Bifidobacteria: Methods and Protocols (Methods in Molecular Biology, 2278) [1st ed. 2021] 1071612735, 9781071612736

Table of contents :
Preface
Contents
Contributors
Chapter 1: Methods for Isolation and Recovery of Bifidobacteria
1 Introduction
2 General Overview on Growth Media and Cultivation Requirements for Bifidobacteria
3 Description of Composition, Characteristics, and Recommended Use of Different Media for Bifidobacterial Cultivation
3.1 General Media
3.1.1 De Man-Rogosa-Sharpe (MRS)
3.1.2 Trypticase Phytone Yeast (TPY)
3.1.3 Wilkins-Chalgren (WC)
3.1.4 Other Complex Culture Media
3.2 Selective Media
3.2.1 Commercially Available Selective Media
3.3 Chemically Defined Media
4 Notes
References
Chapter 2: Bifidobacterium Transformation
1 Introduction
2 Materials
2.1 Reagents
2.2 Equipment
3 Methods
4 Notes
References
Chapter 3: Isolation of Chromosomal and Plasmid DNA from Bifidobacteria
1 Introduction
2 Materials
2.1 Solutions
2.1.1 Chromosomal DNA Isolation
2.1.2 Plasmid Isolation (Miniprep)
2.2 Equipment
3 Methods
3.1 Chromosomal DNA Isolation
3.2 Plasmid DNA Isolation (Miniprep)
4 Notes
References
Chapter 4: Assembly, Annotation, and Comparative Analysis of Bifidobacterial Genomes
1 Introduction
2 Materials
2.1 DNA Quality Filtering
2.2 Genome Assembly
2.3 Genome Contig Reordering
2.4 Gene Prediction
2.5 Gene Annotation
2.6 Genome Visualization
2.7 Bifidobacterial Pangenome and Core Genome
2.8 Functional Analyses
2.9 Whole-Genome Analysis
2.10 Bifidobacterial Phylogenomic
3 Methods
3.1 DNA Quality Filtering
3.2 Genome Assembly
3.3 Genome Contig Reordering
3.4 Gene Prediction
3.5 Gene Annotation
3.6 Genome Visualization
3.7 Bifidobacterial Pan-Genome and Core Genome
3.8 Functional Analyses
3.9 Whole-Genome Analysis
3.10 Bifidobacterial Phylogenomic
4 Notes
References
Chapter 5: Site-Directed Mutagenesis of Bifidobacterium Strains
1 Introduction
2 Materials
2.1 Reagents
2.2 Equipment
2.3 Cultures
3 Methods
3.1 Generation of Fragment-Harboring Plasmid pORI19 Vector
3.2 Preparation of E. coli EC101 Competent Cells, and Transformation with pORI19 Construct
3.3 Selection of Recombinant pORI19 Clones, and Incorporation of tetW
3.4 Selection of Recombinant pORI19 Clones Harboring tetW (where Suitable; See Note 4)
3.5 Generation of a Methylated Plasmid Construct Suitable for Introduction to Bifidobacteria (where Relevant; See Note 5)
3.6 Transformation of Competent Bifidobacterium Cells with the Recombinant Construct
3.7 Selection and Confirmation of Recombinant Bifidobacterium Transformants
4 Notes
References
Chapter 6: Protocol to Select Bifidobacteria from Fecal and Environmental Samples
1 Introduction
2 Requirements for the Isolation of Members of the Bifidobacterium Genus
2.1 Maintenance of an Anaerobic Environment
2.2 pH
2.2.1 Temperature
3 Cultivation Media Preparation for Bifidobacterial Isolation (See also Chapter 1 of this Book for Additional Information on C...
3.1 Selective and Counterselective Agents for the Recovery of Bifidobacteria
3.2 Validated Cultivation Media for the Isolation of Bifidobacterial (See also Chapter 1)
3.2.1 De Man-Rogosa-Sharpe (MRS) Medium
3.2.2 Tryptone, Phytone, and Yeast Extract (TPY) Medium
3.2.3 Wilkins-Chalgren (WC) Medium
3.2.4 Transgalactosylated Oligosaccharides-Propionate-Mupirocin (TOS-Propionate-MUP) Medium
3.2.5 Other Complex Generic Cultivation Media
3.2.6 Chemically Defined Medium (CDM)
3.2.7 Notes for the Preparation of Cultivation Media
4 Protocol for Isolation of Bifidobacterial from Fecal or Other Environmental Samples
References
Chapter 7: Phageome Analysis of Bifidobacteria-Rich Samples
1 Introduction
2 Materials
3 Methods
3.1 Tris-HCl (pH 7.5) Buffer Preparation
3.2 SMG Buffer Preparation
3.3 Proteinase K Solution Preparation
3.4 Virus-Like Particle (VLP) Isolation (Adapted from)
3.5 Extraction of Bacteriophage (Phage) Viral DNA
3.6 Quantification of Viral DNA
3.7 Preparation of DNA Sample for Sequencing
3.8 DNA Sequencing
3.9 In Silico DNA Sequence Analysis
4 Notes
References
Chapter 8: Measuring Conjugated Linoleic Acid (CLA) Production by Bifidobacteria
1 Introduction
1.1 CLA Global Market, Next Generation Products, and Long-Term Health Implications
1.2 Production of Conjugated Linoleic Acid and Conjugated Linolenic Acid Isomers by Bifidobacterium Species
1.3 Qualitative and Quantitative Determination of Conjugated Linoleic Acid Production In Vitro
2 Materials
2.1 Standards
2.2 Chemicals
2.3 Culture Medium, Solutions and Conditions
2.4 Equipment and Consumables
3 Methods
3.1 Inoculum Preparation and Culture Conditions
3.2 UV-Based Spectrophotometric Assay for CLA Production
3.2.1 Extraction of Lipid Fraction
3.2.2 Plate Reading
3.2.3 Preparation of CLA Standard Curve
3.3 Gas Chromatography Analysis
3.3.1 Lipid Extraction
From Supernatant
From Pellet
3.3.2 Preparation of Fatty Acid Methyl Esters (FAMEs)
3.3.3 Instrument Conditions for FAME Analysis
3.3.4 CLA/CLNA Conversion Percentages
4 Additional Notes
References
Chapter 9: Detection, Isolation, and Purification of Bifidobacterial Exopolysaccharides
1 Introduction
2 Materials
2.1 Phenotypic Detection of EPS-Producing Strains
2.2 Isolation of EPS
2.3 Purification of EPS
3 Methods
3.1 Phenotypic Detection of EPS-Producing Strains
3.2 Isolation of EPS
3.3 Purification of EPS
4 Notes
References
Chapter 10: Determination of Bifidobacterial Carbohydrate Utilization Abilities and Associated Metabolic End Products
1 Introduction
2 Materials
2.1 Growth, CFU, and Acidification Determination
2.2 HPAEC-PAD
2.3 Growth Medium
3 Methods
3.1 Preparation of the Bacterial Suspension
3.2 Inoculation of the Test Medium
3.2.1 Microtiter Plate Assays
3.2.2 Manual Growth and Acidification Curve Generation
3.2.3 Colony-Forming Unit (CFU) Determination
3.3 Metabolite Analyses by High-Performance Liquid Chromatography (HPLC)
3.4 Assessing Substrate Consumption and/or Degradation Profile Using High-Performance Anion Exchange Chromatography-Pulsed Amp...
4 Notes
References
Chapter 11: Model for Murine Gut Colonization by Bifidobacteria
1 Introduction
2 Materials
3 Methods
3.1 Antibiotic Concentration
3.2 Antibiotic Preparation
3.3 Antibiotic Administration
3.4 Bacterial Feeding
3.5 Assessment of Bifidobacterial Colonization
4 Notes
References
Chapter 12: Identification of Bifidobacteria by the Phosphoketolase Assay
1 Introduction
2 Materials
2.1 Bifidobacterial Culture
2.2 F6PPK Enzymatic Test
2.3 Bifidobacterial Chromosomal DNA Extraction
2.4 PCR
2.5 Agarose Gel and Visualization
3 Methods
3.1 Enzymatic Detection of F6PPK
3.2 Extraction of Bifidobacterial Chromosomal DNA
3.3 d-Xylulose-5-Phosphate/Fructose-6-Phosphate Phosphoketolase Bifidobacterial Gene Targeting PCR
3.4 Agarose Gel Visualization
4 Notes
References
Chapter 13: Determination of Bile Salt Hydrolase Activity in Bifidobacteria
1 Introduction
2 Material and Reagents
2.1 Common Materials and Reagents Required for all Described Methods
2.2 Material and Reagents Specifically Required for Qualitative Determination of BSH (Protocol 1)
2.3 Materials and Reagents Specifically Required for Semiquantitative Determination of BSH (Protocol 2)
2.4 Materials and Reagents Specifically Required for Quantitative Determination of BSH (Protocol 3)
3 Methods
3.1 Qualitative Determination of BSH Activity in Bifidobacteria- Protocol 1
3.2 Semiquantitative Determination of BSH Activity in Cell-Free Extracts-Protocol 2
3.3 Quantitative Determination of BSH Activity in Bifidobacteria- Protocol 3
3.3.1 Perform Bile Salt Hydrolysis Reaction
3.3.2 Quantification of Released Amino Acids
3.3.3 Measurement of Total Protein Concentration
4 Notes
References
Chapter 14: A Resource for Cloning and Expression Vectors Designed for Bifidobacteria: Overview of Available Tools and Biotech...
1 Introduction
2 Naturally Occurring Bifidobacterial Plasmids as a Resource to Create Novel Cloning Vectors for Bifidobacteria
2.1 Other Plasmid Replicons Used to Genetically Manipulate bifidobacteria
3 General Guidelines to Design a Cloning and/or (Heterologous) Gene Expression Strategy in Bifidobacteria: Vector Module Design
3.1 Replicon Modules
3.1.1 Replicon Testing Vectors
3.1.2 Conditional Replicons
3.2 Selection Biomarker Modules
3.3 Other Selection and/or Labeling Modules
3.4 Enhancing (Heterologous) Gene Expression Systems in Bifidobacteria
3.4.1 Promoter Selection
3.4.2 Codon Optimization
3.5 Biotechnological Applications, Future Perspectives, and Conclusions
References
Chapter 15: Metagenomic Analyses of Bifidobacterial Communities
1 Introduction
2 Materials
2.1 Quality Filtering
2.2 16S rRNA Gene Microbial Profiling
2.3 Bifidobacterial ITS Profiling
2.4 Shotgun Metagenomics
3 Methods
3.1 Quality Filtering
3.2 16S rRNA Gene Microbial Profiling
3.3 Bifidobacterial ITS Profiling
3.4 Shotgun Metagenomics
4 Notes
References
Chapter 16: Resistance of Bifidobacteria Toward Antibiotics
1 Introduction
1.1 Antibiotic Resistance in Bifidobacteria
1.2 In Vitro Methods for Evaluating the Antimicrobial Activity in Bifidobacteria
2 Materials
2.1 Culture Media
2.1.1 MRS-Cysteine (MRSC) Agar Medium
2.1.2 MRS-Cysteine (MRSC) Broth Medium
2.1.3 ITS Broth Medium
2.1.4 LSM-Cysteine Broth Medium
2.1.5 LSM-Cysteine Agar Medium
2.2 Microdilution Plates
2.3 Equipment and Consumables
3 Methods
3.1 Culture Conditions of Bifidobacteria
3.2 Broth Microdilution Assay
3.2.1 Inoculum Preparation
3.2.2 Microdilution Plate Filling
3.2.3 MIC Reading
3.3 Antimicrobial Gradient Method (E-Test)
3.3.1 Inoculum Preparation
3.3.2 Agar Plate Inoculation and Strip Application
3.3.3 MIC Reading
4 Notes
References
Chapter 17: In Vitro Assessment of Prebiotic Activity
1 Introduction
2 Materials
2.1 Media
2.2 Bioreactors
2.3 Reagents and Solutions for Glycosyl-Hydrolase Assay
2.4 Reagents and Equipment for the Analysis of Carbohydrates and Organic Acids
3 Methods
3.1 Bioreactor Assembly
3.2 Pure Culture Fermentations of Bifidobacteria
3.3 Setup of Microbiota Fermentations
3.4 Monitoring of Growth
3.5 Assay of Glycosyl-Hydrolases Activity
3.6 Analysis of Carbohydrates and Metabolites
3.6.1 Chromatographic Techniques
3.6.2 Anthrone Colorimetric Assay
4 Notes
References
Chapter 18: Bifidobacterium Genome Assembly and Methylome Analysis Using Pacbio SMRT Sequencing
1 Introduction
2 Requirements
3 Methods
4 Notes
References
Index

Citation preview

Methods in Molecular Biology 2278

Douwe van Sinderen Marco Ventura Editors

Bifidobacteria Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Bifidobacteria Methods and Protocols

Edited by

Douwe van Sinderen School of Microbiology & APC Microbiome Ireland, University College Cork, Cork, Ireland

Marco Ventura Laboratory of Probiogenomics, Department of Chemistry, Life Sciences & Environmental Sustainability, University of Parma, Parma, Italy

Editors Douwe van Sinderen School of Microbiology & APC Microbiome Ireland University College Cork Cork, Ireland

Marco Ventura Laboratory of Probiogenomics, Department of Chemistry, Life Sciences & Environmental Sustainability University of Parma Parma, Italy

ISSN 1064-3745 ISSN 1940-6029 (electronic) ISBN 978-1-0716-1273-6 ISBN 978-1-0716-1274-3 (eBook) https://doi.org/10.1007/978-1-0716-1274-3 © Springer Science+Business Media, LLC, part of Springer Nature 2021 This work is subject to copyright. All rights are reserved by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors, and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface Members of the genus Bifidobacterium are Gram-positive bacteria, which possess a high G +C content genome, belong to the phylum Actinobacteria, and represent common inhabitants of the gastrointestinal tract (GIT) of mammals, especially as nurslings, birds, and certain cold-blooded animals. Different ecological relationships between bifidobacteria and their host can be developed, which can even be health-promoting or probiotic. In this case, though we have an awareness of these health-promoting host-bifidobacterial interactions, the mode of action and molecular mechanism of such beneficial activities are far from completely understood, although they are believed to represent a crucial factor in the development and maintenance of human physiology and the associated immune system. Due of their purported health-promoting activities, bifidobacteria are commercially exploited as probiotic bacteria and in this context are receiving growing research attention from the scientific community. In particular, scientific interest is focused on the ecological and molecular mechanisms that drive the establishment of bifidobacteria in the human gut as well as their interactions with their human host and other members of the GIT microbiota. In contrast to certain other microorganisms, such as Escherichia coli, Bacillus subtilis, and many human pathogens, scientific research pertaining to bifidobacteria is still in its infancy. This is to a large degree due to the lack of experimental protocols that can be applied to bifidobacteria. The aim of this book is therefore to provide a detailed description of current protocols that can be used in various experimental settings involving bifidobacteria, though such protocols may also be useful for other bacteria. This book contains chapters written by various leading researchers in the field of bifidobacterial biology. As can be deduced from the table of contents, it consists of sections dealing with experimental protocols ranging from procedures to isolate and cultivate bifidobacteria from their natural environments, techniques that can be applied for the accurate taxonomic identification of bifidobacterial isolates, methods to be used to sequence and annotate their genomes, protocols to physiologically characterize bifidobacteria, to methods for the genetic manipulation of bifidobacterial strains. This collection of bifidobacterial protocols is intended to be useful for many undergraduate, MSc, and PhD students interested in bifidobacterial biology, while it is also intended to invigorate research interest among industrial, academic, and medical professionals. We therefore hope that this book will serve as a go-to bifidobacterial laboratory handbook for all those interested in this fast moving and rapidly expanding scientific research field. Last but not least, we would like to sincerely thank all authors for contributing their hands-on practical knowledge and extensive experimental know-how, in particular through the provision of details that is typically not included in standard publications. We are highly indebted to their pioneering work and their dedication to promote bifidobacterial research and hope that this book may form the experimental foundation of many future scientific careers. Cork, Ireland Parma, Italy

Douwe van Sinderen Marco Ventura

v

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

v ix

1 Methods for Isolation and Recovery of Bifidobacteria . . . . . . . . . . . . . . . . . . . . . . . Abelardo Margolles and Lorena Ruiz 2 Bifidobacterium Transformation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Emily C. Hoedt, Roger S. Bongers, Francesca Bottacini, Jan Knol, John MacSharry, and Douwe van Sinderen 3 Isolation of Chromosomal and Plasmid DNA from Bifidobacteria . . . . . . . . . . . . Maria Esteban-Torres, Lorena Ruiz, Rocio Sanchez-Gallardo, and Douwe van Sinderen 4 Assembly, Annotation, and Comparative Analysis of Bifidobacterial Genomes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Gabriele Andrea Lugli 5 Site-Directed Mutagenesis of Bifidobacterium Strains . . . . . . . . . . . . . . . . . . . . . . . . Kieran James and Douwe van Sinderen 6 Protocol to Select Bifidobacteria from Fecal and Environmental Samples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Giulia Alessandri, Maria Cristina Ossiprandi, Marco Ventura, and Douwe van Sinderen 7 Phageome Analysis of Bifidobacteria-Rich Samples . . . . . . . . . . . . . . . . . . . . . . . . . . Brian McDonnell, Eoghan Casey, Christian Milani, Gabriele Andrea Lugli, Alice Viappiani, Jennifer Mahony, Marco Ventura, and Douwe van Sinderen 8 Measuring Conjugated Linoleic Acid (CLA) Production by Bifidobacteria . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Grace Ahern, Douwe van Sinderen, Bo Yang, R. Paul Ross, and Catherine Stanton 9 Detection, Isolation, and Purification of Bifidobacterial Exopolysaccharides . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Patricia Ruas-Madiedo 10 Determination of Bifidobacterial Carbohydrate Utilization Abilities and Associated Metabolic End Products . . . . . . . . . . . . . . . . . . . . . . . . . . . Ana Solopova and Douwe van Sinderen 11 Model for Murine Gut Colonization by Bifidobacteria . . . . . . . . . . . . . . . . . . . . . . Valerio Rossini and Ken Nally 12 Identification of Bifidobacteria by the Phosphoketolase Assay . . . . . . . . . . . . . . . . Monica Modesto, Alice Checcucci, and Paola Mattarelli 13 Determination of Bile Salt Hydrolase Activity in Bifidobacteria . . . . . . . . . . . . . . . Lorena Ruiz, Borja Sa´nchez, and Abelardo Margolles

1

vii

13

21

31 45

61

71

87

101

117 131 141 149

viii

14

15 16 17

18

Contents

A Resource for Cloning and Expression Vectors Designed for Bifidobacteria: Overview of Available Tools and Biotechnological Applications . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Lorena Ruiz, Maria Esteban-Torres, and Douwe van Sinderen Metagenomic Analyses of Bifidobacterial Communities . . . . . . . . . . . . . . . . . . . . . . Christian Milani Resistance of Bifidobacteria Toward Antibiotics. . . . . . . . . . . . . . . . . . . . . . . . . . . . . Miguel Gueimonde and Silvia Arboleya In Vitro Assessment of Prebiotic Activity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Alberto Amaretti, Stefano Raimondi, Nicola Volpi, and Maddalena Rossi Bifidobacterium Genome Assembly and Methylome Analysis Using Pacbio SMRT Sequencing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Francesca Bottacini and Douwe van Sinderen

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

157 183 195 209

225 233

Contributors GRACE AHERN • Teagasc Food Research Centre, Moorepark, Fermoy, Co. Cork, Ireland; School of Microbiology, University College Cork, Cork, Ireland; APC Microbiome Ireland, University College Cork, Cork, Ireland GIULIA ALESSANDRI • Department of Medicine and Surgery, University of Parma, Parma, Italy ALBERTO AMARETTI • Department of Life Sciences, University of Modena and Reggio Emilia, Modena, Italy; BIOGEST—SITEIA, University of Modena and Reggio Emilia, Modena, Italy SILVIA ARBOLEYA • Department of Microbiology and Biochemistry of Dairy Products, Instituto de Productos La´cteos de Asturias, Consejo Superior de Investigaciones Cientı´ficas (IPLACSIC), Villaviciosa, Spain ROGER S. BONGERS • Danone Nutricia Research, Utrecht, The Netherlands FRANCESCA BOTTACINI • APC Microbiome Ireland, University College Cork, Cork, Ireland EOGHAN CASEY • APC Microbiome Ireland and School of Microbiology, University College Cork, Cork, Ireland ALICE CHECCUCCI • Department of Agricultural and Food Sciences, University of Bologna, Bologna, Italy MARIA ESTEBAN-TORRES • School of Microbiology and APC Microbiome Ireland, University College Cork, Cork, Ireland MIGUEL GUEIMONDE • Department of Microbiology and Biochemistry of Dairy Products, Instituto de Productos La´cteos de Asturias, Consejo Superior de Investigaciones Cientı´ficas (IPLA-CSIC), Villaviciosa, Spain EMILY C. HOEDT • APC Microbiome Ireland, University College Cork, Cork, Ireland KIERAN JAMES • APC Microbiome Ireland, University College Cork, Cork, Ireland JAN KNOL • Danone Nutricia Research, Utrecht, The Netherlands; Laboratory of Microbiology, Wageningen University, Wageningen, The Netherlands GABRIELE ANDREA LUGLI • Laboratory of Probiogenomics, Department of Chemistry, Life Sciences, and Environmental Sustainability, University of Parma, Parma, Italy JOHN MACSHARRY • APC Microbiome Ireland, University College Cork, Cork, Ireland; School of Microbiology, University College Cork, Cork, Ireland; School of Medicine, University College Cork, Cork, Ireland JENNIFER MAHONY • APC Microbiome Ireland and School of Microbiology, University College Cork, Cork, Ireland ABELARDO MARGOLLES • Department of Microbiology and Biochemistry of Dairy Products, Dairy Research Institute of Asturias (IPLA-CSIC), Villaviciosa, Asturias, Spain; Instituto de Investigacion Sanitaria del Principado de Asturias (ISPA), Oviedo, Asturias, Spain PAOLA MATTARELLI • Department of Agricultural and Food Sciences, University of Bologna, Bologna, Italy BRIAN MCDONNELL • APC Microbiome Ireland and School of Microbiology, University College Cork, Cork, Ireland

ix

x

Contributors

CHRISTIAN MILANI • Laboratory of Probiogenomics, Department of Chemistry, Life Sciences, and Environmental Sustainability, University of Parma, Parma, Italy; GenProbio srl, Parma, Italy; Interdepartmental Research Centre “Microbiome Research Hub”, University of Parma, Parma, Italy MONICA MODESTO • Department of Agricultural and Food Sciences, University of Bologna, Bologna, Italy KEN NALLY • APC Microbiome Ireland, University College Cork, Cork, Ireland; School of Biochemistry and Cell Biology, University College Cork, Cork, Ireland MARIA CRISTINA OSSIPRANDI • Department of Medicine and Surgery, University of Parma, Parma, Italy STEFANO RAIMONDI • Department of Life Sciences, University of Modena and Reggio Emilia, Modena, Italy R. PAUL ROSS • APC Microbiome Ireland, University College Cork, Cork, Ireland MADDALENA ROSSI • Department of Life Sciences, University of Modena and Reggio Emilia, Modena, Italy; BIOGEST—SITEIA, University of Modena and Reggio Emilia, Modena, Italy VALERIO ROSSINI • APC Microbiome Ireland, University College Cork, Cork, Ireland PATRICIA RUAS-MADIEDO • MicroHealth Group, Instituto de Productos La´cteos de Asturias— Consejo Superior de Investigaciones Cientı´ficas (IPLA-CSIC), Villaviciosa, Asturias, Spain LORENA RUIZ • Department of Microbiology and Biochemistry of Dairy Products, Dairy Research Institute of Asturias (IPLA-CSIC), Villaviciosa, Asturias, Spain; Instituto de Investigacion Sanitaria del Principado de Asturias (ISPA), Oviedo, Asturias, Spain BORJA SA´NCHEZ • Department of Microbiology and Biochemistry of Dairy Products, Instituto de Productos La´cteos de Asturias, IPLA-CSIC, Villaviciosa, Spain; Instituto de Investigacion Sanitaria del Principado de Asturias (ISPA), Oviedo, Asturias, Spain ROCIO SANCHEZ-GALLARDO • School of Microbiology and APC Microbiome Ireland, University College Cork, Cork, Ireland ANA SOLOPOVA • School of Microbiology and APC Microbiome Ireland, University College Cork, Cork, Ireland CATHERINE STANTON • Teagasc Food Research Centre, Moorepark, Fermoy, Co. Cork, Ireland; APC Microbiome Ireland, University College Cork, Cork, Ireland DOUWE VAN SINDEREN • School of Microbiology & APC Microbiome Ireland, University College Cork, Cork, Ireland MARCO VENTURA • Laboratory of Probiogenomics, Department of Chemistry, Life Sciences, and Environmental Sustainability, University of Parma, Parma, Italy ALICE VIAPPIANI • GenProbio srl, Parma, Italy NICOLA VOLPI • Department of Life Sciences, University of Modena and Reggio Emilia, Modena, Italy BO YANG • State Key Laboratory of Food Science and Technology, School of Food Science and Technology, Jiangnan University, Wuxi, Jiangsu, P. R. China

Chapter 1 Methods for Isolation and Recovery of Bifidobacteria Abelardo Margolles and Lorena Ruiz Abstract Since their discovery, bifidobacteria have been considered to represent cornerstone commensal microorganisms in the host-microbiome interface at the intestinal level. Bifidobacteria have therefore enjoyed increasing scientific and commercial interest as a source of microorganisms with probiotic potential. However, since functional and probiotic traits are strictly strain-dependent, there is a constant need to isolate, cultivate, and characterize novel strains, activities that require the utilization of appropriate media, as well as robust isolation, cultivation, and preservation techniques. Besides, effective isolation of bifidobacteria from natural environments might require different manipulation and cultivation media and conditions depending on the specific characteristics of the sample material, the presence of competitive microbiota, the metabolic state in which bifidobacteria might be encountered within the sample and the particular metabolic traits of the bifidobacterial species adapted to such inhabitation. A wide array of culture media recipes have been described in the literature to routinely isolate and grow bifidobacteria under laboratory conditions. However, there is not a single and universally applicable medium for effective isolation, recovery, and cultivation of bifidobacteria, as each growth medium has its own particular advantages and limitations. Besides, the vast majority of these media formulations was not specifically formulated for these microorganisms, and thus information on bifidobacterial cultivation options is scarce while being scattered throughout literature. This chapter intends to serve as a resource summarizing the options to cultivate bifidobacteria that have been described to date, highlighting the main advantages and limitations of each of them. Key words Bifidobacterium, Growth media, Selective media, Chemically defined media

1

Introduction Bifidobacteria are Gram-positive commensal microorganisms, frequently encountered in the gut of humans and other mammals [1]. This genus encompasses several species, of which several strains are known that have been attributed beneficial or probiotic traits. Particularly, the demand for novel probiotics has motivated extensive research efforts in order to isolate, cultivate, and characterize novel bifidobacterial strains from their natural environment. However, effective isolation and cultivation of a given microorganism in artificial culture media requires detailed knowledge of its

Douwe van Sinderen and Marco Ventura (eds.), Bifidobacteria: Methods and Protocols, Methods in Molecular Biology, vol. 2278, https://doi.org/10.1007/978-1-0716-1274-3_1, © Springer Science+Business Media, LLC, part of Springer Nature 2021

1

2

Abelardo Margolles and Lorena Ruiz

nutritional and metabolic requirements. These facts have motivated a significant expansion of research on bifidobacteria in recent decades, significantly widening our knowledge on general characteristics regarding the genus Bifidobacterium, facilitated by a combination of culture-dependent and culture-independent, molecular biology-based approaches, including functional and comparative genomics approaches [2]. This body of knowledge has provided useful insights so as to reformulate improved enrichment and selective media for bifidobacteria [3]. Bifidobacteria are strict anaerobes, which typically lack efficient oxygen detoxification systems and which historically have been considered fastidious to manipulate in the laboratory. Their cultivation requires maintaining oxygen deprivation conditions, generally in combination with the utilization of reducing agents that are added in complex growth media. Collectively, microorganisms from the genus Bifidobacterium are saccharolytic, being specialized in obtaining energy from a wide variety of “indigestible” (i.e., nondigestible by their human host) complex carbohydrates typically encountered in the gut ecosystem, including oligosaccharides from human host origin, such as human milk oligosaccharides or mucins; and from plant/dietary origin, including galactooligosaccharides, fructooligosaccharides, xylooligosaccharides, arabinooligosaccharides, and combinations thereof [4, 5]. Remarkably, the ability to metabolize one or several of these human- or plantderived complex carbohydrates is strongly strain dependent, and usually related to the natural environmental origin of the particular strain. For instance, bifidobacterial species typically encountered in the breastfed infant gut, such as Bifidobacterium longum subsp. infantis, Bifidobacterium breve, or Bifidobacterium bifidum are usually specialized toward the utilization of (certain) human milk oligosaccharides [6, 7], while species typically encountered in the adult gut are more specialized toward the utilization of diet-derived carbohydrates. Moreover, bifidobacterial carbohydrate metabolism is characterized by a unique central metabolic pathway for the metabolism of hexoses derived from either simple or complex oligosaccharides, denoted the “bifid-shunt,” and typified by the presence of the enzyme fructose-6-phosphate phosphoketolase, which is thus considered a taxonomic marker of the family Bifidobacteriaceae [8]. This metabolic route generates a theoretical 3:2:5 ratio of acetate to lactate to ATP as metabolic end-products from the metabolism of one molecule of glucose and one molecule of galactose. In relation to other metabolic characteristics, it is worth mentioning that their micronutrient and macronutrient requirements are largely unknown, albeit they are generally capable of growing under iron limiting conditions, several species/strains have demonstrated auxotrophy for the amino acid cysteine and the b-vitamin folate, while pantothenic acid and riboflavin have been reported to be required by almost all strains of bifidobacteria [9–11].

Cultivation Tools for Bifidobacteria

3

2 General Overview on Growth Media and Cultivation Requirements for Bifidobacteria Overall, cultivation conditions to grow bifidobacteria in the laboratory need to satisfy at least two criteria, provision of adequate nutritional composition within the media and maintenance of oxygen-free atmospheric conditions (see Notes 1 and 2). Additional requirements imposed by particular experimental designs may include the addition of selective agents, either aimed at promoting bifidobacterial growth or at inhibiting that of other competitor microorganisms, or the design of chemically defined formulations, to allow for testing the auxotrophy for certain nutrients. For these purposes, a comprehensive knowledge on the physiological traits of the target microorganism is necessary. Table 1 summarizes the main media used for bifidobacterial growth and described in this chapter, including information on the species on which it has been validated and information on their suitability for specific experimental approaches. Numerous commercially available general culture media are able to sustain growth of bifidobacteria, although they are not selective, thus also enabling growth of other bacteria, and in some cases, they also require specific supplements to support growth of bifidobacteria. Besides, it is worth remarking that at the time of writing this chapter, no universal medium for the selective isolation or differential detection of all bifidobacterial species/strains was available. While some of the described media increase the selectivity toward the isolation of bifidobacteria, some species/strains may be unable to grow on a particular medium, and thus different colony counts from the same sample will be detected on different media. In addition, a low percentage of nonbifidobacterial species can grow on the media described in the selective media section, which can be particularly challenging when isolating bifidobacteria from complex biological samples, such as fecal material, and/or those with low bifidobacterial levels. Besides, none of the media described in this chapter allows for straightforward identification or differentiation of Bifidobacterium species. Thus, all bifidobacterial isolation procedures should be followed by subcultivation and further strain testing (e.g., through 16S rRNA or ITS sequencing, alone or in combination to biochemical detection of fructose-phosphoketolase activity). Besides, most chemically defined media formulations have only been validated for a small number of strains (Table 1); thus, their formulation might need to be further optimized for particular experimental design or working strains. The most widely employed and recommended growth media for bifidobacteria, listed here in order of the most recommended to those that have only been used in a limited number of studies, are described below, including any supplements that they may require.

4

Abelardo Margolles and Lorena Ruiz

Table 1 Use indications on general, selective, and chemically defined media for bifidobacterial growth described in this chapter Growth medium

References Validated for

Use indications

[13]

Most species/strains

Routine growth, after supplementation with L-cysteine

Several species/strains

Frequently used for isolation from complex communities, following supplementation with selection/ counterselection agents (see Subheading 3.2)

Several species/strains

Frequently used for isolation from complex communities, following supplementation with selection/ counterselection agents (see Subheading 3.2)

General media De man, Rogosa, Sharpe (MRS)

Trypticase Phytone yeast [17] (TPY) Wilkins-Chalgren [18] Others (brain–heart infusion [19] (BHI), Gifu anaerobic medium (GAM), chopped meat medium, Columbia agar base (CAB), and reinforced clostridial medium (RCM)) Selective media General media supplemented [20–23] with mupirocin, norfloxacin, acetic acid, sodium propionate, lithium chloride, or specific carbon sources (or a combination of some of these components) [24, 25] Transgalactosylated oligosaccharidespropionate-mupirocin lithium salt (TOS-propionate-MUP) Raffinose-propionate lithium [26] mupirocin (RP-MUP) Chemically defined media Probiotic Laboratory Base media (PROLAB)

[27]

B. animalis

Routine growth

Bifidobacterial minimal medium (BMM)

[28]

B. longum

Identify auxotrophy for uracil

Folate-free medium (FFM)

[29]

Identify folate production B. adolescentis, B. animalis, B. bifidum, B. breve, B. catenulatum, B. longum and B. pseudocatenulatum (continued)

Cultivation Tools for Bifidobacteria

5

Table 1 (continued) Growth medium

References Validated for

Use indications

Semisynthetic medium 7 (SM7)

[30]

B. adolescentis, B. catenulatum, B. dentium, B. animalis, B. bifidum, B. longum, B. breve, B. pseudocatenulatum

Chemically defined media (CDM)

[3]

Validated for the isolation of Originally designed to control the carbon source novel bifidobacterial species based on their carbohydrate utilization capabilities

Identify folate production

3 Description of Composition, Characteristics, and Recommended Use of Different Media for Bifidobacterial Cultivation 3.1

General Media

3.1.1 De Man–Rogosa– Sharpe (MRS)

MRS was originally formulated for particular Lactobacillus species [12], but the addition of 0.05–0.5 g/L of L-cysteine hydrochloride (MRSc) (see Note 3) transforms it into a very suitable medium to grow bifidobacteria, and in fact represents the medium of choice for routine growth and recovery of bifidobacterial strains. Furthermore, other modified MRS (mMRS) formulations have been described that supplement MRS with water-soluble vitamins (thiamine, riboflavin, and pantothenic acid) and lactulose syrup; or α-lactalbumin or β-lactoglobulin from bovine whey to enhance growth of certain species/strains [13]. It is also worth noting that commercially available MRS formulations contain glucose and starch (an α-linked glucose polymer) as the only carbon sources although the original media description indicates that the carbon sources used for its preparation should match those present in the environment from which bacteria are intended to be isolated. While many bifidobacterial strains are able to utilize either glucose or starch, the presence of these carbohydrates in the media might prevent selectivity, which could be provided by alternative carbon sources. Thus, the preparation of MRSc formulations from its separate ingredients excluding glucose or starch sources, and the further supplementation with a specific carbohydrate at a final concentration ranging from 0.5 to 1 g/L can be used to selectively grow bifidobacterial strains based on their particular metabolic traits. Indeed such approaches have enlarged our comprehension on the vast array of complex carbohydrates that can be metabolized, collectively, by members of the genus Bifidobacterium [14, 15].

6

Abelardo Margolles and Lorena Ruiz

3.1.2 Trypticase Phytone Yeast (TPY)

Commercially available, TPY medium is reported to allow for growth of most bifidobacterial species [16] and does not require the addition of other supplements or components. It is not a selective medium and thus enables growth of other bacteria, in particular lactic acid bacteria, but it has been widely used to isolate several novel species of bifidobacteria, being considered the preferred medium for routine cultivation and isolation of bifidobacteria by some authors.

3.1.3 Wilkins-Chalgren (WC)

WC medium requires supplementation with 5 g/L of soya peptone, 0.5 g/L of L-cysteine, 1 mL/L of Tween 80, and 1 mL/L glacial acetic acid to provide appropriate conditions to grow bifidobacteria [17]. This media contains glucose present in the WC basal formulation, in addition to raffinose-series oligosaccharides provided by the soya peptone, which aid in supporting growth of non–glucosefermenting strains. Bifidobacteria have shown comparable growth in this media and in TPY [17].

3.1.4 Other Complex Culture Media

Other complex and commercially available culture media described to support bifidobacterial growth, though not yet widely used for their routine growth, are brain–heart infusion (BHI), Gifu anaerobic medium (GAM), chopped meat medium, Columbia agar base (CAB), and reinforced clostridial medium (RCM) [18]. Addition of 0.5 g/L of L-cysteine to these media, although not strictly necessary, might aid at lowering their redox potential in order to support reliable growth of bifidobacteria.

3.2

Strategies to make a medium selective for bifidobacteria include the addition of selective agents, those aimed at selectively enhancing growth of targeted bifidobacteria; or counterselection agents, those aimed at inhibiting growth of competitor microorganisms, to the above-described media. With regard to counterselection agents, commonly employed selective agents to inhibit growth of competitor microorganisms favoring the selective isolation of bifidobacteria, include the use of antibiotics, to which bifidobacteria exhibit intrinsic resistance. Among these, 100 mg/L mupirocin alone [19] or in combination with 200 mg/L norfloxacin (see Note 4) [20] have been proven effective to selectively enumerate bifidobacteria. Other selective agents are acetic acid, already present in the original formulation of commercial MRS, which inhibits growth of certain nonbifidobacterial species and thus has been used as supplement in certain media to enhance its selectivity toward bifidobacteria. Sodium propionate and/or lithium chloride have also been employed in several formulations to enhance the selectivity of some of the above-described media toward bifidobacteria, as these appear to inhibit the growth of other lactic acid bacteria and molds [21]. As regards other selective agents, it is common to employ

Selective Media

Cultivation Tools for Bifidobacteria

7

specific carbohydrate sources (e.g., raffinose, GOS, FOS, lactose), which can help to promote growth of bifidobacteria, and thus facilitate their isolation from complex microbial communities. Indeed, formulation of selective media for bifidobacteria has frequently relied on the combination of both selection and counterselection agents to general media formulations, such as the ones described above, as well as in commercially available selective media for bifidobacteria. Some of the most commonly used selective agent combinations used to improve the recovery of bifidobacteria are described in the following paragraphs. 1. Addition of 1 mL/L glacial acetic acid and 100 mg/L mupirocin (see Note 4) to TPY (modified TPY) or to WilkinsChalgren (modified Wilkins-Chalgren) has been described to increase the selectivity to isolate bifidobacteria from cecal samples, although about 5% of recovered colonies were not bifidobacteria. Besides, addition of non-glucose carbon sources, such as soya peptone (5 g/L), which represents a source of raffinosecontaining oligosaccharides, aided in the recovery of nonglucose-fermenting bifidobacterial strains [22]. 2. The selectivity of modified Wilkins-Chalgren can be further improved through its supplementation with 100 mg/L of mupirocin (see Note 4) [19]; yet also through supplementation with a combination of 5 g/L soya peptone, 0s.5 g/L L-cysteine, 1 mL/L Tween 80, 100 mg/L mupirocin, and 1 mL/L acetic acid (mWCmup) [22]. Further addition of 200 mg/L norfloxacin increased the selectivity toward recovery of bifidobacteria from fecal samples. However, it is worth highlighting that some bifidobacterial species have been reported to be sensitive to norfloxacin and thus its utilization as selective agent might cause exclusion of some of the natural occurring strains present in the tested matrix [20]. 3. As mentioned above, raffinose-containing sources such as soya peptone (5 g/L) have demonstrated the usefulness in improving the efficiency and selectivity of bifidobacterial isolation [20, 22], while starch, pullulan and transgalactosylated oligosaccharides have also aided in the isolation of novel bifidobacterial species/strains from fecal samples [3]. 3.2.1 Commercially Available Selective Media

To date, only TOS-Propionate-MUP (transgalactosylated oligosaccharides-propionate-mupirocin lithium salt) media, which combines both counterselection and selective agents, is commercially available as a bifidobacterial selective agar media. Some bifidobacterial strains have been shown to grow significantly better on this media as compared to MRSc [23], while TOS-PropionateMUP has also been validated as an effective medium for the enumeration of bifidobacteria from milk products [24]. However,

8

Abelardo Margolles and Lorena Ruiz

when used for the purpose of isolating bifidobacteria from complex communities such as fecal samples, a small percentage of nonbifidobacterial colonies may inadvertently be recovered. A further modification of TOS-Propionate-MUP was proposed by Miranda et al., who formulated a raffinose-propionate lithium mupirocin (RP-MUP), with the aim of combining multiple selection agents for bifidobacteria. For this purpose, RP base media was prepared following the composition of TOS-Propionate, but substituting its TOS components by raffinose to a final concentration of 5 g/L, after which this RP basal media was supplemented with 50μg/mL of mupirocin (see Note 4) [25]. However, no significant differences were observed on its performance as compared to TOSMUP. 3.3 Chemically Defined Media

Semisynthetic and chemically defined media formulations have been proposed by several authors as guided by specific research needs, including definition of auxotrophies, isolation of bioactive compounds or need to label specific amino acids during bifidobacterial growth in culture. Semisynthetic media include some ingredients of unknown detailed composition, such as yeast, meat, or peptone extracts, while the precise components of a fully chemically defined media are fully known. Some of the chemically defined medium formulations that have been reported for bifidobacterial strains are described in the following paragraphs and additional information regarding their suitability for specific experimental purposes and/or the species/strains in which it has been validated are included in Table 1. 1. Probiotic Laboratory Base Medium (PROLAB): 10.8 g/L lactose, 1 g/L NH4Cl, 3.5 g/L K2HPO4, 0.25 g/L MgSO4·7H2O, 0.42 g/L NaHCO3, 5 mL/L Tween 80, 0.5 g/L cysteine hydrochloride, 2 mg/L biotin, 0.5 mg/ L Vitamin B12, 10 mg/L pantothenate, 5 mg/L nicotinamide, 5 mg/L p-aminobenzoic acid, 4 mg/L thiamine, 20 mg/L MnSO4·H2O, 5 mg/L ZnSO4·7H2O, 0.1 mg/L CuSO4·5H2O, 50 mg/L MgCl2·6H2O, 5 mg/L FeCl2·4H2O, 5 mg/L riboflavin (for addition of vitamins see Note 4) [26]. The same authors that formulated the PROLAB medium composition above indicated described several modifications of this formulation as indicated in Note 5, though they have only been validated for one particular strain (Table 1). 2. Bifidobacterial minimal medium (BMM): 9 g/L NaCl, 5 g/L – CH3COONa, 4.5 g/L KH2PO4, 400 mg/L Na2CO3, 400 mg/L (NH4)2SO4, 200 mg/L MgSO4, 250 mg/L CaCl2·2H2O, 100 mg/L MnCl2·4H2O, 20 g/L D-glucose, 340 mg/L L-ascorbate(Na), 1400μg/L inositol, 800μg/L 4-aminobenzoic acid, 600μg/L nicotinic acid, 300μg/L

Cultivation Tools for Bifidobacteria

9

biotin, 300μg/L choline, 300μg/L pantothenic acid, 120μg/ L riboflavin, 40μg/L pyridoxine, 1.5μg/L folic acid, 500 mg/ L cysteine hydrochloride, 64.5 mg/L isoleucine, 87.0 mg/L tyrosine [27]. Particular cautions to follow during its preparation and concerning the species/strains in which it has been tested, are indicated in Note 6 and Table 1. 3. Folate-free medium (FFM): 15 g/L glucose, 10 g/L sodium acetate, 10 g/L ammonium sulfate, 5 g/L di-potassium hydrogen phosphate, 3 g/L dihydrogen phosphate, 2 g/L urea, 10 g/L ascorbic acid, 1 mL/L Tween 80, minerals (0.2 g/L MgSO4·7H2O, 10 g/L FeCl2·4H2O, 8 mg/L MnSO4·4H2O, 10 mg/L NaCl), trace metals (30 mg/L EDTA, 9 mg/L CaCl2·2H2O, 9 mg/L ZnSO4·7H2O, 6 mg/L FeSO4·7H2O, 2 mg/L H3BO3, 1.2 mg/L MnCl2·2H2O, 0.8 mg/L Na2MoO4·2H2O, 0.6 mg/L CoCl2·2H2O, 0.6 mg/L CuSO4·5H2O, 0.2 mg/L KI), vitamins (2 mg/L pyridoxamine pantothenate hydrochloride, 2 mg/L nicotinic acid, 2 mg/L thiamine, 1 mg/L calcium pantothenate, 1 mg/L riboflavin, 50μg/L p-aminobenzoic acid, 50μg/L biotin), amino acids (0.5 g/L cysteine hydrochloride, 0.2 g/L L-alanine, 0.2 g/L DL-arginine, 0.2 g/L DL-asparagine, 0.2 g/L aspartic acid, 0.2 g/L glycine, 0.2 g/L L-histidine, 1 g/L Lglutamic acid, 0.1 g/L L-isoleucine, 0.1 g/L L-lysine, 0.2 g/L L-leucine, 0.2 g/L L-methionine, 0.2 g/L DL-phenylalanine, 0.2 g/L L-proline, 0.2 g/L DL-serine, 0.2 g/L L-threonine, 0.2 g/L DL-tyrosine, 0.2 g/L L-tryptophan, 0.2 g/L DLvaline). The pH of the medium needs to be adjusted to 6.6–6.8 with a 4 M NaOH solution [28]. 4. Semisynthetic medium 7 (SM7): 2 mg/L pyridoxine, 2 mg/L nicotinic acid, 2 mg/L thiamine, 1 mg/L calcium pantothenate, 1 mg/L riboflavin, 0.05 mg/L para-aminobenzoic acid, 0.05 mg/L biotin, 10 g/L ascorbic acid, 10 g/L sodium acetate 5 g/L (NH4)2SO4, 2 g/L urea, 0.2 g/L MgSO4·7H2O, 0.01 g/L FeSO4·7H2O, 0.007 g/L MnSO4·7H2O, 0.01 g/L NaCl, 1 g/L Tween 80, 0.5 g/L cysteine. The pH needs to be adjusted to 7.0, before autoclaving for 30 min at 110  C. Glucose needs to be filter-sterilized separately and added to the sterile basal medium to obtain a final concentration of 20 g/L [29]. 5. Chemically Defined Medium (CDM): 4.0 g/L sodium acetate, 1.0 g/L triammonium citrate, 2.0 g/L KH2PO4, 2.0 g/L K2HPO4, 0.5 g/L MgSO4·7H2O, 0.05 g/L MnSO4·H2O, 0.02 g/L FeSO4·7H2O, 0.2 g/L CaCl2, 20 mg/L adenine, 40 mg/L xanthine, 0.4 g/L cysteine, 0.3 g/L aspartic acid, 0.3 g/L glutamic acid, 0.2 g/L of each the following amino acids: alanine, arginine, glycine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine,

10

Abelardo Margolles and Lorena Ruiz

tryptophan, tyrosine, and valine; 0.5 g/L orotic acid, 0.5 mg/ L p-aminobenzoic acid, 0.5 mg/L folic acid, 2 mg/L nicotinic acid, 2 mg/L Ca-pantothenate, 1 mg/L biotin, 2 mg/L pyridoxal, 2 mg/L riboflavin, and 1 mg/L vitamin B12. The medium is sterilized by filtration (pore size 0.22μm) [3].

4

Notes 1. Maintenance of oxygen-free atmospheric conditions can generally be achieved through the incubation under static conditions on either portable anaerobic devices such as standard anaerobic jars, or anaerobic chambers or incubators. A commonly used atmospheric condition for bifidobacterial incubation consists of a mixture of 10% CO2, 10% H2, and 80% N2. 2. Overall and with few exceptions, due to its anaerobic character most species/strains of bifidobacteria have been shown to be unable to grow under aerobic conditions, but remarkably, most of them are capable to survive for a short period to aerobic manipulation/exposure. Thus, general strain manipulation can be performed under routine atmospheric conditions, although cultures/plates must be placed under anaerobic conditions, at 37  C immediately following inoculation/plating. 3. Due to their anaerobic character, bifidobacteria grow well in media with appropriate reducing agents, such as cysteine, thioglycolate, sodium sulfite or ascorbic acid; which also help to recover injured Bifidobacterium cells [30]. Of these reducing agents, cysteine is the most commonly used in bifidobacterial culture media. 4. When antibiotic or vitamin supplements are to be added to a certain bacterial cultivation medium, these supplements should not be sterilized through autoclaving. Instead, these will be added to autoclaved media, previously cooled down to about 50  C, from filter-sterilized stocked solutions, prepared at appropriate concentrations (e.g., usually 1000 fold concentrated). 5. Further addition of 50 mg/L adenine, 50 mg/L xanthine, and 50 mg/L guanine to the PROLAB medium increased the growth efficiency of a B. animalis strain. 6. Glucose, Na2CO3, vitamins, and cysteine hydrochloride should be filter-sterilized and added after the medium is autoclaved and cooled down to 50  C. This medium was validated in a particular strain of B. longum and, although the agar media worked properly for B. longum growth, the addition of yeast extract was necessary to achieve proper growth on liquid BMM.

Cultivation Tools for Bifidobacteria

11

References 1. O’Callaghan A, van Sinderen D (2016) Bifidobacteria and their role as members of the human gut microbiota. Front Microbiol 7:925. https://doi.org/10.3389/fmicb. 2016.00925 2. Bottacini F, van Sinderen D, Ventura M (2017) Omics of bifidobacteria: research and insights into their health-promoting activities. Biochem J 474:4137–4152. https://doi.org/10.1042/ BCJ20160756 3. Lugli GA, Milani C, Duranti S et al (2019) Isolation of novel gut bifidobacteria using a combination of metagenomic and cultivation approaches. Genome Biol 20:96. https://doi. org/10.1186/s13059-019-1711-6 4. Milani C, Turroni F, Duranti S et al (2016) Genomics of the genus Bifidobacterium reveals species-specific adaptation to the glycan-rich gut environment. Appl Environ Microbiol 82:980. https://doi.org/10.1128/AEM. 03500-15 ˜ iga M, Monedero V, Yebra MJ (2018) Uti5. Zu´n lization of host-derived Glycans by intestinal Lactobacillus and Bifidobacterium species. Front Microbiol 9:1917. https://doi.org/10. 3389/fmicb.2018.01917 6. Sakanaka M, Hansen ME, Gotoh A et al (2019) Evolutionary adaptation in fucosyllactose uptake systems supports bifidobacteriainfant symbiosis. Sci Adv 5:eaaw7696. https://doi.org/10.1126/SCIADV. AAW7696 7. Thomson P, Medina DA, Garrido D (2018) Human milk oligosaccharides and infant gut bifidobacteria: molecular strategies for their utilization. Food Microbiol 75:37–46. https://doi.org/10.1016/J.FM.2017.09.001 8. Pokusaeva K, Fitzgerald GF, van Sinderen D (2011) Carbohydrate metabolism in Bifidobacteria. Genes Nutr 6:285–306. https://doi. org/10.1007/s12263-010-0206-6 9. Ferrario C, Duranti S, Milani C et al (2015) Exploring amino acid Auxotrophy in Bifidobacterium bifidum PRL2010. Front Microbiol 6:1331. https://doi.org/10.3389/fmicb. 2015.01331 10. Sugahara H, Odamaki T, Hashikura N et al (2015) Differences in folate production by bifidobacteria of different origins. Biosci Microbiota Food Health 34:87–93. https://doi. org/10.12938/bmfh.2015-003 11. Lanigan N, Bottacini F, Casey PG et al (2017) Genome-wide search for genes required for

Bifidobacterial growth under iron-limitation. Front Microbiol 8:964. https://doi.org/10. 3389/fmicb.2017.00964 12. De MJC, Rogosa M, Sharpe ME (1960) A medium for the cultivation of lactobacilli. J Appl Bacteriol 23:130–135. https://doi.org/ 10.1111/j.1365-2672.1960.tb00188.x 13. Pacher B, Kneifel W (1996) Development of a culture medium for the detection and enumeration of bifidobacteria in fermented milk products. Int Dairy J 6:43–64. https://doi.org/ 10.1016/0958-6946(94)00052-2 14. Bottacini F, Morrissey R, Esteban-Torres M et al (2018) Comparative genomics and genotype-phenotype associations in Bifidobacterium breve. Sci Rep 8:10633. https://doi. org/10.1038/s41598-018-28919-4 15. Arboleya S, Bottacini F, O’Connell-Motherway M et al (2018) Gene-trait matching across the Bifidobacterium longum pan-genome reveals considerable diversity in carbohydrate catabolism among human infant strains. BMC Genomics 19:33. https://doi.org/10.1186/ S12864-017-4388-9 16. Scardovi V (1986) Bifidobacterium. In: Sneath HAP, Mair NS, Sharpe ME, Holt JG (eds) Bergey’s manual of systematic bacteriology, vol 2. Williams & Wilkins, Baltimore, pp 1418–1435 17. Bunesˇova´ V, Vlkova´ E, Rada V et al (2012) Bifidobacterium animalis subsp. lactis strains isolated from dog faeces. Vet Microbiol 160:501–505. https://doi.org/10.1016/J. VETMIC.2012.06.005 18. Barret E, Mattarelli P, Simpson P et al (2011) Culture media for the detection and enumeration of bifidobacteria in food production. In: Handbook. Royal Society of Chemistry, Cambridge 19. Ferraris L, Aires J, Waligora-Dupriet A-J, Butel M-J (2010) New selective medium for selection of bifidobacteria from human feces. Anaerobe 16:469–471. https://doi.org/10.1016/J. ANAEROBE.2010.03.008 20. Vlkova´ E, Salmonova´ H, Bunesˇova´ V et al (2015) A new medium containing mupirocin, acetic acid, and norfloxacin for the selective cultivation of bifidobacteria. Anaerobe 34:27–33. https://doi.org/10.1016/J. ANAEROBE.2015.04.001 21. Lapierre L, Undeland P, Cox LJ (1992) Lithium chloride-sodium propionate agar for the enumeration of Bifidobacteria in fermented

12

Abelardo Margolles and Lorena Ruiz

dairy products. J Dairy Sci 75:1192–1196. https://doi.org/10.3168/jds.S0022-0302( 92)77866-7 22. Rada V, Petr J (2000) A new selective medium for the isolation of glucose non-fermenting bifidobacteria from hen caeca. J Microbiol Methods 43:127–132 ˜ro¨si T, Hucker A, Varga L (2014) 23. Su¨le J, Ko Evaluation of culture media for selective enumeration of bifidobacteria and lactic acid bacteria. Braz J Microbiol 45:1023–1030. https://doi.org/10.1590/s151783822014000300035 24. Bunesova V, Musilova S, Geigerova M et al (2015) Comparison of mupirocin-based media for selective enumeration of bifidobacteria in probiotic supplements. J Microbiol Methods 109:106–109. https://doi.org/10. 1016/j.mimet.2014.12.016 25. Miranda RO, de Carvalho AF, Nero LA (2014) Development of a selective culture medium for bifidobacteria, Raffinose-propionate lithium mupirocin (RP-MUP) and assessment of its usage with Petrifilm™ aerobic count plates. Food Microbiol 39:96–102. https://doi.org/ 10.1016/j.fm.2013.11.010

26. Kongo J, Gomes A, Malcata F (2003) Development of a chemically defined medium for growth of Bifidobacterium animalis. JFS Food Microbiol Saf 68:2742–2746 27. Sakaguchi K, Funaoka N, Tani S et al (2013) The pyrE gene as a bidirectional selection marker in Bifidobacterium Longum 105-a. Biosci Microbiota Food Health 32:59–68. https://doi.org/10.12938/bmfh.32.59 28. D’Aimmo MR, Mattarelli P, Biavati B et al (2012) The potential of bifidobacteria as a source of natural folate. J Appl Microbiol 112:975–984. https://doi.org/10.1111/j. 1365-2672.2012.05261.x 29. Pompei A, Cordisco L, Amaretti A et al (2007) Folate production by Bifidobacteria as a potential probiotic property. Appl Environ Microbiol 73:179. https://doi.org/10.1128/AEM. 01763-06 30. Nebra Y, Jofre J, Blanch AR (2002) The effect of reducing agents on the recovery of injured Bifidobacterium cells. J Microbiol Methods 49:247–254. https://doi.org/10.1016/ S0167-7012(01)00373-6

Chapter 2 Bifidobacterium Transformation Emily C. Hoedt, Roger S. Bongers, Francesca Bottacini, Jan Knol, John MacSharry, and Douwe van Sinderen Abstract The protocol presented in this chapter describes a generic method for electrotransformation of Bifidobacterium spp., outlining a technique that is ideal for conferring selective properties onto strains as well as allowing the user to introduce or knock out/in selected genes for phenotypic characterization purposes. We have generalized on the plasmid chosen for transformation and antibiotic selection marker, but the protocol is versatile in this respect and we are able to achieve transformation efficiencies up to 107 transformants/μg of DNA. Key words Probiotic, Bifidobacterial, Genetic accessibility, Electroporation

1

Introduction Electroporation as a technique is based on the imposition of a strong electrical field to increase cell membrane permeability [1], thereby allowing for the introduction of chemicals or nucleic acids (such as single and double stranded, circular or linear DNA) [2– 4]. Introduction of DNA into target cells facilitates their “transformation” into derivatives carrying or expressing a novel function, or mutants in which a target gene was removed or (re)introduced [5, 6]. For microbiology the development and implementation of electroporation as a method of DNA introduction for genetic transformation purposes has been fundamental in the application of selective markers and the characterization of hypothetical genes [5, 7]. Being Gram-positive, obligate anaerobes, particular members of the genus Bifidobacterium are purported to exert beneficial effects to their host and as a result a large body of research has been published by scientists who are working to better characterize these rather fastidious microbes, which are sometimes difficult to cultivate [8, 9]. Members of the Bifidobacterium genus are ideal targets for genetic manipulation via electrotransformation,

Douwe van Sinderen and Marco Ventura (eds.), Bifidobacteria: Methods and Protocols, Methods in Molecular Biology, vol. 2278, https://doi.org/10.1007/978-1-0716-1274-3_2, © Springer Science+Business Media, LLC, part of Springer Nature 2021

13

14

Emily C. Hoedt et al.

however, bifidobacteria are notoriously recalcitrant to genetic manipulation due to their extensive and diverse restriction/modification (RM) systems, thick cell wall, and sensitivity to oxygen [10– 12]. Only recently these hurdles have been investigated and overcome [5, 13, 14]. Here we describe a routine transformation methodology via electroporation for members of the genus Bifidobacterium. However, it should be noted that currently available literature suggests that the procedure for transformation may not be uniformly applicable for all Bifidobacterium species and strains [13, 15]. The protocol described below should therefore be used as an initial guide to achieve transformation, and modifications may thus have to be tested in order to suit each individual Bifidobacterium spp. For example, modifications can be made to the carbohydrate in the growth medium, plasmid to be transformed, amount of plasmid DNA used, electroporation parameters, and recovery medium.

2 2.1

Materials Reagents

1. Luria–Bertani (LB) culture medium/agar: 10 g/L tryptone, 5 g/L yeast extract, 10 g/L sodium chloride (and 16 g/L agar when required), autoclave to sterilize solution. 2. Modified de Man–Rogosa–Sharpe (mMRS) Media: 10 g/L tryptone (peptone from casein), 2.5 g/L yeast extract, 3 g/L tryptose, 3 g/L potassium phosphate dibasic (K2HPO4), 3 g/ L potassium phosphate monobasic (KH2PO4), 2 g/L triammonium citrate, 0.2 g/L pyruvic acid (sodium pyruvate), 0.575 g/L magnesium sulfate heptahydrate (MgSO4·7H2O), 0.12 g/L manganese(II) sulfate tetrahydrate (MnSO4·4H2O), and 0.034 g/L iron(II) sulfate heptahydrate (FeSO4·7H2O), dissolve all components in distilled water using a magnetic stirrer and then add 1 mL/L Tween 80, autoclave to sterilize solution (see Note 1). 3. 38 g/L Reinforced Clostridium Medium (RCM; available as a premix from Oxoid), autoclave to sterilize solution. 4. 52.6 g/L Reinforced Clostridium Agar (RCA; available as a premix from Oxoid), autoclave to sterilize solution. 5. 10% glucose solution: prepared in distilled water and 0.2 μm filter-sterilized. Store at 4
C and remake fresh weekly or as required. 6. 6% L-cysteine-HCl solution: prepared in distilled water and 0.2 μm filter-sterilized. Store at 4
C and remake fresh weekly or as required. 7. Glycerol stock tubes: 200 μL 100% glycerol aliquoted into 2 mL screw cap tubes and sterilized by autoclaving.

Bifidobacterium Transformation

15

8. 80% glycerol stock solution for competent cells: prepared in distilled water, autoclave to sterilize solution. 9. Thermo Scientific (or equivalent).

GeneJET

Plasmid

Miniprep

Kit

10. Antibiotic for selection of specific plasmid, filter-sterilized (e.g., 5 μg/mL Chloramphenicol, final concentration). 11. Sucrose-citrate wash buffer: 0.21 g Citric Acid dissolved in 800 mL distilled water, adjust pH to 5.8 (using NaOH), make up to volume to 1 L with distilled water. Divide solution into five 200 mL bottles and add 0.5 M Sucrose, equivalent to 34.2 g per 200 mL bottle, autoclave to sterilize solution. 12. 1 TAE buffer: 4.844 g/L Tris base, 1.21 mL/L acetic acid, and 0.372 g/L EDTA. 13. 1% agarose dissolved in TAE by microwaving. 2.2

Equipment

1. NanoDrop1000/Qubit (DNA quantification equivalent). 2. 1.5 mL tubes. 3. 50 mL falcon tubes. 4. 25 mL serological pipettes. 5. Microcentrifuge. 6. Gel-electrophoresis system. 7. Transilluminator for gel imaging. 8. Anaerobic work station (10% hydrogen, 10% carbon dioxide, and 80% nitrogen). 9. Refrigerated centrifuge with rotor for 50 mL falcon tubes. 10. Electroporator and electroporation cuvettes (2 mm). 11. Spectrophotometer measuring optical density at a wavelength of 600 nm.

3

Methods 1. Recover desired plasmid from relevant bacterial host (e.g., Escherichia coli, see Note 2) achieved with Plasmid Miniprep Kit following the manufacturer’s instructions. 2. Plasmid recovery can be confirmed by standard agarose gel electrophoresis. 3. Quantify extracted plasmid DNA using spectrophotometric methods (e.g., Nanodrop or Qubit). 4. To prepare bifidobacterial competent cells, overnight cultures are first prepared in 10 mL RCM supplemented with 0.05% Lcysteine stock solution (with an additional carbohydrate if required—strain specific). Incubate cultures at 37
C anaerobically overnight (~16 h) without shaking.

16

Emily C. Hoedt et al.

5. The following day inoculate 5 mL of the overnight culture into 40 mL of mMRS, with 1% vol/vol addition of filter-sterilized stock sugar (e.g., glucose) and 0.05% L-cysteine stock solution. 6. Incubate anaerobically at 37
C until optical density (OD600nm) reaches 0.6–0.9 (~3 h), monitor OD600nm with a spectrophotometer by aseptically removing 1 mL of growing culture approximately every 1–2 h. 7. Once an OD600nm of 0.6–0.9 is reached, place cultures on ice for 20 min, inverting every 5 min (see Note 3). 8. Harvest cells by centrifugation: 4
C, 4052  g for 10 min. 9. Discard supernatant into waste. 10. Wash cells with ice cold 25 mL sucrose–citrate wash buffer. To resuspend the cell pellet use the serological pipette to knock the pellet off the side of the tube after adding the ice-cold buffer and gently mix. 11. Repeat steps 8–10. 12. During centrifugation, ensure that recovery medium RCM is prewarmed to 37
C. 13. Prepare 1.5 mL tubes with aliquoted plasmid DNA (concentration can vary, we recommend starting with 200 ng) and label electroporation cuvettes, these should be chilled on ice before use. 14. After final wash and centrifugation of bifidobacterial cells, discard supernatant into waste. 15. Gently resuspend cells in 200 μL sucrose–citrate wash buffer. If freezing competent cells, add 200 μL of 80% glycerol (see Note 4), dispense into prechilled labelled 1.5 mL tubes and store at 80
C. 16. Mix 50 μL of competent cells and plasmid DNA (e.g., 200 ng), and transfer total volume to an electroporation cuvette. 17. Prepare a negative control for electroporation by only adding 50 μL of competent cells to a cuvette. 18. Carry out electrotransformation as quickly as possible, using the following settings: (a) 25 μF. (b) 200 Ω. (c) 2000 V. 19. Following electroporation, resuspend cells in cuvette to a final volume of 1 mL with prewarmed RCM and incubate at 37
C anaerobically for 1 h. 20. Plate 100 μL of transformed cells onto RCA (plating dilutions of the cell preparation are also recommended, e.g., 101, 102, and 103) with appropriate selective antibiotic (e.g., final concentration 5 μg/mL chloramphenicol).

Bifidobacterium Transformation

17

21. Incubate plates anaerobically at 37
C for 2–3 days. 22. Colony counts can then be performed to determine the transformation efficiency. Transformation efficiency ¼ number of colonies counted on plate/(μg plasmid DNA transformed/ total dilution of DNA before plating).

4

Notes 1. Improved transformation efficiency has been observed when mMRS is 0.2 μm filter-sterilized in comparison to autoclave sterilization. Filter-sterilized medium should be stored at 4
C and remade fresh weekly or aliquoted and frozen at 30
C. 2. Suggested plasmids for bifidobacterial transformation are listed below in Table 1 (NB. See also Chapter 15 of this book for information on plasmids that replicate in bifidobacteria). It should be noted that one of the biggest hurdles for successful transformation is resident restriction–modification (RM) systems [10, 16]. Selection of a plasmid with fewer RM motifs (strain-specific) can drastically improve the recovery of transformants. Alternatively, a plasmid can be methylated chemically (eg: NEB, GpC Methyltransferase (M.CviPI)) or by first transforming a given plasmid into a methylase-positive strain such as E. coli EC101 (DAM+; methylates GATC sites) otherwise an E. coli strain in which a bifidobacterial methylase gene is expressed [16–19]. Transformation of EC101 and other E. coli strains is performed using methods published by Dower et al. [20]. 3. When preparing competent cells ensure that they are always kept chilled (on ice) to ensure cells remain receptive to plasmid DNA. This includes making the wash buffer at least the day before, storing at 4
C overnight and then keeping on ice during the cell wash steps.

Table 1 Example plasmids for Bifidobacterium transformation Plasmid

Relevant characteristics

Citations

pNZ8048

CmR, pSH71 replicon, inducible nisA promoter

[21, 22]

pNZ44

R

[23]

R

Cm , pNZ8048 containing constitutive P44 promoter from L. lactis

pPKCM

Cm , set of E. coli–Bifidobacterium shuttle vectors based on pBlueCm

[24]

pSKEm

EmR, E. coli–Bifidobacterium shuttle vector derived from pErythromycin

[24]

pAM5

R

Tet , pBC1-pUC19 [tet(W)]

[25]

18

Emily C. Hoedt et al.

4. Improved transformation efficiency is always observed when freshly made competent cells are used. Use of frozen competent cells is still possible for electroporation but expect a decrease in transformation efficiency.

Acknowledgments This work was sponsored by Nutricia Research, Utrecht, The Netherlands. E.C.H., F.B., J.M., and D.v.S. are members of APC Microbiome Ireland, which is funded by Science Foundation Ireland (SFI) through the Irish Government’s National Development Plan (Grant Numbers SFI/12/RC/2273-P1 and SFI/12/RC/ 2273-P2). References 1. Sugar IP, Neumann E (1984) Stochastic model for electric field-induced membrane pores electroporation. Biophys Chem 19:211–225 2. Wong TK, Neumann E (1982) Electric field mediated gene transfer. Biochem Biophys Res Commun 107:584–587 3. Miller JF, Dower WJ, Tompkins LS (1988) High-voltage electroporation of bacteria: genetic transformation of campylobacter jejuni with plasmid DNA. Proc Natl Acad Sci U S A 85:856–860 4. Zaharoff DA, Henshaw JW, Mossop B et al (2008) Mechanistic analysis of electroporation-induced cellular uptake of macromolecules. Exp Biol Med (Maywood) 233:94–105 5. O’Callaghan A, Bottacini F, O’Connell Motherway M et al (2015) Pangenome analysis of Bifidobacterium longum and site-directed mutagenesis through by-pass of restrictionmodification systems. BMC Genomics 16:832 6. Ruiz L, Motherway MO, Lanigan N et al (2013) Transposon mutagenesis in Bifidobacterium breve: construction and characterization of a Tn5 transposon mutant library for Bifidobacterium breve UCC2003. PLoS One 8:e64699 7. Cronin M, Morrissey D, Rajendran S et al (2010) Orally administered bifidobacteria as vehicles for delivery of agents to systemic tumors. Mol Ther 18:1397–1407 8. Bernini LJ, Sima˜o AN, Alfieri DF et al (2016) Beneficial effects of Bifidobacterium lactis on lipid profile and cytokines in patients with metabolic syndrome: a randomized trial. Effects of probiotics on metabolic syndrome. Nutrition 32:716–719

9. O’Callaghan A, van Sinderen D (2016) Bifidobacteria and their role as members of the human gut microbiota. Front Microbiol 7:925–925 10. Bottacini F, Morrissey R, Roberts RJ et al (2018) Comparative genome and methylome analysis reveals restriction/modification system diversity in the gut commensal Bifidobacterium breve. Nucleic Acids Res 46:1860–1877 11. Fischer W, Bauer W, Feigel M (1987) Analysis of the lipoteichoic-acid-like macroamphiphile from Bifidobacterium bifidum subspecies pennsylvanicum by one- and two-dimensional 1H- and 13C-NMR spectroscopy. Eur J Biochem 165:647–652 12. Brancaccio VF, Zhurina DS, Riedel CU (2013) Tough nuts to crack: site-directed mutagenesis of bifidobacteria remains a challenge. Bioengineered 4:197–202 13. Foroni E, Turroni F, Guglielmetti S et al (2012) An efficient and reproducible method for transformation of genetically recalcitrant bifidobacteria. FEMS Microbiol Lett 333:146–152 14. Rossi M, Brigidi P, Matteuzzi D (1997) An efficient transformation system for Bifidobacterium spp. Lett Appl Microbiol 24:33–36 15. Park MJ, Park MS, Ji GE (2018) Improvement of electroporation-mediated transformation efficiency for a Bifidobacterium strain to a reproducibly high level. J Microbiol Methods 159:112–119 16. O’Connell Motherway M, O’Driscoll J, Fitzgerald GF et al (2009) Overcoming the restriction barrier to plasmid transformation and targeted mutagenesis in Bifidobacterium breve UCC2003. Microb Biotechnol 2:321–332

Bifidobacterium Transformation 17. Law J, Buist G, Haandrikman A et al (1995) A system to generate chromosomal mutations in Lactococcus lactis which allows fast analysis of targeted genes. J Bacteriol 177:7011–7018 18. Yasui K, Kano Y, Tanaka K et al (2009) Improvement of bacterial transformation efficiency using plasmid artificial modification. Nucleic Acids Res 37:e3 19. Zhang G, Wang W, Deng A et al (2012) A mimicking-of-DNA-methylation-patterns pipeline for overcoming the restriction barrier of bacteria. PLoS Genet 8:e1002987 20. Dower WJ, Miller JF, Ragsdale CW (1988) High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res 16:6127–6145 21. Putman M, van Veen HW, Poolman B et al (1999) Restrictive use of detergents in the functional reconstitution of the secondary

19

multidrug transporter LmrP. Biochemistry 38:1002–1008 22. Kuipers OP, de Ruyter PGGA, Kleerebezem M et al (1998) Quorum sensing-controlled gene expression in lactic acid bacteria. J Biotechnol 64:15–21 23. McGrath S, Fitzgerald GF, van Sinderen D (2001) Improvement and optimization of two engineered phage resistance mechanisms in Lactococcus lactis. Appl Environ Microbiol 67:608–616 24. Cronin M, Knobel M, O’Connell-Motherway M et al (2007) Molecular dissection of a bifidobacterial replicon. Appl Environ Microbiol 73:7858–7866 25. Alvarez-Martin P, O’Connell-Motherway M, van Sinderen D et al (2007) Functional analysis of the pBC1 replicon from Bifidobacterium catenulatum L48. Appl Microbiol Biotechnol 76:1395–1402

Chapter 3 Isolation of Chromosomal and Plasmid DNA from Bifidobacteria Maria Esteban-Torres, Lorena Ruiz, Rocio Sanchez-Gallardo, and Douwe van Sinderen Abstract Rapid and efficient protocols aimed at the isolation and purification of DNA for the purpose of downstream applications, such as cloning, PCR, Southern blotting, or sequencing, are essential for genetic, biochemical, and molecular biological analyses of a given bacterium. The protocols herein presented provide a robust and efficient method for the isolation of chromosomal and plasmid DNA from Bifidobacterium strains by organic extraction. The methods are simple, and the yield, purity, and quality of the DNA are adequate to perform various downstream applications including next-generation sequencing. Key words Bifidobacteria, DNA purification, Cell lysis, Plasmid isolation, Whole genome sequencing

1

Introduction Bifidobacteria are gram-positive, rod-shaped, anaerobic, and saccharolytic commensals of the gastrointestinal tract of humans and other mammals, where they are considered to exert a variety of beneficial health effects [1, 2]. These positive effects include reinforcement of the host intestinal barrier, competitive exclusion of pathogens, modulation of the host immune response, (micro)nutrient supplementation, and enhancement/expansion of host metabolism [3–6]. The basic knowledge of the mechanisms by which bifidobacteria interact and communicate with other bacteria and host cells remains poorly understood. Such knowledge is essential for the scientific support for their purported health benefits, including the precise mode of action, and their rational inclusion as probiotics in functional foods. To better understand the mode of action behind their probiotic properties and their contribution to host health and wellbeing requires molecular tools based on genetic (DNA) manipulations. Isolation of purified deoxyribonucleic acid (DNA) is the key to the genetic characterisation of a biological

Douwe van Sinderen and Marco Ventura (eds.), Bifidobacteria: Methods and Protocols, Methods in Molecular Biology, vol. 2278, https://doi.org/10.1007/978-1-0716-1274-3_3, © Springer Science+Business Media, LLC, part of Springer Nature 2021

21

22

Maria Esteban-Torres et al.

entity through a variety of molecular biological approaches, such as gene cloning, strain genotyping, comparative and functional genomic analyses, among various others. For such approaches, DNA (whether genomic and/or plasmidic) needs to be separated from proteins, carbohydrates, membranes, and other cellular material [7]. The simplest cells, that is, bacterial cells, are prokaryotes comprising a cell wall, a lipid bilayer cytoplasmic membrane, and a cytoplasm typically containing a circular chromosome (some can contain also plasmids that are extrachromosomal genetic elements), proteins and other molecules [8]. The cell wall in Gram-positive bacteria is a complex envelope composed of a peptidoglycan layer forming a thick, rigid structure that also contains teichoic acids and polysaccharides. By contrast, Gram-negative cell walls contain only a thin layer of peptidoglycan, yet possess a second, outer membrane [8]. Since 1930 many methods have been developed to purify DNA from bacteria. These methods invariably involve three common steps: (1) growth of the bacterial strain, (2) harvesting and subsequent lysis (break open) of the bacterial cells, and (3) DNA purification [9]. The cleaner the final DNA preparation, the more efficient will be the enzymatic reactions that use the obtained DNA as a template or a substrate for subsequent downstream applications [10]. Lysis is a critical step, especially in the case of bifidobacteria, because the presence of a thick peptidoglycan layer, frequently in combination with a cell wall–associated polysaccharide cover, in these Gram-positive bacteria confers resistance to conventional methods of lysis, making isolation of pure DNA more difficult [11]. Enzymatic treatments including lysozyme and mutanolysin (to degrade the cell wall) has conventionally been used, in conjunction with detergents such as sodium dodecyl sulfate (SDS) (for membrane solubilisation) to ensure efficient lysis of Gram-positive cells [12, 13]. For plasmid isolation, an alkaline lysis step is performed in order to denature chromosomal DNA [14]. Another key step, the removal of proteins and RNA, can be performed simply by a treatment with proteinase K or RNase, respectively [15]. Finally, the aqueous solution containing intact (deoxyribo)nucleic acids is extracted with phenol: chloroform (organic extraction) [9]. Here, we provide robust methods for genomic and plasmid DNA isolations from bifidobacterial species based on the protocols of Anderson and McCkay [16], Birnboim and Doly [14], and O’Riordan and Fitzgerald [17]. There are commercial kits available for quick chromosomal and plasmid DNA isolations based in a DNA binding resin. However, the methods described here are cheap, simple and the yield, purity, and quality of the double-stranded DNA are adequate to perform multiple molecular purposes including nextgeneration sequencing and cloning.

Bifidobacterial DNA Isolation

2 2.1

23

Materials Solutions

2.1.1 Chromosomal DNA Isolation

Prepare all solutions using ultrapure water and analytical grade reagents and store at room temperature (RT). Carefully follow all waste disposal regulations for disposing of waste materials. 1. TSE buffer: 6.7% sucrose, 10 mM Tris, 1 mM ethylenediaminetetraacetic acid (EDTA). Filter-sterilized using 0.2 μm pore filters. 2. SDS solution: 10% sodium dodecyl sulfate (SDS; w/v) in 50 mM Tris, 20 mM EDTA, pH 8.0. 3. Sodium acetate solution: 3 M sodium acetate in water pH 5.2. Filter-sterilized using 0.2 μm pore filters. 4. TE buffer: 10 mM Tris, 1 mM EDTA, pH 8.0. Filter-sterilized using 0.2 μm pore filters.

2.1.2 Plasmid Isolation (Miniprep)

1. TEG buffer: 50 mM glucose, 25 mM Tris–HCl, 10 mM EDTA, pH 8.0 (sterilized by autoclave or filtration using 0.2 μm pore filters). 2. Alkaline SDS solution: 0.2 M NaOH, 10% SDS (w/v) in distilled water (prepare fresh every time). 3. Potassium acetate solution: 3 M sodium acetate in 11.5% glacial acetic acid, pH 4.8. Filter-sterilized using 0.2 μm pore filters. 4. TE buffer: 10 mM Tris, 1 mM EDTA, pH 8.0. Filter-sterilized using 0.2 μm pore filters.

2.2

Equipment

1. Anaerobic hood. 2. Microcentrifuge and centrifuge for 15 ml tubes. 3. Water bath. 4. Fume hood. 5. DNA electrophoresis and visualizing equipment.

3

Methods For a schematic overview of the procedure see Fig. 1.

3.1 Chromosomal DNA Isolation

1. Inoculate in a 15-ml tube, 10 ml of de Man, Rogosa, and Sharpe medium broth (MRS) [18] supplemented with cysteine-HCl (0.05% w/v) with the appropriate strain (1% v/v) and the desirable antibiotic (see Note 1). Incubate the culture overnight (or to mid-log phase) under anaerobic conditions (10% carbon dioxide, 10% hydrogen, and 80% nitrogen) in an anaerobic hood.

24

Maria Esteban-Torres et al.

Fig. 1 Overview of the protocol for the bifidobacterial (a) chromosomal and (b) plasmidic DNA isolation and purification

Bifidobacterial DNA Isolation

25

2. Harvest bacteria (2  5 ml of culture) by centrifugation at 2200  g for 5 min at 4  C (see Note 2). 3. Remove the medium gently leaving the bacterial pellet as dry as possible (see Note 3). 4. Wash the pellet with 1 ml TSE buffer, centrifuge again as before and remove the supernatant (see Note 4). 5. Resuspend the pellet in 0.5 ml TSE buffer containing lysozyme (30 mg/ml) and transfer the suspension to a 1.5 ml tube (see Note 5). Make sure no clumps are left. 6. Incubate at 37  C for 30 min in a water bath. 7. Add 20 μl of proteinase K (20 mg/ml in 10 mM Tris, pH 8.0) and mix by inversion (six times). 8. Add 25 μl of 10% SDS and mix thoroughly by inversion (six times). 9. Incubate at 60  C in a water bath for at least 1 h to complete the lysis (solution should typically become clear and viscous, though this does not always have to be the case). 10. Add 500 μl of phenol–chloroform (1:1 v/v) pH 8.0 (see Note 6). Thoroughly mix the organic and aqueous phase by vortexing for 30–60 s. 11. Centrifuge the emulsion for 10 min at maximum speed in a microfuge at RT. 12. Transfer the upper phase (aqueous phase) to a clean tube while ensuring that the organic interphase (white) is not disturbed. 13. Repeat steps 10–12 twice. 14. Precipitate DNA from the supernatant by adding 50 μl (1/10 volumes) of 3 M sodium acetate pH 5.2 and 500 μl of isopropanol (1 volume), mix gently by inversion until the DNA (whitish) is visible (see Note 7). 15. Collect the precipitated DNA by centrifugation for 15 min at maximum speed in a microfuge at 4  C. 16. Discard the supernatant gently and thoroughly as described in step 3. A pipette can be used though care should be taken to not touching the pellet. 17. Wash the pellet by adding 0.5 ml of 70% ethanol ( 20  C). 18. Recover the DNA by centrifugation at maximum speed for 5 min in a microfuge at RT. 19. Discard the ethanol thoroughly. 20. Air-dry the pellet storing the open tube at RT until the ethanol has evaporated (10–15 min) (see Note 8). 21. Dissolve the DNA in 50–100 μl of TE buffer. An incubation at 50  C for 15 min can help to dissolve the DNA (see Note 9).

26

Maria Esteban-Torres et al.

Fig. 2 Agarose analysis of the (a) chromosomal DNA isolation from several strains of Bifidobacterium. Line 1, 5 μl of molecular ladder 1 kb (Bioline); lines 2–6, 5 μl of chromosomal DNA isolated from Bifidobacterium breve UCC2003 (2), Bifidobacterium kashiwanohense APCKJ1 (3), Bifidobacterium pseudocatenulatum DSM 20438 (4), Bifidobacterium pseudocatenulatum NCIMB 8811 (5), Bifidobacterium stellenboschense DSM 23968 (6), 0.7% agarose in 1 TAE stained with SYBR Safe

22. To eliminate RNA, treat the DNA solution by the addition of 5 μl DNase-free RNase A (10 mg/ml) followed by incubation at 37  C for 30 min (see Note 10). 23. Analyse 3–5 μl of DNA by agarose gel electrophoresis (0.7% w/v) (see Note 11) (see Fig. 2). 24. Keep the DNA frozen at 3.2 Plasmid DNA Isolation (Miniprep)

20  C for further analysis.

The preparation of the cells is the same as for chromosomal DNA (see steps 1–3, Subheading 3.1). 1. Wash the pellet with 1 ml TEG buffer, centrifuge again as before and remove the supernatant (see Note 4). 2. Resuspend the pellet in 200 μl TEG buffer supplemented with lysozyme just before use (30 mg/ml) and transfer the suspension to a 1.5 ml tube. Make sure no clumps are left. 3. Incubate at 37  C for 30 min in a water bath. 4. Add 400 μl of alkaline SDS solution and mix well but gently (invert the tube six times) (see Note 12). Incubate on ice for 10 min. 5. Add 300 μl of cold 3 M potassium acetate pH 4.8 and mix gently (invert the tube six times) until a white precipitate is formed.

Bifidobacterial DNA Isolation

27

6. Centrifuge 5 min at 12,000  g at 4  C. 7. Collect the supernatant (700–800 μl) with a 1 ml micropipette into a new 1.5 ml tube. 8. Add 700 μl of phenol–chloroform (1:1 v/v) pH 8.0 commercial solution (see Note 6). Mix the organic and aqueous phase very well by vortexing for 30–60 s. 9. Centrifuge the emulsion for 10 min at maximum speed in a microfuge at RT. 10. Transfer the upper phase (aqueous phase, 500–700 μl approx.) with a 1 ml micropipette to a clean 1.5 ml tube. Do not carry over the white inter-phase that contains mostly proteins, even if this means that some of the aqueous phase is left behind. 11. Repeat steps 8–10. 12. Collect the water-upper phase with a micropipette and try to avoid contamination with the lower phase. 13. Precipitate DNA by adding 1 ml 96% ethanol ( 20  C) and mix gently by inversion until the DNA (white) is visible (see Note 7). 14. Collect the precipitated DNA by centrifugation for 10 min at maximum speed in a microfuge at RT. Place the cups in a known orientation to remember the position of the pellet because the pellet is sometimes hardly visible. 15. Discard the supernatant with a micropipette and take care not to touch the pellet. 16. Wash the pellet by adding 1 ml of 70% ethanol ( 20  C). Mix carefully by inverting the tube six times. 17. Recover the DNA by centrifugation at maximum speed for 5 min in a microfuge at RT. 18. Discard all the ethanol thoroughly with a micropipette while care should be taken to not disturb the sometimes transparent pellet. 19. Air-dry the pellet storing the open tube at RT until the ethanol has evaporated (10–15 min) (see Note 8). 20. Dissolve the DNA in 25 μl of TE buffer. 21. To eliminate the RNA, treat the DNA with 1 μl DNase-free RNase A (10 mg/ml) at 37  C for 30 min (see Note 10). 22. Analyse 3–5 μl of DNA by agarose gel electrophoresis (0.7% w/v) (see Note 11). 23. The DNA can be stored at

20  C.

28

4

Maria Esteban-Torres et al.

Notes 1. A single colony of a given bifidobacterial strain can be inoculated. 2. For those strains producing extracellular polysaccharide (EPS) abundantly, the centrifugation should be performed at higher speed, such as 15,000  g to obtain a firm cell pellet. 3. The supernatant can be removed by pipetting, avoiding to touch the bacterial pellet. 4. The cell-wall components in the medium inhibit the action of many restriction enzymes. To avoid this problem, the bacterial pellet is resuspended in TES buffer and centrifuged again. Optionally, the process can be stopped at this step and the pellet can be kept at 20  C. 5. The lysozyme is added just before use. If the specific strain is difficult to lyse, mutanolysin can be added to the lysis solution (0.5 units). Furthermore, the detergent cetyltrimethylammonium bromide (CTAB) can be used for the lysis of those strains producing a lot of polysaccharide. 6. Phenol–chloroform–isoamyl alcohol (25:24:1 v/v/v) pH 8.0 can be used. The commercial phenol solutions are saturated with Tris–HCl which form a water phase on top of the solution. Pipette through the upper layer to get access to the phenol. Work in a fume hood when phenol is used. 7. An incubation at 80  C for 1 h helps to precipitate the DNA and improves the yield. 8. Drying the pellet for 10–15 min at RT is usually sufficient for the ethanol to evaporate without the DNA becoming dehydrated, do not over dry. Be extra careful with this step because the pellet sometimes is not adhered tightly to the tube. 9. If the DNA is highly concentrated (viscous) add more TE to help for dissolving it. 10. Depending on the applications, the RNase step can be done before adding the phenol–chloroform solution to avoid the presence of any protein in the final preparation of DNA. 11. These are standard methods which have been demonstrated to be robust and adequate for a high number of bifidobacterial strains, however, specific applications or strains can require additional modifications of the protocols to obtain highquality DNA preparations. For plasmid isolation, the yield also depends of the size and copy number of the plasmid. Following these protocols the average amount of bifidobacterial chromosomal DNA is 100 μg and 10–30 μg of a plasmid from 5 ml of bacterial culture. 12. Do not mix too much to prevent contamination of chromosomal DNA.

Bifidobacterial DNA Isolation

29

References 1. Turroni F, Milani C, Duranti S, Ferrario C, Lugli GA, Mancabelli L, van Sinderen D, Ventura M (2018) Bifidobacteria and the infant gut: an example of co-evolution and natural selection. Cell Mol Life Sci 75:103–118 2. Tojo R, Tojo R, Sua´rez A, Clemente MG, de los Reyes-Gavila´n CG, Margolles A, Gueimonde M, Ruas-Madiedo P (2014) Intestinal microbiota in health and disease: role of bifidobacteria in gut homeostasis. World J Gastroenterol 20:15163–15176 3. Bottacini F, Morrissey R, Esteban-Torres M, James K, van Breen J, Dikareva E, Egan M, Lambert J, van Limpt K, Knol J, O’Connell Motherway M, van Sinderen D (2018) Comparative genomics and genotype-phenotype associations in Bifidobacterium breve. Sci Rep 8:10633 4. Ventura M, Turroni F, Motherway MO, MacSharry J, van Sinderen D (2012) Hostmicrobe interactions that facilitate gut colonization by commensal bifidobacteria. Trends Microbiol 20:467–476 5. Round JL, Mazmanian SK (2009) The gut microbiota shapes intestinal immune responses during health and disease. Nat Rev Immunol 9:313–323 6. Sanchı´s-Chorda` J, Del Pulgar EMG, Carrasco˜ erLuna J, Benı´tez-Pa´ez A, Sanz Y, Codon Franch P (2018) Bifidobacterium pseudocatenulatum CECT 7765 supplementation improves inflammatory status in insulinresistant obese children. Eur J Nutr 58:2789–2800 7. Dahm R (2008) Discovering DNA: Friedrich Miescher and the early years of nucleic acid research. Hum Genet 122:565–581 8. Salton MRJ, Kim KS (1996) Structure. In: Baron S (ed) Medical microbiology, 4th edn. University of Texas, Galveston (TX)

9. Sambrook J, Russell DW (2001) Molecular cloning: a laboratory manual. In: vol 1, 3rd edn. Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York 10. Green MR, Sambrook J (2018) From the molecular cloning collection. Cold Spring Harb Protoc, New York 11. Monsen TJ, Holm SE, Burman LG (1983) A general method for cell lysis and preparation of deoxyribonucleic acid from streptococci. FEMS Microbiol Lett 16:19–24 12. Chassy BM, Giuffrida A (1980) Method for the lysis of gram-positive, asporogenous bacteria with lysozyme. Appl Environ Microbiol 39:153–158 13. Klaenhammer TR (1984) A general method for plasmid isolation in lactobacilli. Curr Microbiol 10:23–28 14. Birnboim HC, Doly J (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res 7:1513–1523 15. Hilz H, Wiegers U, Adamietz P (1975) Stimulation of proteinase K action by denaturing agents: application to the isolation of nucleic acids and the degradation of “masked” proteins. Eur J Biochem 56:103–108 16. Anderson DG, McKay LL (1983) Simple and rapid method for isolating large plasmid DNA from lactic streptococci. Appl Environ Microbiol 46:549–552 17. O’Riordan K, Fitzgerald GF (1999) Molecular characterisation of a 5.75-kb cryptic plasmid from Bifidobacterium breve NCFB 2258 and determination of mode of replication. FEMS Microbiol Lett 174:285–294 18. De Man JC, Rogosa A, Sharpe ME (1960) A medium for the cultivation of lactobacilli. J Appl Bacteriol 23:130–135

Chapter 4 Assembly, Annotation, and Comparative Analysis of Bifidobacterial Genomes Gabriele Andrea Lugli Abstract Genome assembly and annotation are two of the key actions that must be undertaken in order to explore the genomic repertoire of (bifido)bacteria. The gathered information can be employed to genomically characterize a given microorganism, and can also be used to perform comparative genome analysis by including other sequenced (bifido)bacterial strains. Here, we highlight various bioinformatic programs able to manage next generation sequencing data starting from the assembly of a genome to the comparative analyses between strains. Key words Bifidobacterium, Next generation sequencing, Genomics, Pangenome, Phylogenetics

1

Introduction The genome sequencing era, which commenced in the late 1990s of the twentieth century, gave birth to whole-genome random sequencing, also called shotgun sequencing, which is an efficient strategy allowing for the reconstruction of the complete genomic content of a given microorganism [1]. Recent technological developments, referred to as Next Generation Sequencing (NGS) technologies, do now generate enormous amounts of DNA sequencing data [2]. Thus, acquisition of microbial genome sequences, such as those of members of the genus Bifidobacterium, is within everyone’s reach [3, 4]. The outputs of NGS methodology provide crucial insights into the genomic repertoire of (bifido)bacteria in order to decipher the genetic blueprint of organisms using several bioinformatic tools for the management of in silico data [5–7]. To date (July 2020) more than 1100 bifidobacterial genomes have been decoded and their sequences can be retrieved form online repositories such as the National Center for Biotechnology Information (NCBI). Thus, it is crucial to understand how these chromosomal sequences are produced and how to take advantage of all the information stored in public online databases.

Douwe van Sinderen and Marco Ventura (eds.), Bifidobacteria: Methods and Protocols, Methods in Molecular Biology, vol. 2278, https://doi.org/10.1007/978-1-0716-1274-3_4, © Springer Science+Business Media, LLC, part of Springer Nature 2021

31

32

Gabriele Andrea Lugli

Here, we describe a complete pipeline, starting from the sequencing of a bifidobacterial genome, followed by in silico assembly of sequence reads, the prediction of coding regions among the genome and subsequent functional prediction. Then, using the genomic repertoire of multiple bifidobacterial genomes, we describe comparative analyses such as the pangenome reconstruction, evaluation of genetic similarities between species, and design of a core gene-based phylogenetic tree.

2

Materials Once the genomic DNA of a bifidobacterial strain has been extracted following the procedure described in Chapter 3, it will be subjected to DNA sequencing following a specific procedure to achieve next generation sequencing (NGS), which will not be covered in this chapter as this will depend on the particular NGS technology used (e.g., Illumina, PacBio, NanoPore, Ion Torrent). The following protocols assume that sequencing has been performed by generating paired-end reads using an Illumina platform (see Note 1). All bioinformatic tools and pipelines mentioned in this chapter are intended for use in a Linux environment. Described programs have been tested using the Linux distribution Ubuntu 18.04 long-term support (LTS) release (Bionic Beaver). Those programs for which no example of syntax has been reported are provided with a graphical interface that can also be used in Windows distributions.

2.1 DNA Quality Filtering

1. fastq-mcf v1.04.636 (https://github.com/ExpressionAnalysis/ ea-utils) is a command-line tool for processing biological sequencing data.

2.2 Genome Assembly

1. SPAdes v3.14.0 [8] is an assembler toolkit which contains various assembly pipelines and which works with Illumina and IonTorrent sequencing data, also capable of hybrid assemblies using PacBio.

2.3 Genome Contig Reordering

1. Multiple Alignment of Conserved Genomic Sequence with Rearrangements (MAUVE) [9] is a system for constructing multiple genome alignments.

2.4

1. Prokaryotic Dynamic Programming Gene finder Algorithm (Prodigal) v2.6.1 [10] is a gene-finding program for genome annotation of microbial sequences.

Gene Prediction

2. tRNAscan-SE v1.4 [11] is a gene-finding program which can identify tRNA genes in genomic sequences. 3. Rnammer v1.2 [12] is a gene-finding program which can find rRNA genes in genomic sequences.

Assembly, Annotation, and Comparative Analysis of Bifidobacterial Genomes

2.5

Gene Annotation

33

1. National Center for Biotechnology Information (NCBI) RefSeq database [13] is a comprehensive nonredundant set of genomic sequences. 2. Reduced Alphabet based Protein similarity Search (RAPSearch2) [14] is a tool for rapid protein similarity search. 3. Pfam-A database [15] is a large collection of protein families that represent multiple sequence alignments and hidden Markov models (HMMs). 4. HMMER v3.2.1 [16] is a tool for searching sequence homologs using probabilistic models based on HMMs.

2.6 Genome Visualization

1. Artemis [17] is a genome browser and annotation tool that allows visualization of a genome sequence and associated features.

2.7 Bifidobacterial Pangenome and Core Genome

1. Pan-Genome Analysis Pipeline (PGAP) [18] is a tool for cluster analysis of functional genes, pangenome profiles, and evolution analysis. 2. Basic Local Alignment Search Tool (BLAST) [19] is a tool that finds regions of local similarity between nucleotide and amino acid sequences. 3. MCL algorithm [20] is a graph-theory-based Markov clustering algorithm.

2.8 Functional Analyses

1. The EggNOG database [21] allows functional annotation of orthologous groups using abovementioned bioinformatic tools, such as BLAST and RAPSearch2. 2. CAZy database [22] encompasses genes encoding enzymes that possess structurally related catalytic and carbohydratebinding modules catalyzing hydrolysis, modification, or synthesis of glycoside bounds. Interrogating the database by means of specific bioinformatic tools, it will provide information about analyzed gene functions pertaining to carbohydrates, such as glycoside hydrolases and glycosyl transferases. 3. MetaCyc database [23] encompasses pathways involved in both primary and secondary metabolism. Interrogating the database by means of specific bioinformatic tools, it will provide information about which enzymes are involved in metabolic pathways.

2.9 Whole-Genome Analysis

1. JSpecies v1.2.1 [24] is a tool to measure the probability of two genomes belonging to the same species. 2. MUMmer v3.0 [25] is a system for aligning entire genomes in complete or draft form.

34

Gabriele Andrea Lugli

2.10 Bifidobacterial Phylogenomic

1. MAFFT v7 [26] is a multiple sequence alignment program. 2. ClustalW v2.1 [27] is a DNA or protein multiple sequence aligner program. 3. FigTree v1.4.4 (http://tree.bio.ed.ac.uk/software/figtree/) is a graphical viewer to allow the visual display of phylogenetic trees.

3

Methods Figure 1 provides a schematic representation of the procedure, starting from the DNA sequencing of the bacterial genome to the comparative analyses performed among predicted genetic repertoire of the reconstructed (bifido)bacterial chromosomes.

3.1 DNA Quality Filtering

To improve quality of the sequenced paired-end reads, a filtering step is typically implemented in order to remove low quality reads employing fastq-mcf script (https://github.com/ ExpressionAnalysis/ea-utils) (see Note 2). Using paired-end fastq files as input, option “-q” will set the quality threshold causing base removal, while option “-w” the widow size for quality trimming.

Fig. 1 Workflow for assembly, annotation, and comparative analysis of bifidobacterial genomes

Assembly, Annotation, and Comparative Analysis of Bifidobacterial Genomes

35

Option “-l” allows setting of the minimum remaining sequence length, while output file can be set using the option “-o”. Specifying “n/a” will turn off adapter clipping. Example of syntax: fastq-mcf -k 0 --qual-mean 20 -w 5 -q 20 -l 150 n/a - o

- o

3.2 Genome Assembly

In order to perform assembly of sequence reads, we suggest the use of the open source sequence assembler program SPAdes v3.14.0 [8]. Fastq files obtained from the genomic DNA sequencing procedure are used as input material in order to perform a de novo assembly. Pipeline option “--careful” is strongly recommended to be used for the assembly of small genomes like bifidobacteria to reduce the number of mismatches and short indels. The collection of sequence reads obtained from the NGS instrument is recognized by the program using option “-1” specifying the forward reads file name and “-2” for the reverse reads file. Advanced option “-t” set up the number of threads used by SPAdes, while option “-m” represents the memory limit in Gb. The crucial advanced option to declare is represented by the list of comma-separated k-mer size “-k”. All k-mer size values must represent odd numbers, be less than 128 and listed in ascending order, for example, for Illumina MiSeq data of 2  250 nt reads we suggest 21,33,55,77,99,127. Finally, the output directory must be specified with the basic option “-o”. The resulting output will be a multifasta file containing the assembled consensus nucleotide sequences of the reconstructed (bifido)bacterial chromosome, also called contigs (see Note 3). Example of syntax: spades.py -t 64 --disable-gzip-output -m 200 -k 21,33,55,77,99,127 -careful -1 -2 -o

3.3 Genome Contig Reordering

Obtained contig sequences obtained following de novo SPAdes assembly are ordered based on their sequence length. Thus, to retrieve the correct position relative to the intact (bifdo)bacterial chromosome it is necessary to order contigs (see Note 4). This step can be executed when a complete genome of the same (bifido)bacterial species is available in a public repository such as the NCBI genome database. To order contigs, the command-line interface of Multiple Alignment of Conserved Genomic Sequence with Rearrangements (MAUVE) is employed [9]. The contig mover support operation through the Mauve Java JAR file, invoking the reorder package reordeorg.gel.mauve.contigs.ContigOrderer. The reference genome file is recognized by the program using option “-ref” including a file in fasta or genbank format, while draft

36

Gabriele Andrea Lugli

genome sequences obtained from SPAdes assembly are assigned accordingly using “-draft” option. Finally, the output directory must be specified with the basic option “-output”. Example of syntax: java -Xmx4g -cp Mauve.jar org.gel.mauve.contigs.ContigOrderer output -ref -draft

3.4

Gene Prediction

To obtain insights into the coding capacity of the sequenced (bifido)bacterial genome, gene-finding programs are used. The Prokaryotic Dynamic Programming Genefinder Algorithm (Prodigal) v2.6.3 [10] allows the prediction of Open Reading Frames (ORFs) across the bifidobacterial chromosomal sequence. Using the nucleotide multifasta file of the assembled contigs as input file “-i”, Prodigal predicts translation initiation sites resulting in amino acid sequences “-a”. To collect the position of each predicted gene the “-f” option can be set as “gff” specifying the output file with the basic option “-o” (see Note 5). Example of syntax: prodigal.linux -f gff -a -i -o

Transfer RNA genes are identified using tRNAscan-SE v1.4 [11]. Using the nucleotide sequence of the reconstructed genomes, the program generates a tabular output file “-o” with position and type of each predicted tRNA gene. Example of syntax: tRNAscan-SE -B -o

Ribosomal RNA genes are detected using Rnammer v1.2 [12]. Using the nucleotide sequence of the reconstructed genomes the program predicts 5S, 16S and 23S ribosomal RNA employing the option “-m tsu,ssu,lsu”. Prediction of bacterial rRNA must be specified using the option “-S bac”, while a tabular output will be generated using the basic option “-gff”. Example of syntax: rnammer -S bac -m tsu,ssu,lsu -gff

3.5

Gene Annotation

Amino acid sequences of protein-coding genes can be used to infer a functional annotation retrieved from public databases (see Note 6). The Reduced Alphabet based Protein similarity Search (RAPSearch2) supports multithreading searches against amino acid databases [14]. The most used and updated databases are managed by the National Center for Biotechnology Information (NCBI), that is, nr and RefSeq that can be downloaded from the ftp sites of

Assembly, Annotation, and Comparative Analysis of Bifidobacterial Genomes

37

NCBI (ftp://ftp.ncbi.nlm.nih.gov/blast/db/ and ftp://ftp.ncbi. nlm.nih.gov/refseq/release/bacteria/) [13]. The program prerapsearch prepares an index file “-n” for the database search employed by RAPSearch2 using as input “-d” the downloaded nr or RefSeq file. Then, using as a query “-q” the collected amino acid sequences obtained through Prodigal-mediated ORF prediction, it is possible to perform the gene search using RAPSearch2 against the indexed database “-d”. In the output file “-o” we retrieve the orthologous genes of each (bifido)bacterial gene used as query together with its functional prediction as tabular file. Each subject is collected based on the highest sequence identity obtained in the gene search against the database. To discard distant homologs, an e-value based cutoff can be set up using the option “-e”, and a minimum alignment length with option “-l”. In order to declare the number of subjects to be reported in the tabular output file for each query, state the advanced options “-b” and “-v”. To perform a fast gene search, it is recommended to run the program on a multithreaded server and declare the dedicated number of cores using the advanced option “-z”. Example of syntax: wget ftp://ftp.ncbi.nlm.nih.gov/blast/db/FASTA/ nr.gz prerapsearch -f T -d -n rapsearch -q -d -o -s f -e 1e-5 -l 20 -z 60 -b 10 -v 10

Further gene search analyses can be performed together with RAPSearch2, using probabilistic models called profile hidden Markov models (profile HMMs). HMMER v3.2.1 is employed for making sequence alignments to a database composed by collection of protein families [16]. It is recommended to select the preformatted Pfam-A database available online at the Pfam ftp site (ftp:// ftp.ebi.ac.uk/pub/databases/Pfam/releases/) [15]. Then, using as input the collected amino acid sequences obtained through Prodigal-mediated ORF prediction, it is possible to perform protein family search using hmmscan against the Pfam-A database. The output file “--tblout” collects identified protein families of each (bifido)bacterial gene used as query as tabular file. In order to discard distant homologs, an e-value based cutoff can be set up using the option “-E”. To perform a fast gene search it is recommended to run the program on a multithreaded server and declare the dedicated number of cores using the advanced option “-z”. Example of syntax: hmmscan --cpu 60 -E 1e-10 --tblout -o

38

Gabriele Andrea Lugli

3.6 Genome Visualization

Collected data (see Subheadings 3.4 and 3.5) can be visualized using a bioinformatic tool able to manage genomic information such as Artemis [17]. The program can be used for manual editing purposes aimed at verifying and redefining the start of each predicted coding region, and to remove or add coding regions. The genome visualizer uses an interface in which features are arranged across the whole genome sequence, that is, predicted ORFs, tRNA, and rRNA by means of Prodigal, tRNAscan-SE, and Rnammer, respectively. Coding region features are enriched by the predicted functional annotation retrieved from homology searches performed by RAPSearch2 and the protein family search using hmmscan. Across menu is possible to download the amino acid and nucleotide sequence of all ORFs to perform comparative genomic analyses employing other (bifido)bacterial strains.

3.7 Bifidobacterial Pan-Genome and Core Genome

The availability of the genetic content of multiple strains within the Bifidobacterium genus allows pan-genome analysis, representing the entire set of genes contained by all members of the genus [28]. The pangenome calculation is managed by the use of the PGAP pipeline [18]. The ORF contents from all bifidobacterial genomes are organized in functional clusters using the GF (Gene Family) method involving comparison of each protein to all other proteins using BLAST [19]. Then, using MCL (graph-theorybased Markov clustering algorithm) [20], clustering of protein families is performed, resulting in specific clusters of orthologous groups (COGs) “--cluster”. Optimum cutoff values for the sequence comparison are 50% of identity “--identity” over at least 80% of both protein sequences “--coverage”. Finally, a pangenome profile is built using an algorithm incorporated in the PGAP software “--pangenome”, based on a presence/absence matrix of identified COGs between analyzed genomes. Following this approach, unique protein families for each genome are classified as truly unique genes (TUGs), while protein families shared between all genomes are named core gene. PGAP is also a multithreaded program that can be executed using the advanced option “-thread”. Example of syntax: PGAP.pl

--strains

--input

--output --thread 60 --identity 0.5 --coverage 0.8 --cluster --pangenome --evolution -method GF

3.8 Functional Analyses

Using the predicted genes obtained by means of Prodigal (see Subheading 3.4), many functional analyses can be performed employing different databases of classified proteins. Here, we report three of the most used databases related to the functional classification of microbial genes. The eggNOG database can be

Assembly, Annotation, and Comparative Analysis of Bifidobacterial Genomes

39

used to facilitate the functional annotation of orthologous groups, providing a broader classification based on 25 general categories [21]. The CAZy database can be employed for the prediction of genes encoding enzymes that possess structurally related catalytic and carbohydrate-binding modules responsible for the hydrolysis, modification or synthesis of glycoside bounds [22]. The MetaCyc metabolic pathways database allows for surveys of complete pathways involved in both primary and secondary metabolism [23]. To perform these analyses on a dedicated server, these three databases or any other database, can be downloaded and indexed using makeblastdb. Using the basic option “-in” any sequences’ collection can be used to produce a database with option “-out”. The advanced option “-dbtype” has to be used to specify if the sequences are in nucleotide or amino acid format. Then, gene searches are performed by means of BLASTp declaring genes to analyze with the basic option “-query” and the indexed databased by makeblastdb with option “-db”. Using advanced option “-evalue” a cutoff can be set specifying to ignore low quality alignments, while the option “-max_target_seqs” reports a finite number of hits retrieved from the database. Finally, the advanced option “-outfmt” can be used to obtain a tabular file as output file, specifying the required statistics as reported in the example below. Example of syntax: makeblastdb -in -dbtype prot -out blastp -query -db -evalue 1e-5 max_target_seqs 1 -num_threads 60 -outfmt "6 qseqid sseqid pident length mismatch gapopen qstart qend sstart send evalue stitle" -out

3.9 Whole-Genome Analysis

Average nucleotide identity (ANI) indicates the genetic relatedness among prokaryotic strains. Validation of the methodologies found that ANI values around 95% correspond to a DNA-DNA hybridization of 70% [29]. ANI values between chromosomal sequences of bifidobacterial pairs can easily be calculated using the program JSpecies, v1.2.1 [24]. JSpecies can be used to generate ANI calculations based on BLAST and MUMmer software packages [25]. Based on previous studies that focused on the investigation among the genus Bifidobacterium [5–7], it is recommended to use values relying on ANIm calculation (see Note 7). First of all, select from the menu “Edit” and then “Preferences” to browse the path of Nucmer and related blast programs. After this configuration, select from the menu “File” and then “New” to create a group in which to include nucleotide genome sequences of bifidobacterial strains to be analyzed. Sequences can be imported online from NCBI using the option “Import FASTA(S) from WWW” or manually with the option “Import FASTA(S) from File(S)”. To perform the ANIm analysis select from the menu “Calculation” and from

40

Gabriele Andrea Lugli

the drop-down menu “Average Nucleotide Identity (Nucmer)”. From the new windows, select all strain pairs and click on the start button. When on the left corner the progression label indicates “Ready,” select from the menu “Result” and then “Show” to explore the results. 3.10 Bifidobacterial Phylogenomic

The assembled chromosome for each genome can be used to infer phylogeny within the genus Bifidobacterium through the use of genomic-based data. In this context, we use the amino acid sequences of genes shared between all genomes identified between COGs (see Subheading 3.7) by means of PGAP (see Note 8), also known as core genes. The concatenated core genome sequence of each bifidobacterial genome is aligned using the multiple alignment program for amino acid or nucleotide sequences MAFFT v7 [26]. The option “--clustalout” will produce an output file formatted for ClustalW, version 2.1 [27] (see Note 9). MAFFT is also a multithreaded program that can be executed using the advanced option “--thread”. Example of syntax: mafft --thread 60 --retree 2 --clustalout --reorder >

Once run clustalw on a terminal, select option “4. Phylogenetic trees” to enable the phylogenetic tree menu. Then select “1. Input an alignment” option and insert the name of the aligned file obtained through MAFFT. ClustalW will generate a Phylip format tree, to select additional output files select “6. Output format options”. To visualize the bootstrap labels at nodes, set Phylip boostrap position at “NODE LABELS”. Then, press return to exit and select “5. Bootstrap tree” option followed by multiple enter to accept the default options, including the number of bootstrap iterations to be perform. The output files can be open in programs for viewing trees such as FigTree v1.4.4 (http://tree. bio.ed.ac.uk/software/figtree/). In FigTree selecting from the menu “File” and then “Open,” it will open a search menu to select the output file of ClustalW. To show the bootstrap values on the nodes, check in the left menu “Node Labels” option and then, in the drop-down menu “Display” select “label.” Now the supertree with the related bootstrap can be exported by selecting from the menu “File” and then “Export Graphic.” To import the tree in PowerPoint, it is suggested to export the file as a Windows Enhanced Metafile.

Assembly, Annotation, and Comparative Analysis of Bifidobacterial Genomes

4

41

Notes 1. In this book chapter, we have reported how to manage Illumina paired-end reads since it is the most common and convenient strategy to obtain and analyze the genetic content of a sequenced (bifido)bacterial genome. Nonetheless, based on the final application of the sequenced microbial genomes, knowledge of all gene sequences may not be enough. To obtain a complete genome sequence without gaps between contigs using a de novo assembly, other NGS technologies may have to be applied such as PacBio. For example, a hybrid sequencing strategy employing Illumina and PacBio will close gaps between contigs, while Illumina will give the adequate coverage for the base calling. 2. To check the quality of the obtained paired-end reads, the program FastQC can be employed (https://www.bioinformat ics.babraham.ac.uk/projects/fastqc/). 3. SPAdes assembler results in a multifasta file with contig sequences ranging from the longest to the shortest. It is suggested to only use assembled contigs over 1000 nucleotides in length, since shorter contigs are more likely to contain sequencing errors and are not informative for further genomic analysis described in this chapter. 4. In order to avoid errors when using multifasta files in Unix and Windows environments, it is recommended to employ only one-line sequences. Using multifasta files with sequences formatted in single rows allows easy management of sequences employing Unix-like commands such as grep and the import of files as spreadsheet in Microsoft Excel. 5. Functional annotation of each gene is a crucial step. Since many sequences have been deposited in an online repository without manual curation, many false positive can misrepresent the actual function of the annotated gene. Thus, it is recommended to use manually curated databases for the functional annotation of genes, followed, where possible, by the comparison of multiple hits to avoid the assumption of erroneous annotations. 6. To date, several pipelines can be employed to perform genome assembly and subsequent gene annotation (see Subheadings 3.2–3.5). One of these tools is the bioinformatics suite MEGAnnotator, which can also be downloaded as a ready-to-use virtual box to facilitate the execution of the abovementioned programs for the assembly of the raw reads, the prediction and annotation of genes [30].

42

Gabriele Andrea Lugli

7. In recent articles aimed to explore the genetic relatedness among bifidobacterial species a cutoff value of 94% has been identified based on ANIm calculation as a level of identify below which to declare an new isolate as a novel species of the genus Bifidobacterium [5–7]. Using this methodology 12 novel bifidobacterial species have been characterized and approved by the International Committee on Systematics of Prokaryotes [31–33]. 8. During the selection of the core genome obtained from PGAP analysis, several COGs will be present in multiple copy in the same microbial genome, also called paralogs. To obtain a robust supertree you may choose to discard those COGs that show paralogs or to select only a single gene sequence among them. Since using a hundred genes is enough for a robust supertree reconstruction, it is recommended to discard paralogs in order to use only the core genome that displays a single copy of the selected COGs in each genome. This strategy has been already applied to describe several bifidobacterial species [34–37]. 9. In order to generate a robust supertree, it is necessary to select an outgroup sequence before the MAFFT alignment. It is suggested to use an ancestor of the analyzed microorganism. For example, performing a supertree of the whole genus, we suggest the usage of gene sequences of a member of the Bifidobacteriaceae family [5, 38]. Thus, in Figtree, select the output branch and then chose “Reroot” from the upper menu. Doing that, the phylogenetic tree will be based on the ancestral lineage represented by the root, while tips of the branches represent the descendants of the ancestor. References 1. Fleischmann RD, Adams MD, White O, Clayton RA, Kirkness EF, Kerlavage AR, Bult CJ, Tomb JF, Dougherty BA, Merrick JM et al (1995) Whole-genome random sequencing and assembly of Haemophilus influenzae Rd. Science 269:496–512 2. Slatko BE, Gardner AF, Ausubel FM (2018) Overview of next-generation sequencing technologies. Curr Protoc Mol Biol 122:e59 3. Turroni F, Milani C, Duranti S, Ferrario C, Lugli GA, Mancabelli L, van Sinderen D, Ventura M (2018) Bifidobacteria and the infant gut: an example of co-evolution and natural selection. Cell Mol Life Sci 75:103–118 4. Milani C, Duranti S, Bottacini F, Casey E, Turroni F, Mahony J, Belzer C, Delgado Palacio S, Arboleya Montes S, Mancabelli L, Lugli GA, Rodriguez JM, Bode L, de Vos W,

Gueimonde M, Margolles A, van Sinderen D, Ventura M (2017) The first microbial colonizers of the human gut: composition, activities, and health implications of the infant gut microbiota. Microbiol Mol Biol Rev 81:e00036-17 5. Lugli GA, Milani C, Duranti S, Mancabelli L, Mangifesta M, Turroni F, Viappiani A, van Sinderen D, Ventura M (2018) Tracking the taxonomy of the genus Bifidobacterium based on a Phylogenomic approach. Appl Environ Microbiol 84:e02249-17 6. Lugli GA, Milani C, Turroni F, Duranti S, Mancabelli L, Mangifesta M, Ferrario C, Modesto M, Mattarelli P, Jiri K, van Sinderen D, Ventura M (2017) Comparative genomic and phylogenomic analyses of the Bifidobacteriaceae family. BMC Genomics 18:568

Assembly, Annotation, and Comparative Analysis of Bifidobacterial Genomes 7. Lugli GA, Milani C, Turroni F, Duranti S, Ferrario C, Viappiani A, Mancabelli L, Mangifesta M, Taminiau B, Delcenserie V, van Sinderen D, Ventura M (2014) Investigation of the evolutionary development of the genus Bifidobacterium by comparative genomics. Appl Environ Microbiol 80:6383–6394 8. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD, Pyshkin AV, Sirotkin AV, Vyahhi N, Tesler G, Alekseyev MA, Pevzner PA (2012) SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol 19:455–477 9. Darling AC, Mau B, Blattner FR, Perna NT (2004) Mauve: multiple alignment of conserved genomic sequence with rearrangements. Genome Res 14:1394–1403 10. Hyatt D, Chen GL, Locascio PF, Land ML, Larimer FW, Hauser LJ (2010) Prodigal: prokaryotic gene recognition and translation initiation site identification. BMC Bioinformatics 11:119 11. Lowe TM, Eddy SR (1997) tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 25:955–964 12. Lagesen K, Hallin P, Rodland EA, Staerfeldt HH, Rognes T, Ussery DW (2007) RNAmmer: consistent and rapid annotation of ribosomal RNA genes. Nucleic Acids Res 35:3100–3108 13. O’Leary NA, Wright MW, Brister JR, Ciufo S, Haddad D, McVeigh R, Rajput B, Robbertse B, Smith-White B, Ako-Adjei D, Astashyn A, Badretdin A, Bao Y, Blinkova O, Brover V, Chetvernin V, Choi J, Cox E, Ermolaeva O, Farrell CM, Goldfarb T, Gupta T, Haft D, Hatcher E, Hlavina W, Joardar VS, Kodali VK, Li W, Maglott D, Masterson P, McGarvey KM, Murphy MR, O’Neill K, Pujar S, Rangwala SH, Rausch D, Riddick LD, Schoch C, Shkeda A, Storz SS, Sun H, Thibaud-Nissen F, Tolstoy I, Tully RE, Vatsan AR, Wallin C, Webb D, Wu W, Landrum MJ, Kimchi A et al (2016) Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res 44:D733–D745 14. Zhao Y, Tang H, Ye Y (2012) RAPSearch2: a fast and memory-efficient protein similarity search tool for next-generation sequencing data. Bioinformatics 28:125–126 15. Finn RD, Coggill P, Eberhardt RY, Eddy SR, Mistry J, Mitchell AL, Potter SC, Punta M, Qureshi M, Sangrador-Vegas A, Salazar GA, Tate J, Bateman A (2016) The Pfam protein

43

families database: towards a more sustainable future. Nucleic Acids Res 44:D279–D285 16. Eddy SR (2011) Accelerated profile HMM searches. PLoS Comput Biol 7:e1002195 17. Carver T, Harris SR, Berriman M, Parkhill J, McQuillan JA (2012) Artemis: an integrated platform for visualization and analysis of highthroughput sequence-based experimental data. Bioinformatics 28:464–469 18. Zhao Y, Wu J, Yang J, Sun S, Xiao J, Yu J (2012) PGAP: pan-genomes analysis pipeline. Bioinformatics 28:416–418 19. Pearson WR (2014) BLAST and FASTA similarity searching for multiple sequence alignment. Methods Mol Biol 1079:75–101 20. Enright AJ, Van Dongen S, Ouzounis CA (2002) An efficient algorithm for large-scale detection of protein families. Nucleic Acids Res 30:1575–1584 21. Huerta-Cepas J, Szklarczyk D, Forslund K, Cook H, Heller D, Walter MC, Rattei T, Mende DR, Sunagawa S, Kuhn M, Jensen LJ, von Mering C, Bork P (2016) eggNOG 4.5: a hierarchical orthology framework with improved functional annotations for eukaryotic, prokaryotic and viral sequences. Nucleic Acids Res 44:D286–D293 22. Lombard V, Golaconda Ramulu H, Drula E, Coutinho PM, Henrissat B (2014) The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Res 42:D490–D495 23. Caspi R, Billington R, Ferrer L, Foerster H, Fulcher CA, Keseler IM, Kothari A, Krummenacker M, Latendresse M, Mueller LA, Ong Q, Paley S, Subhraveti P, Weaver DS, Karp PD (2016) The MetaCyc database of metabolic pathways and enzymes and the BioCyc collection of pathway/genome databases. Nucleic Acids Res 44:D471–D480 24. Richter M, Rossello-Mora R, Oliver Glockner F, Peplies J (2016) JSpeciesWS: a web server for prokaryotic species circumscription based on pairwise genome comparison. Bioinformatics 32:929–931 25. Kurtz S, Phillippy A, Delcher AL, Smoot M, Shumway M, Antonescu C, Salzberg SL (2004) Versatile and open software for comparing large genomes. Genome Biol 5:R12 26. Katoh K, Misawa K, Kuma K, Miyata T (2002) MAFFT: a novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res 30:3059–3066 27. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG

44

Gabriele Andrea Lugli

(2007) Clustal W and Clustal X version 2.0. Bioinformatics 23:2947–2948 28. Tettelin H, Masignani V, Cieslewicz MJ, Donati C, Medini D, Ward NL, Angiuoli SV, Crabtree J, Jones AL, Durkin AS, Deboy RT, Davidsen TM, Mora M, Scarselli M, Margarit y Ros I, Peterson JD, Hauser CR, Sundaram JP, Nelson WC, Madupu R, Brinkac LM, Dodson RJ, Rosovitz MJ, Sullivan SA, Daugherty SC, Haft DH, Selengut J, Gwinn ML, Zhou L, Zafar N, Khouri H, Radune D, Dimitrov G, Watkins K, O’Connor KJ, Smith S, Utterback TR, White O, Rubens CE, Grandi G, Madoff LC, Kasper DL, Telford JL, Wessels MR, Rappuoli R, Fraser CM (2005) Genome analysis of multiple pathogenic isolates of Streptococcus agalactiae: implications for the microbial "pan-genome". Proc Natl Acad Sci U S A 102:13950–13955 29. Richter M, Rossello-Mora R (2009) Shifting the genomic gold standard for the prokaryotic species definition. Proc Natl Acad Sci U S A 106:19126–19131 30. Lugli GA, Milani C, Mancabelli L, van Sinderen D, Ventura M (2016) MEGAnnotator: a user-friendly pipeline for microbial genomes assembly and annotation. FEMS Microbiol Lett 363 31. Duranti S, Mangifesta M, Lugli GA, Turroni F, Anzalone R, Milani C, Mancabelli L, Ossiprandi MC, Ventura M (2017) Bifidobacterium vansinderenii sp. nov., isolated from faeces of emperor tamarin (Saguinus imperator). Int J Syst Evol Microbiol 67 (10):3987–3995. https://doi.org/10.1099/ ijsem.0.002243 32. Lugli GA, Mangifesta M, Duranti S, Anzalone R, Milani C, Mancabelli L, Alessandri G, Turroni F, Ossiprandi MC, van Sinderen D, Ventura M (2018) Phylogenetic classification of six novel species belonging to the genus Bifidobacterium comprising Bifidobacterium anseris sp. nov., Bifidobacterium criceti sp. nov., Bifidobacterium imperatoris sp. nov., Bifidobacterium italicum sp. nov., Bifidobacterium margollesii sp. nov. and Bifidobacterium parmae sp. nov. Syst Appl Microbiol 41:173–183 33. Duranti S, Lugli GA, Napoli S, Anzalone R, Milani C, Mancabelli L, Alessandri G,

Turroni F, Ossiprandi MC, van Sinderen D, Ventura M (2019) Characterization of the phylogenetic diversity of five novel species belonging to the genus Bifidobacterium: Bifidobacterium castoris sp. nov., Bifidobacterium callimiconis sp. nov., Bifidobacterium goeldii sp. nov., Bifidobacterium samirii sp. nov. and Bifidobacterium dolichotidis sp. nov. Int J Syst Evol Microbiol 69 (5):1288–1298. https://doi.org/10.1099/ ijsem.0.003306 34. Lugli GA, Mancino W, Milani C, Duranti S, Mancabelli L, Napoli S, Mangifesta M, Viappiani A, Anzalone R, Longhi G, van Sinderen D, Ventura M, Turroni F (2019) Dissecting the evolutionary development of the species Bifidobacterium animalis through comparative genomics analyses. Appl Environ Microbiol 85(7):e02806–e02818 35. Lugli GA, Duranti S, Albert K, Mancabelli L, Napoli S, Viappiani A, Anzalone R, Longhi G, Milani C, Turroni F, Alessandri G, Sela DA, van Sinderen D, Ventura M (2019) Unveiling genomic diversity among members of the species Bifidobacterium pseudolongum, a widely distributed gut commensal of the animal kingdom. Appl Environ Microbiol 85(8): e03065–e03018 36. Duranti S, Milani C, Lugli GA, Mancabelli L, Turroni F, Ferrario C, Mangifesta M, Viappiani A, Sanchez B, Margolles A, van Sinderen D, Ventura M (2016) Evaluation of genetic diversity among strains of the human gut commensal Bifidobacterium adolescentis. Sci Rep 6:23971 37. Duranti S, Milani C, Lugli GA, Turroni F, Mancabelli L, Sanchez B, Ferrario C, Viappiani A, Mangifesta M, Mancino W, Gueimonde M, Margolles A, van Sinderen D, Ventura M (2015) Insights from genomes of representatives of the human gut commensal Bifidobacterium bifidum. Environ Microbiol 17:2515–2531 38. Lugli GA, Milani C, Duranti S, Alessandri G, Turroni F, Mancabelli L, Tatoni D, Ossiprandi MC, van Sinderen D, Ventura M (2019) Isolation of novel gut bifidobacteria using a combination of metagenomic and cultivation approaches. Genome Biol 20:96

Chapter 5 Site-Directed Mutagenesis of Bifidobacterium Strains Kieran James and Douwe van Sinderen Abstract At present, only a limited number of Bifidobacterium species are amenable to genetic manipulation using mutagenesis. This lack of genetic accessibility among the majority of bifidobacterial strains represents a significant roadblock for the study of gene function and expression in these potential probiotics. Genetic tools for generating mutants are difficult to develop for bifidobacteria, as they require workarounds for obstacles such as low transformation efficiencies, and the presence of differing and sometimes multiple restriction modification systems, in different strains. Site-directed mutagenesis is a frequently applied molecular strategy for the generation of targeted mutations, resulting in gene deletion or disruption, or alteration of their expression, thereby revealing information regarding their function. This strategy has been employed as a molecular tool in some Bifidobacterium strains and is typically achieved using a nonreplicating vector, harboring a DNA fragment corresponding to an internal part of the gene to be mutated. This vector is introduced into a bifidobacterial cell of the strain in question by electroporation. Through homologous recombination, this vector is integrated into the genomic DNA of said cell, disrupting the coding region of the targeted gene, thus preventing the expression of a functional protein product. Such mutant versions of Bifidobacterium strains may then be assessed for alterations in their phenotype or gene expression. Key words Homologous recombination, Mutagenesis, Molecular cloning, Functional gene analysis

1

Introduction While a large number of strains of varying Bifidobacterium species have been isolated and their genome sequenced [1–3], relatively little is known about the functions of their individual genes. This is largely due to the genetic inaccessibility of most bifidobacteria. Factors such as low transformation efficiencies, a lack of suitable molecular tools, and the presence of active restriction modification (RM) systems in these strains, are believed to be the main obstacles to this [4]. RM systems, in particular, present a major challenge to genetic amenability, as different strains may possess one or more of a wide variety of RM systems, with distinct RM systems being present among strains of the same species [5–7]. RM systems are

Douwe van Sinderen and Marco Ventura (eds.), Bifidobacteria: Methods and Protocols, Methods in Molecular Biology, vol. 2278, https://doi.org/10.1007/978-1-0716-1274-3_5, © Springer Science+Business Media, LLC, part of Springer Nature 2021

45

46

Kieran James and Douwe van Sinderen

an effective defence mechanism employed by prokaryotes to prevent the unwanted introduction of invading (e.g., viral) DNA [8, 9]. However, RM systems will also effectively impair the manipulation of genomic sequences using genetic tools. This has historically presented a problem in the study and development of potential probiotic Bifidobacterium strains, as the functions of their individual genes involved in metabolic functions, which may include probiotic activity, could not be studied at a molecular level [4, 7]. Site-directed mutagenesis is a molecular technique used to intentionally alter the genetic sequence of a targeted gene or region of DNA [10]. This can be employed to a number of ends, ranging from the change of a single codon in a gene, to the replacement of one entire gene with another. One of the most common ways to achieve site-directed mutagenesis is insertional mutagenesis. This involves the interruption of a targeted gene with a sequence of exogenous DNA, using homologous recombination as the underlying mechanism [11–13]. This is typically achieved by cloning a DNA fragment corresponding to an internal part of the targeted gene into a plasmid containing an antibiotic selectable marker gene. This plasmid construct is replicated in an intermediate host organism (mostly Escherichia coli), and then introduced into cells of the target strain where this plasmid is unable replicate. Here, it may undergo homologous recombination between the cloned segment of the vector and its homologous equivalent on the chromosome, resulting in the integration of the plasmid construct within the sequence of the target gene (Fig. 1). The consequent interruption of this gene’s sequence renders its protein product nonfunctional in the resulting mutant strain of the target organism. This mutant organism may then be tested for changes in phenotype or gene expression, in order to deduce the function of the gene in that organism under particular conditions. Here, we outline a method used for site-directed mutagenesis, originally developed for Bifidobacterium breve UCC2003 [7]. This method may be applied to other Bifidobacterium strains (or species), with modifications to circumvent the RM systems present in such strains. Using a plasmid construct with a pORI19 backbone, harboring a fragment of the target gene, an erythromycin resistance cassette and with the introduction of a tetracycline resistance cassette, homologous recombination is achieved with the UCC2003 genome, resulting a mutant strain, defective for the expression of functional protein product of the target gene. Where relevant, we will include notes on how this protocol may be adapted to other Bifidobacterium isolates amenable to such mutagenesis.

Site-Directed Mutagenesis of Bifidobacterium Strains

47

pORI19 backbone

~500 bp Cloned internal fragment

TetW casset te (~2.5 kb)

Target gene

5’

3’

Genomic DNA

Internal gene fragment

Homologous recombination

5’

3’

Plasmid integration

5’

3’

Interruption of gene sequence

5’

3’ ~500 bp + ~500 bp + 2.5 kb

ConfPf

TetWf

Fig. 1 Schematic representation of the process of homologous recombination between the plasmid construct (harboring the cloned homologous internal gene fragment and TetW cassette) and the genomic DNA at the target gene. Genomic DNA is designated with a black line, and marked with 50 and 30 orientation. The target gene is shown as a yellow arrow, with the internal fragment chosen as the site of recombination shown in hatched yellow and green. The pORI19 plasmid construct is represented as blue, with the encoded tetW cassette designated as red. The cloned internal fragment in the construct, homologous to that in the target gene, is represented in green. The homology between the cloned internal gene fragment and its counterpart in the Bifidobacterium genomic DNA initiates recombination between the plasmid construct and the genomic DNA within the target gene, and simultaneous integration of the construct into the genomic DNA at this site. This results in the generation of a recombinant version of the gene in the genomic DNA, with its sequence disrupted by the integrated plasmid. This interruption prevents expression of a functional protein product of the targeted gene, thus generating a site-directed mutant strain of the Bifidobacterium. The potential locations of the primers used for confirmation of integration at the correct genomic location, TetWF and ConfPf, are shown in the final panel as black arrows

48

2 2.1

Kieran James and Douwe van Sinderen

Materials Reagents

All solutions are to be prepared using deionized water (dH2O), and using molecular grade reagents. All reagents can be prepared and stored at room temperature, unless indicated otherwise. Enzymes should be stored at 20  C. All media and reagents to be used with bacterial cultures should be autoclaved prior to use. Autoclaving should be carried out for 1 h at 121  C. Standard media (broth and agar) should be made according to the manufacturers’ instructions. Filters with a pore size of 20 μm or 45 μm should be used for filter sterilization. All waste disposal regulations should be rigorously adhered to when disposing of waste materials. 1. 50 mg/mL (1000) kanamycin stock solution: Dissolve 500 mg kanamycin (sulfate) in 10 mL of dH2O, and filtersterilize. Aliquot into 1 mL volumes, and store at 20  C. 2. 100 mg/mL (1000) erythromycin stock solution: Dissolve 1 g erythromycin in 10 mL ethanol (EtOH), and filter-sterilize. Store at 20  C. 3. 10 mg/mL (1000) tetracycline stock solution: Dissolve 100 mg tetracycline (hydrochloride) in a mixture of 5 mL dH2O and 5 mL ethanol (EtOH), and filter-sterilize. Store at 20  C, out of exposure to light (photosensitive). 4. 10 mg/mL (1000) chloramphenicol stock solution: Dissolve 100 mg chloramphenicol in 10 mL ethanol (EtOH), and filtersterilize. Store at 20  C. 5. 143 mM (1000) isopropyl β-D-1-thiogalactopyranoside (IPTG) stock solution: Dissolve 0.34 g isopropyl β-D-1-thiogalactopyranoside in 10 mL dH2O, and filter-sterilize. Aliquot into 1 mL volumes, and store at 20  C. 6. 98 mM (1000) 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal) stock solution: Dissolve 0.1 g X-gal in 2.5 mL dimethylformamide (DMF), filter-sterilize. Store in a glass bottle at 20  C, avoid exposure to light (photosensitive). 7. dH2O for cell washes: Autoclave 400 mL of dH2O. 8. 10% glycerol solution for cell washes: Add 360 mL dH2O to 40 mL glycerol, and autoclave. 9. 10% (10) glucose stock solution: Dissolve 5 g glucose in 50 mL dH2O, and filter-sterilize. Store at 4  C. 10. 381 mM (100) cysteine hydrochloride stock solution: Dissolve 1.2 g L-cysteine hydrochloride in 20 mL dH2O, and filter-sterilize. Store at 4  C. 11. 0.5 M sucrose, 1 mM citrate buffer for cell washes: Dissolve 0.21 g citric acid in 800 mL dH2O. Adjust pH to 5.8, using molecular-grade NaOH. Fill volume up to 1 L with dH2O, and

Site-Directed Mutagenesis of Bifidobacterium Strains

49

mix. Split solution into 5 volumes of 200 mL, and add 34.3 g of sucrose to each bottle. Autoclave to dissolve sucrose and sterilise. 12. Luria–Bertani (LB) culture medium/agar: Dissolve 10 g tryptone, 5 g yeast extract, 10 g sodium chloride (and 16 g agar when required) in 1 L dH2O, and autoclave. 13. Reinforced Clostridium Medium (RCM; available as a premix from Oxoid): As per the manufacturer’s instructions. Dissolve 38 g in 1 L dH2O, and autoclave to sterilize. 14. Reinforced Clostridium Agar (RCA; available as a premix from Oxoid): As per the manufacturer’s instructions. Dissolve 52.6 g in 1 L dH2O, and autoclave to sterilize. 15. De Man, Rogosa, and Sharpe medium (MRS; available as a premix from Difco): As per the manufacturer’s instructions. Dissolve 55 g in 1 L dH2O, and autoclave to sterilize. 16. Modified De Man, Rogosa, and Sharpe medium (mMRS; from first principles): Add the following components to a 1 L Duran bottle: 10 g tryptone (peptone from casein), 2.5 g yeast extract, 3 g tryptose, 3 g dibasic potassium phosphate (K2HPO4), 3 g monobasic potassium phosphate (KH2PO4), 2 g triammonium citrate, 0.2 g pyruvic acid (sodium pyruvate), 0.3 g cysteine hydrochloride, 0.575 g magnesium sulfate heptahydrate (MgSO4·7H2O), 0.12 g manganese sulfate tetrahydrate (MnSO4·4H2O), and 0.034 g iron(II) sulfate heptahydrate (FeSO4·7H2O). Fill flask to 1 L with dH2O, add 1 mL of Tween 80, and mix to dissolve all components. Split media into 5 volumes of 200 mL, and autoclave. 17. Glycerol stock tubes: Add 200 μL of 100% glycerol to 2 mL screw cap tubes, and autoclave. 18. Thermo Scientific (or equivalent).

GeneJET

Plasmid

Miniprep

Kit

19. Thermo Scientific (or equivalent).

GeneJET

Plasmid

Maxiprep

Kit

20. GenElute PCR cleanup kit (or equivalent). 21. 1 TAE buffer: Add 4.844 g Tris base and 0.372 g EDTA to 1.21 mL acetic acid, and make up volume to 1 L using dH2O. 22. 1% Agarose: Dissolve 1 g agarose per 100 mL 1 TAE buffer by microwaving. 23. Thermo Phusion Green HS DNA polymerase mastermix (or equivalent). 24. Promega T4 DNA Ligase and 10 Buffer (or equivalent).

50

Kieran James and Douwe van Sinderen

25. Restriction enzymes suitable for cloning digestions (gene fragment and plasmid vector-dependent; available from New England Biolabs, or equivalent commercial supplier). 26. 0.5 M sodium acetate (NaAc). 27. 99% ethanol (EtOH). 2.2

Equipment

1. NanoDrop 1000/Qubit (DNA quantification equivalent). 2. 1.5 mL tubes. 3. 15 mL falcon tubes. 4. 50 mL falcon tubes. 5. 25 mL serological pipettes. 6. Microcentrifuge. 7. Gel-electrophoresis system. 8. Transilluminator for gel imaging. 9. Anaerobic work station (10% hydrogen, 10% carbon dioxide, and 80% nitrogen). 10. Refrigerated centrifuge with rotor for 50 mL falcon tubes. 11. Electroporator and electroporation cuvettes (2 mm). 12. Spectrophotometer measuring optical density at a wavelength of 600 nm. 13. Standard PCR block/system. 14. Water bath or heating block capable of incubating 1.5 mL tubes at 37  C. 15. Computer with DNA analysis software for primer design (DNAstar or equivalent). 16. Merck Millipore MF membrane filters (or equivalent) for DNA dialysis. 17. Sorvall bottles for megacentrifugation (autoclaved prior to use). 18. Refrigerated megacentrifuge, capable of 3000  g and 4  C incubation.

2.3

Cultures

1. Escherichia coli EC101 (kanamycinr 50 μg/mL) harboring pORI19 (erythromycinr 100 μg/mL). 2. E. coli EC101 (kanamycinr 50 μg/mL) harboring pAM5 (tetracycliner 10 μg/mL). 3. E. coli EC101 (kanamycinr 50 μg/mL) harboring a suitable methylation system encoded on a plasmid vector, if required (dependent on RM system(s) present in the target Bifidobacterium strain; see Note 5).

Site-Directed Mutagenesis of Bifidobacterium Strains

3

51

Methods All procedures should be carried out at room temperature, unless otherwise specified.

3.1 Generation of Fragment-Harboring Plasmid pORI19 Vector

1. Design and order primers for PCR amplification of the fragment to be cloned into the plasmid vector, using DNA analysis software (see Note 1). 2. Resuspend primers in dH2O, according to supplier’s guidelines. Using genomic DNA of the target strain (see Chapter 3 for preparation protocol) as a template, amplify the internal gene fragment with the designed primers and DNA polymerase. 50 μL PCR reactions can be set up as follows: 1 μL genomic DNA, 1 μL Primer 1, 1 μL Primer 2, 25 μL DNA polymerase mastermix, 22 μL dH2O. Set up PCR thermocycling in accordance with supplier’s guidelines. Purify the PCR products using a PCR cleanup kit, according to the manufacturer’s instructions, and run on a 1% agarose electrophoresis gel at 120 V for 45 min (500 mA) to check for PCR product purity. 3. Set up 10 mL culture(s) of E. coli EC101 harboring pORI19 in LB broth, supplemented with 50 μg/mL kanamycin and 100 μg/mL erythromycin, incubated shaking at 37  C. Following overnight growth, isolate and purify pORI19 plasmid using plasmid prep kit, according to the manufacturer’s instructions. Run plasmid on a 1% agarose electrophoresis gel at 120 V for 45 min (500 mA) to check for plasmid purity and quality. 4. Digest the purified PCR product and pORI19 with the same pair of enzymes, as selected in the primer design process. Digestions should be carried out sequentially, with a minimum of 2 h digestion time for each enzyme. If the two enzymes do not share compatibility with each other’s reaction buffer, a purification step has to be carried out between the two digestion steps, using a PCR cleanup kit. 200 μL digestion reactions may be set up as follows: 50 μL PCR product/100 μL plasmid vector, 20 μL 10 reaction buffer, 5 μL restriction enzyme, and 125 μL/75 μL dH2O. Enzyme-reaction buffer compatibility and optimum incubation temperature should be checked according to the manufacturer’s instructions. Following digestions, purify the digests using a PCR cleanup kit, and run on a 1% agarose electrophoresis gel at 120 V for 45 min (500 mA) to check for digest effectiveness and quality. Quantify DNA in purified digests using the NanoDrop 1000/Qubit, and so on, according to the manufacturer’s instructions.

52

Kieran James and Douwe van Sinderen

5. Ligate the digested (with compatible enzymes) PCR product and plasmid vector. 20 μL ligation reactions may be set up as follows: 1 μL ligase, 2 μL 10 ligation buffer, 2 μL plasmid vector, 10 μL PCR product, and 5 μL dH2O. Purified plasmid and PCR digests should be diluted or concentrated, as required, to achieve an optimum ligation concentration and ratio (see Note 2). Ligation reactions should be incubated according to the manufacturer’s instructions. 3.2 Preparation of E. coli EC101 Competent Cells, and Transformation with pORI19 Construct

1. Inoculate 5 mL of LB broth, supplemented with 50 μg/mL kanamycin, with 50 μL of E. coli EC101 from 80  C stock, and incubate shaking at 37  C. 2. Following overnight growth, inoculate 500 mL of LB broth, supplemented with 50 μg/mL kanamycin, with 5 mL of the EC101 culture. Incubate as above, until the OD600nm is approximately 0.5–0.8. 3. Harvest cells by centrifugation in sterile 2 Sorvall bottles at 3000  g for 15 min at 4  C. Ensure the bottles are balanced in accordance with the centrifuge the manufacturer’s instructions. 4. Discard supernatant, and wash cell pellets (fully resuspending the cells) with 50 mL ice-cold sterile dH2O per bottle. Centrifuge at 3000  g for 5 min at 4  C. 5. Repeat the wash step with ice-cold sterile dH2O, as above. 6. Carry out a wash step as above, but with 50 mL ice-cold sterile 10% glycerol per bottle. 7. Resuspend cell pellets in 1–1.5 mL sterile 10% glycerol, and aliquot cell suspension into 100 μL volumes in chilled sterile 1.5 mL Eppendorf tubes. These competent cells may be stored at 80  C and thawed on ice, as required for transformations. Keep cells on ice at all times. 8. Prepare electroporation cuvettes by labeling as required, and placing on ice. 9. Dialyse ligation and plasmid DNA control, by dispensing 10 μL of ligation/plasmid onto the top surface of a membrane filter in a petri dish filled with dH2O. Allow dialysis to occur for approximately 20 min. Dialysis removes excess salt from ligations/DNA preparations, reducing the potential for arcing during transformation, and thus improving transformation efficiency. 10. Transfer the dialysed ligation and plasmid DNA to their respective electroporation cuvettes, and add 50 μL of EC101 competent cells to each and mix by pipetting. Also add 50 μL of EC101 competent cells to an electroporation cuvette without any DNA as a negative control. Dialysed pORI19 DNA with EC101 competent cells may be used as a positive control for the transformation.

Site-Directed Mutagenesis of Bifidobacterium Strains

53

11. Electroporate E. coli EC101 competent cells in the electroporation cuvettes, using the electroporator. Conditions of 2.5 kV, 25 mF and 200 Ω should be used. Following electroporation, the cuvettes should be places back on ice until all are complete. 12. Add 950 μL of LB broth (warmed to 37 ) to each cuvette, and incubate at 37  C shaking for 1 h. 13. Following incubation, serial-dilute the transformations to 102 using LB broth. Plate 100 μL dilutions of 100 to 102 on LB agar supplemented with 50 μg/mL kanamycin, 100 μg/mL erythromycin, 143 μM IPTG and 98 μM X-Gal. Plate 100 μL of the negative and positive controls on the same type of agar plates at a neat (100) concentration. Incubate plates overnight at 37  C. 3.3 Selection of Recombinant pORI19 Clones, and Incorporation of tetW

1. Following incubation of plates, colonies may be selected using blue-white screening. White colonies indicate disruption of the αLacZ gene contained within the pORI19 construct, by the cloned fragment. Select white colonies (NB in some cases Insertion of the DNA fragment will lead to a fusion product which will not cause disruption of the αLacZ gene and in such cases blue colonies will have to be screened), and restreak these on plates of the same agar as used in the transformation. Check positive and negative control plates to ensure high transformation efficiency and effective selection using antibiotics (see Note 3). 2. Confirm presence of fragment in transformant construct clones by colony PCR. The primers used should be those used to amplify the fragment originally from the genomic DNA. Colony PCR’s may be set up as follows: 1 μL Primer 1, 1 μL Primer 2, 10 μL DNA polymerase mastermix, 8 μL colony suspended in dH2O. Colonies may be resuspended in approximately 20 μL dH2O, and incubated for 5 min at 100  C to improve cell lysis and DNA availability. 1 μL of genomic DNA added to 7 μL of dH2O may be used as a positive control. PCR thermocycling conditions should be set up in accordance with the manufacturer’s instructions. Run the PCR on a 1% agarose electrophoresis gel at 120 V for 45 min (500 mA) to confirm the presence of the fragment-harboring pORI19 in the analyzed transformants. 3. Inoculate volumes (at least 1) of 10 mL LB supplemented with 50 μg/mL kanamycin and 100 μg/mL erythromycin with colonies from the restreaks of confirmed clones, and incubate shaking at 37  C. Following overnight growth, stock these cultures by adding 800 μL of culture to an autoclaved stock tube containing 200 μL glycerol, and store at 80  C. With the remaining culture, carry out plasmid purifications to isolate the

54

Kieran James and Douwe van Sinderen

pORI19 construct harboring the cloned fragment. Run on a 1% agarose electrophoresis gel at 120 V for 45 min (500 mA) to check for presence of construct. 4. Set up 10 mL culture(s) of E. coli EC101 harboring pAM5 in LB broth, supplemented with 50 μg/mL kanamycin and 10 μg/mL tetracycline, incubated shaking at 37  C. Following overnight growth, isolate and purify pAM5 plasmid using plasmid prep kit, according to the manufacturer’s instructions. Run plasmid on a 1% agarose electrophoresis gel at 120 V for 45 min (500 mA) to check for plasmid purity and quality. 5. Digest both the fragment-harboring pORI19 construct and pAM5 (separately) with SacI. Set up digestions, purify, run on an agarose gel and quantify DNA, all as previously described. 6. Ligate SacI-digested fragment-harboring pORI19 and tetW (released form the digestion of pAM5) as described previously. Here, the tetW cassette (approximately 2.5 kb) is the DNA fragment to be cloned into the pORI19 plasmid construct. 7. Dialyse ligation, as previously described, as well as pAM5 plasmid (positive control). 8. Transform previously prepared EC101 competent cells with the ligation, as well as a pAM5 positive control, and a negative control, by electroporation, as previously described. 9. Following incubation plate five 200 μL volume of neat (i.e. 100 dilution) transformations on LB agar supplemented with 50 μg/mL kanamycin, 100 μg/mL erythromycin and 10 μg/mL tetracycline. Plate 200 μL of the negative control on the same type of agar plate at a neat (100) concentration. Plate 200 μL of the positive control on LB agar supplemented with 50 μg/mL kanamycin and 10 μg/mL tetracycline, at a neat (100) concentration. Incubate plates overnight at 37  C. Check positive and negative control plates to ensure high transformation efficiency and effective selection using antibiotics (see Note 3). 3.4 Selection of Recombinant pORI19 Clones Harboring tetW (where Suitable; See Note 4)

1. Following incubation of plates, select approximately 5–10 colonies from the transformation plates, and inoculate into LB broth supplemented with 50 μg/mL kanamycin, 100 μg/ mL erythromycin and 10 μg/mL tetracycline, and incubate on a shaking platform at 37  C overnight. Following overnight growth, stock these cultures by adding 800 μL of culture to an autoclaved stock tube containing 200 μL glycerol, and store at 80  C. With the remaining culture, carry out plasmid purifications to isolate the plasmid construct. Run on a 1% agarose electrophoresis gel at 120 V for 45 min (500 mA) to check for presence of construct. 2. Check the orientation of the cloned tetW by restriction analysis with HindIII. 30 μL digestion reactions may be set up as

Site-Directed Mutagenesis of Bifidobacterium Strains

55

follows: 15 μL plasmid construct, 3 μL 10 reaction buffer, 2 μL restriction enzyme and 10 μL dH2O. This digestion can be incubated for 2 h at 37  C, and subsequently run on a 1% agarose electrophoresis gel at 120 V for 45 min (500 mA). A band profile of an approximately 5 kb fragment and an approximately 1.5 kb fragment is indicative of tetW cloning in the reverse orientation (in relation to the 50 –30 orientation of the cloned genomic fragment). A band profile consisting of a roughly 2.5 kb fragment and a 4 kb fragment is indicative of insertion of tetW in the reverse orientation. Select reverseoriented tetW-containing clones for the following steps. 3.5 Generation of a Methylated Plasmid Construct Suitable for Introduction to Bifidobacteria (where Relevant; See Note 5)

1. Transform the generated pORI19 construct, harboring tetW and the internal gene fragment, into the suitable methylating shuttle organism. When generating B. breve UCC2003 insertional mutants, this is E. coli BM101. As such, prepare BM101 competent cells (grown in LB supplemented with 50 μg/mL kanamycin and 5 μg/mL chloramphenicol), as previously described. Transform these with the generated construct, as well as a pAM5 positive control, and a negative control, by electroporation, as previously described. 2. Following incubation, plate five 200 μL volume of neat (100) transformations (including positive and negative controls) on LB agar supplemented with 25 μg/mL kanamycin, 5 μg/mL chloramphenicol and 10 μg/mL tetracycline. Incubate plates for 48 h at 37  C. Check positive and negative control plates to ensure high transformation efficiency and effective selection using antibiotics (see Note 3). 3. Following incubation of plates, select approximately 5–10 colonies from the transformation plates, and inoculate into LB broth supplemented with 25 μg/mL kanamycin, 5 μg/ mL chloramphenicol, and 10 μg/mL tetracycline, and incubate shaking at 37  C overnight. Following overnight growth, stock these cultures by adding 800 μL of culture to an autoclaved stock tube containing 200 μL glycerol, and store at 80  C. With the remaining culture, carry out plasmid purifications to isolate the plasmid construct. Run on a 1% agarose electrophoresis gel at 120 V for 45 min (500 mA) to check for presence of construct. 4. Check the methylation of the constructs by restriction analysis with HindIII and PstI, separately, in 30 μL digestions, as previously described. This digestion can be incubated for 2 h at 37  C, and subsequently run on a 1% agarose electrophoresis gel at 120 V for 45 min (500 mA). If methylation of the construct has successfully taken place, HindIII should digest the construct, and PstI should not. Select a clone harboring a correctly methylated construct to proceed with.

56

Kieran James and Douwe van Sinderen

3.6 Transformation of Competent Bifidobacterium Cells with the Recombinant Construct

1. Set up an overnight 10 mL culture of the E. coli strain harboring the recombinant construct, and the following day, subculture into a 250 mL volume of LB containing the appropriate antibiotics. 2. Following overnight growth, carry out a large-scale plasmid isolation from this 250 mL culture, using the Thermo Scientific GeneJET Plasmid Maxiprep Kit (or equivalent), according to the manufacturer’s instructions. Elute in 1–2 mL of elution buffer. 3. Concentrate 500 μL of the isolated construct using ethanolsodium acetate precipitation, which is carried out as follows. To 500 μL of construct, add 50 μL NaAc 1 mL of ice-cold 99% EtOH in a 1.5 mL Eppendorf tube. Mix by inversion, and place at 80  C for 15 min. Centrifuge the tube(s) at maximum speed at 4  C for 15 min. A small pellet should form at the bottom of the tube. Discard the supernatant, and wash the pellet with 70% ethanol by pipetting. Centrifuge the tube for a further 5 min at 4  C at maximum speed. Again discard the supernatant, and remove as much as possible using a pipette, without disturbing the pellet. Dry the pellet on a benchtop or in a laminar flow hood until all the supernatant has evaporated. Add 20–30 μL of elution buffer from the plasmid preparation kit or PCR purification kit, and dissolve the pellet into solution by incubating at 55  C for 10 min. Run approximately 3 μL of the concentrated DNA on a 1% agarose electrophoresis gel at 120 V for 45 min (500 mA), to confirm it has not been lost through error in the precipitation process. 4. Prepare Bifidobacterium competent cells, as described in Chapter 3. 5. Dialyse concentrated construct, as previously described, as well as pAM5 plasmid (positive control) and empty (i.e. unaltered) pORI19 plasmid (negative control). 6. Transform the electrocompetent Bifidobacterium cells with the dialyzed construct, as well as a pAM5 positive control, and a pORI19 negative control, as described in Chapter 3. Add 950 μL of RCM broth (warmed to 37 ) to each cuvette, and incubate at 37  C anaerobically for 2–3 h. 7. Following incubation, plate five 200 μL aliquots of the construct transformation on RCA supplemented with tetracycline at concentrations of 10 μg/mL, 15 μg/mL and 20 μg/mL. Plate 200 μL of the negative and positive controls on the RCA at supplemented with tetracycline at concentrations of 10 μg/ mL, 15 μg/mL and 20 μg/mL. Incubate plates for 3–4 days at 37  C anaerobically. Check positive and negative control plates to ensure sufficient transformation efficiency and effective selection using antibiotics (see Note 3).

Site-Directed Mutagenesis of Bifidobacterium Strains

3.7 Selection and Confirmation of Recombinant Bifidobacterium Transformants

57

1. Following incubation of the transformation plates, select colonies from these plates (provided no colonies have appeared on the negative control plates of the same tetracycline concentration), and restreak on plates of the same agar and antibiotic concentration as used for the transformations. Incubate these plates overnight at 37  C anaerobically. 2. Set up colony PCR’s to confirm the integration of the recombinant pORI19 construct into the Bifidobacterium genome at the correct location, and thus successful disruption of the target gene. Set up three colony PCR’s for each restreaked colony; one to confirm the presence of the integrated tetW cassette, and two to confirm the correct location of the integration (see Note 6). Set up the colony PCR’s as follows: 8 μL dH2O, 10 μL polymerase mastermix, 1 μL primer 1, 1 μL primer 2 (see Note 6). Add a small amount of the colony from each restreak for each colony PCR reaction. Set up PCR thermocycling in accordance with supplier’s guidelines, with an extended initial denaturation step, if possible, to aid in the lysis of the cells in each reaction. Alternatively, the colonies can be added to the dH2O, and incubated at 99  C for 10 min, prior to the addition of the other PCR reaction components, to achieve cell lysis. Once complete, run the colony PCR reactions on a 1% agarose electrophoresis gel at 120 V for 45 min (500 mA). Candidates with correctly sized band profiles (see Note 6) for all three confirmation PCR’s are considered to have successful integration at the correct site, and are therefore considered homologous recombinants of the target gene, that is, (site-directed) mutant strains of the target gene. 3. Colonies from these restreaks should be inoculated into RCM broth supplemented with 10 μg/mL tetracycline, and incubated overnight at 37  C anaerobically. Following overnight growth, stock these cultures by adding 800 μL of culture to an autoclaved stock tube containing 200 μL glycerol, and store at 80  C. 4. If a particular phenotype is expected as a result of mutation in the target gene, assays may be carried out to verify the disrupted expression of this gene and thus activity of its encoded protein.

4

Notes 1. The PCR-amplified fragment to be cloned into the integration vector should represent a fragment representing an internal part of the gene targeted for mutagenesis (see Fig. 1 for a schematic representation). The presence of this fragment on the vector will enable the homologous recombination with the corresponding genomic DNA at the target gene, resulting in

58

Kieran James and Douwe van Sinderen

integration of the gene, and thus disruption of the gene sequence. Primers should be designed approximately 500–600 bp apart, within the target gene. For single-domain protein-coding genes, the fragment should be as centrally located within the gene to be targeted as possible. For multidomain protein-coding genes, the fragment should ideally encompass parts of at least 2 domains. Primers should ideally have a melting temperature of >50  C, and be between 18 and 24 bp long, flanked by incorporated restriction enzyme sites, and external to these 6 random bases. Restriction sites chosen for the primers should not be found elsewhere in the fragment to be amplified, and must be compatible with matching or otherwise suitable sites present in the multiple cloning site of the plasmid vector to be used for cloning (e.g., pORI19). 2. Ligations should preferentially have a DNA concentration of 1–10 μg/mL. Vector–insert molar ratio of 1:3 are typical, but this may be adjusted from 1:1 to 1:10, as necessary, depending on efficiency of ligation achieved. 3. Following incubation, positive control plates should ideally have a lawn of bacteria growing on the agar surface. This indicates that the (empty) plasmid, conferring resistance to the antibiotic used for selection, has been successfully transformed into and replicated within the cells, confirming a sufficiently high efficiency of transformation. A cell lawn is indicative of an efficiency of approximately 1  106 to 1  108 transformants/μg DNA. Low numbers of colonies on the positive control plates indicate that the antibiotic concentration used in the media is too high (in which case, it can be lowered), or that the cells are not sufficiently competent (in which case, a new batch can be made). For transformation of Bifidobacterium strains to achieve homologous recombination, the positive control should be a plasmid capable of replication within this Bifidobacterium strain (e.g., pAM5). Negative control plates, conversely, should ideally be free of colonies or microbial growth following incubation. This indicates that the culture does not possess a sufficient natural resistance to the antibiotic to overcome that used in the transformant selection, and that there has not been contamination of the culture with another resistant microbe. The presence of colonies on the negative control plates may indicate that the concentration of antibiotic is not high enough (in which case, it can be raised), or that the competent cells are contaminated with another microbe (in which case, a new batch can be made). For the transformation of Bifidobacterium strains to achieve homologous recombination, the negative control should be an unaltered (or “empty”) copy of the nonreplicating plasmid used to generate the construct destined for homologous recombination (e.g., pORI19). This will not be able to

Site-Directed Mutagenesis of Bifidobacterium Strains

59

integrate, due to the absence of a sequence homologous to that of the genome, and will not replicate in the Bifidobacterium strain, due to the absence of a suitable encoded replication element. 4. The tetracycline resistance-conferring cassette tetW (obtained from pAM5) is used here as the selectable marker for the insertional mutation in B. breve UCC2003, and likewise may be used for other Bifidobacterium strains (RM systemdepending; see Note 5), where suitable. Suitability of this marker for a strain depends on the strain’s inherent resistance to tetracycline. Strains with an inherent resistance to tetracycline will require the use of a different antibiotic resistance cassette as a selectable marker. 5. If one or more active RM systems are present in the target Bifidobacterium strain, the restriction activity of this system on the construct can be prevented by passaging the construct through a suitable shuttle strain, where available. This shuttle strain expresses plasmid-harboring or genomically integrated genes encoding the machinery necessary to methylate the specific restriction sites of the R-M system in the target Bifidobacterium strain. By passaging the pORI10-TetW construct through this strain, the restriction sites, recognized by the target host’s restriction modification system, will be methylated, and thus protected from restriction when the construct is introduced to the target host. In the case of B. breve UCC2003 site-directed mutagenesis, mainly two RM systems are active; designated BbrII and BbrIII. Thus, the shuttle organism E. coli BM101 is used to methylate plasmid constructs prior to their introduction to UCC2003. BM101 encodes the BbrIIM and BbrIIIM methylases necessary to methylate these sites, and protect them from restriction by BbrII and BbrIII [7]. This is the example used in the protocol here, but may be adapted as necessary, to overcome other active RM systems, where relevant. 6. Additional primers need to be designed for the PCR confirmation of the integration of tetW cassette and the correct genomic location of the integration. Primers for the amplification of the tetW cassette are designed at the flanking regions of this cassette. These forward and reverse primers are given here: TetWf—tcagctgtcgacatgctcatgtacggtaaggaagca, TetWr— gcgacggtcgaccataacttctgattgttgccg. The amplicon corresponding to the tetW cassette is approximately 2.5 kb. For PCR confirmation of the location of the integration, the reverse primer of this amplification is the forward primer for the tetW cassette, TetWf (if the tetW cassette is in the reverse orientation). The forward primer for this amplification, ConfPf, is to be designed with a sequence homologous to a location in the genomic DNA of the target strain, 500 bp to

60

Kieran James and Douwe van Sinderen

1 kb upstream of the gene fragment present in the recombinant pORI19 construct, that is, the site of the homologous recombination. The size of this PCR amplicon can be calculated as follows: no. of bp from forward primer to start of internal gene fragment + no. of bp within internal fragment + no. of bp of tetW cassette (approx. 2500). References 1. Bottacini F, O’Connell Motherway M, Kuczynski J, O’Connell KJ, Serafini F, Duranti S, Milani C, Turroni F, Lugli GA, Zomer A, Zhurina D, Riedel C, Ventura M, van Sinderen D (2014) Comparative genomics of the Bifidobacterium breve taxon. BMC Genomics 15:170. https://doi.org/10.1186/ 1471-2164-15-170 2. Milani C, Lugli GA, Duranti S, Turroni F, Bottacini F, Mangifesta M, Sanchez B, Viappiani A, Mancabelli L, Taminiau B, Delcenserie V, Barrangou R, Margolles A, van Sinderen D, Ventura M (2014) Genomic encyclopedia of type strains of the genus Bifidobacterium. Appl Environ Microbiol 80 (20):6290–6302. https://doi.org/10.1128/ AEM.02308-14 3. Milani C, Mangifesta M, Mancabelli L, Lugli GA, James K, Duranti S, Turroni F, Ferrario C, Ossiprandi MC, van Sinderen D, Ventura M (2017) Unveiling bifidobacterial biogeography across the mammalian branch of the tree of life. ISME J 11(12):2834–2847. https://doi.org/ 10.1038/ismej.2017.138 4. Brancaccio VF, Zhurina DS, Riedel CU (2013) Tough nuts to crack: site-directed mutagenesis of bifidobacteria remains a challenge. Bioengineered 4(4):197–202. https://doi.org/10. 4161/bioe.23381 5. Bottacini F, Morrissey R, Roberts Richard J, James K, van Breen J, Egan M, Lambert J, van Limpt K, Knol J, Motherway Mary OC, van Sinderen D (2017) Comparative genome and methylome analysis reveals restriction/modification system diversity in the gut commensal Bifidobacterium breve. Nucleic Acids Res 46 (4):1860–1877. https://doi.org/10.1093/ nar/gkx1289 6. O’Callaghan A, Bottacini F, O’Connell Motherway M, van Sinderen D (2015) Pangenome analysis of Bifidobacterium longum and site-directed mutagenesis through by-pass of restriction-modification systems. BMC Genomics 16:832. https://doi.org/10.1186/ s12864-015-1968-4

7. O’Connell Motherway M, O’Driscoll J, Fitzgerald GF, Van Sinderen D (2009) Overcoming the restriction barrier to plasmid transformation and targeted mutagenesis in Bifidobacterium breve UCC2003. Microb Biotechnol 2(3):321–332. https://doi.org/10. 1111/j.1751-7915.2008.00071.x 8. Makarova KS, Wolf YI, Koonin EV (2013) Comparative genomics of defense systems in archaea and bacteria. Nucleic Acids Res 41 (8):4360–4377. https://doi.org/10.1093/ nar/gkt157 9. Oliveira PH, Touchon M, Rocha EP (2014) The interplay of restriction-modification systems with mobile genetic elements and their prokaryotic hosts. Nucleic Acids Res 42 (16):10618–10631. https://doi.org/10. 1093/nar/gku734 10. Yang H, Li J, Du G, Liu L (2017) Chapter 6 microbial production and molecular engineering of industrial enzymes: challenges and strategies. In: Brahmachari G (ed) Biotechnology of microbial enzymes. Academic Press, Cambridge, pp 151–165. https://doi.org/10. 1016/B978-0-12-803725-6.00006-6 11. De Vos WM, Simons GFM (1994) Gene cloning and expression systems in Lactococci. In: Gasson MJ, De Vos WM (eds) Genetics and biotechnology of lactic acid bacteria. Springer, Netherlands, Dordrecht, pp 52–105. https:// doi.org/10.1007/978-94-011-1340-3_2 12. Chopin MC, Chopin A, Rouault A, Galleron N (1989) Insertion and amplification of foreign genes in the Lactococcus lactis subsp. lactis chromosome. Appl Environ Microbiol 55 (7):1769–1774 13. Mercenier A, Pouwels PH, Chassy BM (1994) Genetic engineering of lactobacilli, leuconostocs and Streptococcus thermophilus. In: Gasson MJ, De Vos WM (eds) Genetics and biotechnology of lactic acid bacteria. Springer Netherlands, Dordrecht, pp 252–293. https:// doi.org/10.1007/978-94-011-1340-3_6

Chapter 6 Protocol to Select Bifidobacteria from Fecal and Environmental Samples Giulia Alessandri, Maria Cristina Ossiprandi, Marco Ventura, and Douwe van Sinderen Abstract Bifidobacteria are commensal microorganisms able to colonize several ecological niches. Since their discovery, culture-dependent methods combined with the most modern next-generation sequencing techniques have contributed to shed light on the ecological, functional and genomic features of bifidobacteria, purporting them as microorganisms with probiotic traits. Thanks to their acclaimed health-promoting effects, several members of the Bifidobacterium genus have been included in a variety of functional foods and drugs. In this context, the functional relevance of bifidobacteria in the gut explains ongoing efforts to isolate novel and potentially beneficial strains. For this purpose, development of effective and selective isolation protocols in concert with knowledge on the physiological characteristics of bifidobacterial are fundamental requirements for their recovery and discovery from their natural environments, in particular from fecal samples. Key words Bifidobacterium, Isolation, Culture media

1

Introduction Bifidobacteria are Gram-positive commensal microorganisms belonging to the Bifidobacterium genus, which forms a deepbranching lineage within the Actinobacteria phylum. The first representative of this microbial genus was observed from a fecal sample of a breast-fed infant by Tissier in 1899. Since then bifidobacteria have been isolated from several ecological niches including the oral cavity, sewage, human blood, rumen liquid, fermented milk and water kefir, the insect gut and the mammalian gastrointestinal tract. In recent decades, particular interest has focused on the Bifidobacterium genus because of the probiotic features attributed to certain bifidobacterial members. Thanks to their ability to exert such asserted beneficial and health-promoting effects, which encompass stimulation of the immune system, protection against pathogens and nutrient provision through the breakdown of nondigestible

Douwe van Sinderen and Marco Ventura (eds.), Bifidobacteria: Methods and Protocols, Methods in Molecular Biology, vol. 2278, https://doi.org/10.1007/978-1-0716-1274-3_6, © Springer Science+Business Media, LLC, part of Springer Nature 2021

61

62

Giulia Alessandri et al.

carbohydrates, several bifidobacterial strains have been incorporated into a variety of functional foods and drug formulations [1, 2]. Based on their importance, the scientific community has dedicated and continues to devote concerted efforts to isolate and characterize novel bifidobacterial strains. However, the effective isolation of microorganisms, including that of bifidobacteria, from their natural environment is not a straightforward procedure, since it requires a thorough knowledge of their nutritional needs and metabolic capacities coupled with the ability to in vitro reproduce their specific ecological niche. In this context, the introduction of culture-independent approaches based on Next Generation Sequencing (NGS) techniques associated with the more traditional culture-dependent approaches has contributed to broaden our knowledge concerning the Bifidobacterium genus by means of comparative and functional investigations, allowing for the reformulation and improvement of culture media for specific selection of bifidobacterial species [3]. Collectively, bifidobacteria are fastidious microorganisms that are not easy to manipulate under standard laboratory conditions. Indeed, being deprived of an efficient oxygen detoxification system, they require an oxygen-free environment and the addition of reducing agents in their cultivation medium for optimal growth. Moreover, the ability of these commensal microorganisms to degrade a wide variety of complex carbohydrates, typical of the gastrointestinal ecosystem of their host, is another key feature to consider for the formulation of selective culture media. Specifically, bifidobacteria are able to degrade diet-derived sugars, for example glucans, pectins, fructans, xylans, and/or resistant starch, as well as hostderived glycans, such as human milk oligosaccharides and mucins [4]. In this context, NGS-based studies have revealed that most bifidobacterial genomes contain a substantial arsenal of genes involved in the degradation and subsequent utilization of aforementioned carbohydrates. Although the ability to metabolize particular human- and/or diet-derived glycans is strain-dependent, all bifidobacterial genomes contain glycosyl hydrolase (GH)-encoding genes coupled with gene sequences responsible for the assembly of carbohydrate-specific ATP-binding cassette transporters, proton symporters, permeases, and phosphoenolpyruvatephosphotransferase systems. The cooperation of these enzymes and transporter systems allows saccharides to be shuttled into the main bifidobacterial metabolic pathway, the so-called bifid shunt, were simple sugars converge for energy production. At the end of this metabolic route, 2.5 Mol ATP, 1 Mol of lactate and 1.5 Mol of acetate per 1 Mol of glucose are generated. All together, these characteristics/needs should be considered for the correct formulation of (selective) cultivation media suitable for the isolation of bifidobacterial species [5, 6].

Protocol to Select Bifidobacteria from Fecal and Environmental Samples

2

63

Requirements for the Isolation of Members of the Bifidobacterium Genus A schematic procedure for the isolation of bifidobacterial species is displayed in Fig. 1.

2.1 Maintenance of an Anaerobic Environment

a)

With the exception of some facultative aerobic/microaerophilic species, bifidobacteria are generally strictly anaerobic, thus requiring oxygen-free conditions for growth. The maintenance of an oxygen-deprived environment is achieved by the use of special devices that allow anaerobic incubation of cultures/plates such as traditional anaerobic jars or anaerobic chambers/incubators. In case of hermetic anaerobic jars, an oxygen-free atmosphere can be obtained by inserting, in the jar itself, commercially available chemical packs containing certain reagents that are able to remove oxygen and release carbon dioxide, thus creating an anaerobic environment suitable for bifidobacterial growth. These peculiar devices have the advantage of ensuing secure transport of a bacterial culture by avoiding or minimizing oxygen exposure. However, anaerobic jars generally offer the accommodation of just a limited number of microbial cultures/plates. For this reason, in the modern era, microbiological laboratories have replaced anaerobic jars with anaerobic cabinets that guarantee the incubation of bacterial cultures under static conditions and strictly controlled atmosphere consisting of a gas mixture of CO2, H2, and N2.

Serial dilution

+

DNA extraction from the isolated colonies

Whole Genome Identification of the Sequencing isolated colonies through 16S rRNA sequencing

< Novel genome

Selective culture media Plating

Plating

Whole Metagenome Sequencing

b)

Extraction of total DNA from the target sample

gtacctgatcaagtacagttagga taggagtcgata ctgatcaagta cagtaagcggtactt cagtaagcggtactta cctgatca agcccatagctagaacttaagtt

Metagenomic Assembly

Contigs of classified bifidobacterial species

Raw data Contigs of a putative novel species

GHS

GTS

CES

PLS

Glycobiome analysis

GH Enzyme Selection


1 mM EDTA, and is free of organic contaminants. Ideally, the input sample should have an OD260nm/OD280nm (UV absorbance) ratio of between 1.8 and 2.0, and an OD260nm/OD230nm ratio of between 2.0 and 2.2. These ratios may be determined through the use of a spectrophotometer.

78

Brian McDonnell et al.

3. “Tagmentation” of DNA sample. (a) Preparation of reagents: Defrost the ATM and TD reagents on ice, and centrifuge (pulse) briefly. Check the NT reagent for precipitates—if present, vortex until fully resuspended. (b) Add the following to each well of a 96-well PCR plate: 10μL TD, 1 ng DNA (5μL). Pipet up and down briefly to mix. (c) Add 5μL ATM to each well. Pipet up and down ten times to mix. (d) Seal the plate using Microseal ‘A’ adhesive film and a rubber roller, and centrifuge the plate at 280  g for 1 min. (e) Run the sealed plate in the following PCR program with a 50μL reaction volume: Step

Temperature

Duration

Heated lid

100
C

1

Incubation




10 min




1

Store

55 C 10 C

(f) When the sample temperature is at 10
C, immediately add 5μL NT to each well. Pipet up and down ten times to mix. (g) Centrifuge the plate at 280  g for 1 min. Incubate the plate at RT for 5 min. 4. Amplification of Libraries . (a) Preparation of reagents: Defrost the index adapters. If provided in tubes, vortex to mix, then centrifuge briefly before use. If provided in plates, centrifuge briefly before use. Thaw NPM on ice for 20 min. (b) Depending on the index adapter kit in use, add either (1) 5μL i7 then 5μL i5 adapters (tubes); or (2) 10μL prepaired i7 and i5 adapters to each sample. (c) Add 15μL NPM to each well. Pipet up and down ten times to mix, then seal the plate using Microseal ‘A’ adhesive film and a rubber roller. (d) Centrifuge at 280  g at 20
C for 1 min. (e) Place the plate on a PCR cycler and run the following program with a 50μL reaction volume:

Phageome Analysis of Bifidobacteria-Rich Samples

Step

Temperature


Duration

Heated lid

100 C

1

Incubation

72
C

3 min

Incubation

95
C

30 s

Cycle (12)

Incubation Store




10 s




55 C

30 s

72
C

30 s

72
C

5 min

95 C




10 C

79

--p-sampling-depth argument. The “sample-metadata.tsv” tabular file should contain metadata regarding the samples that will be used to provide output with samples that are grouped accordingly.

188

Christian Milani

7.

qiime emperor plot --i-pcoa < input weighted_unifrac_p-

coa_results.qza file in output folder diversity metrics results> --m-metadata-file -o-visualization

Beta-diversity results can be visualized in a PCoA representation using this script. Alternative matrices such as unweighted UniFrac and Bray Curtis, available in output folder of diversity metrics results, can also be represented through PCoA. 8.

qiime

feature-classifier

classify-sklearn

--p-n-jobs

--i-classifier

--i-reads

--o-classification

This QIIME 2 script performs taxonomic classification of OTUs using sklearn method and provides relative abundance of detected taxa in each sample at multiple taxonomic levels (see Note 3). An appropriate database, trained for use with sklearn, should be provided. Ready-to-use QIIME 2 sklearn databases can be found in QIIME 2 (https://qiime2.org/) and SILVA (https://www.arbsilva.de/) websites. 9.

qiime taxa barplot --i-table --i-taxonomy < input taxonomy.qza file> --mmetadata-file --o-visualization

This script generates bar plots from taxonomic data. 3.3 Bifidobacterial ITS Profiling

The following pipeline based on QIIME 2 performs the key steps for analysis of paired-end sequencing data corresponding to PCR amplicons obtained through amplification with the bifidobacterial ITS primers Primers Probio-bif_Uni (50 - CTKTTGGGYYCCCK (50 CGCGTCCACTMTC GRYYG -30 )/Probio-bif_Rev 0 CAGTTCTC -3 ) specific for the ITS hypervariable region of bifidobacteria [6]. Notably, this primer pair was developed to maximize taxonomic coverage of bifidobacteria. The ITS region allows discrimination even of closely relates (sub)species. Amplicon length is circa 200 bp. 1. “fastq-join

-o

Fastq-join produces three output files with “un1,” “un2,” or “join” suffixes. Files with “un1” and “un2” suffixes represent respectively unmerged forward and reverse reads, while the file

Metagenomic Analyses of Bifidobacterial Communities

189

with “join” suffix represents the merged reads. In case alternative primers are used, the amplicon size should allow merging of the reads. “fastq-join -h” provides details of all applied criteria. This step must be executed for each sample. 2. cutadapt

-g CTKTTGGGYYCCCKGRYYG -a CGCGTCCACTMTCCAGTTCTC --

discard-untrimmed --match-read-wildcards -e 0.2 -o

Cutadapt checks the sequencings reads for primers used for PCR amplification, that is, Primers Probio-bif_Uni (50 -CTKTTGGGYY CCCKGRYYG -30 )/Probio-bif_Rev (50 - CGCGTCCACTMTC CAGTTCTC-30 ) and removes them. If both forward and reverse primers cannot be identified, the read is discarded. “cutadapt -h” provides details of all applied criteria. This step must be executed for each sample. 3.

qiime tools import --type ’SampleData[SequencesWithQual-

ity]’ --input-path --outputpath --input-format SingleEndFastqManifestPhred33

This QIIME 2 script performs formatting of the .fastq data of each sample included in the analysis into a QIIME 2 artifact file. The path to each input file and metadata regarding each sample must be reported in the Fasting_Map.txt text file. Formatting of the Fasting_Map.txt file may vary depending on QIIME 2 release, thus the user should refer to the QIIME 2 website (https://qiime2.org/) for updated details based on the QIIME 2 release in use. 4.

qiime dada2 denoise-single --i-demultiplexed-seqs --p-chimera-method consensus --p-trunc-len 0 --p-n-threads --output-dir

This QIIME 2 script uses dada2 software to perform de novo out generation at 100% identity, picking of representative sequences and removal of chimeric reads. The number of threads to be used depends on available hardware resources. 5. qiime

phylogeny align-to-tree-mafft-fasttree --i-sequences

--oalignment --o-maskedalignment --o-tree --o-rooted-tree

This QIIME 2 script performs alignment of representative sequences of OTUs and subsequent tree generation.

190

Christian Milani

6.

qiime diversity core-metrics-phylogenetic --i-phylogeny

--i-table --p-sampling-depth --m-metadata-file --outputdir

This QIIME 2 script performs alpha and beta diversity analyses. The maximum sequencing depth used for rarefaction analyses is defined by the “--p-sampling-depth ” argument. The “sample-metadata.tsv” tabular file should contain metadata regarding the samples that will be used to provide output with samples grouped accordingly. 7.

qiime emperor plot --i-pcoa < input weighted_unifrac_p-

coa_results.qza file in output folder diversity metrics results> --m-metadata-file -o-visualization

Beta-diversity results can be visualized in a PCoA representation using this script. Alternative matrices such as unweighted UniFrac and Bray Curtis, available in output folder of diversity metrics results, can also be represented through PCoA. 8.

qiime

feature-classifier

classify-sklearn

--p-n-jobs

--i-classifier --i-reads

--o-classification

This QIIME 2 script performs taxonomic classification of OTUs using sklearn method and provides relative abundance of detected taxa in each sample at multiple taxonomic levels. An appropriate database, trained for use with sklearn, should be provided. Readyto-use QIIME 2 sklearn databases can be found in QIIME 2 (https://qiime2.org/) and SILVA (https://www.arb-silva.de/) websites. 9.

qiime taxa barplot --i-table --i-taxonomy < input taxonomy.qza file> --mmetadata-file --o-visualization

This script generates bar plots from taxonomic data. 3.4 Shotgun Metagenomics

The bioinformatic tool METAnnotatorX allows to perform both reads- and assembly-based metagenomics analyses.

Metagenomic Analyses of Bifidobacterial Communities

1.

METAnnotatorX_Bash

-n

-t

-f -r

This command starts the METAnnotatorX pipeline that consist in a first phase of quality filtering of the dataset followed by a second phase of read-based analyses and a third phase of metagenomic assembly followed by contig-based analyses. The mandatory arguments are “project name,” that is, a user-defined name for the analysis project, along with input .fastq files corresponding to forward and reverse metagenomic reads. The user can modify a wide range of parameters and/or exclude specific analyses trough editing of the setting file “parameters” (see Note 4). In this regard, “read length” parameter must be changed according to the data under analysis. Output of the METAnnotatorX pipeline can be found in the “results” folder. Furthermore, reads and contigs can be screened for genes of interest. In both cases a custom database must be build. 2.

prerapsearch -d -n -f T

PreRapSearch performs building of the custom databases encompassing reference genes for homology searches in reads and contigs. The “-f T” includes in the database the full fasta headers of entries to facilitate annotation. 3. rapsearch

-q -d -o -e -z

Rapsearch2 performs search of homologs based on a custom database provided by the user (see Note 5). In case the user wants to screen reads for those encoding genes of interest, the qualityfiltered dataset in fasta format should be provided as input, these data are located in “output/filtered_reads/filtered_reads.fasta”. In case the user is interested to screen assembled contigs for specific genes, the amino acidic sequence of genes encoded by contigs of specific genera or species should be provided as input, these data are located in the folders “output/genbank_species_level/aaORFs/” genus_level/aaORFs/”.

and

“output/genbank_-

192

4

Christian Milani

Notes 1. Quality filtering Quality filtering of the data provides two major check points for exclusion of samples due to quality issues. The first check point is represented by the results obtained from analysis of raw sequence reads with FastQC. This software provides a general overview of a wide range of quality index and highlights values falling outside of standard cutoffs. Through integration of these data the user may opt for exclusion of the sample from further analyses. The second check point is represented by the output of quality filtering with fastq-mcf. In this case, the quality filtering process may reduce the number of reads of a dataset below the sequencing depth limits required by the ongoing study. In this case, the user may opt for exclusion of the sample. 2. Post-filtering number of reads in 16S rRNA gene microbial profiling and bifidobacterial ITS profiling Fastq-join and Cutadapt may reduce the number of reads of a dataset below the sequencing depth limits required by the ongoing study. In this case, the user may opt for exclusion of the sample. 3. Confidence level of taxonomic assignment in 16S rRNA gene microbial profiling and bifidobacterial ITS profiling The confidence level for taxonomic assignment of predicted OTUs through “qiime feature-classifier” can be adjusted with the option “--p-confidence X,” where it can range between 0 and 1 (default is 0.7). If an OTU cannot be classified at a target taxonomic rank, it will be attributed to a higher rank based on the confidence level provided. 4. Shotgun metagenomics, databases used for classifications of the reads METAnnotatorX classifies Eukaryotes, Archaea, Bacteria, and Viruses based on four NCBI databases. Notably, when used to analyze the bacterial population, it gives an indication of the amount of (contaminant) eukaryotic DNA sequenced. Moreover, METAnnotatorX can also be used for analysis of the bifidobacterial phage population. In case the user is interested only in the bacterial population, the use of additional databases can be disabled in the “parameters” setting file. 5. Shotgun metagenomics, details regarding custom databases When RAPSearch2 is used to screen quality filtered reads for genes of a custom database, the e-value must be set based on read length to maximize the specificity of the analysis. The .aln output file contains all alignments, thus can be used to evaluate if the e-value used provided sufficient accuracy.

Metagenomic Analyses of Bifidobacterial Communities

193

References 1. Quince C, Walker AW, Simpson JT, Loman NJ, Segata N (2017) Shotgun metagenomics, from sampling to analysis. Nat Biotechnol 35:833–844 2. Biteen JS, Blainey PC, Cardon ZG, Chun M, Church GM, Dorrestein PC et al (2016) Tools for the microbiome: Nano and beyond. ACS Nano 10:6–37 3. Hamady M, Knight R (2009) Microbial community profiling for human microbiome projects: tools, techniques, and challenges. Genome Res 19:1141–1152 4. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK et al (2010) QIIME allows analysis of highthroughput community sequencing data. Nat Methods 7:335–336 5. Schloss PD, Westcott SL, Ryabin T, Hall JR, Hartmann M, Hollister EB et al (2009) Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl Environ Microbiol 75:7537–7541 6. Milani C, Lugli GA, Turroni F, Mancabelli L, Duranti S, Viappiani A et al (2014) Evaluation of bifidobacterial community composition in the human gut by means of a targeted amplicon sequencing (ITS) protocol. FEMS Microbiol Ecol 90:493–503 7. Milani C, Duranti S, Bottacini F, Casey E, Turroni F, Mahony J et al (2017) The first

microbial colonizers of the human gut: composition, activities, and health implications of the infant gut microbiota. Microbiol Mol Biol Rev 81:e00036-17 8. Bokulich NA, Kaehler BD, Rideout JR, Dillon M, Bolyen E, Knight R et al (2018) Optimizing taxonomic classification of marker-gene amplicon sequences with QIIME 2’s q2-feature-classifier plugin. Microbiome 6:90 9. Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P et al (2013) The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res 41:D590–D596 10. Milani C, Casey E, Lugli GA, Moore R, Kaczorowska J, Feehily C et al (2018) Tracing mother-infant transmission of bacteriophages by means of a novel analytical tool for shotgun metagenomic datasets: METAnnotatorX. Microbiome 6:145 11. Zhao Y, Tang H, Ye Y (2012) RAPSearch2: a fast and memory-efficient protein similarity search tool for next-generation sequencing data. Bioinformatics 28:125–126 12. Milani C, Hevia A, Foroni E, Duranti S, Turroni F, Lugli GA et al (2013) Assessing the fecal microbiota: an optimized ion torrent 16S rRNA gene-based analysis protocol. PLoS One 8:e68739

Chapter 16 Resistance of Bifidobacteria Toward Antibiotics Miguel Gueimonde and Silvia Arboleya Abstract The genus Bifidobacterium constitutes one of the main groups of the human microbiota and some species have a long history of safe consumption supporting an excellent safety record. However, in the context of the increasing worldwide problems associate to the rise of pathogenic microorganisms with acquired resistance to antibiotics, the risk associated to the presence of antibiotic resistance determinants should always be a key starting point for the introduction of any microbial strain into the food chain. Bifidobacteria are not an exception and the presence of resistance to antibiotics is of interest since these microorganisms could potentially act as a reservoir of such resistances. In this context it is necessary to evaluate the presence of antibiotic resistance in any bifidobacterial strain to be included into the food chain. To this end, the first step is the determination of the antibiotic resistance pattern of the strain and the comparison with the susceptibility breakpoints for that species, allowing identifying the presence of atypical resistances in the strain. In this chapter we discuss the many efforts done to harmonize the methods used for the evaluation of antimicrobial susceptibility in the genus Bifidobacterium and the currently available guidelines. Moreover, we describe, in detail, the reference protocols used for evaluating the in vitro antimicrobial activity on bifidobacteria. Key words Bifidobacterium, Antibiotics, Resistance, Susceptibility, Methods

1

Introduction The introduction of any microorganism into the food chain must always be preceded by a careful identification and safety assessment of the strain(s) used. Regarding the genus Bifidobacterium the currently available data indicates that they are generally safe microorganisms, with a long history of safe consumption for some species. Bifidobacteria belong to the phylum Actinobacteria, which is one of the main groups of the human infant gut microbiota. Infections by bifidobacteria are extremely rare and the few cases reported in the literature have typically involved immunocompromised patients [1]. These, together with the epidemiological data on the consumption of bifidobacteria-based products, and the lack of side effects reported in the numerous intervention studies in which these bacteria were used, indicate an excellent safety record.

Douwe van Sinderen and Marco Ventura (eds.), Bifidobacteria: Methods and Protocols, Methods in Molecular Biology, vol. 2278, https://doi.org/10.1007/978-1-0716-1274-3_16, © Springer Science+Business Media, LLC, part of Springer Nature 2021

195

196

Miguel Gueimonde and Silvia Arboleya

Many in vitro tests have been used to evaluate the safety of bifidobacterial strains, always with positive results thus corroborating the safety status of these microorganisms [2]. Indeed, the species most widely used as probiotics have the Generally Recognized As Safe (GRAS) status in the USA and are included in the Qualified Presumption of Safety (QPS) list by the European Food Safety Authority (EFSA) [3]. Among the potential safety risks associated with these microorganisms is the presence of antibiotic resistance determinants, and their potential transferability to other bacteria. Since bifidobacteria are part of the human gut microbiota, and being consumed in large amounts in foods and supplements, the presence of genes conferring resistance to antibiotics may indeed represent a risk. It is important, however, to underline that the presence of resistance to a certain antibiotic, per se, may not pose safety risk; it is only considered a concern when there is a risk for horizontal transfer of that resistance to other microorganisms [4]. Therefore, the antibiotic-resistance genes in nonpathogenic microorganisms, such as bifidobacteria, may act as a genetic reservoir which may at some point be acquired by a pathogenic bacterium. This highlights the need for assessment of the presence of antibiotic resistance genes, and for evaluation of the risk of transference to other microorganisms, in any bifidobacterial strain to be included into the food chain [2]. Since the risk of transfer is related to the genetic basis of the resistance, it is important to determine the genetic basis behind an observed antibiotic resistance phenotype. When the resistance gene/s are carried on mobile genetic elements, the risks of horizontal transfer of resistance determinants between different microbes is perceived to be unacceptably high. In contrast, when the resistance is intrinsic, that is, acquired as a result of a chromosomal mutation(s) , the risk of transfer is considered to be very low. It is also important to point out that our knowledge in this context is still limited and the databases of antibiotic resistance genes may still be incomplete which in some cases makes it difficult to identify the gene, or genes, conferring the resistance phenotype to a particular strain. In this context, under the QPS approach, the EFSA indicates the need of assessing the presence of antibiotic resistances and, if present, its molecular basis for any strain to be used [3]. The first step to achieve this aim is the determination of the antibiotic resistance pattern of the strain and the comparison with resistance patterns of a representative number of different strains from the same species. This will allow for determining the susceptibility breakpoints for that species (likely due to intrinsic resistance) and then facilitating the identification of those strains showing atypical resistances (values above the species breakpoints). Unfortunately, for some species that have not been extensively studied there is still

Resistance of Bifidobacteria Toward Antibiotics

197

no agreement on the breakpoints to be used for most antibiotics, indicating the need for more studies [5]. Many efforts have also been done in order to harmonize the methods used for the evaluation of antimicrobial susceptibility and to define the susceptibility breakpoints [6]. An EU project (ACEART Project) funded some years ago substantially contributed to this task and has set the basis for subsequent development of both the International Standard ISO 10932:2010 [7] for the determination of the Minimal inhibitory concentration (MIC) of antibiotics applicable to bifidobacteria and nonenterococcal acid lactic bacteria, and the guidelines issued by EFSA on the assessment of bacterial susceptibility to antimicrobials of human and veterinary importance [8]. These documents constitute the current basis for the determination of the antibiotic susceptibility pattern of bifidobacteria and form the basis of the protocols presented in this chapter. 1.1 Antibiotic Resistance in Bifidobacteria

In the specific case of the genus Bifidobacterium some strains, including both intestinal and commercial strains, have been reported to present antibiotic resistance phenotypes [9, 10]. In some cases these resistances have been found to be intrinsic, then representing a low risk of transferability. Very likely as a consequence of the lack of cytochrome-mediated drug transport, bifidobacteria exhibit resistance to high concentrations of aminoglycosides [11]. Similarly, since bifidobacteria are anaerobes and Gram-positive they often present resistance to metronidazole [12], and to Gram-negative spectrum antibiotics such polymyxin B. They are also intrinsically resistant to mupirocin, due to the presence of an atypical isoleucyl-tRNA synthetase [13]. In contrast, most often Bifidobacterium strains are susceptible to beta-lactams, macrolides, vancomycin, chloramphenicol, or rifampicin, among others [2, 13], whereas their susceptibility to cephalosporins is variable [14]. Some strains have been found to be resistant to streptomycin, which has been linked to a mutation on the rpsL gene [15, 16], and mutations in the 23S ribosomal RNA gene have been linked to resistance to erythromycin [16]. In all these cases, since the resistances are due to chromosomal mutations, the risk of transferability remains low. In some other cases the genes conferring resistance to antibiotics have been found in, or close to, mobile genetic elements suggesting a potential risk of transfer to other bacteria in the intestinal ecosystem. The erythromycin resistance gene erm(X) was found within the transposon Tn5432 in some strains of Bifidobacterium animalis subsp. lactis and Bifidobacterium thermophilum [17]. A recent study identified in Bifidobacterium breve a gene conferring resistance to erythromycin and clindamycin and that seems to have been recently acquired by the strain [18]. However, the most widely distributed antibiotic resistance genes in the genus Bifidobacterium are those conferring resistance to tetracycline. The

198

Miguel Gueimonde and Silvia Arboleya

presence of tet genes is common in bifidobacteria [19, 20], tet(W), tet(M), tet(O), tet(S), tet(W/32/O), and tet(O/W) have been repeatedly observed in different species, including Bifidobacterium longum, Bifidobacterium longum subsp. infantis, B. breve, B. animalis subsp. lactis, Bifidobacterium bifidum, Bifidobacterium pseudocatenulatum, and B. thermophilum [20–26]. The gene tet (W) is especially ubiquitous; it has been detected at high frequencies in B. longum strains and in all B. animalis subsp. lactis strains analyzed until now [20, 23, 27]. This seems to be integrated in the bifidobacteria chromosome and its surrounding regions vary depending on the strain, but often the gene is flanked by transposases, suggesting that there may be a risk of transference to other bacteria [17, 20, 22, 23]. 1.2 In Vitro Methods for Evaluating the Antimicrobial Activity in Bifidobacteria

Different methods were suggested to test the antimicrobial susceptibility of bacteria including diffusion methods, thin-layer chromatography (TLC)-bioautography, and dilution methods [28]. Most of these techniques are used to determine the MIC of the antimicrobial, which is defined as the lowest concentration of the compound (expressed in micrograms per milliliter) that, under defined in vitro conditions, prevents visible growth of bacteria within a defined period of time [7]. Following the definition used by EFSA a bacterium is susceptible when its growth is inhibited at a concentration of a specific antimicrobial equal to or lower than the established cutoff value (S  x mg/l); and it is resistant when it is able to grow at a concentration of a specific antimicrobial compound higher than the established cutoff value (R > x mg/l) [29]. As mentioned above a problem that may arise is the lack of previously stablished cutoff values for a certain species. The broth microdilution method implicates preparing a battery of twofold dilutions of the drug. Then, the bacteria are inoculated from a standardized suspension in the same broth medium at a final concentration of 1–5  105 cfu/ml or 0.5–1 McFarland scale. After incubating at optimal growth conditions and time for the test bacteria (in the case of bifidobacteria under anaerobic conditions and 48 h) visible bacterial growth evidenced by turbidity or growth on the bottom of the plate is examined. The main advantage of this method is the generation of quantitative results (i.e., the MIC) and the possibility to test several antimicrobials simultaneously using 96-well plates. However, it is a tedious technique when manual preparation of the antibiotics is needed. To save this disadvantage some ready-to-use microdilution antibiotic panels are commercially available, allowing for better reproducibility and time-saving during the procedure. When using this method the MIC is determined and acceptable when is in the range of plus or minus 1 twofold from the expected MIC value. The broth microdilution assay is the most widely used method and is the one recommended by the International Standard ISO 10932:2010 [7].

Resistance of Bifidobacteria Toward Antibiotics

199

Among the agar diffusion methods, a commonly described and used approach is the antimicrobial gradient method. This technique is based on the establishment of an antimicrobial concentration gradient in the agar medium. Commercial strips permeated with a dried antibiotic concentration gradient are available for different antimicrobials, facilitating this task. To perform the test the antibiotic strip, containing the antibiotic concentration gradient, is deposited on an agar plate previously inoculated with the target microorganisms at a final concentration of 1  108 cfu/ml. Then the plate is incubated under the optimal conditions and time for the test bacteria. After incubation, MIC values are determined at the intersection of the strip and the growth inhibition ellipse. The lack of accuracy renders this method merely semiquantitative. It is important to underline that, generally, qualitative or semiquantitative methods such as this one are not acceptable to EFSA. However, they are justified, under specifics circumstances such as cases in which the antimicrobial agent is not available otherwise [29]. Nevertheless, it is also important to point out that this technique allows testing the interaction of two drugs, thus resulting of interest in some studies. Regardless of the method used for MIC determination the previous steps of preparation of the bacterial culture and inoculum are extremely important. It is well known that different factors can affect to the results and reproducibility of antimicrobial susceptibility test and MIC determination. Among there the inoculum size and preparation method, the incubation time, the growth media used, etc., are of outmost importance. For this reason results critical to use standardized method for the bacteria of interest whenever such method is available. In this chapter, we are describing two protocols for evaluating the in vitro antimicrobial activity on bifidobacteria, one for the broth microdilution and the other for the antimicrobial gradient method, following indications by EFSA [29] and the International Standard ISO 10932:2010 [7].

2

Materials Prepare all culture media using distillated water and buffers using Milli-Q water. Prepare all reagents at room temperature and store at 4  C in the dark (unless indicated otherwise).

2.1

Culture Media

Bifidobacteria are grown in MRS-cysteine agar medium; however, the medium required for antibiotic susceptibility test in bifidobacteria is LSM-cysteine broth. The composition and preparation of these media is as indicated below, there are, however, different commercial providers from which ready-to-use culture media can be bought (see Chapters 1 and 6 of this book).

200

Miguel Gueimonde and Silvia Arboleya

2.1.1 MRS-Cysteine (MRSC) Agar Medium

Dissolve the following ingredients in water by agitation: 10 g of peptone (tryptic digest of casein); 10 g of meat extract; 5 g of yeast extract; 20 g of glucose; 2 g of dipotassium hydrogen phosphate (K2HPO4); 5 g of sodium acetate trihydrate (NaCH3CO2·3H2O); 2 g of diammonium citrate ((NH4)2HC6H5O7); 0.2 g of magnesium sulfate heptahydrate (MgSO4·7H2O); 0.05 g of manganese sulphate tetrahydrate (MnSO4·4H2O); 0.03 g of L-cysteine hydrochloride; 20 g of agar; 1 ml of Tween 80; and water up to 1 l (see Note 1). Adjust the pH to 6.35  0.2 with dilute hydrochloric acid (HCl) or diluted sodium hydroxide (NaOH) (see Note 2). Sterilize in an autoclave by 15 min at 121  C. Keep it at 48  C  2  C. After sterilization pH should be 6.2  0.2. Pour 15 ml to 20 ml into Petri dishes and allow them to solidify. MRSC agar plates may be stored at 4  C in the dark for up to 1 week.

2.1.2 MRS-Cysteine (MRSC) Broth Medium

MRS broth is prepared following indications in Subheading 2.1.1 buy without adding agar to the media. MRSC broth may be stored at 4  C in the dark for up to 1 week.

2.1.3 ITS Broth Medium

Dissolve the following ingredients in water by agitation: 11 g of hydrolyzed casein; 3 g of peptone; 2 g of glucose; 3 g of sodium chloride; 1 g of soluble starch; 2 g of disodium hydrogen phosphate; 1 g of sodium acetate; 0.2 g of magnesium glycerophosphate; 0.1 g of calcium gluconate; 0.001 g of cobalt(II) sulfate; 0.001 g of copper(II) sulfate; 0.001 g of zinc sulfate; 0.001 g of iron (II) sulfate; 0.002 g of manganese(II) chloride; 0.001 g of menadione; 0.001 g of cyanocobalamin, 0.02 g of L-cysteine hydrochloride; 0.02 g of L-tryptophan; 0.003 g of pyridoxine; 0.003 g of pantothenate; 0.003 g of nicotinamide; 0.000 3 g of biotin; 0.000 04 g of thiamine; 0.01 g of adenine; 0.01 g of guanine; 0.01 g of xanthine; 0.01 g of uracil; and water up to 1 liter (see Note 3). Sterilize in an autoclave by 15 min at 121  C. ITS medium may be stored at 4  C in the dark for up to 1 week.

2.1.4 LSM-Cysteine Broth Medium

LSM medium is formulated by mixing 90% of ITS broth and 10% of MRS broth media. Prepare ITS broth medium and MRS broth medium (without L-cysteine hydrochloride) separately and without autoclaving. Mix 90 ml of ITS broth media (Subheading 2.1.3) and 10 ml of MRS broth media (Subheading 2.1.2). Add 0.03 g of Lcysteine hydrochloride into the 100 ml of LSM medium. Adjust the pH to 6.85  0.1 with dilute HCl or diluted NaOH. Sterilize in an autoclave by 15 min at 121  C. After sterilization pH should be 6.7  0.1. LSM-cysteine medium may be stored at 4  C in the dark for up to 1 week.

Resistance of Bifidobacteria Toward Antibiotics

201

Table 1 Antibiotics required by EFSA, its concentration range on microdilution plate and the double strength dilutions Antibiotic

Final concentration range (μg/ml)

Double strength dilutions (μg/ml)

Gentamicin

0.5 to 256

1 to 512

Kanamycin

2 to 1024

4 to 2048

Streptomycin

0.5 to 256

1 to 512

Tetracycline

0.125 to 64

0.25 to 128

Erythromycin

0.016 to 8

0.032 to 16

Clindamycin

0.032 to 16

0.063 to 32

Chloramphenicol

0.125 to 64

0.25 to 128

Ampicillin

0.032 to 16

0.063 to 32

Vancomycin

0.25 to 128

0.5 to 256

2.1.5 LSM-Cysteine Agar Medium

LSM-cysteine agar is prepared following indications in Subheading 2.1.4 with the addition of agar at 2% (w/v) to the media. LSM-cysteine agar may be stored at 4  C in the dark for up to 1 week.

2.2 Microdilution Plates

Prepare the microdilution plates by adding each antibiotic to be tested at final double strength for the range of dilutions (Table 1), by making twofold dilutions from an antibiotic stock in Milli-Q water. Dispend 50μl of each double strength dilution into the wells of the microdilution plate from the second to the eleventh column, keeping columns 1 and 12 empty (Table 2). Sealed microdilution plates may be stored at 20  C for several months.

2.3 Equipment and Consumables

Glassware resistant to higher temperatures; anaerobic incubators capable of maintaining constant temperature at 37  C  1  C; autoclave capable of maintaining constant temperature at 121  C  1  C; pH meter with an accuracy of 0.1 pH unit at 25  C; calibrated micropipettes; sterile petri dishes; sterile test tubes; sterile cotton swabs; sterile forceps; McFarlane turbidity standards; spectrophotometer capable of measuring optical density at 625 nm; sterile microdilution plates; sterile tips.

3

Methods

3.1 Culture Conditions of Bifidobacteria

Reactivate bifidobacterial strains from frozen stocks on MRSC agar medium by 48 h incubation at 37  C in an anaerobic atmosphere (see Note 5).

202

Miguel Gueimonde and Silvia Arboleya

Table 2 Layout of microdilution plate (see Note 4) Antibiotic

1

2

3

4

5

6

7

8

9

10

11

Gentamicin

1

2

4

8

16

32

64

128

256

512

Kanamycin

4

8

16

32

64

128

256

512

1024

2048

Streptomycin

1

2

4

8

16

32

64

128

256

512

Tetracycline

0,25

0,5

1

2

4

8

16

32

64

128

Erythromycin

0,032

0,063

0,125

0,25

0,5

1

2

4

8

16

Clindamycin

0,063

0,125

0,25

0,5

1

2

4

8

16

32

Chloramphenicol

0,25

0,5

1

2

4

8

16

32

64

128

Ampicillin

0,063

0,125

0,25

0,5

1

2

4

8

16

32

Vancomycin

0,5

1

2

4

8

16

32

64

128

256

12

Bifidobacterium longum ATCC 15707 should be tested in parallel with the bifidobacterial target strain as quality control in the broth dilution assay, following the identical culture conditions cited above. Enterococcus faecalis ATCC 29212 can be tested in parallel with the bifidobacterial target strain as quality control in the E-test, following the same culture conditions then for bifidobacteria [6]. 3.2 Broth Microdilution Assay

This method is performed in a 96-well plate for testing several antibiotics at the same time. Protocol is based on ISO 10932:2010 [7] indications.

3.2.1 Inoculum Preparation

Pick up individual colonies from an MRSC agar plate and suspend them in a sterile tube containing 5 ml of prereduced LSM-cysteine broth medium. Suspend colonies until the turbidity reaches an optical density at 625 nm of 0.2 by spectrophotometer or McFarland standard 1, which corresponds about 3  108 cfu/ml (see Note 6). Dilute the bacterial suspension 500 times (see Note 7) in prereduced LSM-cysteine broth medium (see Note 8).

3.2.2 Microdilution Plate Filling

Distribute 50μl of the diluted suspension into each well, with the only exception of the negative control column (Table 3), in less than 30 min from its preparation (see Notes 9 and 10). The final bacterial concentration should be 3  104 cfu/well. The final concentration of the antibiotic is showed in Table 3. Distribute 50μl of the prereduced LSM-cysteine broth medium in the last column as negative control. Incubate plates for 48 h at 37  C in an anaerobic atmosphere (see Notes 11 and 12).

Resistance of Bifidobacteria Toward Antibiotics

203

Table 3 Plate of microdilution with final antibiotic concentration for MIC determination. Showed antibiotics required by EFSA for bifidobacteria. P: positive control; N: negative control Antibiotic

1

2

3

4

5

6

7

8

9

10

11

12

Gentamicin

P

0,5

1

2

4

8

16

32

64

128

256

N

Kanamycin

P

2

4

8

16

32

64

128

256

512

1024

N

Streptomycin

P

0,5

1

2

4

8

16

32

64

128

256

N

Tetracycline

P

0,125

0,25

0,5

1

2

4

8

16

32

64

N

Erythromycin

P

0,016

0,032

0,063

0,125

0,25

0,5

1

2

4

8

N

Clindamycin

P

0,032

0,063

0,125

0,25

0,5

1

2

4

8

16

N

Chloramphenicol

P

0,125

0,25

0,5

1

2

4

8

16

32

64

N

Ampicillin

P

0,032

0,063

0,125

0,25

0,5

1

2

4

8

16

N

Vancomycin

P

0,25

0,5

1

2

4

8

16

32

64

128

N

3.2.3 MIC Reading

Read the plates after 48 h of incubation. Firstly, check if negative control wells have visible growth in the bottom. If any microbial contamination is detected, discard plate. If negative control is clear, check positive control wells. If both are correct, determine the MIC by comparing visually the growth with the positive control (Fig. 1). Discard any series of wells where the growth was not continuous. MIC concentration is expressed in micrograms/milliliter (μg/ml).

3.3 Antimicrobial Gradient Method (E-Test)

Epsilometer test (E-test) is a commercial “read to use” strip with an already predefined antimicrobial gradient, covering a continuous concentration range (bioMerieux SA). E-test protocol is performed based on company (https://www.biomerieux.es) and Huys et al. [30] indications.

3.3.1 Inoculum Preparation

Pick up individual colonies from an MRSC agar plate and suspend them in a sterile tube containing 5 ml of prereduced LSM-cysteine broth medium. Suspend colonies until the solution turbidity reaches an optical density corresponding to a McFarland standard of 1, which corresponds about 3  108 cfu/ml (see Note 6).

3.3.2 Agar Plate Inoculation and Strip Application

Swab the suspension onto LSM-cysteine agar plates (4.0  0.5 mm) three times by rotating the plate approximately 60 each time using a sterile cotton swab. Dry the plates by 15–20 min until the surface is completely dry before applying the Etest gradient strips. Take out the strip from an unopened package using forceps or other manual applicator and place on the agar plate (see Note 13). Three to six strips can be placed on the same plate when using a plate with a diameter of 150 mm; and two strips can be placed on

204

Miguel Gueimonde and Silvia Arboleya

Fig. 1 Broth dilution assay for different antibiotics using 96-well plate. Two examples of MICs determination are shown (circled in yellow), also positive and negative controls are indicated

Fig. 2 Template for 2 strips per 90 mm plate; and template for 4 strips per 150 mm plate

the same plate when using a 90 mm diameter plate (Fig. 2) (see Note 14). Ensure that the whole strip is in contact with the agar surface. Leave the MIC scale facing upward. Strips cannot be moved once they were applied due to instantaneous release of antibiotic into the agar. Incubate plates in an inverted position (lid down) for 48 h at 37  C in an anaerobic atmosphere (see Note 15). Incubate a LSM-cysteine agar plate inoculated with strain as control of correct growth; and LSM-cysteine agar plate as negative control.

Resistance of Bifidobacteria Toward Antibiotics

205

Fig. 3 Etest inhibition ellipse showing the MIC 3.3.3 MIC Reading

4

Read the plates after 48 h of incubation. Firstly, check if the negative control agar plate is clear. Secondly, check if the positive agar plates display a regular and good growth. If both are correct, determine the MIC as the first point on the Etest strip where the growth did not occur along the inhibition ellipse (see Note 16). MIC concentration is expressed in micrograms/milliliter (μg/ml) (Fig. 3).

Notes 1. MRS can be purchased in dehydrated form from different commercial vendors and supplemented with L-cysteine. 2. Diluted HCl (1 N) or NaOH (1 M) can be used to avoid a sudden drop or rise in the required pH. 3. ITS can be purchased in dehydrated form from different commercial vendors as Iso-Sensitest medium and supplemented with L-cysteine. 4. Antibiotic microdilution plates can be purchased from the National Veterinary Institute (Uppsala, Sweden): VetMIC™ antibiotic precoated microdilution plates. The Vet-MIC system is a commercially available microtiter-based system comprised of dried antimicrobials in serial twofold dilutions that can be stored for 2 years at room temperature. It consists of two 96-well plates (Lact-1 and Lact-2) for testing 16 different antibiotics, which comprised the 9 antibiotics required by EFSA for bifidobacteria. 5. If a bifidobacterial strain does not grow well directly on the agar plate, it can be recovered from a liquid culture of MRSC broth incubated at 37  C under anaerobic conditions for 24–48 h, after which it may be grown on plate. On the other hand,

206

Miguel Gueimonde and Silvia Arboleya

another carbon source can be tested. Another option is to use Reinforced Clostridial Medium (RCM) for those fastidious bifidobacterial strains that cannot grow directly from frozen stocks in MRS. 6. McFarland turbidity standards do not guarantee the exactly count of viable cells desired. Before starting, evaluate the colony counts of the target strain to verify that the inoculum procedure gives the correct number of viable cells in cfu/ml. 7. If precoated microdilution Vet-MIC plates are used, the bacterial suspension has to be diluted 1000-fold to get the final concentration on plate of 3  104 cfu/well. 8. About 10 ml of final volume is required for a 96-well plate. 9. If precoated microdilution Vet-MIC plates are used, 100μl of the diluted suspension has to be distributed into each well. 10. Use a multichannel pipette for saving time in the plate filling. 11. If plates are incubated in anaerobic jars, a lid between every two plates has to be used to generate a homogeneous environment. 12. If there is no growth for the positive control, the strain could be sensitive to the buffer used for the antibiotic dilution. Try to repeat the test with 100μl of the diluted suspension (200 for μl VetMIC plates). MICs concentration should be adjusted accordingly. 13. Strips should be used at room temperature. If strips container is kept in fridge or freezer, remove and allow to reach room temperature before using. 14. For those bifidobacterial strains that are expected to be highly susceptible, use only one strip per 90 mm plates. 15. Do not pile the plates in stacks higher than 5. 16. Important reading interpretations (obtained from E-Test Antimicrobial Susceptibility Testing protocol; bioMe´rieux SA; https://www.biomerieux-diagnostics.com): (a) For bacteriostatic agents (tetracycline, clindamycin, and erythromycin), MIC is determined by the point where growth was inhibited by 80% (the first point of significant inhibition as judged by the naked eye). (b) For bactericidal agents (ß-lactams), MIC is always read at the point of complete inhibition of all growth, including hazes, microcolonies and isolated colonies. When macrocolonies are present within the ellipse read all macrocolonies within 1–3 mm from the strip. (c) When growth occurs along the entire strip and no inhibition ellipse is seen, report the MIC as  the highest value on the MIC scale. When the inhibition ellipse is below the strip (does not intersect the strip), report the MIC < the lowest value on the MIC scale.

Resistance of Bifidobacteria Toward Antibiotics

207

(d) If inhibition ellipses for clindamycin, erythromycin, or chloramphenicol “dip” at the endpoint, extrapolate the MIC at the initial indentation, that is, 0.5–1 dilution above the intersection. (e) Vancomycin inhibition ellipses can be slim. Read the actual intersection at the strip and not growth “hugging” the side of the strip. References 1. Esaiassen E, Hjerde E, Canavagh JP (2017) Bifidobacterium bacteremia: clinical characteristics and a genomic approach to assess pathogenicity. J Clin Microbiol 55:2234–2248 2. Lahtinen SJ, Boyle RJ, Margolles A, Frias R, Gueimonde M (2009) Safety assessment of probiotics. In: Charalampopoulos D, Rastall RA (eds) Prebiotics and probiotics science and technology. Springer-Verlag, Heidelberg, Germany 3. EFSA (2012) European food safety authority panel on biological hazards. Scientific opinion on the maintenance of the list of QPS biological agents intentionally added to food and feed (2012 update). EFSA J 10:3020 4. EFSA (2008) Update of the criteria used in the assessment of bacterial resistance to antibiotics of human or veterinary importance. EFSA J 732:1–15 5. Połka J, Morelli L, Patrone V (2016) Microbiological cutoff values: a critical issue in phenotypic antibiotic resistance assessment of lactobacilli and bifidobacteria. Microb Drug Resist 22:696–699 6. M€atto¨ J, van Hoek AH, Doming KJ et al (2007) Susceptibility of human and probiotic Bifidobacterium spp. to selected antibiotics as determined by the Etest method. Int Dairy J 17:1123–1131 7. ISO 10932:2010. Milk and milk productsDetermination of the minimal inhibitory concentration (MIC) of antibiotics applicable to bifidobacteria and non-enterococcal lactic acid bacteria (LAB). International Organization for Standardization 8. EFSA (2012) Guidance on the assessment of bacterial susceptibility to antimicrobials of human and veterinary importance. EFSA J 10:2740 9. Duranti S, Lugli GA, Mancabelli L et al (2017) Prevalence of antibiotic resistance genes among human gut-derived bifidobacteria. Appl Environ Microbiol 83:e02894–e02816

10. Xu F, Wang J, Guo Y et al (2018) Antibiotic resistance, biochemical typing, and PFGE typing of Bifidobacterium strains commonly used in probiotic health foods. Food Sci Biotechnol 27:467–477 11. Mayrhofer S, Mair C, Kneifel W, Domig KJ (2011) Susceptibility of bifidobacteria of animal origin to selected antimicrobial agents. Chemother Res Pract 2011:989520 12. Fang H, Edlund C, Hedberg M, Nord CE (2002) New findings in beta-lactam and metronidazole resistant Bacteroides fragilis group. Int J Antimicrob Agents 19:361–370 13. Gueimonde M, Sanchez B, de los Reyes-Gavila´n VG, Margolles A (2013) Antibiotics resistance in probiotic bacteria. Front Microbiol 4:202 14. Zhou JS, Pillidge CJ, Gopal PK, Gill HS (2005) Antibiotic susceptibility profiles of new probiotic Lactobacillus and Bifidobacterium strains. Int J Food Microbiol 98:211–217 15. Kiwaki M, Sato T (2009) Antimicrobial susceptibility of Bifidobacterium breve strains and genetic analysis of streptomycin resistance of probiotic B. breve strain Yakult. Int J Food Microbiol 134:211–215 16. Sato T, Lino T (2010) Genetic analyses of the antibiotic resistance of Bifidobacterium bifidum strain Yakult YIT 4007. Int J Food Microbiol 137:254–258 17. van Hoek AH, Mayrhofer S, Domig KJ, Aarts HJ (2008) Resistance determinant erm(X) is borne by transposon Tn5432 in Bifidobacterium thermophilum and Bifidobacterium animalis subsp. lactis. Int J Antimicrob Agents 31:544–548 18. Martinez N, Luque R, Milani C et al (2018) A gene homologous to rRNA methylase genes confers erythomycin and clindamycin resistance in Bifidobacterium breve. Appl Environ Microbiol 84:e02888–e02817 19. Scott KP, Melville CM, Barbosa TM, Flint HJ (2000) Occurrence of the new tetracycline

208

Miguel Gueimonde and Silvia Arboleya

resistance gene tet(W) in bacteria from the human gut. Antimicrob Agents Chemother 44:775–777 20. Gueimonde M, Flo´rez AB, van Hoek AH et al (2010) Genetic basis of tetracycline resistance in Bifidobacterium animalis subsp. lactis. Appl Environ Microbiol 76:3364–3369 21. Flo´rez AB, Ammor MS, Alvarez-Martı´n P, Margolles A, Mayo B (2006) Molecular analysis of tet(W) gene-mediated tetracycline resistance in dominant intestinal Bifidobacterium species from healthy humans. Appl Environ Microbiol 72:7377–7379 22. Kazimierczak KA, Flint HJ, Scott KP (2006) Comparative analysis of sequences flanking tet (W) resistance genes in multiple species of gut bacteria. Antimicrob Agents Chemother 50:2632–2639 23. Ammor MS, Flo´rez AB, Alvarez-Martı´n P, Margolles A, Mayo B (2008) Analysis of tetracycline resistance tet(W) genes and their flanking sequences in intestinal Bifidobacterium species. Antimicrob Chemother 62:688–693 24. van Hoek AH, Mayrhofer S, Domig KJ et al (2008) Mosaic tetracycline resistance genes and their flanking regions in Bifidobacterium thermophilum and Lactobacillus johnsonii. Antimicrob Agents Chemother 52:248–252

25. Aires J, Thouverez M, Doucet-Populaire F, Butel MJ (2009) Consecutive human bifidobacteria isolates and acquired tet genes. Int J Antimicrob Agents 33:291–293 26. Wang N, Hang X, Zhang M, Liu X, Yang H (2017) Analysis of newly detected tetracycline resistance genes and their flanking sequences in human intestinal bifidobacteria. Sci Rep 7:6267 27. Aires J, Doucet-Populaire F, Butel MJ (2007) Tetracycline resistance mediated by tet(W), tet (M), and tet(O) genes of Bifidobacterium isolates from humans. Appl Environ Microbiol 73:2751–2754 28. Balouiri M, Sadiki M, Ibnsouda SK (2016) Methods for in vitro evaluating antimicrobial activity: a review. J Pharm Anal 6:71–79 29. EFSA (2018) Guidance on the characterisation of microorganisms used as feed additives or as production organisms. EFSA J 16(3):5206 30. Huys G, D’Haene K, Cnockaert M et al (2010) Intra- and interlaboratory performances of two commercial antimicrobial susceptibility testing methods for bifidobacteria and nonenterococcal lactic acid bacteria. Antimicrob Agents Chemother 54:2567–2574

Chapter 17 In Vitro Assessment of Prebiotic Activity Alberto Amaretti, Stefano Raimondi, Nicola Volpi, and Maddalena Rossi Abstract Bifidogenic effect is a main target for the assessment of prebiotic activity. pH-controlled batch processes of bifidobacteria and fecal microbiota are herein presented. Growth of bifidobacteria, carbohydrate breakdown and consumption, organic acid production, and activity of specific glycosyl hydrolases involved in the hydrolysis of di-, oligo-, or polysaccharides are exploited to study and compare substrate preference of bifidobacteria for candidate prebiotics. Key words Prebiotic, Bifidobacterium, Microbiota cultures, Bioreactor, Batch, HPTLC-AMD, HPAEC-PAD, Glycosyl-hydrolase

1

Introduction Prebiotics are substrates selectively utilized by host microorganisms that confer a health benefit, generally observed as a reduction of risk or burden of disease, according to the consensus definition proposed by the International Association for Probiotics and Prebiotics [1]. The selective utilization of prebiotics by beneficial bacteria residing in the colon differentiates them from other undigested substrates that are fermented by a wide range of gut microorganisms. For most of the first prebiotics assessed in humans, selectivity was determined based on the abundance increase of indigenous bifidobacteria and lactobacilli. Bifidobacteria have remained a main target of prebiotics, while gut-resident lactobacilli represented a minor group of gut bacteria and were less prone to thrive [2, 3]. A large number of human intervention studies demonstrated that dietary consumption of prebiotics, such as Fructooligosaccharides (FOS), galactooligosaccharides (GOS), and xylooligosaccharides (XOS), determined changes in the composition of the gut microbiota, mostly in terms of an increase of bifidobacteria, associated to the positive modulation of health biomarkers [4]. Nowadays, a deeper knowledge of colonic bacteria and their role resulted in the identification of other targets, such as

Douwe van Sinderen and Marco Ventura (eds.), Bifidobacteria: Methods and Protocols, Methods in Molecular Biology, vol. 2278, https://doi.org/10.1007/978-1-0716-1274-3_17, © Springer Science+Business Media, LLC, part of Springer Nature 2021

209

210

Alberto Amaretti et al.

Akkermansia muciniphila and the butyrate producers Roseburia spp. and Faecalibacterium prausnitzii [5, 6]. However, bifidobacteria persist as a main marker of the response to prebiotics. The affinity of bifidobacteria for a candidate prebiotic can be evaluated in pure cultures in a medium containing the carbohydrate of interest as the sole fermentable carbon source [7, 8]. Cultures require pH-controlled bioreactors, in order to avoid the inhibition due to lowering of pH, and accurate monitoring of biomass, carbohydrates, and fermentation products. Nonlinear least-square analysis of reproducible and controlled processes can yield the best-fit values of mechanistic kinetic parameters (maximum specific growth rate, saturation constants, yields, etc.) mathematically describing the substrate preference and affinity of bifidobacteria [7, 9]. An in vitro model of gut microbiota is useful to evaluate the impact of the candidate prebiotic on the bacterial community and the capability of bifidobacteria to ferment it competing with a multitude of gut microbes [10, 11]. pH-controlled microbiota cultures are run in a complex medium where the tested carbohydrate is the sole fermentable carbon source, and growth of bifidobacteria and other relevant microbial groups can be monitored by culture dependent or independent techniques, encompassing qPCR and metagenome analysis.

2 2.1

Materials Media

1. Prepare media and the stock solutions with distilled water and autoclave at 121
C for 30 min, unless otherwise stated. 2. Sterilized carbohydrate solutions are prepared separately. Thermally unstable oligosaccharides are filter-sterilized at 0.22 μm. If insoluble or too viscous, carbohydrates are autoclaved with the basal medium. 3. Modified De Man, Rogosa, Sharpe Medium (mMRS): For 1 L of medium, dissolve all the components enlisted in Table 1 in 900 mL of water, adjust the pH to 6.8–7.0, autoclave, and add 100 mL of 100 g/L carbohydrate sterile solution. 4. Semisynthetic medium (SSM) [7]: For 1 L of medium, dissolve all the components enlisted in Table 2 in 900 mL of water, adjust the pH to 6.8–7.0, autoclave, and add 100 mL of 50 g/ L carbohydrate sterile solution. Yeast nitrogen base without amino acids can be substituted with the corresponding components on the basis of strain specific requirements (Table 3) [12]. 5. Fermenter medium for microbiota cultures (FM) [13, 14]: For 1 L, dissolve all the components enlisted in Table 4 in 840 mL and add 10 mL of hemin solution, 6 mL of Volatile fatty acid

In Vitro Assessment of Prebiotic Activity

211

Table 1 Formula for 1 L of basal mMRS medium Proteose peptone No. 3 (BD Difco)

10.0 g

Beef extract

10.0 g

Yeast extract

5.0 g

Sodium acetate

5.0 g

Ammonium citrate

2.0 g

K2HPO4

2.0 g

Polysorbate 80 (Tween 80)

1.0 g

Cysteine hydrochloride

0.5 g

MgSO4

0.1 g

MnSO4

0.05 g

Water

to 900 mL

Table 2 Formula for 1 L of SSM Sodium acetate

10.0 g

Yeast nitrogen base without amino acids (BD Difco)

6.7 g

Casaminoacids (BD Difco)

5.0 g

(NH4)2SO4

5.0 g

Urea

2.0 g

Polysorbate 80 (Tween 80)

1.0 g

Cysteine hydrochloride

0.5 g

MgSO4

0.2 g

NaCl

0.01 g

FeSO4

0.01 g

MnSO4

0.007 g

Water

to 900 mL

solution (VFA), and 0.6 mL of resazurin solution. Autoclave, then add the following sterilized components: 100 mL of 75 g/L carbohydrate, 2 mL of minerals, 1.4 mL of vitamins, and 40 mL of reducing solution (Table 5). (a) Hemin solution: dissolve 100 mg of hemin, 280 mg of KOH, 25 mL of ethanol 95% and add water to 100 mL. Store at 20
C.

212

Alberto Amaretti et al.

Table 3 Macro- and micronutrients contained in 6.7 g of yeast nitrogen base without amino acids Salts

Trace elements

Vitamins

(NH4)2SO4

5.0 g

H3BO3

0.5 mg

Inositol

2.0 mg

KH2PO4

1.0 g

MgSO4

0.4 mg

Calcium pantothenate

0.4 mg

MgSO4

0.5 g

ZnSO4

0.4 mg

Niacin

0.4 mg

NaCl

0.1 g

Na2MoO4

0.2 mg

Pyridoxine hydrochloride

0.4 mg

CaCl2

0.1 g

FeCl3

0.2 mg

Thiamine hydrochloride

0.4 mg

KI

0.1 mg

p-Aminobenzoic acid

0.2 mg

CuSO4

0.04 mg

Riboflavin

0.2 mg

Biotin

2.0 μg

Folic acid

2.0 μg

Table 4 Formula for 1 L of FM basal medium Peptone

5.0 g

Ammonium citrate

2.0

KH2PO4

2.0

NaCl

4.5

MgSO4

0.5

Bile salts (Oxgal)

50 mg

CaCl2

45 mg

FeSO4

5 mg

Water to

840 mL

(b) VFA: mix 10 M NaOH with acetic, propionic, butyric, isobutyric, valeric, and isovaleric acids in the following volume proportion: 50:29:10:5:2:2:2. Store at 20
C. (c) Resazurin solution: dissolve 10 mg of resazurin in 10 mL water. Store at 20
C. (d) Mineral solution: dissolve all the components enlisted in Table 5 in 1 L of water, autoclave, and store at 20
C. (e) Vitamin solution: dissolve all components listed in Table 5 in 1 L of water, filter sterilize at 0.22 μm, and store at 20
C. (f) Reducing solution: dissolve 0.5 g of cysteine HCl and 3 g of NaHCO3 in 40 mL of water and filter at 0.22 μm. Prepare fresh before use.

In Vitro Assessment of Prebiotic Activity

213

Table 5 Mineral and Vitamin solutions for FM medium Mineral solution EDTA

Vitamin solution 500 mg

Menadione

1 mg

Biotin

2 mg

ZnSO4

10 mg

Pantothenate

2 mg

MnCl2

3 mg

Nicotinamide

10 mg

H3BO3

30 mg

Vitamin B12

0.5 mg

CoCl2

20 mg

Folate

0.5 mg

CuCl2

1 mg

Thiamine

4 mg

NiCl2

2 mg

PABA

5 mg

NaMoO4

3 mg

Water

to 1 L

Water

to 1 L

Table 6 Formula for 1 L of RB salts solution and 1 L of RB medium RB salts solution

RB medium

NaHCO3

10.0 g

Raffinose

7.5 g

NaCl

2.0 g

Sodium propionate

15.0 g

K2PO4

1.0 g

Sodium caseinate

5.0 g

KH2PO4

1.0 g

Yeast extract

5.0 g

MgSO4

0.2 g

LiCl

3.0 g

CaCl2

0.2 g

Sodium acetate

2.5 g

Water

to 1 L

Cysteine hydrochloride

0.5 g

Sodium thioglycolate

0.5 g

RB salts solution

40.0 mL

Bromocresol purple, 5 g/L in 0.02 M NaOH

10.0 mL

Water

to 1 L

6. Raffinose Bifidobacterium medium (RB) [15]: for 1 L of RB medium, dissolve the ingredients enlisted in Table 6, including the salts according to the table, add water to 1 L, 18 g of agar, and autoclave. 2.2

Bioreactors

Fermentations are carried out in autoclavable benchtop stirred-tank bioreactors of 0.2–1 L working volume, equipped with the following:

214

Alberto Amaretti et al.

1. Connection to a CO2 or N2 supply, with autoclavable 0.22 μm air filters in both the gas inlet and outlet. 2. Automatic pH control and regulation: autoclavable pH-meter for in situ measurement of pH and feedback control circuit for activating peristaltic pumps with acid and alkali. 3. Online data logger of process parameters: it includes the cumulative time of activation of pH corrector pumps. 4. Ports and devices for aseptic addition of medium components (see Note 1). 5. Sterile sampling system (see Note 2). 2.3 Reagents and Solutions for Glycosyl-Hydrolase Assay

1. Z buffer: 0.1 M phosphate buffer, pH 7.0, containing 10 mM MgSO4 and 1 mM CaCl2. Store at 4
C. 2. 5% (v/v) Triton X-100 in Z buffer. Store at 4
C. 3. 1 M Na2CO3. Store at 4
C. 4. Nitrophenyl-sugar (NPS): 4 g/L 2-nitrophenyl or 4-nitrophenyl glycoconjugate in water (see Note 3). Prepare fresh before use. 5. Nitrophenol (NP) standard solutions: 0.2–2.0 mM solutions of 2-nitrophenol or 4-nitrophenol (depending on the NPS utilized) in water. Prepare fresh.

2.4 Reagents and Equipment for the Analysis of Carbohydrates and Organic Acids

1. Anthrone solution: 2 g/L anthrone in H2SO4 96%. 2. Oligosaccharides (e.g., FOS, GOS, and XOS with DP ~ 3–10) are analyzed by High Performance Thin Layer Chromatography with Automated Multiple Development (HPTLC-AMD, e.g., Camag, Muttenz, Switzerland), equipped with diol-silica HPTLC plates of 20  10 cm, is used to analyze. Acquisition of layers is performed with a densitometric scanner (e.g., TLC Scanner, Camag). 3. Oligo- and polysaccharides (e.g., inulin) are measured with High Performance Anion Exchange Chromatography with Pulsed Amperometric Detection (HPAEC-PAD, e.g., 4000i, Dionex, Sunnyvale, CA, USA). 4. Mono- and disaccharides and fermentation products such as ethanol and lactic, succinic, acetic, propionic, butyric, valeric, and isovaleric acids are measured with HPLC (e.g., 1200 System, Agilent Technologies, Waldbronn, Germany) equipped with UV and refractive index detector (HPLC-UV-RID) and with an ion exclusion column (Aminex HPX-87 H, Biorad, Hercules, California, USA).

In Vitro Assessment of Prebiotic Activity

3

215

Methods

3.1 Bioreactor Assembly

pH-controlled batch experiments in benchtop bioreactors are utilized to evaluate the performance of candidate prebiotics as a carbon source for both pure cultures of Bifidobacterium strains and microbiota cultures. The bioreactors are prepared as follow: 1. Fill the vessel of the bioreactor with the basal medium (mMRS, SSM, or FM) and add few drops of an antifoam agent (e.g., Xiameter DC-1510, Sigma). 2. Assemble the vessel, including the insertion of a calibrated pH electrode and the connection to the reservoirs of control solutions. 3. Autoclave at 121
C for 30 min. 4. Connect the sterile vessel to the control module. 5. Turn on gentle stirring (e.g., 150 rpm) and pressurize under constant flow (0.5 volume/volume/min) of filter sterilized CO2 or N2, continuing sparging until the vessel is inoculated. 6. Cool to 37
C utilizing the automatic temperature control system. 7. Insert the pipes of pH correctors in the peristaltic pumps, fill the reservoirs with alkali (4 M NaOH for pure Bifidobacterium cultures, 1 M NaOH for microbiota cultures) and acid (1 M HCl for microbiota cultures only), and manually activate the pumps to fill the pipes. 8. Reconstitute the medium with the aseptic addition of the carbon source and all the constituents that have been sterilized separately. 9. For Bifidobacterium pure cultures, sparge gas for at least 10 min before proceeding with the inoculation. For microbiota cultures, wait until the redox indicator resazurin changes the medium from reddish (aerobic) to gray (anaerobic), indicating that anaerobic conditions have been achieved, then proceed with inoculation (see Note 4).

3.2 Pure Culture Fermentations of Bifidobacteria

Carbohydrates preferences of Bifidobacterium strains is evaluated in mMRS or SSM containing the carbohydrate to be tested. A negative control is carried out with media without supplementation of a carbohydrate, while a positive one is carried out with lactose or FOS. All bifidobacterial cultures are incubated at 37
C in anaerobiosis (see Note 5). Culture preparation: 1. Thaw a frozen stock culture, maintained at 20 or 80
C, streak it onto glucose-based mMRS agar plates, and incubate for 16–48 h.

216

Alberto Amaretti et al.

2. Inoculate 10 mL of glucose-based mMRS with a single colony and incubate for 16–48 h. 3. Inoculate (5% v/v) 10 mL of the medium that will be utilized in bioreactor (i.e., mMRS or SSM) with the appropriate carbon source (see Note 6). 4. Inoculate (5% v/v) the seed culture for the bioreactor in a flask or bottle and incubate it until the late exponential phase (see Note 7). 5. Inoculate (5% v/v) the sterile and anaerobic bioreactor, containing the same medium and carbon source to which the strain has been adapted. 6. Set the pH target to 5.6–5.8 or to the optimum of the strain, if known, then switch the automatic control on. 7. Interrupt gas sparging and close both the gas inlet and outlet (see Note 8). 8. Activate data logging and start periodical sampling of the culture every 1–6 h and determine the time course of biomass concentration, residual carbohydrates, and fermentation products. 3.3 Setup of Microbiota Fermentations

Bioreactor cultures of microbiota are carried out in FM medium containing the carbohydrate to be tested. A negative control is carried out with the medium without carbon source, while a positive one can be carried out with inulin. Microbiota cultures are prepared as follow: 1. Collect fresh feces from healthy subjects who had not been treated with prebiotics and/or probiotics for 1 month, and antibiotics for at least 3 months. 2. Transfer the feces in the anaerobic cabinet (e.g., Concept plus, Baker-Ruskinn, Sanford, Maine, USA) within 2 h from defecation, in order to minimize the exposure of intestinal bacteria to oxygen (see Note 9). 3. Prepare a 10% w/v suspension of feces in anaerobic FM medium without carbohydrates: homogenize the suspension with a vortex and, if necessary, with the addition of sterile 1 mm glass beads. 4. Aliquot the suspension in an airtight bottle, on the basis of the volume necessary to inoculate the bioreactor, equipped with a sterile pipe that can be mounted in a peristaltic pump. 5. Inoculate (5% v/v) the sterile and anaerobic bioreactor, containing FM medium and the appropriate carbohydrate. 6. Set the pH target to 6.5, then switch the automatic control on. 7. Interrupt gas sparging and close both the gas inlet and outlet (see Note 8).

In Vitro Assessment of Prebiotic Activity

217

8. Activate data logging and start periodical sampling of the culture every 1–6 h and determine the time-course of microbiota composition and/or bifidobacteria concentration, residual carbohydrates, and fermentation products. 3.4 Monitoring of Growth

1. Turbidity (OD600): Read the turbidity at 600 nm of the pure Bifidobacterium culture, properly diluted in order to fit into the linearity range of the measure. 2. Dry weight (DW): (a) Centrifuge a known volume of pure Bifidobacterium culture (5–20 mL) at 7000  g for 10 min and discard the supernatant. (b) Wash the pellet three times with 20 mL of water. (c) Transfer the wet biomass onto a preweighted tray. (d) Dry the biomass to constant weight in a halogen moisture balance (see Note 10). 3. Viable counts of bifidobacteria: (a) Viable bifidobacteria of pure cultures are quantified by seeding serial dilutions of the culture onto plates of MRS-agar and incubating at 37
C in anaerobiosis for 24–38 h. (b) Viable bifidobacteria of fecal cultures are quantified by seeding serial dilutions of the culture onto plates of RB-agar and incubating at 37
C in anaerobiosis for 24–38 h.

3.5 Assay of Glycosyl-Hydrolases Activity

The activity of the specific glycosyl-hydrolases involved in hydrolysis of di-, oligo-, or polysaccharides potentially exerting prebiotic activity can be measured on the culture supernatant, whole cells, cell-free extract, and permeabilized cells [7, 8]. Any method suitable to analyze a glycosyl hydrolytic activity can be adapted and utilized for this purpose. Chromogenic NP-glycoconjugates are widely utilized in a simple spectrophotometric assay to quantify specific hydrolytic activities (see Note 3). The hydrolysis releases NP, a yellow chromophore with a high extinction coefficient at 420 nm in a slightly alkaline environment. One unit of glycosylhydrolase is defined as the amount of enzyme that releases 1 μmol NP per minute under the assay conditions. Specific activities of cell extracts or permeabilized cells, whole cells, and supernatants are expressed as units per milligram of dry biomass. 1. Preparation of supernatant, whole cells suspension, cell-free extract, and permeabilized cells. Keep all the samples in ice, unless otherwise stated. Cool the culture in ice and centrifuge at 6000  g for 10 min at 4
C to separate supernatant from cells.

218

Alberto Amaretti et al.

(a) Supernatant: filter the culture supernatant at 0.22 μm, dialyze it against 20 mM Tris pH 7.0 in a 14 kDa cutoff membrane at 4
C, and measure glycosyl hydrolase activity. (b) Whole cells: wash the pellet twice and concentrate it tenfold in cold Z buffer. Assay the washed cells to determine the activity of glycosyl hydrolase bound to the cell envelope. To determine intracellular activity, prepare cell-free extracts or permeabilized cells from washed cells suspension. (c) Cell-free extract: treat the washed cells suspension with a French Press or another physical cell disruptor (see Note 11). Remove the debris by centrifugation at 10,000  g for 10 min at 4
C and measure enzymatic activity. (d) Permeabilized cells: mix 0.5 mL of cell suspension with 0.5 mL of Triton X-100 solution, incubate at 37
C for 10 min, and measure enzymatic activity. 2. Glycosyl-hydrolase assay with chromogenic NP-glycoconjugates. (a) Add 0.2 mL of 4 g/L NP-sugar solution to 1 mL of sample (supernatant, whole cells, cell free extract, or permeabilized cells) properly diluted in Z buffer. (b) Incubate the mixture at 37
C for 3 min, then stop the reaction with 0.5 mL of 1 M Na2CO3. (c) Centrifuge at 13,000  g for 5 min and read the absorbance of the supernatant at 420 nm. (d) Determine the concentration of nitrophenol released, by comparison with a calibration curve, prepared incubating 0.2 mL of standard solutions from 0.2 to 2.0 mM NP with 1 mL of Z buffer, then adding 0.5 mL of 1 M Na2CO3. 3.6 Analysis of Carbohydrates and Metabolites

Utilize HPTLC-AMD technique to separate and quantify mono-, di-, and oligosaccharides, HPAEC-PAD to separate oligo- and polysaccharides, and HPLC-RID-UV to separate and quantify the fermentation products and simple sugars [7, 8, 16]. All the chromatographic analyses are carried out on centrifuged and filtered supernatants. Anthrone colorimetric assay is a robust method for the analysis of total carbohydrates, particularly useful for the ones with a complex structure and/or for which the standards are not available [17]. The assay is carried out on the supernatant for soluble carbohydrates or on the whole sample for insoluble ones.

In Vitro Assessment of Prebiotic Activity 3.6.1 Chromatographic Techniques

219

Cool the culture samples in ice and centrifuge at 12,000  g for 10 min at 4
C, then filter the supernatants (0.22 μm) and store it at 20
C until analyzed. 1. HPTLC-AMD protocol 1 (optimized for FOS). (a) Elute the sample with step-gradient mixtures of acetone– acetonitrile (1:1) and ultrapure water in different percentages (from 35 to 15% water) on a HPTLC layer (see Notes 12 and 13). (b) Air-dry the layers for 15 min. (c) For derivatization, treat the layers with 4-aminobenzoic acid reagent. (d) Dry the derivatized layer in an oven at 115
C. (e) Scan the developed layers with a densitometric scanner at a wavelength of 366 nm. The analytes are recognized based on their migration, compared to analytical standards, and quantified according to their area on the densitogram (see Notes 14 and 15). 2. HPTLC-AMD protocol 2 (optimized for GOS). (a) Elute the sample with step-gradient mixtures of ultrapure water and acetonitrile at different percentages (from 32% to 24% v/v water with a linear gradient) on a HPTLC layer (see Notes 12 and 13). (b) Air-dry the layers for 15 min. (c) For derivatization, treat the layers with lead(IV) acetate and 2,7-dichlorofluorescein, according to the method of Funk et al. [18]. (d) Scan the developed layers with a densitometric scanner at a wavelength of 366 nm. The analytes are recognized based on their migration, compared to analytical standards, and quantified according to their area on the densitogram (see Note 14 and 15). 3. HPTLC-AMD protocol 3 (optimized for xylose and XOS). (a) Elute the sample with a n-butanol:ethanol:water mixture (50:30:20%, v/v) on a HPTLC layer (see Notes 12 and 13). (b) Air-dry the layers for 15 min. (c) For derivatization, treat the layers for 5 s with an acetone solution of 9 mL/L aniline and 16.6 g/L phthalic acid. (d) Dry the layers for 10 min and incubate at 120
C for 20 min.

220

Alberto Amaretti et al.

(e) Scan the developed layers with a densitometric scanner at wavelength of 366 nm. The analytes are recognized based on their migration, compared to analytical standards and quantified according to their area on the densitogram (see Notes 14 and 15). 4. HPAEC-PAD (optimized for FOS and inulin). (a) Elute the sample in a Dionex CarboPac PA100 column connected to the associated guard column, utilizing a flow of 0.8 mL/min of a mixture of water (eluent 1), 0.6 M sodium hydroxide (eluent 2) and 0.5 M sodium acetate (eluent 3) and the following gradient program (eluents 1, 2, and 3 are expressed as percent v/v): 0 to 5 min, 89, 10, and 1; 5.1 to 45 min, 50, 20, and 30; 45.1 to 95 min 0, 25, and 75; 95.1 to 105 min, 0, 25, and 75 (see Notes 12 and 16). (b) The detector is set at the following detection waveform: E1, 0.10 V (t1 ¼ 0.50 s); E2, 0.60 V (t2 ¼ 0.08 s), E3, 0.60 V (t3 ¼ 0.05 s) (versus a silver-silver chloride reference electrode and a gold working electrode). (c) The integration of the signal occurs between 0.30 and 0.50 s. (d) Samples are injected using a Rheodyne model 9125 nonmetal (peek) injection valve with a peak sample loop of 10 μL. (e) Recognize the analytes based on their retention time, compared to the analytical standards, and quantify them according to the area of their chromatographic peaks (see Notes 14 and 15). 5. HPLC-RID-UV (optimized for mono- and disaccharides, ethanol and lactic, succinic, acetic, propionic, butyric, valeric, and isovaleric acids). (a) Elute the sample with 0.6 mL/min of 0.005 M H2SO4 through an ion exclusion column maintained at 60
C. (b) Acquire the chromatogram with both RID and the UV (λ ¼ 210 nm) detector (see Note 17). (c) Identify the analytes based on the retention time and quantify them utilizing the corresponding peak/concentration calibration curves. 3.6.2 Anthrone Colorimetric Assay

1. Mix the sample (1:2 v/v) with anthrone reagent and boil for 10 min at 100
C. 2. Cool in ice and read absorbance at 620 nm and compare it with a calibration curve in the range between 0 and 150 mg/L glucose.

In Vitro Assessment of Prebiotic Activity

4

221

Notes 1. A syringe can be utilized for the addition of small volumes (/path/to/smrtlink/smrtcmds/bin/bax2bam

*.bax.h5

-o

pacbio_reads.

The input files are the bax.h5 files (one file per SMRT Cell), and the output is a bam file named pacbio_reads.subreads.bam, containing all Pacbio subreads. In the case of Sequel datasets, the raw reads are provided already in bam format and no file conversion is required. 2. The second step of the protocol consists of preparation of the input files for canu (Pacbio only) or unicycler (Pacbio + Illumina) assemblers. In this step fastq files are extracted from the bam files and this can be performed using the bamtools suite: >bamtools convert -format fastq -in pacbio_reads.subreads.bam -out pacbio_reads.subreads.fastq

3. The fastq files produced by bamtools can then be used as input files for the de novo assembly. ä Fig. 1 (continued) execution pipeline consists of three main steps: (1) genome sequencing and obtaining raw reads; (2) de novo assembly, which can be performed either with Pacbio-only data or Pacbio/Illumina (hybrid assembly); (3) methylome analysis allowing for the detection of base modifications and methylated motifs in the sequenced genomes. The main output of this pipeline are two files: a reference genome in fasta format (the assembled bacterial chromosome, with eventual plasmids) and a csv file containing the computed methylated motifs resulting from the methylome analysis

Bifidobacterium Genome Assembly and Methylome Analysis Using Pacbio. . .

229

When starting from Pacbio only fastq reads, the assembly can be performed employing canu assembler. >canu -p assembly_prefix -d directory genomeSize¼3m -pacbio-raw pacbio_reads.subreads.fastq

In this example command -p represents the assembly prefix used to name the output, while -d specifies the assembly directory. As an additional parameter, the expected genome size can also be included. Once the assembly is finished, a file with extension *unitigs.fasta can be found in the assembly directory and this represents the reference fasta file to be used for methylome analysis. When starting from a mix of Pacbio (long reads) and Illumina (short reads) fastq files, the unicycler pipeline should be used to perform a hybrid assembly and retrieve the bacterial chromosome along with any present plasmids. >unicycler -1 illumina_R1.fastq -2 illumina_R2.fastq -l pacbio_reads.subreads.fastq -o assembly_prefix -t 10 --mode bold --start_genes DnaA-genes.fasta --start_gene_id 80 -start_gene_cov 80

When performing unicycler assembly Illumina paired-end reads can be combined with Pacbio long reads, in order to obtain a fully sequenced genome (i.e., the complete sequence of the chromosome plus any plasmids, if present). If a database of dnaA or plasmid replicase-encoding genes is provided (option –start_genes), the assembler can be instructed to circularize the complete chromosome and rotate the sequence to start the genome sequence with the replicase-encoding gene on the forward strand. 4. Once the assembly phase is complete and the reference chromosome (including plasmids) is obtained, the next step consists of the alignment of Pacbio data on this reference genome. The first stage of the alignment is the indexing of the reference sequence, which can be obtained using samtools and the following command: > samtools faidx reference.fasta

After indexing the reference fasta sequence, the next step is the alignment of the Pacbio subreads on the reference. This step can be performed using the pbalign function available as part of SMRT-Link: >/path/to/smrtlink/smrtcmds/bin/pbalign

--concordant

--hitPolicy¼randombest --minAccuracy 70 --minLength 50 -algorithmOptions¼"--minMatch 12 --bestn 10 --minPctIdentity 70.0" pacbio_reads.subreads.bam reference.fasta aligned_subreads.bam

The above command invokes pbalign to align the Pacbio subreads stored in bam format (pacbio_reads.subreads.bam) to the reference assembled chromosome (reference.fasta) and

230

Francesca Bottacini and Douwe van Sinderen

stores the output alignment in a new bam file (alignmed_subreads.bam). By default, the minimum percentage accuracy of the alignments is set at 70%, while the minimum aligned read length of alignments is set at 50 bp. The parameters for the BLASR aligner are specified by the --algorithmOption function and are set in a way that nearly identical reads to the reference are selected for the alignment. Basically, an accuracy of 70% and minimum anchor size of 12 a correctly mapped reads is expected to show at least 10 anchors (which is close to the theoretical computed value of 85% of accuracy over a minimum anchor size of 15) [5]. 5. Once the alignment is performed, a subsequent polishing step can be performed using quiver: >/path/to/smrtlink/smrtcmds/bin/variantCaller -j 8 -algorithm¼quiver

--referenceFilename¼reference.fasta

-o

consensus.fasta -o consensus.fastq aligned_subreads.bam

Using quiver the reference sequence can be further refined and a consensus sequence can be saved in fasta and fastq format. 6. Following the read alignment, the detection of DNA-base modifications along the reference sequence can be obtained using the ipdSummary function implemented in SMRT-Link: > /path/to/smrtlink/smrtcmds/bin/ipdSummary aligned_subreads.bam \ --reference reference.fasta \ --gff basemods.gff \ --csv basemods.csv \ --bigwig basemods.wig \ --pvalue 0.01 \ --numWorkers 20 \ --identify m4C,m6A \ --minCoverage 3 \ --methylMinCov 10

This command produces a list of base modifications in gff and csv formats, for predicted m6A and m4C methylations. 7. Finally, the final steps of the protocol allow for computation and retrieval of conserved motifs where base modifications have been detected. This can be obtained using the motifMaker function implemented in SMRT-Link via two steps, a motif finder and a motif refiner: Motifs finder: >/path/to/smrtlink/smrtcmds/bin/motifMaker find \ -f reference.fasta \ -g basemods.gff \ -m 30 \ -o motifs.csv \ -p \

Bifidobacterium Genome Assembly and Methylome Analysis Using Pacbio. . .

231

2>&1 | tee -a motifMaker_find_log.txt

Motifs refiner: >/path/to/smrtlink/smrtcmds/bin/motifMaker reprocess \ -f reference.fasta \ -g basemods.gff \ --minFraction 0 \ -m motifs.csv \ -o motifs.gff

Finally a summary of all identified refined motifs can be obtained as a motif_summary.csv file: > /path/to/smrtlink/smrtcmds/bin/summarizeModifications basemods.gff

An example of implementation of the above commands in a bash script can be found at the following link: https://github. com/frbot/Pacbio-assemblies-and-methylome-analysis/blob/ master/Pacbio_assembly_and_methylome.sh (see Note 3).

4

Notes 1. The installation of the tools required for this protocol may require the installation of additional software tools to solve dependencies. Please refer to the official manual and documentation available at each software distributor website. 2. The installation of SMRTLink requires the administrator access to a Linux machine and the fulfilment of the minimum computational requirements. Please refer to the official Pacbio SMRTLink software documentation for specific information (https://www.pacb.com/wp-content/uploads/SMRT-LinkSoftware-Installation-v8.0.pdf). 3. Commands and parameters indicated in this protocol can be modified according to specific needs. For additional information on the SMRT-Link and SMRT_Tools functions and options, please refer to the official documentation: https:// www.pacb.com/wp-content/uploads/SMRT_Tools_Refer ence_Guide_v700.pdf

Acknowledgments F.B. and D.v.S. are members of APC Microbiome Ireland, which is funded by Science Foundation Ireland (SFI) through the Irish Government’s National Development Plan (Grant Numbers SFI/ 12/RC/2273-P1 and SFI/12/RC/2273-P2).

232

Francesca Bottacini and Douwe van Sinderen

References 1. Amarasinghe SL et al (2020) Opportunities and challenges in long-read sequencing data analysis. Genome Biol 21(1):30 2. Eid J et al (2009) Real-time DNA sequencing from single polymerase molecules. Science 323 (5910):133–138 3. Flusberg BA et al (2010) Direct detection of DNA methylation during single-molecule, realtime sequencing. Nat Methods 7(6):461–465

4. Bottacini F et al (2018) Comparative genome and methylome analysis reveals restriction/ modification system diversity in the gut commensal Bifidobacterium breve. Nucleic Acids Res 46(4):1860–1877 5. Chaisson MJ, Tesler G (2012) Mapping single molecule sequencing reads using basic local alignment with successive refinement (BLASR): application and theory. BMC Bioinformatics 13:238

INDEX A Agarose gel electrophoresis ......................................26, 27 αLacZ gene ...................................................................... 53 Amino acid sequences................................. 36, 37, 40, 83 Ampicillin ............................................................. 134, 137 Animals .......................................................................... 138 Antibiotic administration.............................................. 138 Antibiotic cocktail ......................................................... 138 Antibiotic inhibits growth ............................................ 128 Antibiotic resistance B. breve ..................................................................... 197 cephalosporins ......................................................... 197 Antibiotics .............................................................. 54, 137 Antibiotic solution ........................................................ 137 Antibiotic treatment...................................................... 132 Assembled chromosome ................................................. 40 Average nucleotide identity (ANI) ................................ 39

B Bacterial bioconversion................................................... 98 Bacterial cells ................................................................... 22 Bacterial suspension .................................... 106, 107, 112 Bacteriophages ................................................................ 71 Bacteriophage viral DNA extraction ........................75, 76 Base-catalyzed methylation ............................................ 92 Basic Local Alignment Search Tool (BLAST) ............... 33 Bifidobacteria aerobic conditions ....................................................... 9 Bifidobacterium ........................................................... 2 chemically defined media............................................ 4 communication, host cells ........................................ 21 cultivation ................................................................ 1, 3 diet-derived sugars .................................................... 62 fastidious microorganisms ........................................ 62 gastrointestinal tract.................................................. 21 general media .............................................................. 4 gram-positive commensal microorganisms..........1, 61 growth media .............................................................. 3 human gastrointestinal tract ..................................... 71 isolation .................................................................1, 61 metabolic characteristics ............................................. 2 oxygen detoxification systems .................................... 2 probiotic properties .................................................. 21 probiotics ..................................................................... 1 selective media............................................................. 4

vitamin supplements ................................................... 9 Bifidobacteria identification methods chromosomal DNA extraction ............................... 145 F6PPK enzymatic detection .......................... 143–145 Bifidobacterial carbohydrate metabolism ........................ 2 Bifidobacterial carbohydrate utilization screening acidification curve generation........................ 122, 124 aseptic techniques ................................................... 120 assessing substrate consumption/ degradation ......................................... 126, 127 bacterial suspension preparation ................... 120, 121 CFU and acidification determination ........... 118, 119 CFU determination ....................................... 123, 125 growth medium.............................................. 119, 120 HPAEC-PAD .......................................................... 119 HPLC metabolite analysis ............................. 125, 126 manual growth curve generation .................. 122, 124 microtiter plate-based assay ........................... 121–123 multiple carbohydrates............................................ 129 Bifidobacterial cell biomass........................................... 106 Bifidobacterial cells ......................................................... 16 Bifidobacterial chromosomal DNA extraction ............................................ 143, 145 Bifidobacterial colonization.......................................... 132 Bifidobacterial cultivation chemically defined media........................................ 8, 9 culture media............................................................... 6 MRS ............................................................................. 5 selective media......................................................... 6–8 TPY .............................................................................. 6 WC ............................................................................... 6 Bifidobacterial genome annotation ................................................................. 34 assembly ...............................................................32, 34 bifidobacterial phylogenomic .............................34, 40 comparative analysis .................................................. 34 contig reordering ......................................... 32, 35, 36 core genome ........................................................33, 37 DNA quality filtering ................................... 32, 34, 35 functional analyses........................................ 33, 37, 39 gene annotation ........................................... 33, 36, 37 gene prediction....................................................32, 36 genome assembly ...................................................... 35 genomic DNA ........................................................... 32 microbial genomes .................................................... 41 NCBI ......................................................................... 31

Douwe van Sinderen and Marco Ventura (eds.), Bifidobacteria: Methods and Protocols, Methods in Molecular Biology, vol. 2278, https://doi.org/10.1007/978-1-0716-1274-3, © Springer Science+Business Media, LLC, part of Springer Nature 2021

233

BIFIDOBACTERIA: METHODS

234 Index

AND

PROTOCOLS

Bifidobacterial genome (cont.) NGS .....................................................................32, 41 pangenome ................................................... 32, 33, 37 visualization .........................................................33, 37 whole-genome analysis ................................ 33, 39, 40 Bifidobacterial genomes NGS-based studies .................................................... 62 Bifidobacterial ITS profiling QIIME 2 script ....................................................... 187 Bifidobacterial minimal medium (BMM) ........................ 8 Bifidobacterial phylogenomic...................................34, 40 Bifidobacterial strains ............................................. 28, 118 Bifidobacterium .....................................2, 3, 9, 31, 40, 42 electrotransformation................................................ 13 EPS (see Exopolysaccharides (EPS)) probiotic features ...................................................... 61 Bifidobacterium bifidum.................................................... 2 Bifidobacterium breve strains......................................... 226 Bifidobacterium breve UCC2003 ................................... 46 Bifidobacterium longum ............................................9, 131 Bifidobacterium spp....................................................... 152 Bifidobacterium transformation electroporation (see Electroporation) plasmids ..................................................................... 17 Bifid shunt ....................................................................... 62 Bile ................................................................................. 149 Bioanalyzer ...................................................................... 81 Bioluminescence/fluorescent protein-encoding genes............................................................. 174 BLAST ............................................................................. 39 Brain Heart Infusion (BHI) ........................................... 67 Broth microdilution assay............................................. 198 BSH activity qualitative determination (Protocol 1) .................. 151 semiquantitative determination (Protocol 2) ........ 152

C Candidate prebiotics ..................................................... 210 Carbohydrates ............................................................... 117 Carbohydrate sources ..................................................... 65 Catabolic operons repression ....................................... 128 CAZy database ..........................................................33, 39 Cell lysis ........................................................................... 22 Cellular biohydrogenation mechanisms ........................ 88 Cetyltrimethylammonium bromide (CTAB) ................ 28 Chemically defined media................................................. 3 auxotrophies ................................................................ 8 bifidobacterial strains .................................................. 8 BMM ........................................................................... 8 FFM ............................................................................. 9 PROLAB ..................................................................... 8 semisynthetic ............................................................... 8 SM7.............................................................................. 9 Chemically defined medium (CDM) .......................67, 68

Chromatographic techniques HPTLC-AMD protocol 1 ...................................... 219 HPTLC-AMD protocol 3 ...................................... 220 Chromeleon software (Dionex) ................................... 127 Chromosomal DNA isolation agarose analysis.......................................................... 26 equipment.................................................................. 23 protocol ........................................................ 23–26, 28 solutions .................................................................... 23 Cloning and expression vectors biological applications............................................. 178 naturally occurring bifidobacterial plasmids .......... 159 Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)......................................... 83 Clusters of orthologous groups (COGs)....................... 37 Codon optimization ............................................ 176, 178 Colony-forming units (CFU)..................... 122, 123, 136 Columbia agar base medium (CAB).............................. 67 Commercial CLA ............................................................ 90 Commercialized probiotics........................................... 131 Complex carbon sources............................................... 117 Conditional replicons genetic engineering................................................. 172 Conjugated fatty acids (CFAs) chemical mechanisms ................................................ 88 dairy products............................................................ 88 LA and LNA.............................................................. 88 Conjugated linoleic acid (CLA) analytical technologies .............................................. 91 bacteria....................................................................... 89 Bifidobacterium ......................................................... 91 bioconversion ............................................................ 91 chemicals.................................................................... 93 culture conditions ..................................................... 94 culture media............................................................. 93 dairy industry ............................................................ 88 dietary manipulation ................................................. 90 EFSA .......................................................................... 89 equipment.................................................................. 94 fatty acid substrate .................................................... 89 food ingredients ........................................................ 89 formulations .............................................................. 90 functional food .......................................................... 89 gas chromatography............................................92, 95 growth media ............................................................ 89 health benefits ........................................................... 90 health food supplement ............................................ 88 in vitro ....................................................................... 89 inoculum preparation................................................ 94 novel ingredients ....................................................... 90 nutraceutical .............................................................. 89 production ................................................................. 91 rich oils ...................................................................... 90 solution ...................................................................... 93

BIFIDOBACTERIA: METHODS standards ..............................................................92, 93 supplementation........................................................ 90 UV-based spectrophotometric assay ........... 91, 94, 95 Conjugated linolenic acid (CLNA)................... 88, 89, 91 Contigs ............................................................................ 35 Contig sequences ......................................................35, 41 Core genes....................................................................... 40 Core genome................................................................... 42 Counterselective agent.................................................... 65 Cultivation media BHI ............................................................................ 67 CAB ........................................................................... 67 CDM....................................................................67, 68 chemically undefined composition........................... 64 counterselective agent............................................... 65 fecal/environmental samples.................................... 69 GAM .......................................................................... 67 MRS .....................................................................65, 66 nutrient content ........................................................ 64 preparation ................................................................ 68 RCM .......................................................................... 67 selective agents ....................................................64, 65 TOS-propionate-MUP ............................................. 67 TPY ............................................................................ 66 WC .......................................................................66, 67 Culture-independent approaches ................................... 62

D Dairy products ................................................................ 88 Deionized water (dH2O) ............................................... 48 Deoxyribonucleic acid (DNA) .......................... 21, 22, 28 Dietary CLA .................................................................... 88 Dietary fats ...................................................................... 88 de Man–Rogosa–Sharpe medium (MRS) .................5, 49, 65, 66, 119, 121 DNA electrophoresis ...................................................... 23 DNA purification ............................................................ 22 DNA quality filtering .................................. 32, 34, 35, 82 DNA sequencing.......................................................81, 82 dsDNA HS assay ............................................................. 76

E E. coli BM101.................................................................. 59 E.coli–Bifidobacterium shuttle vectors ......................... 163 E. coli EC101 .................................................................. 17 E. coli EC101 competent cells ....................................... 53 EggNOG database ....................................................33, 37 Electroporation DNA .......................................................................... 13 E. coli EC101 ............................................................ 17 electrical field............................................................. 13 equipment.................................................................. 15 methods ............................................................... 15–17

AND

PROTOCOLS Index 235

microbiology ............................................................. 13 modifications ............................................................. 14 nucleic acids............................................................... 13 plasmid DNA............................................................. 17 reagents................................................................14, 15 transformation efficiency ....................................17, 18 transformation methodology ................................... 14 Electrotransformation..................................................... 16 Enhancing (heterologous) gene expression systems promoter selection ......................................... 175–177 Enzymatic treatments ..................................................... 22 Enzymes........................................................................... 48 Epsilometer test (E-test) strip applications............................................. 203, 204 EPS-producing strain.................................................... 102 EPS-production phenotype .......................................... 105 Erythromycin resistance gene erm(X).......................... 197 Escherichia coli EC101 .................................................... 49 Ethylenediaminetetraacetic acid (EDTA) ...................... 23 European Food Safety Authority (EFSA)...................... 89 Exopolysaccharides (EPS) anaerobic conditions ............................................... 112 bacterial suspension................................................. 112 bifidobacteria ........................................................... 101 Bifidobacterium ....................................................... 101 carbohydrate polymers............................................ 101 characterization .............................................. 102, 104 detection .................................................................. 102 freeze-drying ........................................................... 113 gene replacement techniques ................................. 112 genetic machinery ................................................... 102 high-throughput screening methods ..................... 102 isolation ......................................... 103, 104, 106–108 methods ................................................................... 108 miniaturized methods ............................................. 111 mucoid colony......................................................... 112 mucoid phenotype .................................................. 106 phenotypic detection ............................ 103, 105, 111 physical–chemical properties ......................... 102, 113 physiology................................................................ 101 priming-glycosyltranferase(s).................................. 102 purification ....................................104, 105, 110, 111 ropy phenotype .............................................. 106, 112 strain-dependent characteristic............................... 112 sucrose ..................................................................... 111 Extracellular polysaccharide (EPS)................................. 28

F Fatty acid methyl esters (FAMEs) ..................... 92, 93, 97 Fecal ................................................................................. 72 Folate-free medium (FFM) .............................................. 9 Food and Drug administration (FDA) .......................... 89 F6PPK enzymatic test................................................... 143 Functional analyses............................................. 33, 37, 39

BIFIDOBACTERIA: METHODS

236 Index

AND

PROTOCOLS

Functional annotation, gene .......................................... 41 Functional food............................................................... 89

G Gas chromatography CLA/CLNA conversion percentages ...................... 97 CLA isomers.............................................................. 92 CLA production ........................................................ 95 FAMEs .................................................................92, 97 lipid extraction pellet ..............................................................96, 97 supernatant fluid ................................................. 95 Gastrointestinal tract (GIT) ................................ 131, 132 Gavage ......................................................... 132, 135, 136 Gene annotation ......................................... 33, 36, 37, 83 Gene-finding program .................................................... 83 Gene-finding programs.............................................32, 36 Gene prediction.................................................. 32, 36, 83 Generally Recognized As Safe (GRAS).......................... 89 Gene replacement techniques ...................................... 112 Genetically modified microorganisms (GMOs) ............ 91 Gene search analyses .................................................37, 39 Gene sequences ............................................................... 42 Gene tet(W) ................................................................... 198 Genome assembly .............................................. 32, 35, 41 Genome contig reordering ................................ 32, 35, 36 Genome sequencing ....................................................... 31 Genome visualization................................................33, 37 Genomic DNA sequencing ..................32, 35, 47, 51, 53 Genus Bifidobacterium......................................... 118, 131 Gifu anaerobic medium (GAM).................................6, 67 Glucose ............................................................................ 66 Glycodeoxycholic acid (GDCA)................................... 151 Glycosyl-hydrolase assay ............................. 214, 217, 218 Gram-negative cell walls ................................................. 22 Gram-positive bacteria .................................................... 22 Graph-theory-based Markov clustering algorithm ....... 37

H Heteropolysaccharides .................................................. 102 Hexadecyltrimethylammonium bromide..................... 143 High-performance anion exchange chromatography (HPAEC) ..................................................... 126 High-performance anion exchange chromatography— pulsed amperometric detection (HPAEC-PAD).......................... 126, 127, 214 High-performance liquid chromatography (HPLC)............................................... 125, 126 High performance thin layer chromatography with automated multiple development (HPTLCAMD)........................................................... 214 High-throughput screening methods.......................... 102 Homologous recombination ....................................46, 58

HPLC equipped with UV and refractive index detector (HPLC-UV-RID)........................................ 220 HPTLC-AMD protocol 1 ............................................ 219 HPTLC-AMD protocol 2 ............................................ 219 HPTLC-AMD protocol 3 ................................... 219, 220 Human gut-associated bifidobacteria ............................ 72 Human milk oligosaccharides (HMOs) ........................ 71

I In silico DNA sequence analysis DNA quality filtering ................................................ 82 gene annotation ........................................................ 83 gene prediction.......................................................... 83 phage contig selection/validation............................ 83 phage genome assembly ........................................... 82 phage sequence identification ............................83, 84 In vitro antimicrobial activity evaluation antimicrobial gradient method...................... 202–203 broth microdilution assay .............................. 202–203 culture media.................................................. 199–201 microdilution plates ................................................ 201 In vitro assessment, prebiotic activity bioreactors ...................................................... 211, 215 carbohydrates/organic acids analysis ..................... 214 Isolate virus-like particles (VLPs) .................................. 72 Isolation, bifidobacterial species anaerobic environment maintenance .................63, 64 cultivation media (see Cultivation media) pH .............................................................................. 64 procedure................................................................... 63 temperature ............................................................... 64 Isomerization ............................................................88, 89 Isopropyl β-D-1-thiogalactopyranoside (IPTG) ........... 48 ITS broth medium ........................................................ 200

L Lactic acid bacteria (LAB) ..................................... 89, 101 Lactobacillus species ...................................................... 131 LA emulsion .................................................................... 98 L-cysteine................................................................ 67, 205 L-cysteine hydrochloride ................................................ 64 Linoleate isomerase (LAI) .............................................. 91 Linoleic acid (LA) .................................87, 89, 91, 92, 94 Linolenic acids (LNA) ....................................... 87–89, 91 Lipid extraction .........................................................95–97 LSM-cysteine agar medium.......................................... 201 LSM-cysteine broth medium ....................................... 200 Luria–Bertani (LB) culture medium ........................14, 49 Lyophilization ...................................................... 104, 108 Lysis ...........................................................................22, 28 Lysozyme......................................................................... 28 Lytic phage life cycle....................................................... 72

BIFIDOBACTERIA: METHODS M MetaCyc database ........................................................... 33 MetaCyc metabolic pathways database .......................... 39 Methylated plasmid construct ........................................ 55 Methylation ..................................................................... 92 Microbial CLA production............................................. 91 Microbial genome sequences ......................................... 31 Microbial genomes.......................................................... 41 Microbiota cultures....................................................... 215 Microbiota depletion .................................................... 132 Microdilution plate filling............................................. 202 Microtiter plate-based assay.......................................... 123 Microtiter plate reader ......................................... 121, 122 Modified de Man–Rogosa–Sharpe medium (mMRS) ................................. 14, 49, 119, 216 Modified MRS (mMRS) formulations............................. 5 Modified MRS (mMRSc) ............................................... 66 Monosaccharides ........................................................... 117 MRS-cysteine (MRSC) ................................................. 200 MRS-cysteine broth ........................................................ 98 Mucoid phenotype ........................................................ 106 MUMmer software packages.......................................... 39 Mupirocin ...................................................................... 139 Murine gut colonization model antibiotic administration......................................... 135 antibiotic concentration.......................................... 134 antibiotic preparation.............................................. 134 bacterial feeding ...................................................... 136 bifidobacterial colonization ........................... 132, 137 materials................................................................... 132

N National Center for Biotechnology Information (NCBI).............................................. 31, 36, 83 Naturally occurring bifidobacterial plasmids pSP02-/pBC1 ......................................................... 162 pTB6 replicon ......................................................... 162 Next generation sequencing (NGS) ...................... 22, 31, 32, 35, 41, 62 bifidobacterial ITS profiling .......................... 187–190 efficient exploration ................................................ 183 quality filtering ............................................... 184, 186 16S rRNA gene microbial profiling .............. 186–188 Nonbifidobacterial species ................................................ 3 Non-EPS producing strains.......................................... 105 Novel vector general design guidelines gene expression systems enhancing .............. 175–178 replican modules ..................................................... 170 selection biomarker modules.................................. 173 Nucleotide sequence ....................................................... 36

O Oligosaccharides........................................................2, 117 Open Reading Frames (ORFs).................................36, 83

AND

PROTOCOLS Index 237

Organic solvents.............................................................. 93 Oxygen-deprived environment ...................................... 63 Oxygen-free atmospheric conditions ............................... 9 Oxygen-free environment............................................... 98

P PacBio .............................................................................. 41 Pacbio SMRT sequencing motifMaker function ............................................... 230 pAM5 plasmid ...........................................................54, 56 Pangenome ...................................................................... 37 Pan-Genome Analysis Pipeline (PGAP .................. 33, 37, 40, 42 PCR amplification ........................................................... 51 PCR colony ................................................................... 137 pH ....................................................................... 64, 74, 83 Phage genome ................................................................. 83 Phage genome assembly ................................................. 82 Phages ........................................................................71, 72 Phage sequence identification ..................................83, 84 Phenol–chloroform–isoamyl alcohol ............................. 28 Phylogenetics............................................... 32, 34, 40, 42 Plasmid DNA ..................................................... 16, 17, 52 Plasmid isolation agarose analysis.......................................................... 26 alkaline lysis ............................................................... 22 equipment.................................................................. 23 protocol ........................................................ 24, 27, 28 robust methods ......................................................... 22 solutions .................................................................... 23 Plasmid purifications ....................................................... 55 Plasmid recovery ............................................................. 15 Plasmid replicons BEST........................................................................ 169 Plasmids ........................................................................... 17 pORI19 plasmid................................................. 47, 51, 56 Probiotic Laboratory Base Medium (PROLAB) ............ 8 Prokaryotes...................................................................... 46 Prokaryotic Dynamic Programming Genefinder Algorithm....................................................... 83 Promoter selection native........................................................................ 177 stress inducible ........................................................ 177 vector pNZ272........................................................ 176 Prophages ........................................................................ 72 Proteinase K solution...................................................... 74 Protein-coding genes ...................................................... 36 Pulsed amperometric detection (PAD)........................ 126

Q Quality filtering FastQC software...................................................... 185 Quantification, viral DNA ........................................76, 77

BIFIDOBACTERIA: METHODS

238 Index

AND

PROTOCOLS

R Recombinant pORI19 construct .............................57, 60 Reference database .......................................................... 83 Reinforced clostridial agar (RCA).......................... 14, 49, 121, 132 Reinforced clostridial medium (RCM) ............. 14, 49, 67 Replicon testing vectors....................................... 171, 172 Restriction–modification (RM) systems ........... 14, 17, 45 Ribosomal RNA genes.................................................... 36 Rich liquid culture media ............................................. 106 RNase............................................................................... 28 Room temperature (RT) ................................................ 23 Ropy phenotype .......................................... 105, 106, 112 rRaffinose-containing sources .......................................... 7 Rreceptor-binding protein (RBP) .................................. 72

S Selective agents..................................................... 6, 64, 65 Selective media .............................................................. 6–8 Semisynthetic media ......................................................... 8 Semisynthetic medium (SSM) ...................................... 216 Semisynthetic medium 7 (SM7) ...................................... 9 Sequenced plasmids ...................................................... 160 Short chain fatty acids (SCFAs) ................................... 117 Shotgun sequencing........................................................ 31 Single-domain protein-coding genes ............................. 58 Single-molecule real-time (SMRT) Pacbio ...................................................................... 225 Site-directed mutagenesis antibiotics .................................................................. 58 B. breve UCC2003 ..............................................46, 59 Bifidobacterium strains.............................................. 46 competent Bifidobacterium cells transformation..... 56 cultures ...................................................................... 49 E.coli EC101 competent cells.............................52, 53 electrocompetent Bifidobacterium cells transformation ............................................... 56 equipment.................................................................. 49 fragment-harboring plasmid pORI19 vector................................................. 51, 52, 57 homologous recombination ...............................46, 58 insertional mutagenesis............................................. 46 ligations ..................................................................... 58 methylated plasmid construct .................................. 55 molecular technique.................................................. 46 PCR confirmation, tetW cassette ............................. 59 plasmid construct vs. homologous recombination ............................................... 47 pORI19 ..................................................................... 52 reagents................................................................ 48–50 recombinant Bifidobacterium transformants ........... 57 recombinant pORI19 clones and tetW.............. 53–55

RM systems ............................................................... 59 tetW............................................................................ 59 16S rRNA gene-based sequencing................................. 69 Sodium chloride–magnesium sulfate (SMG) buffer.............................................................. 74 Sodium dodecyl sulfate (SDS)........................................ 22 Solid culture media ......................................................... 68 SPAdes ............................................................................. 41 Specific bifidobacteria primers...................................... 139 Spectrophotometer ......................................................... 15 Spectrophotometric methods......................................... 15 Stress Inducible Controlled Expression (SICE).......... 177 Sucrose........................................................................... 111 Supernatant fluid ............................................................. 95

T Taurocholic acid (TCA)....................................... 151, 154 Temperature .................................................................... 64 tetW.................................................................................. 54 Transformation efficiency .........................................17, 18 Transgalactosylated oligosaccharides–propionate–mupirocin (TOS-Propionate-MUP) .............................. 67 Transgalactosylated oligosaccharides-propionatemupirocin lithium salt (TOS-PropionateMUP) ........................................................... 7, 8 Transgalactosylated oligosaccharides (TOS) ................. 67 Transfer RNA genes..................................................36, 83 Tridecanoic acid .............................................................. 93 Tris-HCl buffer ............................................................... 74 Truly unique genes (TUGs) ........................................... 37 Trypticase phytone yeast (TPY) ....................................... 6 Tryptone, phytone, and yeast extract (TPY) ................. 66 Tween 80......................................................................... 98

U UV-based spectrophotometric assay .............................. 93 advantage ................................................................... 91 bifidobacteria ............................................................. 94 CLA production ........................................................ 91 CLA standard curve .................................................. 96 lipid fraction extraction.......................................94, 95 plate readers.........................................................95, 96

V Vaccenic acid.................................................................... 88 Viral DNA bacteriophage viral DNA extraction ..................75, 76 DNA samples clean-up, libraries ..........................................79, 80 dilution libraries .................................................. 81 library amplification ......................................78, 79

BIFIDOBACTERIA: METHODS library quality check ............................................ 80 Nextera XT DNA Library Prep kit .................... 77 normalization, libraries .................................80, 81 spectrophotometer .............................................. 77 tagmentation ....................................................... 78 DNA sequencing.................................................81, 82 in silico DNA sequence analysis ......................... 82–84 materials...............................................................72, 73 Proteinase K solution................................................ 74 quantification.......................................................76, 77 SMG buffer ............................................................... 74

AND

PROTOCOLS Index 239

Tris-HCl buffer ......................................................... 74 VLP isolation.......................................................74, 75 Virus-like particle (VLP) ..........................................74, 75

W Whole genome aligner.................................................... 83 Whole-genome analysis ..................................... 33, 39, 40 Whole-genome random sequencing .............................. 31 Whole metagenome shotgun (WMGS)......................... 67 Wilkins–Chalgren (WC) ...................................... 6, 66, 67