(x, y) where f(x,y) and g(x,y) are homogeneous dy dx functions of sum is called a homogeneous Differential equation. These equations can be solved by substituting y = vx so that dependent variable y is changed to another variable v, where v is some unknown function.

Differential equation can be expressed in the form

=f (x, y) or

UNIT-IV: VECTORS & THREE-DIMENSIONAL GEOMETRY

10

VECTORS Basic Algebra of Vectors

Topic-1

Concepts Covered 



Basic concepts of vectors,  Operations on vectors

Different types of vectors,  Triangle Law,  Parallelogram Law

Revision Notes (i.e., a = x , b = y, c = z; in a manner we can say that

1. Vector : Basic Introduction : • A physical quantity having magnitude as well as the direction is called a vector. It is denoted

→





scalar components of vector r and its d.r.’s both are the same). Also, the coefficients of i , j , k in

→

→

as AB or a . Its magnitude (or modulus) is →

→





•

→

r (which is the unit vector of r )

→

| AB | or | a | otherwise, simply AB or a.

 Vectors are denoted by symbols such as a .

i.e.,

[Pictorial representation of vector]

x x +y +z 2

2

2

y

,

x +y +z 2

2

2

,

Scan to know more about this topic

z

x + y2 + z2 2





























x y z 2. Initial and Terminal Points : , , 2 2 2 2 2 2 2 + z point x + y 2 + z 2 are called direction Position Vector x + y that x +y +z The initial and terminal points means from which the vector originates and terminates cosines (which is abbreviated as d.c.’s) of vector →r . respectively. • These direction cosines are denoted by l, m, n such that l = cos a, m = cos b, n = cos g and l2 3. Position Vector : + m2 + n2 = 1 ⇒ cos2 a + cos2 b + cos2 g = 1. The position vector of a point say P(x, y, z) is x → → • It can be easily concluded that = l = cos a, OP = r = xi + y j + zk and the magnitude is r  | r |= x 2 + y 2 + z 2 . y z = m = cos b, = n = cos g. → → r r The vector OP = r = xi + y j + zk is said to be in its Therefore, component form. Here x, y, z are called the scalar  → r = lri + mr j + nrk = r(cos αi + cos β j + cos γ k ) . components or rectangular components of r and → → xi, y j , zk are the vector components of r along X, [Here r = | r |]. Y, Z-axis respectively. 5. Addition of vectors → • Also, AB = (Position Vector of B) – (a) Triangular law : If two adjacent sides (say sides (Position Vector of A). For example, let AB and BC) of a triangle ABC are represented →

→

A(x1, y1, z1) and B(x2, y2, z2). Then, AB =



4.

Here i , j and k are the unit vectors along the axes OX, OY and OZ respectively (The discussion about unit vectors is given later under ‘types of vectors’).

•







•



( x 2 i + y 2 j + z2 k ) − ( x1 i + y1 j + z1 k ).

→

by a and b taken in same order, then the third side of the triangle taken in the reverse order gives the sum of vectors → and → i.e., a b   → → → → AC = AB + BC ⇒ AC = a + b . → → → → →  Also since AC = − CA ⇒ AB + BC + CA = 0 .

Direction Ratios and Direction Cosines: →  If r = xi + y j + zk , then coefficient of i , j , k in r i.e., x, y, z are called the direction ratios (abbreviated

B a

b

→

as d.r.’s) of vector r . These are denoted by a, b, c A

c

C

228

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

→

 → r  vector r is given by r =  such that | r | = 1, |r |  so, if r = xi + y j + zk then its unit vector is :

→

(b) Parallelogram law : If two vectors a and b are represented in magnitude and the direction by the two adjacent sides (say OA and OB) of a parallelogram OACB, then their sum is given by that diagonal of parallelogram which is co





229

MATHEMATICS

r =



→

→

→

→

→

y x2 + y2 + z2

j +

z x2 + y2 + z2

k .

→

Unit vector perpendicular to the plane a and

•



C

B

i +



initial with a and b i.e., OC = OA + OB .

x x2 + y2 + z2

  a×b b is : ±   . |a × b|

a



(f) Reciprocal of a vector : It is a vector which has →



the same direction as the vector r but magnitude →

equal to the





a A O 6. Properties of Vector Addition     (a) Commutative property : a + b = b + a   Consider a = a1 i + a2 j + a3 k and b = b1 i + b2 j + b3 k be any two given vectors, then     a + b = ( a1 + b1 )i + ( a2 + b2 ) j + ( a3 + b3 )k = b + a.       (b) Associative property : ( a + b ) + c = a + ( b + c ) .



→

→ –1

b

 −1 1 r = . r

(g) Equal vectors : Two vectors are said to be equal if they have the same magnitude as well as direction, regardless of the position of their initial points.     | a | = | b |  Thus a = b ⇔   a and b have same direction   Also, if a = b ⇒ a1 i + a2 j + a3 k = b1 i + b2 j + b3 k ⇒ a1 = b1 , a2 = b











It is denoted as r . Hence

C

B

reciprocal of the magnitude of r .



































































a O A      (c) Additive identity property : a + 0 = 0 + a = a. (d) Additive inverse property : Types of Vectors :   (a) Zero or Null vector : It is Scan to know a = b ⇒ a1 i + a2 j + a3 k = b1 i + b2 j + b3 k ⇒ a1 = b1 , a2 = b2 , a3 = b3 . more about that vector whose initial and this topic terminal points are coincident. (h) Collinear or Parallel vector : Two vectors    It is denoted by 0 . of course its a and b are collinear or parallel if there exists a magnitude is 0 (zero).   non-zero scalar l such that a = lb . • Any non-zero vector is called a Types of Vector proper vector. • It is important to note that the respective (b) Co-initial vectors : → → coefficients of i , j , k in a and b are Those vectors (two or more) having the same starting point are called Scan to know proportional provided they more about the co-initial vectors. are parallel or collinear to each this topic (c) Co-terminus vectors : Those vectors (two or other. more) having the same terminal point are • The d.r’s of parallel vectors are called the co-terminus vectors. same (or are in proportion). Unit Vector (d) Negative of a vector : The vector which has → → → • The vectors a and b will the same magnitude as the r but opposite have same or opposite direction as l is positive direction. It is denoted by – r . Hence if, or negative respectively. → → → → → → → → AB = r or BA = − r i.e., AB = − BA , PQ = − QP → →    etc. • The vectors a and b are collinear if a × b = 0 . (e) Unit vector : It is a vector with the unit (i) Free vectors : The vectors which can undergo magnitude. The unit vector in the direction of parallel displacement without changing its

magnitude and direction are called free vectors.

230

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Mnemonics

Mnemonics

Interpretation : The vector sum of two coinitial vectors is given by the diagonal of the parallelogram whose adjacent sides are given vectors.

Types Of Vectors (A) Collinear

Unit

Teachers of Various New Colleges Using Types

Vectors

B

C

D

Negative

Zoom Conferencing during Epidemic Zero

A

Coinitial

Equal AB + AC = AD

Interpretation : Types of Vectors1. Zero Vector - Initial and terminal points coincide 2. Unit Vector - Magnitude is unity 3. Coinitial Vectors - Same initial points 4. Collinear vectors - Parallel to the same Line 5. Equal Vectors - Same magnitude and direction 6. Negative of a vector - Same magnitude, opp. direction Properties Of Vectors(B) "Neither choose East nor choose north, always choose North-East and save your time".

Properties Of Vectors(C)







Aao Bnaye Circle Tirahe par A





(zero wala circle)

North C

Triangle

B

C

D

or

th

-E

as

t

Interpretation: The vector sum of the three sides of a triangle taken  in order is O i.e

N

  



AB + BC + CA = O

B East

A

Dot Product of Vectors

Topic-2

Concepts Covered



Properties of dot product,



Projection of a vector

Revision Notes Vectors



and

and →→

→

b

is defined by,

→



Scalar Dot Product

→

a · b = | a || b |cosθ where q is the angle →

→

∧

∧

∧ →

∧

∧

∧

a = a1 i + a2 j + a3 k , b = b1 i + b2 j + b3 k ,

→



a

→

→ →

The dot product of two vectors →

Consider

then a . b = a1b1 + a2 b2 + a3b3 .

(a) Scalar Product or Dot Product :



 Projection of a vector : a on the other vector → → →  a.b  say b is given as  →  .   | b | →

between a and b , 0 £ q £ p.

 Projection of a vector : b on the other vector

b





1. Products of Two Projection of Vectors

Scan to know more about this topic

θ a

→ → → a.b  say a is given as  .  →  | a |



MATHEMATICS

231

Know the Properties (Dot Product) •

Properties/Observations of Dot product ∧ ∧

∧

∧

∧ ∧

∧

∧

∧ ∧

∧ ∧

∧ ∧

→ →





 i . i =| i || i |cos 0 = 1 or i . i = 1 = j . j = k ·k

→

→

Moreover if q = p, then a ·







→

a . a =| a |2 = a 2 ; as q in this case is 0.

∧ ∧ ∧ ∧ ∧∧ π  i . j =| i || j |cos = 0 or i . j = 0 = j . k = k ·i 2 → →

→

→

→

b = – | a || b | .





 a · b ∈R, where R is real number i.e., any scalar.



→

→ →

If q = 0, then a · b = | a || b | . Also













→  → → → → → →  a .  b + c  = a . b + a . c (Distributive property   of dot product).

→ →



→ →

 a · b = b · a (Commutative property of dot product). → →

→

→

→

→

→  →  → →  → →  a . − b  = −  a . b  =  − a  . b .      



 a · b = 0 Û a ^ b or | a |= 0 or | b |= 0.

Cross Product

Topic-3

Concepts Covered



and scalar product

Properties of cross product,  Relationship between Vector product

Revision Notes 1. The cross product or vector product of two

→

→

→

a and

→ →

b is defined by,

Scan to know more about this topic

∧

a × b = a b sin θ n , where q is the

→

→

c is perpendicular to both the vectors a and

→

b .

angle between the vectors a and Vector Cross Product Part-1

→

perpendicular to both a and b . For better illustration, see figure.

→

→

→

→

→

→

®

®

®

→

→

→

→ →

→

 a × b = 0 ⇔ a || b or , a = 0 , b = 0 .

∧

b , 0 £ q £ p and n is a unit vector →

→

→

→

→

→

 a × b is a vector c (say) then this vector



→

vectors



 a × a=0.

b θ

→

a ∧

∧

∧

→

∧

∧

∧

a = a1 i + a2 j + a3 k , b = b1 i + b2 j + b3 k .

→

→

→

→

→

→

→

→

→

→

→

→

 ( b + c ) × a = b × a + c × a (Right distributive).





→

Consider

→

 a × ( b + c ) = a × b + a × c (Left distributive).



–n

®

 a ´ b ¹ b ´ a (Commutative property does not hold for cross product).



n

,then



(Distributive property of the vector product or cross product) Scan to know more about → → ∧ ∧ 2. ∧Relationship between Vector this topic a × b = a1 a2 a3 = ( a2 b3 − a3b2 ) i − ( a1b3 − a3b1 ) j + ( a1b2 − a2 b1 ) kproduct . and Scalar product [Lagrange’s Identity] b3 ∧b1 b2 ∧ ∧ i j k → →  → →2 → → ∧ or | a × b |2 +  a · b  = | a |2 ·| b |2 → → ∧ ∧ a × b = a1 a2 a3 = ( a2 b3 − a3b2 ) i − ( a1b3 − a3b1 ) j + ( a1b2 − a2 b1 ) k .   ∧

j

∧

k







i



∧





∧

∧

∧

∧

∧

∧

∧

→

∧

∧

→

∧

∧

∧ ∧

∧

∧ ∧

∧

∧

 i × i =|i || i |sin 0 = 0 or i × i = 0 = j × j = k × k . ∧

∧

∧

∧

∧

∧

∧

 i × j = | i || j |sin π . k = k or i × j = k , j × k = i , k × i = j . 2

3. Cauchy-Schwarz inequality : → → For any two vectors a and b ,

of Cross Product b• bProperties/Observations 2 3



b1

→→

→

→

always have | a· b |≤| a || b |.

Vector Cross Product Part-2

11

THREE DIMENSIONAL GEOMETRY Direction Ratios and Direction Cosines

Topic-1

Concepts Covered 



Direction Ratios,  Direction Cosines

Relationship between DC's of a line.

Revision Notes



Z

Scan to know more about this topic

where AB is the distance between the points A and

P

( x 2 − x1 )2 + ( y 2 − y1 )2 + ( z2 − z1 )2

r  O

x

A

Y

Direction Cosines & Direction Ratios of Vector













B i.e., AB = 2. Direction Ratios of a Line : Any three numbers a, b, c (say) which are proportional to d.c.’s i.e., l, m, n of a line are called the direction ratios (d.r.’s) of the line. Thus, a = ll, b = lm, c = ln for any l ∈ R – {0}. m n 1 l Consider, = = = (say) b c λ a a b c or l = ,m= ,n= λ λ λ









and B(x2, y2, z2) are ± x 2 − x1 , ± y 2 − y1 , ± z2 − z1 ; AB AB AB















Now in DOAP, ∠PAO = 90° OA x = or x = lr. we have, cos a = OP r Similarly we can obtain y = mr and z = nr. Therefore,x2 + y2 + z2 = r2(l2 + m2 + n2) But we know that x2 + y2 + z2 = r2 Hence, l2 + m2 + n2 = 1.







•



•







•

→



•



•











→

AB and BA are the direction cosines (d.c.’s) of line L. Thus if a, b, g are the directionangles which the line L makes with the positive direction of X, Y, Z-axis respectively, then its d.c.’s are cos a, cos b, cos g. If direction of line L is reversed, the direction angles are replaced by their supplements angles i.e., p – a, p – b, p – g and so are the d.c.’s i.e., the direction cosines become – cos a, – cos b, – cos g. So, a line in space has two set of d.c.’s viz ± cos a, ± cos b, ± cos g. The d.c.’s are generally denoted by l, m, n. Also l2 + m2 + n2 = 1 and so we can deduce that cos2 a + cos2 b + cos2 g = 1. Also sin2 a + sin2 b + sin2 g = 2. The d.c.’s of a line joining the points A(x1, y1, z1)

Direction ratios are sometimes called as Direction Numbers. Scan to know more about 3. Relation Between the Direction this topic Cosines of a Line : Consider a line L with d.c’s l, m, n. Draw a line passing through the origin and P(x, y, z) and parallel to the given line L. From P draw Introduction to a perpendicular PA on the X-axis, Three Dimensional suppose OP = r Geometry







1. Direction Cosines of a Line : • If A and B are two points on a given line L, then direction cosines of vectors

2

2



 b  a  c or   +   +   = 1 [Using l2 + m2 + n2 = 1]  λ  λ  λ

Dance Choreographer Prefer Dieting

Mnemonics

Direction Cosines

Direction Cosines

Positive Direction

1 glass L e M o N juice

l = ± a2 + b2 + c 2 l 2c + m 2 + n 2 = 1 a b ± , , . m = ± n = ± Therefore, l = Prefer Dieting a2 + b2 + c 2 a 2 + b 2 + c 2 Dance a2 C + horeographer b2 + c2 a b c ± ,m=± ,n=± . 2 2 2 2 2 2 2 Direction a +b +c a +b +c a + b2 + c2 Cosines Positive Direction • The d.r.’s of a line joining the points A(x1, y1, z1) and B(x2, y2, z2) are x2 – x1, y2 – y1, z2 – z1 or 1 glass L e M o N juice x1 – x2, y1 – y2, z1 – z2.





or











2

X

l2+ m2+ n2= 1



MATHEMATICS

233

234

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Direction Ratios

Director Remo a Professional Dancer Direction

Ratios

Proportional

Direction

Choreographer created Cosines

3 Lifetime Movies with New faces a b c l l=

√a

m a 2

2

+b +c

2

n

,m=

√a

b 2

2

+b +c

2

c

,n=

√a

2

+b 2 +c 2

Interpretation : Direction cosines of a line are the cosines of the angles made by the line with the positive directions of the co. ordinate axes. If l , m, n are the D. cs of a line, then l2+m2+n2=1

Lines & Its Equations in Different forms

Topic-2

Concepts Covered

 Equation of line in cartesian and vector form, Shortest distance between lines  Skew lines  Condition of parallelism and perpendicularity of lines. 

Revision Notes





respectively. Also assume r as the position vector of any arbitrary point P(x, y, z) on the line L passing through A and B. Thus





→



→

→

and B(x2, y2, z2) with position vectors a and b



∧ ∧ ∧

On equating the coefficients of i , j , k , we get x = x1 + l(x2 – x1), y = y1 + l(y2 – y1), z = z1 + l(z2 – z1) ...(i) On eliminating l, we have y − y1 z − z1 x − x1 = = y 2 − y1 z2 − z1 x 2 − x1



1. Equation of a Line passing through two given points : Consider the two given points as A(x1, y1, z1)

















∧ → → ∧ → ∧ → → ∧ ∧ ∧ ∧ → ∧ ∧ OA = a = x1 i + y1 j + z1 k , OB = b = x 2 i + y 2 j + z2 k , OP2.=Angle r = x i between + y j + z ktwo lines : (a) When d.r.’s or d.c.’s of the two lines are given : ∧ → → ∧ → ∧ → → ∧ ∧ ∧ ∧ → ∧ ∧ Consider two lines L1 and L2 with d.r.’s in A = a = x1 i + y1 j + z1 k , OB = b = x 2 i + y 2 j + z2 k , OP = r = x i + y j + z k proportion to a1, b1, c1 and a2, b2, c2 respectively (a) Vector equation of a line : Since the points ; d.c.’s as l1, m1, n1 and l2, m2, n2. Consider → ∧ → ∧ ∧ ∧ ∧ ∧ A, B and P all lie on the same line which means that b 1 = a1 i + b1 j + c1 k and b 2 = a2 i + b2 j + c 2 k . they are all collinear points.





→

→

→

→

→



→

→

Further it means, AP = r − a and AB = b − a are collinear vectors, i.e., →

→

AP = λ AB

→





→

These vectors b 1 and b 2 are parallel to the given lines L1 and L2. So in order to find the angle between the lines L1 and L2, we need to

→

→

→

→



→

→

→



→

r = a + λ( b − a ), where l ∈ R. or This is the vector equation of the line. (b) Cartesian equation of a line : By using the

→







→

b 1 and b 2 (and hence lines L1 and L2) can be obtained as, →





→

→

→

→ → → → b 1 . b 2 = | b 1 || b 2 |cos θ vector equation of the line r = a + λ( b − a ) , we get a1a2 + b1b2 + c1c 2 Thus,∧  cos q = ∧  ∧ ∧ ∧ ∧ ∧ ∧ ∧ 2 a1 + b12 + c12 a22 + b22 + c 22 x i + y j + z k = x1 i + y1 j + z1 k + ( x 2 − x1 ) i + ( y 2 − y1 ) j + ( z2 − z1 ) k    • Also, in terms of d.c.’s : cos q = |l1l2 + m1m2 + ∧  ∧ ∧ ∧ ∧ ∧ n1n2 |. x1 i + y1 j + z1 k + ( x 2 − x1 ) i + ( y 2 − y1 ) j + ( z2 − z1 ) k  • Sine of angle is given as :  





















→

get the angle between the vectors b 1 and b 2 . So the acute angle q between the vectors

r − a = λ( b − a )





or



MATHEMATICS



→

→

and r 2 = a 2 + µ b 2 respectively.





3. Shortest Distance between two Lines : If two lines are in the same plane i.e., they are coplanar, they will intersect each other if they are non-parallal.Hence, the shortest distance between them is zero. If the lines are parallel then the shortest distance between them will be the perpendicular distance between the lines i.e., the length of the perpendicular drawn from a point on one line onto the other line. Adding to this discussion, in space, there are lines which are neither intersecting nor parallel. In fact, such pair of lines are non-coplanar and are called the skew lines.

→

b1. b2

→

→

.

Scan to know more about this topic

| b 1 || b 2 |

y − y2 z − z2 = b2 c2

a12 + b12 + c12 a22 + b22 + c 22



(c) When Cartesian equation of two lines are given: Consider the lines L1 and L2 in Equations of a Cartesian form as,







cos q =

=

a1a2 + b1b2 + c1c 2

Line in 3 dimensions

Then, the acute angle q between the two lines is given by the relation →

x − x2 a2



→

→

→

L2 :

Then the acute angle q between the lines L1 and L2 can be obtained by, cos q =

lines L1 and L2 as r 1 = a 1 + λ b 1 →

y − y1 z − z1 x − x1 = = c1 b1 a1





Scan to know more about this topic

Consider vector equations of





(b) When Vector equations of two lines are given :

L1 :



( a1b2 − a2 b1 )2 + ( b1c 2 − b2 c1 )2 + ( c1a2 − c 2 a1 )2 . a12 + b12 + c12 a22 + b22 + c 22

sin q =

235

straight line in space

Key Fact



Ù Ùö Ù Ù Ù ∧ ∧ ∧ æ Ù x i + y j + z k = x1 i + y1 j + z1 k + l ç a i + b j + c k ÷ è ø

∧ ∧ ∧



1. Equation of a line in space passing through a given point and parallel to a given vector : Consider the line L is passing through the given point A(x1, y1, z1) with the position vector a , d

Now, as we equate the coefficients of i , j , k , we get the parametric equations of line given as,



→ →

→

is the given vector with d.r.’s a, b, c and r is the position vector of any arbitrary point P(x, y, z) on the line.



























x = x1 + la, y = y1 + lb, z = z1 + lc. Co-ordinates of any point on the line considered here are (x1 + la, y1 + lb, z1 + lc). A P (c) Cartesian equation of a line : If we eliminate the (x1, y1, z1) a r parameter l from the parametric equations of a ® ® Ù Ù Ù  ® Ù Ù Ù ® Ùline,Ùwe get Ù Thus, OA = a = x1 i + y1 j + z1 k , OP = r = x i + y j + z k , d = a i + b j + c k . the Cartesian equation of line as y − y1 z − z1 x − x1 ® ® Ù Ù Ù  ® Ù Ù Ù ® Ù Ù Ù = = OA = a = x1 i + y1 j + z1 k , OP = r = x i + y j + z k , d = a i + b j + c k . b c a (a) Vector equation of a line : As the line L is parallel • If l, m, n are the d.c.’s of the line, then Cartesian •

equation of line becomes

®

y − y1 z − z1 x − x1 = = m n l











•







to given vector d and points A and P are lying ®  on the line so, AP is parallel to the d .  ® AP = l d , where l ∈ R i.e., set of or real numbers →

®

r− a = ld





®

®

®

b, c, then by using r = a + l d , we get

•



®



®

r = a+ ld. or This is the vector equation of line. (b) Parametric equations : If d.r.’s of the line are a,





→





→







or

Skew Lines : Two straight lines in space which are neither parallel nor intersecting are known as the skew lines. They lie in different planes and are non-coplanar. Line of Shortest distance : There exists unique line perpendicular to each of the skew lines L1 and L2, and this line is known as the line of shortest distance (S.D.).

UNIT-V: LINEAR PROGRAMMING

12

LINEAR PROGRAMMING





Linear programming problems: Problems which minimize or maximize a linear function z subject to certain conditions determined by a set of linear inequalities with non-negative variables are known as linear programming problems. Objective function: A linear function z = ax + by, where a and b are constants which has to be maximised or minimised according to a set of given conditions, is called as linear objective function.





Revision Notes Decision variables: In the objective function z = ax + by, the variables x, y are said to be decision variables. Constraints: The restrictions in the form of inequalities on the variables of a linear programming problems are called constraints. The condition x ³ 0, y ³ 0 are known as non-negative restrictions.

Scan to know more about this topic

Linear Programming Introduction

the objective function. If R is bounded, then the objective function Z has both maximum and minimum values of R and each of these occurs at a corner point (vertex) of R. However, if the feasible region is unbounded, the optimal value obtained may not be maximum or minimum.



Feasible region: The common region determined by all the constraints including non-negative constraints x, y ³ 0 of linear programming problem is known as the feasible region. Feasible solution: Points with in and on the boundary of the feasible region represents feasible solutions of constraints. In the feasible region, there are infinitely many points (solutions) which satisfy the given conditions. Theorem 1: Let R be the feasible region for a linear programming problem and let Z = ax + by be the objective function. When Z has an optimal value (maximum or minimum), where variables x and y are subject to constraints described by linear inequalities, the optimal value must occur at a corner point (vertex) of the feasible region. Theorem 2: Let R be the feasible region for a linear programming problem, and let Z = ax + by be

Mnemonics LLP parameters N ¯ Non-negative variables

O ¯ Objective function

C ¯ Constraints

Key Facts





• Linear programming is often used for problems where no exact solution is known, for example for planning traffic flows. • The goal of linear programming is to maximize or minimize specified objectives, such as profit or cost. This process is known as optimization. • Linear programming is heavily used in microeconomics and company management, such as planning, product, transportation, technology and other issues, either to maximize the income or minimize the costs of a production scheme.











Key Terms



MATHEMATICS

237

UNIT-VI: PROBABILITY

13

PROBABILITY Conditional Probability and Multiplication Theorem on Probability

Topic-1

Concepts Covered 

 Conditional Probability, Multiplication Theorem of Probability







(a) their union is the total sample space i.e., A ∪ B ∪ C = S







(b) the event A, B and C are disjoint in pairs

i.e., A ∩ B = f, B ∩ C = f and C

Scan to know more about this topic

∩ A = f.

(c) P(A) + P(B) + P(C) = 1.











Here probability of occurrence of event B is not affected by the occurrence or non - occurrence of the event A.





 Note that P( E ) can also be represented as P(E’).

2. Mutually Exclusive Or Disjoint Events : Two events A and B are said to be mutually exclusive if occurrence of one prevents the occurrence of the other i.e., they can’t occur simultaneously. In this case, sets A and B are disjoint i.e., A ∩ B = f. Consider an example of throwing a die. We have the sample space as, S = {1, 2, 3, 4, 5, 6} Suppose A = the event of occurrence of a number greater than 4 = {5, 6} B = the event of occurrence of an odd number = {1, 3, 5} and C = the event of occurrence of an even number = {2, 4, 6} In these events, the events B and C are mutually exclusive events but A and B are not mutually exclusive events because they can occur together (when the number 5 comes up). Similarly A and C are not mutually exclusive events as they can also occur together (when the number 6 comes up).

3 2 , P(B) = 5 5

Hence events A and B are independent events. 4. Exhaustive Events : Two or more events say A, B and C of an experiment are said to be exhaustive events, if

P(E) such that P( E) denotes the probability of nonoccurrence of the event E.

P(A) =





of an event E, then 0 £ P(E) £ 1 and P( E) = 1 –

Then,







0 £ n(E) £ n(S) 0 £ P(E) £ 1 Hence, if P(E) denotes the probability of occurrence

B = the event of occurrence of a black ball in the second draw.















1. Basic Definition of Probability : Let S and E be the sample space and event in an experiment respectively. Then, Probability n( E) Number of Favourable Events = = Total number of Elementary Eventts n(S)



Revision Notes















Consider an example of throwing a die. We have S = {1, 2, 3, 4, 5, 6}

Suppose A = the event of occurrence of an even number = {2, 4, 6} B = the event of occurrence of an odd number = {1, 3, 5} and C = the event of getting a number multiple of 3 = {3, 6}



P(A ∪ B) = P(A) + P(B).



 If A, B and C are mutually exhaustive events, then we always have P(A ∪ B ∪ C) = P(A) + P(B) + P(C)











\





P(A ∩ B) = 0 [As n(A ∩ B) = n(f) = 0]





 If A and B are mutually exhaustive events, then we always have



In these events, the events A and B are exhaustive events as A ∪ B = S but the events A and C or the events B and C are not exhaustive events as A ∪ C ¹ S and similarly B ∪ C ¹ S.



Scan to know 3. Independent Events : more about Two events are independent if this topic the occurrence of one does not affect the occurrence of the other. Consider an example of drawing two balls one by one with replacement from a bag containing 3 red and 2 Independent black balls. Event Suppose A = the event of occurrence of a red ball in first draw

Conditional Probability Definition



MATHEMATICS

239

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

P( A ∩ B ) , A ¹ f i.e., P(A) ¹ 0 P( A )



 P(B|A) =



P( A ∩ B ) , B ¹ f i.e., P(B) ¹ 0 P( B )



Concept: Independent and Mutually exclusive events. I Is not ME ME Is not I Here, I: Independent Events ME: Mutually Exclusive events

 P(A|B) =





Mnemonics



240

P( A | B) = P( A ∩ B) , P(B) ¹ 0 P( B )



P( A | B ) = P( A ∩ B ) , P( B ) ¹ 0 P( B )



P( A | B ) = P( A ∩ B ) , P( B ) ¹ 0 P( B )



P( A | B) + P( A | B) = 1, B ≠ φ.







Scan to know more about this topic









Scan to know more about this topic





5. Conditional Probability : By the conditional probability, we mean the probability of occurrence of event A when B has already occurred. The ‘conditional probability of occurrence of event A when B has already occurred’ is sometimes also called as probability of occurrence of event A w.r.t. B.







Conditional Probability Introduction

Conditional Probability

NOTE : EVENTS AND SYMBOLIC REPRESENTATIONS : Verbal description of the event

Equivalent set notation

Event A

A

Not A

A or A'

A or B (occurrence of atleast one A or B)

A ∪ B or A + B

A and B (simultaneous occurrence of both A and B)

A ∩ B or AB

A but not B (A occurs but B does not)

A ∩ B or A – B

Neither A nor B

A ∩ B

Atleast one A, B or C

A∪B∪C

All the three A, B and C

A∩B∩C

Topic-2

Bayes’ Theorem Concept Covered



Bayes’ Theorem

Revision Notes Bayes’ theorem is also known as the formula for the probability of causes.

•

If E1, E2, E3, ..... , En form a partition of S and A be any event, then P(A) = P(E1).P(A|E1) + P(E2).P(A|E2) + .... + P(En).P(A|En) Scan to know more about [∵ P(Ei ∩ A) = P(Ei).P(A|Ei)]

•

The probabilities P(E1), P(E2), ...., P(En) which are known before the experiment takes place are called prior probabilities and P(A|En) are called posterior probabilities.



•



Scan to know more about this topic



Bayes’ Theorem



BAYES’ THEOREM : If E1, E2, E3, ........., En are n nonempty events constituting a partition of sample space S i.e., E1, E2, E3, ...., En are pair wise disjoint and E1 ∪ E2 ∪ E3 ∪ .... ∪ En = S and A is any event of non-zero probability, then P(Ei|A) =

P( Ei ).P( A | Ei )

n

, i = 1, 2 , 3, ....., n

Σ P ( E j )P ( A | E j )

j =1

For example, P(E1|A) = P( E1 ). P( A | E1 ) P( E1 ).P( A | E1 ) + P( E2 ).P( A | E2 ) + P( E3 ).P( A | E3 )

this topic

Bayes’ Theorem: Application



MATHEMATICS

Topic-3

241

Random Variable and its Probability Distributions Concepts Covered



Random Variable,  Probability Distribution

Revision Notes 1. RANDOM VARIABLE : A random variable is a real valued function defined over the sample space of an experiment. In other words, a random variable is a realvalued function whose domain is the sample space of a random experiment. A random variable is usually denoted by uppercase

letters X, Y, Z etc. Scan to know more about this topic

Random Variable

2. PROBABILITY DISTRIBUTION OF A RANDOM VARIABLE : If the values of a random variable together with the corresponding probabilities are given, then this description is called a probability distribution of the random variable.

Scan to know more about this topic

R.V., Prob. Distribution, Mean and Variance

Discrete random variable : It is a random variable which can take only finite or countable infinite number of values. Continuous random variable : A variable which can take any value between two given limits is called a continuous random variable.



• •







Key Terms

n

•





Key Formulae Mean or Expectation of a random variable X = µ = Σ xi Pi i =1

qq

Sample Question Paper (Issued by Board dated 16th Sep. 2022) MATHEMATICS (041) Class-12 SOLVED Maximum Marks : 80



Time Allowed : 3 Hours





(ii) (iii) (iv) (v) (vi)



(i)















General Instructions : This Question paper contains five sections A, B, C, D and E. Each section is compulsory. However, there are internal choices in some questions. Section A has 18 MCQ’s and 02 Assertion-Reason based questions of 1 mark each. Section B has 5 Very Short Answer (VSA)-type questions of 2 marks each. Section C has 6 Short Answer (SA)-type questions of 3 marks each. Section D has 4 Long Answer (LA)-type questions of 5 marks each. Section E has 3 source based/case based/passage based/integrated units of assessment (4 marks each) with sub parts.

Section - A







aij ¹ 0 where i = j



(D)













(C) 3

–3











(D)

x + log| x | + C 2

1   | AC ´ AB | 8

2

x - log| x | + C 2

(D)

(C)









x2 + log| x | + C 2

(B)





(A) x2 + log |x| + C

(C) 1.





5.

(D)

ì 1 - cos 4 x , if x ¹ 0 ï is continuous at x = 0 is í 8x 2 ï k, if x = 0 î

(B) – 1 1 If f '(x) = x + , then f ( x ) is x

(A) 0

1   | AC ´ AB | 4





4. The value of ‘k’ for which the function f(x) =



(C)



1   | AB ´ AC | 2









(B)





(A) | AB ´ AC |





(B) –9

3. The area of a triangle with vertices A, B, C is given by





(D)



(A) 9





(C) aij = 0, where i = j

2. If A is a square matrix of order 3, |A’| = – 3, then |AA'| =









(B) aij ¹ 0 " i, j



1 " i, j a ji

(A) aij =





1. If A = [aij] is a skew-symmetric matrix of order n, then





(Multiple Choice Questions) Each question carries 1 mark











(D)

4









6 13

7 2

(D)

(C)





7 14

(B)

14



7

8.









(C) 3

(A) an open half-plane not containing the origin. (B) an open half-plane containing the origin. (C) the whole XY-plane not containing the line 3x + 5y = 4. (D) a closed half plane containing the origin. The scalar projection of the vector 3ˆi - ˆj - 2 kˆ on the vector ˆi + 2 ˆj - 3kˆ is (A)



(B) 2

7. The solution set of the inequality 3x + 5y < 4 is







(A) 1





6.





4

d éæ dy ö ù If m and n, respectively, are the order and the degree of the differential equation dx êçè dx ÷ø ú = 0, then m + n = ë û



Sample Question Paper

x

log

9 4









(D)





(D)





(C) BA–1





(B) A–1B–1



(A) A–1B



1 log 2 2

(C)

10. If A, B are non-singular square matrices of the same order, then (AB–1)–1 =



AB

11. The corner points of the shaded unbounded feasible region of an LPP are (0, 4), (0.6, 16) and (3, 0) as shown in



3 2

log



(B)



(A) log 4







is



3

9. The value of ò2 x 2 + 1 dx

243

the figure. The minimum value of the objective function Z = 4x + 6y occurs at





2 4 2x 4 = , then the possible value(s) or ‘x’ is/are 5 1 6 x













(D)

0.1

(D)

y = Cx2













(C) 0.28





(B) 0.18





(C) y = Cx

(B) x = Cy2





(A) xy = C





16. If y = sin–1 x, then (1 – x2) y2 is equal to









(D)



(C) 24

2 6









(B)

2







17.



(B) xy (C) xy2 (D) x2         If two vectors a and b are such that | a | = 2, | b | = 3 and a . b = 4, then | a - 2b | is equal to

(A) xy1

2 2



18. P is a point on the line joining the points A(0,5, –2) and B(3, –, 2). If the x-coordinate of P is 6, then its z-coordinate

Reason (R): sec–1 (–2) = –

p 4























is (A) 10 (B) 6 (C) – 6 (D) – 10 ASSERTION-REASON BASED QUESTIONS In the following questions, a statement of assertion (A) is followed by a statement of Reason (R). Choose the correct answer out of the following choices. (A) Both A and R are true and R is the correct explanation of A. (B) Both A and R are true but R is not the correct explanation of A. (C) A is true but R is false. (D) A is false but R is true. æ 1ù é1 ö 19. Assertion (A): The domain of the function sec–1 2x is çè -¥ , - 2 úû È êë 2 , ¥÷ø



1 5

(D)

15. The general solution of the different equation ydx – xdy = 0 is



(B) 25

(A) 0.9







(A) 5













(C) 125

14. Given two independent events A and B such that P(A) = 0.3, P(B) = 0.6 and P(A' Ç B’) is



3, - 3

(D)

13. If A is a square matrix of order 3 and |A| = 5, then |adj A| =

(A)



- 3





(C)

3



(B)



(A) 3





12. If





















(A) (0.6, 1.6) only (B) (3, 0) only (C) (0.6, 1.6) and (3, 0) only (D) at every point of the line-segment joining the points (0.6, 1.6) and (3, 0)

244

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

p  r = ˆi + ˆj + 2 kˆ + l(ˆi - ˆj ) and the x-axis is 4

Reason (R): The acute angle q between the lines   r = x1ˆi + y1ˆj + z1kˆ + l( a1ˆi + b1ˆj + c1kˆ) and r = x 2ˆi + y 2 ˆj + z2 kˆ + µ( a2ˆi + b2 ˆj + c 2 kˆ) is given by









20. Assertion (A): The acute angle between the line



cos q =

| a1a2 + b1b2 + c1c 2 | a12 + b12 + c12

a 2 2 + b2 2 + c 2 2

Section - B

This section comprises of very short answer type-questions (VSA) of 2 marks each

23.





22. A man 1.6 m tall walks at the rate of 0.3 m/s away from a street light is 4 above the ground. At what rate is the tip of his shadow moving? At what rate is his shadow lengthening?       If a = ˆi - ˆj + 7 kˆ and b = 5ˆi - ˆj + lkˆ, then find the value of l so that vectors a + b and a - b are orthogonal.

OR Find the direction ratio and direction cosines of a line parallel to the whose equations are 6x – 12 = 3y + 9 = 2z – 2.









Is the function injective? Justify your answer.



2 y 1 - x 2 + x 1 - y 2 = 1, then prove that dy = - 1 - y 2 dx 1-x       Find | x |if ( x - a ) . ( x + a ) = 12, where a is a unit vector.



24. If 25.





é æ 13p ö ù êsin ç ÷ú ë è 7 øû

OR Prove that the function f is surjective, where f : N ® N such that ìï n + 1 , if n is old f(n) = í n 2 ïî 2 , if n is even







21. Find the value of sin–1

Section - C



27. Three friends go for coffee. They decide who will pay the bill, by each tossing a coin and then letting the ‘‘odd



28.











(This section comprises of short answer type questions (SA) of 3 marks each) dx 26. Find: ò 3 - 2x - x 2 person’’ pay. There is no odd person if all three tosses produce the same result. It there is no odd person in the first round, they make a second round of tosses and they continue to do so until there is an odd person. What is the probability that exactly three rounds of tosses are made? OR Find the mean number of defective items in a sample of two items drawn one-by-one without replacement from an urn containing 6 items, which include 2 defective items. Assume that the items are identical in shape and size. p/3 dx Evaluate: ò p/ 6 1 + tan x OR

ò0 | x - 1|dx

29. Solve the differential equation: ydx + (x – y2) dy = 0





Evaluate:

4

OR



30. Solve the following Linear Programming Problem graphically:



31.









Solve the differential equation: xdy – ydx =

x 2 + y 2 dx

Maximize Z = 400x + 300y subject to x + y < 200, x < 40, x > 20, y > 0 ( x 3 + x + 1) dx Find ò ( x 2 - 1)



Sample Question Paper

245

Section - D





32. Make a rough sketch of the region {(x, y): 0 < y < x2, 0 < y < x, 0 < x < 2} and find the area of the region using integration. 33. Define the relation R in the set N × N as follows:

34.















This section comprises of long answer-type questions (LA) of 5 marks each.

For (a, b), (c, d) Î N × N, (a, b) R (c, d) iff ad = bc. Prove that R is an equivalence relation in N × N. OR Given a non-empty set X, define the relation R in P(X) as follows: For A, B Î P(X), (A, B) Î R iff A Ì B. Prove that R is reflexive, transitive and not symmetric.  An insect is crawling along the line r = 6ˆi + 2 ˆj + 2 kˆ + l(ˆi - 2 ˆj + 2 kˆ) and another insect is crawling along the line  r = - 4ˆi - kˆ + µ(3ˆi - 2 ˆj - 2 kˆ). At what points on the lines should they reach so that the distance between them is





the shortest? Find the shortest possible distance between them. OR The equations of motion of a rocket are: x = 2t, y = –4t, z = 4t, where the time t is given in seconds, and the coordinates of a moving point in km. what is the path of the rocket? At what distances will the rocket be from the starting point O(0, 0, 0) and from the following line in 10 seconds?  r = 20ˆi - 10 ˆj + 40 kˆ + µ(10ˆi - 20 ˆj + 10 kˆ)





é 2 -3 5 ù A = ê 3 2 -4 ú , find A–1. Use A–1 to solve the following system of equations 2x – 3y + 5z = 11, ê ú êë 1 1 -2 úû 3x + 2y – 4z = – 5, x + y – 2z = – 3.

35. If

Section - E



36. Case-Study 1: Read the following passage and answer the questions given below.

The temperature of a person during an intestinal illness is given by f(x) = – 0.1 x2 + mx + 98.6, 0 < x < 12, m being a constant, where f(x) is the temperature in °F at x days. (i) Is the function differentiable in the interval (0, 12)? Justify your answer. (ii) If 6 is the critical point of the function, then find the value of the constant m. (iii) Find the intervals in which the function is strictly increasing/strictly decreasing. OR (iv) Find the points of local maximum/local minimum, if any, in the interval (0, 12) as well as the points of absolute maximum/absolute minimum in the interval [0, 12]. Also, find the corresponding local minimum and the absolute maximum/absolute minimum values of the function.







37. Case-Study 2: Read the following passage and answer the questions given below.















This section comprises of 3 case-study/passage-based questions of with two sub-parts. First two case study questions have three sub sub-parts (i), (ii), (iii) of marks 1, 1, 2 respectively. The third case study question has two sub parts of 2 marks each.

246

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



In an elliptical sport field, the authority wants to design a rectangular soccer field with the maximum possible x2 y2 area. The sport field is given by the graph of 2 + 2 = I. a b



38. Case-Study 3: Read the following passage and answer the questions given below.





There are two antiaircraft guns, named as A and B. The probabilities that the shell fired from them hits an airplane are 0.3 and 0.2 respectively. Both of them fired one shell at an airplane at the same time. (i) What is the probability that the shell fired from exactly one of them hit the plane? (ii) If it is known that the shell fired from exactly one of them hit the plane, then what is the probability that it was fired from B? qq





























(i) If the length and the breadth of the rectangular field be 2x and 2y respectively, then find the area function in terms of x. (ii) Find the critical point of the function. (iii) Use First derivative Test to find the length 2x and width 2y of the soccer field (in terms of a and b) that maximize its area. OR (iv) Use Second Derivative Test to find the length 2x and width 2y of the soccer field (in terms of a and b) that maximize its area.

SOLUTIONS Sample Question Paper Marking Scheme-2022-23 (Issued by Board) MATHEMATICS (041)







Option (B) is correct. Explanation: The strict inequality represents an open half plane and it contains the origin as (0, 0) satisfies it.

8.

Option (A) is correct.



Explanation: In a skew-symmetric matrix, the (i, j)th element is negative of the (j, i)th element. Hence, the (i, i)th element = 0

2.

7.

Option (C) is correct.



1.







Section - A

Explanation: Scalar Projection of

Option (A) is correct.

3ˆi - ˆj - 2 kˆ on vector ˆi + 2 ˆj - 3kˆ

=

9.





Hence, the area of the triangle with vertices 1   A, B, C = | AB ´ AC | . 2

Explanation:

Explanation: The function f is continuous at x = 0 if lim f ( x ) = f(0)

= lim

x® 0

sin 2 2 x 4x2

11.

æ x2 1ö ö æ + log| x | + C ç f ( x ) = ò ç x + ÷ dx ÷ 2 xø ø è è

12.



Option (B) is correct.







Hence, k = 1

Explanation:

1

2

+ 1)ùû

=

log 10 - log 5 2

=

1 æ 10 ö 1 log ç ÷ = log 2 2 2 è 5 ø

3 2

Option (C) is correct.

Option (D) is correct. Explanation: The minimum value of the objective function occurs at two adjacent corner points (0.6, 1.6) and (3, 0) and there is no point in the half plane 4x + 6y < 12 in common with the feasible region. So, the minimum value occurs at every point of the line-segment joining the two points.

2



æ sin 2 x ö = xlim ç ÷ ® 0 è 2x ø

x

Explanation: (AB–1)–1 = (B–1)–1 A–1 = BA–1



8x

2

8x



2 sin 2 2 x

x® 0

10.

2



x® 0

1 - cos 4 x



We have f(0) = k and lim f ( x ) = lim

5.

14



x® 0

x® 0

3

ò2 x 2 + 1 = 2 éëlog ( x



Option (C) is correct.

= lim

7

Option (C) is correct.



Explanation: The area of the parallelogram   with adjacent sides AB and AC = | AB ´ AC |.

4.

(3ˆi - ˆj - 2 kˆ). (1 + 2 ˆj - 3kˆ) = |ˆi + 2 ˆj - 3kˆ|



Option (B) is correct.



3.





Explanation: |AA'| = |A||A'| = (– 3) (– 3) =9

Option (D) is correct.

3

2 æ dy ö d y 4ç ÷ 2 = 0, Here, m = 2 and n = 1 is è dx ø dx Hence, m + n = 3

13.



Explanation: The given differential equation



Option (C) is correct.



6.







Explanation: 2 – 20 = 2x2 – 24 Þ 2x2 = 6 Þ x2 = 3 Þ x = ± 3 Option (B) is correct. Explanation: |adj A| = |A|n–1 Þ |adj A| = 25

Option (C) is correct.

19.



Explanation: sec–1 x is defined if x < – 1 or x > 1. Hence, sec–1 2x will be defined is 1 1 x < – or x ³ . 2 2

Option (C) is correct.

Hence, A is true. The range of the function sec–1 x is [0, p] – ìp ü í ý , R is false. î2þ

dy dx =ò + log K, K > 0 y x

20.



ò



Þ



Explanation: ydx – xdy = 0 Þ ydx – xdy = 0 dy dx Þ = y x

Explanation: The equation of the x-axis may  be written as r = tiˆ. Hence, the acute angle q





Þ log|y| = log|x| + log K Þ log|y| = log|x| K Þ |y| = |x| K Þ y = ± Kx Þ Cx

16.

Option (A) is correct.

between the given line and the x-axis is given |1 ´ 1 + ( - 1) ´ 0 + 0 ´ 0| by cos q = 2 1 + ( - 1)2 + 0 2 ´ 12 + 0 2 + 0 2

Option (A) is correct. Explanation: y = sin–1 x

=







Let y Î N (codomain). Then $ 2y Î N (domain) 2y such that f(2y) = = y. Hence, f is surjective. 2





y-5 z+2 x = = 3-0 -1-5 2+2 y-5 z+2 x = = 4 -6 3

Any point on the line is (3k, – 6k + 5, 4k – 2), where k is an arbitrary scalar. 3k = 6 Þ k = 2 The z-coordinate of the point P will be 4×2–2=6







Given,

1

ìï n + 1 , if n is odd f(x) = í n 2 for all x Î N. ïî 2 . if n is even

For surjective Let



Explanation: The line through the points (0, 5, –2) and (3, –1, 2) is





Option (B) is correct.



1

Detailed Answer:







= 4 – 16 + 36 = 24     | a - 2b |2 = 24 Þ | a - 2b | = 2 6

Hence, f is not injective.





   = | a |2 - 4 a.b + 4| b |2



1, 2 Î N (domain) such that f(1) = 1 = f(2)













1

OR

Option (B) is correct.     2   Explanation: | a - 2b | = ( a - 2b ) . ( a - 2b )      | a - 2b |2 = a.a - 4 a.b + 4 b .b



1

= sin–1 ésin æ - p ö ù = - p ê ç ÷ú 7 ë è 7 øû

Simplifying, we get (1 – x )y2 = xy1

or,

p 4

é 13p ö ù p öù æ -1 é sin–1 êsin æç ú = sin êsin ç 2p - ÷ ú ÷ 7 øû ë è 7 øû ë è

2

18.

Þq=









21.

d y dy æ -2 x ö ÷ =0 1 - x2 + ·ç dx 2 dx çè 2 1 - x 2 ÷ø 2

17.

2

Section - B



Again, differentiating both sides w.r. to x, we get

1



dy 1 dy = Þ 1 - x2 . =1 2 dx dx 1-x







Explanation: P(A' Ç B') = P(A') × P(B') (As A and B are independent, A' and B' are also independent) = 0.7 × 0.4 = 0.28

15.

Option (C) is correct.



14.



Oswaal CBSE LMP (Last Minute Preparation), Class-XII





248

f(x) = y, such that y Î N

When n is odd n+1 y= 2

When n is even n y= 2

2y = n + 1 2y – 1 = n = 2y – 1 Hence, for y is a natural number, n = 2y – 1 is also a natural number

2y = n n = 2y Hence for y is a natural number, n = 2y is also a natural number



Solutions

OR The equations of the line are 6x – 12 = 3y + 9 = 2z – 2, which when written in standard symmetric form, will be x-2 y - ( - 3) z-1 = = 1 1 1 ½ 6 3 2





Hence, f is surjective.



(Since 1 is odd)



1+1 2 = =1 2 2

Since, lines are parallel, we have





f(1) =





For injective

(since 2 is even)



Hence, the required direction ratios are



Since, f(1) = f(2) but 1 ¹ 2

æ1 1 1ö ç , , ÷ or (1, 2, 3) è6 3 2ø

and the required 2 3 ö æ 1 , , ç ÷ 14 14 ø è 14







Hence, f is not injective.



1









or

1 1 y+ 3 = z-1 3 = 2 3 1

x-









So, d.r.’s of line L are: 1, 2, 3 \ Direction cosines of line L are: 1 2

2

1 +2 +3

,

3

2 2

2

1 +2 +3

3

,

3 2

1 + 2 2 + 33



Differentiating both sides w.r.t. t, we get dy dx 3 =2 dt dt

1



i.e.,

14

2

,

14

,

3 14





are

x-

or



cosines

æ 1ö 1 y - ç- ÷ è 3ø = z -1 3 = 1/3 1/2 1/6

½









Using similarity of triangles, we have x+y 4 Þ 3y = 2x = y 1.6

direction

Detailed Answer: Given line L: 6x – 2 = 3y + 1 = 2z – 2





Let AB represent the height of the street light from the ground. At any time t seconds, let the man represented as ED of height 1.6 m be at a distance of x m from AB and the length of his shadow EC by y m.

½ 



Both f(1) & f(2) have same image 1

22.

½



2 =1 2





f(2) =

a1 b1 c1 = = a 2 b2 c 2





Thus, for every y Î N, there exists x Î N such that f(n) = y

249



Now, since the parallel lines have the proportional d.r.’s and direction cosines so, d.r.’s of required line passing through (2, – 1, – 1) are 1, 2, 3 and direction cosines are



½





At any time t seconds, the tip of his shadow is at a distance of (x + y) m from AB. The rate at which the tip of his shadow moving æ dx dy ö + = ç ½ ÷ m/s = 0.5 m/s è dt dt ø

1 14

,

2 14

3

,

14





Þ sin B cos A + sin A cos B = 1 Þ sin (A + B) = 1 Þ A + B = sin–1 1 = Þ sin–1 x + sin–1 y =

p 2

1

p 2 ½



2

i.e., if – 24 + (49 – l ) = 0 Þ l = 25 i.e., if, l = ± 5 





2

Let sin–1 x = A and sin–1 y = B. Then x = sin A and y = sin B ½ y 1 - x2 + x 1 - y2 = 1





Hence     a + b = 6ˆi - 2 ˆj + (7 + l )kˆ and a - b = -4ˆi + (7 - l )kˆ     a + b and a - b will orthogonal if,     ( a + b ). ( a - b ) = 0 ½

y 1 - x2 + x 1 - y2 = 1

24.



23.









The rate at which his shadow is lengthening dy = m/s = 0.2 m/s ½ dt   a = ˆi - ˆj + 7 kˆ and b = 5ˆi - ˆj + lkˆ















dy 2 dy = 0.2 = ´ 0.3 Þ dt 3 dt

250

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

1 - y2 dy =dx 1 - x2

ò

=

ò

=

ò





1

=

1

1 2

2 - ( x + 1)2





2 - ( x + 1)2









P(obtaining an odd person in a single round)



  Since a is a unit vector, \| a | = 1

1 + 1/2

= 1 – P(not obtaining an odd person in a single 3 round) = ½ 4



dy + =0 2 2 dx 1-x 1- y ½



The required probability



    ( x - a ).( x + a ) = 12.

½

=



½

= P(‘In first round there is no odd person and ‘In second round there is no odd person’ and ‘In third round there is an odd person’)





 Þ | x |2 - 1 = 12

1 1 3 3 ´ ´ = 4 4 4 64

1



  Þ | x |2 - | a |2 = 12.





    Þ x.x + x.a - a.x - a.a = 12.

1 1 1 1 ´ ´ ´2= 2 2 2 4





1



P(not obtaining an odd person in a single round) = P(All three of them throw tails or All three of them throw heads) =

)

1

Þ



x + 1ö = sin–1 æç ÷+c è 2 ø

2









a - x2



27.

Differentiating with respect to x, we get



= sin–1 æ x ö + c ça÷ è ø

2

dx

ò

\

d d d æpö sin -1 x + (sin -1 y ) = dx dx dx çè 2 ÷ø



dx

dx

ò

On applying the identity, Þ sin B cos A + sin A cos B = 1 Þ sin (A + B) = 1 Þ A + B = sin–1(1) On substituting the value of A and B, we get p sin–1 x + sin–1 y = 2

25.

dx



- éë( x + 1)2 - 2 2 ùû

We know that,



Þ sin B 1 - sin 2 A + sin A 1 - sin 2 B = 1

(

dx









-( x + 2 x + 1 - 3 - 1)







y = y (1 - x 2 ) + x (1 - y 2 ) = 1

Suppose x = sin A and y = sin B Now, the equation became





Detailed Answer: Given as

1 2





Differentiating w.r.t. x, we obtain



OR

½ 





dx 4 - ( x + 1)

2

2

P(X = 2) =

2 1 1 ´ = 6 5 15

2



-( x + 2 x - 3)

=ò



2



dx

ò



=





3 - 2x - x

2

4 3 2 ´ = 6 5 5

æ2 4ö 8 P(X = 1) = 2 × ç ´ ÷ = è 6 5 ø 15

dx

26. ò



P(X = 0) =



Section - C





  Þ | x |2 = 13 Þ | x | = 13

Let X denote the Random Variable defined by the number of defective items.



é ù dx æ x + 1ö æ xö = sin–1 ç + C êò = sin -1 ç ÷ + C ú ÷ è aø è 2 ø ê a2 - x 2 ú ë û Detailed Answer: 3 - 2x - x 2

dx

0

1

2

pi

2 5

8 15

1 15

pixi

0

8 15

2 15 1/2



-( x 2 + 2 x - 3)

dx

10 2 Mean = S pixi = = 15 3

1/2

ò



=

1









ò

1

xi

Solutions

xdy – ydx =

dx

It is a Homogeneous Equation as

...(i)



dy = dx

b





Put y = vx,



æp p ö æp p ö sin ç + - x ÷ + cos ç + - x ÷ è6 3 ø è6 3 ø

v+x

p/6

cos x + sin x

dx + ò

dx



sin x + cos x

+ log K, K > 0

p/ 3

òp/6 dx

2 2 log | y + x + y | = log x2 K



p/3

òp/6 1 +

I=

dx tan x

=



p p p - = 3 6 6 p 12

1

Þy+

x 2 + y 2 = ± Kx2

Þy+

x 2 + y 2 = Cx2, which is the required

general solution.

1 + 1/2

4



4

2 1 ù + éê x - x ùú ûú 0 ëê 2 úû1

We have Z = 400x + 300y subject to x + y < 200, x < 40, x > 20, y > 0 The corner points of the feasible region are C(20, 0) D(40, 0), B(40, 160), A(20, 80)

1



1ö æ æ1 ö = ç 1 - ÷ + (8 - 4) - ç - 1 ÷ 2ø è è2 ø 1



=5



29.

2





30.



x2 2



= éx ëê



1



1

ò0 (1 - x )dx + ò1 ( x - 1)dx



=



4

ò0 | x - 1|dx



OR











=



p 3 p 6

= [x] Hence,

½

2 Integrating, we get log | v + 1 + v | = log |x|



2I =



sin x



òp/6

2I =

p/3



cos x

p/ 3

½

Separating variables, we get dv dx = 1 + v2 x







cos x + sin x

Adding (i) and (ii), we get



...(ii) 1

dx

1 + v2 + v



òp/6

I=

dy dv =v+x dx dx

dv = dx



sin x

p/ 3

y æyö æyö 1 + ç ÷ + = f ç ÷. x èxø èxø



òp/6

=



I=

x 2

æp p ö cos ç + - x ÷ è6 3 ø

p/ 3

x2 + y2 + y



b

òa f ( x ) dx = òa f ( a + b - x )dx



Using

x + y 2 dx



cos x sin x + cos x

2



p/ 3



tan x

p /6

=ò

251

OR

dx

òp/6 1 +



p /3

Let I =



28.







ydx + (x – y )dy = 0 Reducing the given differential equation to the dx form + Px = Q dy dx x + =y dy y

½

1





we get,

1

= e log y = y

Corner Point

Z = 400x + 300y

x.IF = ò Q.IFdy Þ xy = ò y dy



y3 + C , which is the required general 3

C(20, 0)

8000

D(40, 0)

16000

B(40, 160)

64000

A(20, 180)

62000

1 1

Maximum profit occurs at x = 40, y = 160



Þ xy =

1







2



solution

and the maximum profit = ` 64, 000



The general solution is given by











P dy I.F. = e ò =e

1 ò y dy

252

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

æ

ö

2x + 1

ò çè x + ( x - 1) ( x + 1) ÷ø dx

2x + 1 ( x - 1) ( x + 1)

32.

into partial



Now, resolving

Section - D

1







=



3

31. ò ( x +2 x + 1) dx ( x - 1)

fractions as



We get

2x + 1 3 1 + = ( x - 1) ( x + 1) 2( x - 1) 2( x + 1)

Hence,

ò

1

dx

( x 2 - 1)



( x 3 + x + 1)

1











2x + 1 A B + = ( x - 1) ( x + 1) x-1 x+1

2x + 1

ö



æ

y = x2 and the line y = x are (0, 0) and (1, 1).



ò çè x + ( x - 1) ( x + 1) ÷ø dx

Required Area =





=

The points of intersection of the parabola



æ ö 2x + 1 ò çè x + 2( x - 1) 2( x + 1) ÷ø dx

2



Required Area =

1 2 x 0

ò

dx + ò x dx 1

2



x2 3 1 + log| x - 1| + log| x + 1| + C 2 2 2

=

x2 1 + (log| x - 1|3 ( x + 1)) + C 2 2

2

é x3 ù é x2 ù 1 3 11 = ê ú +ê ú = + = êë 3 úû 0 êë 2 úû1 3 2 6 

1+½



x -1

A B + ( x + 1) ( x - 1)

Þ cb = da (by commutative property of multiplication of natural numbers





Let (a, b), (c, d), (e, f) Î N × N such that





af = be

Hence, R is transitive.

2

Since, R is reflexive, symmetric and transitive, R is an equivalence relation on N × N. ½





Hence, R is reflexive. Let A, B, C, Î P(X) such that (A, B), (B, C) Î R Þ A Ì B, B, Ì C













Let A Î P(X). Then A Ì A Þ (A, A) Î R







OR



x2 1 + (log|( x - 1)3 ( x + 1)| + C = 2 2

adcf = bcde







1

ò ( x - 1) dx x2 1 3 = + log| x + 1| + log| x - 1| + C 2 2 2











ò

ad = bc, cf = de

Þ (a, b) R (e, f)



Now,

Then Þ

x3 + x + 1

1 3 dx = ò xdx + dx + x2 - 1 x+1 2

1+½

(a, b) R (c, d) and (c, d) R (e, f). Þ





3 1 3 \ x +x+1 = x+ + x2 - 1 2( x + 1) 2( x - 1)





Hence, R is symmetric.







Þ (c, d) R (a, b)







Let Þ 2x + 1 = A(x – 1) + B(x + 1) ...(1) Substituting x = 1 and – 1 in equation (1), we obtain 1 3 A = and B = 2 2

1

Let (a, b), (c, d) Î N × N such that (a, b) R (c, d). Then ad = bc



=

x2 - 1



Hence, R is reflexive.



2x + 1



2







x -1

2x + 1





= x+

2



Þ (a, b) R (a, b)



x3 + x + 1

Let (a, b) Î N × N. Then we have ab = ba (by commutative property of multiplication of natural numbers)



Detailed Answer:



33.









 

 

=

1

½

2



=

1

ò0 yparabola dx + ò1 yline dx

1



Since, PQ is perpendicular to both the lines (–10 + 3m – l) + (– 2m – 2 + 2l)(–2) + (– 3 – 2m – 2l).2 = 0

2





i.e., µ – 3l = 4

and (– 10 + 3µ – l)3 + (– 2µ – 2+ 2l) (– 2) + (– 3 – 2µ – 2l) (–2) = 0

which implies that (X, Æ) Ï R.



Detailed Answer:





ad = bc

5ˆi + 4 ˆj and - ˆi - 2 ˆj - 3kˆ  PQ = - 6ˆi - 6 ˆj - 3kˆ



Eliminating t between the equations, we obtain x y z the equation of the path = = , , which 2 -4 4



R is symmetric

are the equations of the line passing through the origin having direction ratios . This line is the path of the rocket. 1



Transitive: If (a, b) R (c, d) and (c, d) R (e, f)





When t = 10 seconds, the rocket will be at the point (20, -40, 40). Hence, the required distance from the origin at 10 seconds = 1/2





20 2 + 40 2 + 40 2 km = 20 × 3 km = 60 km





e a = f b





Þ ad = bc and cf = de c c e a Þ = and = d d f b



1

OR



of

Þ (c, d) R (a, b)

Þ

6 2 + 6 2 + 32 = 9



bc = ad

(Using commutative property multiplication of natural numbers)



The shortest distance  = | PQ | =

ad = bc

1/2











Symmetric: If (a, b) R (c, d) Î N × N





(a, b) Î (a, b). So R is reflexive.

Þ

1



ab = ab







Reflexive: If (a, b) Î N × N





The position vector of the points, at which they should be so that the distance between them is the shortest, are

For (a, b), (c, d) Î N × N, (a, b) R (c, d) iff

Þ

1/2







µ = 1, l = −1.

A relation R in the set N × N is defined as:

Þ

...(ii)

solving (i) and (ii) for l and µ, we get







i.e., 17µ – 3l = 20



2

Thus, R is not symmetric.

...(i) 1/2





Æ, X Î P(X) such that Æ Ì X. Hence, (Æ, X) Î R. But, X Ë Æ







Hence, R is transitive.









Þ (A, C) Î R







ÞAÌC



253

Solutions





1/2

km

10 6



1/2











|A| = 2(0) + 3(– 2) + 5(1) = – 1 adjA A–1 = | A|





é 2 -3 5 ù A = ê 3 2 -4 ú ê ú êë 1 1 -2 úû





35.

é 0 -1 2 ù é 0 -1 2 ù 1 ê adj A= ê 2 -9 23 ú , A -1 = 2 -9 23 úú 3 ê ú ( -1) ê êë 1 -5 13 úû êë 1 -5 13 úû



X = A–1 B

1/2  PQ = ( -10 + 3 µ - l )ˆi + ( - 2 µ - 2 + 2 l )ˆj + ( -3 - 2 µ - 2 l )k '



is (– 4 + 3µ) ˆi + ( - 2 µ )ˆj + ( - 1 - 2 µ )kˆ for some µ









2

= 10 3 km

is (6 + l )ˆi + (2 - 2 l)ˆj + (2 + 2 l)kˆ for some l 1/2 The position vector of Q lying on the line  r = -4ˆi - k + µ(3ˆi - 2 ˆj - 2 kˆ)

300 2



=

1/2

The position vector of P lying on the line  r = 6ˆi + 2 ˆj + 2 kˆ + l(ˆi - 2 ˆj + 2 kˆ)

| -300ˆi + 300 kˆ| km |10ˆi - 20 ˆj + 10 kˆ|



=



The given lines are non-parallel lines. There is a unique line-segment PQ (P lying on one and Q on the other, which is at right angles to both the lines. PQ is the shortest distance between the lines. Hence, the shortest possible distance between the insects = PQ



34.





The distance of the point (20, -40, 40) from the given line    |( a2 - a1 ) ´ b | | - 30 ˆj ´ (10ˆi - 20 ˆj + 10 kˆ)|  = = km |b | |10ˆi - 20 ˆj + 10 kˆ|

















af = eb (a, b) R (e, f) Î N × N So R is transitive Since, R is reflexive, symmetric and transitive. Therefore, R is an equivalence relation on N × N.

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



X = A–1B é 0 -1 2 ù é 11 ù = – ê 2 -9 23 ú ê -5 ú ê úê ú êë 1 -6 13 úû êë -3 ûú

é 0+5-6 ù 1 ê 22 + 45 - 69 úú ( -1) ê ëê 11 + 25 - 39 ûú

é 0+5-6 ù X = – ê 22 + 45 - 49 ú ê ú êë 11 + 25 - 39 úû é -1 ù X = – êê -2 úú êë -3 úû

1 + 1/2





x = 1, y = 2, z = 3.



Þ





Þ

é -1 ù ê ú ê -2 ú êë -3 úû



éx ù 1 ê ú ê y ú = ( -1) êë z úû





=

which is in the form AX = B



é 0 -1 2 ù é 11 ù ê úê ú ê 2 -9 23 ú ê -5 ú êë 1 -5 13 úû êë -3 úû



éx ù 1 ê ú ê y ú = ( -1) êë z úû

Þ



254

Detailed Answer:





Section - E

To find adjoint of A A11 = 0, A12 = 2, A13 = 1





(ii) f(x) = –0.2x + m



At critical point,



(iii) f(x) = – 0.1x2 + 1.2x + 98.6



f'(x) = – 0.2x + 1.2 = – 0.2(x – 6)



é 0 -1 2 ù = ê 2 -9 23 ú ê ú êë 1 -6 13 úû

0 = –0.2 × 6 + m m = 1.2



1ù é0 2 Adj(A) = co-factor ê -1 -9 -6 ú ê ú êë 2 23 13 úû









A31 = 2, A32 = 23, A33 = 13

(i) f(x) = – 0.1x2 + mx + 98.6, being a polynomial function, is differentiable everywhere, hence, differentiable in (0, 12). 1

36.



A21 = – 1, A22 = – 9, A23 = – 6





x = 1, y = 2 and z = 3.



Hence,



\ A exists





–1





éx ù é1 ù ê y ú = ê2 ú ê ú ê ú êë z úû êë 3 úû

|A| = 0 – 6 + 5 = – 1 ¹ 0





é 2 -3 5 ù A = ê 3 2 -4 ú ê ú êë 1 1 -2 úû

1 Adj( A ) | A|

é 0 -1 2 ù 1 ê = 2 -9 23 úú -1 ê êë 1 -6 13 úû



2x – 3y + 5z = 11

Conclusion

(0, 6)

+ve

f is strictly increasing in [0, 6]

(6, 12)

-ve

f is strictly decreasing in [6, 12]

(iii) f(x) = – 0.1x2 + 1.2x + 98.6, f'(x) = – 0.2x + 1.2, f'(6) = 0, f''(x) = – 0.2 f''(6) = – 0.2 < 0 Hence, by second derivative test 6 is a point of local maximum. The local maximum value = f(6) = − 0.1 × 62 + 1.2 × 6 + 98.6 = 102.2 1 We have f(0) = 98.6, f(6) = 102.2, f(12) = 98.6 6 is the point of absolute maximum and the absolute maximum value of the function = 102.2. 1/2

0 and 12 both are the points of absolute minimum and the absolute minimum value of the function = 98.6. 1/2

Represent it in matrix form





x + y – 2z = – 3.







3x + 2y – 4z = – 5

é 2 -3 5 ù é x ù é 11 ù ê 2 2 -4 ú ê y ú = ê -5 ú ê ú ê úê ú ëê 1 1 -2 ûú ëê z ûú ëê -3 ûú



Given system of linear equations are





















é 0 -1 2 ù A–1 = – ê 2 -9 23 ú ê ú ëê 1 -6 13 úû

f '(x)

OR



Thus

In the Interval







A–1 =

(i)

255

A is maximum when Z is maximum.



37.



Solutions

dZ 16b 2 32b 2 = 2 (2 xa 2 - 4 x 3 ) = 2 x( a + 2 x ) dx a a









(a - 2x )





1/2

1/2

Thus, for maximum area of the soccer field, its





Let E = The shell fired from exactly one of them hits the plane. P(E1) = 0.3 × 0.2 = 0.06, P(E2) = 0.7 × 0.8 = 0.56, P(E3) = 0.7 × 0.2 = 0.14, P(E4) = 0.3 × 0.8 = 0.24

æEö æ Eö ÷ + P( E2 ). P ç ÷ + P( E3 ). è E1 ø è E2 ø

P(E) = P(E1). P ç



æ Eö æ E ö P ç ÷ + P( E4 ). P ç ÷ è E3 ø è E4 ø

16b 2 a2

(x2a2 – x4), x Î (0, a)





Squaring both sides, we get x 2 ( a2 - x 2 ) =

(i) Let P be the event that the shell fired from A hits the plane and Q be the event that the shell fired from B hits the plane. The following four hypotheses are possible before the trial, with the guns operating independently:    E1 = PQ, E2 = PQ , E3 = PQ , E4 = PQ

1



OR b 2 (iii) A = 2x × 2 a - x 2 , x Î (0, a ). a

38.





.

æEö æ Eö æ Eö æ E ö P ç ÷ = 0, P ç ÷ + 0, P ç ÷ = 1, P ç ÷ = 1 è E1 ø è E2 ø è E3 ø è E4 ø

length should be a 2 and its width should be 1/2 b 2.



, hence, A is maximum at

1







1

Since, there is only one critical point, therefore, the area of the soccer field is maximum at this a critical point x = . 1/2 2



2

2



and



2

Hence, by the first derivative test, there is a a . local maximum at the critical point x = 2

a

a

a



a

1

Thus, for maximum area of the soccer field, its length should be a 2 and its width should be



and close

dA < 0. 2 dx

2

(a2 – 3a2) = – 64b2 < 0



2

,

16b 2

a2



a

and for the values of x greater than

Z = A2 =

32b 2

b 2.

dA , >0 2 dx

a

2

=

maximum at x = x=

a

close to

a

( a2 - 6x 2 )

therefore, Z is

1/2

is the critical point.

(iii) For the values of x less than to

a2

Hence, by the second derivative test, there is a local maximum value of Z at the critical point a . Since there is only one critical point, x= 2





2







x =

32b 2





æ d 2Z ö çç 2 ÷÷ è dx øx =



a öæ a ö æ x2ç x + 2 2 ÷ ç ÷ 4b a - 2x 4b 2 øè 2ø = ´ =´ è 2 2 2 2 a a a -x a -x 1/2 a dA . = 0Þx= 2 dx a

=

dx 2

ù dA 4 b éê -x = + a2 - x 2 ú x´ ú dx a ê a2 - x 2 ë û

(ii)

.



d 2Z



4b = x a 2 - x 2 , x Î (0, a ). a

2







æ b 2 ö a - x 2 ÷ be the upper right Let (x, y) = ç x , è a ø vertex of the rectangle. b 2 The area function A = 2x × 2 1 a - x2 a

a

dZ =0Þx= dx

= 0.14 + 0.24 = 0.38

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Alternative way of writing the solution: (i) P(Shell fired from exactly one of them hits the plane) 1





E (ii) By Bayes’ Theorem, P æç 3 ö÷ è Eø





256







2

P(Shell from only B hit the plane) P(Exactly one of them hit the plane)

=

0.14 7 = 0.38 19

1

=

1



NOTE: The four hypotheses form the partition of the sample space and it can be seen that the sum of their probabilities is 1. The hypotheses E1 and E2 are actually eliminated æEö æ Eö as P ç ÷ = P ç ÷ = 0 è E1 ø è E2 ø

1

P(Shell fired from B hit the plane Ç Exactly one of them hit the plane) = P(Exactly one of them hit the plane)



0.14 7 = 0.38 19

= 0.3 × 0.8 + 0.7 × 0.2 = 0.38

(ii) P(Shell fired from B hit the plane/Exactly one of them hit the plane)



æ Eö æ E ö P ç ÷ + P( E4 ).P ç ÷ è E3 ø è E4 ø =

= P[(Shell from A hits the plane and Shell from B does not hit the plane) or (Shell from A does not hit the plane and Shell from B hits the plane)]





æ Eö P( E3 ).P ç ÷ è E3 ø = æEö æ Eö P( E1 ).P ç ÷ + P( E2 ). P ç ÷ + P( E3 ). è E1 ø è E2 ø

qq

Biology

UNIT-VI: REPRODUCTION

1

SEXUAL REPRODUCTION IN FLOWERING PLANTS Sexual Reproduction in Flowering Plants

Topic-1

Concepts Covered

 Structure of a flower, male and female reproductive structures, development of male and female gametophytes.

l



l





l



l



l



l

















l l

l





l



l l l l l

l



l



l

l



l



l







l



l



l





l



l





l



l

l



l





l





l





The first two layers perform the function of protection and help in dehiscence of anther to release the pollens. The middle layers and the innermost layer, (tapetum) nourishes the developing pollen grains. The cells of the tapetum possess dense cytoplasm and more than one nuclei. When the anther is young, a group of compactly arranged homogenous cells called sporogenous tissues occupies the centre of each microsporangium. Microsporogenesis When the anther develops, Scan to know each cell of sporogenous tissue more about undergoes meiotic division to this topic form microspore tetrads. Each cell of sporogenous tissue is a microspore mother cell (MMC) or pollen mother cell (PMC). MicrosporoThe process of formation of genesis microspores from a pollen mother cell (PMC) through meiosis is called microsporogenesis. Dehiscence of anther The microspores get arranged in a group of four cells and each group is called microspore tetrad. As the anthers mature and dehydrate, the microspores dissociate from each other and develop into pollen grains. From each microsporangium, thousands of pollen grains are formed and released due to the dehiscence of anther. Pollen grain (Male gametophyte) Pollen grain germinate and give rise to male gametophyte. These are spherical, measuring about 25-50 micrometers in diameter. Pollen grains are well preserved as fossils due to the presence of sporopollenin, a tough, resistant and stable material. A pollen grain has a two-layered wall namely, exine and intine. (a) Exine Exine is the hard outer layer which is made up of sporopollenin. The sporopollenin is one of the most resistant organic materials. l

Flower Flowers are the site of sexual reproduction in flowering plants. Parts of a typical angiospermic flower are: sepals, petals, stamens and pistils. The four whorls of the flower are attached on a central axis called thalamus. A flower can be bisexual (contains both male and female reproductive parts) or unisexual (only one of the reproductive parts is present). Male Reproductive Structures Androecium (Whorl of Stamens) Androecium consists of a whorl of stamens. The number and length of the stamens are variable in flowers of different species. A stamen has three parts namely, anther, filament and connective. (a) Anther It is the terminal and bilobed part of stamens attached with filament. A bilobed anther is called dithecous. Each lobe has two pollen sacs or microsporangia. Therefore, the anther is tetrasporangiate. A longitudinal groove runs lengthwise separating the theca. (b) Filament It is the long and slender stalk part of the stamen. Its proximal end is attached to the thalamus or petals of the flower. (c) Connective The structure which connects the anther lobes is known as connective. Transverse section of an anther The anther is tetragonal in a structure consisting of four microsporangia or pollen sacs located at the corners, two in each lobe. The microsporangia develop to become pollen sacs. They extend longitudinally throughout the length of an anther. These are packed with pollen grains. Structure of microsporangium or pollen sac It is circular and is generally surrounded by wall layers namely, (a) Epidermis (b) Endothecium (c) Middle layers (d) Tapetum l



Revision Notes

260

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



BIOLOGY

l

It can withstand high temperature and strong acids and alkali. It cannot be degraded by enzymes. The exine has apertures called germ pores where sporopollenin is absent. (b) Intine It is the inner, thin and continuous layer that is made up of cellulose and pectin. A mature pollen grain contains two cells namely, vegetative cell and generative cell. (i) Vegetative cell It is the bigger cell having abundant food reserve and a large irregularly shaped nucleus. (ii) Generative cell It is the smaller cell that floats in the cytoplasm of the vegetative cell. It is spindle shaped with dense cytoplasm and a nucleus. The pollen grains are generally shed at the 2-celled stage in flowering plants. In other plants, the generative cell divides mitotically to give rise to the two male gametes before pollen grains are shed in a 3-celled stage. Once they are shed, pollen grains have to land on the stigma before they lose viability. The period of pollen grains remaining viable varies and depends on the prevailing temperature and humidity. The viability of pollen grains of some cereals such as rice, wheat, etc. is 30 minutes while some members of Leguminosae, Rosaceae & Solanaceae have viability for months. Pollen grains of some plants like Parthenium are allergic for some people leading to chronic respiratory disorders such as asthma, bronchitis, etc. Pollen grains are rich in nutrients. Pollen tablets are used as food supplements. Pollen consumption in the form of tablets and syrups increases the performance of athletes and race horses. It is possible to store pollen grains for years in liquid nitrogen (–196°C). The pollens stored in the pollen banks for crop breeding programmes.

261













Concept: Male Reproductive Structures Mnemonic: Ask For Connectivity Interpretation: Anther, Filament, Connective Concept: Structures of microsporangium or pollen sac Mnemonic: Eating Tomato Interpretation: Endothecium, Tapetum Concept: Female Reproductive Structures Mnemonic: Small Soft Ornament Interpretation: Stigma, Style, Ovary



Fig 1.1: Transverse Section of a young anther

Fig 1.2: Enlarged view of an microsporangium



l



l



l



l



l



l

l



l



l



l



l

l



l



l



l



l



l



l

Mnemonics

Key Words Bronchitis: Inflammation of the mucous membrane in the bronchial tubes. Crop breeding: Deals with the production and selection of superior phenotypes for the development of improved and new varieties. Fig 1.3: Structure of two-celled male gametophyte (pollen grain)

Fig 1.4: Microsporogenesis

262

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



l



l l



l









l





l









l



l





l





l















l

l



l

l





l



l





l l l l



l l l l

l l

l

l

l

l

l

l

l



A single megaspore mother cell is differentiated in the micropylar region of the nucellus. The megaspore mother cell is a large cell containing dense cytoplasm and a prominent nucleus. The megaspore mother cell undergoes meiotic division resulting in the production of four haploid megaspores. Female gametophyte (Embryo sac) In most of the flowering plants, only one megaspore is functional while the other three degenerate. The functional megaspore develops into the female gametophyte or embryo sac. This method of embryo sac formation from a single megaspore is termed as monosporic development. Development of Female gametophyte The nucleus of the functional megaspore divides mitotically to form two nuclei which move towards the opposite poles, forming a twonucleated embryo sac. Two more sequential mitotic nuclear divisions result in the formation of the four-nucleated and later the eight-nucleated stages of the embryo sac These divisions are strictly free nuclear, i.e., nuclear divisions are not followed immediately by cell wall formation. After eight-nucleate stage, the organisation of the typical female gametophyte or embryo sac takes place. Generally six of the eight nuclei are surrounded by cell walls and organised into cells. The remaining two nuclei called the polar nuclei are found below the egg apparatus in the large central cell. Distribution of the cells within the embryo sac The three cells consisting of two synergids and one egg cell which are grouped at the micropylar end constitute the egg apparatus. The synergids have special cellular thickenings at the micropylar tip called filiform apparatus. The filiform apparatus helps to guide the pollen tubes into the synergid. Three cells at the chalazal end organise as the antipodals. Thus, a typical mature angiosperm embryo sac at maturity is eight-nucleate and seven-celled. l

Female Reproductive Structures Gynoecium (Pistil) It represents the female reproductive part of the flower. If it consists of a single pistil or carpel then, it is known as monocarpellary or if it has more than one pistil or carpel then, it is called multicarpellary. When there is more than one carpel, they may be fused then the pistil is known as syncarpous or may be free then, it is known as apocarpous. Each carpel has three parts namely stigma, style and ovary. (a) Stigma It is a landing platform for pollen grains. (b) Style It is an elongated slender part beneath the stigma. (c) Ovary It is the basal swollen part of the carpel. Inside the ovary is the ovarian cavity called the locule where the placenta is located. Placenta contains the ovules or megasporangia. The number of ovules in an ovary may be one as seen in wheat, paddy, mango, etc., or many as seen in papaya, watermelon, orchids, etc. Megasporangium (Ovule) It is a small structure attached to the placenta by a stalk called the funicle. Scan to know The junction where the body more about this topic of the ovule and funicle fuse is called the hilum. Each ovule has one or two and some times three protective Megasporancoverings called integuments. gium Integuments encircle the ovule except at the tip where a small opening called micropyle is organised. Opposite to the micropylar end is the chalaza which is the basal part of the ovule. Within the integuments, there is a mass of cells called nucellus which contains reserve food materials. Inside the nucellus there is an embryo sac, which is also called as the female gametophyte. An ovule has a single embryo sac usually formed from a single haploid megaspore. Megasporogenesis The formation of haploid megaspores from the diploid megaspore mother cell (MMC) as a results of meiosis is called megasporogenesis.





Fig 1.5: Stages of a microspore maturing into a pollen grain

BIOLOGY

Fig 1.6: A diagrammatic view of a typical anatropous ovule

Topic-2

263





Fig 1.7: A diagrammatic view of the mature embryo

Pollination and Fertilisation Concepts Covered

 Modes of Pollination,  Pollen-Pistil Interaction, Artificial Hybridisation, Double Fertilisation



l





l



l





l

l



l



l



l



l







l









l















l l l l







l











l

l



l l l l



Cleistogamous flowers produce assured seed set even in the absence of pollinators. Geitonogamy When the pollen grains are transferred from the anther to the stigma of another flower of the same plant, it is known as geitonogamy. It involves pollination with the help of a pollinating agent. It is structurally cross-pollination but genetically self-pollination. It is genetically similar to autogamy because the pollen grains come from the same plant. Xenogamy When the pollen grains are transferred from anther to the stigma of a different plant, it is known as xenogamy. It brings about genetically different types of pollen grains to the stigma. Agents of pollination: There are two types of agents of pollination namely: (a) Biotic agents (b) Abiotic agents Abiotic Agents There are two abiotic agents namely, wind and water which help pollination to takes place. Pollination by Wind The pollination taking place by the wind is called anemophily. Wind and water pollinated flowers are not very colourful and do not produce nectar. Wind pollinated flowers often have a single ovule in each ovary. Numerous flowers remain packed into an inflorescence. Example – In corn cob, the tassels are the stigma and style wave in the wind to trap pollen grains. Wind pollination is commonly seen in grasses. l

Modes of Pollination The process of transfer of pollen grains from the Scan to know anther to the stigma of a pistil is more about known as pollination. this topic There are few external agents which help the plants for pollination to take place. Pollination is of three types Pollination based on the source of pollens namely, (a) Autogamy (b) Geitonogamy (c) Xenogamy Autogamy When the pollen grains are transferred from the anther to the stigma of the same flower, it is known as autogamy. In flowers with exposed anthers and stigma, a complete autogamy is rare and hence the anthers and stigma should lie close to each other to enable self-pollination. Along with this there should be synchrony in pollen release and stigma receptivity. Plants like Viola (common pansy), Oxalis and Commelina produce two types of flowers namely Chasmogamous flowers and Cleistogamous flowers. (a) Chasmogamous flowers They are similar to flowers of other species with exposed anthers and stigma. (b) Cleistogamous flowers They do not open at all. Anthers and stigma lie close to each other. They are autogamous as there is no chance of cross-pollination. When anthers dehisce in the flower buds, pollen grains come in contact with the stigma for pollination.



Revision Notes

264

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



l

Synchrony: Fluctuation of multiple populations of



l

different places in the same way.

Stigma receptivity: Ability of stigma to support vi-

l



l l l





l

l





l





l



Unisexual flowers: Flower which contain only one i.e., either male or female reproductive parts in it.



l





and female reproductive organs.





l

Monoecious: An individual possessing both male

l



l l l l

Key Words

Outbreeding Devices (Devices for promoting CrossPollination) To avoid self-pollination, cross-pollination is encouraged in plants as follows:



l l



l





l

l





l

l





l

l





l



l



l



l





l





l



l



l



l





l





able anther for germination.

Characteristics of Anemophilous flowers The flowers produce an enormous amount of pollen. The pollen grains are light and non-sticky so that they can be transported through wind currents. They often possess well-exposed stamens for easy dispersal of pollens into wind currents. They have large, feathery and sticky stigma to trap air-borne pollen grains. Pollination by Water The pollination taking place by water is called hydrophily. It is limited to about 30 genera, mostly monocotyledons. In Vallisneria, the female flowers reach the surface of the water by the long stalk and the male flowers or pollen grains are released on to the surface of the water. These male flowers or pollen grains are carried by water currents and reach the female flowers. In sea grasses, the female flowers remain submerged in water and the long, ribbon-like pollen grains are carried inside the water and reach the stigma. The pollen grains of most of the water-pollinated species have a mucilaginous covering to protect from wetting. Not all aquatic plants use hydrophily. For example, in aquatic plants like water hyacinth, water lily, etc., the flowers emerge above the level of water for entomophily or anemophily i.e., for pollination to takes place by insects or wind. It is seen in Vallisneria & Hydrilla (freshwater), Zostera (marine sea-grasses), etc. Biotic Agents Some flowering plants use animals as pollinating agents like Bees, butterflies, flies, beetles, wasps, ants, moths, birds (sunbirds and hummingbirds) bats, some primates (lemurs), arboreal (treedwelling) rodents, reptiles (gecko lizard & garden lizard) etc. When the pollination takes place by insects, it is known as entomophily. Characteristics of Entomophilous Flowers Flowers are large, colourful, fragrant and rich in nectar. When the flowers are small, they form inflorescence to make them visible. The flowers pollinated by flies and beetles secrete foul odours to attract these animals. The pollen grains are generally sticky.

(a) Avoiding Synchronisation In some species, pollen release and stigma receptivity are not synchronised. Either the pollen is released before the stigma becomes receptive or the stigma becomes receptive before the release of pollen i.e., the anther and stigma mature at different times. This phenomenon is called dichogamy. It prevents autogamy. (b) Arrangement of Anther and Stigma at different Positions In some species, the arrangement of anther and stigma at different positions prevents autogamy. (c) Self-incompatibility It is a genetic mechanism that prevents pollen of one flower to germinate on the stigma of the same flower on of the same plant due to the presence of similar sterile genes in pollen and stigma. (d) Production of Unisexual Flowers (Dicliny) Monoecious plants such as castor and maize, where the male and the female flowers are present on the same plant prevents autogamy but not geitonogamy. On the other hand, dioecious plants like papaya, where the male and female flowers are present on different plants prevent both autogamy and geitonogamy. Pollen-pistil Interaction It is a dynamic process involving pollen recognition followed by Scan to know promotion or inhibition of the more about this topic pollen. This interaction takes place through the chemical components produced by them. If the pollen is compatible, then Pollen-Pistil the pistil accepts it and promotes interaction post-pollination events. The pollen grain germinates on the stigma to produce a pollen tube through one of the germ pores. The contents of the pollen grain move into the pollen tube. The pollen tube grows through the tissues of the stigma and style and reaches the ovary. If the pollen is incompatible, then the pistil rejects the pollen by preventing pollen germination on the stigma or the pollen tube growth in the style. In some plants, the pollen grains are shed at the two-celled stage, the generative cell divides and forms the two male gametes during the growth of the pollen tube on the stigma. In plants that shed pollen in the three-celled stage, the pollen tubes carry two male gametes from the beginning. The pollen tube, after reaching the ovary, enters the ovule through the micropyle chalaza/ integuments and then enters one of the synergids through the filiform apparatus. The filiform apparatus present at the micropylar part of the synergids guides the entry of the pollen tube. A plant breeder can manipulate pollen-pistil interaction, even in incompatible pollinations, to get desired hybrids. Artificial Hybridisation It is one of the major approaches of crop improvement programme by using desired pollen grains for pollination.

Key Words

265

Double Fertilisation The pollen tube after entering one of the synergids releases its contents including the two male gametes into the cytoplasm Scan to know more about of the synergid. this topic One of the male gametes moves towards the egg cell and fuses with its nucleus by the process of syngamy to form a diploid cell called the zygote. Double fertilisation The other male gamete moves towards the two polar nuclei located in the central cell and fuses with them to produce a triploid primary endosperm nucleus (PEN). As this involves the fusion of three haploid nuclei, it is called triple fusion. Since two types of fusions viz. syngamy and triple fusion take place in an embryo sac, it is called double fertilisation. The central cell after triple fusion becomes the primary endosperm cell (PEC) and develops into the endosperm while the zygote develops into an embryo. It is an event unique to flowering plants.

l

l

Emasculation is the removal of anthers by using forceps from the bisexual flower bud of female parent before the anther dehiscence. The emasculated flowers are then covered with a suitable bag made up of butter paper to prevent contamination of its stigma with unwanted pollen. This is called bagging.

l



When the stigma attains receptivity, the mature pollen grains collected from anthers of the male parent are dusted on the stigma. Then the flowers are rebagged and allowed to develop the fruits.



l



l

If the female parent produces unisexual flowers, there is no need for emasculation. The female flower buds are bagged before the flowers open.



l

When the stigma becomes receptive, pollination is carried out using the desired pollen and the flower rebagged.



l



l



l



l



l



l

l





This is achieved by emasculation and bagging techniques.



BIOLOGY l



Topic-3

Post-fertilisation Changes and Special Modes of Reproduction Concepts Covered and its types



 Embryo and its Development Apomixis and Polyembryony



Structure and types of Seed



Fruit



l



l



l l







l l





Dicotyledonous Embryo It has a central embryonal axis and two lateral cotyledons. The portion of the embryonal axis above the level of cotyledons is the epicotyl, which terminates into the plumule (stem tip). The cylindrical portion below the level of cotyledon is hypocotyl that terminates into the radicle (root tip). The root tip is covered with a root cap. l







l l l l l

Embryo Development The embryo develops at the micropylar end of the embryo sac where the zygote is situated. The zygotes divides only after the formation of a certain amount of endosperm to provide nutrition to the developing embryo. The development of embryo is similar in monocotyledons and dicotyledons up to the octant stage. The zygote gives rise to the pro-embryo and subsequently to the globular, heart-shaped and mature embryo.

l

Post-fertilisation Events The development of endosperm and embryo, the maturation of ovule(s) into seed(s) and ovary into fruit are post-fertilisation events. Endosperm Development The primary endosperm cell divides repeatedly Scan to know by mitosis to form a triploid more about endosperm tissue. this topic Endosperm cells are filled with reserve food materials that are used for the nutrition of the developing embryo. During the endosperm Post-fertilisation events development, the primary endosperm nucleus undergoes successive mitotic nuclear divisions to give rise to free nuclei. This stage is called free-nuclear endosperm. Then the endosperm becomes cellular due to the cell wall formation. For example, the tender coconut water is a freenuclear endosperm that is made up of thousands of nuclei and the surrounding white kernel is the cellular endosperm. l



Embryo and its Development



Revision Notes

266

Seed Seed is the final product of sexual reproduction. It is the fertilised ovule formed inside fruits. It consists of the seed coat(s), cotyledon(s) and an embryonal axis. The cotyledons are simple, thick and swollen due to the storage of food as seen in most of the dicots. Mature seeds may be non-albuminous or albuminous.

l



l



l

l



l



Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Fig 1.8: Fertilised embryo sac

Fig 1.11: L.S of an embryo of grass

Fig. 1.9: Stages in embryo development in a dicot showing zygote and primary endosperm nucleus

l





l





l



Fig 1.13: L.S. (monocot seed of onion) Non-albuminous or Non-endospermic Seeds These seeds have no residual endosperm as it is completely consumed during embryo development. Examples - pea, groundnut, beans. Albuminous or Endospermic Seeds These seeds retain a part of the endosperm as it is not completely used up during embryo development.

l







l

l



Fig 1.10: A typical dicot embryo Monocotyledonous Embryo They possess only one cotyledon. In the grass family, the cotyledon is called the scutellum which is situated lateral to the embryonal axis. At its lower end, the embryonal axis has the radicle and root cap enclosed in an undifferentiated sheath called coleorhiza. The portion of the embryonal axis above the level of attachment of the scutellum is the epicotyl. It has a shoot apex and a few leaf primordia enclosed in a hollow foliar structure called coleoptile. l



Fig 1.12: L.S (grain of maize)



BIOLOGY

l l





l





l

l





l

l





l



l

l





l

l

l



l





l

l







l



l









l



l



l



l



l



l



l



l





l



l



l



In some species such as banana, the fruits develop without fertilisation, these fruits are called parthenocarpic fruits. Parthenocarpy can be induced through the application of growth hormones. Such fruits are seedless. Advantages of Seeds The pollination and fertilisation processes are independent of water while the seed formation is more dependable. Seeds have better adaptive strategies for dispersal to new habitats and help the species to colonise in other areas. They have food reserves and so young seedlings are nourished until they are capable of photosynthesis. The hard seed coat protects the young embryo. Since seeds are the products of sexual reproduction, they generate new genetic combinations leading to variations. The dehydration and dormancy of mature seeds are crucial for the storage of seeds. It can be used as food throughout the year and also to raise a crop in the next season. Apomixis and Polyembryony Apomixis (apo = without; mixis = mixing together) means the production of seeds without fertilisation. It is seen in some species of Asteraceae and grasses. The apomixis is a form of asexual reproduction that mimics sexual reproduction. The occurrence of more than one embryos in a seed is called polyembryony. Development of Apomictic Seeds In some species, the diploid egg cell is formed without reduction division and develops into the embryo without fertilisation. In species like Citrus and Mango varieties, some of the nucellar cells surrounding the embryo sac divide and protrude into the embryo sac and develop into the embryos. Hence, in these species, each ovule contains many embryos. Importance of Apomixis in Hybrid Seed Industry Hybrid seeds have to be produced every year. If the seeds collected from hybrids are sown, the plants in the progeny will segregate and lose hybrid characters. The production of hybrid seeds is costly. Hence the cost of hybrid seeds is also expensive for the farmers. If the hybrids are made into apomict, there is no segregation of characters in the hybrid progeny. This helps farmers to use the hybrid seeds to raise new crop year after year without losing hybrid characteristics.



l



l



Examples: wheat, maize, barley, castor, coconut, sunflower. In some seeds like black pepper, beet, etc., the remnants of nucellus also persistent. It is called the perisperm. Integuments of ovules harden as tough protective seed coats. It has a small pore (micropyle) through which oxygen and water enter into the seed during germination. As the seed matures, its water content gets reduced and the seeds become dry (10-15 % moisture by mass). The general metabolic activity of the embryo slows down. The embryo may enter a state of inactivity (dormancy). If favourable conditions are available such as adequate moisture, oxygen and suitable temperature, they germinate. Fruit The ovary develops into a fruit after pollination and fertilisation. The transformation of ovules into seeds and ovary into fruit proceeds simultaneously. The wall of the ovary develops into a pericarp. The fruits may be fleshy as seen in guava, orange, mango, etc., or may be dry as seen in groundnut, mustard, etc., Many fruits have mechanisms for the dispersal of seeds. Fruits are of two types namely: (a) True fruits: When the fruit develops only from the ovary and other floral parts degenerate and fall off, they are called true fruits. Examples- mango, maize, grape. (b) False fruits: When parts of a flower other than the ovary also contribute to the fruit formation, they are called false fruits. Examples– apple, strawberry, cashew, etc.

267

Fig 1.14: Sectional view of an apple

Mnemonics Mnemonics: Personal Assistant Engineer and Senior Commandant of Railway Police Crops. Interpretation: Pericarp, Aleurone layer, Endosperm, Scutellum, Coleoptile, Radicle, Plumule, Coleorhiza





1. Concept: Cells in Mature Embryo sac Mnemonics: All Purpose Central Education Senior Federation Interpretation: Antipodal, Polar nuclei, Central cell, Egg cell, Synergid, Filiform apparatus 2. Concept: L. S. of Grain of maize

qqq

2

HUMAN REPRODUCTION

Topic-1

Human Reproductive System Concepts Covered Reproductive System



Structure of Male Reproductive System,



Structure of Female

Revision Notes

l l

















l l



l



l















l l

l



IMPORTANT DIAGRAMS

Fig 2.1 : Human Male Reproductive System

l



l





l





l

l



l





l

l





l



l

l

l

l

l

l

l

Seminal vesicles produce seminal fluid and form 60 – 70% of semen. The secretion of bulbourethral glands is alkaline and rich in mucus. It helps in the lubrication of the penis, supplies nutrient to sperms and provides an alkaline medium to counteract the acidity of the uterus. External Genitalia The penis is the male external genitalia. It is made up of special tissue that helps in the erection of the penis to facilitate insemination. The enlarged end of the penis is called the glans. The penis is covered by a loose fold of skin called foreskin.



Reproductive System Male Reproductive System  It consists of : (a) A pair of testes (b) Accessory ducts (c) Accessory glands (d) External genitalia Testes Testes are the primary sex organs that produce sperms and testosterone hormone. Testes are located in the scrotum present in between upper thighs. The low temperature (2 – 2.5°C less than the normal internal body temperature) in the scrotum helps for the proper functioning of testes and spermatogenesis. Each testis is oval in shape and has about 250 (200 – 300) compartments called testicular lobules. Each lobule is filled with connective tissue and contains 1-3 coiled yellow seminiferous tubules in which sperm are produced. Seminiferous tubule is lined internally with spermatogenic cells called spermatogonia or primary male germ cells and sertoli cells or supporting cells. Spermatogonia undergo meiotic divisions and leads to sperm formation. Sertoli cells give shape and nourishment to developing spermatogenic cells and therefore also called as nurse cells. The regions outside the seminiferous tubules are the interstitial spaces which contain small blood vessels and interstitial cells or Leydig cells. The Leydig cells are endocrine in nature and secrete testicular hormones called androgens. Immunologically competent cells are also present. Accessory Ducts The duct system includes rete testis, vasa efferentia, epididymis and vas deferens. The seminiferous tubules open into the vasa efferentia through rete testis. The vasa efferentia open into the epididymis. The epididymis leads to vas deferens that ascends into the abdomen and loops over the urinary bladder. It receives a duct from the seminal vesicle and opens into the urethra as the ejaculatory duct. These ducts store and transport the sperms from the testis to the outside through urethra. The urethra originates from the urinary bladder and extends through the penis to its external opening called the urethral meatus. Accessory Male Genital Glands It includes paired seminal vesicles, prostate and paired bulbourethral glands (Cowper’s glands). The secretions of these glands constitute the seminal plasma, which is rich in fructose, calcium and certain enzymes.

Fig 2.2 : Sectional view of human seminiferous tubule

Ovum

Cells of the corona radiata

Perivitelline space

Zona Perivitelline

Sperm

Human foetus within uterus

Plug of mucus in cervix

Umbilical cord with its vessels

Placental villi

Ovum Fertilisation to 2-celled (a) form zygote (b) stage (c)

Cavity of uterus Yolk sac Embryo

Morula (e)

Fertilisation

(f) Blastocyst (g)

4-celled stage (d)

Blastocyst implantation

Pregnancy and placenta formation

Parturition

m

Reprodu an c

External Genitalia

Menstrual Cycle

Gametogenesis

the end of pregnancy

Female Reproductive System minora



First Level

Second Level

Trace the Mind Map

2nd



Hu

Male Reproductive System

Third Level 

BIOLOGY

269

n tio

Oswaal CBSE LMP (Last Minute Preparation), Class-XII





l







l



l

l





l

l



l







l

l





l

l



l





l

l l





l

l





l



l

l





l

l





l

l



(a) The external thin membranous perimetrium. (b) The middle thick layer of smooth muscle, myometrium. (c) The inner glandular layer called the endometrium. The endometrium undergoes cyclic changes during the menstrual cycle while the myometrium exhibits strong contraction during delivery of the baby. The vagina opens to the exterior between the urethra and anus. The lumen of the vagina is lined by a glycogenrich mucous membrane consisting of sensitive papillae and Bartholin’s glands. The secretions of Bartholin’s glands lubricate the penis during sexual activity. External Genitalia It includes the mons pubis, labia majora, labia minora, hymen and clitoris. The external genitalia are collectively called the vulva. Mons pubis is a cushion of fatty tissue covered by skin and pubic hair. The labia majora are a pair of large thicker fleshy folds of tissue, which surround the vaginal opening. The labia minora are a pair of narrow fleshy folds of tissue found below labia majora. The opening of the vagina is often covered partially by a membrane called the hymen. The hymen is often torn during the first coitus (intercourse) or accidentally. The clitoris is a tiny finger-like structure that lies at the upper junction of the two labia minora above the urethral opening.

The Female Reproductive System It includes a pair of ovaries, accessory ducts and external genitalia. Ovaries They are the primary female sex organs that produce ova or the female gametes. It Scan to know secretes many steroid ovarian more about hormones such as estrogen and this topic progesterone. Ovaries are located on both sides of the lower abdomen. Each ovary is about 2-4 cm in length. and Female The ovaries are connected to Male Reproductive the pelvic wall and uterus by system ligaments. Each ovary is covered by a thin epithelium which encloses the ovarian stroma. The stroma has outer cortex and an inner medulla. The ovary contains groups of cells known as Ovarian or Graafian follicles. Each follicle carries a centrally placed ovum. Accessory Ducts It includes two oviducts or fallopian tubes, cervix, a uterus and vagina. Each oviduct is 10-12 cm long and has four parts namely, infundibulum, ampulla, isthmus and uterine part. (a) Infundibulum It is the funnel-shaped opening provided with many finger-like fimbriae for catching released ovum. It helps to collect the ovum after its release from the ovary. (b) Ampulla The infundibulum leads to the curved and dilated part called the ampulla. (c) Isthmus It is the last straight part of the oviduct. It has a narrow lumen and joins the uterus. (d) Uterine part It is about 1 cm long part of the oviduct which passes into the uterus. Uterus It is single and also called the womb. The shape of the uterus is like an inverted pear. It is supported by ligaments attached to the pelvic wall. The uterus opens into the vagina through a narrow cervix. The cavity of the cervix is called the cervical canal which along with the vagina forms the birth canal. The wall of the uterus is thick and muscular and is differentiated into three layers of tissue namely,



270

l



Key Words vaginal aperture

l







l



l



l



l



l

Mammary Glands A pair of mammary glands containing glandular tissue and fat is present in the chest region. The glandular tissue of each breast has 15-20 mammary lobes containing clusters of cells called alveoli. The cells of alveoli secrete milk which is stored in the cavities or lumen of alveoli. The alveoli open into mammary tubules. The tubules of each lobe join to form a mammary duct. Several mammary ducts join to form a wider mammary ampulla which is connected to the lactiferous duct through which milk is sucked out.

l

l





l



l



l





l



l



l



Cervix : Connects vagina and uterus Hymen : Thin membrane partially covering the

Mnemonics 1. Concept: Accessory Male Genital Glands Mnemonics: Supreme Power in Back or Seven Pieces of Banana Interpretations: Seminal vesicles, Prostate, Bulbo-urethral glands 2. Concept: Structure of Oviducts. Mnemonics: I Am Intelligent than U

Interpretations: Infundibulum, Ampulla, Isthmus, Uterine part. 3. Concept: Female External genitalia Mnemonics: Mobile's Light Led Him Crazy. Interpretations: Mons pubis, Labia majora, Labia minora, Hymen Clitoris.



BIOLOGY

271

Fig 2.3: Human Female Reproductive system

Topic-2

Gametogenesis and Menstrual Cycle Concepts Covered 

Menstrual Cycle



Gametogenesis  Structure of Sperm  Structure of Ovum



l





l





l l



l





l l



l





l



l l











(b) Neck Behind the head is a neck containing proximal and distal centrioles. The distal centriole of the neck is connected to the axial filament. (c) Middle Piece It is composed of axial filament surrounded by numerous mitochondria and cytoplasm. Mitochondria produce energy for the sperm motility. (d) Tail It consists of a central axial filament. The sperm moves in fluid medium and female genital tract by the undulating movement of the tail.

l



l







l



l l l l l l l l



l l l

secrete two gonadotropins namely Luteinizing hormone (LH) and Follicle stimulating hormone (FSH). LH acts on the Leydig cells and stimulates the synthesis and secretion of androgens which in turn stimulate the spermatogenesis. FSH acts on the Sertoli cells and stimulates the secretion of some spermatogenic factors which help in the process of spermiogenesis. Structure of Sperm It is a microscopic structure. A mature sperm measures about 60 μm (0.06 mm) long. A plasma membrane envelops the whole body of sperm. Sperm consists of four parts namely, head, neck, a middle piece and a tail region. (a) Head It is oval-shaped, consisting of a nucleus and acrosome. The acrosome is formed from Golgi complex which contains lytic enzymes, that help in fertilisation of the ovum.

l

Gametogenesis The process of formation of gametes or sex cells is known as gametogenesis. It includes spermatogenesis and oogenesis. Spermatogenesis It is the process of the formation of sperms in seminiferous tubules of testes. Scan to know It has two stages namely, more about this topic (a) Formation of spermatids (b) Spermiogenesis During the formation of spermatids, spermatogonia i.e., sperm mother cells or immature male germ cells produce Spermatogenesis spermatids. In spermiogenesis, the spermatids are transformed into sperm. Each primary spermatocyte undergoes meiosis-I and produces two haploid secondary spermatocytes. Each secondary spermatocyte divides by meiosisII and produces two haploid spermatids. Thus, four spermatids are formed from each primary spermatocyte. The spermatids, under the influence of FSH of the anterior pituitary, are converted into spermatozoa. The process is called spermiogenesis. After spermiogenesis, the sperm head become embedded in the Sertoli cells and are finally released from seminiferous tubules. The process of release of mature spermatozoa from the Sertoli cells into the lumen of seminiferous tubules is known as spermiation. Hormones in Spermatogenesis The hypothalamus releases a large amount of Gonadotropin-releasing hormone (GnRH). GnRH stimulates the anterior pituitary gland to l



Revision Notes

272

l







l



l



l

l



Fig 2.4 : Structure of a Sperm Oogenesis It is the process of formation and maturation of the ovum. Scan to know more about It takes place in Graafian this topic follicles. It is initiated in embryonic stage when millions of egg mother cells (oogonia) are formed Oogenesis within each ovary.



l

l



l





l

l





l



l

l



l



l





l



l



l



l



l

l





l

Sperms are transported through the accessory ducts. The secretions of the epididymis, vas deferens, seminal vesicle and prostate are essential for maturation and motility of sperms. The seminal plasma and sperms together constitute the semen. The human male ejaculates about 200-300 million sperms during a coitus ejaculation. For normal fertility at least 60% of sperms must have a normal shape and size and 40% of them, must show vigorous motility. Key Diagram :

l

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

No oogonia are formed and added after birth. Oogonia multiply to form primary oocytes which enter into prophase-I of the meiosis and get temporarily arrested at that stage. Each primary oocyte gets surrounded by a layer of granulosa cells to form a primary follicle. A large number of primary follicles degenerate during the phase from birth to puberty. Therefore at puberty, only 60,000-80,000 primary follicles are left in each ovary. The primary follicles get surrounded by more layers of granulosa cells and a new theca to form secondary follicles. The secondary follicles get transformed into a tertiary follicle. It has a fluid-filled cavity (antrum). The theca layer forms an inner theca interna and an outer theca externa. The primary oocyte within the tertiary follicle grows in size and undergoes first unequal meiotic division to form a large haploid secondary oocyte and a tiny first polar body. The secondary oocyte retains the nutrient-rich cytoplasm of the primary oocyte. It is unknown, whether the first polar body divides further or degenerates. The tertiary follicle further changes into the mature follicle (Graafian follicle). The secondary oocyte forms a new membrane (zona pellucida). The Graafian follicle now ruptures to release the secondary oocyte (ovum) from the ovary. This is called ovulation.

Key Diagram :

Fig 2.5 : Schematic representation of (a) Spermatogenesis (b) Oogenesis

BIOLOGY

Structure of Ovum It is a spherical or oval and non-motile female gamete. It is about 0.2 mm in diameter. The human ovum is non cleidoic (without shell) and alecithal (without yolk). Ovum has four membranes namely, (a) Plasma membrane (Oolemma) : Innermost layer. (b) Vitelline membrane : Attached to the plasma membrane. (c) Zona pellucida : Transparent non-cellular, thick, glycoprotein rich layer found outer to the vitelline membrane. (d) Corona radiata : Outer layer is formed of follicle cells. These cells are held together by a mucopolysaccharide called hyaluronic acid.

273



 











l l



l



l





Fig 2.6 : Structure of human ova

Fig 2.7 : Graafian follicle

l





l



l





l



l



l



l



l l



Fig 2.8 : Sectional view of ovary Menstrual Cycle The reproductive cycle in the human female and related primates is called the menstrual cycle. The first menstruation begins at puberty (at the age of 10-12 years) and is called menarche. In human females, menstruation is repeated at an average interval of about 28/29 days and the cycle of events starting from one menstruation till the next one is called the menstrual cycle. One ovum is released during the middle of each menstrual cycle. The cycle starts with the menstrual phase, when menstrual flow occurs, it lasts for 3-5 days.

The menstrual flow results due to the breakdown of the endometrial lining of the uterus and its blood vessels which form the liquid that comes out through the vagina. Menstruation occurs only if the released ovum is not fertilised. Lack of menstruation may be indicative of pregnancy or may also be caused due to some other underlying causes like stress, poor health, etc. The menstrual phase is followed by the follicular phase.

274



l



l

l



l





l

l



l







l

During the follicular phase, the primary follicles in the ovary grow to become a fully mature Graafian follicle and simultaneously, the endometrium of uterus regenerates through proliferation. These changes in the ovary and the uterus are induced by changes in the levels of pituitary and ovarian hormones. The secretion of gonadotropins (LH and FSH) increases gradually during the follicular phase and stimulates follicular development as well as secretion of estrogens by the growing follicles. Both LH and FSH attain a peak level in the middle of the cycle (about the 14th day). Rapid secretion of LH leading to its maximum level during the mid-cycle called LH surge induces rupture of Graafian follicle and thereby the release of an ovum (ovulation). The ovulation (ovulatory phase) is followed by the luteal phase during which the remaining parts of the Graafian follicle transform as the corpus luteum. The corpus luteum secretes large amounts of progesterone which is essential for the maintenance of the endometrium. During pregnancy, all events of the menstrual cycle stop and there is no menstruation. In the absence of fertilisation, the corpus luteum degenerates. This causes disintegration of the endometrium leading to menstruation, marking a new cycle.

l



l

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

In human beings, the menstrual cycle ceases at around 50 years of age and is termed as menopause. Cyclic menstruation is an indicator of the normal reproductive phase and extends between menarche and menopause.

Fig 2.9 : Various events during Menstrual Cycle

Mnemonics 1. Concept: Structure of Sperm Mnemonics: High Node Magnification Time Interpretations: Head, Neck, Middle piece, Tail 2. Concept: Structure of Ovum

Topic-3

Mnemonics: Please cross Via Zebra Crossing Interpretations: Plasma membrane Vitelline membrane, Zona pellucida, Corona radiata

Fertilisation and Post-Fertilisation Events Concepts Covered 

Lactation





Fertilisation



Pregnancy



Placenta Formation and Functions

Parturition

l

Fertilisation The process of fusion of male gamete (sperm) with the female gamete (ovum) is called fertilisation. During copulation, semen is released through the penis into the vagina (insemination). After insemination, the sperms swim through the cervix and enter into the uterus and reach the ampullary-isthmic junction of the oviduct where fertilisation takes place. The process of fertilisation takes place as follows : Sperms → vagina → cervical canal → uterus → isthmus ↓ Fertilisation ← Ampullary-isthmic Junction ampulla ↑ Ovum (from ovary) → fimbriae → infundibulum →

















l







l



l



l



l



l





Revision Notes Fertilisation (sperm + ovum → zygote) occurs only if ovum and sperms are transported simultaneously. So all copulations do not lead to fertilisation and pregnancy. As soon as sperm contacts with zona pellucida, it induces changes in the membrane that block entry of additional sperms. With the help of enzymes of the acrosome, which dissolve the zona pellucida and plasma membrane of the ovum, the sperm enters into the cytoplasm of the ovum. This induces

Scan to know more about this topic

Fertilisation Scan to know more about this topic

Embryo development

BIOLOGY





l l



l



l





l



l

l

l



Key Word

l



Morula: The embryo with 8-16 celled blastomeres. Chorionic villi: Tiny projections of placental tissue



l l







l



l



l



l



l l

The blastomeres in the blastocyst are arranged into an outer layer (trophoblast) and an inner group of cells (inner cell mass) attached to the trophoblast. The trophoblast layer then gets attached to the endometrium and the inner cell mass gets differentiated into three germ layers namely, outer ectoderm, middle mesoderm and inner endoderm forming 3-layered structure (gastrula) leading to the formation of the embryo. After attachment, uterine cells divide rapidly and cover the blastocyst. As a result, the blastocyst becomes embedded in the endometrium of the uterus. This is called implantation.



l







l l

l



l

that look like fingers and contain the same genetic material as the foetus.



l



l





l l



l

l





l





l



l

l



Fig 2.10: Diagram of a Blastocyst Embryo Pregnancy and Embryonic DevelImplantation opment After implantation, the finger-like projections called chorionic villi appear on the trophoblast which is surrounded by the uterine tissue and maternal blood. The chorionic villi and uterine tissue become interdigitated with each other and form a structural and functional unit between the developing embryo and the maternal body called the placenta. The placenta is a structural and functional unit between the embryo (foetus) and the maternal body. The placenta is connected to the embryo by an umbilical cord. The umbilical cord helps to transport substances to and from the embryo. l





l



l

Scan to know more about this topic

275

Functions of Placenta It acts as a barrier between the foetus and mother. Soluble inorganic and organic materials, nutrients, hormones, antibodies, etc. can pass through the placenta from the mother to the foetus. It helps in the gas exchange between mother and foetus. It helps to eliminate nitrogenous wastes of foetus. It acts as an endocrine gland by secreting several hormones like human Chorionic Gonadotropin (hCG), human Placental Lactogen (hPL), oestrogens, progesterone and relaxin. Pregnancy During pregnancy, levels of estrogen, progestogen, cortisol, prolactin, thyroxine, etc. are also increased in maternal blood. They support the foetal growth, metabolic changes in the mother and maintain pregnancy. Three germ layers (ectoderm, endoderm, mesoderm) give rise to all tissues (organs) in adults. The stem cells in inner cell mass have the potency to give rise to all the tissues and organs. Human pregnancy (gestation period) lasts 9 months (for cats : 2 months, dogs : 2 months, elephants : 21 months). Changes in Embryo during Pregnancy After one month of pregnancy : The heart is formed. End of second month : Limbs and digits are developed. End of 12 weeks (first trimester) : The major organs such as limbs, external genital organs etc., are well developed. During 5th month : The first movement of foetus and appearance of hair on the head. End of 24 weeks (second trimester) : Body is covered with fine hair, eyelids separate and eye lashes are formed. End of 9 months : Ready for delivery. Parturition (Labour) and Lactation The process of giving birth to young ones after the gestation period of nine months is known as parturition. Parturition is induced by a neuroendocrine mechanism. The signals originating from the foetus and placenta induce mild uterine contractions (foetal ejection reflex). This causes the release of oxytocin from the maternal pituitary. Oxytocin causes stronger uterine muscle contractions which in turn stimulate further secretion of oxytocin. This process is continued leading to the expulsion of the baby out of the uterus through the birth canal. After parturition, the umbilical cord is cut off. The placenta and remnants of the umbilical cord are expelled from the maternal body after parturition. This is called “after birth”. Lactation The mammary glands produce milk towards the end of pregnancy by the process called lactation. The yellowish milk produced during the initial few days of lactation is called colostrum. The colostrum contains several antibodies essential to develop resistance for newborn babies. qqq l



l





l

second meiotic division of the secondary oocyte to form a second polar body and a haploid ovum (ootid). The haploid nuclei of the sperm and ovum fuse together to form a diploid zygote. Implantation The mitotic division (cleavage) starts as the zygote moves through the isthmus of the oviduct towards the uterus and forms 2, 4, 8, 16 daughter cells called blastomeres. The embryo with 8-16 blastomeres is called a morula. Morula continues to divide and transforms into a large mass of cells called the blastocyst, which moves further towards the uterus.





3

REPRODUCTIVE HEALTH

















Immunisation : A process of making an individual immune to infection (Protecting against disease by the use of vaccine) Abstinence : Practice of refraining oneself from sexual intercourse, stimulants, food etc. They are grouped as follows : 1. Natural or Traditional Methods : These methods of birth control depend upon the natural rhythm of a woman. These include the following methods: (a) Coitus interruptus : This involves withdrawing the penis by the male partner before ejaculation so that









Key Words







 















Foeticide : Destruction or abortion of a foetus. Pre-natal : Before birth Post-natal : After birth





















Key Words

The aims of Reproductive and Child Care Programmes : (a) Create awareness in both males and females about various reproductive aspects with the help of audio-visual and print media by both Government and Non-Government agencies. (b) Provide sex education in schools to save the young generation from myths and misconceptions about sex related issues. (c) Prevention and control of sexually transmitted diseases by providing the correct information about reproductive organs, adolescence and safe and hygienic sexual practices. (d) Educate the fertile couples and those in marriageable age about birth control devices, prenatal and post-natal care of mother and child, importance of breast-feeding, etc. (e) Provide awareness about ill-effects of population explosion, sexual abuses, sex discrimination and sex related crimes. (f) Provide medical facilities and support like infra structural facilities, professional expertise and material support to decrease maternal and infant mortality rates. (g) Reduce the problem of infertility by promoting Assisted Reproductive Techniques (ARTs).

Steps Taken to Maintain a Reproductively Healthy Society 1. Imposing a statutory ban on amniocentesis (analysis of amniotic fluid-Foetal Sex Determination.) 2. Rigorous implementation of immunisation programs. 3. Creation of specialised health centres like infertility clinic for diagnosis and corrective treatment of some infertility disorders. 4. Better awareness about sex-related matters and sex-related problems, etc. 5. Increase in the number of medically assisted deliveries and better post-natal care. 6. Increase in the number of couples with small families. 7. Early detection and cure of STDs. How to Control Over Population ? (i) People should be given education regarding the advantages of small family and family planning methods. (ii) Increasing the age of marriage. (iii) Incentives to those families, who are adopting family planning methods. (iv) Birth control through vasectomy and tubectomy. (v) Family planning programmes with the slogan ‘Hum Do Hamare Do’. Birth Control Measures : The most important step to overcome this problem is to encourage smaller families by using various contraceptive methods. The contraceptive methods help to prevent unwanted pregnancies. An ideal contraceptive should be • User-friendly, easily available, effective and reversible. • With no or least side-effects. • Non-interfering with sexual drive, desire & sexual act.



Reproductive Health • The term ‘reproductive health’ simply refers to healthy reproductive organs with normal functions. According to WHO (World Health Organisation), the word ‘reproductive health’ means a total well-being in all aspects of reproduction i.e., physical, emotional, behavioural and social. • Thus, a society with people having physically and functionally normal reproductive organs and normal emotional and behavioural interactions among them in all sex-related aspects might be called reproductively healthy. Problems Associated with Reproductive Health : (a) Rapid increase in the human population is called population explosion. (b) Lack of awareness and sex education in people. (c) Spread of myths and misconceptions about sexrelated aspects. (d) Common occurrence of sexually transmitted diseases due to lack of knowledge of hygiene of reproductive organs. (e) Illegal abortions and female foeticides. (f) Sex abuse and sex-related crime. Strategies of Reproductive Health Programmes: To ensure total reproductive health, several programmes like reproductive health programmes and family planning were started in 1951.





Revision Notes

Scan to know more about this topic

Natural contraceptive method



BIOLOGY

277

278

Oswaal CBSE LMP (Last Minute Preparation), Class-XII  

















Sterilisation or Surgical Methods : These methods block gamete transport and so prevent conception. These include the following measures : (a) Male sterilisation : It is a permanent method of birth control in which Scan to know either testes are surgically more about removed, called castration, this topic or cutting of the vas deferens, called Vasectomy. The vas deferens is exposed and cut through a small Surgical incision on the scrotum Methods to prevent the passage of sperms. (b) Female sterilisation : Methods of female sterilisation include : (i) Ovariectomy involves surgical removal of ovaries. (ii) Tubectomy involves cutting or tying up of fallopian tubes through a small incision in the abdomen or through vagina. (iii) Tubal ligation involves blocking of fallopian tubes by an instrument called a laparoscope. Medical Termination of Pregnancy (MTP) • Intentional or voluntary termination of pregnancy before full term is called MTP or induced abortion. • 45 to 50 million MTPs are performed in a year all over the world (i.e., 1/5th of the total number of conceived pregnancies). • MTP helps to decrease the population. • Because of emotional, ethical, religious and social issues many countries have not legalised MTP.











































4.











• The pills are usually small doses of progestogens or progestogen–estrogen combinations in the form of tablets (pills). • Pills are taken daily for 21 days starting within the first five days of the menstrual cycle. After a gap of 7 days (during which menstruation occurs) it has to be repeated in the same pattern as long as the female desires to prevent conception. • They inhibit ovulation and implantation as well as alter the quality of cervical mucus to prevent the entry of sperms. • Pills are very effective with lesser side effects. • Saheli : It is a new oral contraceptive for females. It was developed by the Central Drug Research Institute (CDRI) Lucknow. It contains a non-steroidal preparation. It is a 'once a week' pill with very few side effects and high contraceptive value. • Drawbacks of Oral Contraceptives : Nausea, abdominal pain, breakthrough bleeding, irregular menstrual bleeding, breast cancer etc. (iii) Injectables/Implants • Progestogens alone or in combination with an oestrogen is used by females as injections or implants under the skin. • Their mode of action is similar to that of pills and their effective periods are much longer. These are also effective within 72 hours of coitus. Thus it has been found to very effective as emergency contraceptives.



semen is not deposited in the vagina. It is the oldest method of voluntary fertility control. This method has certain limitations: • Some sperms may be deposited in the vagina even before the sexual climax. • May develop physiological and psychological problems for both partners. (b) Periodic abstinence : A week before and a week after the menstrual phase are supposed to be safe periods for sexual intercourse. It reduces the chances of pregnancy by about 80 percent. The period from 10th to 17th day (both days included) of the menstrual cycle is called danger or risk or fertile period and unprotected sexual intercourse should be avoided during this period. (c) Lactational amenorrhea : It has been noticed that during the period of intense lactation after the parturition, the mother does not undergo menstruation and ovulation so, the chances of conception are nearly nil. It also has no side effects but it is effective only up to a maximum period of six months after parturition. 2. Artificial Methods : This involves mechanical or barrier methods. (a) Condoms : These are rubber or latex sheaths that are put on the penis before coitus (copulation). These are popularly called ‘Nirodh’. These check pregnancy by preventing the deposition of sperms in the vagina. These can be self-inserted to give privacy to the user. These also prevent the spread of sexually transmitted diseases (STDs) including AIDS, syphilis, etc. Female condoms are also available called femidoms. (b) Diaphragms and cervical caps : These are mechanical barriers made of rubber and fitted in the vagina of a female to check the entry of sperms in the uterus. These are reusable. (c) Intra Uterine Devices (IUDs) : These are inserted by doctors or expert nurses in the uterus through the vagina. These include : • Non-medicated IUDs (e.g., Lippes loop) • Copper releasing IUDs (e.g., Copper T) • Hormone releasing IUDs (e.g., Progestogen) : Make the uterus unsuitable for implantation and the cervix hostile to the sperms. • IUDs increase the phagocytosis of sperms. The Cu ions suppress the motility and fertilising capacity of sperms. • IUDs are ideal contraceptives for females who want to delay pregnancy or spacing in children. 3. Chemical Methods : These are of the following types : (i) Spermicidal tablets, jellies, paste and creams introduced in the vagina before coital activity. These kill sperms. Common spermicidal chemicals used are lactic acid, citric acid, potassium permanganate, zinc sulphate etc. (ii) Physiological (Oral) Devices : These are the hormonal preparation in the form of pills for females.



BIOLOGY







 

































































Assisted Reproductive Technologies (ART) (1) In vitro fertilisation (IVF– test tube baby programme) : In this method, ova from the wife/ donor and sperms from the husband/donor are collected and are induced to form zygote under simulated conditions in the laboratory. This is followed by Embryo transfer Scan to know (ET). It is of 2 types : more about (a) Zygote Intra Fallopian this topic Transfer (ZIFT) : Transfer of zygote or early embryos (with up to 8 blastomeres) into the fallopian tube. (b) Intra Uterine Transfer (IUT) In vitro : Transfer of embryos with fertilisation more than 8 blastomeres into the uterus. The embryo formed by in vivo fertilisation (fertilisation within the female) is also used for such transfer to assist those females who cannot conceive. (2) Gamete Intra Fallopian Transfer (GIFT) : Transfer of an ovum from a donor into the fallopian tube of another female who cannot produce ovum, but can provide a suitable environment for fertilisation and development. (3) Intra Cytoplasmic Sperm Injection (ICSI) : A laboratory procedure in which a single sperm (from a male partner) is injected directly into an egg (from a female partner). Then the fertilised egg is implanted into the woman’s uterus. (4) Artificial Insemination (AI) technique: • The semen collected from the husband or a healthy donor is artificially introduced into the vagina or the uterus (IUI– intra-uterine insemination) of the female. • This technique is useful for the male partner having an inability to inseminate female or low sperm counts, etc. (5) Surrogacy • Here, a woman (surrogate mother) bears a child for a couple unable to Scan to know produce children, because more about this topic the wife is infertile or unable to carry. • The surrogate is impregnated either through artificial insemination or through the implantation Infertility Artificial of an embryo produced by Insemination in vitro fertilisation. Problems of ART • It requires high precision handling by specialized professionals and expensive instrumentation. Therefore, these facilities are available only in very few centres and are affordable to only a limited number of people.











• Government of India legalised MTP in 1971 with some strict conditions to check indiscriminate and illegal female foeticides which are reported to be high in India. Importance of MTP • To avoid unwanted pregnancies due to casual intercourse or failure of the contraceptive used during coitus or rapes. • Essential in cases where continuation of the pregnancy could be harmful to the mother or to the foetus or both. • MTPs are safe during the first trimester, (up to 12 weeks of pregnancy). 2nd-trimester abortions are very risky. Problems Related to MTPs • Majority of the MTPs are performed illegally. • Misuse of amniocentesis (a foetal sex determination test based on the chromosomal pattern in the amniotic fluid). • MTP for a female child causes sex imbalance in society. Amniocentesis • It is a prenatal diagnostic method to determine the sex of the developing baby. This method has both positive and negative application. This method is legally banned in India. (a) Positive application • It helps to detect any genetically controlled congenital disease or any metabolic disorders in the foetus. (b) Negative application • People use this method for female foeticide, which causes sex imbalance in society. Sexually Transmitted Diseases (STDs) • Diseases transmitted through sexual intercourse are called Sexually transmitted diseases (STDs)/ Venereal diseases (VD) or Reproductive tract infections (RTI). e.g., Gonorrhoea, syphilis, genital herpes, chlamydiosis, genital warts, trichomoniasis, hepatitis-B and HIV leading to AIDS. • Hepatitis-B and HIV are also transmitted: (a) By sharing of injection needles, surgical instruments, etc. (b) By transfusion of blood. (c) From infected mother to foetus. • Except Hepatitis B, genital herpes, HIV and other diseases are completely curable if detected early and treated properly. • Early symptoms : Itching, fluid discharge, slight pain, swellings, etc., in the genital region. • Absence or less significant early symptoms and the social stigma deter the infected persons to consult a doctor. This leads to pelvic inflammatory diseases (PID), abortions, stillbirths, ectopic pregnancies, infertility, cancer of the reproductive tract, etc. • All persons are vulnerable to STDs. These are very high among persons in the age group of 15-24 years. • Prevention : (a) Avoid sex with unknown partners/multiple partners. (b) Always use condoms during coitus. (c) In case of doubt, go to a qualified doctor for early detection and get complete treatment. Infertility • It is the inability of male or female to produce children. • The reasons for this may be physical, congenital, diseases, drugs, immunological or even psychological.

279

Concept: Sexually Transmitted Diseases (STDs) Mnemonics: Haryana Government School Head Girl Interpretations: Hepatitis B, Genital herpes, Syphilis HIV, Gonorrhoea.













Mnemonics

qqq

UNIT-VII : GENETICS AND EVOLUTION

4

PRINCIPLES OF INHERITANCE AND VARIATION

Topic-1

Mendel's laws and Chromosomal Theory Concepts Covered

 Heredity, variation, Mendel's laws of Inheritance, Non-Mendelian inheritance, Chromosomal theory, Linkage and Recombination.

Revision Notes

Colour of the flower

Violet/ Red (R)

White (r)

3.

Position of the flower

Axial (A)

Terminal (a)

4.

Shape of pod

Full/ Inflated (I)

Constricted (i)

5.

Colour of pod

Green (G)

Yellow (g)

6.

Shape of seed

Round (R)

Wrinkled (r)

7.

Colour of seed/cotyledons

Yellow (Y)

Green (y)



2.



Dwarf (t)



Tall (T)





Height of the stem



1.

Inheritance of One Gene Monohybrid Cross : • A cross involving two plants differing in one pair of contrasting characters. • e.g., Mendel crossed tall and dwarf pea plants to study the inheritance of one gene. Steps in Making a Cross of Pea : • Selection of two pea plants with contrasting characters. • Removal of anthers (emasculation) of one plant to avoid self- pollination. This is a female parent now. • Collection of pollen grains from the other plant (male parent) and transfer to female parent for pollination. • Collection of seeds and production of offspring. • Mendel made similar observations for other pairs of traits and proposed that factors were inherited from parent to offspring. Later, these factors were called genes.



Recessive



Dominant



Characters

• The F1 generation (Tt) when self-pollinated, produces gametes T and t in equal proportion. • Mendel self-pollinated the F2 generation plants. • He found that dwarf F2 plants continued to generate dwarf plants in F3 & F4 generation. • He concluded that the genotype of the dwarf was homozygous- tt. Monohybrid Phenotypic Ratio : 3 Tall : 1 Dwarf = 3 : 1 Monohybrid Genotypic Ratio : 1 Homozygous tall (TT) : 2 Heterozygous tall (Tt) : 1 Homozygous dwarf (tt) Back cross and Test cross • Back cross : Crossing of F1 hybrid with either of its parent. • Test cross : Crossing of an F1 hybrid with its recessive parent (Test cross ratio=1:1). It is used to find out the unknown genotype. Mendel conducted a test cross to determine the F2 genotype. Mendel’s Principles or Laws of Inheritance : 1. Principle of Dominance • Characters are controlled by discrete units called factors. • Factors occur in pairs. • In a dissimilar pair of factors or contrasting alleles i.e., in heterozygous condition, only one member of the pair expresses its effect in the hybrid and is called dominant while the manifestation of the other is masked and is called recessive. 2. Law of Segregation This law states that allelic pairs separate or segregate during gamete Scan to know formation and randomly unite more about at fertilization, thus homozygous this topic parent produces similar gametes. Heterozygous parent produces two kinds of gametes, each having one allele in equal proportion. The Concept of Dominance Chromosomal • In heterozygotes, there are Theory of dominant and recessive Inheritance alleles. • The normal (unmodified or functioning) allele of a gene produces a normal enzyme that is needed for the transformation of a substrate. • The modified allele is responsible for the production of (i) The normal/less efficient enzyme or (ii) A non-functional enzyme or (iii) No enzyme at all

S. No.









Heredity (L. hereditas - heirship or inheritance) : It is the sum of all biological processes by which particular characteristics are passed on from parents to their offspring, either through asexual or sexual reproduction. Variation: Tendency of differences in various traits of individuals of a progeny from one another and their parents. Mendel's Laws of Inheritance : Hybridization Experiments on Garden Pea (Pisum sativum) • Mendel selected 7 pairs of contrasting traits of true breeding pea varieties.



BIOLOGY

281

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



























 







 





























(b) Co-dominance • It is the inheritance in which both alleles of a gene are expressed equally and independently in a hybrid i.e., both the alleles are dominant e.g., ABO blood grouping in humans. • ABO blood groups are controlled by the gene. • The gene (I) has three alleles IA, IB and i. However, a person can have any two of these three alleles. IA and IB both are dominant alleles while i is a recessive allele. • The alleles IA and IB produce antigen A and antigen B respectively on the RBC surface while allele i doesn’t produce any antigen. • When IA and IB are present together they both express their types of surface antigen A and B. This is due to codominance. (c) Multiple Allelism • Here, more than two alleles govern the same character. • Since in an individual, only two alleles are present, multiple alleles can be found only when population studies are made e.g., ABO blood grouping (3 alleles : IA, IB & i). The skin colour and height of humans are also examples of multiple alleles. (d) Pleiotropy • Pleiotropy is the phenomenon in which one gene controls many traits. For example, the gene in pea plants that controls the round and wrinkled texture of seeds also influences the phenotypic expression of starch grain size.



Mendel, besides pea plant, also worked on Hawkweed (Hieracium) and lablab. But he failed to obtain same results as he found availability and in garden pea due to parthenogenesis and non- availability of pureline seeds.

So, if the starch grain size is considered as the phenotype, then from this angle, the alleles show incomplete dominance. • Therefore, dominance is not an autonomous feature of a gene or the product that it has information for. It depends as much on the gene product and the production of a particular phenotype. Inheritance of Two Genes Dihybrid Cross • A cross between two parents differing in two pairs of contrasting characters. • Mendel made some dihybrid crosses e.g., Cross between the pea plants with round shaped and yellow coloured seeds (RRYY) and wrinkled shaped and green coloured seeds (rryy). • On observing the F2 generation, Mendel found that the yellow and green colour segregated in a 3:1 ratio. • Round and wrinkled seed shape also segregated in a 3:1 ratio. • Thus, the segregation of one pair of contrasting characters (Round and wrinkled shape) is independent of the segregation of another pair of contrasting character (yellow and green) colour and also that some new combinations of character appear in F2 generation as the alleles get randomly rearranged in the offsprings at the time of fertilization. • Dihybrid genotypic ratio: 1 : 2 : 2 : 4 : 1 : 2 : 1 : 2 : 1 RRYY =1; RRYy =2; RrYY = 2; RrYy = 4; RRyy = 1; Rryy = 2; rrYY = 1; rrYy = 2; rryy = 1 • Dihybrid Phenotypic ratio : Round yellow 9 : Round green 3 : Wrinkled yellow 3 : Wrinkled green : 1, i.e., 9 : 3 : 3 : 1 The ratio 9 : 3 : 3 : 1 can be derived as a combination series of 3 yellow : 1 green, with 3 round : 1 wrinkled. i.e., (3 : 1) (3 : 1) = 9 : 3 : 3 : 1 3. Mendel's Law of Independent Assortment : • It states that when more than one pair of characters are involved in a cross, the segregation of one pair of contrasting characters is independent of the segregation of other pair of contrasting characters and also that new recombinations of characters along with the parental type also appear in the F2 generation. Non-recognition of Mendel's work • Mendel’s work remained unrecognizable till 1900 because : (a) Communication was not easy. (b) Non-recognition of Mendel as a scientist. (c) His mathematical approach was new and unacceptable. (d) He used statistical calculations which were beyond the comprehension of the biologists of his time. (e) Chromosomes, mitosis and meiosis were not known in Mendel's time. (f) The concept of genes (factors) as stable and discrete unit was not accepted. Mendel could not explain the continuous variations seen in nature. (g) Mendel could not provide any physical proof for the existence of factors. • In 1900, de Vries of Holland, Correns of Germany & Von Tschermak of Austria independently rediscovered Mendel’s results and proclaimed their conclusions as Mendel's Laws of inheritance.

Key Fact

•



• In the first case : The modified allele will produce the same phenotype like the unmodified allele. It becomes dominant. • In 2nd and 3rd cases : The phenotype is dependent only on the functioning of the unmodified allele. Here, the modified allele becomes recessive. Non-Mendelian Inheritance (a) Incomplete Dominance • It is an inheritance in which heterozygous offspring shows an Scan to know intermediate character more about between two parental this topic characteristics. e.g., Flower colour in Snapdragon (dog flower or Antirrhinum sp.) and Mirabilis jalapa (4’O clock Incomplete plant). dominance • Here, phenotypic and genotypic ratios are the same. • Phenotypic ratio = 1 Red : 2 Pink : 1 White • Genotypic ratio = 1 (RR) : 2 (Rr) : 1(rr) • This means that R was not completely dominant over r.



282



























  





•













•







•





   















•

Morgan et. al crossed yellow body and white eyed females with wild type brown body and red-eyed males and inter-crossed F1 offsprings. He found that the two genes did not segregate independently, resulted in deviation from normal dihybrid ratio 9 : 3 : 3 : 1 in F2 generation because the appearance of parental combinations were higher than the non-parental and new recombinations. Morgan further carried out several dihybrid test crosses in Drosophila to study sex-linked genes. Cross A : Double recessive, yellow-bodied, white-eyed females (yw/yw) Scan to know X hybrid brown-bodied, redmore about this topic eyed males (Y'W'/YW) (wild type). Cross B : Double recessive, white-eyed, miniature winged (wm/wm) X hybrid red eyed, large winged (W'm/Wm) (wild Morgan's Experiment with type). Drosophila Morgan in the above crosses found that : (a) The two genes did not segregate independently of each other and the F2 ratio deviated from the 9 : 3 : 3 : 1 ratio. (b) Genes were located on the X chromosome. (c) When two genes were situated on the same chromosome, the proportion of parental gene combinations was much higher than the non-parental type. This is due to linkage. (d) Genes for white and yellow were very tightly linked and showed only 1.3% new recombination while white and miniature wings showed 37.2% recombination (loosely linked). (e) Tightly linked genes show low recombination. (f) Loosely linked genes show high recombination. The strength of linkage is inversely proportional to the distance between two linked genes. Thus, the linkage between y & w alleles is stronger than the linkage between w & m alleles. Linkage groups : All the genes present together on a single chromosome make up a linkage group. The total number of linkage groups in an organism is equal to its haploid number of chromosomes or number of homologous pairs in diploid organisms. Alfred Sturtevant used the recombination frequency between gene pairs as a measure of the distance between genes and ‘mapped’ their position on the chromosome. Recombination frequency or the cross over value (COV) can be calculated by the following formula. 



•



COV= •





283





•



Chromosomal Theory (1902) • The Chromosomal theory was proposed independently by Walter Sutton and Theodore Boveri in 1902. • Walter Sutton & Theodore Boveri proposed that the pairing and separation of a pair of chromosomes during meiosis lead to the segregation of pair of factors. • Sutton united chromosomal segregation with Mendelian principles and called it the Chromosomal Theory of Inheritance. • It states that : (a) Chromosomes are vehicles of heredity i.e., they are transmitted from parents to offspring. (b) Two identical chromosomes form a homologous pair. Genes are present in a linear fashion on chromosomes. (c) They segregate at the time of gamete formation. (d) Independent pairs segregate independently of each other. (e) Chromosomes are mutable. (f) Sex chromosomes determine the sex of an individual. Parallelism between Genes (Mendelian factors) & Chromosomes : • Mendelian factors as well as chromosomes are transferred from generation to generation. • The chromosomes occurs in homologous pairs. The genes also occurs in pairs (allelic pairs). • Both chromosomes and genes segregate at the time of gamete formation in such a way that gametes receive only one chromosome & similarly one allele of each pair. • Different pairs of chromosomes segregate independently of each other. Similarly, one pair of alleles segregates independently of another pair. • Fusion of two (male & female) gametes brings about the diploid chromosome number as well as the allelic Scan to know more about pairs in the offsprings. this topic • Thomas Hunt Morgan proved the Chromosomal Theory of Inheritance using fruit flies (Drosophila melanogaster). He took fruit flies as a suitable material because : Mendel's Laws (a) It breeds very quickly. of Inheritance (b) Short generation time (life cycle : 12-14 days). (c) Breeding can be done throughout the year. (d) Hundreds of progenies are produced per mating. (e) They can grow on a simple synthetic medium. (f) Male and female flies are easily distinguishable. Linkage and Recombination • Recombination : It is a process by which pieces of DNA are broken and recombined to produce a new combination of alleles. • Linkage : Physical association of two or more genes on a chromosome, which show the tendency to inherit together. They do not show independent assortment.



BIOLOGY





























































Number of recombinants × 100 Total number of offsprings

Genetic maps are used as a starting point in the sequencing of genomes as was done in Human Genome Project.

Mnemonics Concept: Non-Mendelian Inheritance Mnemonics: I Care Mendel's Principles.

Interpretations: Incomplete dominance, Codominance, Multiple alleles, Pleiotropy

284

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Topic-2

Sex Determination and Chromosomal Disorder Concepts Covered



Sex determination, Mendelian disorders, chromosomal disorders.





























There is an equal probability of fertilization of the ovum with the sperm carrying either the X or Y chromosome. • The sperm determines whether the offspring will be male or female. (ii) Environmental Sex-determination : Determination of sex depends upon the environmental condition. Environmental factors like temperature, etc., determine whether the zygote will develop into male or female. e.g., In turtles and crocodile. (iii) Genetic balance mechanism of sex determination : The sex of the individual is decided by the ratio of X-chromosome and autosome, as it is found in Drosophila. (iv) Cytoplasmic Sex-determination : Cytoplasmic or fertility factor called as an F+ factor located in plasmid determines the sex as it is found in some bacteria. Scan to know Genetic Disorders more about • There are two types of genetic this topic disorders namely, Mendelian disorders and Chromosomal disorders. (1) Mendelian Disorders • It is caused by alteration or Mendelian mutation in a single gene. Disorder • The pattern of inheritance of Mendelian disorders can be traced in a family by the pedigree analysis. e.g., Haemophilia, Cystic fibrosis, Sickle-cell anaemia, Colour blindness, Phenylketonuria, Thalassaemia, etc. • Mendelian disorders may be dominant or recessive.

Mnemonics









•







Sex determination • The method by which the distinction between male and female is established in a species is called sex determination. • Sex of an individual is finalized at the time of zygote formation. Autosomes and Sex chromosomes (allosomes) • Autosomes are chromosomes other than sex chromosomes. They contain genes that determine somatic characteristics. • Number of autosomes is the same in males and females. • Sex chromosomes (X & Y) are the chromosomes that are involved in sex determination. • Henking (1891) studied spermatogenesis in some insects and observed that 50 % of sperm received a nuclear structure after spermatogenesis, whereas the other 50 % of sperms did not receive it. • Henking called this structure as the X body (later it was called as X-chromosome). Mechanism of Sex Determination (i) Chromosomal sex determination : It is based on heterogamety i.e., the occurrence of two types of gametes in one of the two sexes. It is of the following types : (a) XX-XO mechanism : Here, the male is heterogametic i.e., XO besides autosomes (gametes with X and gametes without X) and female is homogametic i.e., XX (all gametes are with X chromosomes). (b) XX-XY mechanism : Male is heterogametic (X & Y) and female is homogametic (X only). e.g., Human and Drosophila. (c) ZZ-ZW mechanism : Male is homogametic (ZZ) and female is heterogametic (Z & W). e.g., Birds. (d) ZO-ZZ mechanism : Females have only Z-chromosomes besides autosomes and males have a pair of Z-chromosomes e.g., in cockroaches. XX-XO & XX-XY mechanisms show male heterogamety. ZZ-ZW mechanism shows female heterogamety. Females have only Z chromosome besides autosomes and males have a pair of Z chromosome as seen in cockroaches. Sex Determination in Humans (XX-XY type) • Human has 23 pairs of chromosomes (22 pairs are autosomes and 1 pair is sex chromosome). • A pair of X-chromosome (XX) is present in the female, whereas the X and Y chromosome are present in male. • During spermatogenesis, males produce 2 types of gametes i.e., 50 % with X-chromosome and 50 % with Y-chromosome. • Females produce the only ovum with X-chromosome.

   











(a) Colour blindness • It is a recessive sex-linked trait in which the eye fails to distinguish red and green colours. • The normal gene and its recessive allele are carried by X-chromosome. • In female, colour blindness appear when both the sex chromosomes carry the recessive gene. (b) Haemophilia (Royal disease) • Sex-linked recessive disease. • In this, a protein involved in the blood clotting is affected. • A simple cut results in non-stop bleeding. • The heterozygous female (carrier) for haemophilia may transmit the disease to sons. 











Concept: Mendelian Disorders Mnemonics: Highlight The Concepts Clearly Interpretations: Haemophilia, Thalassaemia, Cystic fibrosis, Colour blindness.











































Revision Notes


































































Duplication : It is a change in chromosome structure in which a part of a chromosome breaks up and unites with another homologous chromosome. This process repeats the chromosome segments because the same block of genes is present more than once in a haploid component. 4. Translocation : It is a change in chromosome architecture that is due to breaking up of segment of chromosome and its union with another non-homologous chromosome. It may also be due to mutual exchange of chromosomal segments between nonhomologous chromosomes. Examples for Chromosomal Disorders (a) Down’s Syndrome (Mongolism) : • It is the presence of an additional copy of chromosome number 21 (trisomy of 21). • Genetic constitution : 45 A + XX or 45 A + XY (i.e., 47 chromosomes). • Features : (a) They are short-statured with small round head. (b) Broad flat face. (c) Furrowed big tongue and partially open mouth. (d) Many “loops” on fingertips. (e) Palm is broad with characteristic palm crease. (f) Retarded physical, psychomotor & mental development. (g) Congenital heart disease.



Key Fact



































(b) Klinefelter’s Syndrome : • It is the presence of an additional copy of X-chromosome in male. • Genetic constitution: 44 A + XXY (i.e., 47 chromosomes). • Features : (a) Overall masculine development however the feminine development is also expressed. e.g., development of breast (Gynaecomastia). (b) Sterile. (c) Mentally retarded. (c) Turner’s Syndrome : • This is due to the absence of one of the X chromosomes in female. • Genetic constitution: 44 A + XO (i.e., 45 chromosomes). • Features : (a) Sterile, Ovaries are rudimentary. (b) Lack of other secondary sexual characters. (c) Dwarf. (d) Mentally retarded.





























Punnett, Batteson and other workers found Mendel’s work as an universal application, including animals also.





285

3.



The possibility of a female becoming a haemophilic is very rare because mother has to be at least carrier and the father should be haemophilic (inviable in the later stage of life). • Queen Victoria was the carrier of this disease. So her family pedigree shows many haemophilic descendents. (2) Chromosomal Disorders Scan to know • They are caused due to the more about absence or excess or abnormal this topic arrangement of one or more chromosomes. • These are of two types namely, (a) Aneuploidy (b) Euploidy. Chromosomal (a) Aneuploidy Disorders • The gain or loss of chromosomes due to failure of segregation of chromatids during cell division. It includes, (a) Nullisomy (2n-2) : A complete homologous pair is lost from diploid set. (b) Monosomy (2n-1) : One chromosome is lost from the diploid set. (c) Trisomy (2n+1) : One chromosome is added to the diploid set, so that one chromosome occurs in triplicate. (d) Tetrasomy (2n+2) : Two chromosomes are added to the diploid set, so that a chromosome is found in quadrapulate. (b) Polyploidy (Euploidy) • It is an increase in the number of chromosomes sets beyond the diploid X condition (2n). • This is often seen in plants. • Based on the number of chromosome sets, the polyploid are of the following types : triploids (3n), tetraploids (4n), pentaploids (5n), hexaploids (6n), etc. (a) Autopolyploidy : It is an increase in number of the same genome. e.g., AAA (autotriploid), AAAA (autotetraploid), etc. (b) Allopolyploidy : It is the increase in the number of sets of chromosome due to the coming together of diploid genomes of two or more than two individuals of different species. e.g., AABB, AABBDD. Bread wheat is allohexaploid (AABBDD). Triticale is the man-made cereal formed by hybridization between durum, wheat and rye. It is allohexaploid. • Autoallopolyploidy : It is a kind of polyploidy where the genomes of two species come together in which one has double set of chromosomes. e.g., Helianthus tuberosus which is autoallohexaploid. • Chromosomal aberrations : These are the changes in morphology and structure of chromosome resulting in the change in number and sequence of genes on them without any change in ploidy. They are of the following types : 1. Deletion : It is the loss of a terminal segment of a chromosome or from within the chromosome (interstitial segment) followed by a reunion of its remaining parts. 2. Inversion : It is a change in a chromosome architecture due to breaking up, rotation through 180° of a segment and its reunion so that sequence of genes is reversed in the inverted region. 

•



BIOLOGY









Mnemonics Concept: Chromosomal Disorders Mnemonics: Dying to know Interpretations: Down's syndrome Turner's syndrome, Klinefelter's syndrome qqq

5

MOLECULAR BASIS OF INHERITANCE Nucleic Acid – DNA and RNA

Topic-1

Concepts Covered

 Nucleic acids, packaging of DNA helix, nucleosome, experiments to show DNA as a genetic material, RNA, process of protein synthesis.

Revision Notes



















Deoxythymidine



Uridine

Nitrogen base + sugar + phosphate group = Nucleotide (deoxyribonucleotide). In RNA, every nucleotide residue has an additional – OH group present at 2’-position in the ribose.  2 nucleotides are linked through 3’ → 5’ phosphodiester bond to form dinucleotide.  When series of nucleotides are linked together, it forms polynucleotide. Structure of DNA  Johann Friedrich Miescher (1869) : Identified DNA and named it as ‘Nuclein’.  James Watson & Francis Crick proposed the double helix model of DNA. It was based on the X-ray diffraction data produced by Maurice Wilkins & Rosalind Franklin. 



Deoxycytidine



Cytidine



Deoxyguanosine



Guanosine



Deoxyadenosine



Adenosine



Nucleosides in DNA



Nucleosides in RNA



























































DNA is made of two polynucleotide chains coiled in a right-handed fashion. Its backbone is formed of sugar and phosphates. The bases project inside.  The two chains have anti-parallel polarity i.e., one chain has the polarity 5’ → 3’ and the other has 3’ → 5’.  Nitrogen bases of opposite chains are held together by hydrogen bonds forming base pairs (bp).  There are two hydrogen bonds between A and T (A = T) and three H-bonds between C and G (C ≡ G).  Purine comes opposite to a pyrimidine. This generates a uniform distance between the two strands. Erwin Chargaff’s Rule  Purines and pyrimidines are always in equal amounts i.e., A + G = T + C.  In DNA, the proportion of A is equal to T and the proportion of G is equal to C i.e., A = T and G = C.  The base ratio A + T/G + C may vary from species to species but constant for a given species.  Length of DNA = number of base pairs × distance between two adjacent base pairs.  φ 174 (a bacteriophage) has 5386 nucleotides.  Bacteriophage lambda has 48502 base pairs (bp). 6  E. coli has 4.6 × 10 bp. 9  Haploid content of human DNA = 3.3 × 10 bp. 9  Number of base pairs in human = 6.6 × 10 9  Length of DNA in humans = 6.6 × 10 bp × 0.34 –9 × 10 m/bp = 2.2 m –3  Length of DNA in E. coli =1.36 mm (1.36 × 10 m). –3 \ The number of base pairs = 1.36 × 10 m/0.34 × 10–9 m/bp = 4 × 106 bp. Packaging of DNA Helix  In prokaryotes (e.g., E. coli), the DNA molecule is held with some positively charged non-histone basic proteins like negatively charged polyamines and form ‘nucleoid’.  In eukaryotes, there is a set of positively charged basic proteins called histones.  Histone proteins are rich in positively charged basic amino acid residues lysine and arginine.  There are five types of histone proteins-H1, H2A, H2B, H3 and H4.  Two molecules each of H2A, H2B, H3 and H4 organize to form a unit of eight molecules called as histone octamer.  Negatively charged DNA is wrapped around positively charged histone octamer to form a structure called a nucleosome. 



Genetic Material Nucleic Acids  DNA and RNA are the two types of nucleic acids.  DNA is the genetic material in all organisms except some viruses.  RNA is the genetic material in some viruses.  RNA mostly functions as messenger. Structure of Polynucleotide Chain  Polynucleotides are the polymers of nucleotides.  DNA and RNA are examples of polynucleotides.  A nucleotide has 3 components : 1. A nitrogenous base 2. A pentose sugar (ribose in RNA and deoxyribose in DNA) 3. A phosphate group  Nitrogen bases are of 2 types : Scan to know (a) Purines : It includes more about Adenine (A) and Guanine this topic (G). (b) Pyrimidines : It includes Cytosine (C), Thymine (T) and Uracil (U). Thymine (5-methyl Uracil) present only in DNA and Uracil Molecular Basis of Inheritance only in RNA ( In place of thymine).  A nitrogenous base is linked to the pentose sugar through an N-glycosidic linkage to form nucleoside.



BIOLOGY

287

288

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

















In Eukaryotes, DNA polymerases are of 5 types, these are DNA polymerase α, β, γ, δ and ε.

The Search for Genetic Material Griffith’s Experiment - Transforming Principle  Griffith (1928) used mice and a bacterial strain, Streptococcus pneumoniae. • Streptococcus pneumoniae has two strains : (a) Smooth (S) strain (Virulent) : Has polysaccharide mucous coat. Causes pneumonia. (b) Rough (R) strain (Non-virulent) : No mucous coat. Does not cause pneumonia. Experiment • S-strain → Inject into mice → Mice die • R-strain → Inject into mice → Mice live • S-strain (Hk) → Inject into mice → Mice live • S-strain (Hk) + R-strain (live) → Inject into mice → Mice die • He concluded that there exists some ‘transforming principle’, that is transferred from heat-killed S-strain to R-strain. It enabled R-strain to synthesize smooth polysaccharide coat and become virulent. This must be due to the transfer of genetic material. Biochemical Characterization of Transforming Principle • Oswald Avery, Colin MacLeod & Maclyn McCarty in 1944 worked to determine the biochemical nature of ‘transforming principle’ in Griffith’s experiment.





 





DNA is a better Genetic Material than RNA due to the following reasons : • DNA is chemically less reactive and structurally more stable. It can to undergo repair. • Due to the unstable nature of RNA, RNA viruses (e.g., Qβ bacteriophage, Tobacco Mosaic Virus, etc.) mutate and evolve faster. • For the storage of genetic information, DNA is better due to its stability. But for the transmission of genetic information, RNA is better. • RNA can directly code for protein synthesis, hence can easily express the characters. DNA is dependent on RNA for protein synthesis. 







































Nucleotide arrangement in DNA can be seen by X-ray Crystallography.



Key Facts

























• They purified biochemicals (proteins, DNA, RNA, etc.) from heat-killed S cells using suitable enzymes. • They discovered that : (a) Digestion of protein and RNA (using Proteases and RNases) did not affect transformation. So, the transforming substance was not a protein or RNA. (b) Digestion of DNA with DNase inhibited transformation. It means that DNA caused the transformation of R cells to S cells i.e., DNA was the transforming substance. The Genetic Material is DNA • The fact that DNA is the genetic material also came from the experiments of Alfred Hershey and Martha Chase (1952). • They worked with viruses that infect bacteria and are called bacteriophages. Hershey-Chase Experiment—Blender Experiment • Hershey and Chase made two preparations of bacteriophage - In one, proteins were labelled with 35S by putting in a medium containing radioactive sulphur (35S). In the second, DNA was labelled with 32P by putting in a medium containing radioactive Phosphorous (32P). • These preparations were used separately to infect E. coli. • After infection, the E. coli cells were gently agitated in a blender to separate the phage particles from the bacteria. • Then the culture was centrifuged. Heavier bacterial cells were formed as a pellet at the bottom. Lighter viral components outside the bacterial cells remained in the supernatant. • They found that, (a) Supernatant contains viral protein labelled with 35S, i.e., the viral protein had not entered the bacterial cells. (b) The bacterial pellet contains radioactive 32P. This shows that viral DNA labelled with 32P had entered the bacterial cells. This proves that DNA is the genetic material. Properties of Genetic Material • A molecule that can act as a genetic material must fulfill the following criteria : (a) Be able to generate its replica by the process of replication. (b) Chemically and structurally be stable. (c) Allow slow changes, the mutations that are required for evolution. (d) It should be able to store genetic information which can be inherited. (e) Be able to express itself as ‘Mendelian Characters’.







Nucleosomes are connected with the help of linker DNA on which H1 Histone is present. Nucleosome  A typical nucleosome contains 200 bp of DNA helix.  Therefore, the total number of nucleosomes in human = 6.6 × 109 bp/200 bp = 3.3 × 107.  Nucleosomes constitute the repeated unit to form chromatin.  Chromatin is the thread-like stained bodies.  Nucleosomes in chromatin appears as “beadson-string” when it is viewed under the electron microscope.  Chromatin is packaged to form a solenoid or a zig-zag structure.  Further supercoiling constitute a looped structure called chromatin fibre. These chromatin fibres further coil and condense at the metaphase stage of cell division to form chromosomes.  Chromatin is packaged → solenoid → chromatin fibres → coiled and condensed at metaphase stage → chromosomes.  Higher level packaging of chromatin requires non-histone chromosomal (NHC) proteins.  Two types of chromatin are : (a) Euchromatin : Loosely packed and transcriptionally active chromatin and is light-stained. (b) Heterochromatin : Densely packed and inactive region of chromatin and stains dark. 



BIOLOGY   

    

















Presence of 2’-OH



Absence of 2’-OH

• The two DNA strands are complementary. On heating, they separate. When appropriate conditions are provided they come together. (In Griffith’s experiment, when the bacteria were heat-killed, some properties of DNA did not destroy). RNA World • RNA is a single-stranded structure but it is often folded back upon itself forming helices. Nitrogenous bases are like those of DNA except that there is uracil in place of thymine. • RNA was the first regulatory chemical and genetic material in early life forms. • It acts as genetic material and biocatalyst. • Essential life processes (metabolism, translation, splicing, etc) evolved around RNA. • DNA has evolved from RNA with chemical modifications that made it more stable. Central Dogma of Molecular Biology • It was proposed by Francis Crick (1958). It states that the genetic information flows unidirectionally from DNA → RNA → Protein. Reverse Transcription : H. Temin and Baltimore in 1978 gave the concept of reverse flow of genetic information i.e., the formation of DNA from RNA. This is called Reverse Central Dogma or Teminism or reverse transcription. This takes place in some of the viruses in the presence of an enzyme called reverse transcriptase. Types of RNA • RNA is of 3 types –mRNA, tRNA and rRNA. • mRNA constitutes 2–5% of the total cellular RNA, tRNA is about 15% and rRNA is about 70–80%. • mRNA (messenger RNA) : Provides a template for translation (protein synthesis) and is transcribed from DNA. • rRNA (ribosomal RNA) : Structural and catalytic role during translation. e.g., 23S rRNA in bacteria acts as ribozyme. It is the component of ribosome and is the most stable type of RNA. • tRNA (transfer RNA or sRNA or soluble RNA or adaptor RNA) : Brings amino acids for protein synthesis and reads the genetic code. • tRNA is the smallest amongst all the RNA and is made up of 70–80 nucleotides only. DNA Replication • Replication is the copying of DNA from parental DNA. • Watson & Crick proposed a semi-conservative mode of replication. • It suggests that the parental DNA strands act as a template for the synthesis of new complementary strands. After the completion of replication, each DNA molecule would have one parental and one new strand. Experimental Proof • Mathew Meselson & Franklin Stahl (1958) experimentally proved semi-conservative mode.



Presence of Uracil



Presence of thymine



Single-stranded



Double-stranded

• Meselson & Stahl’s Experiment : They cultured E. coli in a medium containing N15H4Cl (N15 : heavy isotope of N). N15 was incorporated into both strands of bacterial DNA and the DNA became heavier. • Another preparation containing N salts labelled with N14 was also made. N14 was also incorporated in both strands of DNA and became lighter. • These two types of DNA can be separated by centrifugation in a CsCl density gradient. • They took E. coli cells from the N15 medium and transferred them to the N14 medium. • After one generation (i.e., after Scan to know more about 20 minutes), they isolated and this topic centrifuged the DNA. Its density was intermediate (hybrid) between 15N DNA and 14N DNA. This showed that in the newly formed DNA, one strand Meselson is old (N15 type) and one strand & Stahl's is new (N14 type). This confirms Experiment the semi-conservative mode of replication. • After II generations (i.e., after 40 minutes), there were equal amounts of hybrid DNA and light DNA. • Taylor et. al (1958) performed similar experiments on Vicia faba (faba beans) using radioactive thymidine to detect distribution of newly synthesized DNA in the chromosomes. It proved that the DNA in chromosomes also replicate semiconservatively. The Machinery and Enzymes for Replication • DNA replication starts at a point called origin (ori). • A unit of replication with one origin is called a replicon. • During replication, the two strands unwind and separate by breaking H-bonds in the presence of an enzyme, Helicase. • Unwinding of the DNA molecule at a point forms a ‘Y’-shaped structure called replication fork. • The separated strands act as templates for the synthesis of new strands. • DNA replicates in the 5’→3’ direction. • Deoxyribonucleoside triphosphates (dATP, dGTP, dCTP & dTTP) act as substrate and also provide energy for polymerization. • Firstly, a small RNA primer is synthesized in presence of an enzyme, primase. • In the presence of an enzyme, DNA dependent DNA polymerase, many nucleotides join with one another to primer strand and form a polynucleotide chain (new strand). • The DNA polymerase forms one new strand (leading strand) on a continuous stretch in the 3’→5’ direction (Continuous synthesis). • The other new strand is formed in small stretches (Okazaki fragments) in the 5’→3’ direction (Discontinuous synthesis). • The Okazaki fragments are then joined together to form a new strand by an enzyme, DNA ligase. This new strand is called lagging strand. • If a wrong base is introduced in the new strand, DNA polymerase can do proofreading. • E. coli completes replication within 38 minutes i.e., 2000 bp per second. • In eukaryotes, the replication of DNA takes place at the S-phase of the cell cycle. Failure in cell division after DNA replication results in polyploidy. 

Reasons for mutability (high reactivity) of RNA



Reasons for stability (less reactivity) of DNA

289

290

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



















 





In eukaryotes, there are 2 additional complexities : (a) There are three RNA polymerases : • RNA polymerase I : Transcribes rRNAs (28S, 18S & 5.8S). • RNA polymerase II : Transcribes the heterogeneous nuclear RNA (hnRNA). It is the precursor of mRNA. • RNA polymerase III : Transcribes tRNA, 5S rRNA and snRNAs (small nuclear RNAs). (b) The primary transcripts (hnRNA) : They contain both the exons and introns and are nonfunctional. Hence introns have to be removed. For this, it undergoes the following processes : • Splicing : From hnRNA, introns are removed (by the spliceosome) and exons are spliced (joined) together. • Capping : Here, a nucleotide methyl guanosine triphosphate (cap) is added to the 5’ end of hnRNA. • Tailing (Polyadenylation) : Here, adenylate residues (200-300) are added at 3’-end. It is the fully processed hnRNA, now called mRNA.













introns. Introns or intervening sequences do not appear in mature or processed RNA. Steps of transcription in prokaryotes • Initiation : Here, the enzyme RNA polymerase binds at the promoter site of DNA. This causes the local unwinding of the DNA double helix. An initiation factor (s factor) present in RNA polymerase initiates the RNA synthesis. • Elongation : The RNA chain is synthesized in the 5’-3’ direction. In this process, activated ribonucleoside triphosphates (ATP, GTP, UTP & CTP) are added. This is complementary to the base sequence in the DNA template. • Termination : A termination factor (r factor) binds to the RNA polymerase and terminates the transcription. • In bacteria (Prokaryotes), transcription and translation can be coupled (Translation can begin before mRNA is fully transcribed) because mRNA requires no processing to become active. • Transcription and translation take place in the same compartment (no separation of cytosol and nucleus). 





Transcription • It is the process of copying genetic information from one strand of Scan to know more about the DNA into RNA. this topic • Here, adenine pairs with uracil instead of thymine. • Both strands are not copied during transcription, because (a) The code for protein is different in both strands. Transcription This complicates the translation. (b) If two RNA molecules are produced simultaneously they would be complementary to each other, hence form a double-stranded RNA. This prevents translation. Transcription Unit • It is the segment of DNA between the sites of initiation and termination of transcription. • It consists of 3 regions : (a) A promoter (Transcription start site) : Binding site for RNA polymerase. (b) Structural gene : The region between promoter and terminator where transcription takes place. (c) A terminator : The site where transcription stops. • The DNA- dependent RNA polymerase catalyses the polymerization only in 5’→3’direction. • 3’→5’ acts as the template strand. 5’→3’ acts as the coding strand. • 3 ’ – AT G CAT G CAT G CAT G CAT G CAT G C – 5 ’ template strand. 5’–TACGTACGTACGTACGTACGTACG–3’ coding strand. Transcription Unit and the Gene • Gene : Functional unit of inheritance. It is the DNA sequence coding for RNA molecule. • Cistron : A segment of DNA coding for a polypeptide. • Structural gene in a transcription unit is of two types : (a) Monocistronic structural genes (split genes) : It is seen in eukaryotes. Scan to know Here, the coding sequences more about this topic (expressed sequences or exons) are interrupted by introns (intervening sequences). (b) Polycistronic structural genes : It is seen in Transcription Unit prokaryotes. Here, there are no split genes. • Exons and Introns : In eukaryotes, the monocistronic structural genes have interrupted coding sequences i.e., the genes in eukaryotes are split. The coding sequences or expressed sequences are called as exons. Exons are said to be those sequences that appear in mature or processed RNA. The exons are interrupted by IMPORTANT DIAGRAMS :

Mnemonics 1. Concept: Erwin Chargaff ’s Rule Mnemonics: AayaTha; ChalaGya Interpretations: A- Adenine = T- Thymine G-Guanine = C- Cytosine 2. Concept: Central Dogma of Molecular Biology Mnemonics: Doctors Recovered Patients Interpretations: DNA  RNA → Protein

Fig 5.1 : A polynucleotide Chain of RNA



BIOLOGY

291

Fig 5.3 : Central Dogma

Fig 5.2 : Double Stranded polynucleotide chain

Fig 5.5 : The Hershey and Chase Experiment

Fig 5.4 : Nucleosome

Fig 5.6 : Watson Crick model of Semi-conservative DNA replication

Separation of DNA by Centrifugation

Fig. 5.7 : Meselson and Stahl’s Experiment

292

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Fig 5.8 : Replicating Fork

Fig 5.9 : Schematic structure of a transcription unit

Fig 5.10 : Process of Transcription in Bacteria

Fig 5.11 : Process of Transcription in Eukaryotes



BIOLOGY

293

Genetic Code, Translation, Lac Operon, HGP and Topic-2 DNA Fingerprinting Concepts Covered

 Genetic code, Translation, Gene expression, Lac Operon, HGP, Rice Genome Project, steps and application of DNA Fingerprinting









 



































 





















Translation – Protein Synthesis It takes place in ribosomes. It includes 4 steps : 1. Charging of tRNA (aminoacylation of tRNA) • Formation of a peptide bond requires energy obtained from ATP. • For this, amino acids are activated (amino acid + ATP) and linked to their cognate tRNA in the presence of aminoacyl tRNA synthetase. So, the tRNA becomes charged. 2. Initiation • It begins at the 5’-end of mRNA in the presence of an initiation factor. • The mRNA binds to the small subunit of the ribosome. Now the large subunit binds to



































of amino acid residue glutamate to valine. It results into a diseased condition called sickle cell anaemia. • Insertion or deletion of one or two bases changes the reading frame from the point of insertion or deletion. • When there is shifting of the reading frame due to insertion or deletion of the nucleotide, such mutation is known as frameshift mutation. • This forms the genetic basis of proof that the codon is a triplet and is read in a continuous manner. The Adaptor Molecule – tRNA • The tRNA is a molecule that has about 60% of its part double-stranded and the rest remains single stranded which has unpaired bases. • The tRNA has (a) An anticodon (NODOC) loop that has bases complementary to the CODON with which it gets attached in mRNA. (b) An amino acid acceptor end to which amino acid binds. This end or site lies at the 3' end & CCA–OH group. The 5' end bears G. (c) T Y C loop : This is the site for attaching with the ribosome. This has some unusual bases like Y (pseudouridine) and ribothymidine. (d) DHU-Loop : It is the binding site for the enzyme aminoacyl synthetase. It is the largest loop and has Dihydrouridine. (e) Extra arm : It is a variable side arm lying between T Y C and anticodon loop. • tRNA is called an adaptor molecule because it picks up amino acids from the cytoplasm and transfers them to ribosomes during protein synthesis. • For initiation, there is another tRNA called initiator tRNA. • There are no tRNAs for stop codons. • 2-D structure of tRNA looks like a clover-leaf according to Robert Holly (1965). The 3-D structure looks like inverted ‘L’ according to Klug (1974). 

Genetic Code : It is the sequence of nucleotides in mRNA that contains information for protein synthesis (translation). 20 amino acids are involved in translation. • George Gamow : Suggested that for coding 20 amino acids, the code should be made up of 3 consecutive nucleotides. • Har Gobind Khorana : Developed the chemical method in synthesizing RNA molecules with defined combinations of bases (homopolymers and copolymers). • Marshall Nirenberg : Developed a cell-free system for protein synthesis. • Severo Ochoa (polynucleotide phosphorylase) enzyme is used to polymerize RNA with defined sequences in a template-independent manner. Salient Features of Genetic Code • The genetic code is a triplet code (three-letter code) where three adjacent nitrogen bases code for a single amino acid. • 61 codons code for amino acids. 3 codons (UAA, UAG and UGA) do not code for any amino acids. They function as stop codons (Termination codons or non-sense codons). • Genetic code is universal e.g., From bacteria to human UUU codes for Scan to know more about Phenylalanine. Some exceptions this topic are found in mitochondrial codons and in some protozoans. • No punctuations between adjacent codons (comma less code). The codon is read in Genetic Code mRNA in a continuous fashion. • Genetic code is non-overlapping. • A single amino acid is represented by many codons (except AUG for methionine and UGG for tryptophan). Such codons are called degenerate codons. • Genetic code is unambiguous and specific. i.e., one codon specifies for only one amino acid. • The codon is read in the 5' → 3' direction. • AUG has dual functions. It codes for Methionine (met) and also acts as an initiator codon. In eukaryotes, methionine is the first amino acid and formyl methionine is the first amino acid in prokaryotes. Mutations and Genetic Code • The relationships between genes and DNA are best understood by mutation studies. • Effects of large deletions and rearrangements in a segment of DNA may result in loss or gain of a gene and so a function. • A classical example of point mutation is a change of single base pair in the gene for beta globin chain of haemoglobin that results in the change





Revision Notes

294































b







• The genes present in the operon function together in the same or related metabolic pathway. There is an operator region for each operon. • If there is no lactose (inducer), lac operon remains switched off. In the absence of inducer, repressor gene is active. The regulator gene synthesizes mRNA to produce the repressor protein, this protein binds to the operator genes and blocks RNA polymerase movement. So, the structural genes are not expressed. • In the absence of glucose, If lactose is provided in the growth medium, the lactose is transported into the E. coli cells by the action of permease. Lactose (inducer) binds with repressor protein. • So, repressor protein cannot bind to operator gene. The operator gene becomes free and induces the RNA polymerase to bind with promoter gene then transcription starts. Regulation of lac operon by repressor is called negative regulation. Human Genome Project (HGP) • The entire DNA in the haploid set of chromosome

Concept : Translation process (It include 4 steps) Mnemonics : Come In Evening Time Interpretations : Charging of tRNA, Initiation, Elongation, Termination















Mnemonics

Regulation of Gene Expression Gene expression results in the formation of a polypeptide. In eukaryotes, the regulation includes the following levels : • Transcriptional level (formation of primary transcript). • Processing level (regulation of splicing). • Transport of mRNA from the nucleus to the cytoplasm. • Translational level.























Importance of regulation of gene expression: • Gene regulation is the process to switch off or switch on the genes as per the requirement of the organism. • Gene regulation is required so that there is no waste of energy in expressing the genes not required at the time. • However, there are housekeeping genes that are always expressed in the cell. The metabolic, physiological and environmental conditions regulate the expression of genes. e.g., • In E. coli, the enzyme beta-galactosidase hydrolyses lactose into galactose and glucose. In the absence of lactose, the synthesis of betagalactosidase stops. • The development and differentiation of an embryo into an adult the result of the regulation of several set of genes. Operon Concept : This is a regulatory system that is observed in bacteria. • “Each metabolic reaction is controlled by a set of genes”. • All the genes regulating a metabolic reaction constitute an Operon e.g., lac operon, trp operon, ara operon, his operon, val operon etc. • When a substrate is added to growth medium of bacteria, a set of genes is switched on to metabolize it. This is called induction. • When a metabolite (product) is added, the genes to produce it are turned off. This is called repression. The Lac Operon Scan to know • Lac operon in E. coli : The operon more about this topic controlling lactose metabolism. It consists of a regulator gene, 3-structural genes, an operator gene, promoter gene, a repressor and an inducer. (a) A regulatory or inhibitor Lac Operon Function gene : Codes for the repressor. (b) 3 structural genes : (i) z gene : Codes for -galactosidase (hydrolyze lactose to galactose and glucose). (ii) y gene : Codes for permease (increase permeability of the cell to lactose). (iii) a gene : Codes for a transacetylase. 



the small subunit to complete the initiation complex. • Large subunit has 2 binding sites for tRNAaminoacyl tRNA binding site (A site) and peptidyl site (P site). • Initiation codon for methionine is AUG. So, methionyl tRNA complex would have UAC at the anticodon site. 3. Elongation • At the P-site the first codon of mRNA binds with anticodon of methionyl tRNA complex. • Another aminoacyl tRNA complex with an appropriate amino acid enters the ribosome and attaches to A site. • Its anticodon binds to the second codon on the mRNA and a peptide bond is formed between first and second amino acids in presence of an enzyme, peptidyl transferase. • The uncharged tRNA moves from the P site to the E site and the peptidyl-tRNA moves to the P site. This is called a translocation. • Then 3rd codon comes into A site and a suitable tRNA with 3rd amino acid binds at the A site. This process is repeated. • A group of ribosomes associated with a single mRNA for translation is called a polyribosome (polysomes). • A ribozyme is a ribonucleic acid (RNA) enzyme that catalyses a chemical reaction. The ribozyme catalyses specific reactions in a similar way to that of protein synthesis. Also called catalytic RNA, ribozyme are found in ribosome where they join amino acids together to form protein chains. 4. Termination • When aminoacyl tRNA reaches the termination codon like UAA, UAG & UGA, the termination of translation occurs. The polypeptide and tRNA are released from the ribosomes. • The ribosome dissociates into large and small subunits at the end of protein synthesis. An mRNA has additional sequences that are not translated (untranslated regions or UTR). UTRs are present at both 5’-end (before start codon) and 3’-end (after stop codon). They are required for an efficient translation process.



Oswaal CBSE LMP (Last Minute Preparation), Class-XII



BIOLOGY







polymorphism or ‘snips’) occur in humans. Rice Genome Project Rice is one of the most largely consumed foods in India. Also, the population is increasing with a rapid pace, so, to meet this requirement, Rice genome project has been launched to increase the production of rice. Rice has the smallest genome of 430Mb nucleotides located on chromosome 12. Rice Genome : It is a joint project of National Institute of Aerobiological Sciences (NIAS), forestry and fisheries (STAFF), Ministry of Agriculture, Forestry and Fisheries (NAFF), Society for Techno-innovation of Agriculture genome research program. Arabidopsis is an experiment plant of rice genome because it has fast life cycle and can be easily grown. It has smaller genome and high diversity and helps in enhancing the molecular products.

Key Word ESLI : Ethical, legal and social implications of genetic Need for sequencing rice genome: • To know the functioning of genes by accurate gene sequencing. • It is important for agronomic traits which requires mapping of genomic sequences. • Improvement of other cereals will become easier. DNA Fingerprinting (DNA profilScan to know ing) more about • It is the technique to compare this topic the DNA fragments of two individuals. • Developed by Alec Jeffreys (1985). He is considered as the DNA father of DNA fingerprinting. Fingerprinting Lalji Singh is the Father of Indian DNA fingerprinting. Basis of DNA Fingerprinting • DNA carries some non-coding sequences called repetitive sequence [Variable Number of Tandem Repeats (VNTR)]. • Number of repeats is specific. It varies from person to person and is specific to a person. • The size of VNTR varies from 0.1 to 20 kb. • Repetitive DNA is separated from bulk genomic DNA as different peaks during density gradient centrifugation. • The bulk DNA forms a major peak and the other small peaks are called satellite DNA. • Satellite DNA is classified into many categories (micro-satellites, mini-satellites, etc.) based on the base composition (A-T rich or G-C rich), length of segment and number of repetitive units. • An inheritable mutation observed in a population at high frequency is called DNA polymorphism (variation at genetic level). • Polymorphism is higher in non-coding DNA sequence. This is because mutations in these sequences may not have any immediate effect on an individual’s reproductive ability. • These mutations accumulate generation after generation and cause polymorphism. For evolution & speciation, polymorphisms play an important role.  







 



















and genomic research.































































of an organism is called a Genome. • In human genome, DNA is packed in 23 chromosomes. • Human Genome Project (1990-2003) is the first effort in identifying the sequence of nucleotides and mapping of all the genes in the human genome. • Human genome contains about 3 × 109 bp. Goals of HGP (a) To identify all the estimated genes in human DNA. (b) To determine the sequences of the 3 billion chemical base pairs that make up human DNA. (c) To store this information in databases. (d) To improve tools for data analysis. (e) To transfer related technologies developed during the project of society to other sectors of society. (f) To address the ethical, legal and social issues (ELSI) that may arise from the project. HGP was Closely Associated with Bioinformatics The application of computer science and information technology to the field of biology and medicine helps in analysing DNA sequence data. Methodologies of HGP There are two major approaches namely, ESTs and sequence annotation. • Expressed Sequence Tags (ESTs) : Focused on identifying all the genes that are expressed as RNA and sequencing the same. • Sequence annotation : Sequencing whole set of the genome containing all the coding & noncoding regions and later assigning functions to different regions. Procedure : Isolate total DNA from a cell → Convert into random fragments of smaller size → Clone in suitable host (e.g., BAC – bacterial artificial chromosomes & YAC – yeast artificial chromosomes) for amplification through PCR (polymerase chain reaction) → Fragments are sequenced using Automated DNA sequencers (using Frederick Sanger method) → Sequences are arranged based of the overlapping regions → Alignment of sequences using computer-based programs → Genetic and physical maps on the genome were generated using the information on polymorphism of restriction endonuclease recognition sites and some repetitive DNA sequences (micro-satellites). Salient Features of Human Genome (a) Human genome contains 3164.7 million nucleotide bases pairs. (b) Total number of genes = about 25,000. (c) Average gene consists of 3000 bases, but sizes vary. The largest known human gene (dystrophin on X-chromosome) contains 2.4 million bases. (d) 99.9% of nucleotide bases are identical in all people. It is 0.1% which makes each of us unique. (e) Functions of over 50% of discovered genes are unknown. (f) Chromosome I has the most genes (2968) and Y has the fewest (231). (g) Less than 2% of the genome codes for proteins. (h) Repeated sequences make up a very large portion of the human genome. Repetitive sequences are stretches of DNA sequences that are repeated many times. They have no direct coding functions but they shed light on chromosome structure, dynamics and evolution. (i) About 1.4 million locations where single-base DNA differences (SNPs- Single nucleotide

295

296

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

















solution containing a radioactive labelled singlestranded DNA probe. The DNA probes are small radioactive synthetic DNA segments of known sequences of nitrogen bases. These DNA probe binds with the complementary sequences of the DNA fragment on the membrane to form a hybridized DNA. (h) The filter paper is washed to remove unbound probe. (i) The hybridised DNA is photographed on to an X-ray film by autoradiography. The image (in the form of dark & light bands) obtained is called a DNA fingerprint. This gives the characteristic pattern of an individual's DNA. Applications of DNA Fingerprinting are : • Forensic tool to solve paternity, rape, murder, etc. • For the diagnosis of genetic diseases. • To determine the phylogenetic status of animals.

Fig 5.12: tRNA- the adapter molecule





















Steps of DNA Fingerprinting (Southern Blotting Technique) (a) Isolate DNA (from any cells like blood stains, semen stains or hair roots). (b) Make copies (amplification) of DNA by Polymerase Chain Reaction (PCR) if the amount of isolated DNA is small. (c) Digest DNA by restriction endonucleases. (d) Separate DNA fragments by gel electrophoresis over agarose polymer gel. (e) Treat with alkali solution (NaOH) to denature DNA bonds so as to split them into singlestranded DNAs in the gel. (f) Transfer (blotting) single-stranded DNA fragments to synthetic membranes such as nitrocellulose or nylon, and then baked in a vacuum oven at 80°C for 3-5 hours (to fix the DNA fragment on the membrane). (g) Nitrocellulose filter membrane is placed in a IMPORTANT DIAGRAMS :

Fig 5.13: Translation

Fig 5.14: The lac Operon qqq

6

EVOLUTION

Topic-1

Origin of Life on Earth and Various Related Evidences Concepts Covered evidences.



Theories of origin of life, Urey-Miller experiment Evolution and it’s

Revision Notes























































(ii) Biogenesis It was proposed by Francisco Redi,  Spallanzani and Louis Pasteur.  It states that life originates from pre-existing life.













Mnemonics Concept : Theories of Origin of life Mnemonic : All Boys Come in School it's Compulsory Interpretation: Abiogenesis, Biogenesis, Cosmic theory, Special creation theory, Chemical evolution theory











(iii) Cosmic Theory (Theory of Panspermia)  It states that the units of life (spores) were transferred to different planets including Earth. (iv) Theory of Special Creation  It states that living & non-living things are created by some supernatural power (God). (v) Theory of Chemical Evolution of life  It was proposed by Oparin and Haldane.  It states that the first form of life was originated from non-living inorganic and organic molecules such as CH4, NH3, H2O, sugars, proteins, nucleic acids, etc.  “Abiogenesis first, but biogenesis ever since”.  Two hypothetical proposals of OparinHaldane’s theory are : (i) Chemical evolution from inorganic to organic molecules. (ii) First life formed by assembly and interaction of organic molecules.  This theory is also known as primary abiogenesis. Urey-Miller Experiment  Harold Urey & Stanley Miller conducted an experiment to prove the theory of chemical evolution.  They created a condition similar to that of primitive earth (i.e., high temperature, volcanic storms, reducing atmosphere devoid of oxygen but containing compounds of carbon, hydrogen, nitrogen and water.  They made electric discharge in a closed flask containing CH4, NH3, H2 and water vapour at 800° C.  As a result, some amino acids were formed.  In similar experiments, others observed the formation of sugars, nitrogen bases, pigments and fats.  First non-cellular form of life originated 3 billion years ago.  They were RNA, proteins, polysaccharides, etc. Evolution of Life Forms – Various Theory  Based on observations made during a sea voyage in a survey ship called H.M.S. Beagle round the world, Charles Darwin concluded that existing living forms share similarities to varying degrees not only among themselves but also with life forms that existed millions of years ago. 

Evolution is an orderly change from one form to another.  Evolutionary Biology : Study of history of development of newer life forms from preexisting ones. Origin of Life  Big Bang theory state that the universe originated about 20 billion years ago by a thermonuclear explosion (big bang) of a dense entity.  The earth was formed about 4.5–5 billion years ago.  There was no atmosphere on early earth.  Water vapour, CH4, CO2 and NH3 released from molten mass covered the surface. H 2O → H 2 + O 2 NH3 + O2 → NO + water CH4 + O2 → CO2 + Water  Then the ozone layer was formed.  As it cooled, the water vapour condensed to fell as rain to form oceans. Theories of Origin of Life (i) Abiogenesis states that life originated from a simple organic compound : It states that life came out of decaying and  rotting matter like straw, mud, etc. Louis Pasteur (1864) demonstrated that life  comes from pre-existing life and dismissed abiogenesis theory. He showed that in pre-sterilised flasks,  life did not come from killed yeast while in another flask open to air, new living organisms arose. 

298

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



BIOLOGY





























 





























 

























2. Morphological and Anatomical Evidences Comparative anatomy and morphological  evidences showed that different forms of animals have some common structural features. This can be explained as follows : (a) Homologous Organs and Homology Homologous organs are the organs having  fundamental similarity in structure and origin but different in functions. This phenomenon is called homology. e.g., Human hand, Whale’s flippers, Bat’s wings, and Cheetah’s foot.  All these perform different functions but are constructed on the same fundamental plan.  Homology can be seen in the skeleton (e.g., humerus, radius, ulna, carpals, metacarpals & phalanges), heart, blood vessels, excretory system, brain, etc.  Homology in Plants : (i) The thorns of Bougainvillea and tendrils of Cucurbita. (ii) The origin of homologous organs is due to divergent evolution. (iii) The divergent evolution is the process by which related species become less similar in order to survive and adapt to different environmental conditions. (iv) Homology indicates common ancestry. (b) Analogous Organs and Analogy  Analogous organs are organs having similar function but different structure and origin. This phenomenon is called analogy.  Examples (i) Wings of insects (formed of a thin flap of chitin) and wings of birds (modified forelimbs). (ii) Eyes of Octopus (retina from skin) and mammals (retina from the embryonic brain). (iii) Flipper of Penguins and Dolphins. (iv) Sweet potato (modified root) and Potato (modified stem). (v) Trachea of insects (from ectoderm) and lungs of vertebrates (from endoderm).  The origin of analogous organs is due to convergent evolution.  The convergent evolution is the process by which unrelated species become more similar to survive and adapt in similar environmental conditions. 3. Adaptive Radiation (Biogeographical Evidences)  Adaptive radiation (evolution by adaptation) is the evolution of closely related species in a given geographical area starting from a point. e.g., (a) Darwin’s finches (seen in Galapagos Islands). (b) Australian marsupials. (c) Placental mammals in Australia.  When more than one adaptive radiation occurs in an isolated geographical area, this leads to convergent evolution e.g., Australian Marsupials and Placental mammals. 4. Biochemical Evidences  Similarities in proteins and genes.  Similarities in other biomolecules and metabolism.

 



















































There had been extinctions of different life forms in the years gone by just as new forms of life, arose at different periods of the history of the earth.  There has been a gradual evolution of life forms due to variation in characteristics.  Those characteristics which enable some to survive better in natural conditions (climate, food, physical factors etc.) would outbreed others that are less-endowed to survive under such natural conditions or fitness of the individual or population.  Fitness, according to Darwin, refers ultimately and only to reproductive fitness.  Hence, those who are a better fit in an environment, leave more progeny than others.  These, therefore, will survive more and hence are selected by nature.  He called it natural selection and implied it as a mechanism of evolution. The modern synthetic theory : The modern synthetic theory is also known as Neo- Darwinian theory which merges the theory of Darwinian evolution with Mendelian genetics given by many evolutionary biologists such as such as T. Dobzhansky, Sewall Wright, G.I. Stebbins, Ernst Mayr. This theory provide a new definition of evolution as “the change occurring in the allele frequencies within the populations” which emphasises the genetic basis of evolution. Factors of modern synthetic theory:  Mutation  Genetic recombination  Genetic drift  Natural selection  Isolation  Alfred Wallace, a naturalist who worked in the Malay Archipelago also came to similar conclusions around the same time.  All the existing life forms share similarities and share common ancestors.  However, these ancestors were present at different periods in the history of the earth.  The geological history of the earth closely correlates with the biological history of the earth. Evidences for Evolution 1. Palaeontological Evidences  The study of fossils is known as paleontology.  Fossils are remnants of life forms or the parts found preserved in rocks (earth crust).  Fossils are written documents of evolution.  Significance of Fossils (a) To study phylogeny (evolutionary history or race history) e.g., Horse Scan to know more about evolution. this topic (b) To study the connecting link between two groups of organisms e.g., Archaeopteryx having reptilian and avian Evidences of characteristics. Evolution (c) To study extinct animals e.g., Dinosaurs. (d) To study about the geological period by analysing fossils in different sedimentary rock layers. The study showed that life forms varied over time and certain life forms are restricted to certain geological periods. 

299

300

Oswaal CBSE LMP (Last Minute Preparation), Class-XII







Excess use of herbicides, pesticides, antibiotics or drugs, etc., resulted in the selection of resistant varieties (natural selection by anthropogenic action). IMPORTANT DIAGRAM : 

  

















5. Evidences for Evolution by Natural Selection  Natural selection is the process by which the organisms that are best suited for their environment survive and reproduce.  Examples of natural selection : Industrial Melanism (In England) : Before Industrialisation (1850s) :  There were more white-winged moths (Biston betularia) on trees than dark-winged or melanised moths (Biston carbonaria).  Reason : White coloured lichen covered the trees. In that background, the white-winged moths survived but the dark coloured moths were easily spotted out and picked out by predators. After industrialisation (1920) : More dark-winged moths and less white winged moths.  Reason : The tree trunks became dark due to pollution by industrial smoke and soot. No growth of lichens. Under this condition, the white winged moth did not survive because the predators identified them easily against dark background. Dark winged moth survived because of suitable dark background.

Miller and Urey’s Experiment

Evolutionary Theories, It's Mechanism and Topic-2 Evolution of Man

 Theory of Biological Evolution, Hardy - Weinberg Principle, Human Evolution 

Concepts Covered

Revision Notes

•





1. Darwinism (Theory of Natural Selection) • It was proposed by Charles Darwin (1859) in his book “Origin of Species”. • It is based on two key concepts namely, (a) Branching descent (Adaptive radiation) (b) Natural selection (Convergent evolution) (a) Branching Descent • It explains that all organisms are modified descendants of previous life forms. (b) Natural Selection • Consider a bacterial colony (say A) growing on a given medium. • If the medium composition is changed, only a part of the population (say B) can survive under new conditions. This variant population outgrows the others and appears as new species i.e. B is better than A under new condition. • Nature selects for fitness. • The work of Thomas Malthus on principle of populations (1794) was influenced by Darwin. • Natural selection is based on the following facts : (a) Heritable minor variations. (b) Over production by organisms. (c) Limited natural resources. (d) Struggle for existence for food and space. (e) Survival of the fittest.  





•







 

• •















Mechanism of Evolution • Darwin ignored about origin of variation and mechanism of speciation. Scan to know Mutation Theory more about • Hugo de Vries (1901) proposed this topic Mutation Theory of evolution in his book “Mutation theory”. • He conducted some experiments on Oenothera lamarckiana (evening primrose) and believed Mechanism of that evolution takes place Evolution through mutation and not by minor variation. • Evolution for Darwin was gradual while for de Vries it is a sudden / spontaneous process. He believed mutation caused speciation and hence called it saltation (single step large mutation).



























• •

Population size grows exponentially if everybody reproduces maximally (e.g., bacterial population). In fact, population size is limited due to competition for resources (Struggle for existence). Only some survives (Survival of the fittest). Darwin said that the organisms with heritable variations make resource utilisation better. They reproduce and leave more progeny. It leads to a change in population characteristics and new forms appear.

BIOLOGY











Basic unit of natural selection is individual. Australopithecus is considered as the connecting link between man and apes.

































































Origin and Evolution of Man (Human ancestry) (i) Dryopithecus & Ramapithecus (15 mya) (a) Hairy. (b) Walked like gorillas and chimpanzee. (c) Dryopithecus : ape-like. (d) Ramapithecus : man-like. (e) Fossils of man-like bones found in Ethiopia and Tanzania. (f) Man-like primates (3-4 mya) : Height up to 4 feet. (ii) Australopithecus (2 mya) • In East African grasslands. • Hunted with stone weapons. • Ate fruits. (iii) Homo habilis • First human-like being (hominid). • Brain capacity : 650-800 cc. • Did not eat meat. (iv)Homo erectus (1.5 mya) • Large brain (900 cc) : Ate meat. (v) Neanderthal man : 40,000 - 1 lakh yrs ago : • Brain 1400 cc. • Lived in East and Central Asia. • Used hides to protect their body. • Buried their dead. (vi)Homo sapiens (Modern man) : Evolution took place during 10,000 to 75,000 years ago. • Pre-historic cave art developed about 18,000 years ago. • Agriculture and settlements : 10,000 years ago. qqq















Key Fact

















Concept: Factors Affecting Hardy- Weinberg Equilibrium Mnemonic: 3G Modern Network Interpretation: Gene migration, Genetic drift, Genetic recombination, Mutation, Natural selection.









Mnemonics

• Sum total of all the allelic frequencies = 1. e.g., In a diploid, p and q are the frequencies of alleles A & a respectively. • The frequency of AA = p2 (i.e., the probability of an allele A with frequency p is the product of the probabilities, i.e., p2) • The frequency of aa = q2 • The frequency of Aa = 2pq • Hence p2 + 2pq + q2 = 1 [binomial expansion of (p+q)2] • Change of frequency of alleles in a population causes disturbance in genetic equilibrium. This is due to evolution. Factors Affecting Hardy-Weinberg Equilibrium : There are time basic processes which may bring about the change in Hardy WeinScan to know more about berg equilibrium and bring about this topic the variations at the genetic level as follows : (a) Gene Migration • Gene flow from one population to another. Hardy Weinberg's • Here, gene frequencies Principle change in both populations. • There would be a gene flow if migration happens multiple times. (b) Genetic Drift • The accidental gene flow causing change in frequency. • Sometimes, the change in frequency is so different in the new sample of population that they become a different species. • The original drifted population becomes founders and the effect is called founder effect. (c) Mutation • Mutations result in formation of new phenotypes. • Over few generations, this leads to speciation.

301

(d) Genetic Recombination • It is the reshuffling of gene combinations during crossing over resulting in genetic variation. (e) Natural Selection : It is the major factor which adds variations in the population, change the gene frequencies in the gene pool resulting in the formation new gene pool. These are of three types namely, Stabilising selection, Directional selection and Disruptive selection. (i) Stabilising Selection : Here, more individuals acquire average character value and variation is reduced. (ii) Directional Selection : Here, individuals of one extreme are more favoured. (iii) Disruptive Selection : Individuals of both the extremes are favoured. It produces two peaks that may lead to the development of two different populations.

Hardy - Weinberg Principle • It says that allele frequencies in a population are stable and constant from generation to generation. • The gene pool (total genes and their alleles in a population) remains constant. This is called genetic equilibrium (Hardy-Weinberg equilibrium).





UNIT-VIII: BIOLOGY AND HUMAN WELFARE

7

HUMAN HEALTH AND DISEASES

Topic-1

Health, Common Human Diseases and Immunity Concepts Covered

 Types of diseases, Different microorganisms causing different type of diseases, life cycle of Plasmodium, Immune system, Immunisation, AIDS and cancer.













2. VIRAL DISEASES (a) Common cold • Pathogen: Rhino viruses • Mode of transmission: Inhaling droplets resulting from cough or sneezes through contaminated objects. • Symptoms : Infects nose and respiratory passage. Nasal congestion and discharge, sore throat, hoarseness, cough, headache, tiredness, etc., Last for 3-7 days.









  































3. PROTOZOAN DISEASES (a) Malaria • Pathogen: Plasmodium sp. (P. vivax, P. malariae, P. ovale. and P. falciparum). • Mode of transmission: Biting of Anopheles mosquito. • Symptoms: Haemozoin causes chill and high fever recurring every 3-4 days. Life cycle of Plasmodium-: The life cycle of Plasmodium has three phases - Schizogony, gamogony and sporogony. Female Anopheles mosquito is the primary host while man is the secondary host. Life cycle of Plasmodium in Man: (a) The infective stage of Plasmodium is the sporozoite, which is injected into the blood of the human by the bite of female Anopheles mosquito. (b) From the human blood, sporozoites reach the liver cells where they multiply. (c) The liver cells rupture to liberate the parasites into the blood where they attack the RBCs, multiply and cause their rupture. (d) The rupture is associated with the release of a toxin called haemozoin, which is responsible for the recurring chill and high fever within 3 - 4 days. (e) The development of gametocytes takes place in the RBCs, which are of two types: male gametocytes or microgametocytes, and female gametocytes or macrogametocytes. Life cycle of Plasmodium in Female Anopheles Mosquito (a) When a female Anopheles mosquito sucks the blood of an infected human host, it receives the RBCs including gametocytes. (b) Further development occurs in the stomach wall of the mosquito, the gametes fuse to form a zygote. (c) The zygote undergoes further development to form sporozoites. (d) The sporozoites after liberation from the stomach wall move to different organs in the body cavity, but many of them penetrate the salivary glands.





















l





l



l



l

l





l

l





l



Human Diseases and Immunity Health is a state of complete physical, mental and social well-being. Health is affected by genetic disorders, infections, sedentary lifestyle (Junk food, lack of exercise, habits, etc). Disease: A disease can be defined as any condition that may lead to discomfort, distress, health problems or death of the affected person. Congenital diseases: These are diseases that are present since birth. For instance, a hole in the heart of an infant. They are caused by some genetic abnormalities or metabolic disorder or malfunctioning of an organ. Acquired diseases: These are diseases that may occur after birth during one’s lifetime. Among non-infectious diseases, cancer is the major cause of death. Pathogens are disease-causing organisms. Parasites are pathogens as they harm the host by living in or on them. Pathogens have to adapt to live within the environment of the host. Common Infectious Diseases in Man 1. BACTERIAL DISEASES (a) Typhoid • Pathogen: Salmonella typhi. • Mode of transmission: It enters the small intestine through food and water and migrates to other organs through blood. • Symptoms: Sustained high fever (39°- 40°C), weakness, stomach pain, constipation, headache and loss of appetite. Intestinal perforation and death may occur. • Confirmation: The Widal test is used for confirmation of the disease. (b) Pneumonia • Pathogen: Streptococcus or Diplococcus pneumoniae and Haemophilus influenzae. • Mode of transmission: Inhaling the droplets/aerosols released by an infected person. Sharing glasses and utensils with an infected person. • Symptoms: Infects lung's alveoli. The alveoli get filled with fluid leading to respiratory problems. Fever, chills, cough, headache. • Severe cases: Lips and fingernails turn grey to a bluish colour. • Dysentery, plague, diphtheria are some other bacterial diseases in humans. l



Revision Notes



BIOLOGY

303

304

Oswaal CBSE LMP (Last Minute Preparation), Class-XII







(b) Filariasis (Elephantiasis) • Pathogen: Filarial worms or Wuchereria (W. bancrofti & W. malayi). • Mode of transmission: Bite of female Culex mosquito. • Symptoms: Filarial worms live in lymphatic vessels (usually of lower limbs). It causes chronic inflammation of the organs, in which they live for many years. Limbs and genital organs may be deformed. 5. FUNGAL DISEASES (a) Ring worms • Pathogens: Microsporum, Trichophyton & Epidermophyton. They are seen in groin between the toes. • Mode of transmission: From soil or by using towels, cloths, comb, etc. Heat and moisture help fungi to grow. • Symptoms: Appearance of dry, scaly lesions on various body parts such as skin, nails and scalp. Intense itching. Other Infectious Diseases (i) Bacterial Diseases Transmission Contact, Contaminated food and water

Disease Dysentery





Pathogen Shigella Pasteurella pestis Corynebacterium diphtheriae Vibrio cholerae Mycobacterium tuberculosis Clostridium tetani Bordetella pertussis Mycobacterium leprae Bacillus anthracis Leptospira

Rat fleas Contaminated food, Direct contact Food & water contaminated with faeces Droplets from patient/carrier Contamination of wound by bacteria Contact, Droplets Direct contact Contact with cattle Contact with rodents, dogs, etc.



Plague Diphtheria Cholera Tuberculosis Tetanus Whooping cough Leprosy Anthrax Weil’s disease (ii) Viral Diseases Disease































(e) The mosquito now becomes infective, when the female Anopheles mosquito bites a healthy person the sporozoites are injected in his / her blood along with saliva. (b) Amoebiasis (Amoebic dysentery) or Enteritis. • Pathogen: Entamoeba histolytica found in the large intestine of humans. • Mode of transmission: Houseflies (mechanical carriers) transmit parasites from the faeces of an infected person to food and water and thereby contaminating them. • Symptoms: Constipation, abdominal pain and cramps, stools with excess mucous and blood clots. 4. HELMINTH DISEASES (a) Ascariasis • Pathogen: Ascaris lumbricoides (Intestinal parasite). • Mode of transmission: Soil, water, vegetables, fruits, etc., contaminated with faeces containing eggs of parasites. • Symptoms: Internal bleeding, muscular pain, fever, anaemia and blockage of intestinal passage.

Transmission Rabid dogs. Aedes mosquito Coughing & Sneezing Droplets Close contact Airborne droplets Airborne droplets Direct contact Faeces & Air Aedes mosquito Contact with infected poultry. Airborne spread Contact with pigs, cough & sneeze of infected person.































(iv) Introduce larvivorous fish like Gambusia in ponds. (v) Spraying insecticides in ditches, drainage and swamps. (vi) Doors and windows should be provided with wire mesh to prevent the entry of mosquitoes. These precautions can avoid vecScan to know tor-borne diseases like malaria, filamore about riasis, dengue and chikungunya. this topic Immune System • It is the system that gives immunity to the body by recognizing, responding and remembering foreign antigens. Human Immune System • It plays an important role in an allergic reaction, auto-immune

Rabies virus Dengue virus Influenza virus Rubeola virus Rubella virus Mumps virus Varicella zoster Variola virus Polio virus CHIK virus H5N1 virus H1N1 virus

Prevention and Control of Diseases 1. Personal Hygiene: Keep the body clean. Use clean drinking water, food, etc. 2. Public Hygiene (a) Proper disposal of wastes and excreta. (b) Periodic cleaning and disinfection of water reservoirs, pools, cesspools and tanks. (c) Avoid contact with infected persons or their belongings (to control air-borne diseases). (d) Standard practices of hygiene in a public gathering. • Control and eliminate the vectors (e.g., mosquitoes) and their breeding places by following methods: (i) Avoid stagnation of water. (ii) Regular cleaning of household coolers. (iii) Use of mosquito nets.



Rabies Dengue Influenza Measles German measles Mumps Chickenpox Smallpox Polio Chikungunya Avian flu H1N1 (Swine flu)

Pathogen



BIOLOGY













 















 













 

















































 





































and monocytes and natural killer (type of lymphocytes) in the blood as well as macrophages in tissues can phagocytose and destroy microbes. (iv) Cytokine Barriers: Virus-infected cells secrete proteins called interferon which protect non-infected cells from further viral infection. (b) Acquired Immunity • It is a pathogen-specific immunity. • It is not present since birth but develops during the lifetime of an individual. • It is characterized by memory i.e., during the first encounter of a pathogen; our body produces a primary response in low intensity. The second encounter with the same pathogen produces a secondary (anamnestic) response in high intensity. • The primary and secondary immune responses are carried out with B-lymphocytes and T-lymphocytes. (a) B-lymphocytes (B-cells): Produce antibodies. (b) T-lymphocytes: Help B-cells to produce antibodies. Structure of an Antibody Molecule • Each antibody has 4 polypeptide chains namely, 2 small light chains and 2 large heavy chains (H2L2). • In our body, different types of antibodies such as IgG, IgA, IgM, IgE & IgD are produced. • Acquired immune response is of two types namely humoral mediated response and cell-mediated response. (a) Humoral or Antibody-Mediated Response/ Antibody-Mediated Immunity (AMI) • Antibodies are found in blood plasma. So, it is called as humoral immune response. • It includes B-lymphocytes and T-lymphocytes. The latter help the former to produce antibodies. (b) Cell-Mediated Response/Cell-Mediated Immunity (CMI) • It is T-lymphocytes (T-cells) mediated (CMI). • CMI causes Graft rejection. • The body can differentiate ‘self ’ and ‘nonself ’. • Tissue matching and blood group matching are essential before undertaking any graft / transplant. After this, the patient has to take immune-suppressants for all his life. Types of Acquired Immunity: Acquired immunity is of two types i.e., active and passive Immunity. (a) Active Immunity • The immunity in which antibodies are produced in a host body when the host is exposed to antigens (e.g., living or dead microbes or other proteins) is known as active immunity. • It is a slow process. • It is produced in 2 ways: (i) Natural Active Immunity: During natural infection by microbes. (ii) Artificial Active Immunity: Injecting the microbes deliberately during immunization. (b) Passive Immunity: • Here, ready-made antibodies are directly given to protect the body. • It is of two types-:





disease and organ transplantation. • It includes lymphoid organs, tissues, cells and soluble molecules like antibodies. Lymphoid Organs • These are the organs where origin, maturation and proliferation of lymphocytes occurs. • These are of two types namely, primary lymphoid organs and secondary lymphoid organs. (a) Primary Lymphoid Organs • Here, immature lymphocytes differentiate into antigen-sensitive lymphocytes e.g., Bone marrow and thymus. • Bone marrow is the main lymphoid organ and is the site of formation of all the blood cells including lymphocytes. • Thymus is large during birth but gradually reduces in size and becomes very small size at puberty. • Growth and maturation of T-lymphocytes takes place here. (b) Secondary Lymphoid Organs • The organs to which matured lymphocytes migrate, interact with antigens and then proliferate to become effector cells e.g., Spleen, lymph nodes, tonsils, Peyer’s patches, MALT and appendix. Secondary lymphoid organs are: (i) Spleen: (i) It is a bean-shaped organ. (ii) It contains lymphocytes and phagocytes. (iii) It removes worn-out RBCs and microorganisms from blood. (iv) It is a reservoir of erythrocytes in the foetus. (ii) Lymph Nodes (i) These are found in the lymphatic system. (ii) They trap microorganisms or other antigens that enter the lymph and tissue fluid. (iii) The trapped antigens activate lymphocytes and cause an immune response. (iii) Mucosa Associated Lymphoid Tissue (MALT): (i) It is located within the lining Scan to know of respiratory, digestive and more about urinogenital tracts. this topic (ii) It constitutes 50% of lymphoid tissue in the human body. Immunity • It is the ability of the immune Immunity and system of the body to fight against Its Types the disease-causing organisms. • It is of two types namely Innate immunity and Acquired immunity. (a) Innate Immunity • It is the non-specific defence present at the time of birth. • It provides barriers to the entry of foreign agents into our body. • It consists of four types of barriers: (i) Physical Barriers • Skin on our body is the first and main barrier that prevents entry of the microorganisms. It is the first line of defence. • Mucus coating of the epithelium lining the respiratory, gastrointestinal and urogenital tracts also help in trapping microbes entering our body. (ii) Physiological Barriers: Acid in the stomach, saliva in the mouth, tears from eyes–all prevent microbial growth. (iii) Cellular Barriers: Certain types of leukocytes (WBC) of our body like polymorphonuclear leukocytes (PMNL-neutrophils)

305

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

















































































 

































• It is caused by HIV (Human Immunodeficiency Virus), a retrovirus having an RNA genome. • AIDS was first reported in America (1981). • Mode of Transmission: (a) Sexual contact with an infected person. (b) Transfusion of contaminated blood and blood products. (c) Sharing of infected needles. (d) From infected mother to her child through the placenta. • High risk of getting HIV includes (a) Individuals with multiple sexual partners. (b) Drug addicts who take drugs intravenously using infected syringes. (c) Individuals who require a repeated blood transfusion. (d) Children born to an HIV infected mother. • HIV does not spread by touch or physical contact. • It spreads only through body fluids. • There is always a time-lag (from few months to 5-10 years) between the infection and appearance of symptoms. • Life Cycle of HIV Virus: • HIV enters into body → To macrophages (acts as HIV factory) → RNA genome replicates in presence of Reverse transcriptase to form viral DNA → Viral DNA incorporates into host DNA → Infected cells produce virus particles → HIV enters into helper T-cells (TH) → Replicates and produce progeny viruses → Attack another helper T-cells → T-cells decrease → Weaken immunity. • HIV infected person may be infected with Mycobacterium, viruses, fungi and parasites like Toxoplasma. • Diagnosis of AIDS: ELISA test (Enzyme-Linked Immune-Sorbent Assay) PCR-Test, western blotting, etc. • Treatment of AIDS • Anti-viral drugs partially effective. • They can only prolong the life of the patient. • Prevention of AIDS (i) Educate people about AIDS. (ii) Making blood (from blood banks) safe from HIV. (iii) Use of disposable needles and syringes. (iv) Advocating safe sex and free distribution of condoms. (v) Controlling drug abuse. Scan to know (vi) Regular check-ups for HIV more about in a susceptible population. this topic Cancer • Cancer is an abnormal and uncontrolled multiplication of cells resulting in the formation of tumour (masses of cells). Causes of • Normal cells show a contact Cancer inhibition (contact with the other cells inhibits their uncontrolled growth). Cancer cells do not have this property. • Tumours are of two types namely Benign tumour and Malignant tumour. (a) Benign Tumour • It is confined to the place of its origin and does not spread to other parts of the body. • It is harmless or causes less damage to the body. (b) Malignant Tumor • It spreads and invades nearby tissues. • It is harmful. • Metastasis: The spread of cancer cells from one part of the body to another.

 

 



(i) Natural Passive Immunity-: e.g., Antibodies (IgG) from mother → Placenta → Foetus → Antibodies (IgA) in colostrum → infants. (ii) Artificial Passive Immunity-: e.g., Antitetanus serum (ATS). Immunization • This is based on the ‘memory’ of the immune system. • It is of two types namely active immunization and passive immunization. (a) Active Immunization (Vaccination) • A preparation of vaccine (antigenic proteins of pathogen or inactivated pathogen) is introduced into the body. • The antibodies produced in the body against the antigens neutralize the pathogenic agents during actual infection. • The vaccines also generate memory B and T-cells that recognize the pathogen quickly e.g., Polio vaccine, Hepatitis B vaccine, DPT vaccine etc. • Vaccines are produced using DNA recombinant technology (e.g., Hepatitis B vaccine produced from Yeast). Such vaccines are called as second-generation vaccines. • The vaccines produced by conventional methods e.g., small pox-vaccines are called first-generation vaccine and those which are synthetic vaccine are the third generation vaccine. (b) Passive Immunization • It is the direct injection of preformed antibodies or antitoxin. It is for quick immune response e.g., Immunization against tetanus, snake venom, etc. Allergies • It is the exaggerated or hypersensitive response of the immune system to certain antigens present in the environment. • Allergens are substances causing allergy e.g., mites in dust, pollens, animal dander, fur, etc. • Antibodies produced against the allergens are of IgE type. • Allergy is due to the release of chemicals like histamine and serotonin from the mast cells. • Symptoms: Sneezing, watery eyes, running nose, difficulty in breathing, etc. • Determination of cause of allergy: The patient is exposed to or injected with very small doses of possible allergens and the reactions studied. • Treatment, Drugs like anti-histamine, adrenaline and steroids quickly reduce the symptoms of allergy. • Modern-day lifestyle results in lowering of immunity and more sensitivity to allergens. • Asthma is a respiratory disease due to allergy. Auto Immunity • It is caused due to genetic and other unknown reasons. The body attacks self cells. This results in auto-immune disease. • It is memory-based acquired immunity evolved in higher vertebrates based on Scan to know the ability to differentiate foreign more about organisms (e.g., pathogens) from this topic self-cells e.g., Rheumatoid arthritis. AIDS (Acquired Immunodeficiency Syndrome) • Syndrome is a group of symptoms. • AIDS is the deficiency of the AIDS immune system.







306



BIOLOGY

be advised to avoid exposure to particular carcinogens (e.g., tobacco smoke). • Treatment of Cancer Most cancers are treated by a combination of surgery, radiotherapy and chemotherapy. (a) Radiation therapy: Tumour cells are irradiated lethally without damaging surrounding normal tissues. (b) Chemotherapy: Use of chemotherapeutic drugs. Many drugs have side effects like hair loss, anaemia, etc. (c) Immunotherapy: The patients are given biological response modifiers (e.g., interferon) which activates their immune system and helps in destroying the tumour.







a





















• Types of Cancer • Carcinoma: cancer of epithelial cells. • Sarcoma: cancer of connective tissues. • Melanoma: cancer of melanocytes. • Leukemia: blood cancer. • Lymphomas: cancer of spleen and lymph nodes. Causes of Cancer (Carcinogens) (a) Physical agents: e.g., Ionizing radiations like X-rays and gamma rays and non-ionizing radiations like UV. (b) Chemical agents: Tobacco smoke (a major cause of lung cancer), vinyl chloride, caffeine, nicotine, mustard gas, etc. (c) Biological agents: e.g., oncogenic viruses, cellular oncogenes (c-onc) or proto oncogenes, etc. When a C-onc in normal cells is activated, the cells becomes oncogenic. • Cancer Detection and Diagnosis (a) Biopsy: A thin piece of the suspected tissue is stained and examined under a microscope (histopathological studies). (b) In case of leukaemia: Biopsy and histopathological studies. Blood and bone marrow tests for increased cell counts. (c) Radiography (use of X-rays): CT (Computerized Tomography) scan and MRI (Magnetic Resonance Imaging). (d) Use of antibodies against cancer-specific antigens. (e) Techniques of molecular biology to detect genes related to cancer. Such individuals may

307













Mnemonics

Topic-2

1. Concept: Helminth diseases Mnemonic: He Finished Assignment Interpretation: Helminth, Filariasis, Ascariasis 2. Concept: Viral diseases Mnemonics: Vice Chancellor

Interpretation: Viral, Common cold 3. Concept: Protozoan diseases Mnemonic: Pre Medical Association Interpretation: Protozoa, Malaria, Amoebiasis

Drugs and Adolescence Concepts Covered



Drugs and their types, Effects of drugs and alcohol.

Revision Notes











• Opium is obtained from dried latex of unripe capsules of Poppy plant (Papaver somniferum). Opium Derivatives (a) Morphine: Strong analgesic and sedative extracted from the latex of poppy plant. Useful during surgery. (b) Brown sugar (c) Heroin (Diacetyl morphine/smack): Most dangerous, white, odourless, bitter crystalline compound produced by acetylation of morphine. It is a depressant and slows down body functions. It is taken by snorting and injection.

Key Words







Analgesic: Drug used as pain reliever. Sedative: Drugs are meant for inducing sleep. Drug is CNS (Central Nervous System) depressants.

Hallucination: An experience in which we see,

hear, feel or smell something that actually does not exist. It could be due to side effect of some drug or any disease.

(d) Codeine: Mild analgesic. Used in cough syrups. 3. Stimulants • Stimulates CNS e.g., Cocaine, Caffeine (cardiac stimulant), amphetamines (synthetic). • Amphetamines & anabolic steroids are misused by some athletes. • Coca alkaloid (Cocaine or coke / crack): Obtained from the coca plant (Erythroxylum coca). • Interferes the transport of neurotransmitter dopamine.



















Scan to know Drugs and their effects more about Drugs this topic • These can alter the activity of the nervous system. • They are also called as psychotropic drugs or mood-altering drugs or neurological drugs. Drugs • These drugs change the mood, feelings, behaviour and power of perception. • The sources of most of the drugs are mainly flowering plants and some fungi. Types of Drugs • The drugs, which are commonly abused are opioid, cannabinoids and coca alkaloids. • These drugs are of the following main types: 1. Depressants • Depress brain activity. • They include (a) Sedatives: Give calmness and relaxation. High doses induce sleep. e.g., Barbiturates (sleeping pills). (b) Tranquilizers: Lower tension and anxiety without inducing sleep. e.g., Benzodiazepines (e.g., Valium). 2. Opiate Narcotics (Pain killers) • Drugs that bind to specific opioid receptors in CNS and gastrointestinal tract. • They are analgesic and depressant (lower tension, anxiety, B.P and respiration rate and reduce visual activity) e.g., Opium and its derivatives (Opiates or Opioids).

308

a vulnerable phase of mental and psychological development. Addiction • It is a psychological attachment (euphoria and a temporary feeling of well being) with drugs and alcohol. • With repeated use of drugs, the tolerance level of the receptors increases. Thus, the receptors respond only to higher doses leading to greater intake and addiction. 





• Cocaine is usually snorted. • Stimulate CNS producing euphoria and energy. • Excessive dosage causes hallucination. 4. Hallucinogens • Cause hallucinations, changing thoughts, feelings and perceptions e.g., Mescaline, Psilocybin, Cannabinoids and LSD (Lysergic Acid diethylamide). • Atropa belladonna & Datura are plants with hallucinogenic property. 5. Cannabinoids • Drugs (a group of chemicals) Scan to know that interact with cannabinoid more about receptors in the brain. this topic • Generally taken by inhalation and oral ingestion. • Natural cannabinoids are obtained from Cannabis sativa (Hemp plant). It’s flower tops, Tobacco Smoking leaves & resin are used to produce bhang, ganja, charas Drugs Effects (hashish), marijuana, etc. • Affects the cardiovascular system. Alcoholism • Alcohols include beverages and spirits. (a) Beverages: Wine, beer and toddy (5-15% alcohol). (b) Spirits: Whisky, brandy, rum, gin, arrack, etc. (more than 50% alcohol). • The victims of alcoholism are known as alcoholics. Effects of Alcoholism (a) Affects thinking ability, speech, movements, reflexes, etc. (b) Amnesia, blurred vision, loss of body balance, nausea, vomiting, headache, etc. (c) Cirrhosis and fatty liver. (d) Alcoholic polyneuritis and loss of appetite. (e) Cardiovascular diseases and hypertension. (f) Ulcer, pancreatitis and gastritis. (g) Loss of sexual drive and necrospermia. (h) Foetal alcohol syndrome (FAS or Alcohol Embryopathy). (i) Family and social problems. • Effects of Alcoholism on Traffic Accidents (a) Affects co-ordination and correct judgment of distance. (b) Affects vision causing Tunnel vision. (c) Increases reaction time. (d) Affects behaviour. • De-alcoholism • Medical treatment. • Social methods of treatment (Group therapy). • Aversion therapy (Behavioural treatment). Smoking • Tobacco is smoked, chewed or used as a snuff. • Tobacco contains nicotine (an alkaloid) which stimulates the adrenal gland to release adrenaline and nor-adrenaline causing high BP and heart rate. • Smoking causes cancers of lung, urinary bladder and throat, bronchitis, emphysema, coronary heart disease, gastric ulcer, etc. Tobacco chewing causes oral cancer. • Smoking increases CO (Carbon monoxide) content in blood and reduces oxyhaemoglobin. This causes O2 deficiency in the body. Adolescence • It is ‘a period’ and ‘a process’ during which a child becomes mature in terms of his / her attitudes and beliefs for effective participation in society. • Adolescence is a bridge linking childhood and adulthood (period of 12-18 years of age). It is very



Oswaal CBSE LMP (Last Minute Preparation), Class-XII



Key Word Cirrhosis: It is a disease of liver, marked by degen-







































































 













































Dependence • It is the tendency of the body to manifest a characteristic and unpleasant withdrawal syndrome if a regular dose of drugs / alcohol is abruptly discontinued. • This results in anxiety, shakiness, nausea and sweating. • Dependence leads to social adjustment problems. Effects of Drug or Alcohol Abuse (a) Reckless behaviour, vandalism and violence. (b) Coma and death due to respiratory failure, heart failure or cerebral haemorrhage. (c) Drugs together with alcohol may cause death. (d) Drop in academic performance and absence from school. (e) Lack of interest in personal hygiene. (f) Withdrawal and isolation. (g) Depression, fatigue, aggressive and rebellious behaviour, the deteriorating relationship between family and friends. (h) Loss of interest in hobbies. (i) Fluctuations in sleeping, eating habits, weight, appetite, etc. (j) Social problems like stealing and the spread of infectious diseases (e.g., AIDS, hepatitis B). (k) Damage of the nervous system and cirrhosis. (l) Use of drugs and alcohol by pregnant woman adversely affects the foetus. (m) Misuse of drugs by athletes (e.g., narcotic analgesics, anabolic steroids, diuretics and certain hormones to increase muscle strength and bulk and to promote aggressiveness). Side Effects of Anabolic Steroid in Females (a) Masculinisation (b) Mood swings and depression (c) Excessive hair growth (d) Deepening of voice (e) Increased aggressiveness (f) Abnormal menstrual cycle (g) Enlargement of clitoris Side Effects of Anabolic Steroid in Males (a) Acne (b) Mood swings and depression (c) Increased aggressiveness (d) Reduced testicles (e) Decreased sperm (f) Kidney and liver dysfunction (g) Breast enlargement (h) Premature baldness (i) Enlargement of the prostate gland Side Effects in the Adolescent, Male and Female • Severe facial and body acne. • Premature closure of the growth centres of the long bones resulting in stunted growth. Prevention and Control (a) Avoid undue peer pressure. (b) Education and counselling. (c) Seeking help from parents and peers. (d) Looking for danger signs. (e) Seeking professional and medical help. (f) Psychologists and psychiatrists. (g) De-addiction and rehabilitation programs. 



eration of cells.

8

MICROBES IN HUMAN WELFARE

Topic-1

Microbes and their Uses Concepts Covered

 Microbes in Daily Life, household products, Industrial Products Sewage Treatment and Biogas Production

growing microbes in very large vessels called fermentors or bioreactors. 1. Fermented Beverages • Saccharomyces cerevisiae (Brewer’s yeast) is used in the production of beverages by fermenting malted cereals and fruit juices to produce ethanol. • Wine and beer are produced without distillation. • Whisky, Brandy and Rum are produced by distillation of the fermented broth. 2. Antibiotics • The chemical substances produced by some microbes that can kill or inhibit the growth of other disease-causing microbes. • They are used to treat plague, whooping cough, diphtheria, leprosy and many other infectious diseases.

































Microbes in Industrial Products • The large scale production of beverages, antibiotics etc., on an industrial scale, requires







2. Bacterial Fermentation (Anaerobic Respiration) • The dough which is formed by the fermentative activity of bacteria is used to make foods such as dosa, idli, etc. • The puffed-up appearance of dough is due to the production of CO2 gas. • ‘Toddy’ is an alcoholic drink, made by fermenting flower sap from palms by bacteria. • Microbes are used to ferment fish, soyabean and bamboo-shoots to make foods. • Microbes are used to produce cheese, which differ in flavour, taste and texture e.g., Large holes in ‘Swiss cheese’ are due to the production of a large amount of CO2 by Propionibacterium shermanii (a bacterium). • ‘Roquefort cheese’ is ripened by growing a specific fungus (Penicillium roqueforti) on them that gives them a particular flavour. 3. Baker’s Yeast (Saccharomyces cerevisiae): • It is used to make bread by fermenting dough.













Penicillin • First antibiotic discovered by Alexander Fleming in 1929. • He observed that a mould (Penicillium notatum) growing in unwashed culture plates around which Staphylococci could not grow. • He extracted penicillin from it. • Ernst Chain and Howard Florey established its full potential as an effective antibiotic. • Fleming, Chain and Florey were awarded Nobel Prize (1945). 3. Chemicals, enzymes and other bioactive molecules (a) Organic Acids: e.g., • Aspergillus niger (a Scan to know fungus): Citric acid more about • Acetobacter aceti (a this topic bacterium): Acetic acid • Clostridium butylicum (a bacterium): Butyric acid • Lactobacillus (a bacterium): Lactic acid Chemicals, (b) Alcohol: Enzymes and • Yeast (Saccharomyces Organic Acids cerevisiae) is used to produce ethanol. (c) Enzymes: • Lipases: Used in detergent formulations. Help to remove oily stains from the laundry. • Pectinases and Proteases: To clarify bottled juices. • Streptokinase: Produced by Streptococcus. Used as a ‘clot buster’ to remove clots from the blood vessels of patients who have a myocardial infarction.

Microbes in Daily Life • Microbes are the major components of the biological system on the Earth. • They are very minute organisms that cannot be seen with the naked eyes but are viewed under the microscope. • Microbes are present everywhere such as in soil, water, air, inside our body and bodies of animals and plants. • They are also present where no other life-form could exist such as deep inside the geysers (thermal vents) where the temperature may be as high as 100°C, deep in the soil, under the layers of snow, several metres thick and in highly acidic environments. • Microbes are diverse–protozoa, bacteria, fungi and microscopic plants. • Viruses, viroids and also prions are not considered as living entities, even though, they are considered as infectious agents. Microbes in household products. 1. Lactobacillus or Lactic Acid Bacteria (LAB) • It converts milk into curd. • It produces lactic acid that coagulates and partially digests the milk protein casein. • A small amount of curd containing LAB converts fresh milk into curd. • It also increases vitamin B12. • In the stomach, it inhibits the growth of pathogens.



Revision Notes

310

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



BIOLOGY

Biological Oxygen Demand (BOD) • BOD represents the amount of dissolved oxygen required for the complete oxidation of all the organic matter present in one litre of water by bacteria at 20°C. • BOD measures the amount of organic matter present in water by measuring the rate of O2 taken up by microbes. • Higher BOD indicates that the water is highly polluted by organic matter. A lower value of BOD means the water is less polluted or normal. Microbes in Production of Biogas • Biogas is a mixture of inflammable gases (mainly CH4) produced by the microbial activity. • Biogas is used for cooking and lighting. • Methanogens grow anaerobically on cellulosic material and produce CH4 gas e.g., Methanobacterium. • Methanobacterium is found in the anaerobic sludge and rumen of cattle (for cellulose digestion). • The dung of cattle (gobar) is rich in these bacteria. • Dung can be used for the generation of biogas (Gobar gas).























There are more bacteria in a person's mouth than the entire population of the world.





A Biogas plant consists of (a) A concrete tank Scan to know (b) Floating cover more about (c) An outlet this topic • The concrete tank (10-15 feet deep) collects bio-wastes and slurry of dung. • A floating cover is placed over the slurry, which keeps on rising as Biogas Plant the biogas is produced. • There is an outlet which is connected to a pipe to supply biogas to nearby houses. • Used slurry is removed through another outlet and can be used as a fertilizer. • Indian Agricultural Research Institute (IARI), Khadi and Village Industries Commission (KVIC) developed the technology of biogas production in India.





























Key Fact



























(d) Cyclosporin A: • It is produced by Trichoderma polysporum (fungus). • It is used as an immunosuppressive agent in organ-transplant patients. (e) Statins: • It is produced by Monascus purpureus (an yeast). • It is used as a blood-cholesterol lowering agent. • It inhibits the enzymes responsible for the synthesis of cholesterol. Microbes in Sewage Treatment • Sewage (municipal waste-water) contains a large amount of human excreta, Scan to know organic matter and microbes. more about • Sewage is treated in Sewage this topic Treatment Plants (STPs) to make it less polluting. It includes stages namely: primary treatment and secondary treatment. (a) Primary Treatment Sewage • It is a physical treatment. Primary Treatment • It involves the physical removal of large and small particles from sewage. It includes:  Removal of floating debris by sequential filtration.  Removal of the grit (soil and pebbles) by sedimentation.  All solids that settle form the primary sludge and the supernatant forms the primary effluent.  The effluent is taken for secondary treatments. (b) Secondary treatment (Biological treatment) • Primary effluent is passed into large aeration tanks Scan to know more about and constantly agitated. this topic • This allows vigorous growth of useful aerobic microbes into flocs (masses of bacteria associated with fungal filaments to form Secondary mesh-like structures). Sewage • These microbes consume Treatment the major part of the organic matter in the effluent. • This reduces the BOD (Biochemical Oxygen Demand) of the effluent. • The effluent is then passed into a settling tank where the bacterial ‘flocs’ are allowed to sediment. This sediment is called ‘activated sludge’. • A small part of the activated sludge is pumped back into the aeration tank to serve as the inoculum. • The remaining major part of the sludge is pumped into large tanks called anaerobic sludge digesters. • Here, some anaerobic bacteria digest the bacteria and fungi in the sludge by producing gases like CH4, H2S and CO2. These gases form the biogas. • The effluent from the secondary treatment plant is released into natural water bodies like rivers and streams. • The Ministry of Environment and Forests has initiated the Ganga Action Plan and Yamuna Action Plan to save rivers from water pollution.

311

Fig. 8.1 A Biogas plant

312

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Mnemonics 1. Concept: Organic acid bacteria Mnemonic: All Answers Clearly Labelled Interpretations: Aspergillus niger, Acetobacter aceti, Clostridium butylicum, Lactobacillus.

Topic-2

Microbes as Biocontrol Agents and Bio-Fertilisers Concepts Covered



Microbes as biocontrol agents, biofertilisers.

































IPM program to conserve beneficial insects. Microbes as Biofertilisers • Biofertilizers are the micro-organisms that enrich the nutrient quality of the soil. e.g., Bacteria, fungi, cyanobacteria etc. Rhizobium • It is a symbiotic bacteria found in root nodules of leguminous plants that fixes atmospheric N2. • Free-living bacteria in the soil such as Azospirillum and Azotobacter enrich the nitrogen content of the soil. Mycorrhiza • It is a symbiotic association of fungi (e.g., the genus of Glomus) with the roots of higher plants. • The fungus gets food for the plant. • The fungal symbiont help to absorb phosphorus from soil and passes it to the plant, give resistance to root-borne pathogens, tolerance to salinity and drought and also gives an overall increase in plant growth and development. Cyanobacteria (Blue-green algae): • They are autotrophic microbes that fixes atmospheric nitrogen e.g., Anabaena, Nostoc, Oscillatoria, etc. • In paddy fields, Cyanobacteria serve as an important biofertilizers. • It also adds organic matter to the soil and increases its fertility.

Biocontrol • It is the application of biological methods for controlling plant diseases and pests. Chemical Pesticides and Insecticides • These are toxic and harmful to all organisms including human beings and cause pollution. • Chemical pesticides kills both useful and harmful life forms. • Weedicides used to eliminate weeds cause soil pollution. Microbial biocontrol agents (a) Bacillus thuringiensis (Bt): • This is to control the butterfly caterpillar. These are available in sachets as dried spores which are mixed with water and sprayed on vulnerable plants such as Brassica and fruit trees, where these are eaten by the insect larvae. In the gut of the larvae, the toxin is released and the larvae get killed. Scientists have introduced B. thuringiensis toxin genes into plants e.g., Bt cotton. (b) Trichoderma sp. (Fungus): • These are free livings species that are seen in the root ecosystem. They are effective biocontrol agents of several plant pathogens. (c) Baculoviruses (Especially genus Nucleopolyhedrovirus): • It attacks insects and other arthropods. These are suitable for species-specific, narrow spectrum insecticidal applications. This is desirable in the



Revision Notes

Mnemonics 1. Concept: Microbial Biocontrol agents Mnemonic: Back To Back Interpretation: Bacillus thuringiensis, Trichoderma sp., Baculoviruses. 2. Concept: Free living bacteria Mnemonic: Almond's Apple Interpretation: Azospirillum, Azotobacter qqq

UNIT-IX: BIOTECHNOLOGY AND ITS APPLICATIONS

9

BIOTECHNOLOGY: PRINCIPLES AND PROCESSES

Topic-1

Principles of Biotechnology and Tools of Recombinant DNA Technology Concepts Covered DNA technology.



Biotechnology, Principles of Biotechnology, Tools of Recombinant

























































• Stanley Cohen and Herbert Boyer (1972) constructed the first recombinant DNA. They isolated the antibiotic resistance gene by cutting out a piece of DNA from a plasmid. Steps in Genetically Modifying an Organism • There are three basic steps in genetically modifying an organism: (a) Identification of DNA with desirable genes. (b) Introduction of the identified DNA into the host. (c) Maintenance of introduced DNA in the host and transfer of the DNA to its progeny. Tools of Recombinant DNA technology 1. Restriction Enzymes (‘molecular scissors’) • The restriction enzymes are called molecular scissors and are responsible Scan to know for cutting DNA. more about • In 1963, two enzymes this topic responsible for restricting the growth of bacteriophage in E. coli were isolated. One of these added methyl groups to DNA. The other (restriction Restriction Enzymes endonuclease) cut DNA. • The first restriction endonuclease is Hind II. Isolated by Smith, Wilcox and Kelley (1968) from Haemophilus influenzae bacterium. It always cuts DNA molecules at a particular point by recognizing a specific sequence of six base pairs. This is known as the recognition sequence for Hind II. • Today more than 900 restriction enzymes have been isolated from over 230 strains of bacteria. Naming of the restriction enzymes • First letter indicates genus and the second two letters indicate species of the prokaryotic cell from which they were isolated e.g., EcoRI comes from E. coli RY 13, where R = the strain, Roman numbers = the order in which the enzymes were isolated from that strain of bacteria. • Restriction enzymes belong to a class of enzymes called nucleases. • The nucleases include exonucleases and endonucleases. (i) Exonucleases • They remove nucleotides from the ends of the DNA.

Introduction • Biotechnology deals with the techniques of using live organisms or their enzymes for products and processes useful to humans. • The term biotechnology was given by Karl Ereky (1919). • The European Federation of Biotechnology (EFB) defines Biotechnology as ‘the integration of natural science and organisms, cells, parts thereof, and molecular analogues for products and services’. Biotechnology deals with: • Microbe-mediated processes (making curd, bread, wine, etc.) • In vitro fertilisation (‘test-tube’ baby programme). • Synthesis and using of a gene. • Preparation of a DNA vaccine. • Correcting a defective gene. Principles of Biotechnology • The two core techniques of modern biotechnology are: (a) Genetic engineering: The technique in which the genetic material (DNA and RNA) is chemically altered and introduced into host organisms to change the phenotype is known as genetic engineering. (b) Maintenance of sterile ambience: It is necessary for chemical engineering processes to grow only the desired microbe / eukaryotic cell in large quantities for the manufacture of antibiotics, vaccines, enzymes, etc. • Traditional hybridisation techniques lead to the inclusion and multiplication of undesirable genes along with desired genes. • Genetic engineering helps to isolate and introduce only desirable genes into the target organism. • A piece of DNA is not only able to multiply itself in the progeny cells of the organism, but, when it gets integrated into the recipient genome, it multiplies and inherits along with the host DNA. • First recombinant DNA was emerged from the possibility of linking a gene of antibiotic resistance with a native plasmid of Salmonella typhimurium. The plasmid is an autonomously replicating circular extra-chromosomal DNA.



Revision Notes

314

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



BIOLOGY

(ii) Endonucleases • They cut at specific positions within the DNA. • Each restriction endonuclease can bind to a specific recognition sequence of the DNA and cut each of the two strands at specific points in their sugar-phosphate backbones. • Each restriction endonuclease recognizes a specific palindromic nucleotide sequence in the DNA. • The palindrome in DNA is a sequence of base pairs that read the same on the two strands in the 5’ → 3’ direction and in 3’ → 5’ direction. e.g., 5’  GAATTC  3’ 3’  CTTAAG  5’ • Restriction enzymes cut the strand a little away from the centre of the palindrome sites but between the same two bases on the opposite strands. This leaves single-stranded overhanging stretches at the ends. They are called sticky ends. • They form H-bonds with their complementary cut counterparts. This stickiness facilitates the action of the enzyme DNA ligase. • When cut by the same restriction enzyme, the resultant DNA fragments have the same kind of sticky-ends and these are joined together by the enzyme DNA ligases.

315





Key Fact













b



Features of cloning vector: (a) Origin of replication (ori) • This is a DNA sequence from where replication starts. A piece of DNA linked to ori site can replicate within the host cells. This also controls the copy number of the linked DNA. So, to get many copies of the target DNA, it should be cloned in a vector whose origin support high copy number. (b) Selectable marker (marker gene) • It helps to select the transformants and eliminate the non-transformants. • Transformation is a procedure in which a piece of DNA is introduced in a host bacterium. • Selectable markers of E. coli include the genes encoding resistance to antibiotics like ampicillin, chloramphenicol, tetracycline or kanamycin, etc. • The normal E. coli cells do not carry resistance against any of these antibiotics. (c) Cloning sites • To link the alien DNA, the vector needs very few recognition sites for restriction enzymes. • Presence of more than one recognition site generates several fragments, which complicates the gene cloning. • The ligation of alien DNA is carried out at a restriction site present in one of the two antibiotic resistance genes. e.g., ligation of a foreign DNA at the BamHI site of the tetracycline resistance gene in the vector pBR322. • The recombinant plasmids lose tetracycline resistance due to insertion of foreign DNA. But, they can be selected out from nonrecombinant ones by plating the transformants on ampicillin containing medium. • Then, these transformants are transferred to a tetracycline medium. • The recombinants grow in ampicillin medium but not on tetracycline medium. But, nonrecombinants will grow on the medium containing both the antibiotics. • In this case, one antibiotic resistance gene helps to select the transformants, whereas the other antibiotic resistance gene gets inactivated due to the insertion of alien DNA and helps in the selection of recombinants. • Selection of recombinants due to the inactivation of antibiotics requires simultaneous plating on two plates having different antibiotics. • Therefore, alternative selectable markers have developed to differentiate recombinants from non-recombinants based on their ability to produce colour in the presence of a chromogenic substrate. • A recombinant DNA is inserted within the coding sequence of an enzyme, -galactosidase. So, the enzyme is inactivated. It is called insertional inactivation. Such colonies do not produce any colour. These are identified as recombinant colonies.























Separation and isolation of DNA fragments: • DNA fragments formed by restriction endonuclease can be separated by a technique called Gel electrophoresis. • DNA fragments are negatively charged. So, they can be separated by moving them towards the anode under the influence of an electric field through a medium / matrix such as agarose (which is a natural polymer of D-galactose and 3, 6 anhydro L-galactose and is extracted from sea weeds). • The DNA fragments separate (resolve) according to their size through the sieving effect provided by the agarose gel. • The smaller sized fragments move farther. • The separated DNA fragments can be visualized after staining the DNA with ethidium bromide followed by exposure to UV radiation. Bright orange coloured DNA bands can be seen. • The separated DNA bands are cut out from agarose gel and extracted from the gel piece. This step is called elution. • These purified DNA fragments are used in constructing recombinant DNA by joining them with cloning vectors. 2. Cloning Vectors • These are the DNA molecules that can carry a foreign DNA segment and replicate inside the host cells e.g., plasmids (circular extra-chromosomal DNA of bacteria) and bacteriophages. • Bacteriophages (high number per cell) have very high copy numbers of their genome within the bacterial cells. • Some plasmids have only 1-2 copies per cell. Others may have 15-100 copies per cell. • When the cloning vectors are multiplied in the host the linked piece of DNA is also multiplied to the numbers equal to the copy number of the vectors.

















Humans shares about 98% of their genes with chimpanzees, 92% with mice, 18% with (E. coli) bacteria.

316

Oswaal CBSE LMP (Last Minute Preparation), Class-XII





























Topic-2

• DNA is a hydrophilic molecule. So it cannot pass through cell membranes. • To avoid this problem, bacterial cells are treated with a specific concentration of a divalent cations (e.g., calcium), so as to increase the pore size in the cell wall. • So, DNA enters the bacterium through pores in the cell wall. Such cells are incubated with recombinant DNA on ice. • They are then placed briefly at 42°C (heat shock) and then put them back on ice. This enables the bacteria to take up the recombinant DNA. Other methods to introduce alien DNA into host cells: (a) Micro-injection: In this, recombinant DNA is directly injected into the nucleus of an animal cell. (b) Biolistics (gene gun) method: In this, cells are bombarded with high-velocity micro-particles of gold or tungsten coated with DNA. This method is suitable for plants. (c) ‘Disarmed pathogen’ vectors: These vectors, when infect the cell, transfer the recombinant DNA into the host.



• If the plasmid in bacteria do not have any insert it gives blue coloured colonies in presence of chromogenic substrate. (d) Vectors for cloning genes in plants and animals • Genetic tools of some pathogens can be transformed into useful vectors for delivering genes to plants and animals. e.g., Agrobacterium tumefaciens (a pathogen of many dicot plants) can deliver a piece of DNA (T-DNA) to transform normal plant cells into a tumor. • These tumor cells produce the chemicals required by the pathogen. • The tumor-inducing (Ti) plasmid of A. tumefaciens is modified into a cloning vector which is not pathogenic to the plants but can use the mechanisms to deliver genes of interest into plants. • Retroviruses in animals can transform normal cells into cancerous cells. So, they are used to deliver desirable genes into animal cells. 3. Competent Host (For Transformation with Recombinant DNA) • Competent cells are capable of uptaking DNA from the surrounding. For the process of transformation, bacterial cells are made competent, so that DNA can enter the cells.

Process of Recombinant DNA Technology Concepts Covered



Processes of rDNA technology  Bioreactors























• After cutting the source DNA and the vector DNA, the cutout gene (DNA segment) of interest from the source DNA and the cut vector are mixed and ligase is added. • This creates recombinant DNA. Amplification of Gene of Interest Using PCR • Polymerase Chain Reaction (PCR) is the synthesis of multiple copies of the gene of Scan to know interest in vitro using two sets of more about this topic primers and the enzyme DNA polymerase. • The technique was developed by Kary Mullis in 1985 and for this, he was awarded the Nobel Polymerase Chain Prize in 1993. Reaction • DNA polymerase enzyme joins the nucleotides • Most commonly enzyme is Taq polymerase Insertion of Recombinant DNA into the Host Cell / organism • There are several methods of introducing the ligated DNA into recipient cells. • Recipient cells take up DNA present in its surrounding. • If a recombinant DNA bearing ampicillin resistant gene (a selectable marker gene) is transferred into E. coli cells, the host cells become ampicillinresistant cells.

Isolation of the Genetic Material (DNA) • To get pure DNA (free from other macromolecules), the bacterial cells / plant or animal tissue are treated with enzymes such as lysozyme (bacteria), cellulase (plant cells), chitinase (fungus), etc. • The cell is broken to release DNA along with other macromolecules (RNA, proteins, polysaccharides and lipids). • Genes (DNA) are interwined with proteins such as histones. • RNA is removed by treating with ribonuclease. • Proteins are removed by treatment with protease. • Other molecules are removed by appropriate treatments. • When chilled ethanol is added, purified DNA precipitates out as a collection of fine threads in the suspension. Cutting of DNA at Specific Locations • Restriction enzyme digestions are performed by incubating purified DNA with the restriction enzyme, at the optimal conditions. Isolation of derived DNA fragments. • Agarose gel electrophoresis is employed to check the progression of a restriction enzyme digestion. As DNA is negatively charged, it moves towards the anode. The process is repeated with the vector DNA also.



Revision Notes



BIOLOGY



































• Such formulation undergoes through clinical trials as in the case of drugs. • Strict quality control testing for each product is also required. • The downstream processing and quality control testing vary from product to product. Bioreactors • To produce large quantities of products, the bioreactors are used where large volumes (1001000 litres) of culture can be processed. • Bioreactors are the vessels in which raw materials are biologically converted into specific products, enzymes etc., using microbial plant, animal or human cells. • A bioreactor provides the optimal growth conditions (temperature, pH, substrate, salts, vitamins, oxygen) for achieving the desired product. • There are two types of bioreactors namely, (a) Simple stirred-tank bioreactor (b) Sparged stirred-tank bioreactor • The most commonly used bioreactors are of stirring type. • The bioreactor has (a) An agitator system. (b) An oxygen delivery system. (c) A foam control system. (d) A temperature control system. (e) pH control system. (f) Sampling ports (for periodic withdrawal of the culture). (g) The contents are mixed by stirrer. This makes the oxygen available throughout the bioreactor.



























• If the transformed cells are spread on agar plates containing ampicillin, only transformants will grow, non transformed recipient cells will die. Obtaining the Foreign Gene Product • The ultimate aim of recombinant DNA technology is to produce a desirable protein. • The foreign gene gets expressed under appropriate conditions. • If a protein-encoding gene is expressed in a heterologous host, it is called a recombinant protein. • The cells with foreign genes may be grown on a small scale in the laboratory. • The cultures may be used to extract the desired protein and purified using different separation techniques. • The cells can also be multiplied on large scale in a continuous culture system. • Here, the used medium is drained out from one side while the fresh medium is added from the other side. • It maintains the cells more physiologically active and so produces a larger biomass leading to higher yields of the desired protein. Downstream Processing: All the processes to which the product is subjected to before being marketed as a final and finished product are called as downstream processing. • It includes a series of processes such as separation and purification of products after the biosynthetic stage. • The product is formulated with suitable preservatives.

317

qqq

10 

BIOTECHNOLOGY AND ITS APPLICATIONS

Topic-1

Applications of Biotechnology in Agriculture and Medicine Concepts Covered Molecular diagnosis.



Applications of Biotechnology, Stem cell technology, Gene therapy,









































































• It reduces the need for Scan to know more about insecticides e.g., Bt cotton, this topic Bt corn, rice, tomato, potato, soyabean, etc. Bt Cotton • Some strains of Bacillus thuringiensis produce Genetically proteins that kill insects Crops like coleopterans (beetles), Modified Bt toxin lepidopterans (tobacco, budworm, armyworm) and dipterans (flies, mosquitoes). • B. thuringiensis forms a toxic insecticidal protein (Bt toxin) crystal during a particular phase of their growth. It does not kill the Bacillus as it exists as inactive protoxins. • When an insect ingests the inactive toxin, it is converted into an active toxin due to the alkaline pH of the gut which solubilises the crystals. • The toxin binds to the surface of midgut epithelial cells and create pores. • It causes cells to swell and undergo lysis and ultimately leading to the death of the insect. • Bt toxin genes were isolated from B. thuringiensis and incorporated into crop plants such as cotton. • Most Bt toxins are insect-group specific. • The toxin is coded by a gene named cry e.g., the proteins encoded by the genes cryIAc and cryIIAb control the cotton bollworms and that of cryI Ab controls corn borer. Genetically Engineered Insulin • The management of adult-onset diabetes is possible by taking insulin at regular time intervals. • Now, it is possible to produce human insulin using bacteria. Scan to know • Insulin from the pancreas of more about this topic animals (cattle and pigs) causes allergy or other types of reactions to the foreign protein. • Insulin consists of two short polypeptide chains (chain A and chain B) that are linked together Genetically Engineered by disulphide bridges. Insulin • In mammals, insulin is synthesized as a pro-hormone. • The pro-hormone needs processing before it becomes a fully mature and functional hormone. • The pro-hormone contains an extra stretch called the C peptide. • This is removed during maturation into insulin. • In 1983, Eli Lilly an American company prepared two DNA sequences corresponding to A and B

Applications of Biotechnology • Biotechnology essentially deals with industrialscale production of biopharmaceuticals using genetically modified microbes, fungi, plants and animals. • The applications of biotechnology include therapeutics, diagnostics, and genetically modified crops for agriculture, processed food, bioremediation, waste treatment and energy production. • Three critical research areas of biotechnology are: (a) Providing the best catalyst in the form of an improved organism usually a microbe or pure enzyme. (b) Creating optimal conditions through engineering for a catalyst to act. (c) Downstream processing technologies to purify the protein / organic compound. Biotechnological Applications in Agriculture : • Three options for increasing food production are are : (a) Agro-chemical based agriculture. (b) Organic agriculture. (c) Genetically engineered crop-based agriculture. • The Green Revolution succeeded in tripling the food supply. • Increased yields have partly been due to the use of improved crop varieties, but mainly due to the use of better management practices and use of agrochemicals (fertilisers and pesticides). • Genetically Modified Organisms (GMO) or transgenic organisms are the plants, bacteria, fungi and animals whose genes are altered by manipulation. Advantages of Genetic Modification in Plants (a) It makes crops more tolerant to abiotic stresses (cold, drought, salt, heat, etc). (b) It helps to reduce post-harvest losses. (c) It increases the efficiency of mineral usage by plants (this prevents early exhaustion of fertility of soil). (d) It enhances the nutritional value of food e.g., Vitamin ‘A’ enriched rice. (e) GM is used to create tailor-made plants to supply alternative resources to industries in the form of starch, fuels and pharmaceuticals. Pest Resistant Plants • Pest Resistant Plants reduce the use of chemical pesticide.



Revision Notes



BIOLOGY

319

320





















Vaccine production: Vaccines are the substances which protect the human body from various diseases by recognizing and destroying the harmful foreign pathogens. A dead or weakened microbe is used to produce the vaccine. Generally, there are four types of vaccines which include: 1. Live attenuated vaccine: This type of vaccine contains weakened form of viruses. e.g., Rubella, Measles, Mumps etc. 2. Inactivated vaccines: These vaccines are made from small pieces of virus or bacteria or from their proteins. e.g., The whooping cough vaccine. 3. Toxoid vaccines: These vaccines contain the toxin produced by the bacteria or virus. e.g., Tetanus and diphtheria vaccine. 4. Biosynthetic vaccines: These are the man-made vaccines which are produced from the substances or chemicals similar to the pieces of virus or

Mnemonics











Concept: Achievement through transgenic crops or GM crops. Mnemonic: Proper Package of Muscular body : Hardwork Can Transform Interpretations: Achievements of : Example Protein of interest : Hirudin Production of desired genotype : Cry protein (Crystal protein) Modification of existing : Transgenic rice (higher content of vitamin A) Biosynthetic pathway







Non-malignant diseases : In this case, tumors may grow larger but do not spread to other parts of the body.





Key Word

bacteria. e.g., Hepatitis-B. Gene Therapy : • It is a method to correct a gene defect diagnosed in a child / embryo. • Here, genes are inserted into a person’s cells and tissues to treat a hereditary disease. • It compensates for the non-functional gene. • First clinical gene therapy was given in 1990 to a four year old girl with adenosine deaminase (ADA) deficiency. • This disorder is caused due to the deletion of the gene for Adenosine deaminase (the enzyme crucial for the immune system to function). • This can be cured by bone marrow transplantation or by enzyme replacement therapy (injection of functional ADA) but these approaches are not completely curative. • In gene therapy, lymphocytes from the patient’s blood are grown in a culture. • Then, a functional ADA cDNA (using a retroviral vector) is introduced into these lymphocytes. • They are then returned to the patient. • This should be periodically repeated as these cells are not immortal. • However, if the ADA gene (from bone marrow cells) is introduced into cells at the early embryonic stages, it could be a permanent cure. Molecular Diagnosis • Recombinant DNA technology, PCR and Enzyme Linked Immunosorbent Assay (ELISA) are some techniques for early diagnosis. • The presence of a pathogen is normally suspected only when the pathogen has produced a symptom. • By this time, the concentration of the pathogen will be already very high in the body. • However, a very low concentration of a bacteria or virus can be detected by amplification of their nucleic acid by PCR. • PCR is used to detect HIV in suspected AIDS patients. • It is also used to detect mutations in genes in suspected cancer patients. • It is a powerful technique to identify many other genetic disorders. • A single-stranded DNA or RNA, tagged with a radioactive molecule (probe) is allowed to hybridise to its complementary DNA in a clone of cells followed by detection using autoradiography. • The clone having the mutated gene will hence not appear on the photographic film, because the probe will not have complementarity with the mutated gene. • ELISA is based on the principle of antigenantibody interaction. • Infection by pathogen can be detected by the presence of antigens (proteins, glycoproteins, etc.) or by detecting the antibodies synthesized against the pathogen.











chains of human insulin and introduced them in plasmids of E. coli to produce insulin chains. • The chains A and B were produced separately, extracted and combined by creating disulfide bonds to form human insulin. Stem Cell Technology : • Stem cells are undifferentiated or “blank” cells. • They are special human cells which are capable to develop into many different cell types. • This can range from muscle cells to brain cells. In some cases, they can also fix damage tissues. • Stem cells can be obtained from an embryo, or by using a specialized body cells (developed by a technique) which behave like embryonic stem cells. These cells are known as induced pluripotent stem cells (IPS cells). • They are used in treating several clinical problems like : (i) Tissue regeneration. (ii) Damaged myocardium after heart infarction. (iii) Brain after stroke. (iv) Spinal cord after mechanical injury. • Advantages of stem cells technology : Stem cell technology is a rapidly developing field that combines the efforts of cell biologists, geneticists, and clinicians and offers hope of effective treatment for a variety of malignant and non-malignant diseases. The regenerative property of stem cell can be used in replacing any organ which is not working or damaged. It can help in studying human growth and cell development. It can be used to test the effects of medicinal drugs and medicine without the use of animals.



Oswaal CBSE LMP (Last Minute Preparation), Class-XII



BIOLOGY

Transgenic Animals and Bioethical Issues Concepts Covered

 

Topic-2

321

Transgenic animals, advantages of transgenic animals, Ethical issues.











(a) Certain companies have got patents for products and technologies that make use of the genetic materials, plants etc. that have been identified, developed and used by farmers and indigenous people of a specific country. (b) E.g., Basmati rice, herbal medicines like turmeric, neem, etc. (c) Basmati rice has unique aroma and flavour. (d) India has 27 varieties of Basmati. (e) In 1997, an American company got patent rights on Basmati rice through the US Patent and Trademark Office. (f) This allowed the company to sell a ‘new’ variety of Basmati which had actually been derived from Indian farmer’s varieties. (g) Indian Basmati was crossed with semi-dwarf varieties and claimed as a novelty. (h) Other people selling Basmati rice could be restricted by the patent. • Biopiracy : (a) It is the use of bio-resources by multinational companies and other organizations without proper authorization from the countries and people concerned. (b) Most of the industrialized nations are poor in biodiversity and traditional knowledge. (c) The developing and the underdeveloped world have rich biodiversity and traditional knowledge related to bio-resources. (d) It has to develop laws to prevent unauthorized exploitation of bio-resources and traditional knowledge. (e) Indian Parliament has cleared the second amendment of the Indian Patents Bill that takes such issues into consideration, including patent terms, emergency provisions and research and development initiative.









































• Problems of patent

















Key Fact Mice have been genetically modified to naturally produce human antibodies for use as therapeutics. Seven out of the eleven monoclonal antibody drugs approved by the FDA between 2006 and 2011 were derived from transgenic mice.











Advantages or Benefits of Transgenic Animals • To study normal physiology and development : (a) Transgenic animals are used to study how genes are regulated and how they affect the normal body functions and their development. (b) For example study of complex factors such as insulin-like growth factor. Genes (from other species) that alter the formation of this factor are introduced and the biological effects are studied. This gives information about the biological role of the factor in the body. • To Study the contribution of genes in the development of a disease : (a) Transgenic models help for the investigation of new treatments for human diseases. (b) For example: transgenic models for many human diseases such as Cancer, Cystic Fibrosis, Rheumatoid arthritis and Alzheimer’s disease. • Vaccine safety testing : Transgenic mice are being developed and used in testing the safety of vaccines before they are used for humans. The polio vaccine was tested in mice. • Chemical safety testing (toxicity testing) : Transgenic animals are made to know the effect of toxic chemicals. This is also known as toxicity / safety testing.

Ethical Issues • Problem of unpredictable results (a) Genetic modification may cause unpredictable results when such organisms are introduced into the ecosystem. (b) Therefore, Indian Government has set up organizations like GEAC (Genetic Engineering Approval Committee), which makes decisions about the validity of GM research and the safety of GM-organisms for public services.



Transgenic Animals • These are the animals whose genome has been altered by the introduction Scan to know more about of an extra (foreign) gene by this topic manipulation. e.g., Transgenic rats, rabbits, pigs, sheep, cows and fish. • Over 95% of all existing Transgenic transgenic animals are mice. Animals



Revision Notes

qqq

UNIT-X: ECOLOGY AND ENVIRONMENT

11

ORGANISMS AND POPULATIONS



(i) Exponential Growth : This kind of growth occurs when food and space Scan to know are available in a sufficient more about this topic amount. The population grows exponentially or geometrically. If the size of a population is N, the birth rate is represented as ‘b’ and death rate as ‘d’, then increase and decrease in N Logistic Growth during a unit period time ‘t’ will Model be dN/dt = (b – d) x N Let, (b – d) = r. Then, dN/dt = rN The r in this equation is called ‘intrinsic rate of natural increase. (ii) Logistic Growth : There is a competition between the individuals of a population for food and space. The ‘fittest’ organism survives and reproduces. This type of growth initially shows a lag phase followed by phases of acceleration and de-acceleration. K indicates the carrying capacity of the population. æK-Nö dN/dt = rN ç ÷ è K ø



l l

 





l



2.

Addition of new individuals due to birth, hatching, germination or division.

Number of individuals in a population decreases with the death of the individuals. Population density and its size is decreased by death rate.

Natality shows the number of offsprings produced per unit time per unit population. Growth model : Growth of population takes place according to the availability of food, habitat condition and presence of other biotic and abiotic factors. There are two main types of models :

 









   













Mortality Rate



Natality Rate



S. No. 1.

Where, N= Population density at time t r= Intrinsic rate of natural increase k= Carrying capacity Population interaction : All animals, plants and microbes in a biological community interact with each other. These interactions may be beneficial, detrimental or neutral to one species or both. The following types of interactions are seen : (a) Predation : It is the interaction between two species members in which the members of one species capture, kill and eat up the members of other species. (b) Parasitism : It is the relationship between two living organisms of different species in which one organism called a parasite obtains its food directly from another living organism called the host. (c) Proto-cooperation- : It is the interaction between two living organisms of different species in which both are mutually benefitted but they can live without each other. (d) Competition : It is the rivalry between two or more organisms for obtaining the same resources. (e) Mutualism : It is the interaction between two organisms of different species where both the partners are benefitted but cannot live separately.















     





l











l l l



Characteristics of a Population Population : A population is defined as a group of individuals of the same species that live in a particular geographical area at a particular time and functioning as a unit. A population has certain attributes that an individual organism does not have. For example, individuals may have births and deaths, but a population has birth rates and death rates. The birth and death rates are referred to as per capita births or deaths respectively, which increases and decreases with respect to members of the population. Sex ratio is another attribute of the population. An individual may be male or Scan to know female but the population has a more about this topic sex ratio. A population at a given time is composed of different individuals of different ages. If the age distribution is plotted for the population, the resulting Exponential structure is called age pyramids. Growth Model The shape of pyramids reflects the shape of the growth status of a population. Population size or population density (N) is measured in terms of number. Population Growth : The size of the population is not static. It keeps changing with time, depending upon food availability, predation, and adverse weather condition. The main factors that determine population growth are : (i) Natality (number of births) [B] (ii) Mortality (number of deaths) [D] (iii) Immigration (individuals that come into habitat) [I] (iv) Emigration (individual that leaves the habitat) [E] If ‘N’ is population density at time ‘t’, then its density at t +1 is N(t + 1) = Nt + [(B + I) – (D + E)] Differences between Natality Rate and Mortality Rate :



Revision Notes

Mnemonics Concept: Population Density at time t + 1 Mnemonic: Never try Before I Dare to Exit Interpretation: Nt+1 = Nt + [(B + I) – (D + E)]



BIOLOGY

323

12 

ECOSYSTEM Patterns, Components, Productivity and Decomposition

Topic-1

Concepts Covered

tivity and decomposition.



Ecosystem, Types of ecosystem, component of ecosystem, produc-





















l











  



  









  

















l

















(ii) Environmental factors. (iii) Availability of nutrients. (iv) Photosynthetic capacity of plants. Therefore, it varies in different types of ecosystems. (e) The annual net primary productivity of the whole biosphere is approximately 170 billion tons (dry weight) of organic matter. (f) Of this, despite occupying about 70% of the surface, the productivity of the oceans is only 55 billion tons. The rest of course is on land. Secondary Productivity It is the rate of formation of new organic matter by consumers. Scan to know more about Decomposition this topic (a) It is the breakdown of complex organic matter by decomposers into inorganic substances like carbon dioxide, water and nutrients. Decomposition (b) It is largely an oxygen-requiring process.



l l



(iii) Energy flow (iv) Nutrient cycling Example : Pond - Aquatic Ecosystem (a) A pond is a shallow, simple, self-sustainable water body that exhibits all basic components of an ecosystem. (b) Abiotic components in pond : Water and the soil which is deposited at the bottom. (c) Climatic conditions : The solar input, the cycle of temperature, day-length, etc. (d) Autotrophic components : Phytoplankton, some algae and the floating, submerged and marginal plants.

(e) Consumers (heterotrophs) : Zooplankton, free swimming and bottom-dwelling forms. Scan to know (f) Decomposers : Fungi, more about bacteria and flagellates. this topic Productivity (a) A constant input of solar energy is the basic requirement for any ecosystem to function Ecosystem and sustain. (b) The rate of biomass production Introduction and Productivity is called productivity.

(c) The productivity is expressed in terms of g–2yr–1 or (kcal m–2) yr–1. (d) It can be divided into gross primary productivity (GPP) and net primary productivity (NPP). Primary Productivity (a) The amount of biomass or organic matter produced per unit area over a time period by plants during photosynthesis is called primary production. (b) The primary production is expressed in terms of weight (g–2) or energy (kcal m–2). Gross Primary Productivity (a) It is the rate of production of organic matter during photosynthesis. (b) A considerable amount of GPP is utilized by plants in respiration. (c) Gross primary productivity minus respiration losses (R) is the net primary productivity (NPP), i.e., NPP is the available biomass for the consumption of heterotrophs (herbivores and decomposers). NPP = GPP – R (d) Primary productivity depends on (i) The plant species inhabiting a particular area.



Introduction An ecosystem is a functional unit of nature, where living organisms interact among themselves and also with the surrounding physical environment. The entire biosphere can be regarded as a global ecosystem. Types of Ecosystems (a) Terrestrial ecosystem : Forest, grassland, desert, etc. (b) Aquatic ecosystem : Pond, lake, wetland, river, estuary and ocean. (c) Man-made ecosystem : Crop fields and aquarium. Ecosystem : Structure and Function An ecosystem, consists of biotic and abiotic components. These components function as a unit. Unidirectional flow of energy takes place within these components of an ecosystem. Vertical distribution of different species occupying different levels is called stratification. e.g., trees occupy top vertical strata (layer) of a forest, shrubs the second and herbs and grasses occupy the bottom layers. Components of Ecosystem There are four main functions of ecosystem : (i) Productivity (ii) Decomposition l



Revision Notes



BIOLOGY

325

326

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

















 

Mnemonics





degradation of humus by some microbes. Factors Influencing Decomposition The rate of decomposition is controlled by the chemical composition of detritus and climatic factors. (a) Chemical composition of detritus : Decomposition rate is slower if detritus is rich in lignin and chitin and quicker, if detritus is rich in nitrogen and water-soluble substances like sugars. (b) Climatic factors like temperature and soil moisture : – Temperature and soil moisture are the most important climatic factors that regulate decomposition through their effects on the activities of soil microbes. – Warm and moist environment favours decomposition whereas low temperature and anaerobic conditions inhibits decomposition resulting in the build up of organic materials.























(c) Detritus (dead plant remains such as leaves, bark, flowers and dead remains of animals, including faecal matter) is the raw material for decomposition. Steps in decomposition The important steps in the process of decomposition are fragmentation, leaching, catabolism, humification and mineralisation. (a) Fragmentation It is the breakdown of detritus into smaller particles by detritivores (e.g., Earthworm). (b) Leaching In this process, water-soluble inorganic nutrients go down into the soil horizon and get precipitated as unavailable salts. (c) Catabolism (i) Here, the degradation of detritus into simpler inorganic substances takes place by bacterial and fungal enzymes. (ii) Fragmentation, leaching and catabolism operate simultaneously on the detritus. (d) Humification (i) It is the accumulation of humus (dark amorphous substance) in soil. (ii) Humus is resistant to microbial action and so decomposes very slowly. (iii) Being colloidal, it serves as a reservoir of nutrients. (e) Mineralization It is the release of inorganic nutrients due to the









Concept : Steps in decomposition Mnemonics : Fly Like Crane with High Moral Interpretations : Fragmentation, Leaching, Catabolism, Humification, Mineralization

Energy Flow and Ecological Pyramids Concepts Covered

 Energy flow in an ecosytem, Ecological pyramids- Pyramid of number, Pyramid of biomass and Pyramid of energy. 

Topic-2























• In a terrestrial ecosystem, major producers are herbaceous and woody plants. • Primary producers in an aquatic ecosystem are phytoplankton, algae and higher plants. • The energy trapped by the producer is either passed on to a consumer or the organism dies. • Death of an organism is the beginning of the detritus food chain / web. Consumers (Heterotrophs) • These are all animals that depend on plants (directly or indirectly) for their food. • They include : (a) Primary Consumers • These are herbivores that feed on plants. • For e.g., Insects, birds and mammals in the terrestrial ecosystem and molluscs in aquatic ecosystem. (b) Secondary Consumers • These are primary carnivores that feed on herbivores e.g., Frog, fox, man etc. (c) Tertiary Consumers • These are secondary carnivores that feed on primary carnivores. Grazing Food Chain • A simple grazing food chain (GFC) is depicted below :







Energy Flow • Sun is the only source of energy for all ecosystems on the earth. Scan to know • Of the incident solar more about radiation less than 50% of it this topic is photosynthetically active radiation (PAR). • Plants, photosynthetic and chemosynthetic bacteria (autotrophs) fix solar radiant Energy flow energy to make food. • Plants capture only 2-10% of the PAR and this small amount of energy sustains the entire living world. So, it is very important to know how the solar energy captured by plants flows through different organisms of an ecosystem. • Ecosystem obeys first and second law of Thermodynamics. • The energy of the ecosystem is constant. • They need a constant supply of energy to synthesize the molecules they require, to counteract the universal tendency toward increasing disorderliness. Producers • The green plants in the ecosystem which capture the solar energy and convert it into chemically bound energy are called producers. • All organisms are dependent for their food on producers (green plants), either directly or indirectly.







Revision Notes



BIOLOGY

Grass - - - - - - - - - -

(Secondary Consumer) 











• The number of trophic levels in the grazing food chain is restricted as the transfer of energy follows Lindemann’s 10 % law, which states that only 10% of the energy is transferred to each trophic level from the lower trophic level. • In nature, it is possible to have so many levels – producer, herbivore, primary carnivore, secondary carnivore in the grazing food chain. Ecological Pyramids • The representation of a food chain in the form of a pyramid is called an ecological pyramid. It is the relationship between the producers and consumers of various order represented graphically. • The base of each pyramid represents the producers (first trophic level) while the apex represents tertiary or top level consumer or the last trophic level. • Ecological pyramids are of three types : (a) Pyramid of number (b) Pyramid of biomass (c) Pyramid of energy • Any calculations of energy content, biomass or numbers have to include all organisms at that trophic level. • The trophic level represents a functional level, not a species as such. • A given species may occupy more than one trophic level in the same ecosystem at the same time. For e.g., A sparrow is a primary consumer when it eats seeds, fruits, peas, and a secondary consumer when it eats insects and worms. • In most ecosystems, all the pyramids are upright i.e. producers are more in number and biomass than the herbivores and herbivores are more in number and biomass than the carnivores. • Also, energy at a lower trophic level is always more than at a higher level. • Example of inverted pyramids includes insects feeding on a big tree. • Pyramid of biomass in the sea is generally inverted because the biomass of fishes far exceeds that of phytoplankton. • Pyramid of energy is always upright, because when energy flows from a trophic level to the next trophic level, as some energy is always lost as heat at each step. Limitations of Ecological Pyramids (a) It does not take into account the same species belonging to two or more trophic levels. (b) It assumes a simple food chain that seldom exists in nature. It does not accommodate a food web. (c) Saprophytes are not included in ecological pyramids even though they play a vital role in the ecosystem.

















Man - — — — — -



Detritus Food Chain (DFC) • It begins with dead organic matter. • It is made up of decomposers (saprotrophs) which are heterotrophic organisms. e.g. fungi and bacteria. • They meet their energy and nutrient requirements by degrading dead organic matter or detritus. • Decomposers secrete digestive enzymes that breakdown dead and waste materials into simple, inorganic materials, which are subsequently absorbed by them. • In an aquatic ecosystem, GFC is the major conduit for energy flow. • In a terrestrial ecosystem, a much larger fraction of energy flows through the DFC than through the GFC. • DFC may be connected with GFC at some levels : some of the organisms of DFC are prey to the GFC animals. • Some animals (cockroaches, crows etc.) are omnivores. • These interconnections of food chains make a food web. • Organisms occupy a place in the natural surroundings or in a community according to their feeding relationship. • A specific place of organisms in the food chain is known as their trophic level. • Producers belong to the first trophic level, herbivores to the second and carnivores to the third. • The amount of energy decreases at successive trophic levels. • When an organism dies it becomes dead biomass (detritus) that serves as an energy source for decomposers. • Organisms at each trophic level depend on those at the lower trophic level for their energy demands. • Each trophic level has a certain mass of living material at a particular time called as the standing crop. • The standing crop is measured Scan to know more about as the mass of living organisms this topic (biomass) or the number in a unit area. Biomass of a species is expressed in terms of fresh or dry weight. Ecological • Measurement of biomass in Pyramids terms of dry weight is more accurate.



(Primary Consumer)





(Producer)

Goat — - - - - - - - - - -

327

Mnemonics Concept: Types of Ecological pyramids Mnemonic: Put No Entry Board Interpretation:

(i) Pyramid of number (ii) Pyramid of energy (iii) Pyramid of biomass qqq

13

BIODIVERSITY AND ITS CONSERVATION

Topic-1

Biodiversity and its Patterns Concepts Covered

 Biodiversity, different levels of biodiversity, importance of biodiversity, causes of biodiversity loss.







l



l



l







































 

l l l l





l









l



l







l l l l l l

(a) Conventional taxonomic methods are not suitable for identifying microbial species. (b) Many species are not culturable under laboratory conditions. India has only 2.4% of the world’s land area, but has 8.1% of the species diversity. India is one of the 12 mega diversity countries of the world. Nearly 45,000 species of plants and twice as many of animals have been recorded from India. Applying May’s global estimate, India would have more than 1 lakh plant species and 3 lakh animal species. Patterns of Biodiversity Biodiversity is not uniform throughout the world. It varies with the change in latitude and altitude, it is affected by latitudinal gradients and speciesarea relationship. Following are the main patterns of biodiversity. (a) Latitudinal Gradients Species diversity decreases from the equator to the poles. Tropics (latitudinal range of 23.5° N to 23.5° S) have more species than temperate or polar areas. (i) Colombia (near equator) has about 1400 species of birds. (ii) New York (41° N) : 105 species of birds (iii) Greenland (71° N) : 56 species of birds (iv) India (tropical latitudes) : > 1200 species Tropical forest region like Ecuador has up to 10 times species of vascular plants as compared to a forest of equal area in a temperate region like the Midwest of USA. Tropical Amazonian rain forest (South America) has the greatest biodiversity on earth. It contains : (i) 40,000 species of plants (ii) 3,000 species of fish (iii) 1,300 species of birds (iv) 427 species of mammals (v) 427 species of amphibians (vi) 378 species of reptiles (vii) 1,25,000 species of invertebrates Biodiversity (species richness) is highest in tropics because (i) Tropics had more evolutionary time. (ii) Relatively constant environment (less seasonal). l

Biodiversity : It is the diversity (or heterogeneity) of biological organisation ranging from cellular macromolecules to biomes. Edward Wilson : Popularized the term ‘biodiversity’ to describe the combined diversity at all levels of biological organization. Levels of Biodiversity Biodiversity has been divided into three hierarchical levels of biological organization. 1. Genetic diversity (a) Diversity shown by a single species at the genetic level. e.g., Rauwolfia vomitoria in Himalaya shows genetic variation in the potency and concentration of the chemical, reserpine. (b) India has more than 50,000 different strains of rice and 1,000 varieties of mango. 2. Species diversity Diversity at the species level. e.g., Western Ghats have greater amphibian species than the Eastern Ghats. 3. Ecological diversity Diversity at ecosystem level. For e.g., In India, deserts, rain forests, mangroves, coral reefs, wetlands, estuaries & alpine meadows, all can be seen, whereas the Scandinavian countries (like, Norway, Sweden) have less ecological diversity. Number of Species on Earth (Global Species Diversity) According to IUCN or International Union for Conservation of Nature & Natural Resources (2004) more than 1.5 million species have been described so far. According to Robert May, the global estimate is about 7 million (considering the species are to be discovered in the tropics. i.e., only 22% of the total species have been recorded so far). Animals are more diverse (above 70%) than Plants including plantae and fungi (22%). Most species-rich taxonomic group among animals are : Insects (70%, i.e., out of every 10 animals, 7 are insects). Number of fungal species is more than the combined total of the species of fishes, amphibians, reptiles and mammals. Biologists are not sure about total number of prokaryotic species because :







Revision Notes



BIOLOGY

329

330

Oswaal CBSE LMP (Last Minute Preparation), Class-XII l



l















































l l l l l l l l l l l

l



l





l





l





l l



l





l

 



l l







l





l



l



l





l







More than 15,500 species are facing the threat of extinction. 12% birds, 23% mammals, 32% amphibians, 31% gymnosperm species face the threat of extinction. On earth, there have been five mass extinctions of species and at present ‘Sixth Extinction’ is in progress. The current extinction rate is 100 - 1000 times faster than in pre-human times. If this trend continues, nearly 50% species might be extinct within the next 100 years. Impacts of Loss of Biodiversity (a) Decline in plant production. (b) Lowered resistance to some environmental perturbations such as drought. (c) Increased variability in ecosystem processes such as plant productivity, water use and pest and disease cycles. Causes of Biodiversity Losses (‘The Evil Quartet’) “The Evil Quartet” is the phrase coined by Jared Diamond to describe the four human induced causes of extinction. (a) Habitat Loss and Fragmentation It is the most important cause. For e.g., Tropical rain forests (loss from 14% to 6%). Thousands of hectares of rain forests are being lost within hours. The Amazon rain forest (‘lungs of the planet’) is being cut for cultivating soya beans or for the conversion of grasslands for cattle. When large habitats are broken up into small fragments due to various human activities, mammals and birds requiring large territories and certain animals with migratory habits are badly affected, leading to population decline. (b) Over-exploitation The dependence of humans on nature for food and shelter led to the over-exploitation of natural resources. Example : Many species like Stellar’s sea cow, Passenger pigeon, etc, became extinct due to overexploitation. Many marine fish populations around the world are over-harvested, endangering the continued existence of some commercially important species. (c) Alien Species Invasions When alien species are introduced unintentionally or deliberately, some of them turn invasive, and cause the decline or extinction of indigenous species. These alien species cause decline or extinction of indigenous species. Example : (a) The Nile Perch introduced in Lake Victoria (East Africa) caused extinction of more than 200 species of cichlid fish. (b) Invasive weed species like carrot grass (Parthenium), Lantana and water hyacinth (Eichhornia) caused damage to our native species. l





(iii) They receive more solar energy which contributes to greater productivity. (b) Species - Area Relationship According to the study of Alexander von Humboldt (German naturalist & Scan to know more about geographer) in South American this topic jungles, within a region, species richness increases with an increase in explored area, but only up to a limit. Relation between species Species Area Relationship richness and area for a wide variety of taxa (like, angiospermic plants, birds, freshwater fishes) gives a rectangular hyperbola. On a logarithmic scale, the relationship is a straight line or linear, described by the equation : log S = log C + Z log A where, S = Species richness, A = Area, C = Y-intercept, Z = slope of the line (regression coefficient) The value of Z lies in the range of 0.1 to 0.2. In the species-area relationship among the large areas like entire continents, the slope of the line is steeper (Z value : 0.6 to 1.2). e.g., for frugivorous birds and mammals in the tropical forests of different continents, the slope is 1.15. Importance of Species Diversity to the Ecosystem For many decades, ecologists believed that communities with more species, generally, tend to be more stable than those with fewer species. A stable community should not show too much variation in productivity from year to year; it must be either resistant or resilient to occasional disturbances (natural or man-made), and it must also be resistant to invasions by alien species. David Tilman found that plots with more species showed less year-to-year variation in total biomass. He also showed that in his experiments, increased diversity contributed to higher productivity. A rich biodiversity is not only essential for ecosystem health but imperative for the survival of the human race on this planet. Stanford ecologist Paul Ehrlich explained the effect of loss of species through his ‘rivet popper hypothesis’. Loss of Biodiversity IUCN Red List (2004) says that 784 species (338 vertebrates, 359 invertebrates Scan to know more about and 87 plants) became extinct this topic in the last 500 years. e.g., Dodo (Mauritius), Quagga (Africa), Thylacine (Australia), Stellar’s sea cow (Russia) and 3 subspecies (Bali, Javan, Caspian) of the tiger. Loss of Biodiversity 27 species have disappeared in the last 20 years. The extinctions across taxa are not random. Some groups (like amphibians) appear to be more vulnerable to extinction.



BIOLOGY

(c)

(b) In co-evolved plant-pollinator mutualism extinction of one leads to the extinction of the other.



Mnemonics





The illegal introduction of the African Catfish (Clarias gariepinus) for aquaculture is posing a threat to the indigenous catfish (Clarias batrachus) in our rivers. (d) Co-extinction When a species becomes extinct, the plant and animal species associated with it also become extinct. Example : (a) Extinction of the parasites takes place when the host is extinct.

l



l

Concept: Components of Biodiversity Mnemonic: Grand School Exhibition Interpretation: Genetic diversity, diversity, Ecological diversity





Topic-2

331

Species

Conservation of Biodiversity Concepts Covered



Conservation processes, Types of Conservation

Revision Notes



(c) Ethical Arguments Every species has an intrinsic value.



l l





We have a moral duty to take care for their well-being.







l



l







Areas of land or coastal environments to conserve the ecosystem and genetic resources contained therein.



There are 18 biosphere reserves in India.

l





l



l





l

l







l









l



(iv) Sacred Forests (Sacred Groves) Sacred groves are highly protected forests because of religious and cultural traditions. Sacred groves in Khasi and Jaintia Hills in Meghalaya.

l

Other indirect benefits are pest control, climate moderation and flood control.





Aesthetic pleasures such as walking through thick woods, watching spring flowers in full bloom or waking by hearing a bulbul’s song in the morning.



Pollination service takes place through bees, bumblebees, birds and bats.



Biodiversity Conservation





Amazon forest produces 20% of total O2 in the earth’s atmosphere by the process of photosynthesis.

Scan to know more about this topic





l l l l

Biodiversity has many ecosystem services.

Conservation of Biodiversity Types of Conservation (a) In situ conservation (on site) It is the conservation of genetic resources within natural or human-made ecosystems in which they occur. Examples: Protected areas such as National Parks, Sanctuaries, Biosphere reserves, cultural landscapes, national monuments. (i) National Park Strictly reserved for the welfare of the wildlife where private ownership, cultivation, grazing, etc., are prohibited. There are 90 national parks in India. (ii) Sanctuary Here, protection is given only to the animals. Collection of timbers, minor forest products and private ownership are allowed so long as they do not harm the animals. There are 553 wildlife sanctuaries in India. (iii) Biosphere Reserves l

Exploring molecular, genetic and specieslevel diversity for i.e., ‘bioprospecting’ products of economic importance may enormously benefit nations with rich biodiversity.



25,000 species of plants have medicinal value.









l

More than 25% of the drugs are derived from plants.





Humans derive economic benefits from nature such as food, firewood, fibre, construction material, industrial products (tannins, lubricants, dyes, resins, perfumes) and medicines.

(b) Broadly Utilitarian Arguments l





l



l





l





Conservation Processes There are three main reasons for conserving the biodiversity which are categorized as follows : (a) Narrowly Utilitarian Arguments

Oswaal CBSE LMP (Last Minute Preparation), Class-XII l



l





l



It is the conservation of organisms outside their habitats. In this approach, threatened animals and plants are taken out from their natural habitat and placed in a special setting where they can be protected and given special care. For e.g., genetic resource centres, zoological parks, botanical gardens, gene banks etc.









l







l



Mnemonics Concept: Conservation of Biodiversity (In-situ conservation) Mnemonic: National Service Best Service Hai Interpretation: National park, Sanctuary, Biosphere reserve, Sacred forest, Hotspots



l





l



(b) Ex situ conservation (off site)



Three main hotspots (Western Ghats and Sri Lanka, Indo-Burma and Himalaya) cover India’s biodiversity regions.



There are 36 hotspots in the world.



l l

l

 l



These are the richest and the most threatened reservoirs of plant and animal life on earth. In total, all the biodiversity hotspots cover less than 2% of the earth’s land area but could reduce the ongoing extinctions by almost 30%.

Seeds of different genetic strains of commercially important plants can be kept for long periods in seed banks. International Efforts for Conserving Biodiversity The Earth Summit (Rio de Janeiro, 1992) Three objectives : (a) Conservation of biodiversity (b) Sustainable use of biodiversity (c) Sharing of benefits in the utilization of genetic resources. The World Summit on Sustainable Development (Johannesburg, South Africa, 2002) : 190 countries pledged to reduce the current rate of biodiversity loss.



l

In Meghalaya, the sacred groves are the last refuges for a large number of rare and threatened plants.



l



Sarguja, Chanda and Bastar areas of Madhya Pradesh.





In recent years, ex-situ conservation has advanced by preserving the gametes of threatened species in viable and fertile condition for long periods using cryopreservation techniques, eggs can be fertilised in-vitro, and plants can be propagated using tissue culture methods.

Western Ghat regions of Karnataka & Maharashtra.

(v) Hotspots





Aravalli Hills of Rajasthan.

l

332

Sample Question Paper (Issued by Board dated 16th September 2022) BIOLOGY (044) Class-XII SOLVED Maximum Marks : 70



Time Allowed : 3 hours

(iv)





(v)



(i) (ii) (iii)

An infertile couple was advised to undergo In-vitro fertilisation by the doctor. Out of the options given below, select the correct stage for transfer to the fallopian tube for successful results? (A) Zygote only (B) Zygote or early embryo upto 8 blastomeres (C) Embryos with more than 8 blastomeres (D) Blastocyst Stage [1] 

Given below are four contraceptive methods and their modes of action. Select the correct match: Method

Mode of action

(a)

Condom

(i)

Ovum not able to reach Fallopian tube

(b)

Vasectomy

(ii)

Prevents ovulation

(c)

Pill

(iii)

Prevents sperm reaching the cervix

(d)

Tubectomy

(iv)

Semen contains no sperms



















Interferons are most effective in making noninfected cells resistant against the spread of which of the following diseases in humans? [1] (A) ascariasis (B) ringworm (C) amoebiasis (D) AIDS















































6.

[1]

Apis mellifera are killer bees possessing toxic bee venom. Identify the treatment and the type of immunity developed from the given table to treat a person against the venom of this bee. Remedy Immunity (A) Inactivated proteins Active (B) Proteins of the venom Passive (C) Preformed antibodies Passive (D) Dead micro-organisms Active [1]



Evolutionary convergence is development of a (A) common set of functions in groups of different ancestry. (B) dissimilar set of functions in closely related groups. (C) common set of structures in closely related groups. (D) dissimilar set of functions in unrelated groups. [1]

5.



4.



Which of the following amino acid residues will constitute the histone core? (A) Lysine and Arginine (B) Asparagine and Arginine (C) Glutamine and Lysine (D) Asparagine and Glutamine [1]





(B) (a)–(ii); (b)–(iii); (c)–(iii); (d) – (i) (D) (a)–(iv); (b)–(i); (c)– (iii); (d)–(ii)



3.









(A) (a)–(i); (b)–(ii); (c)– (iii); (d)–(iv) (C) (a)–(iii); (b)–(iv); (c)–(ii); (d)–(i)



2.













1.

All questions are compulsory. The question paper has five sections and 33 questions. All questions are compulsory. Section–A has 16 questions of 1 mark each; Section–B has 5 questions of 2 marks each; Section– C has 7 questions of 3 marks each; Section– D has 2 case-based questions of 4 marks each; and Section–E has 3 questions of 5 marks each. There is no overall choice. However, internal choices have been provided in some questions. A student has to attempt only one of the alternatives in such questions. Wherever necessary, neat and properly labeled diagrams should be drawn.

Section – A













General Instructions :

7.

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Which of the following water samples in the table given below, will have a higher concentration of organic matter?





334

Water Sample

Level of pollution

Value of BOD

High

High

(B)

Low

Low

(C)

Low

High

(D)

High

Low

8.



A foreign DNA was ligated at BamH1. The transformants were then grown in a medium containing antibiotics tetracycline and ampicillin. Choose the correct observation for the growth of bacterial colonies from the given table: Medium with Tetracycline

Medium with Ampicillin

(A)

Growth

No growth

(B)

No growth

Growth

(C)

No growth

No growth

(D)

Growth

Growth Terrestrial Ecosystem

Grazing

Detritus

Detritus

(C)

Detritus

Grazing

(D)

Grazing

Detritus



Which of the following is an example of ex-situ conservation? (A) Sacred Groves (B) National Park (C) Biosphere Reserve (D) Seed Bank [1] Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R). Answer these questions selecting the appropriate option given below: (A) Both A and R are true and R is the correct explanation of A. (B) Both A and R are true and R is not the correct explanation of A. (C) A is true but R is false. 















Which of the following food chains is the major conduit for energy flow in terrestrial and aquatic ecosystems respectively?

Grazing

(B)

(D) A is False but R is true.









11.

Aquatic Ecosystem

(A)





Sea Anemone gets attached to the surface of the hermit crab. The kind of population interaction exhibited in this case is: (A) amensalism. (B) commensalism. (C) mutualism. (D) parasitism. [1]













12.



(Where population size is N, birth rate is b, death rate is d, unit time period is t, and carrying capacity is K). (A) dN/dt = KN (B) dN/dt = r N (C) dN/dt = r N(K-N/K) (D) dN/dt = r N(K+N/K) [1]









[1]

Swathi was growing a bacterial colony in a culture flask under ideal laboratory conditions where the resources are replenished. Which of the following equations will represent the growth in this case?



9.

10.



[1]

The figure below shows the structure of a plasmid.







(A)



Sample Question Paper



Apomictic embryos identical to the parent plant.

are

towards the base and gradually increasing age groups as we move from base to the top, with the oldest population at the top. Study this pyramid and comment upon the appropriateness of the Assertion and the Reason.

genetically

Reason: Apomixis is the production of seeds without fertilisation. [1] 





13. Assertion:



14. Assertion:

When white eyed, yellow bodied Drosophila females were hybridised with red eyed, brown-bodied males; and F1 progeny was intercrossed, F2 ratio deviated from 9 : 3 : 3 : 1. Reason: When two genes in a dihybrid are on the same chromosome, the proportion of parental gene combinations is much higher than the non-parental type. [1]



15.









335

Assertion: Functional ADA cDNA genes must be inserted in the lymphocytes at the early embryonic stage. 



Reason: Cells in the embryonic stage are mortal, differentiated and easy to manipulate. [1]

Assertion: It is a stable population. Reason: The pre-reproductive and reproductive individuals are almost in equal numbers and the post-reproductive individuals are relatively fewer. [1] 



Given below is the Age Pyramid of population in one of the states in India as per 2011 census. It depicts the male population on the left hand side, female population on the right hand side, newborns





16.

Section – B

[2] Name the organs which secrete the hormones represented in parts A and B. State the impact of the hormones in part B on the uterus of the human female during 6 to 15 days of menstrual cycle? [2] 



In the figure given below, parts A and B show the level of hormones which influence the menstrual cycle. Study the figure and answer the questions that follow:





17.

(a)

Given below is a pyramid of biomass in an ecosystem where each bar represents the standing crop available in the trophic level. With the help of an example explain the conditions where this kind of pyramid is possible in nature?

(b)

Will the pyramid of energy be also of the same shape in this situation? Give reason for your response. [2]





21.

A true breeding pea plant, homozygous dominant for inflated green pods is crossed with another pea plant with constricted yellow pods (ffgg). With the help of punnett square show the above cross and mention the results obtained phenotypically and genotypically in F1 generation? [2] During a field trip, one of your friend in the group suddenly became unwell, she started sneezing and had trouble in breathing.



(a)







(b)





GAATTC (a) What are such sequences called? Name the enzyme used that recognises such nucleotide sequences. (b) What is their significance in biotechnology? [2]

OR Draw a pyramid of numbers where a large number of insects are feeding on the leaves of a tree. What is the shape of this pyramid? Will the pyramid of energy be also of the same shape in this situation? Give reason for your response. [2] 

CTTAAG





20.







Name and explain the term associated with such sudden responses. What would the doctor recommend for relief? [2]





19.







18.









(a) (b)

336

Section – C

(a)





(b) (c)









Identify the polarity of x to x’ in the diagram below and mention how many more amino acids are expected to be added to this polypeptide chain.

Mention the codon and anticodon for alanine. Why are some untranslated sequences of bases seen in mRNA coding for a polypeptide? Where exactly are they present on mRNA? [3] (a) What result will be obtained on staining with (a) How is Hardy-Weinberg's expression “(p2 + 2pq+q2) = 1”derived? ethidium bromide? Explain with reason. (b) List any two factors that can disturb the genetic (b) The above set-up was modified and a band equilibrium. [3] with 250 base pairs was obtained at X. Highlight the structural importance of an antibody molecule with a diagram. Name the four types of antibodies found to give a humoral immune response, mentioning the functions of two of them you have studied. [3] OR (a) Explain the Life cycle of Plasmodium starting from its entry in the body of female Anopheles till the completion of its life cycle in humans. (b) Explain the cause of periodic recurrence of chill and high fever during malarial attack in humans. [3] Carefully observe the given picture. A mixture of DNA with fragments ranging from 200 base pairs to What change(s) were made to the previous 2500 base pairs was electrophoresed on agarose gel design to obtain a band at X? Why did the band with the following arrangement. appear at the position X? [3]





(b)

List any three major causes of loss of biodiversity? [3] 

There was loss of biodiversity in an ecosystem due to a new construction project in that area. What would be its impact on the ecosystem? State any three.



(a)





28.



27.













26.













25.











24.



State the agent(s) which helps in pollinating in the following plants. Explain the adaptations in these plants to ensure pollination: (a) Corn (b) Water hyacinth (c) Vallisneria [3]





23.



Explain the functions of the following structures in the human male reproductive system. (a) Scrotum (b) Leydig cells (c) Male accessory glands [3]





22.

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



337

Sample Question Paper

Section – D Study the Pedigree chart given below and answer the questions that follow:

Carrier male

Affected male

Normal male

Carrier female

Affected female

Normal female

On the basis of the inheritance pattern exhibited in this pedigree chart, what conclusion can you draw about the pattern of inheritance? If the female is homozygous for the affected trait in this pedigree chart, then what percentage of her sons will be affected ? Give the genotype of offsprings 1,2,3 and 4 in III generation. OR In this type of inheritance pattern, out of male and female children which one has less probability of receiving the trait from the parents. Give a reason. [4]

The data below shows the concentration of nicotine smoked by a smoker taking 10 puffs/ minute.

(c)









(a) (b) (c)

With reference to the above graph explain the concentration of nicotine in blood at 10 minutes. How will this affect the concentration of carbon monoxide and haembound oxygen at 10 minutes? How does cigarette smoking result in high blood pressure and increase in heart rate? OR How does cigarette smoking result in lung cancer and emphysema?

[4]





30.





(c)



(c)



(b)



(a)



Symbols used in the given Pedigree Chart are as follows:





29.





Q. no 29 and 30 are case based questions. Each question has subparts with internal choice in one subpart.





Trace the development of a megaspore mother cell to the formation of mature embryo sac in a flowering plant. [5]

Observe the segment of mRNA given below.





32.

Trace the events from copulation to zygote formation in a human female. [5] OR 



31.



Section – E [5]

338

o

z

y

a

The active site of enzyme permease present in the cell membrane of a bacterium has been blocked by an inhibitor, how will it affect the lac operon? The protein produced by the i gene has become abnormal due to unknown reasons. Explain its impact on lactose metabolism stating the reason. If the nutrient medium for the bacteria contains



p



i



only galactose; will operon be expressed? Justify your answer. Oil spill is a major environmental issue. It has been found that different strains of Pseudomonas bacteria have genes to break down the four major groups of hydrocarbons in oil. Trials are underway to use different biotechnological tools to incorporate these genes and create a genetically engineered strain of Pseudomonas - a ‘super-bug’, to break down the four major groups of hydrocarbons in oil. Such bacteria might be sprayed onto surfaces polluted with oil to clean thin films of oil. (a) List two advantages of using bacteria for such biotechnological studies? (b) For amplification of the gene of interest PCR was carried out. The PCR was run with the help of polymerase which was functional only at a very low temperature. How will this impact the efficiency of the PCR? Justify. (c) If such bacteria are sprayed on water bodies with oil spills, how will this have a positive or negative effect on the environment? Discuss.

OR Insects in the Lepidopteran group lay eggs on maize crops. The larvae on hatching feed on maize leaf and tender cob. In order to arrest the spread of three such Lepidopteran pests, Bt maize crops were introduced in an experimental field. A study was carried out to see which of the three species of lepidopteran pests was most susceptible to Bt genes and its product. The lepidopteran pests were allowed to feed on the same Btmaize crops grown on 5 fields (A-E). The graph below shows the leaf area damaged by these three pests after feeding on maize leaves for five days.



(c)



(b)



(a)



p

33.

Explain and illustrate the steps involved to make fully processed hnRNA? Gene encoding RNA Polymerase I and III have been affected by mutation in a cell. Explain its impact on the synthesis of polypeptide, stating reasons. OR Study the schematic representation of the genes involved in the lac operon given below and answer the questions that follow:





(b)



(a)



Oswaal CBSE LMP (Last Minute Preparation), Class-XII









Insect gut pH was recorded as 10, 8 and 6 respectively for Species I, II and III respectively. (a) Evaluate the efficacy of the Bt crop on the feeding habits of the three species of stem borer and suggest which species is least susceptible to Bt toxin. (b) Which species is most susceptible to Bt-maize, explain why? (c) Using the given information, suggest why similar effect was not seen in the three insect species? [5]

SOLUTIONS

Sample Question Paper With CBSE Marking Scheme 2022-23

BIOLOGY (044) insects and bats have undergone flight evolution and developed capacity of flight independently. [1]











7.

Option (A) is correct. Explanation: Dissolved organic matters (DOM) is found in every water body, whether it is marine or freshwater. It is heterogeneous mixture derived primarily from the decomposition products of plant material, bacteria and algae. Biochemical Oxygen Demand (BOD) is a measure of organic material present in water. Clean water has BOD which is less than 5ppm. If it is more, then water is considered as polluted. Thus, water with high concentration of organic matter indicates increase in the number of decomposers. These decomposers grow rapidly and use large amount of oxygen during their growth. Thus high BOD level. [1]

Option (A) is correct. Explanation: The length of DNA double helix in a typical mammalian cell is approximately 2.2m, which is far greater than the dimensions of a typical nucleus. In order to package such a long polymer in a cell, histone octamers are used, which are a complex of eight positively charged histone proteins that assist in DNA packaging. Histone comprises of two copies of each of the 4 core histone proteins H2A, H2B, H3 and H4. A protein acquires with charged side chains. Histones are rich in the basic amino acid residues lysine and arginines. [1] Option (A) is correct. Explanation: Evolution of life forms has taken place or earth. Homology indicates common ancestry and is based on divergent evolutions. While analogy is a result of convergent evolution, which refers to independently evolving similar traits by different organisms. Example: Dolphins and Sharks separately evolved very similar physical feature that have helped them to become successful marine predators. Birds,







8.









4.





















3.













Option (D) is correct. Explanation: Interferons are group of soluble glycoproteins which are produced and released from cells in response to virus infection (and other stimuli). Their production is triggered by the immune system in response to pathogens. Once triggered, they induce number of molecular changes that affect cellular response including cell growth and inflammation. Endogenous interferons play an important role in viral infection of the nervous system. They are also used in the treatment of other viral, autoimmune disorders. [1]







6.

Option (B) is correct. Explanation: We can ligate a foreign DNA at the Bam H1 site of tetracycline resistance gene in the vector pBR322.

Option (C) is correct. Explanation: Condoms are barriers, which are made up of thin rubber or latex sheath. They are used to cover the penis in male or vagina and cervix in the female. It is a type of barrier method which prevent the physical meeting of ovum and sperms. Vasectomy is surgical intervention, which blocks gamete transport thus prevents conception. This sterilisation procedure in the male is called vasectomy. In this a small part of the vas deferens is removed or tied up, where as in tubectomy, a small part of the fallopian tube is removed or tied up. Pills are small doses of either progestogens or progestogen estrogen combination, used orally by females in the form of tablets. [1]









2.

Option (C) is correct. Explanation: Apis mellifera or western honey bee or European honey bee is the most common of the 7–12 species of honey bees worldwide. mellifera is the Latin word, which means “honey bearing” or “honey carrying”. It is used both for honey production and pollination activities by beekeepers. Honey bee venom is a bitter, colourless liquid and its active protein contains a mixture of proteins that causes local inflammation and act as anti–coagulants. Preformed antibodies are derived from the blood serum of previously infected people or animal. They are used against fast–acting toxins or microbes as in snake bites in order to provide immediate, passive immunisation. [1]



5.



Option (B) is correct. Explanation: In-vitro fertilisation is the technique in which the fertilisation takes place outside the body but the conditions are similar as that present in the body. Fertilisation process is followed by embryo transfer (ET). In this process the zygote or early embryos (with up to 8 blastomeres) are transferred into the fallopian tube. [1]

1.





Section – A











Option (A) is correct.









Option (C) is correct. Explanation: In a terrestrial ecosystem detritus food chain (DFC) is a major conduit for energy flow. DFC begins with dead organic matter. It is a direct source of energy supply in detritus food chain. It

[1]

Option (C) is correct. Explanation: ADA or adenosine deaminase deficiency causes a rare genetic disorder of the immune system known as Severe Combined Immunodeficiency (SCID). For the permanent treatment of ADA deficiency gene therapy at early embryonic stage is recommended. In this process, lymphocytes from the patient’s body are grown in a culture medium outside the body. A functional ADA cDNA is introduced into the lymphocytes using a retroviral vector. Retrovirus vectors are capable of transferring their ssRNA genome into a dsDNA molecule that integrates itself into the host cell’s [1] genome.

16.













11.

Option (A) is correct. Explanation: Apomixis is defined as production of seed without undergoing the fertilisation process. It is a type of asexual reproduction seen in higher plants. It produces a genetically identical clone of the mother cell. [1]





Option (D) is correct. Explanation: Commensalism is a type of interaction in which one species benefits and the other is neither harmed nor benefited. Association of sea anemone and hermit crab is also an example of commensalism in which sea anemone gives the shelter or protection to the hermit crab and in return the hermit crab provides the food to the sea anemone. [1]

14. 15.









10.

13.



r is known as “intrinsic rate of natural increase “. r is an important factor which help in assessing the impact of any biotic or abiotic factor or population growth. [1]





dN = rN dt

Option (D) is correct. Explanation: To conserve and protect the whole ecosystem its biodiversity should be protected. Ex–situ conservation is one of its type. In this the threatened animals and plants are taken out from their natural habitat and are placed in special places where they can be protected. Seed banks are such places where seeds of different genetic strains of commercially important plants can be kept for long period. [1]

Option (A) is correct.













Option (B) is correct. Explanation: Unlimited resources in any habitat result in increase in number of species. The population grows in an exponential or geometric manner.



9.

has continuous energy flow in comparison to other, utilising the detritus to its fullest, with minimum wastage. In an aquatic ecosystem the grazing food chain is major conduit in energy flow. The consumer which start the food chain, utilising the plant or plant part as their food, constitute the grazing food chain. In aquatic ecosystem phytoplankton (primary producer) are eaten by zooplanktons which are eaten by fishes and fishes are eaten by Pelicans. [1]





12.



The recombinant plasmids will lose the tetracycline resistance due to insertion of foreign DNA but they can be selected from non–recombinant ones by plating the transfomants on ampicillin containing medium. In this case one antibiotic resistance gene helps in selecting the transformants where as the other get inactivated due to insertion of alien DNA. This process is known as insertion inactivation. Bam H1 site of pBR322 is the place of tetracycline resistance. In case of insertion of a foreign DNA at Bam H1 site, susceptibility to tetracycline increases as the resistant gene is replaced. However, resistance to ampicillin is not changed as it is left active. As insertion does not cause any change in the ampicillin resistance gene, the DNA molecules are still resistant to the ampicillin. [1]



Oswaal CBSE LMP (Last Minute Preparation), Class-XII









340

[1]

Section – B [½ × 2 =1]

A –Pituitary gland; B: Ovary





(a)





17.







18.













(b) Endometrium of the uterus regenerates through proliferation. [1] Detailed Answer: The menstrual cycle starts with menstrual phase and it lasts for 3–5 days. It result due to breakdown of endometrial lining of the uterus and its blood vessels. The menstrual phase is followed by follicular phase. In this phase, the primary follicles in the ovary grow to become a mature Graafian follicle and side by side the endometrium of uterus regenerates.

341

Solutions

(a)

Palindromic sequences,

23.

(a)

Corn: Wind. Numerous flowers are packed in an inflorescence; the tassels seen in the corn cob are the stigma and style which wave in the wind to trap pollen grains.

(b)

Water hyacinth: Insects or wind. In water hyacinth the flowers emerge above the level of water and are pollinated by insects or wind as in most of the land plants.

(c)

Vallisneria: Water. In Vallisneria - the female flower reaches the surface of water by the long stalk and the male flowers or pollen grains are released onto the surface of water. They are carried passively by water currents; some of them eventually reach the female flowers and the stigma. [½ × 6 =3]

(a)

x to x’ is 5′ ———→ 3′







Restriction enzymes can make complementary cut counterparts forming sticky ends for recombination DNA / RDNA technology/ to facilitate ligation of vector and foreign DNA. [1]







[½]

No more amino acids will be added

[½]

Codon is GCA

[½]

Anticodon is CGU

[½]













(b)



(c)

The untranslated regions are required for an efficient translation process. [½] 



No, the Pyramid of energy is always upright, and can never be inverted because when energy flows from one trophic level to the next trophic level, some amount of energy is always lost as heat at each step. [1] OR

24.







(b)

Inverted pyramids of biomass are seen in aquatic conditions where a small standing crop of phytoplankton supports a large standing crop of zooplankton/fish. In terrestrial ecosystem where a large number of insects are feeding on the leaves of a tree. [1]





(a)









21.









(b)

[½]







endonuclease enzyme

[½]









20.















Doctors would administer drugs like antihistamines, adrenaline and steroids (any one) to reduce the symptoms. [1]



(b)



Allergy, the exaggerated response of the immune response to certain antigens present in the environment is called allergy. [1]



(a)

prostate and paired bulbourethral glands. Secretions of these glands constitute the seminal plasma which is rich in fructose, calcium and certain enzymes. The secretions of bulbourethral glands also help in the lubrication of the penis. [1 × 3 =3]











19.

[1] [½] [½]

Making the correct punnett square Phenotype - All Inflated green pods Genotype –FfGg











The frequency of 'AA' individuals in a population is p2 and it can be explained that the probability that an allele 'A' with a frequency of 'p' would appear on both the chromosomes of a diploid individual is simply the product of the probabilities, i.e., p2.







(b)

Inverted pyramid because a large number of insects feed on one tree. No, the Pyramid of energy is always upright, and can never be inverted because when energy flows from one trophic level to the next trophic level some amount of energy is always lost as heat at each step. [1 × 2 =2]

Sum total of all the Allele Frequencies is 1: Let there be two alleles 'A' and 'a' in a population. The frequencies of alleles 'A' and 'a' are ‘p’ and ‘q’ respectively. [½]





(a)

(a)





25.









They are present before the initiation codon at the 5’ – end and after the stop/termination codon, at the 3’ – end. [½]

Section – C

p2 + 2pq+q2) = 1, where p2 represents the frequency of homozygous dominant genotype, 2pq represents the frequency of the heterozygous genotype and q2 represents the frequency of the homozygous recessive. [1]













Factors that affect Hardy–Weinberg equilibrium: (i) Gene migration or gene flow (ii) Genetic drift (iii) Mutation (iv) Genetic recombination (v) Natural Selection (Any two)[½+½= 1]

Male accessory glands: The male accessory glands include paired seminal vesicles, a

(b)

(c)



Leydig cells: The regions outside the seminiferous tubules called interstitial spaces, contain small blood vessels and interstitial cells or Leydig cells. Leydig cells synthesise and secrete testicular hormones called androgens.



(b)









Scrotum: The testes are situated outside the abdominal cavity within a pouch called scrotum. The scrotum helps in maintaining the low temperature of the testes (2–2.5 degree celsius lower than the normal internal body temperature) necessary for spermatogenesis.





(a)





22.







Similarly, the frequency of aa is q2 and that of Aa is 2pq. [½]

342





28.

Impacts of loss of biodiversity on the ecosystem: (a) (i) Decline in plant production (ii) Lowered resistance to environmental perturbations such as drought (iii) Increased variability in certain ecosystems – processes such as plant productivity, water use, pest and disease cycles. [½ × 3] (b) (i) Habitat loss and fragmentation (ii) Over-exploitation (iii) Alien invasive species (iv) Co-extinctions. (Any three) [½ × 3 = 1½]





An antibody molecule consists of four polypeptide chains, two are long called heavy (H) chains while other two are short called light (L) chains. Both are arranged in the shape of Y. Hence, the antibody is represented as H2 L2. [1]























26.

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Section – D (b)

100%

[1]











[½]



X- linked (½ Mark), Recessive trait











1. XY OR XY, 2. X X, 3. XY, 4. XX [½ × 4 =2] OR The possibility of the female getting the trait is less. [1] The female will get the trait only if the mother is at least a carrier and the father is affected. [1] (a)



Concentration of nicotine is maximum at 10 minutes/ conc. of nicotine increases steadily in the blood to reach 45 mg/cm3 [1] The Concentration of CO will increase resulting in reduced concentration of haembound oxygen. [1] Nicotine results in stimulating the adrenal gland which results in release of adrenaline / nor - adrenaline in the blood resulting in increase of blood pressure and heart rate. [2] OR Chemical carcinogens present in tobacco smoke are the major cause of lung cancer. [1] The cigarette smoke irritates the air passages of the lungs causing them to produce mucus which causes cough resulting in enlarging air spaces/ reduce surface area/lose their elasticity (any point can be mentioned) thus difficulty in breathing causing emphysema. [1] 





30.













(a) (c)











(Diagram with Labels – Light chain, [½] Heavy Chain [½] Types of Antibody – IgA, IgM, IgE, IgG (1 mark awarded when all 4 types are stated) IgA – Lactating Mother to protect their infant [½] Ig E – To protect from allergen [½] OR (a) When a female Anopheles mosquito bites an infected person, the parasites enter the mosquito’s body as gametocytes. [½] It leads to fertilisation and development in the gut of the mosquito and undergoes further development to form sporozoites that are stored in salivary glands until their transfer to human body. In the human body – the sporozoites reach the liver and reproduce asexually, bursting the cells and releasing them into the RBCs as gametocytes. [½×4=2] (Labeled diagram explaining the mentioned stages can also be considered) (b) The rupture of RBCs releases a toxic substance called haemozoin, [½] which is responsible for the chill and high fever.





29.









(b)









(c)















(c)

(a)





No bands will be obtained as/All DNA will be seen in the well only; [½]







27.



(ii)







(i)

During copulation (coitus) semen is released by the penis into the vagina (insemination). (ii) The motile sperms swim rapidly, pass through the cervix, enter into the uterus and finally reach the ampullary region of the fallopian tube. (iii) The ovum released by the ovary is also transported to the ampullary region where fertilisation takes place.





31.



Position of the positive terminal/ end/ anode and the negative terminal/ end/ cathode was inter-changed [½] The fragment with least base pairs will get separated faster and move faster toward the anode end. [1]

Section – E



(b) (i)









DNA fragments being negatively charged will not move towards negative end/ cathode. DNA being negatively charged will remain stationed at the positive end/ anode end of the agar block; [1]



Solutions

micropylar end and constitute the egg apparatus. The egg apparatus, in turn, consists of two synergids and one egg cell. The synergids have special cellular thickenings at the micropylar tip called filiform apparatus. (ix) Three cells are at the chalazal end and are called the antipodals. (x) The large central cell, as mentioned earlier, has two polar nuclei. Which come to lie below egg apparatus. Thus, a typical angiosperm embryo sac, at maturity, though 8-nucleate is 7-celled. [½ × 10 = 5]

(a)









(b)

The process of translation will not happen, thus the polypeptide synthesis is stopped/ hampered. [1] The reason for the above is: RNA polymerase I transcribes rRNAs which is the cellular factory for protein synthesis. [½] RNA polymerase III helps in transcription of tRNA which is the adaptor molecule/ that transfers amino acids to the site of protein synthesis. [½] OR (a) When the active site of enzyme permease present in the cell membrane of a bacterium has been blocked by an inhibitor, the lactose is not transported into the cell. [1] As lactose is the inducer, the lac operon will not be switched on. [1] (b) Since the repressor protein synthesised by the i gene is abnormal, it will not bind to the operator region of the operon, resulting in a continuous state of transcription process. [2] (c) No, [½] because galactose is not an inducer/ it is a product of lactose metabolism [½] 













































The hnRNA undergoes processes called capping and tailing followed by splicing. In capping, an unusual nucleotide is added to the 5'-end of hnRNA methyl guanosine triphosphate. In tailing, adenylate residues (about 200–300) are added at 3'-end in a template independent manner. Now the hnRNA undergoes a process where the introns are removed and exons are joined to form mRNA called splicing. [½ × 6 =3] 









32.

















(iv) Fertilisation can only occur if the ovum and sperms are transported simultaneously to the ampullary region. This is the reason why not all copulations lead to fertilisation and pregnancy. (v) The process of fusion of a sperm with an ovum is called fertilisation. (vi) During fertilisation, a sperm comes in contact with the zona pellucida layer of the ovum and induces changes in the membrane that block the entry of additional sperms. Thus, it ensures that only one sperm can fertilise an ovum. (vii) The secretions of the acrosome help the sperm enter into the cytoplasm of the ovum through the zona pellucida and the plasma membrane. (viii) This induces the completion of the meiotic division of the secondary oocyte. (ix) The second meiotic division is also unequal and results in the formation of a second polar body and a haploid ovum (ootid). (x) Soon the haploid nucleus of the sperms and that of the ovum fuse together to form a diploid zygote. [½ × 10 = 5] OR Trace the development of a megaspore mother cell to the formation of mature embryo sac in a flowering plant. The process of formation of megaspores from the megaspore mother cell is called megasporogenesis. (i) Ovules generally differentiate a single megaspore mother cell (MMC) in the micropylar region of the nucellus. It is a large cell containing dense cytoplasm and a prominent nucleus. The MMC undergoes meiotic division to form megaspores. (ii) In a majority of flowering plants, one of the megaspores is functional while the other three degenerate. Only the functional megaspore develops into the female gametophyte (embryo sac). This method of embryo sac formation from a single megaspore is termed monosporic development. (iii) The nucleus of the functional megaspore divides mitotically to form two nuclei which move to the opposite poles, forming the 2-nucleate embryo sac. (iv) Two more sequential mitotic nuclear divisions result in the formation of the 4-nucleate and later the 8-nucleate stages of the embryo sac. (v) These mitotic divisions are strictly free nuclear, that is, nuclear divisions are not followed immediately by cell wall formation. (vi) After the 8-nucleate stage, cell walls are laid down leading to the organisation of the typical female gametophyte or embryo sac. (vii) Six of the eight nuclei are surrounded by cell walls and organised into cells; the remaining two nuclei, called polar nuclei are situated in the large central cell. (viii) Three cells are grouped together at the

343

344 (a)

You can easily grow a large quantity of the bacteria/no ethical issues/have plasmids/ can easily transform (Any one) [1]

(b)

PCR will not amplify the gene.



other non-virulent forms and make them super bugs with detrimental effect/ unpredictable/ for a longer duration it may reduce the dissolved oxygen and leading to mortality of aquatic organisms. (Any one) [1]

[½]















33.

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Species III is least susceptible

(b)

Bt toxin protoxins are converted into an active form in the gut which solubilises the toxin crystals. The activated toxin binds to the surface of midgut epithelial cells and create pores that cause cell swelling and lysis and eventually cause death of the insect (2 Marks)

(c)

Insect species I and II have alkaline gut pH which solubilises the insecticidal protein crystals of protoxin and makes it active. Species III has an acidic and the protoxin continues to remain in an inactive form doing no harm to insect species III. [2]













Negative effect: The bacteria can mutate/ can harm other organisms/ can conjugate with



Positive effect: Oil spills can be treated and the environment becomes better/ cleaner/ water becomes more potable/ safe for aquatic forms/ safe for water birds like sea gulls. (Any one) [1] 





(c)

(1 Mark)



(a)







OR







If the polymerase enzyme denatures at low temperature, it will not be able to withstand high temperature which is essential for separating/opening/unwinding/ denaturing DNA strand to open. Thus subsequent step of extending the primers using the nucleotides provided in the reaction and the genomic DNA as template will not occur. [1½]

nnn

English Core



ENGLISH CORE

347

PART - A : READING COMPREHENSION

1

UNSEEN PASSAGES Revision Notes Fundamental Facts

The word ‘comprehension’ means to fully understand the text using one’s intellect. A comprehension

•

Read the entire sentence together to make out the sense or meaning.

•

Infer the meaning of the difficult words through the context clues.

•

Any option that is distracting you out of the passage is never the correct answer. The right answer is always based on the information given within the passage.

•

Try to draw inferences from the given statistics rather than focussing on the numbers.





INTRODUCTION

to comprehend (understand) the meaning being



passage is a text set for testing the reader’s ability

passage. The students need to fully understand the



implied by the text and the theme of that particular

Questions based on a passage generally appear as a chronological relationship with the passage. Usually, the first question has the answer in the





text by using their intellect.

initial paragraphs and so on, but if the answers are inferential, then the matter might have to be collected from various paragraphs and for this, one needs to be

Mnemonics

familiar with the entire passage.



Discursive Passages: These kinds of passages

Concept: technique to solve the passage Mnemonic : ROAST Interpretations: R: Read the passage silently.

involve an opinion. They have a logical flow and are argumentative or persuasive in nature. They may also include Literary Passages which are the extracts

O: Organise your understanding by getting hold of the theme. A: Avoid distractors, examples or illustrations. Focus

from a literary piece. Case-based Factual Passages: These passages convey

on the stem of the questions. S: Spot the key words of the questions in the passage

vivid information about a particular subject. These passages report about an event or a new finding. They can also provide instructions or even descriptions of

to identify the correct answer. T: Trigger words, like ‘but’ or ‘however’, are used only





TYPES OF COMPREHENSION PASSAGE:

something. The complete information is conveyed through visual inputs, graphs or even reports.

to confuse. So avoid focusing on them. 

First Level



Second Level

Skills developed by students

Third Level

Logical reasoning

Unseen Passages

Reading

To the point answer: Multiple Choice/ Objective Type Questions based on one's analysis and interpretation.

Literary passage

Case-based Factual passage

Analytical in nature

Trace the Mind Map

Vocabulary building

Interpretation

Inference



Critical evaluation

Comprehension

Taken from fiction, biography, autobiography, travelogue, poem etc.

To the point answer: Multiple Choice/ Objective Type Questions

Informative/descriptive in nature

Contains facts and data



Read carefully and quickly Understand the theme

Discursive / Descriptive passage

Read the questions that follow to enhance understanding and focus on points to be answered

Skim and scan the keywords

To the point answer: Multiple Choice/ Objective Type Questions based on one's understanding and reasoning.

Argumentative/ persuasive in nature.

Contains opinions /feedbacks.

348 Oswaal CBSE LMP (Last Minute Preparation), Class-XII



ENGLISH CORE

349

PART - B : CREATIVE WRITING SKILLS

2

SHORT AND LONG WRITING TASKS

Topic-1

Notice Writing Concepts Covered



Format and Layout of Notice



How to write a Notice?

Revision Notes than any other tense forms. Notices can be categorized under the following heads: Meeting :

Date, Time, Place





1.

Agenda, Purpose, Objective





Chief Presiding person (if any)



Additional information

Contact Address

2.

Events :

Name Objective, Occasion





Scan to know

Notices are short compositions more about this topic written to convey some information or make a formal announcement about some events like change of name. They How to write a Notice? are simple and lucid in style. The notices are either posted on the noticeboard meant for the purpose or given in a newspaper.





Date, Time, Duration, Venue Who can participate



•



Introduction

Additional information (if any)



Some Useful Tips





Contact Address



• It usually begins with ‘This is to inform’ or ‘It is hereby informed that’.

3.

Lost & Found :

Name of the article lost or found







• The word limit should not exceed 50 words.



• The word NOTICE’ along with a proper title and the issuing organisation should be mentioned.



• Date of issuing the notice should be mentioned.



• The purpose of the notice should be very clear.



• It should be written in a box.



• The language used must be lucid and formal. It must be written in the third person i.e. pronouns like I, you, me, mine, your, our etc. should not be used. Choice of tense will depend on the nature of the notice e.g. in a notice announcing an event, future time reference will be used more

4.







Date, place and time Specific marks for identification Contents Whom, when, where to contact Tours & Camps : Name of the Club/Association Objective Name of the destination Duration Occasion Expenditure Additional information (if any) Contact address

• The signing off should have a signature, name and designation of the person in charge.







• The content must include complete information. It must include the 7 W’s: who, what, where, why, when, in what way and for whom.







• Notice carries 5 marks.





Fundamental Facts 1. Passive Voice should be used to write a Notice. 2. In a Notice, use short sentences and simple words 3. Do not use flowery text or fancy words in a Notice.

Scan to know more about this topic

Writing Notice

350

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



ENGLISH CORE

351

Format



Marking Scheme 5 Marks: Format : 1 / Organisation of Ideas: 1/Content : 2 / Accuracy of Spelling and Grammar : 1

Invitation & Reply

Topic-2

Concepts Covered & Reply



Format and Layout of Invitation & Reply  How to write Invitation

Revision Notes Formal invitations can be of two types: 1.

Printed invitation cards inviting guests to be present on a particular occasion. Such invitations do not include the name of the addressee.

2.

Formal typed (handwritten) letter addressed to a VIP invited to preside over a social, cultural and educational function. In these invitations to VIPs the name of the addressee appears prominently.

•

Invitations form an important part of social dealings. An invitation is a request to an individual to be a part of some social gathering or an event. It may also be an extension of a desire to request someone to participate in a workshop.

Invitations can be classified under two headings : Invitations

Formal Invitations

Informal Invitations

Types of Invitations Invitations can be both formal as well as informal. Formal invitations can be printed on cards or can be drafted in the form of social letters.





Introduction

Formal invitations are formal and polite, pleasant and courteous. Informal invitations generally take the shape and form of personal letters. We use these to invite our friends, relatives and dear ones with whom we have intimate, personal and friendly relations. In informal invitations the tone and treatment is relaxed, informal and friendly.

352

Oswaal CBSE LMP (Last Minute Preparation), Class-XII











This matter should be centrally aligned for better presentation. 4. The other details include name, designation and address of the organiser, sponsor or host or the name(s) of the chief guest or special invitees, in case of an official invitation. 5. Printed formal invitations don’t include the name of the addressee. 6. Invitations to VIP to preside over a function to carry the name of VIP prominently. 7. Length as per CBSE guidelines is limited to 50 words. 8. Change of font and size for highlighting the event, venue and any other important detail should be used for a good presentation. 9. It should not be cluttered in with information. 10. Put the invitation into a box.





Main Characteristics: A formal invitation is normally a single sentence presentation in third person. Formal invitations are generally printed invitation cards. We use them to invite guests on some auspicious occasion like birthdays, weddings, inauguration of shops, houses, etc. The invitation answers the questions who, when, where, what time and for what, i.e., • the occasion • name(s) of the invitee • name(s) of the host • date, time and venue

3.



2.



1.





A. FORMAL INVITATIONS

Formal Invitation Format

Formal Invitation Letter Format :

Respected Sir, ................................................................................................ ................................................................................................ .............................................. BODY ..................................... ................................................................................................ Date : .................. Time : .................. Venue : .................. Yours truly Name (Designation)



…...........………………….… Subject …...........……………



Receiver’s Designation ……………………..……………… Receiver’s Address …………………….……………………



Date ........................

Main Characteristics: Informal invitations follow the pattern of ordinary personal letters. These letters are written to relatives, friends and acquaintances. 1. These letters are first/ second person presentations. 2. Personal feelings and emotions find an expression. 3. The writer’s address is given in the usual place. 4. The salutation is usually ‘Dear’ along with the ‘Name’. 5. The date of writing is given, but the year is generally omitted. 6. The style and tone are relaxed and informal. 7. Different tenses are used as the sense demands. 8. The complimentary close is: ‘Yours sincerely’ / ‘Yours truly’ / ‘Yours lovingly’ / ‘Yours affectionately’.

Sender’s Address ................................... ...................................

B. INFORMAL INVITATIONS



ENGLISH CORE

353

Sender’s Address ...................................

Main characteristics:

Date ........................



•

Acknowledge the invitation.



•

Express thanks in third person.

Dear XYZ, .............................................................................. .............................................................................. .................................... BODY .............................. ..............................................................................



•

Mention acceptance/regret.



•

Specify the reason for refusal.



•

Be brief and specific.



•

Be formal in tone and treatment.



•

Do not exceed the word limit (usually 50 words).



(a) Formal Replies: (Letter / Note)

Formal Acceptance:

Date : .................. Time : .................. Venue : ..................

Mrs. Sharma is thankful to Mrs. & Mr. Kohli for their kind invitation for the inauguration of their new house on 15th March 20xx at 8 a.m. and take delight in accepting it.

Yours truly Name

Formal Refusal: Mr. Ramakrishan is thankful to Mr. Iyer for his kind

WRITING FORMAL AND INFORMAL REPLIES TO INVITATIONS

An informal reply or private letter may, however, express personal feelings or desires in an intimate style and informal tone.

Surya. However he regrets his inability to attend due to prior commitment. He wishes the couple happily married life. (b) Informal Replies: (Letter)

A formal reply is usually very short. It is brief and to the point. The quality of a good reply is that it must always be pleasant. Even while declining the invitation or expressing inability to attend one must be polite and courteous. Formal replies demand a formal tone and treatment. There is no room for unnecessary details or superfluous matter in them.

invitation to the wedding of his son 15th March 20xx at hotel



•

Acknowledge the invitation in first person.



•

Use second person for the sender of invitation.



•

Mention acceptance/regret.



•

Specify the reason in case of refusal.



•

Use warm and simple language.



•

Do not exceed the word limit (usually 50 words).



Marking Scheme Format : 1 / Organisation of Ideas: 1/Content : 2 / Accuracy of Spelling and Grammar : 1

Topic-3

Formal Letter Writing Concepts Covered

 Format and Layout of Formal Letter  How to write application for a job with bio data or resume  How to write Letter to the Editor

Revision Notes communication with non-acquaintances are still conducted through letters.

Introduction Scan to know

Classification of Letters Letters may be divided into the following classes : • Informal letters — These letters are written to close associates. • Formal letters — These are: 1. Business or Official Letters : For making

The most common form of more about this topic written communication is a letter. Although informal letters have now become obsolete, formal communication like Letter Writing commerce, trade, official correspondence, public representation, complaints and other dealings, transactions and



•

354

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

enquiries, registering complaints, asking for

Fundamental Fact

and giving information, placing orders and sending replies.



2. Letter to the Editor : Giving suggestions or opinion on issues of public interest.



3. Application for a Job : Forwarding your

A letter plays an important role in maintaining our communication and relations with friends and relatives, as well as establishing commercial or official relations with authorities.

resume for a job opportunity.

[A] Letter to the Editor Letter to the Editor is written to the editor of a newspaper or a magazine. It is written to highlight a social issue or a social problem to spread awareness and call for an action respectively. It is written with an intention to get it published in the said medium. Main Characteristics: 1. Be brief, clear and to the point.

Format Sender’s Address ............................... ............................... Date Receiver’s Designation Receiver’s Address .................................... ....................................



2. Use separate paragraphs for separate topics.

3. The first para should indicate the theme of the letter. 4. Make factual statements.

Sir,



5. Use simple and direct language. Avoid the use of

Subject : (In bold/ block letters. It should be underlined)

long and high sounding words and ambiguous construction. 6. Even while lodging a complaint or making criticism, you should be polite and courteous.

7. Avoid common-place and clumsy expressions. 8. Use a proper layout/ format for these formal letters.

Introductory para ................................................... ................................................................................. ................................................................................. ........................ Main body of the letter ............... ................................................................................ ........................ Concluding para ............................



9. Use of punctuation marks is dispensed within the block format.

10. Remember the following points about block format:



(a) There is no indentation.



(b) Each block begins with the margin on left hand

Yours sincerely Signature (Full Name in Capitals) Designation (Optional)

side.



(c) Extra space should be left between different sections and paragraphs.



(d) Omit punctuation marks in address and date. A comma (,) may be put after the salutation.











11. You may use the following layout for logical flow of

[B] Application for Job The application for a job may be written with or without a bio-data. In case it is written without a bio-data, the main body of the letter should contain the following information:

ideas.

1.

Personal information, e.g. age, health, gender etc.

Para I : Introduction of theme/issue

2.

Educational/ professional qualifications

Para II : Causes

3.

Experience/ suitability for the job.

Para III : Consequences/Results Para IV : Suggestions to overcome the problem

The format is same as that of a letter to the Editor.



ENGLISH CORE

355

5. Telephone Number/ Mobile Number ………………...

The application for a job is accompanied by a bio-data

6. Email ……………………………….....................………..



BIO-DATA or CURRICULUM-VITAE (C.V.):

(a) Secondary : School attended, course, examinations



the candidate, pertaining to the job requirement.

7. Educational Qualifications

a formal official letter with proper format, language and style. The following features must be mentioned in the bio-data:









(c) Technical/Professional : Degree or diploma





obtained: institution/university

(d) Any other

under the heading ‘Bio-data’. The covering letter will be

(b) Tertiary : College, university, exam., division.



enclosure. The relevant information will be included

passed, grades obtained.



The letter with bio-data will have the bio-data as an



curriculum-vitae (C.V.). It contains full information about



of the applicant. The bio-data is also called resume or



8. Experience (Name of institution, position held, nature of duties, duration)

Mnemonics





(ii) ........................................................................................



(iii) ........................................................................................

9. Present Employment (Optional)



(a) Organisation ................................................................



(b) Position .........................................................................

(c) Salary drawn ...............................................................



Concept: Effective Writing Mnemonic: CODER Interpretation: • Collect all the ideas. • Organise the ideas by putting common ideas together. • Draft them sequentially. • Edit wherever needed, eliminate repeated thoughts. • Review or revise the final structured writing.





(i) ........................................................................................

10. Hobby ..................................................................................

1. Name in full ………………………………………………

11. Languages known ………………………………………..

2. Father’s Name….……......………………………………..

12. References (Name, designation, official address)











BIO-DATA



1. …...………………………………………………………



3. Date of Birth/Age…….....………………………………..



2. …...………………………………………………………



4. Permanent Address …….......……………………………



13. Signature

Topic-4

Article Writing Concepts Covered



Format and Layout of Article Writing  How to write an Article

Revision Notes Fundamental Facts

Introduction An article is an expression of one’s thought on an issue or

The newspaper article is predominantly based on facts, whereas the magazine article usually consists of the report of a factual event in a summarized form/ expression of ideas on any interesting topic.

a subject logically and coherently written in meaningful paragraphs.

Main Characteristics: 1.

Give a title that catches the attention of the reader.

2.

Begin with a striking opening sentence which

356

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

addresses the readers and gets them interested in the

Mnemonics

3.



topic. Present a strong argument for your ideas supporting

Concept: Article Writing Mnemonics: BELLE CNG Interpretation: B: Be ardently passionate. E: Embrace failure with a smile. L: Learn to challenge your limits. L: Learn your craft by practising regularly. E: Enjoy writing trivia. Let your work percolate, before you brew it. C: Creativity is cyclical. N: Nurture your creativity. G: Good critiquing should inspire you, not dampen your spirits.

4.



it with evidence or elaboration. Use

linking

devices

(‘however’,

‘therefore’,

‘although’, ‘even though’, ‘in order to’) to make the Introduce a new point at the beginning of each



5.



composition appear a whole.





paragraph that follows to strengthen your ideas. 6.

Develop your ideas as much as you can to make them

8.

Use passive voice, humour, emotive language,



Conclude with your strongest point.





7.



interesting and substantial.

rhetorical questions to provide a specific effect.

Fundamental Facts



FORMAT: Part 1 – Heading: It should be captivating and need

1. Article writing is the process of inventing or rather presenting your thoughts in an appealing way. The writer thinks critically and reshapes something known into something that is different and original. Each piece of writing has a purpose and is targeted at an audience. It is organized cohesively with a clear beginning, middle and an end. Attention is paid to choice of apt vocabulary, figurative use of language and style.

not exceed more than 5 to 6 words. Unnecessary



punctuation marks shouldn’t be used in the heading. Part 2 – Byline: It contains the name of the writer of



the article. Part 3 – Body: It is the main content part of the article.



It consists of at least 3 to 4 paragraphs. Paragraph 1: This is the introduction paragraph. It reveals the theme of the article. A quotation or striking facts, here, excite the interest of the readers.



to start with a quotation/ some statistics based on

Repetition: Repeating an idea in different words.



Paragraph 2 & 3: These paragraphs deal with a



The language used should be simple. A good way

Verbosity: Using more words than are necessary to express an idea.

research/ with a question.



2. Things that must be avoided by a Writer:



complete analysis of the theme of the article. Analyse and explain different types of problems/



* Explain the current scenario of the problem and







issues related to the topic. the actions taken to resolve them. This may include



* Develop the cause and effect relationship by



advantages or disadvantages of the issues too.



Paragraph 4: This is the concluding paragraph. An article shouldn’t be left open-ended. Sum up all the points raised or issues highlighted giving a food for thought or a planned action.



supporting it with factual information.

Pedantry: Using high sounding, difficult and obscure words instead of simple short ones. Periphrasis Or Circumlocution: Using a roundabout way of saying a simple thing. Archaic Words: Use of outdated words and phrases. Colloquialism: Words or expressions used in familiar conversation such as ‘tis, bike, phone. Slang: Specific colloquialisms invented for humour and vividness in expressions such as cool dude, damn. Indianisms: Translating the idioms and expressions of Indian languages literally. Mixed Metaphors: Comparing a thing to two or more things. CBSE Support Material



ENGLISH CORE

357

Format of an Article Heading -by ABC .............................. Introduction ............................................................................................................... ..................................................................................................................................................................... ..................................................................................................................................................................... ..................................................................................................................................................................... ..................................................................................................................................................................... .................. Content/Problem/Opinion .................................................................................................. ...................................................................................................................................................................... ........................ Solution/Conclusion ....................................................................................................... ......................................................................................................................................................................

Topic-5

Report Writing Concepts Covered



Format and Layout of Report Writing  How to write a Report

Revision Notes Introduction

•

A report is a brief account of an event that has already

•

Write the name of the reporter.

•

Provide a suitable title/ heading.

•

Write in past tense.

•

Write in reported speech and use passive form of

taken place. The report helps in recording the events of importance that occur in our day-to-day life. It attempts to present the first hand information of an incident or event. A report of an event presents a record of events that took place. A report of an event includes one’s ideas, opinions and impressions about the event.

Types of Reports

(people around or affected by the event).

expression. • •



4. A report about an enquiry or survey.

Main Characteristics •

Mention the occasion, place, date, time and other

•

consequences,

Write in a less formal and more descriptive manner, Present your ideas and impressions to make the

Format 1. Headline 2. Byline (Name of the reporter) 3. Opening paragraph 4. Details (Next two paragraphs) 5. Conclusive statement

Mention Chief Guest/Guest of Honour.

reasons,

report interesting.

relevant facts about the event. •

(causes,



witnessed.

ideas

while writing a report for a school magazine.

organisation. 3. A report about an accident/happening that you have

Develop

opinions) logically.

1. A newspaper report. 2. A report about an event or function at school/institute/

Include information collected from the eyewitness

(It can either be a summary of the whole situation, a conclusion, condemnation, appeal or warning)

358

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Specifications Headline: Every news article has a headline to attract the attention of the reader. The headline must state the topic of the news in a strong but crisp phrase or statement. A headline must be: •

catchy & brief

•

brief-articles, prepositions, etc. must be left out wherever possible; abbreviations and shortened word-forms may be used wherever required

Byline: The line with the writer’s name is called the ‘By’ line because it tells by whom the article is written. Lead Paragraph: A lead paragraph usually answers the questions: Who, What, Where, When, Why. The report usually begins with the name of the city where the report is being written and the date when it is being written. Remember to write about these in the lead paragraph•

day, date, and time when the incident happened

•

name/ names of the person(s)/ event(s), etc. that the

news is about •

a place where the incident happened

•

details of the incident

•

reasons why the incident happened

Paragraph 2: The second paragraph should tell the reader how the incident happened in detail. Narrate the incident in chronological order. Since the reports need to be concise elaborate details are left out and only the most relevant information is included. Paragraph 3: Eyewitness accounts should add to the authenticity of the news. Also, they may interest the reader. Include some quotes from the eyewitness’ comments. Also, describe what they felt about the incident. In case of report of a school/college function, quote a line from chief guest’s speech. Paragraph 4: •

Describe the planned future course of action.

•

Remember to use simple, clear but formal language. 



ENGLISH CORE

359

PART - C : LITERATURE (FLAMINGO)

1

THE LAST LESSON —Alphonse Daudet

Revision Notes Introduction ‘The Last Lesson’ is set against the backdrop of the Franco–Prussian war (1870–71) in which France was defeated by Prussia in the war led by Bismark. Prussia, then consisted of what now are the nations of Germany, Poland and parts of Austria. In this story, the French districts of Alsace and Lorraine have passed into Prussian hands. This story also shows the effect of this incident on the normal life in the schools. It also highlights the pain that was inflicted upon the people of a territory by the conquerors, who took away the rights of the people to study or speak their own language. The story portrays the incident as a tragic one and displays the emotional intensity felt by the people, when they are deprived of learning their own language. It also highlights the importance of a language and utility to fend it for the continuity of a race.

Summary As Franz started very late for his school that morning, Scan to know he was in great fear, especially because more about his teacher Mr. Hamel had said that he this topic would put up questions on participles and Franz did not know anything about it. For a moment, he thought of running away and spend the day out. It was a warm and bright day. Birds were The Last Lesson twittering outside and soldiers were practicing. All these things were more attractive than the rules of participles, but anyhow, he forced himself to move hurriedly towards the school. When he was passing the town hall, there was a crowd in front of the bulletin board. For the last two years, all the bad news like the lost battles and the orders of the commanding officers, had been displayed on that notice– board. “What could be the matter then?”, he thought without stopping. The blacksmith, who had read the bulletin, told Franz not to hurry. There was plenty of time he had told him, but Franz did not slow down. He thought that the blacksmith was poking fun at him. Franz wanted to reach his desk unnoticed. He hoped that there would be noise and commotion as usual. He depended on this noise and bustle to reach his desk unnoticed. However, he was surprised as the school was unusually quiet. Students were sitting quietly in their seats. Mr. Hamel was not rapping his ruler on the table. He was moving up and down with the ruler under his arm. He too looked grave and quiet. There was no chance of Franz entering the room

unnoticed. He had to open the door and enter in front of everyone. Unexpectedly, Mr. Hamel did not rebuke him. Instead, he spoke kindly to him and told him to go to his desk. When Franz had settled down, he looked at Mr. Hamel. There was another surprise for him. Mr. Hamel had put on his beautiful green coat, his frilled shirt and his embroidered black silk cap. He used to put on these clothes only on special occasions, but it was no special day. Franz could not understand why Mr. Hamel had put on those Sunday clothes. There was still another surprise in store for Franz. There were village people on the back benches that had always been empty. The former Mayor, the former Post Master, the old Hauser with his triangular cap and some other village people occupied those back benches. Mr. Hamel climbed up his chair and spoke to his pupils in a gentle and serious tone. He told them that an order had come from Berlin. French would not be taught to them anymore. Instead, German was going to be taught and the new teacher was expected to arrive the very next day. The students were going to have their last lesson in French that day. Now, he knew, what order was there on the bulletin board, and why the blacksmith had told him not to hurry. He could also see why Mr. Hamel had put on his best clothes. Mr. Hamel’s words struck Franz like a thunderbolt. He was lost in thoughts. He had hardly learnt how to read and write, he felt that he would have to stop forever. He was sorry to have wasted his time. He had always been enjoying himself outdoors. He had hated his books. He had dreaded Mr. Hamel and his iron ruler, but his attitude suddenly changed. He felt that his books were good companions. He did not mind Mr. Hamel’s ruler and rebukes. Now, he also understood why the people of the village were there. They were also sorry that they had not been to school for enough time. Now, they had come to thank the teacher for his faithful service. Mr. Hamel asked Franz to tell the rule for the participle. Franz wished he could tell the rule, but he failed miserably. Mr. Hamel did not scold Franz. He said Franz was not the only person to blame. The people of Alsace had never been interested in learning. The people always put it off till the next day. Franz’s parents wanted Franz to earn some money instead of going to school. Mr. Hamel said they were strange Frenchmen who could not write or read their own language. He also blamed himself. He said sometimes he had closed the school when he had wanted to go fishing. Mr. Hamel, then, praised his mother tongue. He said that French is the most beautiful, most logical and the clearest language in the world. He exhorted the people to stick to



ENGLISH CORE

it. He assured them that if they held fast to their language, they would be able to get rid of the Prussian rulers. Their language was the key to their freedom from slavery. It was M. Hamel’s last day at school, but he had the sincerity and commitment to carry out his teaching work as usual. He taught grammar as the last lesson. Atmosphere in class was very appealing. The teacher was teaching genuinely and honestly, students and others were studying with utmost concentration. Franz listened to his lesson attentively. He felt Hamel had never explained the lesson so vividly ever before. It appeared to him that on that last day, he wanted to give his pupils all the knowledge he possessed. Later, the students were given writing exercise. M. Hamel had brought new copies for the class that day and so everyone was engrossed in their work. Even the little children, when asked to trace their fishhooks, did it with utmost perfection as if that was French too. Just then, the pigeons cooed very low and Franz wondered sarcastically if Prussians could force pigeons to sing in German. While the class was in motion, M. Hamel sat motionless. It appeared as though he wanted to inscribe this classroom scene in his mind. For 40 years he had served in that school and now he had to leave the very next day, without any notice and without any formal farewell even.

361

The church clock struck twelve. It was the time for the school to close. Mr. Hamel wanted to say something, but he was overwhelmed with emotions. He wrote “Vive La France” (Long Live France) on the blackboard and with a wave of his hand, dismissed the class.

Key Words dread: fear drilling: practice exercises apprentice: trainee counted on: rely upon commotion: stir thunderclap: thunderbolt puts off: postpone reproach: mock angelus: the ringing of church bells announc-

ing the Angelus – a midday prayers sung by the catholic vive la France: long live France mounted: ascended linguistic chauvinism: dominance or superiority of one language over the other 

LOST SPRING (STORIES OF

2

STOLEN CHILDHOOD) —Anees Jung

Revision Notes Introduction This story is written by a famous short–story writer Anees Jung. She was born in Rourkela and spent her childhood and adolescence in Hyderabad. She received her education in Hyderabad and in the United States of America. She began her career as a writer in India. She has been an editor and columnist for major newspapers in India and abroad and has authored many books. The following is an excerpt from her book titled ‘Lost Spring, Stories of Stolen Childhood’. Here, she writes about the utter poverty and traditions which force children to a life of exploitation. Anees Jung highlights the utter destitution of ragpickers of Seemapuri and the bangle makers of Firozabad. They can be seen loitering around near the heaps of garbage to find a rupee note or a coin or something that they can sell. They have no school to go to, no work to do. They are

neglected by society as well as by their parents. For most of us, they do not seem to exist. The ragpickers’ families in Seemapuri came from Bangladesh because their fields were washed away and they were forced to starve. The other part of the story deals with the unenviable lot of the poor bangle makers of Firozabad. They have been traditional bangle makers. They are poor, illiterate, and fatalists. They cannot alter their lot. They find themselves caught in the web of middlemen and moneylenders who are supported by law enforcing authorities and they live in filth and squalor. About 20,000 children help their parents in bangle making. Though this type of child labour is illegal, yet it goes on unabated. One of the children, Mukesh wants to give up his work. He dreams to be a motor mechanic. However, he will have to cross a few hurdles before he can realise his dream.

362

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Key Words looking for: searching for perpetual state of poverty: never-ending poverty

slog their daylight hours: work hard throughout the day

dark hutments: house with very less light roof over his head: a house to live imposed the baggage on the child: forcibly put burden on the child

Summary ‘Sometimes I find a rupee in the garbage.’ The author comes across a boy, Saheb Scan to know more about every morning. She always found him this topic searching for something in a heap of garbage. When he was asked why he did it, he replied, ‘I have nothing else to do.’ She told him to go to the Lost Spring school, but there was no school in his neighbourhood. She told him that she was going to start a school. Saheb was happy. He would go to her school, but she did not intend to start a school. Saheb’s full name was Saheb–e–Alam. It means the ‘Lord of the Universe’. However, the poor boy wandered on roads along with other barefooted poor boys like him. The author talked to the other companions of Saheb. One of the barefooted boys said his mother would not bring his chappals down from the shelf. One of them was wearing shoes though they did not match. Another boy who never had footwear, wished he had a pair of shoes. Many children walk barefoot. Some people argue that lack of money is not the reason. It is a tradition to walk barefoot, but the author does not agree with them. She asserts that perpetual state of poverty is the real cause. Some children are lucky. Their prayers to get shoes have been granted, but the rag pickers remain barefoot. The ragpickers live in Seemapuri. Therefore, the author went there. Seemapuri is very close to Delhi, but there is a world of difference between the two. Like all other families of rag pickers, Saheb’s family came from Bangladesh in 1971. They came there because their homes and fields were destroyed by floods. They had nothing to live on. About 10,000 rag pickers live in Seemapuri. They live in mud structures with roofs of tin and tarpaulin. They lack all civic amenities like sewage and running water. Living in Seemapuri enables them to cast their votes. They move about and pitch their tents wherever they can find food. Rag–picking is their sole means of earning a livelihood. Saheb used to stand outside a club. He watched two young men playing tennis. Tennis fascinated him. He wished to

play tennis. Someone gave him a pair of discarded tennis shoes. Half of his dream came true. Of course, playing tennis was out of his reach. Saheb got a job at a tea stall. He was paid 800 rupees a month and all meals. Still, he was not happy. He lost his carefree look and his freedom. He was no longer his own master.

‘I want to drive a car.’ The author visited Firozabad. Firozabad is famous for its bangle making industry. Almost every other family in Firozabad is engaged in making of glass bangles for women all over India. Glass bangles are a symbol of bliss for a married woman’s life. She came across a boy named Mukesh. His family too was engaged in manufacturing bangles. Mukesh took her to his house. They went through stinking lanes choked with garbage. Families of bangle makers lived there. Their houses had crumbling walls and wobbly doors. They entered Mukesh’s house which was like any other house in the lane. A frail young woman was cooking meals on a firewood stove. Her eyes were filled with smoke. She greeted the author with a smile. She was the wife of Mukesh’s elder brother. She was respected as the daughter–in–law of the family. Mukesh’s father also came in. The daughter–in–law covered her face with her veil as the custom demanded. Mukesh’s father was old and weak. He had lost his eyes working on furnaces at polishing bangles. He had worked hard all his life, but he could not afford to send his two sons to school. He could only teach them the art of making bangles. He had built the house but could not repair it. Mukesh’s grandmother expressed her belief in destiny. She said that on account of their karam (deeds) they were born in the bangle makers’ caste. It was their destiny to suffer and no man could change what was ordained by fate. In fact, her belief was shared by all. Another woman told the author that despite hard work, they had never had a full meal in their whole life. The author could see bangles everywhere. She saw boys and girls sitting with parents before flickering oil lamps. They welded pieces of coloured glass that she had learnt. Their eyes got used to dark and they lost their eyesight before they were adults. At home, families worked hard all day before furnaces with high temperatures. All the operations of bangle making cause blindness. Generation after generation, families of bangle makers have been engaged in making bangles. They live in poverty, they work hard, and die in poverty. Nothing has changed with the passage of time. They find themselves in the clutches of middlemen and moneylenders. The police and the administration do not help them. If they try to pull out of the vicious circle, they are in trouble. The police beats them up and puts them in jail. 



3

DEEP WATER —William Douglas

Revision Notes Introduction William Douglas (1898–1980) was born in Maine, Minnesota. After graduating with a Bachelor of Arts in English and Economics, he spent two years teaching at a high school in Yakima. He was an advisor and a friend to President Roosevelt. Douglas was a leading advocate of individual rights. He retired in 1975 with a term lasting thirty–six years and remained for a time the longest period–serving justice in the history of the court. ‘Deep Water’ has been taken from his book ‘Of Men and Mountains’. It was his personal experience. It reveals how as a young boy, William Douglas nearly drowned in a swimming pool. In this extract, he talks about his fear of water and thereafter, how he finally overcame it.

Key Words treacherous: dangerous misadventure: accident subdued my pride: reduced or lowered selfrespect

bob to the surface like a cork: float quickly to the surface like a cork curtain of life fell- life ended

Summary Scan to know Douglas was about four years old. He more about visited a beach with his father. They this topic stood in the surf. A powerful wave swept him and knocked him down. He was terrified. He had avoided water since Deep Water then. When Douglas was about eleven years old, he had a desire to learn swimming. The Yakima River was treacherous. Many people had drowned in it. His mother advised him never to try to swim in it, but the Y.M.C.A pool was safe. It was only two to three feet deep at its shallow end. The other end was about nine feet deep and the drop was gradual.

Douglas decided to learn swimming there. He bought a pair of water wings and went to the pool. He paddled with water wings. He imitated others. One day he was sitting all alone on the edge of the pool, when a well–built young man came there. He looked at skinny Douglas and out of mirth, picked him up and tossed him into the deepest part of the pool. Douglas hit the water surface in a sitting position and began to sink to the bottom slowly. Douglas was terrified, but he could think of a plan to save himself. He decided to spring from the bottom of the pool as soon as his toes touched it. He hoped he would pop like a cork to the surface. Then, he would lie flat and paddle to the edge of the pool. As soon as his toes touched the tiled floor of the pool, Douglas bounced with all his strength. But he did not rise quickly. He came up slowly. He opened his eyes. He could see only water. He grew panicky. He was suffocating. He tried to shout, but there was no sound. Finally, his eyes and nose came out of the water. He beat his arms. He tried to raise his legs. But they hung like dead weights. He felt something was pulling him downward again. Once again, he slipped downwards. He had spent all his energy. His lungs ached and his head throbbed. He was getting dizzy. Fortunately, he could remember his strategy. Once again, he sprang from the bottom of the pool. He was paralysed, stiff and rigid. But when he jumped, he could see only water around him. Then, suddenly he reached the surface. His eyes and nose came out of water. But he began to go down once again. Once again, he began to drift downwards. He could make no effort. He was relaxed. There was no fear. There was no panic. It was all quiet and peaceful. He felt as if he were floating in space. He was unconscious. When Douglas regained his consciousness, he realised that he had been saved. He was lying on his stomach. He was vomiting. He heard voices. Someone said he had nearly died. The young man who had thrown him into the pool said that he had done it out of fun.

364

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

After sometime, Douglas went home. He was weak and trembling. The dreadful experience haunted him again and again. A few years later, he went to the waters of the Cascades. He wished to wade into them. The terror seized him again. His legs were paralysed. Whenever and wherever he went fishing, canoeing, bathing and swimming, he was seized with terror. The joy of living was lost. Finally, Douglas decided to get an instructor to help him overcome his fear of water. The instructor helped him bit by bit, piece by piece. First, he put a belt around Douglas and attached the belt with a rope. He held the

up and down, he was not sure that the old fear had left him completely. He, however, was prepared to overcome it if it reappeared. Then, he went to Lake Wentworth in New Hampshire. He dived off a dock at Triggs Island. He swam two miles across the lake to Stamp Act Island. He used all the strokes he knew. Only once did the terror return, but Douglas was able to overcome it at once. He still wanted to test himself, so Douglas went to Warm Lake. There, he swam across the other shore and back. Terror did not reappear. Douglas gave out a cry of victory. His terror of water and his conquest of it, gave him an

end of the rope as they moved up and down the pool. He made Douglas put his face under water and exhale. He held Douglas on the side of the pool and made him kick with legs. He was with Douglas for about six months. When he felt that Douglas was able to swim alone, he left. Though Douglas was able to swim the length of the pool

insight into the meaning of life and death. He had experienced the fear of death as well as the sensation of dying. He felt there is peace in death, so he lived more intensely. He enjoyed life.



4 

THE RATTTRAP —Selma Lagerlöf

Revision Notes Introduction The Rattrap is written by a Swedish writer Selma Lagerlöf. The story is an interesting one. It is like a fairy tale. There are many interesting incidents and dialogues. The rattrap seller is a homeless tramp. He stays for a night in the cottage of a crofter. The lonely crofter entertains him like a guest and a trusted friend. He tells him everything, but in the morning, the peddler comes back, smashes a window pane, and steals the crofter’s money. Later, there is a turn in his fortune. The ironmaster mistakes him for an old

comrade. The peddler is the ironmaster’s guest for about two days. It was the ironmaster’s daughter’s kindness that bought a change of heart in peddlar. There is a philosophical angle too in the story. The lonely tramp is a philosopher too. Not only does he make rattraps to sell, he thinks that the world too is a rattrap. As rats are lured by pork and cheese to enter the trap, so are men lured by lands, food, shelter, clothing etc. These are different baits. Those who touch them are trapped. He knew a few persons who were already trapped and others who were trying to bite the bait and get trapped.

Key Words keep body and soul together: earn just enough

arrogantly

for living

eased his way: made himself comfortable

hunger gleamed in his eyes: appeared hungry

fallen into a line of thought: imagined a new

plods along the road: walks along the road

thought

unwonted joy: unusual happiness

things have gone downhill: to become worse

impenetrable prison: situation of no escape nodded a haughty consent: gave approval



ENGLISH CORE

Summary A rattrap peddler went around selling small rattraps. His clothes were in rags. His cheeks were hollow. He had the looks of a starved man. He made wiretaps. Sometimes, he resorted to begging and a little stealing to survive. The world had never been kind to him. He had no home, no shelter.

Scan to know more about this topic

The Rattrap

The peddler led a lonely life and was given to meditation. One day, while he was thinking about his rattraps, an idea struck him. He thought that the world itself was a rattrap. As pork and cheese serve as baits to trap rats, the world offered land, clothes, foods, joys and riches to trap people. As soon as anybody touched them, the trap closed on them. He was amused to think of some people who were already trapped and some others who were trying to reach the bait. It was a cold evening in December. He saw a grey cottage on the roadside. He knocked at the door and asked for a night’s shelter. The owner of the cottage was a lonely old crofter. He wanted someone to talk to. He welcomed the peddler. He gave the peddler hot porridge to eat and tobacco to smoke. Then, they played cards. The crofter was generous as well as trustful. He told the peddler that he had a cow and that he sold milk and cream. He also told him that he received thirty kronors as payment of the previous month. Then, he took down a pouch and showed him the money. Then, he put the money back in the pouch and hung it on a nail in the window frame. Next morning, the peddler left. The crofter locked his cottage and went away. The peddler came back to the cottage. He had been tempted to steal the money that hung like a bait in the window frame. He smashed the pane and stole the money. Now he thought that it was not safe to walk along the public highway. So, he went into the woods. There he walked and walked, but could not get out. He was tired. He looked upon the forest as a rattrap in which he was caught. He thought his end was near. He laid down to die. After a while, he heard the regular thumping of a hammer’s strokes. He knew the sound was coming from some iron mill. He stood up and walked in the direction of the sound. He opened the gate of the works and went into the forge. The blacksmith and his apprentice were there waiting for pig iron to be ready to be put on the anvil. It was the Ramsjo Ironworks. The blacksmith hardly took any notice of his presence. It was not unusual for a vagabond to come in for shelter

365

and warmth. The owner of the work was very particular about the quality of the iron he produced. On one of his visits, he came into the forge, he looked intently at the peddler’s face. He felt sure that the peddler was one of his old regimental comrades Captain von Stahle, who had fallen on evil days. He invited the peddler to come home with him for Christmas. But the peddler was alarmed. He refused and the ironmaster went home. The ironmaster sent his daughter Edla to persuade the peddler to come home. She came in a carriage with a large fur coat. She could see that the peddler was unwilling to accept the invitation because he was afraid. Perhaps she thought, he had stolen something or had escaped from jail. She spoke gently to him. She assured him that he would be free to leave when he pleased. They wanted his company only over Christmas Eve. The peddler felt confidence in her. He agreed to go with her. On the way, he was sorry to have stolen the crofter’s money that had put him in a trap. The ironmaster was happy to have his old regimental comrade under his roof. He planned to feed him well and give him some respectable work. The servant cut the peddler’s hair and bathed him. The peddler appeared wearing one of ironmaster’s fine suits. However, when the ironmaster looked at him in the daylight, he felt he had made a mistake. The peddler was not Captain von Stahle. He thought that the man had deceived him. He even thought of handing him over to the sheriff. The peddler said that he had not pretended to be what he was not. He had not been willing to go to the iron-master’s house. Even then, he was ready to put on his rags and leave. He also told iron master that the world was a rattrap and he too might be tempted by a big bait while getting caught in the trap. The iron master told him to leave at once. Edla did not like her father’s asking the poor peddler to leave. She thought it was unfair to turn away the man whom they had invited. She wanted to have the joy of entertaining a homeless wanderer on Christmas. She stopped the peddler and her father gave in. Edla served food to the peddler. In the evening, during Christmas party, he was given Christmas presents which he thankfully received. Edla told him that her father’s coat that the peddler was wearing was also a Christmas present. She assured him that he would be welcomed again if he liked to spend the next Christmas Eve with them. Next morning, the ironmaster and his daughter went to Church. There they learned that the peddler was a thief. He had robbed the crofter. The ironmaster was sure that the peddler must have made away with their silver. Edla was dejected. But when they reached home, they learned

366

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

that the peddler had left. But he did not take away anything. On the other hand, he had left a Christmas present for Edla. Edla opened the present. It was a tiny rattrap. Edla was happy to see that the peddler had left the crofter’s money behind. There was a letter also. It was addressed to Edla. He had thanked her for the kindness. He wanted to do a good turn to her, so he had left the

crofter’s money and had requested her to return it to the crofter. He said that he was treated as a real captain. That was why he could come out of the rattrap in which he had been caught. He had signed the letter as Captain von Stahle.



5 

INDIGO —Louis Fischer

Revision Notes

Introduction

and surrender the entire product to the landlord as rent. Harvesting indigo was an unpleasant job.

Louis Fischer was an admirer of Gandhiji. He met

However, the things changed. Germany developed

Gandhiji several times and wrote his biography, ‘The Life

synthetic indigo.

of Mahatma Gandhi’. This lesson ‘Indigo’ is taken from

Naturally, the prices of indigo were sure to plummet.

that book.

Harvesting indigo was no longer profitable. Therefore, the

Gandhiji considered Champaran a turning point in his

landlords offered to release the peasants of the irksome

life. Probably, it was the turning point in the history of

job of harvesting indigo. They demanded compensation

India. Gandhiji visited Champaran in 1917. The British

for it. Illiterate peasants, who did not know the real motive

government was well-trenched in India at that time.

of the British landlords, gladly agreed to this while there

Indian masses had a deep-rooted fear of the British.

were others who resisted.

An illiterate man Rajkumar, was greatly perturbed by

Soon, the peasants learnt about the synthetic indigo.

the injustice meted out to Indian peasants by the British

Then, those who had paid compensation demanded

landlords. The cause of the problem was indigo and the

their money back. The landlords hired thugs to calm

greed of the landlords.

them down. The peasants engaged lawyers. At this point,

The British landlords owned large estates in Champaran.

Gandhiji visited Champaran. He felt it was no use going

In those days, harvesting indigo was very profitable. The

to courts. He wanted to free the peasants from the fear of

British landlords, through a long-term agreement, forced

the British. Gandhiji campaigned their cause and finally

Indian tenants to plant 15% of their holdings with indigo

succeeded. He remained firm, fearless, and dedicated.

Key Words Convention: assembly, session

Desertion: abandonment

Delegates: in particular, an elected representative

Unlettered: Illiterate

sent to a conference

Defiance: opposition

Irksome: irritating

Grievances: complaint

Tenacity: perseverance

Vehement: passionate

Yeoman: a servant in a royal or noble household Pestered: troubled



ENGLISH CORE

.Summary Scan to know The annual convention of the Indian more about National Congress was held in Lucknow this topic in December 1916. A poor illiterate peasant came there to complain against the injustice meted out to the peasants Indigo in Champaran. He met Gandhiji. Gandhiji had never heard of Champaran. He had many engagements. So, he did not give any assurance to Shukla, but Shukla was resolute. He followed Gandhiji wherever he went. At last, Gandhiji fixed a date. He told Shukla to meet him in Calcutta on that particular date.

In Calcutta, Gandhiji found Shukla waiting for him. Both of them went to Patna by train. Shukla led Gandhiji to the house of a lawyer, Rajendra Prasad. He became the first President of India. The lawyer was out of town, but the servants knew Shukla. He had been there several times to request the lawyer to help the indigo sharecroppers. They let them stay on the grounds, as they mistook Gandhiji for another peasant and untouchable. They did not allow them to draw water from the well lest the entire water in the well should become polluted.



Gandhiji decided to break his journey to camp at Muzaffarpur, because he wanted to gather more information that Shukla had been unable to provide. He sent a telegram to Professor J. B. Kripalani whom he had met at Shanti Niketan. Kripalani came to the station with his students to receive Gandhiji. At Muzaffarpur, Gandhiji stayed in the house of Mr. Malkani, a government school teacher. In those days, Indians were afraid to harbour men like Gandhiji who were advocates of home rule, but Malkani had the courage. The news of Gandhiji’s arrival in Muzaffarpur and his mission spread quickly. Sharecroppers came to Muzaffarpur to see him. The lawyers also called on him. They briefed him about their cases. Gandhiji chided the lawyers for collecting heavy fees from poor peasants. He thought the most important thing was to free the peasants from the fear of their British landlords. British landlords held large estates in Champaran. Indians worked as sharecroppers on their land. By a long term agreement, the sharecroppers were compelled to plant 15% of their holdings with indigo and surrender the entire indigo produced to the landlords as rent. Harvesting indigo was an irksome business for the peasants. Recently, the landlords had heard that Germany had developed synthetic indigo. British landlords knew that the prices of indigo would fall and planting indigo was no longer profitable. They offered to release the

367

sharecroppers from their obligation to harvest indigo. But the Britishers demanded compensation. Many peasants agreed, while a few of them resisted. Soon, the peasants learnt about the synthetic indigo. Those who had paid compensation demanded their money back. A dispute arose between the landlords and the sharecroppers. The landlords hired thugs. The sharecroppers engaged lawyers. Gandhiji wanted to get the facts. He visited the Secretary of the British Landlords Association. However, the secretary refused to give any information saying that Gandhiji was an outsider. Gandhiji told him that he was not an outsider. Then, Gandhiji called on the commissioner of Tirhut Division. He was rude to Gandhiji. He told Gandhiji to leave Tirhut immediately, but Gandhiji did not leave. Motihari was the capital of Tirhut. Gandhiji made it his headquarters. He started his investigations. A peasant was maltreated in a nearby village. Gandhiji decided to go and find the facts, but the police stopped him. He was served with a notice to leave Champaran. Gandhiji wrote back that he would not concede the notice. Consequently, Gandhiji was summoned by the court. Gandhiji sent a report to the Viceroy. The peasants learnt that the Mahatma who wanted to help them was in trouble with the authorities. Thousands of peasants gathered around the court building. This spontaneous show of their courage baffled the British authorities. They felt powerless. Gandhiji helped them to regulate the trial. In the court, Gandhiji pleaded guilty. He asked for penalty. He read out a statement. He said he was faced with conflict of duties, he respected the lawful authority. He was not a law-breaker. However, he could not disregard the voice of his conscience to do the humanitarian and national service. The judge said he would take several days to deliver the judgement, but he let Gandhiji go free. Gandhiji asked his lawyer friends what they would do if he went to jail. They replied they would go home. Gandhiji asked again what would happen to the poor peasants. Then, the lawyers felt ashamed. Gandhiji, who was a stranger, was willing to go to jail for their sake. The lawyers claimed to have been serving the peasants. Going home would mean a shameful betrayal. They told Gandhiji that they too would follow him to jail. Gandhiji was pleased. He declared that the battle of Champaran was won. He, then, divided the group into two pairs and put down the order in which each pair would court arrest. However, the Lieutenant Governor of the province

368

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

decided to drop the case against Gandhiji. This was the victory of civil disobedience. Gandhiji and lawyers now proceeded to conduct an enquiry. They recorded the statements of thousands of peasants. In the meantime, the Lieutenant Governor summoned Gandhiji. After long interviews, the Lt. Governor constituted an official commission of enquiry to go through the indigo peasants’ complaints. The commission comprised of British officials, landlords and Gandhiji as the sole representative of the sharecroppers. The commission collected the crushing evidence against the British landlords. The landlords were nervous. They agreed in principle to refund the peasants’ money that they had extorted illegally. Gandhiji demanded 50% of it, but the landlords offered only 25%. Gandhiji agreed to it. He had won a moral victory. Gandhiji explained that the amount was not important. By agreeing to refund the peasants’ money, the landlords had lost their prestige. They were no longer dreaded. The peasants learnt that they had rights and there were people to defend their rights. The landlords abandoned their estates which went back to the peasants. This was the end of indigo



6

sharecropping in Champaran. Gandhiji was not satisfied by just winning the indigo battle. During his stay in Champaran, he saw that the people of Champaran were socially and culturally backward. He decided to remove their backwardness. Gandhiji decided to open primary schools. He appealed to teachers, two of his young disciples, their wives and several other volunteers. Gandhiji’s wife Kasturba taught about personal hygiene and community cleanliness. Gandhiji had come to Champaran casually at the entreaty of Shukla. He had expected that his visit would last a few days. However, he had to stay there for seven months continuously. He kept a distant watch on the Ashram. He called for regular financial accounts. He even wrote to them that it was time to fill in the old latrine trenches and dig new ones. Charles Freer Andrews was a devoted follower of Gandhiji. He came to Champaran. Gandhiji’s lawyer friends wanted Charles to stay on to help them. But Gandhiji opposed the idea. He said they should not seek an Englishman’s help in their fight. They must fight their battle themselves. For Gandhiji, self-reliance, India’s independence and helping the sharecroppers were all bound together. 

POETS AND PANCAKES —Asokamitran

Revision Notes Introduction This piece, Poets and Pancakes, is taken from Asokamitran’s book ‘My Years with Boss’. Asokamitran worked in The Gemini Studios. His duty was to cut out newspaper clippings on a wide variety of subjects and preserve them in files.

few buildings which were supposed to have been Clive’s residences. Asokamitran does not believe all this to be true. Lord Clive’s stay in India was very short. He lived in Madras for still shorter time. He couldn’t have lived in all these houses.

Gemini Studios was located in Madras (Chennai). Film–making was at its infancy in India. Asokamitran humorously in a rambling style. To begin with, he talks

‘Pancakes’ was a strange brand name for a makeup material. The Gemini Studios bought truckloads of this material. It was used by the make-up department. The author humorously says that it made decent looking boys and girls ugly.

of the make-up department of the studios. It was at the upstairs of a building that was popularly supposed to have been Lord Clive’s stables. Then there are quite a

Talking about the make–up department, he talks of his office boy. He was in fact a grown-up man of forty. He aspired to be a director or a top star, but he remained



ENGLISH CORE

an office boy. He blamed his neglect on Subbu, who was considered to be No. 2 in the Gemini Studios. Now the author tells us about Kothamangalam Subbu. He was a talented person. He was a poet, novelist, actor and film maker, all rolled into one, but he had no aspirations. He was loyal to boss. Then he tells us of the legal advisor who was a member of the story department. He wore western clothes and looked odd among khadi-clad writers and poets, who were averse to communism. The legal advisor ruined the career of a talented actress unwittingly.

369

Talking of communism, the author speaks of the arrival of Moral Re-armament Army at the Studios. It was a sort of counter-communism movement. It presented plays in the studios. Their plays influenced Tamil dramas, but their anti-communism had no effect. Later an English poet paid a visit to the Studios. But nobody could understand what the poet said or what the purpose of his visit was. The poet, which the author discovered, was the Editor of the periodical, The Encounter. He wrote an essay on his disillusion with communism. His visit to the Studios had been in this connection.

Key Words blew over: got angry was struck dumb: greatly surprised catapulted into: suddenly became famous a coat of mail: oversized coat with metallic decora-

played into their hands: helped unknowingly the favourite haunt: preferred meeting place heard a bell ringing: recalled, remembered

tions

Summary Scan to know ‘Pancakes’ was the brand name of a more about make–up material. The Gemini Studios this topic bought a lot of it. Many well-known dresses must have used that material. It was used by make–up men to turn Poet and decent–looking players into hideous– Pancakes looking monsters. In fact, it was because most of the shooting of a film was done on the sets. The sets and the studio lights required that every pore of players’ faces was closed. A strict hierarchy was maintained in the make–up department to make the player look ugly. The chief make–up man made the hero and heroine ugly. His senior assistant made the second hero and heroine ugly and so forth. It was the office boy’s job to make the crowd

players ugly. The make–up department had an office boy. He was not a boy but a forty–year–old man. He had joined the Studios years ago. He believed that he had a great talent and hoped to become a star actor, director, screen writer or lyrics writer. But he was frustrated. He blamed his disgrace on Gemini Studios. The make–up department was upstairs in the building that was said to have been Robert Clive’s stables. The make–up room looked like a hair cutting salon because it had large mirrors and lights. The lights gave out intense heat. The person who underwent make–up had a miserable experience of being scorched like that of being in a hell. The make–up department presented a picture of national integration long before AIT began broadcasting

programmes on national integration. In the beginning, the department was headed by a Bengali. He was succeeded by a Maharashtrian who was assisted by people from all parts of India. The nature of author’s job appeared to be insignificant. He was usually seen tearing newspapers. Everybody would walk into his cubicle and want to give him some work to do. The office boy would come in to recite his poems. He wished to impress the author by his talent and how it was going waste on account of Subbu. The office boy was frustrated. Probably, he was jealous of Subbu’s stature. Subbu was very close to Boss. When boss had any difficulty in presenting a scene in a film, Subbu would suggest a number of practical ideas. Subbu was a good poet too. He could write poems of high order, but he deliberately suppressed his talent to write for the masses. He was a novelist too. He had written a novel in which he recreated the mood and manner of Devadasis of early 20th century. He had created life-like characters too. Subbu was an excellent actor, but he never aspired for lead roles. However, whatever minor roles he played, he acted better than the main players. Subbu loved all. Several friends and relatives stayed with him for long periods, but Subbu did not care. He never gave a thought to the money he spent to support them, but the office boy hated him. Perhaps, Subbu appeared to be a sycophant. Though, Subbu was always seen with the boss, he was a member of the story department. Besides writers

370

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

and poets in the story department, there was a lawyer too. Officially, he was known as legal adviser. But people called him by an opposite name. Once, the legal adviser unwittingly ruined the career of a talented actress. One day the actress, who was not seasoned in worldly wisdom, lost her temper on the sets. She spoke angrily against the producer. The legal adviser switched on the recording equipment. When she paused, he played back the record. The actress was dumb founded to hear her own voice. Though she had said nothing offensive, she never appeared on the stage again. The legal adviser wore trousers, a shirt and a tie. Sometimes he wore a coat too. He appeared off among khadi clad poets and writers. The poets and writers worshipped Gandhiji though they had no affiliation to his ideas, but they were averse to communism. They had a notion that a communist loved nobody. He was an anarchist. The feelings against communism were widespread in South India. Moral Rearmament Army was a sort of Anti-Communism Movement. It visited Gemini Studios in 1952. They were about 200 people belonging to at least 20 nationalities. They presented two plays ‘Jotham Valley’ and ‘The Forgotten Factor’ in the most professional manner. The Gemini family of 600 and the citizens of Madras were greatly impressed by their plays. Their message was simple but the sets and costumes were excellent. For many years, the Tamil drama imitated the sunrise and sunset scenes presented by MRA. The scenes were presented on a bare stage with white background and a tune played on the flute. However, the MRA did not influence the outlook of the Gemini bosses. The enterprises continued unchanged. The staff had enjoyed hosting MRA. A few months later, Gemini Studios received another



7

guest. It was an Englishman. Nobody knew who he was. Some said he was a poet, but he was not one of the poets known to them. Some believed that he was an editor because the top men of The Hindu were taking the initiative. However, he was not the editor of any of the newspapers which the staff of Gemini Studios had heard of. The Englishman was welcomed by the boss, Mr. Vasan. He read out a long speech talking of freedom and democracy and then the Englishman spoke. Nobody could understand what he said. His accent had made it impossible, but they were baffled. They could not understand the purpose of his visit. They made Tamil films for simple people who could not be expected to have any interest in English poetry. The visit of the Englishman remained a mystery. The author saw a notice in The Hindu. The Encounter, a British periodical, was organizing a short story contest. The author had never heard of the periodical. He wanted to send an entry. He wanted to have some information about it before he sent the entry. He visited the British Council Library. There he found copies of The Encounter. He learned that its Editor was Stephen Spender, who had visited the Gemini Studios. After a few years, the author had retired. One day, he saw a pile of low-priced paperback edition of ‘The God that Failed’. He bought a copy. It contained six different essays of six different writers. They described writers’ journeys to communism and their disillusioned return. One of the writers was Stephen Spender. The whole mystery of Spender’s visit was cleared. Mr. Vasan was not interested in his poetry but was interested on his views on communism. 

THE INTERVIEW —Christopher Silvester

Revision Notes Introduction

‘The Interview’ is an excerpt taken from ‘The Penguin Book of Interviews’. It is written by Christopher Silvester. In this chapter, the author talks about the



ENGLISH CORE

technique of ‘interview’ as a new way of interrogating. He talks about it with reference to the field of Journalism. Moreover, he also discusses the importance of this new technique. He goes on to state how the interview has become a vital arena in everyone’s lives, regardless of the class, literacy or anything. We learn about the opinions

371

of many celebrities concerning an interview. Thus, it teaches us about the functions, methods and merits of an interview. Moreover, the author also incorporates an excerpt from an interview with the writer, Umberto Eco by Mukund Padmanabhan from ‘The Hindu’. This part allows us to get a glimpse at Umberto’s literary method.

Key Words impressively large. powerful, intense or capable

unwarranted: not authorised intrusion: the action of intruding lionized: give a lot of public attention and approval petitioners: a person who asks for something condemnatory: expressing strong disapproval assault: make a physical attack on vile: extremely unpleasant formidable: inspiring fear or respect through being

Part–I –Christopher Silvester

General Introduction about Interviews Invented 130 years ago, interviews have gained a common place in journalism. Everyone reads interviews. It evokes different responses in different minds. Till date, a large number of celebrities have been interviewed and reinterviewed.

Scan to know more about this topic

The Interview

Diverse Opinions about the Interviews: If something exists in this world, then there are bound to be opinions about it. Good opinions that exist about interviews are that they are the source from which we can derive truth. It provides a good platform for communication. It gives a good idea about our contemporaries. Bad opinions are held by those who are interviewed as they see themselves as victims. An interview, for them, acts as an interference and even seems to make them small and vulnerable in front of others. Primitive cultures believed that by taking photograph one takes the very soul of the person who is clicked V.S. Naipaul, who even received a Nobel prize in literature in 2001 said that people are wounded and lose a part of themselves. Lewis Carrol said that he had a horror of the interviewer and so he never consented to be interviewed. It was his horror of being lionized (or controlled) which

especially one written for a university degree or diploma

hypothesis: theory seminal: influential

made him avoid all acquaintances and interviewers. He even narrated amusing incidences where he managed to avoid these people and run away. Rudyard Kipling also hated being interviewed. He considered it immoral and a crime which deserved punishment. He claimed that only a coward person would become an interviewer and no respectable person would agree to be an interviewee. The irony was that later, Kipling had himself interviewed Mark Twain. H.G. Wells calls interviewing an ordeal, but was a frequent interviewee himself and forty years later interviewed Joseph Stalin. Saul Bellow described interviews as if someone is choking one’s throat. True Nature of Interview: Interviews have many drawbacks, but they are effective medium of communication. According to Denis Brian, the interview is an expressive medium which gives the interviewer a very important position. In fact, our vivid impressions of our contemporaries are through interviews.



Summary

interstice: gap dissertation: a long essay on a particular subject,

Part–II

–Umberto Eco

Interview of Umberto Eco: This is an excerpt from the interview between Mukund Padamanabhan (from The Hindu newspaper) and Umberto Eco, a professor at the University of Bologna in Italy who had already acquired a formidable reputation as a scholar for his ideas on semiotics (the study of signs), literary interpretation, and medieval aesthetics before he turned to writing fiction. The interview revolves around the success of his novel, The Name of the Rose, whose more than ten million copies were sold in the market. The interviewer begins by asking him how Umberto manages to do so many

372

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

different things to which he replies by saying that he has philosophical interests. He has pursued them doing academic works or writing novels. He further justifies and mentions that his books about children talk about peace and non-violence which in the end, reflect his interest in philosophy. Hence, he is doing the same thing and has done only one thing in reality. Interstices: He believes there are empty spaces in one’s life, just like there are empty spaces in atoms and the Universe. He calls them interstices and most of his productive work is done during that time. An Academic Scholar: Umberto identifies himself as an academic scholar who attends academic conferences during the week and writes novels on Sundays. It doesn’t



8

bother him that he is identified by others as a novelist and not a scholar, because he knows that it is difficult to reach millions of people with scholarly work. The Name of the Rose: Talking about his novel, The Name of the Rose, he mentions that it is not an easy-read. It has a detective aspect to it along with metaphysics, theology and medieval history. Also, he believes that had the novel been written ten years earlier or later, it would have not seen such a huge success. Thus, the reason for its success still remains a mystery. But this tremendous achievement also highlights one aspect, that is, the right timing is an important factor for any accomplishment. 

GOING PLACES —A. R. Barton

Revision Notes Introduction

socio-economic position and her dreams and fantasies.

Going Places is a short story by A. R. Barton which presents the perceptions, dreams and desires of an adolescent girl. The readers get a glimpse in the life of the protagonist,

Going Places is a story which reflects an adolescent’s desire for going places. “Going Places” is an idiomatic phrase which refers to a promising young person’s likelihood of becoming successful and famous (e.g. “She’s going places”,

Sophie: her relationship with her friends and family, her

meaning she is going to be successful).

Key Words going places: being successful incongruity: not matching, strange arcade: gallery with an arch prodigy: young person with talent

Summary Sophie and Jansie are classmates and Scan to know more about friends. After a few months, they will be this topic out of school. Sophie is a daydreamer. She tells Jansie that after school, she will have a boutique. Jansie tells her that she will Going Places need a lot of money to have a boutique, but Sophie is not discouraged. She says that she will be a manager and then, she will save money. She hopes to be a fashion designer or an actress too. Jansie

chuffed: became happy wharf: boat pangs of doubts: thoughts of doubt

becomes sad. She knows they have no other option but to work in a biscuit factory. At home, Sophie declares that when she will earn some money she will have a boutique. Her father, who was back from the day’s work, while eating a shepherds’ pie retorted that he would thank her if she could buy a decent house for the family. Her younger brother, Derek, also scoffs at her impractical idea. He remarks that she thinks money grows on trees. Her mother who is bent over the sink, could only sigh. Sophie feels uncomfortable and leaves the room. She goes to her elder brother, Geoff, with



ENGLISH CORE

373

whom she can comfortably share her secrets. Danny Casey is a young football player. He is Irish and plays for the United. He is her hero. She thinks of him all the time. She tells Geoff that she had chance meeting with Danny Casey in the arcade. She asked Casey to give her an autograph, but neither of them had a pen and paper. Geoff tells their father about her meeting with Casey. He calls them her wild stories. Sophie asserts that it is true. Her father tells her that if she talks like that she would be in trouble. He observes that Danny is a promising player, but he is too young. They should take care of him lest he

She suspects that Geoff has told Jansie’s brother about the date too. However, soon she discovers that Jansie knows nothing about the date. Then, Sophie tells her about her meeting with Danny Casey and why she could not get his autograph. She tells Jansie to keep it a secret because she does not wish the neighbours to come to her house and ask about all it. She is scared of her father, she tells Jansie that if her father learns about it, he will murder her. Jansie promises to keep the secret. Sophie, her father, and brothers go to watch the United. There, Danny Casey scores the second goal. Sophie is proud of her hero. Her

should go astray. Sophie likes her brother Geoff. He is an apprentice mechanic. He travels to work every day. She imagines that it is a fascinating world which Geoff visits. She has already begun to imagine riding behind Geoff into that world. She is confident the world will receive her with open arms. She tells Geoff that Danny Casey has asked her to meet him again next week. Geoff can hardly believe her. He thinks that Sophie is too young and Danny must be having a lot of girls. However, Sophie says that Danny has told her that he has no girlfriend. Geoff thinks it is the most unlikely thing. Danny could not have told her all about this. Sophie makes Geoff promise that he will not tell their father about the date. One day Sophie comes across Jansie. Geoff has told Jansie’s brother that Sophie has had a meeting with Danny Casey. Jansie is curious to know all about it. Sophie is alarmed.

father is also happy and goes to the pub to celebrate. Sophie decides to meet Danny Casey. After dark, she goes along the canal to a quiet and secluded place. It was an ideal place for the meeting. There is a wooden bench under a tree. She sits on it to wait for Danny to come. She imagines he is coming out of the shadows. She is excited, but he does not come. Time passes and she begins to lose hope. At last, she is disappointed. She feels he will not come. She thinks now she will not be able to tell Geoff that he was wrong. Geoff had doubted if Danny would come at all. Slowly and disheartened, she walks to the arcade. There she imagines meeting him once again. She asks for an autograph. Once again, they discover that they don’t have a pen and paper. Then, Casey disappears and Sophie stands there as if enchanted by the meeting. Once again, she pictures him as she saw him at the United, scoring a goal and the audience cheering wildly. 

Second Level

Trace the Mind Map

First Level



John Keats (Poet)

• Sad • Sympathetic (tone)

Robert Frost (Poet)



Third Level

According to the poet, a thing of beauty is a source of joy forever. It takes all kinds of sadness from our minds and fills us with happiness (Theme)

A Thing of Beauty

The Road Side Stand (Poem)

My Mother at Sixty-Six

Kamala Das (Poet)

ature (Flamin Liter OETRY go) P

Adrienne Rich (Poet)

Aunt Jennifer’s Tigers

Helplessness Weakness (Tone of the poem)

The poem presents the lives of poor people (the stall owners on the roadside) who find it different to make both ends meet. They wait for city people to buy their wares. (Theme)

The poem depicts the picture of the woman who suffers greatly at the hands of her husband. It throws light on Aunt Jennifer who gives vent to her feelings by embroidering tigers on a panel (Theme)



• Tranquil • Serene (Tone of the poem) According to the poet, introspection and a feeling of universal harmony can solve a lot of our problems. The poet tries to advocates to keep quiet and to shed the ego to realize one’s identity as a human being. (Theme)

Keeping Quiet

Pablo Neruda (Poet)

The poem highlights that ageing is an important phase of human life. It brings a common paradox of human relationship and portrays advancing of mother and the fear of loss and seperation associated with it of the daughter.

Sad Pensive Sorrowful (Tone of the poem)

374 Oswaal CBSE LMP (Last Minute Preparation), Class-XII



ENGLISH CORE

375

Poetry

1 

MY MOTHER AT SIXTY-SIX —Kamala Das



Revision Notes

Key Words



home to Cochin last Friday morning, I saw my mother, beside me, doze, open mouthed, her face ashen like that of a corpse and realised with pain that she was as old as she looked but soon put that thought away, and

Explanation: This confessional poem is as intense in its feeling as it is subtle in its approach. The poem engages with a plethora of mingled emotions ranging from love, pain, nostalgia, sadness and despair. Furthermore, action and emotion are beautifully intertwined in this poem. The idea of movement is central to understanding the poem: the physical movement to the airport, the emotional journey of the poetess and the movement of her mother towards old age are all intermingled in this poem about love, longing and separation.

ashen: pale face wan: sick

The poetess was driving from her parent’s house to Cochin Airport the previous Friday. While inside the car, she happens to see her mother beside her doze off. The striking image of a woman weakened by age, dozing off with her mouth open leaves a very strong impression on the speaker who feels that her mother’s face resembles the pale face of a dead body (like that of a corpse). The thought of her mother rapidly advancing (quite like them in the car) towards death deeply disturbs her and she attempts to put the thought away by looking outside the window.

Scan to know more about this topic

My Mother at Sixty Six

The first part of the poem deals with the sensory and emotional experience of the poet-persona while travelling in the car and the second part deals with her experience at the airport before separating from her mother:





Summary This poem follows a single line of thought and switches between the physical and emotional realms with great fluidity, it is neither necessary nor desirable to differentiate the poem in separate segments.

Driving from my parent’s



‘My Mother at Sixty-Six’ is a poem that confesses a daughter’s painful feelings of fear of losing her mother. In this poem the poetess Kamala Das beautifully highlights the complexities of human relationships. This poem is one of the best examples of human bonding. Firstly, the daughter, that is the poet, is surprised to realize that her mother is aging. Secondly, she notices how the rest of the world appears young and energetic. This is in contrast to her mother who continues to age. Thirdly, the poetess expresses her apprehension over losing her mother if the old woman dies. Finally, the poetess says how she hides her true feelings and smiles outwardly, in spite of being much worried about her aging mother. She fears that she will not see her mother again and so wishes to show her love for her mother.





Introduction

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



















Explanation: This transition from the stillness of the dozing mother to the frivolity and movement of youth through a single glance is simply remarkable. The literary device of contrast is used to bring out the distinctive features of the two different worlds separated by a window pane – one with the infirmity of old age and the other tinted with the frolic of youth. The literary device, personification, is used to describe the trees, ‘sprinting‘. They are compared to children “young trees sprinting’’ while describing their apparent movement as seen from inside the car. The merry children on the other hand, are said to be “spilling” out of their homes, thus providing a fluid nature to their happy movement. The literary device used in this case describes the human subject (children) in terms of an inanimate object. Such a technique is known as chremamorphism and can be understood as being opposite of personification. The movement of the trees and children is in sharp contrast to the dozing posture of her mother. but after the airport’s security check, standing a few yards away, I looked again at her, wan, pale as a late winter’s moon and felt that old familiar ache, my childhood’s fear,



out of their homes,



Trees sprinting, the merry children spilling

but all I said was, see you soon, Amma, all I did was smile and smile and smile...... Explanation: When the speaker looks at her mother standing a few yards from her at the airport security check, the mother’s face is described by the simile “wan, pale as late winter’s moon”. A brilliant imagery of the winter moon is used in this part of the poem. “Winter” is used to evoke a sense of an ending (like the ageing mother), a certain frigid, inert state (like that of a corpse) and the inevitable darkness (death) that is to follow. Also, moon has stereotypically received a feminine treatment, and the simile “as a pale moon” is quite apt to describe the round, pale face of the aged mother. On seeing her mother, the poetess experiences “that familiar old ache, my childhood fear”. Though she doesn’t specifically state what it actually is, we can safely infer that it is the fear of losing her mother. Despite being deeply thoughtful of her mother’s present and future, the speaker can neither stop herself from going away from her mother nor can she stop her mother from going away from her forever. All she can do is part with the hope of seeing her mother again. The parting is made all the more poignant by the fact that though she hopes to see her mother, she fears that she might not. This intermingling of emotions of love, hope, longing, nostalgia, fear and a sense of helplessness at the face of the inevitable seems to find its way in the repetition of the final words of the poem: all I did was smile and smile and smile…

looked out at young









376



2

KEEPING QUIET —Pablo Neruda

Revision Notes Introduction Keeping Quiet is a splendid poem by Pablo Neruda that dwells on a quality which seems to have been lost in the buzz of 21st century: the quality of silence. In an age which accepts rush in a celebratory gesture, Keeping Quiet is a gentle reminder what life can be like in a brief moment of a silent pause. This message instantly resonates in the digital age where “switching off ” has become a muchneeded life-hack. The theme of quietude and stillness is accompanied with the themes of peace, pacifism, fellowship, solidarity, brotherhood, justice and ecological conservation. To keep quiet is to stay still and understand that one is a thread, woven within the exquisite fabric of the cosmic order. It is to identify oneself with all and in doing so, escape the “sadness of never understanding

ourselves”. To keep quiet is to escape the death with which we threaten ourselves and for once, truly and genuinely, live. Theme: It is basically an anti-war poem. The poet is deeply concerned about violence, cruelty to animals and plight of manual workers. The poet offers a very simple solution to many of our social, political and religious problems. The solution is self-introspection. If it is acted upon, it will be the first major step towards uniting people. The second step is that everyone should look within and analyse what is wrong and who is the wrong doer. This will cleanse every heart and ennoble all people. Message: Keeping Quiet leaves a message of universal brotherhood and peace. It urges people to stop aggression, including that towards the environment.



ENGLISH CORE





























Scan to know Written in a simple yet elegant language, more about Keeping Quiet is a free verse poem. It this topic begins with an appeal to keep quiet and stay still at the count of twelve and urges for a complete cessation of words and action: Keeping Quiet ‘Now we will count to twelve and we will all keep still Explanation: At the heart of this poem is inclusivity. The poem seeks to rise above racial and linguistic differences. This attempt towards inclusion is seen in the opening lines of the poem. The speaker employs the collective “we” to begin the exercise of keeping quiet. The count till twelve may be interpreted as signifying the twelve-hour mark of the clock from which the two hands circle in a monotonous manner, very much like the daily activities of life. For once on the face of the Earth let’s not speak any language, let’s stop for one second, and not move our arms so much. Explanation: Noteworthy is the fact that Keeping Quiet is as much about staying silent as it is about staying



Summary



FIGURES OF SPEECH: Language: The usage of the term ‘language’ is an instance of metonymy, in which a symbol or sign is used for the thing signified. Language here stands in for culture/ race. Arms: ‘Arms’ is an instance of pun. In pun, duplicity of sense is created because of the unity of sound. Arm here stands for a body part as well as weaponry. Sudden Strangeness: Instance of alliteration. The same syllable is repeated at the beginning of successive words. His hurt hands: This is an instance of alliteration. Wars with fire, Wars with gas: This is an instance of Palilogia. In Palilogia, there is a repetition of same words in a line or sentence – ‘Wars with’ occurs twice. The Earth can teach us: This is an instance of personification. Earth is given the human attribute of teaching. Extended Metaphor: An extended metaphor can be found in the lines – “Perhaps the earth can teach us/ as when everything seems dead/ and later proves to be alive”. Here the stillness which Neruda advocates is being compared to the stillness of winter. Just like winter leads to rejuvenation, even the quietness recommended by the poet leads to re-growth. Symbolism: Symbolism is abundant in Keeping Quiet. Fisherman and whale stand for the oppressor and oppressed respectively. Salt gatherer is symbolic of humanity whereas ‘clean clothes’ symbolize peace. Rhyme Scheme: This poem is written in blank verse.



Exotic: strange Introspection: self-analysis

still which is why the poem advocates for a ceasing of words ( “let’s not speak in any language) and actions ( “let’s not move around so much”) . Language brings differences. The great number of languages on the “face of the Earth” seem to highlight the ways in which we are different from others. The use of the words “any language” suggests that the speaker recognizes the limits of language and envisions a state beyond the domain of language itself – the realm of silence. Keeping Quiet then is also about letting our differences dissipate in the silence of our similarities. The moving of arms not only harks back to the ceaseless movement of the hands of the clock but also to the gestures of restlessness and aggression which the modern world is obsessed with. It would be an exotic moment without rush, without engines, we would all be together in a sudden strangeness’ Explanation: This hectic pace of a busy life is what makes silence an ‘exotic moment‘. Like the clock, our lives have become utterly mechanical, dominated by “rush” and “engines“. A moment of silence will not only be delightful and rare (exotic moment) but also a ‘strange’ one. This is because we have internalized rush to such an extent that silence, though enjoyable has become unfamiliar to us because silence has become rare in the modern world. Keeping Quiet is one powerful way of escaping the mechanistic motion of the modern life. ‘Fishermen in the cold sea would not harm whales and the man gathering salt would look at his hurt hands. Explanation: In line with his political ideology, Neruda was intensely aware of the exploitative economic structures of the capitalist economy which has exploited man and animals alike. Man’s greed not only leads to the exploitation of other creatures but of fellow human beings who are oppressed by the unjust economic system. Neruda strongly sympathized with the working class and very well understood the strong class divisions that had fractured the Chilean society. The sufferings of both the workers in the salt mines and the sea creature in the ocean would end for a moment if only everybody kept quiet. The theme of environmental conservation and Social Justice makes its presence strongly felt in this stanza. Those who prepare green wars, wars with gas, wars with fire, victory with no survivors would put on clean clothes and walk about with their brothers in the shade, doing nothing.’ Explanation: These lines highlight the devastating consequences of war. It seems that all the troubles in the world, from the plight of the whales to the horrors of war result from someone’s inability to keep quiet. Somebody, in some corner of the world takes an unnecessary action which jeopardizes the fate of everybody else. By writing

Key Words

377

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

















3







up in the web of rush and activity to the extent of not understanding ourselves. It is the tragedy of the modern world where people are too busy to live. If everybody kept quiet for a single moment, a huge silence may interrupt the sadness of being too busy to understand ourselves. Our inability to keep quiet results in our failure to understand ourselves and others. The monotonous rush of life makes individuals threaten oneself with death and their failure to keep quiet make nations threaten each other with wars. Thus, the silence which results from keeping quiet isn’t only an exotic one. It is also an introspective one. It is a soothing silence that can heal the self-inflicted wounds of humanity. The poem ends on a positive note by saying that perhaps we can learn the importance of keeping quiet from nature: Perhaps the Earth can teach us as when everything seems dead and later proves to be alive. Now I’ll count up to twelve And you keep quiet and I will go.’ Explanation: These lines bring to light a very important fact: that mere movement and rush should not be confused with life. Perhaps this is the mistake we have been committing all our lives. We have confused movement with life. Perhaps this is why we need to keep quiet: to know the difference between mindless movement and meaningful living. Perhaps this realization may help us appreciate life and perhaps this is the reason why the poet helps us remain with this realization before quietly exiting the scene, letting us fully understand and appreciate what it means to keep quiet.









about those who “prepare wars”, the speaker hints at the manufactured nature of war which is intended to satisfy specific interests of interested parties and devastate the lives of others. The damage done by the conventional, chemical and biological weapons (green wars, wars with gases, with fire) can be stopped only if and when governments and nations teach themselves to keep quiet. “The war began for me when my friends started disappearing”. If only we could keep quiet, people waging such wars would put on clean clothes, free of the bloodstains and guilt and would be able to walk hand in hand with the ‘brothers’ in the shade, in silence and in peace. ‘What I want should not be confused with total inactivity. Life is what it is about; I want no truck with death. Explanation: The poet makes it clear that what he’s advocating shouldn’t be confused with total inactivity for total inactivity means death and he has nothing to do with death. In his own words: I want no truck with death. If we were not so single minded about keeping our lives moving, and for once could do nothing, perhaps a huge silence might interrupt this sadness. of never understanding ourselves and of threatening ourselves with death.’ Explanation: These are perhaps among the most insightful of lines in the poem where a stark reality of the modern life is highlighted: of being intensely caught



378



A THING OF BEAUTY —John Keats

Revision Notes Introduction

The poem, A Thing of Beauty, portrays that things are figuratively an endless source of nectar that pours down to us from heaven bringing eternal joy for the soul’s grandeur. They are like a medicine of life, a never diminishing source of pleasure and delight, a boundless source of joy that seems to be a precious gift from Heaven. A beautiful thing will give joy throughout one’s lifetime. One can return to the beautiful thing and never finish finding it as a source of joy. Even after one dies, the thing of beauty will continue to exist and will give joy to people of the next age group. When they in turn pass, it will give joy to the peer group after theirs, and so on. Thus a beautiful thing may in that sense be a joy forever. Even if the thing of beauty, practiced in the past, can’t for

whatever reasons be experienced at the present moment, our memory of the past experience can still give present pleasure. Even when we are depressed or dejected, our experience of a beautiful thing can help us shake off our sadness and can bring us joy eternally.

Key Words bower: shade of a tree despondence: hopelessness pall: impact (here) cooling covert: a cool place dooms: ruins heaven’s brink: edge of the paradise FIGURES OF SPEECH: Rhyme Scheme: aabbc



Paraphrase





A thing of beauty is a joy forever Its loveliness increases, it will never Pass into nothingness; but will keep A bower quiet for us, and a sleep Full of sweet dreams, and health, and quiet breathing. The poet says that beauty stays forever. It never fades away. Rather, it increases with the passing time.

1.









• Bushes full of musk roses (sprinkling of fair musk rose blooms) • books describing valour of fighters (grandeur-..mighty dead) • God providing us with best things (pouring from the heaven’s brink) Inversion: normal order of words is reversed (Are we wreathing a flowery band) Antithesis: opposite words placed together (old and young) List the things of beauty mentioned in the poem: • The Sun • The Moon • Shady trees • Beautiful daffodil flowers • Streams of water • Dense green bushes of forest ferns where fragrant musk roses grow • Tales of heroic men who sacrifice their lives List the things that cause suffering and pain: • Desire to offend others • Hopelessness • Lack of noble men • Bad health • Unhappiness • Gloom • Darkness

379

The perception of the poet regarding beauty is that it never goes off with the passing time, rather it beautifies more and more. For the poet, beauty is like a beautiful shady tree under whose shade all the creatures can sleep peacefully and enjoy good health. 2. ‘Therefore, on every morrow, are we wreathing A flowery band to bind us to the earth, In spite of despondence, of the inhuman dearth Of noble natures, of the gloomy days, Of all the unhealthy and o’er–darkened ways Made for our searching : yes, in spite of all, Some shape of beauty moves away the pall From our dark spirits. The author says that individuals have an attachment to the Earthly things. This attachment is such that it has the resemblance of a flowery wreath. Furthermore, there are traps that keep people connected to materialistic things. This connection with materialistic things distracts humans from eternal happiness. This is because the focus of such materialistic people will be on acquiring more and more resources rather than on attaining eternal happiness. It is the beauty which fills us with the spirit to live. It is the beauty which builds the desire in us to live though there are sad moments and cruel people around us. The world has a lot of negativity, hatred, and greed. According to the poet, the cause of gloom and sadness is this negativity. So here the poet wants to say that without beauty the earth will be full of cruel people, sad and gloomy moments. It is the beauty which is created by god which helps us to remove the sadness from our hearts. Moreover, one can fade away these negative vibes away with the help of beautiful things that surround us. This is because these beautiful things bring nothing but positivity. 3. Such the Sun, the Moon, Trees old and young, sprouting a shady boon. For simple sheep; and such are daffodils with the green world they live in; and clear rills. That for themselves a cooling covert make ‘Gainst the hot season; the mid forest brake. Rich with a sprinkling of fair musk–rose blooms.’ And such too is the grandeur of the dooms The poet informs us about some beautiful things that are all around us. Beauty is certainly in the eyes of the one who beholds. This means one can see the beauty in anything. Furthermore, the poet talks about the numerous creations of God which we should admire. One such creation is the Sun which provides energy. Moreover, the poet also talks about the beauty of the moon and the natural beauty of the trees. There are various animals around that make our world lively. The pretty flowers like daffodils enhance the liveliness and greenery of the world. Moreover, the flowing streams of water provide refreshment and cooling effect to us in the hot summer season. The forests have plenty of pretty musks rose flowers. Such flowers are a beautiful sight and eyes feel the delight due to them. All such things certainly are things of beauty.

Alliteration: Use of consonant sound at the start of two words which are close in series. For e.g., ‘s’ in sleep sweet, ‘b’ in band bind, ‘n’ in noble nature, ‘c’ in cooling covert, ‘h’ in have heard Metaphor: • bower quiet (calmness of the bower is compared to the calming effect of a beautiful thing) • wreathing a flowery band (the beautiful things of our life bind us to the earth) • Immortal drinks (beautiful objects of nature are forever like a never ending portion of a drink) Anaphora: • Use of same word in two consecutive lines (of noble natures- Of all the unhealthy) Imagery: • creating a sensory effect of beautiful things lined up in a string (A flowery band to bind us) • Trees giving shade (sprouting shady boon) • growing process of daffodils (daffodils with the green world they live in) • clean river streams (Clear rills)

ENGLISH CORE

380

We have imagined for the mighty dead; All lovely tales that we have heard or read; An endless fountain of immortal drink, Pouring unto us from the heaven’s brink. The poet further explains that one must not forget the beautiful and inspiring stories of the brave soldiers. These mighty warriors risked and sacrificed their lives in order to protect others.







4.

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

These beautiful things have a resemblance to the fountain of immortality bestowed upon us by God as a gift and a blessing. They are like nectar given by God to us. Such beautiful things are an inspiration for all of us to continue living. They make life worth living. Also, they help us in maintaining our faith in goodness. Life without these beautiful things would certainly become very hard. 

4 

A ROADSIDE STAND —Robert Frost

Revision Notes









FIGURES OF SPEECH: Rhyme Scheme: The rhyme scheme of the poem is abab. Transferred Epithet: ‘polished traffic’ referring to the city dwellers who pass by the countryside and sometimes they take out a moment to scrutinize the surroundings around them. ‘Selfish cars’ is yet another use of a transferred epithet.



sped: crossed with speed pled: requested dole: gift marred: disturbed artless: ugly crossly: being angry kin: family members plow up: to turn

Scan to know 1. The little old house was out with a more about little new shed this topic In front at the edge of the road where the traffic sped, A roadside stand that too pathetically pled, A Roadside Stand It would not be fair to say for a dole of bread, But for some of the money, the cash, whose flow supports The flower of cities from sinking and withering faint. The occupants of the little old house have extended the shed in front, around the edge of the road where traffic passes by. Though it would be unfair to state that the shack-owners wanted a charity of bread, but nevertheless they seemed to implore the passers-by to stop and buy something from the shack. These deprived people long for the feel of the currency, the circulation of which flourishes the city folks. 2. The polished traffic passed with a mind ahead, Or if ever aside a moment, then out of sorts At having the landscape marred with the artless paint Of signs that with N turned wrong and S turned wrong Offered for sale wild berries in wooden quarts, Or crook-necked golden squash with silver warts,

Key Words

Paraphrase



‘A Roadside Stand’ deals with the lives of poor, deprived people. Furthermore, the poet contrasts the struggling lives of the countryside people with the insensitive life of the city dwellers. The city dwellers don’t even bother to ponder on the harsh condition of the roadside stand. The city dwellers don’t think about the struggles these roadside people have to go through in order to sell their goods. These poor people have nothing to do except wait for the passing cars to stop and purchase their products. If at all a car stops by, it is to know about directions or to complain about something. The poet deeply sympathises with these impoverished people and feels compassionate for them. This sympathy is evident in the portrayal of the roadside sheds in a poignant manner. So, A Roadside Stand shows us the great contrast between the comfortable life of city dwellers and the harshness faced by the impoverished rural people.

This refers to the car owners who do stop at the roadside stand but to ask about the police or the gas stations. Personification: “the sadness that lurks behind the open window there…” where sadness is an example of personification. Sadness dwells in the windows of the farmers because they wait for cars to stop and make a purchase. Alliteration and Oxymoron: ‘Greedy good doers’ and ‘beneficent beasts of prey’ are examples of both alliteration and oxymoron.



Introduction





381













































and hence good sleep, they actually sleep peacefully themselves and destroy their slumber with anxiety. In the ancient way, people used to work during day and sleep in nights which has been reversed here where they are not able to sleep at night because they haven’t worked in the day. 5. Sometimes I feel myself I can hardly bear The thought of so much childish longing in vain, The sadness that lurks near the open window there, That waits all day in almost open prayer For the squeal of brakes, the sound of a stopping car, Of all the thousand selfish cars that pass, Just one to inquire what a farmer’s prices are. And one did stop, but only to plow up grass In using the yard to back and turn around; And another to ask the way to where it was bound; And another to ask could they sell it a gallon of gas They couldn’t (this crossly); they had none, didn’t it see? The poet is distressed to note the interminable wait on the part of the shed owners for their prospective buyers, he calls it almost a “childish longing in vain”. The shop window is blanketed with an ambience of sadness that surrounds expectancy. It seems these people yearn for the sound of the car brakes near the shack. One of the “selfish cars” that pass by the shed has perhaps halted to enquire the “farmer’s price” while the other just wanted to use the backyard to turn. It’s indeed a satire that one of the occupants of the car stops at the shed to get a gallon of gas. It highlights a sense of alienation that exists between the rural and urban life. Unaware of the villager’s plight and engrossed with the pleasure of the material world, these people are unable to gauge the glaring difference in city and rural life. 6. No, in country money, the country scale of gain, The requisite lift of spirit has never been found, Or so the voice of the country seems to complain, I can’t help owning the great relief it would be To put these people at one stroke out of their pain. And then next day as I come back into the sane, I wonder how I should like you to come to me And offer to put me gently out of my pain. The poet regrets that the yardstick of gain vested in money, isn’t found in the country-side at all. Money he feels elevates spirits and the lack of it dampens the villagers’ perspective towards life. They tend to express their grievance about a life bereft of money. At this point of time, the poet is overwhelmed with emotions and contemplates their pain at one go by changing their lives. But a later logical thought and a poised state of mind tells him the futility of this rash act. It might compel him to seek purgation of pain from others for his thoughtless decision.











































Or beauty rest in a beautiful mountain scene, You have the money, but if you want to be mean, Why keep your money (this crossly) and go along. But unfortunately, the refined traffic whizzed past, unmindful of the shack. Or, if by chance, any stopped, it would be with a feeling of reproach at this blot on the picturesque landscape. They are very perturbed to see the unimpressive and toppled up signboards. The shack offered for sale wild berries in a wooden quart (quarter of a gallon). The poor quality local produce is highlighted with the usage of words like “crook-necked”, “squash with silver warts”. The place also offered a blissful stay in the lap of nature for the ones who had money. Angry at the callous attitude of the so-called ‘polished traffic‘, the poet commands them to move ahead oblivious of the road-side stand. 3. The hurt to the scenery wouldn’t be my complaint So much as the trusting sorrow of what is unsaid: Here far from the city we make our roadside stand And ask for some city money to feel in hand To try if it will not make our being expand, And give us the life of the moving-pictures’ promise That the party in power is said to be keeping from us. The poet’s concern is not about the blemish on the landscape but regarding the unvented sorrow of the shed-owners. Expressing the view point of these people, the poet converts their ardent desire to handle some city money, which may perhaps alleviate their sufferings as sometimes promised in movies. The political party in power actually deprive them of a prosperous life. 4. It is in the news that all these pitiful kin Are to be bought out and mercifully gathered in To live in villages, next to the theatre and the store, Where they won’t have to think for themselves anymore, While greedy good-doers, beneficent beasts of prey, Swarm over their lives enforcing benefits That are calculated to soothe them out of their wits, And by teaching them how to sleep they sleep all day, Destroy their sleeping at night the ancient way. The poet quotes the news which highlights the evacuation and relocation of the poor villagers to the vicinity of the theatres and the shops. Tall promises have been made to take good care of them. Outraged at the negligent attitude of the civic authorities, government and even social service agencies, the poet addresses them as “greedy good-doers” apparently benefactors but actually “beasts of prey” who exploit the innocent village folk by giving them a short term sense of security, the villagers are not being helped but harmed. They pay a heavy price by losing their land. These developers, civic authorities, with a calculative strategy “soothe” (silence) and befool the unalloyed heart and minds of these villagers. By ensuring them a better life

ENGLISH CORE



382

Oswaal CBSE LMP (Last Minute Preparation), Class-XII



5

AUNT JENNIFER’S TIGERS —Adrienne Rich

Revision Notes Introduction “Aunt Jennifer’s Tigers” is a 1951 poem by American poet Adrienne Rich. It appeared in her first published book of poems, A Change of World. Told from the perspective of an anonymous speaker, the poem describes a woman, Aunt Jennifer, who crafts vibrant tapestry panels (depicting tigers) to escape—mentally, at least— her unhappy marriage. Written at a time when divorce was unacceptable, the poem criticizes the traditional institution of marriage, suggesting that it oppresses women. Aunt Jennifer creates a needlepoint that shows tigers leaping across the canvas. Bright and vibrant, like topaz gems, the tigers live within the green world of the canvas. They are not afraid of the men standing underneath the tree, who are also depicted in the image. The tigers walk with certainty, shining and courageous. Aunt Jennifer’s fingers swiftly and delicately work the yarn, yet she finds it physically difficult to pull even a small needle made of ivory through the canvas. Her husband’s wedding band feels huge, and weighs down heavily on her hand. When Aunt Jennifer dies one day, her frightened hands will finally be still. Yet they will still be marked by the difficulties that ruled over her while she was alive. Meanwhile, the tigers she created will continue to leap across her needlepoint without shame or fear.

Key Words prancing: walking in a very energetic manner denizen: the native of a place. certainty: confidence chivalry: courage, respect for women ordeals: torturous treatment FIGURES OF SPEECH: Rhyme Scheme: ‘Aunt Jennifer’s Tigers’ is a threestanza poem that is separated into stanzas of four lines, known as quatrains. These quatrains follow a simple rhyme scheme of aabb, with the couplets changing end sounds from stanza to stanza. While there is evidence of metrical patterns in ‘Aunt Jennifer’s Tigers,’ it is not completely consistent. There are sections of the poem in which Rich uses nearly perfect iambic pentameter and moments where she moves away from it and uses trochees instead. It is a conventional rhyme scheme. However, Rich has brought the protest through this pattern. It seems that she

has made the poem’s structure conventional to highlight the conventionality of the protagonist’s life and discuss about critical appreciation of “Aunt Jennifer’s Tigers”. Imagery: It is quite important in this poem. It can be seen through the description of the tigers, their landscape, and Aunt Jennifer’s hands. Rich has used the animal imagery to inject the power and vigour in the vision of Jennifer which she terribly misses in her personal life. Tigers are the popular symbols of power and rebellion. Rich’s tigers signify the vital life force which the conventional society hardly allows to women. The creator of the tigers, Jennifer lives a life of fear, depression and submission. But her tigers are fiercely uncompromising. Here the animal imagery suggests violence and energy which women aspire to acquire but painfully lack. Anaphora: It is a simple and useful technique. There is a good example in the first stanza with the repetition of “They” at the start of lines three and four. Alliteration: It helps to create a feeling of rhythm and rhyme even if one does not exist. For example, “finger fluttering” in stanza two and “prancing, proud” in stanza three. Symbolism: Heavy wedding band: Symbolises oppression in an unhappy marriage; Tigers: Untamed free spirit. The central symbols of the poem are the tapestry tigers and the Uncle’s wedding band. The tapestry tigers are not just individual artistic expressions; they are politically inflected, engaged in patriarchal chivalry myths. The personal and the political again meet in the intimacy of Uncle’s wedding band. By the physical intimacy of a wedding band and by the familial presence conferred by ‘Uncle’s, wedding band’, Aunt Jennifer’s Tigers specify the presence of patriarchal politics. The interplay between rebellion and repression has made the poem interesting. This poem underscores the theme of power and social status. Aunt Jennifer is assigned the role of an aunt. She has no independent identity. In the poem her name is mentioned four times, and in every occasion she is an aunt. This imposition has fragmented her role. Hyperbole: The weight of husband’s wedding ring. Paradox: Here a trembling and ‘mastered’ woman creates free and confident creatures in her artistic endeavours. ‘Fluttering’ fingers produce something that has ‘certainty’. Contrast: This poem identifies the problems of women in the society. The male dominated society subordinates women. So they have nothing to do but continue the roles imposed on them by the male counterparts. Aunt Jennifer



ENGLISH CORE

383

384

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

is the representative of these ill-fated women. Marriage as an institution does not support them. It rather ensures their eternal bondage. That’s why the wedding ring is inseparable in Jennifer’s life. The final stanza points at the contrast between the fearless tigers and the lifeless aunt. In fact through this contrast Rich is stressing at the basic idea of feminism. According to feminism woman are deprived of the equal status because of the social structures and repressions. The tigers are beyond these norms, but Jennifer is confined within it.

Aunt Jennifer’s tigers prance across a screen, Bright topaz denizens of a world of green.



1.



Paraphrase



They do not fear the men beneath the tree;



They pace in sleek chivalric certainty.

In the first stanza of ‘Aunt Jennifer’s Tigers,’ the speaker begins by describing the movement of the tigers across the fabric canvas. They are prancing “across a screen” in a “world of green”. The perfect rhymes give this poem a sing-song-like sound that is juxtaposed against the darker subject matter. It creates a haunting atmosphere that allows for easy contemplation of the problems of marriage. The speaker describes very clearly how the tigers do not “fear the men beneath the tree”. They move without fear or trepidation. It should be noted that this is a state that the artist, Aunt Jennifer, does not know. She is not without fear as they are. The animals are personified. Rich uses words like “chivalric” (an older term that connects to a certain, respectful yet patronizing treatment of women) to describe them. They are masculine, without worry, and “certain” in their actions. This makes it seem even less likely that Jennifer will find this same strength.

Aunt Jennifer’s fingers fluttering through her wool Find even the ivory needle hard to pull. The massive weight of Uncle’s wedding band Sits heavily upon Aunt Jennifer’s hand. The speaker describes in the next stanza how quickly Jennifer’s fingers move. They “flutter” through the movements but are without real strength. The word “flutter” evokes the image of birds’ wings and gentle movements. Her hands find the “needle hard to pull”. There is something weighing them down, a “wedding band”. The ring that ties her to her husband keeps her from moving beyond who she is at that moment. It “sits heavily” on her hand, her mind, and her soul.







3.









2.

When Aunt is dead, her terrified hands will lie. Still ringed with ordeals she was mastered by The tigers in the panel that she made Will go prancing proud and unafraid.

The third stanza begins with a striking move into the future. The speaker looks towards the time in which Aunt Jennifer is going to die. These lines are enjambed, encouraging a reader to move smoothly and quickly

through the stanza. She will stop eventually as will the movement of her hands. But, the ring will still be there. Even in death she will in some ways be tied to her “ordeals”. As she struggles, suffers, and dies, the tigers will continue to prance proudly on her page. They, unlike her, are “unafraid”. Analysis: The speaker describes the tigers which her aunt produced by using coloured threads on heavy cloth. They are set in motion. They are moving quickly by raising the front legs and jumping forwards on the back legs. In the green jungle they look bright yellow and as valuable as topazes which reveals her dream of a happier life in her needle work. There are men sitting under the tree, but the tigers do not care for them. They move on to their goal boldly and smoothly. Jennifer finds it difficult to make pictures by using the ivory needle. She is tired of doing the household work after she got married. She can’t get herself involved in her artistic work. She has to do it in her leisure time. Even then she has to be sure whether her husband is watching her or not. So her hands are terrified. She will not be free from fear until she dies. She will be dominated by her husband. She will die, but her art will express her desire to move proudly and fearlessly like the tigers she has made. Aunt Jennifer’s hands are ‘terrified’ because of the massive weight of household duties. They are heavily pressed. They have undergone severe trials. She is dominated by her husband continuously. ‘Fingers fluttering’, ‘ordeals’, ‘mastered’, ‘hard to pull’ indicate her fear. By mentioning that it is ‘Uncle’s wedding band’, the poet suggests that Uncle owns Jennifer too and that as a female she is the property of her husband. The word ‘massive’ and ‘heavily’ suggest Aunt Jennifer lives a demanding sort of life in which she has to attend to her husband’s needs and fulfil his commands. As a result she is somewhat worn out in her old age. Aunt Jennifer is ‘ringed’, trapped in her marriage and controlled like an animal. Her husband is her master. Her wish to be like the tiger, ‘proud and unafraid’ also shows her fear in real life. Tigers are fierce, courageous and independent animals. They lead the life the way they want to. But Aunt Jennifer is just opposite to tigers. She is quiet, coward, and totally dependent on her husband. She leads her life the way her husband likes for her. So tigers are an appropriate contrast to her. Aunt Jennifer has an artistic talent. If she used it properly, she will surely become a great artist. But she is unable to use her ability because of cowardice. She can’t go against the established pattern in life. She is pressed by ‘the massive weight’ of household work. Instead of pleasing herself, she tries to please her dominating



ENGLISH CORE

husband. She lives a quiet and subdued life. But the tigers she imagined are just opposite to her. They are proud, active, fearless, determined and chivalric. They move toward their goals with single-mindedness. The tigers in the poem represent Jennifer’s innermost desire. She wants to be strong like the tigers that do not fear the men. Like the beautiful animals in the jungle, she wants to create precious pieces of art. Her life has been uncertain, helpless. Her husband is strong and fearless, but he is not chivalrous. So she finds courage,

385

justice and honour in the smooth movement of the tigers. Thus the tiger stand for her unfulfilled wishes. She can’t revolt against him on her own. In order to gain freedom she must be like her tigers that prance being proud and unafraid. Like them she wished if she did not fear the men. The word ‘chivalric’ suggests her inner wish that is, her husband should show bravery, honour, generosity, and good manners to her like the knights in the Middle Ages did. She would like to go forward toward her aim like the determined tigers. 

Supplementary Reader : Vistas

1 

THE THIRD LEVEL —Jack Finney

Revision Notes Introduction: The Third Level by Jack Finney is about the harsh realities of war. War has irreversible consequences thus leaving people in a state of insecurity. It is also about modern day problems and how common man tends to escape reality by various means. In this story, a 31 year old man named Charley hallucinates and reaches the third level of the Grand Central Station which only has two levels. Besides, this psychological story refers to the subway at the Grand Central Railway Station which takes passengers to Galesburg. In addition, this subway becomes the interconnection between the narrator’s harsh reality and fantasy. Moreover, the third level was a way of escape for Charley. As life in the modern world is full of uncertainties, worries and stress, it takes Charley to a different world that his friend also calls, “a walking dream wish fulfilment.” Further, the story is about Charley’s tendency to escape from the world. Most importantly, the third level starts because of Sam’s letter written on 18th July 1894. This story shows the connection between time and space.

Key Words refuge: a place that shelters from danger or difficulty

ducked into: to plunge arched: curved flickering: uncertain way of burning glint: shine brightly with a short flash of light

Summary Charley was 31–year–old man Scan to know married to Louisa. Several times, he had more about this topic lost himself in the Grand Central Station. He always found himself bumping into new doorways and new corridors. Every time he had a new experience. He even had begun to believe that the Grand Central was like a huge tree ever The Third Level pushing new tunnels and new corridors like the roots under the ground. Once, he got into a mile long tunnel and came out in the lobby of a hotel. At another time, he came up into the building of an office. There were certainly only two levels at the Grand Central. However, Charley asserted that there were three levels. He talked about it to his friends. One of them was a psychiatrist. The psychiatrist said that it was nothing but day–dreaming. He explained that it was only an escape from his present life. The modern world is full of fear, tension, and worries. The third level provided him an exit from it. His other friends agreed with the psychiatrist. They said that his stamp collecting was also a temporary escape. Charley did not agree with them. He said that his grandfather started the stamp collection, and in his grandfather’s days, life was peaceful. He did not need an escape. Besides, President Roosevelt also collected stamps. One day, Charley got late from his office. He wanted to reach home soon, so he went to the Grand Central to catch a

386

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

Scan to know train. He walked down to the first level and more about then walked down another flight of stairs. this topic He thought he had reached the second level again, but he got lost. He walked down a corridor. He thought it was wrong, but he walked on downward. He walked down a short flight of stairs. He thought Journey to the that he had reached the second level again, End of the Earth but he had reached the third level. The third level was entirely different and old– fashioned. There were fewer ticket windows. The information booth was made of wood. The lights were open flame gas lights. There were brass spittoons on the floor. Men had beards and sideburns. Women wore old– fashioned dresses and high buttoned shoes. The railway engine was small with a funnel shaped stack. Everything looked a century old. He walked to the newsboy. There he glanced at “The World”. The lead story was about President Cleveland. Later, Charley found out from the library files that it was printed on June 11, 1894. Charley wanted to go to Galesburg. He had been there in his childhood days. It was a wonderful town with tremendous trees and frame houses. In 1894, it was a heaven of peace and tranquility. People lived a carefree life. Therefore, he asked for two tickets to Galesburg. He paid the fare in modern notes which were different from



2

those in 1894. The clerk thought the notes were fake and Charley was trying to cheat him. He threatened to get him arrested. Charley immediately turned around and fled as fast as he could. Next day, Charley bought old–style notes from a coin dealer. He got only two hundred old dollars for three hundred new dollars. However, he could never again find the corridor that led to the third level. Charley’s wife was worried when she heard that he had bought old–style notes. Therefore, Charley turned to his stamp collection. One day, among his grandfather’s collection of first day covers, he discovered an envelope. The postmark showed that it had been there since July 18, 1894. He opened the envelope, but the paper inside was not blank. It was a letter from Sam, the psychiatrist friend whom Charley had often told about Galesburg. He had already gone there. He urged Charley to continue to look for the third level and join him in the Galesburg of 1894. It was a wonderful place. Later, Charley learnt that Sam had bought eight hundred dollars’ worth of old currency. Charley hoped Sam would have set up hay and feed business in Galesburg and that was what he had always wished to do. 

THE TIGER KING —Kalki

Revision Notes

The story mocks the wilfulness and arrogance of those in power. Kalki takes his readers to the days of autocratic and eccentric kings. These kings lived under the thumb rule of British, hence they fear them. In order to make the story mysterious Kalki has added supernatural element in the story. The haughty king disapproved the prophecy made by the astrologer about his death, but his death from the wooden tiger (100th tiger) approved it. The story ‘The Tiger King’ is satire on the conceit of those in power. Most of the time the rulers are not interested in serving the people or work for the welfare of the public; instead they spend their time in foolish pursuits. Even the coteries who surround these power centres are interested in taking advantage of the proximity for their own welfare. This is a story about transience-of life, of power and reverberates the maxim: “Too many slips between a cup and a lip.”

Key Words

strategic: according to the plan indomitable: determined stupefaction: confusion enunciated: spoken rife: common hara-kiri: suicide savage: dangerous



Introduction

Irony and Satire in ‘The Tiger King’ ‘The Tiger King’ is replete with irony that reveals the follies of autocratic and wilful rulers who flout all laws and bend them to suit their selfish interests. The dramatic irony in the story is sharp when the Tiger King alone is unaware that his bullet had not killed the hundredth tiger. The other characters and the readers anticipate his doom as he celebrates his triumph over his destiny. We realize how misplaced the King’s pride at killing the first tiger was. The astrologers had prophesied, “You may kill ninety nine tigers like this, but your death will be brought on by the hundredth tiger.” The King wanted to prove



387

ENGLISH CORE

The Tiger King is born. Astrologers had foretold that one day the Tiger King would have to eventually die. He would grow up to become the hero of heroes and the champion of the champions. However, the child born under that star would, one day, have to meet his death. A great miracle took place. The ten–day–old Jilani Jung Bahadur spoke very clearly. He told them that all those who were born, would have to die one day. There was nothing new in that. There would be some sense if anyone could tell him the manner of his death. Everyone stood stunned. An infant, born just ten days ago, was talking in such a manner. The chief astrologer told the prince that he was born in the hour of the bull. The bull and the tiger were enemies. Therefore, his death would come from a tiger. There were innumerable forests in the Pratibandapuram State. They had tigers in them. The Maharaja was overjoyed when he killed his first tiger. He sent for the state astrologer and showed him the dead beast. He told the Maharaja that he would have to kill ninety–nine more. He must be very careful with the hundredth tiger. The king asked what if the hundredth tiger were also killed. The astrologer declared that he would tear up all his books on astrology and set fire to them. Then, the king would have no trouble. The state banned tiger hunting by all except the Maharaja. If anyone dared to disobey, all his wealth and property would be confiscated. The king did face some problems. Sometimes, the bullet missed its mark. Once, a tiger jumped upon him and he fought the beast with his bare hands. Once a high ranking British officer wished to hunt tigers in Pratibandapuram, but he was refused permission. He could



3



Summary

hunt all other animals except tigers. The Maharaja stood in danger of losing his kingdom itself. He managed to retain his kingdom by offering a bribe of 50 gold rings worth three lakh rupees to the officer’s wife. The Maharaja’s tiger hunt continued to be highly successful. He was able to kill seventy tigers within ten years. The king’s mission of killing tigers came to a halt. The tiger population became extinct in the forests of Pratibandapuram. The king decided to marry into the royal family of a state with a large tiger population. The Deewan found out the right girl. Maharaja Jung Bahadur killed five or six tigers each time he visited Scan to know his father–in–law. In this way, he was able more about this topic to kill 99 tigers. There remained just one tiger to reach his tally of a hundred. If he could kill just one more tiger, the Maharaja would have no fears left. He could give up tiger hunting The Tiger King altogether. He had to be very careful with that last tiger. However, the hundredth tiger was found nowhere. The Maharaja became very sad. The Deewan realised that if the Maharaja didn’t find the tiger soon, the results could be quite dangerous. A tiger was brought from the People’s Park in Chennai. It was brought straight to the forest where the Maharaja was hunting. The Maharaja took a careful aim and the tiger fell in a heap. The Maharaja became elated at killing the hundredth tiger. After he left, the hunters had a closer look at the tiger. The tiger was not dead. They decided that the Maharaja must not know that he had missed the target. Therefore, one of the hunters killed the tiger. A few days later, the third birthday of the Maharaja’s son was celebrated. The Maharaja brought a wooden tiger from a shop as a special gift on his birthday. On that day, father and son played with the wooden toy– tiger. Its surface was rough. One of those needle–like slivers pierced the Maharaja’s right hand. The next day, infection flared up in his hand. In four days, it developed into a suppurating sore. Three surgeons performed an operation. ‘The operation was successful’. The Maharaja was dead. In this manner, the hundredth tiger took its final revenge on the Tiger King.

the astrologer wrong and to save his life. Ironically, to avert death he actually invites it. The lofty titles used to introduce the Tiger King, suggesting an invincible ferocity are indeed ironic for he is finally killed by a cheap, crudely made wooden toy tiger which became the tool of Nature’s revenge. He had killed a hundred tigers in vain and must be punished for it. Irony is indeed sharp when the surgeons announce the operation successful and declare the king dead.



JOURNEY TO THE END OF THE EARTH —Tishani Doshi

Revision Notes Introduction Before human evolution, Antarctica was part of a huge tropical landmass called the Gondwana land which

flourished 500 million years ago. Geological, geographical and biological changes occurred and Antarctica separated and moved away, evolving into what it is today. The lesson refers to the manner in which geological

388

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

phenomena enables us to trace the history of mankind. It also tells us about the way in which landmasses and countries are formed. The writer emphasizes the impact of human endeavour to dominate nature. It should be realized that exploration of this landmass under the ice cap will certainly reveal valuable information on the theory of birth and evolution of our planet and its association with the solar system and the galactic evolution. The challenge to the ecology of the world makes Antarctica (with the simple eco-system and lack of biodiversity) a crucial place for study. The ‘Students on Ice’ programme provides inspiring educational opportunities which help to foster an understanding and respect for our planet. The objective of taking children to Antarctica to teach them the importance of protecting the Earth’s environment is laudable.

Key Words amalgamated: combined jamming: applying force ubiquitous: everywhere consecrates: set apart prognosis: opinion unmitigated: increased blasé about: uninterested epiphany: understanding

Summary The author visited Antarctica on a Russian research ship called Akademik Shokalskiy. She started from Chennai. They had to cross nine time zones, six checkpoints, three water bodies, and three ecospheres. The whole journey took her 100 hours. When she landed on the Antarctica, she was spellbound by its vastness, isolation,– and uninterrupted horizon. She wondered how there could have been a time when India and Antarctica were part of the same land mass–Gondwana. About 650 million years ago, Gondwana was a super continent. It was warm and many species of flora and fauna prospered there and there were no humans then. However, around the time when dinosaurs were wiped out, Gondwana began to break up. India pushed against Asia and buckled its crust to form the Himalayas. South America drifted to join North America, opening up the Drake Passage. It created a cold current that went round the South Pole. It left the Antarctica cold and isolated. The Antarctica is now a part of that history. It helps us to understand where we came from and where we are going. It helps us to understand the significance of Cordilleran folds and pre–Cambrian

granite shields. It helps us to understand about evolution and extinction. Antarctica has remained unspoiled by humans. Its ice–cores hold half–a–million– year–old carbon record. It can help us to examine Earth’s past, present and future. Antarctica is a huge expanse of ice. It is all barren. There are no human markers. There are no trees, buildings, or billboards. There are huge icebergs. There are blue whales, but there are very tiny things too. There are no mornings, noons, evenings and nights. It is a 24– hour day. There is silence everywhere. Therefore, you lose all earthly sense of time and space there. Human civilisation is only 12000 years old. It is only a few seconds old on the geological clock. However, during this short period, man has caused much confusion. He has built towns and cities. He has wiped out many other species to grab the limited natural resources. By burning fossil fuels, man has created a blanket of carbon dioxide around the world. This is raising the global temperature. This rise in temperature has caused climatic changes. It is the most hotly debated question. Many scientists foretell disaster. Antarctica is the place to see the impact of these changes. Because it has a simple ecosystem, a little change in the environment can trigger a big effect. For example, take the microscopic phytoplankton. They are single celled plants. Through photosynthesis, they assimilate carbon to form organic compounds. They sustain the entire food chain in the southern oceans. They regulate the global carbon cycle. Any further depletion of ozone layer will cripple phytoplankton. If they do not function, the entire food chain and global carbon cycle would collapse. ‘Students on Ice’ is a programme headed by Canadian Geoff Green. He has chosen to take students to the end of the world–Antarctica. He wants to provide young students an opportunity to understand and respect the planet. Students are young. They are ready to learn and act. They can actually see the effect of global warming. They see glaciers retreating and ice shelves collapsing. They cannot remain unaffected. They can see that the threat is real. They are the future policy–makers. They have idealism. They will act. Just near the Antarctic Circle, the research ship Shokalskiy was caught between white stretches of ice. It could go no farther. Therefore, the captain decided to turn round and go north, but before doing that, he ordered everybody to climb down the gang plank and walk on the ocean. Therefore, all the 52 of them walked on ice. Beneath the ice there was a living ocean. They saw seals sunning themselves on ice floes. They looked like stray dogs lying in the shade of a banyan tree. 



ENGLISH CORE



4

389

THE ENEMY —Pearl S. Buck

Revision Notes Introduction The story highlights how a Japanese doctor saves the life of an American prisoner of war and rises above narrow national prejudices. He risks his honour, career, position and life by sheltering a war prisoner of the enemy camp and saving his life. The author has beautifully portrayed the conflict in the doctor’s mind as a private individual and as a citizen with a sense of national loyalty.

Key Words wreathe: encircle stupor: unconsciousness assuage: to calm

Summary Dr. Sadao Hoki’s house was built on the Scan to know more about Japanese coast. His father never joked or this topic played with him. Sadao knew that his education was his father’s chief concern. For this reason, he had sent Sadao to America at twenty–two to learn surgery The Enemy and medicine. He had come back at thirty and before his father died, he had seen Sadao become a famous surgeon and scientist. Sadao had met Hana in America but didn’t fall in love with her until he was sure she was a Japanese. His father would never have accepted her unless she had been ‘pure in her race’. Sadao met her at an American Professor’s house. They came home to Japan. Their marriage had been arranged in the old Japanese way. They were perfectly happy and had two children.

were their enemies. If he were healthy, they could hand him over to the police. But he was wounded. He would die unless he was operated upon. At any rate, something was to be done with him. The servants were frightened at what their master had just told them. They thought that their master should not heal the wound of that white man. Even Yumi refused to wash the white man and returned to her work. Hana herself washed Tom’s breast and face with steaming hot water carefully. Sadao asked Hana to help him to turn the man. She obeyed. She was asked to give the anaesthetic if needed. The bullet was still there. He had lost much blood. Hana couldn’t bear the sight and ran out of the room. She had never seen an operation. Sadao went on with his work. But she came with a bottle and some cotton in her hand. Then, with a very clean and precise incision, the bullet was taken out. The man quivered, but was still unconscious. He only muttered a few words in English. Dr. Sadao declared that the man would live in spite of all. The young man woke up. He was very weak. His blue eyes were terrified when he saw where he was. Hana consoled him not to be afraid. She comforted him that he would soon be strong. On the third day, Dr. Sadao examined the wound. Tom asked what they were going to do with him. He looked barely seventeen. For a moment, Sadao didn’t answer. Tom was a prisoner of war and should have been handed over to the police.

Sadao and Hana found something coming out of the mist. A man seemed to be on his hands and knees crawling. Then, they saw him fall on his face and lie there. He was wounded and lay motionless on the sand. He was a white man. On the right side of his lower back, Sadao saw that a gun wound had reopened. He was bleeding. He had packed the wound with the sea moss. The man cried, but didn’t awake. They read the faint letters on his cap : ‘U. S. Navy’. The American was a prisoner of war.

The servants felt that they could not stay if Sadao hid that white man anymore in the house. People would think that they liked Americans. The servants grew more watchful daily. Sadao wanted the prisoner to get up on his feet. He should practice it every day till he gained strength. The man thanked the doctor for having saved his life. The doctor cautioned him not to thank him so early. The last stitches had been pulled out. The young man would be all right within a fortnight. On the seventh day, the servants left all together. Hana was terrified, but maintained her pride as a mistress. She paid them off and thanked them for all they had done for her.

If they sheltered the white man in their house, they would be arrested. But if they turned him over as a prisoner, he would certainly die. The couple was in a fix. All Americans

The old General was sick. He knew that Sadao was indispensable to him. He didn’t want Sadao to be arrested. What would happen if Sadao were condemned to death

390

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

and the next day he himself had to have his operation? He didn’t trust other surgeons. The General hit upon a plan. It would be best if the American could be quietly killed. He had his own private assassins. He could send two of them to his house at night. Sadao agreed that it would be very natural. Sadao thought over the General’s plan. The whole thing could go out of his hands. He didn’t tell anything to Hana. The next morning, he went to the guest room. He thought of putting his boat on the shore that night with food and extra clothing in it. The American might be able to row to that little island not far from the coast. Nobody lived on that island. He gave all necessary instructions to Tom. If his food ran out before he caught a Korean boat, he could signal him two flashes. The young American shook



5

Sadao’s hand warmly and walked into the darkness of the garden. Sadao informed the General that the young man had escaped. The General had promised Sadao to get him killed. But due to his own illness, he forgot to respect his promise. Sadao got his reward. He didn’t receive any signal. No one was on the island. The prisoner had gone safely. Sadao remembered that he had great difficulty in finding a place to live in America because he was a Japanese. The Americans were full of prejudice. White people were repulsive. It was a relief to be openly at war with them at last. Then, he remembered the ‘haggard face of the prisoner—white and repulsive’. ‘Strange’, he thought, ‘I wonder why I could not kill him?’ 

ON THE FACE OF IT —Susan Hill

Revision Notes Introduction The story speaks about two individuals, who meet unfortunate odds but develop different attitudes while facing those odds. The two persons are Derry, a young acid-attack victim, and Mr Lamb a much older man who lost his limb in a blast. Through the contrast in the outlook of both these survivors, the author tries to create a tale of overcoming odds and seemingly insurmountable difficulties and retaining hope in the ability to find happiness.

Key Words scrump: steal a fruit silken ladder: spider web daft in your head: mentally sick Title: According to the dictionary, “On the Face of it” is an informal expression used to say that something seems to be good or true, but this opinion may be changed when you know more about it. This definition of the expression should leave us in no doubt about the appropriateness of the title. An individual may be quite different from what we think of him or what he or she may apparently appear to be at first glance. There is the imperative need for us to view others by removing our glasses of prejudice, hatred, hearsay and dislike. On the face of it, Mr Lamb appears to be mysterious,

lonely, lame old fellow who lives in a neighbourhood house with a huge garden, but in reality he is very kind, generous, loving and altruistic. Similarly, although Derry has an ugly looking scary face, he is fine lad of fourteen with a deep longing for love. There is nothing wrong with Mr Lamb and Derry. What is wrong is the way people in their lives and around them view and treat them. On the face of it, there is so much of diversity, so many differences and divides between the people and other species of the world but underneath is a oneness, a sameness – all of them are created by God and all of them need to live and grow together with love and mutual acceptance. As the play progresses, the characters’ views about each other and our impression of them changes for the better. Thus, Susan Hill has quite appropriately entitled her play “On the Face of it”. Message: The moral of the play is that physically disabled people should focus on their bright future and not to brood over shortcomings of life and society should accept them in a way that they are so that they can lead a good life. In this way they can fight out the loneliness, depression and disappointment.

Summary Derry walks slowly and cautiously through the long grass. He enters Lamb’s garden. Mr. Lamb speaks to him when he is close at hand. Derry is startled. He is

Scan to know more about this topic

On The Face of It



ENGLISH CORE



apologetic. He didn’t know if there was anybody there. Mr. Lamb tries to make Derry comfortable. Mr. Lamb says that he can pick up crab apples. Derry need not go away on Mr. Lamb’s account. Mr. Lamb doesn’t mind who comes in the garden. The gate is always open. Derry did not need to climb over the wall of the garden. Derry says he didn’t come there for stealing apples. Mr. Lamb assures him that he can stay there. Derry says that people are afraid of him. They look at his face and find it terrible and ugly. Even when, he himself sees his face in the mirror, he is afraid of himself. Mr. Lamb says that he will get the ladder and a stick and pull down crab apples. He makes jelly from them. Derry doesn’t want Mr. Lamb to change the subject. He wants to talk about himself. Mr. Lamb thinks that perhaps Derry’s face got burnt in a fire. Derry corrects him. Derry says he got acid all down on that side of his face and burnt it all way. The acid ate up his face. Mr. Lamb is old. Derry is young. Derry has got a burnt face. Lamb has got a tin leg. Similarly, one green plant is called a weed and another a flower. All are life. Mr. Lamb lost his leg. Some kids call him “Lamey–Lamb”. A tin leg and a burnt face are not the only things to be taken notice of or to be stared at. There are so many other things like crab apples, weeds and sunflowers. They deserve our attention and Mr. Lamb enjoys life and people as much as he can. Derry says that people have already told him many fairy stories to console him. They say that it is not important what you look like. People tell these comforting lies only to console him. But Derry knows that he will not change. He will stay as a ‘monstrous beast’. No one will kiss him ever. Only his mother and she too kisses him on the other side of his face. He doesn’t care if nobody ever kissed him. Mr. Lamb asks Derry if he doesn’t care to be kissed by pretty girls. Girls with long hair and large eyes. Will he not like to be kissed by the people he loves? Derry replies that no one will ever kiss and love him. He is grieved that he won’t ever look different. Even when he grows as old as Mr. Lamb, he will look the same. He will still only have “half a face”. Mr. Lamb replies



6

391

that Derry may have a ‘half face’, but the world has got a ‘whole face’. He should look at it. Derry is obsessed with what people say and comment. People remind Derry that there are people even worse than him. They might be blind, dumb or may be mad by birth. Sometimes people can be very cruel. A woman looked at him. She said to another woman, “Look at that, that’s a terrible thing”. She told her that only a mother could love such a face. Mr. Lamb advises Derry to keep his ears shut. Derry says that he doesn’t like being close to people. He can’t stand people staring at him and passing cruel comments about him. Mr. Lamb reminds Derry that he can’t lock himself up in a room and never leave it. Then, he narrates to him the story of a man who was afraid of everything in the world. So, he went into his room, locked the door and stayed there. A picture fell off the wall on to his head and killed him. Mr. Lamb says that he enjoys life as it comes. He sits in the sun and reads books. He is not fond of curtains. Mr. Lamb motivates Derry. Derry has got two arms, two legs, eyes and ears. He has got a tongue and also a brain. He can get on the way he wants like all others. And if he chooses, he can “get on better than all the rest”. Derry asks, “How ?” Mr. Lamb replies that Derry can live the same way as he himself does. For him everybody is welcome. The gate is always open. Derry says that there are some people whom he hates. Mr. Lamb says that hatred is more harmful than a bottle of acid. Derry gets up and prepares to go. He says he will come back. Mr. Lamb says that generally people say so but never come back. Derry comes home. His mother warns him not to go back there. Derry assures her that she need not fear. Only an old man with a tin leg lives there. He has a huge house and a garden. He is Mr. Lamb. He says things nobody else has ever said. Derry runs to Mr. Lamb’s garden. He opens the garden gate. He cries that he has come back. Suddenly, there is a crash. The ladder falls back, Mr. Lamb also falls down with it. He dies. Derry begins to weep. He goes on crying “Lamey-Lamb ! I did .... come back”. 

MEMORIES OF CHILDHOOD —Zitkala-Sa and Bama

Revision Notes Introduction Memories of Childhood summary deals with two extracts which belong to two different autobiographical episodes. Furthermore, these two episodes deal with the lives of two women whose names are Zitkala Sa

and Bama. Both of them had to face hardship and are victims of social discrimination. Zitkala Sa had to deal with racial discrimination while Bama had to suffer caste discrimination. In both the extracts, the writers explore their childhood and there is a reflection on their relationship with the prevalent culture. The culture

392

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

was harsh towards these women and treated them in a harsh manner in their childhood. Both these accounts are means to convey how these women went through their oppression. Also, there was resistance by both the narrators in their own ways. Zitkala-Sa and Bama were young but not so young that they were naïve about the mainstream culture’s evil scheme. They became rebellious due to their bitter childhood experience.

Key Words bedlam: uproar dawdle: waste time oddities: strange things harangue: to give lecture

Summary

I. The Cutting of My Long Hair —Zitkala-Sa The first day in the land of apples was a bitter-cold one. Scan to know The ground was covered with snow; the more about trees were bare. The sound of the bell this topic and the clatter of shoes were annoying to sensitive ears. People murmured in an unknown tongue. The narrator’s soul had lost her peace and freedom. But all was useless. Memories of Childhood A pale-faced woman came up after them. The girls were marching into the dining room. These were Indian girls in stiff shoes and closely clinging dresses. The boys entered through the opposite door. She was feeling very uncomfortable. A small bell rang. She pulled her chair and sat on it. But she noticed that all others were standing. She felt confused. The second bell was sounded. All were seated at last. She caught the eyes of a pale-faced woman upon her. She was being keenly watched by the strange woman. The third bell was sounded. Everyone picked up their knife and fork and began eating. Late in the morning, the narrator’s friend Judewin gave her a terrible warning. She had overheard the pale-faced woman talk. They were talking about cutting her long, heavy hair. Among her people, short hair was worn by mourners. Shingled hair was worn by cowards. Judewin decided to submit, but the narrator rebelled. She decided not to submit but to struggle. She disappeared. She came in a large room with three white beds in it. She crawled under the bed and hid herself. She heard the footsteps nearby. The steps were quickened. The voices grew louder. They looked under the bed. She was dragged out. She was carried down the stairs and tied-fast to a chair. She faced extreme indignities. Her long hair was shingled like that of a coward ! No one

came to comfort her. Now, she was only one of the many little animals driven by a herder.

II. We Too Are Human Beings — Bama

The narrator was in the third class. She hadn’t yet heard people speak openly of untouchability. But she had already seen, felt, experienced and been humiliated by what it was. The distance from her school to home could be covered in ten minutes. But she took from half an hour to an hour to reach there. She watched all the fun and games that were going on. She saw performing monkeys. She saw the snake charmer displaying his snakes. The other attractions were : The Maariyaata temple; the Pongal celebrations; the statue of Gandhiji and the sweet and snack stalls. She could go on and on. Everything stopped her and attracted her attention. Political parties would arrive. They cried through their mikes. Then, there might be a street play or a puppet show or a stunt performance. Some or the other entertainment was always going on. There were the coffee clubs in the bazaar. She would see people chopping onions or almonds blown down by the wind. All these sights stopped her from going home. Then, she would see people selling vegetables, fruits and sweets. One day the narrator saw that a threshing floor had been set up near her street. The landlord sat there watching the proceedings. Then, an elder of their street came along from the bazaar. He was carrying a small packet. It contained something like vadai or green banana bhaji. He came along holding out the packet by its string without touching it. The elder went straight to the landlord. He bowed low and extended the packet towards him. The landlord opened it and began to eat. She went home and told the story in all its comic detail. She fell about with laughter, but Annan (elder brother) was not amused. He told her that the man was not being funny. He was from a low caste. He couldn’t touch the food packet. When she heard it, she felt terribly sad. It was disgusting. She felt so much provoked and angry that she wanted to touch those vadais herself straightway. She wondered why poor people showed respect and bowed before such cruel persons. The rich forget that others are also human beings. Annan told the narrator that they were born in a community of ‘low caste‘ people. They were never given any honour or dignity or respect. If they study and make progress, they can throw away these indignities. If they are learned, then people will come to them of their own accord. The words Annan spoke to her that day made a very deep impression on her. She studied hard and stood first in her class. Many people became her friends. 

Sample Question Paper (Issued by Board on16th September 2022)

ENGLISH CORE (301) Class–12 SOLVED. Time Allowed: 3 hours

Maximum Marks: 80

General Instructions: 1.

15-minute prior reading time allotted for Q-paper reading.

2.

The Question Paper contains THREE sections-READING, WRITING and LITERATURE.

3.

Attempt questions based on specific instructions for each part. Write the correct question number in your answer sheet to indicate the option/s being attempted.

SECTIONA: READING SKILLS I.

Read the passage given below:

[20 Marks] [1×10=10]

(1) Ghost nets aren’t supernatural, but they are legitimately scary. A ghost net is a fishing net that’s been lost or abandoned in the ocean. They are one particularly appalling part of the global ghost fishing problem, which includes fishing gear abandoned in the water. Any net or line left in the ocean can pose a threat to marine life. Just because a net is no longer used by fishers doesn’t mean it stops working. These nets continue to trap everything in their path, presenting a major problem for the health of our oceans and marine life. (2) Ghost nets entangle sea turtles, dolphins and porpoises, birds, sharks, seals and more, apart from catching fish. The nets keep animals from moving freely, cause injuries and keep mammals and birds from rising to the surface for air. Since hundreds of animals can be caught in a single net, this threat is monumental. The ghost nets harm coral reefs too—breaking corals, exposing them to disease and even blocking the reefs from needed sunlight. (3) Ghost nets are also a major contributor to the ocean plastics’ crisis. Most modern nets are made of nylon or other plastic compounds that can last for centuries. According to a 2018 study in Scientific Reports, ghost nets make up at least 46 percent of the Great Pacific Garbage Patch. Those abandoned fishing lines and nets that do breakdown never go away; they just become smaller pieces of plastic. Marine animals mistake this microplastic for food and eat it, which can harm internal organs, keep them from eating and expose them to toxic chemicals. (4) Exorcising ghost nets from our oceans will require commitment, cooperation and innovation. Many groups are working to remove ghost nets from the sea and are collaborating with local fishers and governments around the world to identify target areas and remove as many nets as possible. In 2015, a single World Wildlife Fund for Nature (WWF)-led mission in the Baltic Sea hauled up 268 tons of nets, ropes and other material.

(5) To stop these nets from becoming ghosts in the first place, conservation organisations advocate for fishing gear that can be traced to its owner so anyone dumping nets can be fined and refundable deposits on nets to encourage returning or recycling rather than littering. Tools like sonar reflectors that can make ghost nets easier to find and working with small-scale fisheries to develop more sustainable fishing gear and practices are other suggestions. It is only by attacking this problem from all sides, together with conservation partners, fishers and supporters, can we banish ghost nets and protect our oceans. Based on your understanding of the above passage, answer the following questions.

394

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

(i)

Complete the sentence by choosing an appropriate option. Ghost nets have been named so because they __________________ (A)

cause much harm to the marine life.

(B)

are functional though not in use by fishers.

(C)

are not owned by anyone.

(D) act as a snare for all animals in oceans.

(ii) Comment on the writer’s reference to the ghost nets in paragraph one, as a health problem for the oceans. (iii) List the two ways being entangled in a ghost net is likely to impact a walrus. (Clue: Think about the type of animal a walrus is) (iv) Select the option that conveys the opposite of ‘negligible’, from words used in paragraph two. (A) unimpressive

(B)

(C) exposing

(D) threat

monumental

(v) The writer would not agree with the given statements based on paragraph three, EXCEPT: (A) Most ghost nets take a few years to completely disintegrate. (B) Ghost nets contribute to the Great Pacific Garbage Patch. (C) Most ghost nets provide nutrition to marine animals, upon disintegration. (D) Ghost nets can curtail freedom of marine animals. (vi) Some records share that fishing nets used to be made of common rope using natural fibres, prior to the 1960s. Based on your understanding of paragraph three, list one major advantage that these had over the fishing nets being used in present times. (vii) Why is it fair to say that commitment and innovation have to go hand-in-hand to rid the oceans of ghost nets? (viii)Complete the given sentence with an appropriate inference, with respect to the following: The writer quotes the example of the WWF-led mission in the Baltic Sea (Paragraph 4), in order to .......................... (ix) How can the solutions, suggested in paragraph five, best be described? (A) practical

(B)

(C) popular

(D) prejudiced

presentable

(x) Select the most suitable title for the above passage. (A) The Scary Side of Ghost Nets (B)

Ghost Nets – A Result of Human Dominance

(C) Ghost Nets – A Menace to Marine Life (D) Ways to Tackle the Problem of Ghost Nets

II.

Read the passage given below:

[1×10=10]

(1) It is generally accepted that leadership development should be a part of the education system's responsibility for preparing individuals to participate in a democratic and progressive society. Many schools, colleges and universities, across nations, provide their students with leadership courses, curricular programs and co-curricular programs that are designed to develop students’ formal knowledge about leadership as well as opportunities and experiences to develop students as leaders and actually practise leadership. Yet, only a handful of studies have sought to understand leader development from the students’ point of view, with students describing their own experiences and what they learned from them in their own words. (2) A 2014 descriptive study sought to understand student leadership with research through key events via the following research questions: Research Question 1: What key events do student leaders in college, report as significantly impacting their development as a leader?

Sample Question Paper

395

Research Question 2: What lessons do student leaders in college, report learning as a result of the key events they have experienced? Research Question 3: Are certain key events more likely to be linked to particular lessons? Approximately 130 students were contacted and the 72 interested, were interviewed. Two members of the research team were present for each 15–45 minute interview. One member served as the primary interviewer while the second ran the audio equipment. The results for lessons learned (Table 1), were varied, but there were a few that were frequently quoted. Lessons learned Identity Self Identity Leadership Identity Professionalism Balancing Roles Individual Competencies Delegation Decision Making Adaptability/Flexibility Resilence/Persistence/Hard work Taking Initiative Accountability/Responsibility Big Picture Learning to Teach/Learn Support Systems Developing and Using Support Systems Being a Support System Working with Others Communication Teamwork Conflict Diversity Inspiring and motivating others Other working with others Getting the job done Task skills Environment

Responses 58 54 30 19 17 15 38 18 36 29 27 18 36 28 59 26 21 32 17 30 55 34

(3) This study described the rich array of leadership lessons that students are learning through their experiences. It revealed that student leaders are learning foundational leadership skills and competencies that have positively impacted how to accomplish work, how to work with others and how to be both supported by and support others.

Based on your understanding of the above passage, answer the following questions. (i)

Does the following statement agree with the information given in paragraph 1? The researcher believes that educational institutions have ideal resources to study impact of leadership skills on young adults. Select from the following: True - if the statement agrees with the information False - if the statement contradicts the information Not Given - if there is no information on this

(ii) Do you think the researchers of the study aimed to change the students’ outlook towards the development of leadership skills, directly or indirectly? Support your answer with reference to the text.

396

Oswaal CBSE LMP (Last Minute Preparation), Class-XII

(iii) Select the option that displays the most likely reason for including Research Question 3 in the 2014 study. In order to find out if... (A) learning opportunities shape students’ overall personality. (B) leadership lessons are the result of the designed learning opportunities. (C) all learning opportunities cater to a specific lesson. (D) certain lessons are common in more than one learning opportunity. (iv) Complete the sentence based on the following statement. More than 50% of the identified student respondents were keen to participate in the 2014 study. We can say this because __________ . (v) Select the option that displays the key event designed with “Balancing Roles” (Table 1) as the objective. (A) Students will be able to debate the issue at hand, with different teams. (B) Students will be able to manage the responsibilities of a mentor, planner researcher and presenter. (C) Students will be able to surmount minor problems and focus on the final goal. (D) Students will be able to explain concepts and clarify them for peers. (vi) Complete the given sentence by selecting the most appropriate option. The 2014 study attempts to understand student leadership by focussing on __________. (A) experiences that shaped students’ overall personality (B) lessons gained by students as they grew up. (C) relationship of key events with particular lessons. (D) students in leadership roles. (vii) The lessons for ‘Individual competencies’ had a range of responses. Give one reason why having the least number of responses for ‘Decision Making’, is a matter that needs attention. (viii)Complete the given sentence by selecting the most appropriate option. The concluding sentence of the text makes a clear case for _____________ by listing it as a core competency for student leadership. (A) collaboration

(B)

(C) hard work

(D) observation

flexibility

(ix) Complete the sentence appropriately with one/ two words. In the context of “Working with Others” in Table 1, the lesson of ‘Conflict’ refers to _____________. (x) Based on the reading of the text, state a point to challenge the given statement. When theoretical knowledge about leadership suffices, it is a waste of funds by educational organisations, to organise leadership camps and programmes.

III. 1.

SECTION B: CREATIVE WRITING SKILLS Attempt any one of the following:

[20 Marks] [1×5=5]

(A) You are Josely Mathew, the President of the school book club. The club is organising a drive for promoting reuse of study materials and books. Draft a notice in about 50 words, for the school notice board, addressing students of classes X-XII, informing them about this drive and urging them to contribute to the endeavour. Mention how the donated books would benefit a charitable cause. OR (B)

2.

As the House Captain of A.B.M Public School, Telangana, draft a notice in not more than 50 words for the school notice board, informing House members from X-XII about the change in topic and submission dates for Round 1 of ‘Discovery’ - the upcoming Inter- House Research-based Paper Presentation Competition. Do not forget to issue an apology for the above. You are Kruthika Reddy.

Attempt any one of the following:

[1×5=5]

Sample Question Paper

397

(A) You are Dr. Suchitra Mukherjee. You have received an invitation from the Director, Health Services, Kharagpur, W.B, to preside over a gathering of leading medical practitioners attending a workshop on mental wellness on 09 November, 2023 at 11 a.m. in the Public Hospital, Jammu, J & K. Respond to accept the invitation in about 50 words. OR (B)

3.

Draft an invitation in about 50 words, on behalf of your aunt, Meghna Menon, which she has to share to invite prior work colleagues to the inaugural event of her own investment consultancy firm, in the Acer mall, Kozhikode, Kerala.

Attempt any one of the following:

[1×5=5]

(A) You are Minu Sen, an intern in a software company in Hyderabad. You feel that the growing relationship of companies with non-profit organisations have made Corporate Social Responsibility (CSR) the buzzword today. Your own involvement in one such project for your company has convinced you that CSR looks beyond the company profits and focuses on benefiting the greater community. Write a letter to the editor of a national daily in about 120-150 words, sharing your opinion about CSR and its advantages and provide suggestions to make it an integral part of every organisation. Use the given cues along with your own ideas to compose this letter.

OR (B)

You are Minu Sen, employed as an Asst. Manager for Corporate Social Responsibility (CSR) in your current company in Hyderabad. You saw the given advertisement in the newspaper and wish to apply for the position advertised.

Write a letter to Credit Sage Pvt. Ltd. along with your bio-data, expressing your interest in the situation vacant. 4.

Attempt any one of the following in 120-150 words:

[1×5 = 5]

(A) The construction sector is believed to be quite hazardous and has the maximum number of fatal work injuries because apart from other causes, stakeholders in this sector tend to ignore safety regulations. As a

398

Oswaal CBSE LMP (Last Minute Preparation), Class-XII columnist for an e-zine, draft an article in about 120-150 words, on the theme of the importance of worker safety in construction zones. Explore possible reasons for the prevailing situation and include suggestions for addressing it. Support your ideas with cues given below.

OR (B)

The construction sector is believed to be quite hazardous and has the maximum number of fatal work injuries. A safety fair was organised by ‘Building Safely’, an NGO in Mysuru, Karnataka with the overarching theme pertaining to the importance of worker safety in construction zones. You were asked to cover this event as the junior correspondent of a local daily. Write a report covering this event in about 120150 words. Support your ideas with outline cues given below, to craft your newspaper report.

SECTIONC: LITERATURE

[40 Marks]

IV. Read the givenextracts to attempt the questions with reference to context. 1.

Attempt ANY ONE of two extracts given.

[1×6=6]

(A) It is in the news that all these pitiful kin Are to be bought out and mercifully gathered in To live in villages, next to the theatre and the store, Where they won’t have to think for themselves anymore, While greedy good-doers, beneficent beasts of prey, Swarm over their lives enforcing benefits That are calculated to soothe them out of their wits, And by teaching them how to sleep they sleep all day, Destroy their sleeping at night the ancient way. (i)

(A Roadside Stand)

What is the tone of the poet in the above lines? (a)

aggressive

(b)

tolerant

(c)

sarcastic

(d)

resigned

(e)

sentimental

(A) Only (a)

(B)

(b) and (c)

(C) (a), (d) and (e)

(D) Only (c)

Choose the most appropriate option.

(ii)

Identify the phrase from the extract, that suggests the following:

Sample Question Paper

399

No one bothers to take ‘their’ consent before pushing the promise of a better life, their way. (iii) What quality of the villagers can be inferred through these lines? (A) gullible

(B)

(C) hypocritical

(D) ambitious

futuristic

(iv) Complete the following analogy correctly. Do NOT repeat from used example. greedy good doers: alliteration::__________ : oxymoron

(v)

(A) Thought

(B)

(C) Merry

(D) Spilling

Sprinting

On the basis of the extract, choose the correct option with reference to (1) and (2) given below. (1) The city dwellers make promises for the betterment of the villagers. (2) The city dwellers have ulterior motives. (A) (1) is true but (2) is false. (B)

(2) is true but (1) is false.

(C) (2) is the reason for (1). (D) Both (1) and (2) cannot be inferred from the extract. (vi) Fill the blank with an appropriate word, with reference to the extract. ‘… calculated to soothe them out of their wits’ implies that ‘them’ are being __________. OR (B)

A thing of beauty is a joy forever Its loveliness increases, it will never Pass into nothingness; but will keep A bower quiet for us, and a sleep Full of sweet dreams, and health, and quiet breathing. Therefore, on every morrow, are we wreathing A flowery band to bind us to the earth (i)

(ii)

(A Thing of Beauty)

Choose the option that displays the same poetic device as used in the first line of the extract. (A) I’m as happy as I can be.

(B)

(C) Nature is God’s gift to us.

(D) The dazzling divas enchanted all.

Life is a roller coaster ride.

What does the phrase ‘a bower quiet’ indicate? (A) serenity

(B)

(C) superiority

(D) diversity

morality

(iii) The benefits of a thing of beauty for humans include ____________ . (a)

healthy body

(b)

calm mind

(c)

struggle-free life

(d)

better relationships

(e)

hope to carry on

(A) Only (e)

(B)

(a), (b) and (e)

(C) (a), (c) and (d)

(D) (b) and (d)

Choose the most appropriate option.

(iv) Answer in ONE word. When the poet says that ‘a thing of beauty’ will never pass into nothingness, he means that it is __________. (v)

On the basis of the extract, choose the correct option with reference to the two statements given below: (1)

We are surrounded by beautiful things.

(2)

Beautiful things provide us joy.

400

Oswaal CBSE LMP (Last Minute Preparation), Class-XII (A) (1) can be inferred from the extract but (2) cannot. (B)

(2) can be inferred from the extract but (1) cannot.

(C) Both (1) and (2) can be inferred from the extract. (D) (2) is the reason for (1) and can be inferred from the extract. (vi) Which of the following is an apt title for the extract?

2.

(A) Full to the Brim with Joy

(B)

(C) Live Life King Size

(D) Hope Floats

Beauty Galore

Attempt ANY ONE of two extracts given.

[1×4=4]

(A) DERRY: You’re....peculiar. You say peculiar things. You ask questions I don’t understand. MR LAMB: I like to talk. Have company. You don’t have to answer questions. You don’t have to stop here at all. The gate’s open. DERRY: Yes, but... MR LAMB: I’ve a hive of bees behind those trees over there. Some hear bees and they say, bees buzz. But when you listen to bees for a long while, they humm....and hum means ‘sing’. I hear them singing, my bees. DERRY: But....I like it here. I came in because I liked it .... when I looked over the wall. MR LAMB: If you’d seen me, you’d not have come in. (On the Face of It)

DERRY: No. (i)

List the playwright’s purpose of using ellipses (…) in this extract.

(ii)

Select the option that best describes Derry and Mr. Lamb in the extract. (A) Derry: introvert; Mr. Lamb: friendly (B) Derry: fearful; Mr. Lamb: domineering (C) Derry: friendly; Mr. Lamb: weird (D) Derry: open minded; Mr. Lamb: charming

(iii) Which of the following best summarises Mr. Lamb’s attitude towards the bees? (A) Beauty is being true to yourself. (B) There is a kind of beauty in imperfection. (C) Beauty is the promise of happiness. (D) The beauty of the world lies in the details. (iv) Derry says, “I came in here because I liked it ….” What was the one significant thingDerry might have liked about the place, as per the extract? OR (B)

Students on Ice, the programme I was working with on the Shokalskiy, aims to do exactly this by taking high school students to the ends of the world and providing them with inspiring educational opportunities which will help them foster a new understanding and respect for our planet. It’s been in operation for six years now, headed by Canadian Geoff Green, who got tired of carting celebrities and retired, rich, curiosity-seekers who could only ‘give’ back in a limited way. With Students on Ice, he offers the future generation of policy-makers a life-changing experience at an age when they’re ready to absorb, learn, and most importantly, act. (Journey to the End of the Earth) (i)

Complete the sentence appropriately, with reference to the extract. The writer refers to the educational opportunities as ‘inspiring’ because ___________.

(ii)

Which of the following would NOT be ‘a life changing experience’? (A) Being given the lead role in a play. (B) Going on an adventure trip. (C) Playing a video game. (D) Meeting a great leader, you admire.

(iii) Select the most suitable title for the given extract. (A) Adventure with a Mission

(B)

(C) The Wanderlust

(D) Students of the Future

Adventure – The Spice of Life

(iv) Why does the writer refer to ‘act’ as more important than ‘absorb’ or ‘learn’?

Sample Question Paper 3.

Attempt ANY ONE of two extracts given.

401

[1×6=6]

(A) A girl from the countryside, she hadn’t gone through all the stages of worldly experience that generally precede a position of importance and sophistication that she had found herself catapulted into. She never quite recovered from the terror she felt that day. That was the end of a brief and brilliant acting career — the legal adviser, who was also a member of the Story Department, had unwittingly brought about that sad end. While every other member of the Department wore a kind of uniform — khadi dhoti with a slightly oversized and clumsily tailored white khadi shirt — the legal adviser wore pants and a tie and sometimes a coat that looked like a coat of mail. Often, he looked alone and helpless … (Poets and Pancakes) (i)

Select the option that completes the given sentence appropriately. ‘Stages of worldly experience’ in the given context would refer to _____________.

(ii)

(A) good education to gain knowledge. (B)

situations that require one to be street smart.

(C) smaller, not so important roles in acting.

(D)

training in soft skills.

Select the suitable word from the extract to complete the following analogy: sealed: closed:: propelled: ________________

(iii) Select the correct option to fill in the blank. The harm done to the actress was a/an __________ (A) well-planned act.

(B)

(C) act of jealousy.

(D) act of male dominance.

unintentional act.

(iv) Based on the above extract, choose the statement that is TRUE for the legal adviser. (A) He disliked the actress from the countryside. (B)

He acted after thinking through things carefully.

(C) He did not gel well with others in the Department. (D) He was always dressed smartly. (v)

Identify the textual clue that allows the reader to infer that the writer is sympathetic towards the professional fate of the actor. (Clue: a phrase)

(vi) Complete the sentence with an appropriate explanation, as per the extract. The writer uses the word ‘uniform’ to refer to the outfits of the Department members because just like a uniform __________. OR (B)

Some might make quite extravagant claims for it as being, in its highest form, a source of truth, and, in its practice, an art. Others, usually celebrities who see themselves as its victims, might despise the interview as an unwarranted intrusion into their lives, or feel that it somehow diminishes them, just as in some primitive cultures it is believed that if one takes a photographic portrait of somebody then one is stealing that person’s soul. (The Interview) (i)

What is the most likely reason some people consider the practice of interview to be an art? This could be because it requires-

(ii)

(A) fluency of words.

(B)

(C) creativity and imagination.

(D) probing and focusing on details.

sensitive and careful handling.

Rewrite the sentence by replacing the underlined phrase with its inference. Celebrities feel that an interview diminishes them.

(iii) On the basis of the extract, choose the correct option with reference to the two statements given below. (1) Celebrities don’t consent to be interviewed. (2) Interviews intrude the privacy of celebrities. (A) (1) Can be inferred from the extract but (2) cannot. (B)

(1) cannot be inferred from the extract but (2) can.

(C) (1) is true but (2) is false. (D) (2) is the reason for (1). (iv) Rationalise, to support the given opinion:

402

Oswaal CBSE LMP (Last Minute Preparation), Class-XII To say that an interview, in its highest form, is a source of truth, is an extravagant claim. (v)

Replace the underlined word with its antonym from the extract. Some celebrities hate the idea of having to give an interview because it makes them feel like supporters.

(vi) The author’s views on interview, in the extract, can best be described as statements based on _______.

V.

(A) facts

(B)

(C) beliefs

(D) superstitions

hypothesis

Answer ANY FIVE of the following in about 40-50 words each.

[2×5=10]

(a)

“You realise the true value of a thing only on losing it.” Comment on this statement in the light of the story, The Last Lesson.

(b)

State the common issue faced by most of the aged in the current times, with reference to the poem My Mother at Sixty-six.

(c)

What do we come to know about the author of Lost Spring, Anees Jung, through her interactions with Saheb and Mukesh?

(d)

Give two reasons why, according to Pablo Neruda, is ‘keeping quiet’ essential to attaining a better, more peaceful world. (Keeping Quiet)

(e)

If the Christmas spirit is about selflessness, forgiveness and becoming 'better' versions of ourselves amongst other things, EdlaWillmansson is the epitome of this spirit. Justify with two points of evidence from The Rattrap.

(f)

How can we say that marriage was a compromise for Aunt Jennifer? Support your response with two justifications. (Aunt Jennifer’s Tigers)

VI. Answer ANY TWO of the following in about 40-50 words each.

[2×2=4]

(i)

‘It’s easy to judge others and give advice, but much more difficult to apply it to ourselves.’ Elaborate with reference to the character of Sam in The Third Level.

(ii)

Comment on any one aspect of the writing style of the author, Kalki in The Tiger King.

(iii) How do we know that Dr. Sadao was conscientious as well as loyal? (The Enemy)

VII.Answer ANY ONE of the following in about 120-150 words. (i)

[1×5 = 5]

The prose selections, Deep Water and Indigo, bring out the importance of overcoming fear, in order to be able to lead our lives successfully. Imagine yourself to be a motivational speaker who has to address high school students. Write this address in 120 – 150 words elaborating on occurrences from the two texts to inspire your audience and to convince them about the importance of overcoming fear. You may begin like this … Good morning, students! We all know what it’s like to be afraid. Fear is our body’s natural response to a perceived threat or danger. But when … OR

(ii)

‘Their mother sighed. Sophie watched her back stooped over the sink and wondered at the incongruity of the delicate bow which fastened her apron strings.’ The prose selection, Going Places includes this telling comment about Sophie’s mother. In Aunt Jennifer’s Tigers, we are told that – ‘The massive weight of Uncle’s wedding band Sits heavily upon Aunt Jennifer’s Hand.’ Imagine a conversation between Sophie’s mother and Aunt Jennifer. Create this exchange with reference to the two extracts given above. You may begin the conversation like this … Sophie’s mother: Your embroidery is so beautiful. Do you love tigers?

Sample Question Paper

VIII.Answer ANY ONE of the following in about 120-150 words. (i)

403

[1×5 = 5]

On returning home, Tishani Doshi writes her thoughts reflecting on how her decision to enroll for the Students on Ice programme has been the single most important decision of her life that has completely transformed her. Imagine yourself to be Tishani and express these thoughts. You may begin like this: I can’t thank my stars enough for having cashed in on the opportunity of ........... OR

(ii)

Both Bama and Zitkala Sa experienced the harsh reality of discrimination in their childhood. Instead of letting it pull them down, they both found a way to overcome it. You wish to include a cameo* of both in your upcoming blog post. As a part of the research, compare and contrast the experiences faced by the two and their response/s to these experiences, in 120-150 words. [Clue: Include the similarities and differences in the discrimination they faced - their feelings - determination to overcome – success] *a short description that neatly encapsulates someone or something

    

SOLUTIONS Sample Question Paper Marking Scheme 2022-23 (Issued by Board)

ENGLISH CORE (301)Section A I.

(i)

Option (C) is correct. Value Points

Guidance

C. are not owned by anyone.

▪ Award 1 mark for the correct answer.

2.

The entangling can prevent resurfacing, leading to death by drowning. (iv) Option (B) is correct. Value Points B. monumental

▪ There is no partial credit

▪ There is no partial credit

Explanation: ‘negligible’ means ‘very minute’ while ‘monumental’ means ‘huge’. unimpressive, exposing, threat do not relate to ‘negligible’ with respect to the size.

Explanation: A ghost net is a fishing net that’s been lost or abandoned in the ocean. (ii) Value Points

Guidance

The ghost nets are the reason the marine life is frequently sick. If not addressed, this ‘health issue’ would soon be chronic.

▪ Award 1 mark for the correct explanation with reference to health and sickness.

(v)

▪ There is no partial credit

(iii) Guidance ▪ Award 1 mark for 2 correct points ▪ Partial credit for 1 point ▪ No credit for unclear responses

Explanation: The two ways impacting a walrus, if entangled in a ghost net, are: 1.

The entangling can cause injuries.

Option (C) is correct. Value Points

Guidance

C. Most ghost nets provide nutrition to marine animals, upon disintegration.

▪ Award 1 mark for the correct answer. ▪ There is no partial credit

Explanation: Most modern nets are made of nylon or other plastic compounds that can last for centuries. According to a 2018 study in Scientific Reports, ghost nets make up at least 46 percent of the Great Pacific Garbage Patch. Those abandoned fishing lines and nets that do breakdown never go away; they just become smaller pieces of plastic. Marine animals mistake this micro-plastic for food and eat it, which can harm internal organs, keep them from eating and expose them to toxic chemicals.

Explanation: Ghost nets are one particularly appalling part of the global ghost fishing problem, which includes fishing gear abandoned in the water. These nets continue to trap everything in their path, presenting a major problem for the health of our oceans and marine life. The ghost nets are the reason the marine life is frequently sick. If not addressed, this ‘health issue’ would soon be chronic. Value Points [walrus is a mammal] 1. entangle and cause injuries 3. entangle and prevent resurfacing, leading to death by drowning

Guidance ▪ Award 1 mark for the correct answer.

(vi) Value Points

Guidance

Used to be biodegradable/ easily disintegrated, as compared to artificial fibre nets that do not disintegrate.

▪ Award 1 mark for the correct answer. ▪ There is no partial credit

Explanation: The fishing nets that used to be made of common rope made of natural fibres were bio-degradable/ easily

Solutions

405

disintegrated, as compared to the present fishing nets made of artificial fibre nets that do not disintegrate.

▪ No partial credit

(vii) Value Points

Guidance

Commitment—This task will require perseverance/a long time to accomplish Innovation— Creative ideas and strategies would be needed to address this problem

▪ Award 1 mark if both ‘commitment’ and ‘innovation’ have been addressed separately and correctly. ▪ Partial credit for addressal of one aspect

Explanation: The commitment is that this task will require perseverance or a long time to accomplish. Innovation is that creative ideas and strategies would be needed to address this problem. (viii) Value Points — draw attention to the magnitude of the problem — indicate that Governments need to collaborate with such groups for addressing the problem of ghost nets — share evidence of human apathy/ carelessness towards natural resources (Any 1 OR similar)

Value Points C. Ghost Nets – A Menace to Marine Life

Guidance ▪ Award 1 mark for the correct answer. ▪ No partial credit

Explanation: This passage deals with the problems and threats created by the ghost nets for the marine life. Hence this title is most apt. II.

(i)

Guidance ▪ Award 1 mark for the correct answer. ▪ There is no partial credit

Value Points

Guidance

FALSE [the researcher indicates that educational institutions have opportunities and programmes to inculcate leadership skills]

▪ Award 1 mark for the correct answer. ▪ No partial credit.

Explanation: The given statement is FALSE as the researcher indicates that educational institutions have opportunities and programmes to inculcate leadership skills. (ii)

Explanation: The writer quotes the example of the WWF led mission in the Baltic Sea (paragraph 4), in order to draw attention to the magnitude of the problem. It may also indicate that Governments need to collaborate with such groups for addressing the problem of ghost nets. They can also share evidence of human apathy or carelessness towards natural resources. (Any one) (ix) Option (A) is correct. Value Points A. practical

Explanation: It is only by attacking this problem from all sides, together with conservation partners, fishers and supporters, can we banish ghost nets and protect our oceans. This is a practical solution to the problem. (x) Option (C) is correct.

Guidance ▪ Award maximum 1 mark for the complete correct answer

Value Points Guidance ▪ No ▪ Award 1 mark for the complete ▪ The aim of seeking answer (Response students’ perspec+ explanation) tives was to enable a better designing/ ▪ No partial credit. creation/ of the leadership programmes in educational institutions OR promote higher efficacy/betterment of leadership programmes Explanation: The researchers of the study do not aim to change students’ outlook towards the development of leadership skills, directly or indirectly. The aim of seeking students’ perspectives was to enable a better designing

406

OSWAAL CBSE LMP (Last Minute Preparation), ENGLISH CORE, Class–XII or creation of the leadership programmes in educational institutions or to promote higher efficacy or betterment of leadership programmes. (iii) Option (D) is correct. Value Points

Guidance

D. certain lessons are common in more than one learning opportunity.

▪ Award 1 mark for the correct answer. ▪ No partial credit.

Explanation: Research Question 3 states that “Are certain key events more likely to be linked to particular lessons?” So linked events become common in practice, which is stated in Option D. (iv) Value Points

Guidance

72 of 130 students consented and were interviewed

▪ Award 1 mark for the correct answer.

Note: 72 out of 130 is more than half / 50%.

▪ No partial credit.

support others. (vii) Value Points Guidance This needs attention ▪ Award 1 mark because it clearly for the correct indicates that the answer. lessons created / ▪ No partial student experiences credit. do not allow sufficient opportunity for development of this crucial skill. Explanation: Having the least responses for ‘Decision Making’, is a matter that needs attention because it clearly indicates that the lessons created or student experiences do not allow sufficient opportunity for development of this crucial skill. (viii) Option (A) is correct. Value Points Guidance ▪ Award 1 mark for A. collaboration the correct answer. ▪ There is no partial credit. Explanation: This study described the rich array of leadership lessons that students are learning through their experiences. It revealed that student leaders are learning foundational leadership skills and competencies that have positively impacted how to accomplish work, how to work with others and how to be both supported by and support others. This varied learning and imbibing skills calls for collaboration.

Explanation: We can say this because 72 out of 130 students consented and were interviewed. 72 out of 130 is more than half or 50%. (v)

Option (B) is correct. Value Points

Guidance

B. Students will be able to manage the responsibilities of a mentor, planner researcher and presenter.

▪ Award 1 mark for the correct answer. ▪ No partial credit.

(ix)

Explanation: Balancing Roles come under the ‘Identity’ category. (vi) Option (C) is correct. Value Points

Guidance

C. relationship of key events with particular lessons.

▪ Award 1 mark for the correct answer.

▪ There is no partial credit. Explanation: This study described the rich array of leadership lessons that students are learning through their experiences. It revealed that student leaders are learning foundational leadership skills and competencies that have positively impacted how to accomplish work, how to work with others and how to be both supported by and

Value Points

Guidance

Being able to amicably and effectively resolve matters/conflict resolution

▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

(Any other / Similar relevant) Explanation: In the context of “Working with Others” in Table 1, the lesson of ‘Conflict’ refers to being able to amicably and effectively resolve matters/ conflict resolution. (x) Value Points

Guidance

I disagree because no amount of theoretical knowledge can aid

▪ Award 1 mark for the correct answer. ▪ No partial credit.

Solutions

407

students to actually apply their learning about leadership and develop various skills.

• Poor sequencing of ideas; often sporadically clear and related to the given topic in an attempt to maintain a general overall cohesion. Displays disjointed portions, exhibiting a lack of coherence of ideas.

Explanation: I disagree because no amount of theoretical knowledge can aid students to actually apply their learning about leadership and develop various skills. Practical implementation is the utmost requisite.

III.

• Range of vocabulary is limited but manages to convey, largely, the overall meaning and the purpose of the writing. ACCURACY – 1 mark 1 mark

Section B

• Spelling, punctuation and grammar consistently/largely accurate, with occasional minor errors, that do not impede communication. ½ mark

1. NOTICE Format – 1, Content – 2, Organisation of ideas – 1, Accuracy – 1

• Spelling, punctuation and grammar display some errors spread across, causing minor impediments to the message communicated.

Format – 1 Box, NOTICE (centre), name of issuing authorityorganisation/ agency (centre), date of issue(aligned left), Authorisation name, designation & signature (bottom left) NOTE: Full credit if all aspects included. Partial credit (½ mark) if one-two aspects are missing. No credit if more than two aspects are missing. Note for given descriptors: Dedicated marks at a level are to be awarded only if ALL descriptors match. If one or more descriptors do not match, the marks are awarded at a level lower. CONTENT – 2 marks (As listed in value points)

½ mark×4=2 marks

ORGANISATION OF IDEAS – 1 mark

No credit • Frequent errors in spelling, punctuation and grammar, impeding communication. (A) Value Points ▪ Correct format (as listed above) ▪ Drawing attention—students of X-XII ▪ Mentioning the event ▪ Giving details -D,T,V ▪ Sharing how donated books would benefit a charitable cause + urging them to contribute ▪ Line with reference to the undersigned Detailed Answer: XYZ School

1 mark -- Consistent to frequent display of the listed parameters. • Highly effective style capable of conveying the ideas convincingly with appropriate layout of a notice viz. opening line to indicate the target audience, details/ information to be shared, mention of last date (if the Q lends itself to it), Line about contacting the undersigned etc. • Carefully structured content with organised information presented cohesively in an aligned manner. • Highly effective register (formal tone, tense, and vocabulary), relevant, lucid and appropriate sentences for conveying the idea/s precisely and effectively. ½ mark – Limited display of listed parameters. • Inconsistent style, expression sometimes awkward, layout of the notice, barely accurate.

Book Club Notice 21 September 20XX Reuse of Study Materials and Books This is to inform all the students of X-XII that the school book club is organising a drive for promoting reuse of study materials and books. The students can donate their old books, notebooks, other stationery material etc. to their respective class prefects by 30 September 20XX. The donated books would benefit a charitable cause. All the students are urged to wholeheartedly contribute to the endeavour. For more details contact the undersigned. Josely Mathew (President, School Book Club)

408

OSWAAL CBSE LMP (Last Minute Preparation), ENGLISH CORE, Class–XII OR

(B) ▪ ▪ ▪ ▪ ▪ ▪

Value Points Correct format (as listed above) Drawing attention—House members of X-XII Sharing the changes—giving context Giving details -D,T,V Line of polite apology/ inconvenience regretted etc. Line with reference to the undersigned

Layout usually pertains to the following-• Name of host /hosts • Formal standard expression-cordial • Purpose of invitation • Date /time of event • Venue (address) • Name of special guest (if any) • RSVP

Detailed Answer: A.B.M Public School, Telangana

• Contact detail/ number

Notice

FORMAT – 1 mark

PQR House: Editing in ‘Discovery’ Competition

A. Reply to formal invite — Letter type & B. Formal invite to many — Card type

21 September 20XX This is to inform all the PQR House Members from X-XII that due to some unavoidable and unstated reason, there is a change in the topic and the submission date for Round 1 of ‘Discovery’ - the upcoming Inter-House Research-based Paper Presentation Competition. The old topic stands cancelled and the new topic is ‘Hidden Treasure’. Also the last date for submission is now 1 October 20XX instead of 25 September 20XX. The inconvenience caused is regretted. For more details contact the undersigned. Kruthika Reddy (PQR House Captain)

INVITATION Format – 1, Content – 2, Organisation of ideas – 1, Accuracy – 1 A. Features: Letter type -Formal reply • Acknowledge the invitation express gratefulness • Express thanks in third person • Mention acceptance or regret- (give reason) • Use formal and polite language Layout usually pertains to the format of a formal letter. 2B. Features: Card type-formal invite • a single sentence presentation in third person / end line punctuations skipped • Use the simple present tense • answers the questions who, whom, when, where, what time and for what • Range of vocabulary is limited but manages to convey, largely, the overall meaning and the purpose of the writing. • includes name and address of the organiser /host and name/s of special invitees (if any) • No signatures

NOTE-full credit if all aspects included. Partial credit (½ mark) if one-two aspects are missing. No credit if more than two aspects are missing. CONTENT – 2 marks (As listed in value points)

½ mark × 4=2 marks

ORGANISATION OF IDEAS – 1 mark 1 mark -- Consistent to frequent display of the listed parameters. • Highly effective style capable of conveying the ideas convincingly with appropriate layout [Reply to formal invite--- Letter type] & [Formal invite to many ---Card type] • Carefully structured content with organised information presented cohesively in an aligned manner. • Highly effective register (formal tone, tense, and vocabulary), relevant, lucid and appropriate sentences for conveying the idea/s precisely and effectively. ½ mark – Limited display of listed parameters. • Inconsistent style, expression awkward, layout, barely accurate.

sometimes

• Poor sequencing of ideas; often sporadically clear and related to the given topic in an attempt to maintain a general overall cohesion. Displays disjointed portions, exhibiting a lack of coherence of ideas. • Range of vocabulary is limited but manages to convey, largely, the overall meaning and the purpose of the writing.

Solutions

409 ACCURACY – 1 mark

1 mark

(B) Value Points Refer to Features, listed above.

• Spelling, punctuation and grammar consistently/ largely accurate, with occasional minor errors, that do not impede communication. ½ mark • Spelling, punctuation and grammar display some errors spread across, causing minor impediments to the message communicated.

Detailed Answer: Meghna Menon Request the pleasure of your presence On the auspicious occasion of the INAUGURAL EVENT of her own

No credit • Frequent errors in spelling, punctuation and grammar, impeding communication.

INVESTMENT CONSULTANCY FIRM in Acer Mall, Kozhikode, Kerala at 4:30 p.m.

(A)

on 5 October, 20XX Value Points ▪

Reference to invitation

▪

Acceptance of invitation

▪

Confirmation of date, time and venue

▪

Comment on looking forward to attending (if at all)

Detailed Answer:

R.S.V.P Meghna Menon, 9956879978 ABC Menon, 9956879978

LETTER Format – 1, Content – 2, Organisation of ideas – 1, Accuracy – 1

ABC Hospital

Format

Kharagpur, West Bengal

Sender’s address, Date, Receiver’s address, Subject and Salutation/ Salutation and Subject, Letter,

21 September 20XX

Complimentary close (largely accepted –Yours truly for letter to editor & in business circuits Yours sincerely)

The Director

Format – 1 mark

Health Services Kharagpur, West Bengal

Subject: Acceptance of Invitation Sir Thanks for your invitation to preside over a gathering of leading medical practitioners attending a workshop on mental wellness on 09 November, 2023 at 11 a.m. in the Public Hospital, Jammu, J & K.

NOTE: full credit if all aspects included. Partial credit (½ mark) if one-two aspects are missing. No credit if more than two aspects are missing. Note for given descriptors: Dedicated marks at a level are to be awarded only if ALL descriptors match. If one or more descriptors do not match, the marks are awarded at a level lower. CONTENT – 2 marks 2 marks • All points included • Well-developed with sustained clarity

I would like to utilize this opportunity to share my experiences with the renowned doctors of the country.

1½ marks

I hereby consent to attend the event.

1 mark

• Almost all points incorporated • Reasonably well-developed • Some points incorporated

Yours sincerely

• Fair attempt at developing ideas with some impact on clarity of response

Dr. Suchitra Mukherjee OR

½ mark

410

OSWAAL CBSE LMP (Last Minute Preparation), ENGLISH CORE, Class–XII companies include CSR, privileges or offers of some kind to companies that show some positive change in society via CSR, special rebates for students who take up CSR projects in collaboration with such companies etc.

• Most of the points of the given task not incorporated • Limited awareness of task development ORGANISATION OF IDEAS – 1 mark 1 mark -- Consistent to frequent display of the listed parameters. • Highly effective style capable of conveying the ideas convincingly with appropriate layout of a notice viz. opening line to indicate the target audience, details/ information to be shared, mention of last date (if the Q lends itself to it), Line about contacting the undersigned etc. • Carefully structured content with organised information presented cohesively in an aligned manner.

Detailed Answer: ##, PQR Colony Hyderabad 21 September 20XX The Editor The Hindu Hyderabad Subject: Corporate Social Responsibility (CSR) Sir

• Highly effective register (formal tone, tense, and vocabulary), relevant, lucid and appropriate sentences for conveying the idea/s precisely and effectively.

Through the column of your esteemed daily I would like to express my views about Corporate Social Responsibility (CSR) which is the buzzword today and its advantages.

½ mark – Limited display of listed parameters.

In my opinion, the growing relationship of companies with non-profit organisations have made Corporate Social Responsibility (CSR) the buzzword today. CSR looks beyond company profits & benefits community. With my own involvement in a project for my company, I have recognised four types of CSR effortsenvironmental initiatives, charity work, ethical labour practices and volunteer projects. Also the underlying advantages of CSR include brand value, increased sales, poverty alleviation and positive public attention. Thus, the need of the hour is to make CSR an integral part of every organisation.

• Inconsistent style, expression sometimes awkward, layout of the notice, barely accurate. • Poor sequencing of ideas; often sporadically clear and related to the given topic in an attempt to maintain a general overall cohesion. Displays disjointed portions, exhibiting a lack of coherence of ideas. • Range of vocabulary is limited but manages to convey, largely, the overall meaning and the purpose of the writing. ACCURACY – 1 mark 1 mark • Spelling, punctuation and grammar consistently/largely accurate, with occasional minor errors, that do not impede communication. ½ mark • Spelling, punctuation and grammar display some errors spread across, causing minor impediments to the message communicated. No credit • Frequent errors in spelling, punctuation and grammar, impeding communication. (A) Value Points

So I hereby request you to allow me to raise public awareness through your reputed daily. Kindly provide me some space in your renowned newspaper to voice my thoughts. I urge that mandatory laws should be made for the companies to include CSR. Privileges or offers of some kind should be given to companies that show some positive change in society via CSR. Also special rebates for students should be arranged who take up CSR projects in collaboration with such companies etc. These steps would definitely bring about a major transformation in the corporate world.

▪

Opinion—CSR looks beyond company profits & benefits community – reference to first- hand experience + CSR efforts(cues)

I hope that my thoughts will surely find association with you. Thank you in anticipation.

▪

Advantages (reference --cues)

Yours truly

▪

Importance of making it an integral part of every organisation

Minu Sen

▪

Suggestions-awareness, laws to mandate

(Intern, ABC Software Company)

Solutions

411 OR

(B)

Name Father’s Name Age Residential Address Gender Marital Status Nationality Educational Qualifications

Value Points Content ▪ Covering Letter ▪ Reference to the advertisement ▪ Conveying suitability for the position-CSR (Head) / CSR Manager (as advertised) ▪ Submission of application Bio data as separate enclosure ▪ Profile of self ▪ Educational Qualifications (include advertised requirements) ▪ Work experience/s (if relevant)- include as it is a senior post ▪ References Any other relevant information

: : : : : : : :

Female Unmarried Indian M.A. Sociology, SRM Institute of Arts & Technology; Diploma in Public Relations, Hyderabad PR Institute : 5 years’ experience in CSR project management and execution in ABC Software Company 2 years’ experience with NPO : Interpersonal and communication skills (verbal & written) : Reading and Photography : English, Hindi, Telugu, French : Mr P.K. Nair Regional Manager Credit Sage Pvt. Ltd.

Experience

Detailed Answer: ##, ABC Software Company

Skills

Hyderabad 21 September 20XX

Hobbies Languages known Reference

The Manager Credit Sage Pvt. Ltd. Hyderabad Subject: Post of Corporate Social Responsibility (CSR) Head Sir With reference to your advertisement in 'The Hyderabad Times' dated 20 September 20XX for the post of a Corporate Social Responsibility (CSR) in your esteemed company, I would like to apply for the same. I possess the requisite qualifications and experience. I’m presently employed as an Asst. Manager for Corporate Social Responsibility (CSR) in ABC Software Company, Hyderabad. I have strategized and initiated various community benefit schemes liasoning with different organisations. I have also developed CSR initiatives in my present company’s adopted village. I will, therefore, use my experience for future endeavours. I assure you that I will perform my duties with great dedication and sincerity. I believe that my innovative ideas will prove as asset to the company. I am enclosing my bio-data for your perusal. Thank You Yours sincerely Minu Sen Encl- Bio-data

BIO-DATA Minu Sen R.K. Sen 27 years ##, PQR Colony, Hyderabad

4. ARTICLE / REPORT Format – 1, Content – 2, Organisation of ideas – 1, Accuracy – 1 Article: Assessment Parameters Format • Title & By line Organisation & Content: Format – 1 mark NOTE: Full credit if all aspects included. Partial credit (½ mark) if one-two aspects are missing. No credit if more than two aspects are missing. Note for given descriptors: Dedicated marks at a level are to be awarded only if ALL descriptors match. If one or more descriptors do not match, the marks are awarded at a level lower. CONTENT – 2 marks 2 marks • All points included • Well-developed with sustained clarity 1½ marks

412

OSWAAL CBSE LMP (Last Minute Preparation), ENGLISH CORE, Class–XII Report: Assessment Parameters

• Almost all points incorporated • Reasonably well-developed 1 mark • Some points incorporated • Fair attempt at developing ideas with some impact on clarity of response ½ mark • Most of the points of the given task not incorporated • Limited awareness of task development ORGANISATION OF IDEAS – 1 mark 1 mark -- Consistent to frequent display of the listed parameters. • Highly effective style capable of conveying the ideas convincingly with appropriate layout • Carefully structured content with organised paragraphing presented cohesively. • Highly effective register (formal tone, tense, and vocabulary), relevant, lucid and appropriate sentences for conveying the idea/s precisely and effectively. ½ mark – Limited display of listed parameters. • Inconsistent style, expression sometimes awkward, layout of the notice, barely accurate. • Poor sequencing of ideas; often sporadically clear and related to the given topic in an attempt to maintain a general overall cohesion. Displays disjointed portions, exhibiting a lack of coherence of ideas. • Range of vocabulary is limited but manages to convey, largely, the overall meaning and the purpose of the writing. Large portion of vocabulary copied from question. ACCURACY – 1 mark 1 mark • Spelling, punctuation and grammar consistently/largely accurate, with occasional minor errors, that do not impede communication. ½ mark • Spelling, punctuation and grammar display some errors spread across, causing minor impediments to the message communicated. No credit • Frequent errors in spelling, punctuation and grammar, impeding communication. OR

Format • Headline & By line • Reporting place and date • Paragraphing organisation (Introductory paragraph + one or two Body paragraphs including event details + Concluding paragraph inclusive of witness accounts) Organisation & Content: The report should answer these question Who? name of event, sponsor/ organiser special guests, if any

Where & When? date, time, place– town/city + venue

What & What did How? those present event/ think? programme observations/ details comments

Format – 1 mark NOTE: Full credit if all aspects included. Partial credit (½ mark) if one-two aspects are missing. No credit if more than two aspects are missing. Note for given descriptors: Dedicated marks at a level are to be awarded only if ALL descriptors match. If one or more descriptors do not match, the marks are awarded at a level lower. CONTENT – 2 marks 2 marks • All points included • Well-developed with sustained clarity 1½ marks • Almost all points incorporated • Reasonably well-developed 1 mark • Some points incorporated • Fair attempt at developing ideas with some impact on clarity of response ½ mark • Most of the points of the given task not incorporated • Limited awareness of task development ORGANISATION OF IDEAS – 1 mark 1 mark -- Consistent to frequent display of the listed parameters. • Highly effective style capable of conveying the ideas convincingly with appropriate layout of a newspaper report viz. headline and by-line, place, date. • Carefully structured content with organised paragraphing presented cohesively. • Highly effective register (formal tone, tense, and vocabulary), relevant, lucid and appropriate

Solutions

413

sentences for conveying the idea/s precisely and effectively. ½ mark – Limited display of listed parameters. • Inconsistent style, expression sometimes awkward, layout of the notice, barely accurate. • Poor sequencing of ideas; often sporadically clear and related to the given topic in an attempt to maintain a general overall cohesion. Displays disjointed portions, exhibiting a lack of coherence of ideas. • Range of vocabulary is limited but manages to convey, largely, the overall meaning and the purpose of the writing. Large portion of vocabulary copied from question. ACCURACY – 1 mark 1 mark • Spelling, punctuation and grammar consistently/largely accurate, with occasional minor errors, that do not impede communication. ½ mark • Spelling, punctuation and grammar display some errors spread across, causing minor impediments to the message communicated. No credit • Frequent errors in spelling, punctuation and grammar, impeding communication. (A) The construction sector is believed to be quite hazardous and has the maximum number of fatal work injuries because apart from other causes, stakeholders in this sector tend to ignore safety regulations. As a columnist for an e-zine, draft an article in about 120-150 words, on the theme of the importance of worker safety in construction zones. Explore possible reasons for the prevailing situation and include suggestions for addressing it. Support your ideas with cues given below. Value Points Explain the hazardous nature of the construction sector and write why --refer to the importance of worker safety ▪ Examine the issue with Reasons (any 2)–  Stakeholders ignore safety regulations exploitation  Fatigue of workers (cues) –overworked  Extreme weather conditions (cues) –work doesn’t stop—accidents/ health problems ▪ Provide Suggestions (any 2) -- Awareness  Stricter laws and penalties  Bridge gap between managers and workers (cues)  Frequent training programmes for workers ▪

Detailed Answer: Importance of Worker Safety in Construction Zones by- ABC The construction sector is believed to be quite hazardous and has the maximum number of fatal work injuries because apart from other causes, stakeholders in this sector tend to ignore safety regulations. It is an industry where several workers are exposed to vulnerabilities on the jobsite daily. In fact, over 40% of all workplace deaths in private industry are in the construction industry. Because of this, it is important to have good construction safety practices. Many of these tragic fatalities are caused by the following reasons and greater awareness on the jobsite as well as better safety practices can prevent thousands of deaths every year. The construction work is often performed at high locations with a considerable drop. A worker fall from scaffolding, a ladder, or a rooftop can often mean death for him. Falls make up approximately 50% of construction deaths. Another similar cause is the falling of building materials or suspended loads from the cranes. The workers being struck by heavy objects in motion result in immediate collapse. Reports have also revealed that the workers meet their fate by even being buried under the soil heap. Further, electrocutions are also fatal for the construction workers. Contact with power lines and other energized sources such as exposed wires or defective equipment can cause the human body to act as a conductor. Because of this, it is vital that workers stay alert when working around potential electrical hazards. Nevertheless, construction workers face risk of accidents due to fatigue also. Moreover, they face health challenges in extreme weather conditions too as the construction work doesn’t stop then. As the construction managers do not hail from Mars and the workers are not from Venus, it is important for employers to have a good prevention strategy to save the life of poor wage workers. The supervisors and the employees alike should be well trained. Moreover, having regular worksite inspections and audits by a qualified safety professional is a great way to strengthen construction site safety. Many construction sites are in or around public areas. Because of this, it’s important to keep the safety of the general public in mind too. Getting started with a safety program may seem like a formidable task, but it doesn’t have to be. There are a few simple steps to ensure construction-site safety. Safety training for employees is essential to establish a safe workplace. People cannot do what they have not

414

OSWAAL CBSE LMP (Last Minute Preparation), ENGLISH CORE, Class–XII

learned to do. Having a workforce of employees who are trained and knowledgeable in proper safety practices is one of the best things you can do to protect everyone on the jobsite. Come up with plans for any foreseeable emergencies so that everyone knows what to do. A little preparation goes a long way. Regularly reassess and, when applicable, update your safety protocol. It is good to have a qualified safety professional review your plan to ensure that there is nothing you have missed. Having good construction safety practices benefits everyone. For the business owner, it means less worker’s compensation claims and other loss associated with workplace injuries as well as a reputation as a professional company that cares for its employees and the community. For employees it means having a safer workplace and an employer that demonstrates regard for their wellbeing. For the public, it means that they are protected from construction hazards by proper signage and site boundaries. OR (B)

Value Points

IV.

Section D

1.(A) (i)

Option (D) is correct. Value Points D. Only (iii)

Guidance ▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

Explanation: It is in the news that all these pitiful kin are to be bought out and mercifully gathered in to live in villages. Value Points enforcing benefits

Guidance ▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

Explanation: While greedy good-doers, beneficent beasts of prey, Swarm over their lives enforcing benefits that are calculated to soothe them out of their wits. (iii) Option (A) is correct.

Reason why the safety fair was organised—by whom? When? Who attended? Event details –(refer to cues) witness/

This event was followed by picnic lunch with the bosses where there were some informal conversations also. The whole programme was a grand success due to the interactive session. The NGO Manager presented a vote of thanks and culminated the event.

(ii)

The construction sector is believed to be quite hazardous and has the maximum number of fatal work injuries. A safety fair was organised by ‘Building Safely’, an NGO in Mysuru, Karnataka with the overarching theme, ‘Worker Safety Needs to be a Priority in Construction Zones’. You were asked to cover this event as the junior correspondent of a local daily. Write a report covering this event in about 120-150 words. Support your ideas with outline cues given below, to craft your newspaper report.

Conclude including account/s

talks, video presentation dedicated for the deceased, speeches, safety demonstrations, emergency response drill and safety games also.

Value Points A. Gullible

participant

▪ There is no partial credit.

Detailed Answer: Worker Safety Needs to be a Priority in Construction Zones by- ABC (Jr. Staff Correspondent) Mysuru, Karnataka, 21 September 20XX: The construction sector is believed to be quite hazardous and has the maximum number of fatal work injuries. A safety fair was organised by ‘Building Safely’, an NGO in Mysuru, Karnataka with the overarching them, ‘Worker Safety Needs to be a Priority in Construction Zones’. There was a congregation of site workers and managers who actively participated in the programme. The special feature of the programme was inauguration of special insurance programme for the site workers. There were interesting toolbox

Guidance ▪ Award 1 mark for the correct answer.

Explanation: The villagers seem to be innocent. (To live in villages, next to the theatre and the store, where they won’t have to think for themselves anymore, while greedy good-doers, beneficent beasts of prey, swarm over their lives enforcing benefits that are calculated to soothe them out of their wits.) (iv) greedy good doers: alliteration:: beneficent beasts of prey: oxymoron Value Points

Guidance

beneficent beasts of prey

▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

Solutions

415

Explanation: Oxymoron- opposite terms used together. (v)

(iv)

Option (C) is correct. Value Points

Guidance

C. (2) is the reason for (1).

▪ Award 1 mark for the correct answer.

Guidance

manipulated/ fooled / duped

▪ Award 1 mark for the correct answer.

[one word only]

▪ There is no partial credit. being

OR

(v)

Option (B) is correct. Value Points

Value Points

Option (B) is correct. Value Points

Guidance

B. Life is a roller coaster ride.

▪ Award 1 mark for the correct answer.

Explanation: Poetic device is Metaphor. Option (A) is correct. Value Points A. serenity

D. Hope Floats

Value Points

Value Points To indicate to the character to pause for thought/ to act showing gathering of thoughts

▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

health, and quiet breathing. Therefore, on every morrow, are we wreathing A flowery band to bind us to the earth.

Guidance ▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

Guidance ▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

Explanation: Ellipses (…) are used to indicate to the character to pause for thought or to act showing gathering of thoughts.

Guidance

Explanation: Full of sweet dreams, and

▪ There is no partial credit.

2.(A) (i)

Guidance

▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

▪ Award 1 mark for the correct answer.

Explanation: A bower quiet for us, and a sleep Full of sweet dreams. Dreams enliven our life with hope.

Explanation: It indicates peace. (iii) Option (B) is correct. B. (i), (ii) and (v)

(2) can be inferred from the extract but (1) cannot.

Guidance

Explanation: ‘Beautiful things provide us joy’ means ‘A thing of beauty is a joy forever’. But ‘We are surrounded by beautiful things’ is not compulsorily true as there are ugly things also. (vi) Option (D) is correct.

▪ There is no partial credit. (ii)

▪ Award 1 mark for the correct answer.

B. Value Points

‘them’ are villagers who are manipulated or fooled or duped. (i)

immortal/ everlasting/ eternal / undying

Explanation: When the poet says that ‘a thing of beauty’ will never pass into nothingness, he means that it is immortal/ everlasting/ eternal / undying.

(vi)

(B)

Guidance

▪ There is no partial credit.

▪ There is no partial credit. Explanation: The city dwellers make promises for the betterment of the villagers as the city dwellers have ulterior motives.

Value Points

(ii)

Option (A) is correct. Value Points

Guidance

A. Derry: introvert; Mr. Lamb: friendly

▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

Explanation: Derry has inhibition to express himself while Mr Lamb is sociable.

416

OSWAAL CBSE LMP (Last Minute Preparation), ENGLISH CORE, Class–XII (iii) Option (D) is correct.

playing video games.

Value Points

Guidance

D. The beauty of the world lies in the details.

▪ Award 1 mark for the correct answer.

(iii) Option (A) is correct.

▪ There is no partial credit. Explanation: I’ve a hive of bees behind those trees over there. Some hear bees and they say, bees buzz. But when you listen to bees for a long while, they humm....and hum means ‘sing’. I hear them singing, my bees. All the details are well taken care of. Guidance

Away from prying eyes/ people

▪ Award 1 mark for the correct answer.

(i) These educational opportunities would motivate them to work towards the good of the planet / allow them to observe first-hand that the planet needs to be respected / nurtured rather than abused

▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

3.(A) (i)

Option (C) is correct.

(ii)

Value Points

Guidance

C. Playing a video game.

▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

Explanation: Nothing transforms in a life by

Guidance

Because having the right knowledge or inclination/ understanding is just half the job done. It fails to have an impact till it is applied/ practised/ put to use in our actions

▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

Option (B) is correct. Value Points

Guidance

B. situations that require one to be street smart.

▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

Explanation: A girl from the countryside, she hadn’t gone through all the stages of worldly experience that generally precede a position of importance and sophistication that she had found herself catapulted into. This proves the girl to be a simple village girl far away from shrewdness of the city glamour.

Explanation: The writer refers to the educational opportunities as ‘inspiring’ because these educational opportunities would motivate them to work towards the good of the planet / allow them to observe first-hand that the planet needs to be respected / nurtured rather than abused. (ii)

Value Points

Explanation: The writer refers to ‘act’ as more important than ‘absorb’ or ‘learn’ because having the right knowledge or inclination/ understanding is just half the job done. It fails to have an impact till it is applied/ practised/ put to use in our actions.

OR Guidance

▪ Award 1 mark for the correct answer.

(iv)

Explanation: Derry must have liked friendly Mr Lamb as he was non-judgmental and free from any prejudice.

Value Points

A. Adventure with a Mission

Explanation: Adventurous experience with a goal to explore Antarctica.

▪ There is no partial credit.

(B)

Guidance

▪ There is no partial credit.

(iv) Value Points

Value Points

sealed: closed:: propelled: catapulted Value Points catapulted

Guidance ▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

Solutions

417 just the mention of the type of outfit

Explanation: Both the pairs are synonymous to one another. (iii) Option (B) is correct. Value Points

Guidance

B. unintentional act.

▪ Award 1 mark for the correct answer.

Explanation: The writer uses the word ‘uniform’ to refer to the outfits of the Department members because just like a

▪ There is no partial credit. Explanation: That was the end of a brief and brilliant acting career — the legal adviser, who was also a member of the Story Department, had unwittingly brought about that sad end.

uniform is a common dress code for all, similarly, their apparel/ dress was nearly the same - loose khadi shirt and khadi dhoti. OR (B)

(i)

Option (C) is correct. Value Points

(iv) Option (C) is correct. Value Points

Guidance

C. did not gel well with others in the Department.

▪ Award 1 mark for the correct answer.

C. creativity imagination.

and

Guidance ▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

▪ There is no partial credit.

Explanation: Some people consider the practice of interview to be an art because it

Explanation: The legal adviser wore pants and a tie and sometimes a coat that looked like a coat of mail. Often he looked alone and helpless.

requires creativity and imagination. One has to be innovative. (ii)

(v) Value Points ‘sad end’

Guidance

Value Points

Guidance

▪ Award 1 mark for the correct answer.

Celebrities feel that an interview makes them appear ordinary.

▪ Award 1 mark for the correct answer.

▪ There is no partial credit. Explanation: That was the end of a brief and brilliant acting career — the legal adviser, who was also a member of the Story Department, had unwittingly brought about that sad end. ‘Sad end’ shows sympathy.

[accept - negatively impacts OR weakens them/ their aura]

▪ There is no partial credit.

Explanation: diminishes means to make one appear commonplace. (iii) Option (D) is correct.

(vi) Value Points

Guidance

... is a common dress code for all, similarly, their apparel/dress was nearly the same loose khadi shirt and khadi dhoti

▪ Award 1 mark for the complete correct answer – similarity with uniform + mention of the type of outfit ▪ Partial credit for

Value Points

Guidance

D. (2) is the reason for (1).

▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

Explanation: Celebrities don’t consent to be interviewed because interviews intrude the privacy of celebrities.

418

OSWAAL CBSE LMP (Last Minute Preparation), ENGLISH CORE, Class–XII (iv) Value Points

Guidance

It is an extravagant claim as an interview cannot be a source of truth due to the following-

▪ Award 1 mark for the correct answer. ▪ There is no partial credit.

Interview may be scripted OR People may make false statements OR Certain questions may be left unanswered. Explanation: It is an extravagant claim as an interview cannot be a source of truth due to the following–

importance of holding onto their mother tongue.

the loss and the impact of any one of the 2 value points given.

OR M Hamel was considered strict and the classes / work given by him were not taken seriously - After he was ordered to leave the country, villagers realized the importance of his contribution to the society.

Award ½ mark if only the impact is listed. Expression – 1 mark when both given aspects are included. ▪ Answer organised effectively ▪ usage of words for effect-cause (due to, as a result, owing to, therefore, etc.)

Interview may be scripted or people may make false statements. There may also be certain questions that may be left unanswered.

½ mark when either aspect is missing

(v) Value Points victims

Guidance ▪

Award 1 mark for the correct answer.

▪

There is no partial credit.

Deduct ½ mark from the overall score if the error density is high (more than a total of 2 spellings and/or grammatical errors).

Explanation: opposite of ‘supporters’ is ‘victim.’ Detailed Answer:

(vi) Value Points A. facts

Guidance ▪

▪

Award 1 mark for the correct answer. There is no partial credit.

Explanation: The author’s views on interview, in the extract, can best be described as statements based on facts.

“You realise the true value of a thing only on losing it.” When Prussians put a ban on the French language, it was then that the people realized the importance of holding onto their mother tongue. In

another

instance,

M

Hamel

was

considered strict and the classes or the work given by him were not taken seriously. But

V.

after he was ordered to leave the country,

(i) Value Points Prussians put a ban on the French language - People realized the

Guidance Content Award 1 mark for inclusion of both

villagers realized the importance of his contribution to the society. The old people also were present in the class to attend his last lesson.

Solutions

419

(ii)

(iii) Value Points Common issue: absence of supporting presence/ loneliness/ alone when children move away – Explanation: the poet lived away from her mother.

Guidance Value Points

Content -

Guidance

Award 1 mark for inclusion of both the loss and the impact of any one of the 2 value points given.

[have to be relevant

Content -

with

Award 1 mark for

Award ½ mark if only the impact is listed.

▪ Is moved by their

Expression – 1 mark when both given aspects are included. ▪ Answer organised effectively

respect

to

BOTH boys]

inclusion

▪ Observed in detail

the loss and the

– observant

mark

either

from

½ the

the 2 value points

empathetic

Award ½ mark if

▪ Feels

helpless

about her inability

only the impact is listed.

to do anything for

Expression –

them.

1 mark when both

(Any other relevant)

given

aspects

▪ Answer organised effectively ▪ usage of words for effect-cause to,

is

as

a

(due result,

owing

to,

therefore, etc.)

mark

½

overall

mark

score if the error

either

density

missing

is

are

included.

missing Deduct

impact of any one of given.

when

aspect

both

plight - sensitive /

▪ usage of words for effect-cause (due to, as a result, owing to, therefore, etc.) ½

of

high

when

aspect ½

is

(more than a total of

Deduct

2 spellings and/or

from

grammatical errors).

score if the error

the

density

mark overall

is

high

(more than a total of Detailed Answer:

2 spellings and/or grammatical errors).

The common issues faced by most of the aged in the current times, with reference to

Detailed Answer:

the poem ‘My Mother at Sixty-six’, are

We come to know about the author of Lost

absence

of

supporting

presence,

and

Spring

-

Anees

Jung,

through

her

interactions with Saheb and Mukesh. She is

loneliness when children move away. It is

observant, she is moved by their plight, she

the result of the fact that the poet lived away

is therefore sensitive and empathetic. She

from her mother.

also feels helpless about her inability to do anything for them.

420

OSWAAL CBSE LMP (Last Minute Preparation), ENGLISH CORE, Class–XII what we want. It also enables us to realise

(iv) Value Points ▪ Makes us introspect and reflect upon our actions. ▪ Helps us better understand ourselves and what we want. ▪ Enables us to realise that many of our mindless actions are only harming us and not giving us happiness.

that many of our mindless actions are only

Guidance Content -

harming us and not giving us happiness.

Award 1 mark for inclusion

of

both

the loss and the impact of any one of the 2 value points given. Award ½ mark if only the impact is listed. Expression – 1 mark when both given

aspects

(v) Value Points Edla-

Guidance Content -

Despite knowing the truth about the peddler -

Award 1 mark for

▪ gave him shelter and treated him with full respect. (forgiveness)

the loss and the

▪ even invited him for Christmas next year. (better version of herself)

given.

inclusion

of

both

impact of any one of the 2 value points

Award ½ mark if only the impact is listed.

are

included.

Expression –

▪ Answer organised

1 mark when both given

effectively

to,

as

a

▪ Answer organised

(due

effectively

result,

owing

▪ usage of words for

to,

effect-cause

therefore, etc.) ½

mark

either

to,

when

aspect

from

as

a

(due result,

owing

is

to,

therefore, etc.)

missing Deduct

are

included.

▪ usage of words for effect-cause

aspects

½ the

½

mark

mark

either

overall

aspect

score if the error

missing

density

Deduct

is

high

when

½ the

is

mark

(more than a total of

from

overall

2 spellings and/or

score if the error

grammatical errors).

density

is

high

(more than a total of

Detailed Answer:

2 spellings and/or grammatical errors).

According to Pablo Neruda, ‘Keeping Quiet’ is essential to attaining a better, more peaceful

world

because

it

makes

us

introspect and reflect upon our actions. It helps us better understand ourselves and

Detailed Answer: Despite knowing the truth about the peddler, Edla gave him shelter and treated him with full respect. This shows her

Solutions

421

forgiving nature. She invited the peddlar for Christmas. This depicts the better version of Edla.

Told Charley that he was dissatisfied and looking for an escape – the Third level was his imagination.

(vi) Value Points ▪ Couldn’t live the way she wanted to or do what she wanted to. ▪ Burdened by responsibilities. ▪ Oppressed by her husband.

Guidance

At the end, the same is revealed as true for Sam – he went in search of the Third level himself

Content Award 1 mark for inclusion of both the loss and the impact of any one of the 2 value points given. Award ½ mark if only the impact is listed.

▪ usage of words for effect-cause (due to, as a result, owing to, therefore, etc.)

1 mark when both given aspects are included.

Deduct ½ mark from the overall score if the error density is high (more than a total of 2 spellings and/or grammatical errors).

½ mark when either aspect is missing

Detailed Answer:

Deduct ½ mark from the overall score if the error density is high (more than a total of 2 spellings and/or grammatical errors).

‘It’s easy to judge others and give advice, but much more difficult to apply it to ourselves.’ Charley told that he was dissatisfied in his life and looking for an escape – the Third level. This was a figment of his imagination. At the end, the same is revealed true for Sam as he went in search of the Third level himself.

Detailed Answer:

Guidance

Expression –

½ mark when either aspect is missing

▪ Answer organised effectively

Value Points

Award ½ mark if only the impact is listed.

▪ usage of words for effect-cause (due to, as a result, owing to, therefore, etc.)

1 mark when both given aspects are included.

VI. (i)

Award 1 mark for inclusion of both the loss and the impact of any one of the 2 value points given.

▪ Answer organised effectively

Expression –

Marriage was a compromise for Aunt Jennifer because she couldn’t live the way she wanted to or do what she wanted to. She was burdened by responsibilities and oppressed by her husband.

Content -

(b) Value Points ▪ A satire on those in power – use of humour, exaggeration and harmony to criticize ▪ Conversational, narrative style

Guidance Content Award 1 mark for inclusion of both the loss and the impact of any one of the 2 value points given. Award ½ mark if only the impact is listed. Expression –

422

OSWAAL CBSE LMP (Last Minute Preparation), ENGLISH CORE, Class–XII from the overall score if the error density is high (more than a total of 2 spellings and/or grammatical errors).

1 mark when both given aspects are included. ▪ Answer organised effectively ▪ usage of words for effect-cause (due to, as a result, owing to, therefore, etc.) ½ mark when either aspect is missing Deduct ½ mark from the overall score if the error density is high (more than a total of 2 spellings and/or grammatical errors). Detailed Answer: Kalki’s ‘The Tiger King’ is a satire on those in power. The use of humour, exaggeration and harmony are done to criticize the elite. The conversational, narrative style is really impressive. (c) Value Points ▪ True to his profession (conscientious) – attended to the wounded soldier and saved his life ▪ Informed the General about the prisoner and agreed to the plan of assassination. (loyal-to his country)

Guidance Content Award 1 mark for inclusion of both the loss and the impact of any one of the 2 value points given. Award ½ mark if only the impact is listed. Expression – 1 mark when both given aspects are included. ▪ Answer organised effectively ▪ usage of words for effect-cause (due to, as a result, owing to, therefore, etc.) ½ mark when either aspect is missing Deduct

½

mark

Detailed Answer: Dr Sadao was true to his profession (conscientious) as he attended to the wounded soldier and saved his life. He informed the General about the prisoner and agreed to the plan of assassination. He was loyal to his country.

VII. (a) Value Points ▪ Fear immobilizes us and prevents us from progressing – as in the case of William Douglas – due to his fear of water he could not lead a normal life – could not go fishing, canoeing, etc. Similarly, due to their fear of the Britishers, the peasants of Champaran could not take a stand for their rights. ▪ Need to face our fear, devise a plan and work through it – William Douglas worked through his fear rather than giving into it. When the peasants gathered around the courthouse in Motihari, it was a step towards overcoming their fear. ▪ Require determination – persistence – it took Douglas months to overcome his fear of water and learn swimming. It took nearly a year to get justice for the peasants in Champaran. ▪ strength in unity when fighting a common fear – only when the people in Champaran were they ablev to overcome their fear and fight for justice. ▪ But once overcome, one is free to live his / her life to the fullest. (Any 4 points to be included) (Accept associated relevant points) Detailed Answer: Good morning, students! We all know what it’s like to be afraid. Fear is our body’s natural response to a perceived threat or danger. But when fear immobilizes us and prevents us from progressing, as in the case of William Douglas, due to his fear of water he could not lead a normal life – could not go fishing, canoeing, etc. Similarly, due to their fear of the British, the peasants

Solutions

423

of Champaran could not take a stand for their rights. We need to face our fear, devise a plan and work through it. William Douglas worked through his fear rather than giving into it. When the peasants gathered around the courthouse in Motihari, it was a step towards overcoming their fear. We require determination and persistence. It took Douglas months to overcome his fear of water and learn swimming. It took nearly a year to get justice for the peasants in Champaran. Strength in unity when fighting a common fear is the essential requisite. Only when the people in Champaran were they able to overcome their fear, they could fight for justice and succeed. So, fear once overcome, one is free to live his / her life to the fullest. Thank you.

identity crisis. So I have used art as a means to express my deep-down desires and feelings. Sophie’s mother:

My position is no better either. I have also been playing servile role for long. All my time is spent in meeting the needs of my family. I too have no life of my own. I stay at home while all others go to witness Danny Casey’s football match.

Aunt Jennifer:

Yes, it is so unfortunate that we both feel burdened with responsibilities. We both are suppressed by our domineering husbands.

Sophie’s mother:

And we do not have a say in the family matters.

Aunt Jennifer:

True. There seems to be no likelihood of any change in our status. We can only wait and watch for the time to conduct some transformation in our lives.

OR (b) Value Points ▪ Aunt Jennifer shares about her loss of identity; use of art as a means to express her deep-down desires and feelings. ▪ Sophie’s mother shares information about her servile role – all her time is spent in meeting the needs of the family; has no life of her own. Sophie’s mother stays home while all others go to witness Danny Casey’s football match. ▪ Both feel burdened with responsibilities. ▪ Both have domineering husbands; They do not have a say in the family matters. ▪ There seems to be no likelihood of any change in their status. (Any 4 points to be included) Detailed Answer: Sophie’s mother:

Your embroidery is so beautiful. Do you love tigers?

Aunt Jennifer:

Thank you for your appreciative words. I’m now being recognised for my work otherwise throughout my life I have been suffering from

VIII. (i) Value Points ▪ An experience completely different than any other - to visit a landscape that is not inhabited by humans and so still relatively pristine. ▪ Provided an insight into the earth’s past, present and the future. ▪ Made her delve deep into the threat faced by the environment and the earth itself due to human activities. ▪ Realised how little changes can have a major impact on the environment and therefore the need to take care of the small things. ▪ An eye opening experience – realised how everything on this earth is interlinked. ▪ The trip indeed had a life changing impact. (Any 4 points to be included.)

424

OSWAAL CBSE LMP (Last Minute Preparation), ENGLISH CORE, Class–XII Detailed Answer: I can’t thank my stars enough for having cashed in on the opportunity of undergoing an experience completely different than any other. I’m lucky to visit a landscape that is not inhabited by humans and so still relatively pristine. This has provided an insight into the earth’s past, present and the future. It made me delve deep into the threat faced by the environment and the earth itself due to human activities. I have realised how little changes can have a major impact on the environment and therefore the need to take care of the small things. This has been an eye opening experience as I have realised how everything on this earth is interlinked. This trip indeed had a life changing impact on me.

OR (ii) Value Points ▪ Both of them faced discrimination; Zitkala Sa was discriminated against because of cultural differences while Bama faced discrimination due to her caste. ▪ Zitkala sa rebelled and refused to get her hair cut. She put up a strong fight, though had to give in finally. Bama was enraged and wanted to go and touch the packet of vadai to teach a lesson to the landlord. But was guided by her elder brother to calm down. He showed her the path overcome discrimination. ▪ Both of them worked hard to excel in education. ▪ Both succeeded as writers among other things; They have written much against discrimination and evils of oppression, thus continuing the fight for justice for their communities.

EXAM BITES

This Pdf Is Downloaded From www.exambites.in

Visit www.exambites.in for More Premium Stuffs,Latest Books,Test Papers,Lectures etc. jeeneetadda jna_official

jeeneetadda VISIT NOW !!