Bacterial Virulence: Methods and Protocols (Methods in Molecular Biology, 2427) [1st ed. 2022] 1071619705, 9781071619704

Table of contents :
Preface
Contents
Contributors
Part I: Molecular Biology and Bioinformatics Methods
Chapter 1: Generation of Markerless Gene Deletion Mutants in Listeria monocytogenes Using a Mutated pheS for Counterselection
1 Introduction
2 Materials
2.1 Gibson Assembly Design
2.2 Gibson Assembly Reaction
2.3 Transformation
2.4 Conjugation (Two-Parental Mating)
2.5 Plasmid Integration and Curing
2.6 Mutant Verification
3 Methods
3.1 Designation/Determination of the Insert Homologous Regions and Gibson Assembly Primer Design
3.2 Gibson Assembly Reaction
3.3 Transformation to a Donor E. coli Strain SM10
3.4 Conjugation (Two-Parental Mating)
3.5 Plasmid Integration (Pop-In)
3.6 Plasmid Curing (Pop-Out)
3.7 Mutant Verification
4 Notes
References
Chapter 2: A Rapid Fluorescence-Based Screen to Identify Regulators and Components of Interbacterial Competition Mechanisms in...
1 Introduction
1.1 Principle of Bacterial Competition Fluorescence (BaCoF)
1.2 Method Requirements
1.3 Applying BaCoF on a Vibrio parahaemolyticusT6SS
2 Materials
2.1 Media and Solutions
2.2 Strains and Plasmids
2.3 Equipment
3 Methods
3.1 Generating a Transposon Mutant Library
3.2 Calibrating BaCoF
3.3 Screening a Mutant Library
4 Notes
References
Chapter 3: Predicting Type III Effector Proteins Using the Effectidor Web Server
1 Introduction
2 Running Examples
2.1 Preparing the File of Genome ORFs
2.2 Preparing the File of Known Effectors (Note 1)
2.3 Running Effectidor
2.4 Analyzing Effectidor Predictions
3 Features Analysis (See Note 4)
4 Summary
5 Notes
References
Chapter 4: Assay for Type III Secretion in Escherichia coli
1 Introduction
2 Materials
2.1 Agar Plates
2.2 T3SS Assay
2.3 Sodium Dodecyl Sulfate (SDS) Polyacrylamide Gel
2.4 Immunoblotting
3 Methods
3.1 Growing Bacteria Under T3SS-Inducing Conditions
3.2 Separating the Secreted Fraction from the Bacterial Pellet
3.3 Electrophoresis and Coomassie Staining
3.4 Wet Transfer and Blotting
4 Notes
References
Chapter 5: Profiling of Secreted Type 3 Secretion System Substrates by Salmonella enterica
1 Introduction
2 Materials
2.1 Growth Media
3 Methods
4 Notes
References
Part II: Cell Culture and Organoid Models of Infection
Chapter 6: Analysis of SPI-1 Dependent Type III Secretion and Injection Using a NanoLuc Luciferase-Based Assay
1 Introduction
2 Materials
2.1 S. Typhimurium Culture
2.2 Plasmids for Expression of NLuc or HiBiT
2.3 Nano-Glo Luciferase Assay
2.4 Generation of an HeLa Cell Line Expressing LgBiT
2.5 Infection of HeLa-LgBiT Cells with S. Typhimurium
3 Methods
3.1 Salmonella SPI-1 Secretion Assay Using the Nano-Glo System
3.1.1 Salmonella Growth Conditions
3.1.2 Measurement of T3S Using Bacterial Supernatants
3.2 Salmonella Injection Assay Using the Nano-Glo System
3.2.1 Construction of a Mammalian Cell Line Expressing LgBiT
Initiate Lenti-X 293 T Cell Line Cultures from a Frozen Stock
Cultivation of HEK293T Cells
Transfection of the HEK293T Cells
Concentrating the Supernatant Using Lenti-X Concentrator
Determination of Lentiviral Titer
Transduction of HeLa Cells
Generation of Stable Transduced Cell Clones
Identification of LgBiT-Expressing HeLa Cell Clones
3.2.2 Salmonella Growth Conditions and Inoculum Preparation
3.2.3 Infection of HeLa-LgBiT Cells and Measurement of Injection Kinetics
3.2.4 Infection of HeLa-LgBiT Cells and Measurements of Injection (End-Point Measurement)
4 Notes
References
Chapter 7: Mycobacterium tuberculosis Infection of THP-1 Cells: A Model for High Content Analysis of Intracellular Growth and ...
1 Introduction
2 Materials
2.1 THP-1 Cell Culture
2.2 Mtb Culture
2.3 Infection
2.4 Fixation and Staining
2.5 Analytical Programs and Software
3 Methods
3.1 HCS of Antituberculosis Candidates on Intracellular Mtb
3.1.1 Cell Culture
3.1.2 Batch Infection
3.1.3 Two-Step Infection
3.1.4 Fixation and Nuclear Staining
3.1.5 HCS Platform Setup and Scanning
3.1.6 HCS Data Analysis
3.1.7 Z′ Factor Analysis
3.2 HCS of Mtb Mutant Libraries Using DMN-Tre
3.2.1 Batch Infection
3.2.2 Two-Step Infection
3.2.3 Fixation and DAPI Staining
4 Notes
References
Chapter 8: Bone Marrow-Derived Macrophage (BMDM) Infection by Listeria monocytogenes
1 Introduction
2 Materials
2.1 Preparation of L929-Conditioned Medium
2.2 Preparation of BMDMs
2.3 Infection of BMDMs by L. Monocytogenes
2.4 Intracellular Growth Analysis of L. monocytogenes in BMDMs
3 Methods
3.1 Preparation of L929-Conditioned Medium
3.2 Preparation of BMDMs
3.3 Infection of BMDMs by Listeria monocytogenes
3.4 Intracellular Growth Analysis of L. monocytogenes in BMDMs
4 Notes
References
Chapter 9: Preparation and Inflammasome Activation of Murine Bone Marrow-Derived and Resident Peritoneal Macrophages
1 Introduction
2 Materials
2.1 Mice
2.2 Reagents
2.3 Materials
3 Methods
3.1 Preparation of BMMs
3.2 Preparation of rPMs
3.3 Evaluation of Purity of Macrophages
3.4 Stimulation with Inflammasome Activators
4 Notes
References
Chapter 10: Flow Cytometry-Based Single Cell Analyses of Bacterial Adaptation to Intracellular Environments
1 Introduction
1.1 Flow Cytometry for Single Cell Infection Biology
2 Materials
2.1 Bacterial Strains, Host Cells, Bacterial Infection
2.2 Instrument and Filter Sets
2.3 Software
3 Methods
3.1 Protocol for Preparing and Measuring Bacteria In Vitro
3.2 Protocol for Preparing and Measuring Bacteria Liberated from Host Cells (HeLa, RAW264.7, U937, etc.)
3.3 Protocol for Preparing and Measuring Infected Host Cells (HeLa, RAW264.7, U937, etc.)
4 Notes
References
Chapter 11: Quantification of Microbial Fluorescent Sensors During Live Intracellular Infections
1 Introduction
2 Materials
2.1 Bone Marrow-Derived macrophages (BMDMs)
2.2 Bacteria Encoding a Fluorescent Sensor
2.3 BMDM Infections and Microscopy
2.4 Image Analysis
3 Methods
3.1 Preparation of Bone Marrow-Derived Macrophages
3.2 Preparation of Fluorescent Sensor-Expressing Bacteria
3.3 Infection of Bone Marrow-Derived Macrophages
3.4 Microscopy of Bone Marrow-Derived Macrophages
3.5 Analysis of Microscopy Images (Fig. 1)
3.6 Microscopy Optimization for Multiple Reporters
4 Notes
References
Chapter 12: Dissecting Human Blood Immune Cells Response to Intracellular Infection Using Single-Cell RNA Sequencing
1 Introduction
1.1 Abbreviations
2 Materials
2.1 PBMC Isolation from Human Blood Sample
2.2 Monocyte Enrichment
2.3 Bacterial Growth
2.4 Bacterial Preparation, PBMC Infection, and Preparation for scRNA-Seq
3 Methods
3.1 PBMC Isolation from Human Blood Sample
3.1.1 Starting from Human Whole Blood Sample
3.1.2 Starting from Human Leukocyte Enriched Fraction
3.1.3 Lymphoprep Extraction
3.2 Monocyte Enrichment
3.3 Bacteria Growth
3.4 PBMC/Monocyte Infection
3.4.1 Bacterial Preparation
3.4.2 PBMC/Monocyte Infection
PBMC Infection
Adaptations for Monocytes Infection
3.5 Cell Preparation for scRNA-Seq
3.5.1 For PBMCs
3.5.2 Suggested Adaptations for Monocytes Only
3.6 Bacterial Culture Verification
4 Notes
References
Chapter 13: Salmonella enterica Infection of Human and Mouse Colon Organoid-Derived Monolayers
1 Introduction
2 Materials
2.1 Collection of L-WRN-Conditioned Medium
2.2 Isolation of Colon Crypts from Mouse Tissue
2.3 Isolation of Colon Crypts from Human Tissue
2.4 Passaging Colon Organoids
2.5 Generating 2D Colon Epithelial Cell Monolayers
2.6 S. enterica Infection of 2D Colon Epithelial Cell Monolayers
2.7 Quantifying S. enterica Adherence and Invasion of 2D Colonoids Using the Gentamicin Protection Assay
3 Methods
3.1 Collection of L-WRN-Conditioned Medium
3.2 Isolation of Colon Crypts from Mouse Tissue
3.3 Isolation of Colon Crypts from Human Tissue
3.4 Passaging Colon Organoids
3.5 Generating 2D Colon Epithelial Cell Monolayers
3.6 S. enterica Infection of 2D Colon Epithelial Cell Monolayers
3.7 Quantifying S. enterica Adherence and Invasion of 2D Colonoids Using the Gentamicin Protection Assay
4 Notes
References
Part III: In Vivo Models of Infection
Chapter 14: Analysis of Salmonella enterica Adhesion to Leaves of Corn Salad or Lettuce
1 Introduction
1.1 Gastrointestinal Infections by Contaminated Vegetables
1.2 Bacterial Adhesiomes
2 Materials
2.1 Sterilization of Salad Seeds
2.2 Cultivation of Salad
2.3 Adhesion Assay
3 Methods
3.1 Sterilization of Corn Salad Seeds
3.2 Sterilization of Lettuce Seeds
3.3 Cultivation of Salad Species
3.4 Bacterial Culture for Adhesion Assay
3.5 Adhesion Assay
4 Analysis
5 Notes
References
Chapter 15: Methods for Using the Galleria mellonella Invertebrate Model to Probe Enterococcus faecalis Pathogenicity
1 Introduction
2 Materials
2.1 Reagents and Equipment Required
2.2 G. Mellonella Last Instar Larvae (Approximately 6 Weeks Old)
2.3 Inoculum Containing Strain of Interest
3 Methods
3.1 To Test for Bacterium Virulence Determinants
3.2 To Test Antimicrobials Efficacy Against Bacterial Infection
4 Notes
References
Chapter 16: Murine Soft Tissue Infection Model to Study Group A Streptococcus (GAS) Pathogenesis in Necrotizing Fasciitis
1 Introduction
1.1 Group A Streptococcus
1.2 Animal Models for the Study of Infectious Diseases-General Considerations
1.3 Animal Models for Studying GAS Diseases
1.4 Human GAS NF
1.5 A Murine Model for Studying GAS NF Pathogenesis
2 Materials
2.1 GAS Strains and Bacterial Culturing and Preparation for Infection of Mice
2.2 Infection of Mice
2.3 Quantification of GAS CFU in Skin and Spleen of Infected Mice
2.4 Sample Processing for Histological Analysis
2.5 Immunofluorescence Staining
2.6 Hematoxylin and Eosin Staining
3 Methods
3.1 Culturing and Preparation of Bacteria for Infection of Mice
3.2 Determination of Mice Survival Using a Mouse Model of Lethal Human Soft-Tissue Infection
3.3 A Sublethal Mouse Model of Human Soft-Tissue Infection for CFU Determination and Histological Analysis
3.4 Quantification of GAS CFU in Skin and Spleen of Infected Mice
3.5 Sample Processing for Histological Analysis
3.6 Immunofluorescence Staining of Frozen Tissue Sections
3.7 Hematoxylin and Eosin Staining
4 Notes
References
Chapter 17: Mouse Model to Study Salmonella-Induced Colitis
1 Introduction
1.1 Salmonella Induced Colitis
1.2 Host Resistance to S. Typhimurium Infection
1.3 Microbiota and Antibiotic Treatment
2 Materials
2.1 Mice
2.2 Salmonella entericaserovar Typhimurium (or Other NTS Serovars)
2.3 Consumables
2.4 Chemicals and Media
2.5 Equipment
3 Methods
3.1 Streptomycin Treatment
3.2 Inoculum
3.3 Oral Infection of Mice
3.4 Monitoring Fitness of Mice
3.5 Collection of Fecal Pellets and Processing During the Time Course of Infection
3.5.1 Collection of Fresh Fecal Pellets
3.5.2 Quantification of the Bacterial Load
3.5.3 Quantification of Inflammation Marker Lcn2
3.6 Collecting Tissues at the End of the Experiment
3.7 Sample Processing for Quantification of the Bacterial Organ Load
3.8 Histopathology Scoring
4 Notes
References
Chapter 18: Analysis of Salmonella Typhi Pathogenesis in a Humanized Mouse Model
1 Introduction
2 Materials
2.1 Humanized Mice-Sources
2.2 Source of S. Typhi
2.2.1 Characterized Clinical Isolates
2.2.2 Presence of Vi Antigen
2.2.3 Multidrug Resistance Status
2.3 Growth of S. Typhi
2.4 Infection of CD34+ HU-NSG and NSG Mice
2.5 Organ Harvest and Blood Collection
2.6 Transposon Library Construction
3 Methods
3.1 Biosafety and Animal Husbandry
3.1.1 Humanized Mice
3.1.2 Salmonella enterica
3.1.3 Laboratory Animal Husbandry Staff
3.2 Vi Agglutination Assay
3.3 Determination of S. Typhi Inoculum for CD34+ Hu-NSG Infection
3.3.1 Determination of S. Typhi Inoculum for Competitive Infections
3.4 Infection of CD34+ Hu-NSG Mice or NSG Mice
3.5 Blood Collection
3.6 Organ Homogenization for CFU Determination
3.7 Organ Preservation
3.8 Genetic Manipulation of Salmonella enterica
3.9 Transposon Library Construction, Infection, and Analysis
3.9.1 S. Typhi Transposon Library Construction
3.9.2 Recovery and Archiving of ``Input´´ and ``Output´´ Samples
3.9.3 Isolation of DNA for TraDIS
3.9.4 DNA Shearing
3.9.5 End Repair
3.9.6 C-Tailing
3.9.7 PCR1
3.9.8 PCR2
3.9.9 PCR for Sequencing
3.9.10 SPRI Size Selection
3.9.11 Quantification
3.9.12 Next-Generation Sequencing
4 Notes
References
Chapter 19: In Vivo Tracking of Bacterial Colonization in Different Murine Models Using Bioluminescence: The Example of Salmon...
1 Introduction
2 Materials
2.1 Tn7 Chromosomal Integration of Reporter Fusions
2.2 Inoculum Preparation
2.3 Mouse Models
2.4 In Vivo Experiment and Bacterial Numeration
3 Methods
3.1 Construction of a No Promoter (NoP) Reporter Transcriptional Fusion (See Note 4)
3.2 Chromosomal Integration of Reporter Fusions (See Note 5)
3.3 Preparation of Inocula (See Note 7)
3.4 Preparation of Animals
3.5 Mice Infection, Anesthesia, and Imaging
3.6 Bioluminescence Quantification
4 Notes
References
Chapter 20: Two In Vivo Models to Study Salmonella Asymptomatic Carrier State in Chicks
1 Introduction
2 Materials
2.1 Bacterial Strain
2.2 Inoculum Preparation
2.3 Animals
2.4 In Vivo Experiment
2.4.1 Feed
2.4.2 Battery Cages
2.4.3 Cage
2.4.4 Large Isolator
2.4.5 Inoculation
2.4.6 Euthanasia
2.4.7 Autopsy
2.5 Bacterial Numeration
3 Methods
3.1 Preparation of a Frozen Inoculum
3.2 Animal Handling Before Inoculation
3.3 Checking for the Absence of Salmonella in Chicks
3.4 Inoculation
3.5 Sample Recovery from Live Animals
3.5.1 Fresh Fecal Samples
3.5.2 Blood Samples
3.6 Post-mortem Sample Recovery
3.6.1 Euthanasia
3.6.2 Beginning of the Necropsy
3.6.3 Blood Sampling
3.6.4 Recovery of Internal Organs
3.6.5 Cecal Tissue and Cecal Content Recovery
3.7 Bacterial Numeration
4 Notes
References
Index

Citation preview

Methods in Molecular Biology 2427

Ohad Gal-Mor Editor

Bacterial Virulence Methods and Protocols

METHODS

IN

MOLECULAR BIOLOGY

Series Editor John M. Walker School of Life and Medical Sciences University of Hertfordshire Hatfield, Hertfordshire, UK

For further volumes: http://www.springer.com/series/7651

For over 35 years, biological scientists have come to rely on the research protocols and methodologies in the critically acclaimed Methods in Molecular Biology series. The series was the first to introduce the step-by-step protocols approach that has become the standard in all biomedical protocol publishing. Each protocol is provided in readily-reproducible step-bystep fashion, opening with an introductory overview, a list of the materials and reagents needed to complete the experiment, and followed by a detailed procedure that is supported with a helpful notes section offering tips and tricks of the trade as well as troubleshooting advice. These hallmark features were introduced by series editor Dr. John Walker and constitute the key ingredient in each and every volume of the Methods in Molecular Biology series. Tested and trusted, comprehensive and reliable, all protocols from the series are indexed in PubMed.

Bacterial Virulence Methods and Protocols

Edited by

Ohad Gal-Mor The Infectious Diseases Research Laboratory, Sheba Medical Center, Tel-Hashomer, Israel; The Department of Clinical Microbiology and Immunology, Faculty of Medicine, Tel-Aviv University, Tel Aviv, Israel

Editor Ohad Gal-Mor The Infectious Diseases Research Laboratory Sheba Medical Center Tel-Hashomer, Israel The Department of Clinical Microbiology and Immunology, Faculty of Medicine Tel-Aviv University Tel Aviv, Israel

ISSN 1064-3745 ISSN 1940-6029 (electronic) Methods in Molecular Biology ISBN 978-1-0716-1970-4 ISBN 978-1-0716-1971-1 (eBook) https://doi.org/10.1007/978-1-0716-1971-1 © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022 The chapter 19 is licensed under the terms of the Creative Commons Attribution 4.0 International License (http:// creativecommons.org/licenses/by/4.0/). For further details see license information in the chapters. This work is subject to copyright. All rights are solely and exclusively licensed by the Publisher, whether the whole or part of the material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, recitation, broadcasting, reproduction on microfilms or in any other physical way, and transmission or information storage and retrieval, electronic adaptation, computer software, or by similar or dissimilar methodology now known or hereafter developed. The use of general descriptive names, registered names, trademarks, service marks, etc. in this publication does not imply, even in the absence of a specific statement, that such names are exempt from the relevant protective laws and regulations and therefore free for general use. The publisher, the authors and the editors are safe to assume that the advice and information in this book are believed to be true and accurate at the date of publication. Neither the publisher nor the authors or the editors give a warranty, expressed or implied, with respect to the material contained herein or for any errors or omissions that may have been made. The publisher remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. Cover Illustration Caption: A scanning electron microscope (SEM) photomicrograph of Escherichia coli bacteria cells magnification  90.51 K. Credit: Boris Fichtman, Bar Piscon, Amnon Harel, and Ohad Gal-Mor. This Humana imprint is published by the registered company Springer Science+Business Media, LLC, part of Springer Nature. The registered company address is: 1 New York Plaza, New York, NY 10004, U.S.A.

Preface This book was written during the years 2020–2021 throughout the ongoing coronavirus disease 2019 (COVID-19) outbreak. This global pandemic is overwhelming and greatly affects the health, sociology, politics, and economics of numerous countries, challenging past assumptions and future certainties. Nevertheless, pandemics such as COVID-19 are not entirely new phenomena. Newly emerging and reemerging infectious diseases have been affecting humankind since the Neolithic revolution, 12,000 years ago. Previously, devastating pandemics caused by the smallpox and measles viruses, the parasite falciparum malaria, and the bacterium Yersinia pestis have eliminated significant portions of the world’s population. The 1918 influenza pandemic killed at least 50 million people and is considered as the deadliest disease in recorded human history. More recently, the HIV/AIDS pandemic, identified in 1981, has taken the lives of at least 37 million people. Alarmingly, over the last decades, the frequency of emerging infectious diseases has been on the rise, with recurring outbreaks caused by Influenza, Ebola, Chikungunya, and Zika viruses, as well as outbreaks caused by the novel viruses SARS-CoV-1 in 2002, MERS-CoV in 2012, and the recently emerged SARS-CoV-2. Another troubling phenomenon is the continuous and escalating pandemic of antibiotic-resistant bacteria. In the last decades, we witnessed a dramatic and global increase in the occurrence of opportunistic and pathogenic bacteria that are resistant to antibiotics, such as multidrug-resistant tuberculosis and many other bacterial species. Infections caused by antimicrobial-resistant pathogens are often associated with high morbidity and mortality and may fail to respond to conventional treatment or even to the last-resort antibiotics. These reoccurring examples of unexpected, novel, and impactful emerging diseases may suggest that we have entered a pandemic era and that we will need to continue facing emerging infectious diseases in the foreseeable future. Such global challenge requires improved prevention, better and faster diagnostics, and new treatments for infectious diseases. Nonetheless, in order to effectively address these goals, we need to better know the biology of clinically-relevant pathogens and understand the complex interactions with their hosts. The field of bacterial virulence has gone through a dramatic revolution over the past two decades, and more efforts were put toward understanding how microbial interaction with a host results in the pathology of a specific disease. Today, it is well appreciated that pathogenesis research is highly relevant to the disciplines of cell biology, evolution, epidemiology, and microbial ecology, but it also changes our ability to prevent and treat infectious diseases and therefore affects humankind on the practical level. Establishment of cultured mammalian cells as relevant and informative experimental systems, development of new animal models, next generation sequencing and omics technologies, computational and bioinformatics tools, powerful optical imaging techniques, and new methods for high-throughput screening were all pivotal in the rapid development of the microbial pathogenesis field. This book contains three parts of useful protocols that researchers can follow and implement in their own labs. This collection of selected protocols includes advanced molecular biology and bioinformatics methods (Part I), cell culture and organoid models

v

vi

Preface

of infection (Part II), and in vivo infection models that are useful to study the interaction of pathogens with plants, insects, avian, and mammalian hosts (Part III). I would like to express my sincere gratitude to all of the contributors who agreed to articulate and share their established protocols with the broad scientific community. We hope that these protocols will be found useful and will help to promote and further develop the exciting and continuously evolving field of bacterial virulence. Tel-Aviv, Israel

Ohad Gal-Mor

Contents Preface . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Contributors. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

PART I

MOLECULAR BIOLOGY AND BIOINFORMATICS METHODS

1 Generation of Markerless Gene Deletion Mutants in Listeria monocytogenes Using a Mutated pheS for Counterselection . . . . . . . . . . . . . . . . . . . Shai Ran Sapir, Etai Boichis, and Anat A. Herskovits 2 A Rapid Fluorescence-Based Screen to Identify Regulators and Components of Interbacterial Competition Mechanisms in Bacteria. . . . . . . . . . . Daniel Tchelet and Dor Salomon 3 Predicting Type III Effector Proteins Using the Effectidor Web Server . . . . . . . . Naama Wagner, Doron Teper, and Tal Pupko 4 Assay for Type III Secretion in Escherichia coli . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Bosko Mitrovic and Neta Sal-Man 5 Profiling of Secreted Type 3 Secretion System Substrates by Salmonella enterica . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Rivka Shem-Tov and Ohad Gal-Mor

PART II

v ix

3

11 25 37

47

CELL CULTURE AND ORGANOID MODELS OF INFECTION

6 Analysis of SPI-1 Dependent Type III Secretion and Injection Using a NanoLuc Luciferase-Based Assay . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57 Sara Vilela Pais, Sibel Westerhausen, Erwin Bohn, and Samuel Wagner 7 Mycobacterium tuberculosis Infection of THP-1 Cells: A Model for High Content Analysis of Intracellular Growth and Drug Susceptibility . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73 Leah Rankine-Wilson, Ce´line Rens, Henok Asfaw Sahile, and Yossef Av-Gay 8 Bone Marrow–Derived Macrophage (BMDM) Infection by Listeria monocytogenes. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 83 Etai Boichis, Shai Ran Sapir, and Anat A. Herskovits 9 Preparation and Inflammasome Activation of Murine Bone Marrow–Derived and Resident Peritoneal Macrophages . . . . . . . . . . . . . . . . . . . . . 95 Izumi Sasaki and Tsuneyasu Kaisho 10 Flow Cytometry–Based Single Cell Analyses of Bacterial Adaptation to Intracellular Environments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105 Marc Schulte and Michael Hensel

vii

viii

11

12

13

Contents

Quantification of Microbial Fluorescent Sensors During Live Intracellular Infections . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 119 Erez Mills and Erik Petersen Dissecting Human Blood Immune Cells Response to Intracellular Infection Using Single-Cell RNA Sequencing . . . . . . . . . . . . . . . . . . . 133 Shelly Hen-Avivi and Roi Avraham Salmonella enterica Infection of Human and Mouse Colon Organoid-Derived Monolayers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 149 Erin C. Boyle, Eva J. Wunschel, and Guntram A. Grassl

PART III 14

15

16

17 18

19

20

IN VIVO MODELS OF INFECTION

Analysis of Salmonella enterica Adhesion to Leaves of Corn Salad or Lettuce . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Laura Elpers and Michael Hensel Methods for Using the Galleria mellonella Invertebrate Model to Probe Enterococcus faecalis Pathogenicity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Ling Ning Lam, Debra N. Brunson, Jessica K. Kajfasz, and Jose´ A. Lemos Murine Soft Tissue Infection Model to Study Group A Streptococcus (GAS) Pathogenesis in Necrotizing Fasciitis . . . . . . . . . . . . . . . . . . . Miriam Ravins, Poornima Ambalavanan, Debabrata Biswas, Rachel Ying Min Tan, Kimberly Xuan Zhen Lim, Yael Kaufman, Aparna Anand, Abhinay Sharma, and Emanuel Hanski Mouse Model to Study Salmonella-Induced Colitis . . . . . . . . . . . . . . . . . . . . . . . . . Katrin Ehrhardt and Guntram A. Grassl Analysis of Salmonella Typhi Pathogenesis in a Humanized Mouse Model . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Taylor A. Stepien, Stephen J. Libby, Joyce E. Karlinsey, Michael A. Brehm, Dale L. Greiner, Leonard D. Shultz, Thea Brabb, and Ferric C. Fang In Vivo Tracking of Bacterial Colonization in Different Murine Models Using Bioluminescence: The Example of Salmonella . . . . . . . . . . . . . . . . . Michae¨l Koczerka, Isabelle Lantier, Anne Pinard, Marie Morillon, Justine Deperne, Ohad Gal-Mor, Olivier Gre´pinet, and Isabelle Virlogeux-Payant Two In Vivo Models to Study Salmonella Asymptomatic Carrier State in Chicks. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . Philippe Velge, Pierrette Menanteau, Thierry Chaumeil, Emilie Barilleau, Je´roˆme Trotereau, and Isabelle Virlogeux-Payant

Index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

167

177

185

201

215

235

249

265

Contributors POORNIMA AMBALAVANAN • Singapore-HUJ Alliance for Research and Enterprise, MMID Phase II, Campus for Research Excellence and Technological Enterprise (CREATE), Singapore, Singapore; Department of Microbiology and Immunology, National University of Singapore, Singapore, Singapore APARNA ANAND • Department of Microbiology and Molecular Genetics, The Institute for Medical Research, Israel-Canada (IMRIC), Faculty of Medicine, The Hebrew University of Jerusalem, Jerusalem, Israel YOSSEF AV-GAY • Department of Microbiology & Immunology, The University of British Columbia, Vancouver, BC, Canada; Division of Infectious Disease, Department of Medicine, Faculty of Medicine, The University of British Columbia, Vancouver, BC, Canada ROI AVRAHAM • Department of Biological Regulation, Weizmann Institute of Science, Rehovot, Israel EMILIE BARILLEAU • INRAE, Universite´ Franc¸ois Rabelais de Tours, UMR 1282 ISP, Nouzilly, France DEBABRATA BISWAS • Singapore-HUJ Alliance for Research and Enterprise, MMID Phase II, Campus for Research Excellence and Technological Enterprise (CREATE), Singapore, Singapore; Department of Microbiology and Immunology, National University of Singapore, Singapore, Singapore ERWIN BOHN • Interfaculty Institute of Microbiology and Infection Medicine (IMIT), University of Tu¨bingen, Tu¨bingen, Germany; Excellence Cluster Controlling Microbes to Fight Infections (CMFI), Tu¨bingen, Germany; Partner-site Tu¨bingen, German Center for Infection Research (DZIF), Tu¨bingen, Germany ETAI BOICHIS • The Shmunis School of Biomedicine and Cancer Research, The George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv, Israel ERIN C. BOYLE • Institute for Laboratory Animal Science, Hannover Medical School, Hannover, Germany THEA BRABB • Department of Comparative Medicine, University of Washington, Seattle, WA, USA MICHAEL A. BREHM • Department of Molecular Medicine, University of Massachusetts Medical School, Worcester, MA, USA DEBRA N. BRUNSON • Department of Oral Biology, University of Florida College of Dentistry, Gainesville, FL, USA THIERRY CHAUMEIL • INRAE, PFIE, F-37380, Nouzilly, France JUSTINE DEPERNE • INRAE, Universite´ de Tours, ISP, Nouzilly, France KATRIN EHRHARDT • Institute of Medical Microbiology and Hospital Epidemiology and German Center for Infection Research (DZIF), Partner Site Hannover-Braunschweig, Hannover Medical School, Hannover, Germany LAURA ELPERS • Abteilung Mikrobiologie and CellNanOs—Center of Cellular Nanoanalytics Osnabru¨ck, Fachbereich Biologie/Chemie, Universit€ a t Osnabru¨ck Barbarastr, Osnabru¨ck, Germany

ix

x

Contributors

FERRIC C. FANG • Department of Global Health, University of Washington, Seattle, WA, USA; Department of Laboratory Medicine & Pathology, University of Washington, Seattle, WA, USA; Department of Microbiology, University of Washington, Seattle, WA, USA OHAD GAL-MOR • The Infectious Diseases Research Laboratory, Sheba Medical Center, TelHashomer, Israel; The Department of Clinical Microbiology and Immunology, Faculty of Medicine, Tel-Aviv University, Tel Aviv, Israel GUNTRAM A. GRASSL • Institute of Medical Microbiology and Hospital Epidemiology and German Center for Infection Research (DZIF), Partner Site Hannover-Braunschweig, Hannover Medical School, Hannover, Germany DALE L. GREINER • Department of Molecular Medicine, University of Massachusetts Medical School, Worcester, MA, USA OLIVIER GRE´PINET • INRAE, Universite´ de Tours, ISP, Nouzilly, France EMANUEL HANSKI • Department of Microbiology and Molecular Genetics, The Institute for Medical Research, Israel-Canada (IMRIC), Faculty of Medicine, The Hebrew University of Jerusalem, Jerusalem, Israel; Singapore-HUJ Alliance for Research and Enterprise, MMID Phase II, Campus for Research Excellence and Technological Enterprise (CREATE), Singapore, Singapore; Department of Microbiology and Immunology, National University of Singapore, Singapore, Singapore SHELLY HEN-AVIVI • Department of Biological Regulation, Weizmann Institute of Science, Rehovot, Israel MICHAEL HENSEL • Abteilung Mikrobiologie and CellNanOs—Center of Cellular Nanoanalytics Osnabru¨ck, Fachbereich Biologie/Chemie, Universit€ a t Osnabru¨ck Barbarastr, Osnabru¨ck, Germany ANAT A. HERSKOVITS • The Shmunis School of Biomedicine and Cancer Research, The George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv, Israel TSUNEYASU KAISHO • Department of Immunology, Institute of Advanced Medicine, Wakayama Medical University, Wakayama, Japan JESSICA K. KAJFASZ • Department of Oral Biology, University of Florida College of Dentistry, Gainesville, FL, USA JOYCE E. KARLINSEY • Department of Microbiology, University of Washington, Seattle, WA, USA YAEL KAUFMAN • Department of Microbiology and Molecular Genetics, The Institute for Medical Research, Israel-Canada (IMRIC), Faculty of Medicine, The Hebrew University of Jerusalem, Jerusalem, Israel MICHAE¨L KOCZERKA • INRAE, Universite´ de Tours, ISP, Nouzilly, France LING NING LAM • Department of Oral Biology, University of Florida College of Dentistry, Gainesville, FL, USA ISABELLE LANTIER • INRAE, Universite´ de Tours, ISP, Nouzilly, France JOSE´ A. LEMOS • Department of Oral Biology, University of Florida College of Dentistry, Gainesville, FL, USA STEPHEN J. LIBBY • Department of Laboratory Medicine & Pathology, University of Washington, Seattle, WA, USA KIMBERLY XUAN ZHEN LIM • Singapore-HUJ Alliance for Research and Enterprise, MMID Phase II, Campus for Research Excellence and Technological Enterprise (CREATE), Singapore, Singapore; Department of Microbiology and Immunology, National University of Singapore, Singapore, Singapore PIERRETTE MENANTEAU • INRAE, Universite´ Franc¸ois Rabelais de Tours, UMR 1282 ISP, Nouzilly, France

Contributors

xi

EREZ MILLS • Department of Animal Sciences, Robert H. Smith Faculty of Agriculture, Food, and Environment, The Hebrew University of Jerusalem, Rehovot, Israel BOSKO MITROVIC • The Shraga Segal Department of Microbiology, Immunology and Genetics, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva, Israel MARIE MORILLON • INRAE, Universite´ de Tours, ISP, Nouzilly, France SARA VILELA PAIS • Interfaculty Institute of Microbiology and Infection Medicine (IMIT), University of Tu¨bingen, Tu¨bingen, Germany; Excellence Cluster Controlling Microbes to Fight Infections (CMFI), Tu¨bingen, Germany ERIK PETERSEN • Department of Health Sciences, College of Public Health, East Tennessee State University, Johnson City, TN, USA ANNE PINARD • INRAE, PFIE, Nouzilly, France TAL PUPKO • The Shmunis School of Biomedicine and Cancer Research, Tel Aviv University, Tel Aviv, Israel SHAI RAN SAPIR • The Shmunis School of Biomedicine and Cancer Research, The George S. Wise Faculty of Life Sciences, Tel Aviv University, Tel Aviv, Israel LEAH RANKINE-WILSON • Department of Microbiology & Immunology, The University of British Columbia, Vancouver, BC, Canada MIRIAM RAVINS • Department of Microbiology and Molecular Genetics, The Institute for Medical Research, Israel-Canada (IMRIC), Faculty of Medicine, The Hebrew University of Jerusalem, Jerusalem, Israel CE´LINE RENS • Division of Infectious Disease, Department of Medicine, Faculty of Medicine, The University of British Columbia, Vancouver, BC, Canada HENOK ASFAW SAHILE • Division of Infectious Disease, Department of Medicine, Faculty of Medicine, The University of British Columbia, Vancouver, BC, Canada NETA SAL-MAN • The Shraga Segal Department of Microbiology, Immunology and Genetics, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva, Israel DOR SALOMON • Department of Clinical Microbiology and Immunology, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel IZUMI SASAKI • Department of Immunology, Institute of Advanced Medicine, Wakayama Medical University, Wakayama, Japan MARC SCHULTE • Abteilung Mikrobiologie and CellNanOs—Center of Cellular Nanoanalytics Osnabru¨ck, Fachbereich Biologie/Chemie, Universit€ a t Osnabru¨ck Barbarastr, Osnabru¨ck, Germany ABHINAY SHARMA • Department of Microbiology and Molecular Genetics, The Institute for Medical Research, Israel-Canada (IMRIC), Faculty of Medicine, The Hebrew University of Jerusalem, Jerusalem, Israel RIVKA SHEM-TOV • The Infectious Diseases Research Laboratory, Sheba Medical Center, TelHashomer, Israel; The Department of Clinical Microbiology and Immunology, Faculty of Medicine, Tel-Aviv University, Tel Aviv, Israel LEONARD D. SHULTZ • The Jackson Laboratory, Bar Harbor, ME, USA TAYLOR A. STEPIEN • Department of Global Health, University of Washington, Seattle, WA, USA RACHEL YING MIN TAN • Singapore-HUJ Alliance for Research and Enterprise, MMID Phase II, Campus for Research Excellence and Technological Enterprise (CREATE), Singapore, Singapore; Department of Microbiology and Immunology, National University of Singapore, Singapore, Singapore DANIEL TCHELET • Department of Clinical Microbiology and Immunology, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel

xii

Contributors

DORON TEPER • Department of Plant Pathology and Weed Research, Institute of Plant Protection, Agricultural Research Organization (ARO), Volcani Center, Rishon LeZion, Israel JE´ROˆME TROTEREAU • INRAE, Universite´ Franc¸ois Rabelais de Tours, UMR 1282 ISP, Nouzilly, France PHILIPPE VELGE • INRAE, Universite´ Franc¸ois Rabelais de Tours, UMR 1282 ISP, Nouzilly, France ISABELLE VIRLOGEUX-PAYANT • INRAE, Universite´ de Tours, ISP, Nouzilly, France NAAMA WAGNER • The Shmunis School of Biomedicine and Cancer Research, Tel Aviv University, Tel Aviv, Israel SAMUEL WAGNER • Interfaculty Institute of Microbiology and Infection Medicine (IMIT), University of Tu¨bingen, Tu¨bingen, Germany; Excellence Cluster Controlling Microbes to Fight Infections (CMFI), Tu¨bingen, Germany; Partner-site Tu¨bingen, German Center for Infection Research (DZIF), Tu¨bingen, Germany SIBEL WESTERHAUSEN • Interfaculty Institute of Microbiology and Infection Medicine (IMIT), University of Tu¨bingen, Tu¨bingen, Germany EVA J. WUNSCHEL • Institute of Medical Microbiology and Hospital Epidemiology and German Center for Infection Research (DZIF), Partner Site Hannover-Braunschweig, Hannover Medical School, Hannover, Germany

Part I Molecular Biology and Bioinformatics Methods

Chapter 1 Generation of Markerless Gene Deletion Mutants in Listeria monocytogenes Using a Mutated pheS for Counterselection Shai Ran Sapir, Etai Boichis, and Anat A. Herskovits Abstract Gene alteration/deletion by allelic exchange is the preferred strategy for gene manipulation in bacteria. Here we present the fundamentals for an efficient allelic exchange gene deletion method in the bacterial pathogen Listeria monocytogenes. Combining vector generation by Gibson assembly with a counterselection system based on the mutated phenylalanine synthetase (pheS*) makes the generation of gene deletion mutants straightforward and time efficient. Key words Counterselection, Listeria monocytogenes, Allelic exchange, Mutagenesis, pheS, Gibson assembly

1

Introduction Gene knockout, gene deletion, codon alteration and any other types of gene editing can all be achieved by a fairly simple process of allelic exchange by homologous recombination [1]. In bacteria, homologous recombination is usually catalyzed by RecA, a DNA repair protein that can recombine two DNA molecules that contain homologous sequences. Using this process, genes can be deleted or edited by introducing a plasmid containing upstream and downstream homologous sequences to the gene of interest, which allow two recombination events to occur sequentially around the target gene. Typically, the first recombination event will result in the integration of the complete plasmid into the bacterial chromosome, via one of the homologous regions. Since the plasmid also carries an antibiotic resistance gene (e.g., CmR, conferring chloramphenicol resistance), this recombination event can be selected by growing the bacteria on the corresponding antibiotic drug (Fig. 1a, b). To complete the gene deletion/editing, a second recombination event must occur via the other homologous region, which results in the excision of the plasmid together with the target gene, thereby

Ohad Gal-Mor (ed.), Bacterial Virulence: Methods and Protocols, Methods in Molecular Biology, vol. 2427, https://doi.org/10.1007/978-1-0716-1971-1_1, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022

3

4

Shai Ran Sapir et al.

A pLR16 Plasmid

pLR16

Upstream homology

B

Downstream homology

Upstream homology

Genomic region of the target gene

Downstream homology

Target gene

First recombinaon event Upstream homology

Downstream homology

pheS*

pL16 excision without the target gene

CmR

Upstream homology

Second recombinat ion event

Integraon of pLR16

Downstream homology

Target gene

pL16 excision with the target gene

C CmR

Upstream homology

Downstream homology

Upstream homology

Upstream homology

Target gene

Back to WT

Target gene

Downstream homology

CmR

Upstream homology

Downstream homology

Target gene

Downstream homology

Downstream homology

Upstream homology

Upstream homology

Downstream homology

Successful deletion

Fig. 1 (a) pLR16 plasmid carrying two homologous regions flanking the desired target gene. (b) First recombination event between the plasmid and the bacterial chromosome. (c) Second recombination event between the integrated plasmid and the bacterial chromosome. If the second recombination event occurs in the same flanking region as the first event, the bacterium will return to wild type. If the second recombination event occurs in the other flanking region a deletion mutant will be generated

rendering the bacteria sensitive to the antibiotics (Fig. 1c). Of note, at a similar frequency, the second recombination event can also occur via the first homologous region (where the first crossover took place), resulting in the excision of the plasmid without the target gene, hence reverting the bacteria to the wild type genotype (Fig.1c). Either way, selection for the loss of the plasmid relies on the temperature-sensitive nature of plasmid’s origin of replication, which prevents its replication under high temperatures, that is, 41
C, therefore allowing for the curing of the plasmid at lower temperature [2, 3]. While this approach for gene deletion is widely used, it is not without shortcomings; the second recombination event is rare, occurring in a small number of bacteria of which only 50% lose the desired gene. We therefore describe in this protocol the use of pPL16 (a variant of pKSV7), which harbors a counterselection system that is based on the mutated phenylalanine synthetase gene (pheS*) [4]. Using this plasmid, the process of homologous recombination and screening of gene deletion mutants is more

Gene Alterations Using a Counterselection System

5

rapid and efficient. The pheS* mutation renders the enzyme’s binding site more promiscuous, allowing the binding of the toxic p-chloro-phenylalanine analog (p-Cl-phe) as a substrate. When pheS* is introduced into Listeria monocytogenes and highly expressed under the control of a constitutive promoter [5] (using pLR16), the bacteria become sensitive to p-Cl-phe, hence fail to grow on plates supplemented with this substrate. This enables the utilization of pheS* as a negative selection marker for the identification of plasmid-cured bacteria in a more efficient manner [6]. The protocol presented here uses L. monocytogenes as a model organism for gene deletion, though this method and plasmid [6] can be further adapted to other gram-positive bacteria.

2

Materials

2.1 Gibson Assembly Design

1. The use of cloning software for the primer design is highly recommended, but not a necessity. Snapgene: https://www. snapgene.com/, Geneious: https://www.geneious.com/, Benchling (Free): https://www.benchling.com/. 2. ARGO: http://www.broad.mit.edu/annotation/argo. 3. Biocalculator by metabion: http://www.metabion.com/sup port-and-solution/biocalculator/. 4. pLR16 (Addgene): http://www.addgene.org/search/cata log/plasmids/?q¼pLR16.

2.2 Gibson Assembly Reaction

1. Vector and insert fragments. 2. Gibson assembly kit. 3. NebBioCalculator: dsdnaamt.

2.3

Transformation

https://nebiocalculator.neb.com/#!/

1. Chemical or electrical competent E. coli SM-10 λpir. 2. Luria–Bertani (LB) broth liquid medium. 3. LB agar plates supplemented chloramphenicol (Cm).

with

10

μg/mL

4. Plasmid extraction kit. 5. Plasmid sequencing service. 2.4 Conjugation (Two-Parental Mating)

1. Prepare Listeria recipient strain on a BHI agar plate supplemented with 100 μg/mL streptomycin (Strep). 2. Prepare E. coli SM-10 donor strain on LB agar plate supplemented with 10 μg/mL chloramphenicol (Cm). 3. BHI agar plate. 4. BHI agar plate supplemented with 100 μg/mL Strep and 10 μg/mL Cm (BHI Strep Cm plate).

6

Shai Ran Sapir et al.

2.5 Plasmid Integration and Curing

1. BHI agar plate supplemented with 100 μg/mL Strep and 10 μg/mL Cm. 2. BHI liquid medium supplemented with 100 μg/mL Strep and 10 μg/mL Cm (BHI Strep Cm medium). 3. BHI agar plate supplemented with 100 μg/mL Strep (BHI Strep plate). 4. BHI agar plate supplemented with 18 mM p-chloro-phenylalanine (ACROS™; BHI p-chloro-phe plate). p-chloro-phe is insoluble in water: For 1 L of p-chloro-phe BHI agar, add 3.6 g of p-chloro-phe into of BHI-agar before autoclave. Mix well. Immediately after autoclave, mix again and pour the plates.

2.6 Mutant Verification

1. Ready-to-use Taq polymerase mix. 2. BHI agar plate supplemented with 100 μg/mL Strep. 3. BHI agar plate supplemented with 10 μg/mL Cm (BHI Cm plate).

3

Methods

3.1 Designation/ Determination of the Insert Homologous Regions and Gibson Assembly Primer Design

In this section, the construction of a pLR16 plasmid harboring upand downstream homologous regions is described in two steps: First, the insert’s two homologous region fragments and the pLR16 vector fragment are generated using PCR. These fragments are then combined into a single plasmid via Gibson assembly, a method that allows the joining of multiple DNA fragments in a single isothermal reaction (Fig. 2). Optimize homologous recombination and Gibson assembly by designing 750 bp homologous regions and primers with 40 bp annealing complementation, respectively. Designate your primers as: Insert A/B (IA/IB) for the upstream homologous region, IC/ID for the downstream homologous region, and Vector A/B (VA/VB) for pLR16 plasmid, six primers in total. 1. When choosing primers for the homologous fragments, ribosomal RNA or sequences encoding for highly hydrophobic proteins may cause a major problem and should be avoided. If this is the case, shorten the fragment to a minimum of 350–400 bp (see Note 1). 2. If you plan on deleting a gene that is part of an operon, verify that the location of the ribosome binding site (RBS) of the next gene in the operon is not in the open reading frame (ORF) of your gene of interest (using Argo). If so, consider preforming a partial deletion that preserves the RBS.

Gene Alterations Using a Counterselection System Downstream homology insert fragment

A

VB primer

IC primer IA primer

VA primer ID primer

7

+

pLR16

15 min Gibson mix 50 C

pL16 ready for transformaon

IB primer

Upstream homology insert fragment

B

Fig. 2 Gibson assembly (a) Generation of insert and vector fragments carrying 40 bp of identity at the distal regions. (b) Gibson assembly reaction will result in a complete, ready for transformation plasmid. (c) Gibson primer design: 40 bp of annealing complementation at the seam between fragments. The use of cloning software is highly recommended (see Subheading 4)

3. Do not design a complete gene deletion if possible, instead retain the original reading frame and leave around 2–3 amino acids from each terminus. To do that, design your primers so the deletion starts 6 or 9 bp after the ATG and ends 6 or 9 bp before the stop codon. 4. Avoid repetitive regions and validate that your primers don’t form dimers using Biocalculator by Metabion. 5. Tm of primers should be around 60
C with 40–60% GC content. 6. Generate insert fragments and amplify the vector by doing the following. (a) Running PCR (see Note 2). (b) Separating products in agarose gel. (c) Purifying desired product from gel (see Note 3). 3.2 Gibson Assembly Reaction

1. Add 0.08 pmol of the vector and each fragment and add DDW to a total of volume of 10 μL (calculate by the length of each fragment using NebBioCalculator) (see Note 4). 2. Preheat thermocycler to 50
C. 3. Add 10 μL of Gibson assembly master mix X2 (see Note 5) and incubate for 15–60 min (see Note 6) at 50
C.

3.3 Transformation to a Donor E. coli Strain SM10

1. Use chemical or electrocompetent cells. pLR16 harbors chloramphenicol resistance genes for gram-positive and gramnegative bacteria. Therefore, plate transformants on LB agar plates supplemented with Cm. 2. Validate successful cloning by colony PCR with distal insert primers on several colonies obtained after transformation.

8

Shai Ran Sapir et al.

3. Inoculate a single colony that was validated by PCR into 5 mL LB liquid medium supplemented with Cm and incubate overnight at 37
C. 4. Extract the plasmid using a commercial kit and validate it by restriction with appropriate restriction enzymes (see Note 7). 5. Sequence the plasmid to verify homologous regions using distal insert primers. 3.4 Conjugation (Two-Parental Mating)

1. Using a bacteriological loop streak your donor strain (SM10) on a BHI plate into a 1.5–2 cm2 square, add your recipient strain (Lm 10403S) into the same square and mix well (see Note 8). 2. Incubate 4–6 h at 37
C. Pick up all bacteria into a tube with 2 mL of BHI. 3. Vortex until the bacteria are suspended. Dilute the sample to 1: 10 and spread 50 μL on BHI Strep Cm plates using glass beads. 4. Incubate 2 days at 37
C.

3.5 Plasmid Integration (Pop-In)

1. Pick up a single colony into 3 mL of BHI Strep Cm medium and incubate at 41
C overnight or longer to obtain a turbid bacterial culture (see Note 9). 2. Streak 5 μL from tube on to plate and incubate at 41
C to obtain visible colonies. Incubation may take up to 2 days. Keep this plate until you receive the desired mutant.

3.6 Plasmid Curing (Pop-Out)

1. Grow a single colony from the Pop-In plate in 3 mL of BHI liquid medium in 30
C overnight. Keep this culture at 4
C until you receive the desired mutant. 2. Dilute the culture to 104 and spread 100 μL on one BHI pchloro-phe plate and one BHI Strep plate. Incubate overnight at 37
C. 3. After overnight incubation, there should be a lawn of bacteria on the BHI Strep plate and about 200 colonies on the BHI pchloro-phe plate. 4. If there is lawn on both plates, plasmid integration did not work well. Pick a different colony from Subheading 3.5, step 2.

3.7 Mutant Verification

1. Verify Cm sensitivity: replica plate several colonies (8–10 colonies) grown on the BHI p-chloro-phe plates on both a BHI Strep plate and a BHI CM plate to verify the Cm sensitivity. 2. Perform colony PCR on Cm sensitive colonies to verify the mutants using distal insert primers. The complete procedure of a gene deletion using pLR16 is illustrated in Fig. 3.

Gene Alterations Using a Counterselection System A

9

B1

∆gene pLR16

Transformaon to conjugave donor strain

E. coli SM10

C Donor strain LB Cm plate

D

Pop-in

E

Conjugaon

B2 Listeria monocytogenes 10403S

BHI plate (no anbiocs for 4-6 hours at 37ºC)

BHI Strep Cm plate

Recipient strain BHI Strep plate Streak 5 μl I

J1

H1

9

2 6

5

7 8 3

J2

1

BHI Cm plate

G

4

Colony PCR Deleon verificaon

BHI p-Chloro-Phenylalanine plate H2

BHI Strep plate

Pop-out

100 μl of 10⁻⁴ diluon

BHI Strep medium at 30ºC over night

Verify chloramphenicol sensivty

F

BHI Strep Cm plate at 41ºC over 2 nights

BHI Strep plate

Fig. 3 Gene deletion using pLR16: (a) pLR16 plasmid carrying two homologous regions flanking the desired target gene. (b) Transformation of pLR16 into the donor SM10 strain and the preparation of Listeria monocytogenes 10403S recipient strain. (c) Conjugation 4–6 h at 37
C. (d) Plating of conjugation patch onto BHI Strep Cm for 2 days. (e) Pop-In at 41
C in a liquid medium. (f) Pop-In at 41
C on BHI Strep Cm agar plates. (g) Pop-Out in liquid BHI without Cm. (h) Plating on p-Cl-phe plates and on BHI Strep plates as a control. (i) Colony PCR for verification of the mutant. (j) Test for Cm sensitivity to verify plasmid curing

4

Notes 1. Fragments shorter than 200 bp are not recommended for Gibson assembly. If this is the case, use restriction cloning. 2. Fragments generation: Recommended polymerase: Thermo Scientific™ Phusion Hot Start II DNA Polymerase. 3. Sample recovery: Recommended kits: NucleoSpin® MACHEREY-NAGEL, Wizard® SC Gel and PCR clean-up System PROMEGA. 4. Work on ice. 5. Recommended Gibson kits: GeneArt™ Seamless Cloning and Assembly Enzyme Mix THERMOFISHER SCIENTIFIC ,

10

Shai Ran Sapir et al.

Gibson Assembly® BIOLABS Inc.

Master

Mix

NEW

ENGLAND

6. 15 min reaction is mandatory. Incubate up to 60 min for greater efficiency. 7. Recommended plasmid extraction kit: GenElute™ SIGMA. 8. Conjugation (Two-parental mating): Alternatively: electrocompetent Listeria cells [1] can be generated and transformed with purified plasmid. 9. Plasmid integration (Pop-In): Colonies that appear after more than 2 days are probably resistant mutants and should not be used. References 1. Rychli K, Guinane CM, Daly K, Hill C, Cotter PD (2014) Generation of nonpolar deletion mutants in Listeria monocytogenes using the “SOEing” method. Methods Mol Biol. https://doi.org/10.1007/978-1-4939-07038_16 2. Arnaud M, Chastanet A, De´barbouille´ M (2004) New vector for efficient allelic replacement in naturally nontransformable, low-GC-content, gram-positive bacteria. Appl Environ Microbiol. https://doi.org/10.1128/AEM.70.11. 6887-6891.2004 3. Abdelhamed H, Lawrence ML, Karsi A (2015) A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes. Plasmid. https://doi. org/10.1016/j.plasmid.2015.05.003

4. Kast P, Hennecke H (1991) Amino acid substrate specificity of Escherichia coli phenylalanyl-tRNA synthetase altered by distinct mutations. J Mol Biol. https://doi.org/10. 1016/0022-2836(91)90740-W 5. Behari J, Youngman P (1998) Regulation of hly expression in Listeria monocytogenes by carbon sources and pH occurs through separate mechanisms mediated by PrfA. Infect Immun. https://doi.org/10.1128/iai.66.8.3635-3642. 1998 6. Argov T, Rabinovich L, Sigal N, Herskovits AA (2017) An effective counterselection system for Listeria monocytogenes and its use to characterize the monocin genomic region of strain 10403S. Appl Environ Microbiol 83:1–11. https://doi. org/10.1128/AEM.02927-16

Chapter 2 A Rapid Fluorescence-Based Screen to Identify Regulators and Components of Interbacterial Competition Mechanisms in Bacteria Daniel Tchelet and Dor Salomon Abstract Contact-dependent antibacterial mechanisms enhance bacterial fitness as they enable bacteria to outcompete their rivals and thrive in diverse environments. Such systems also allow pathogenic bacteria to establish a niche inside a host, where they must compete with commensal microflora. In many cases, antibacterial systems are tightly regulated by complex sensor and signal transduction networks. Deciphering these regulatory networks, as well as identifying functional components of antibacterial mechanisms, are valuable objectives since essential regulators and components present possible targets for developing antivirulence therapies. Here we describe Bacterial Competition Fluorescence (BaCoF), a methodology that relies on a fluorescence signal to determine the outcome of bacterial competitions. This methodology enables screening of mutant libraries to identify genes that are essential for activating a contact-dependent antibacterial system of interest. Thus, this methodology can be applied to reveal essential regulators and components of antibacterial systems in bacterial pathogens. Key words Bacterial competition, Antibacterial toxin, Transposon mutagenesis, T6SS, Regulation, Contact-dependent

1

Introduction Bacteria often reside in mixed communities where constant battles over resources have led to the evolution of diverse antibacterial strategies that provide a competitive advantage. A common strategy employed in such competitions is the contact-dependent delivery of toxic proteins that mediate antibacterial activities into neighboring target cells [1]. Several protein delivery systems, such as the type VI secretion system (T6SS) [2–4] and the contact-dependent growth inhibition (CDI) system [5], have been implicated in interbacterial conflicts. These systems are often tightly regulated and are expressed under conditions that benefit their producer; the conditions differ between bacterial species and even between different

Ohad Gal-Mor (ed.), Bacterial Virulence: Methods and Protocols, Methods in Molecular Biology, vol. 2427, https://doi.org/10.1007/978-1-0716-1971-1_2, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022

11

12

Daniel Tchelet and Dor Salomon

isolates of the same strain [6–9]. In many bacteria, the regulatory networks that govern the activation of antibacterial secretion systems upon perception of environmental cues remain unknown. Moreover, in complex systems, such as T6SS, additional components which may be encoded outside of the system’s main gene cluster can be difficult to identify by sequence analyses alone. To enable the identification of regulators and components that are required for the activation of antibacterial systems in bacteria, we developed a methodology, named BaCoF (Bacterial Competition Fluorescence), that relies on qualitative monitoring of bacterial competition outcomes [10]. 1.1 Principle of Bacterial Competition Fluorescence (BaCoF)

BaCoF enables intermediate to high-throughput screening of a mutant library to identify genes that are required for the activation of a contact-dependent antibacterial system of interest. First, a mutant library is generated by random transposon insertions into a parental strain employing the antibacterial system of interest to intoxicate rival bacteria. Individual mutant clones are then mixed in multiwell plates with prey bacteria that are sensitive to intoxication by the antibacterial system of interest and that constitutively express a fluorescent protein. The mixed cultures are stamped onto solid media competition plates (i.e., plates that when incubated under predetermined conditions result in activation of the antibacterial system). Viability and growth of prey bacteria are assessed by monitoring the fluorescence of mixed colonies after co-incubation; detection of fluorescence implies that the antibacterial system in the mutant attacker strain was inactive and thus allowed the fluorescent prey to grow. The mutated gene in the inactive attacker is therefore a putative regulator or structural component of the antibacterial system (see Note 1). Importantly, prior to the screen, calibration of the conjugationbased protocol for transposon mutagenesis is required, as is calibration of the volume of the fluorescent prey culture to be added into each mutant-containing well and the timepoint at which fluorescence in the competition plates should be assessed.

1.2 Method Requirements

Several guidelines and conditions must be fulfilled to employ BaCoF: (i) the antibacterial system of interest must mediate contact-dependent intoxication of the prey. BaCoF is not suitable to study contact-independent antibacterial systems since mixed cultures are stamped in close proximity on the competition plate and thus diffusible antibacterial toxins, such as colicins [11], can affect neighboring competitions; (ii) an attacker strain that activates and uses the antibacterial system of interest under known conditions, preferably devoid of other antibacterial determinants that may mask the results, should be used as the parental attacker; and (iii) a sensitive prey that grows under the conditions in which the antibacterial system is active in the attacker is required. The prey

Elucidating Mechanisms of Interbacterial Competition

13

should be sensitive to intoxication only by the attacker’s system of interest and not by other antibacterial determinants (see Note 2). The prey should also constitutively express a fluorescent protein (e.g., GFP) or a bright chromoprotein (e.g., amilCP [12]), either from the chromosome or from a stable plasmid that does not require selective pressure for maintenance. When implementing BaCoF, one must consider attributes that are specific to the bacterium of choice or the antibacterial system of interest and make appropriate adjustments. For example, growth conditions, selective conditions, the sensitive prey strain, and the time frame of the incubation on competition plates could differ depending on the investigated model system. 1.3 Applying BaCoF on a Vibrio parahaemolyticusT6SS

2

Here, we describe the application of the BaCoF methodology to identify components required for activation of the antibacterial T6SS2 in Vibrio parahaemolyticus strain BB22OP [7, 13]. We provide details on generating a transposon library in Vibrio via conjugation of a Tn5 transposon [14] (see Note 3), and we describe experimental conditions under which the abovementioned T6SS2 is active and used to intoxicate competitors [7].

Materials

2.1 Media and Solutions

1. Lysogeny broth (LB) media: 1% wt/vol NaCl, 0.5% wt/vol yeast extract, 1% wt/vol tryptone. For solid media, add 1.5% agar. Autoclave. 2. Marine LB (MLB) media: LB containing 3% wt/vol NaCl. 3. Marine minimal media (MMM), solid: 2% wt/vol NaCl, 0.4% wt/vol galactose, 5 mM MgSO4, 77 mM K2HPO4, 20 mM NH4Cl, 1.5% wt/vol agar. Autoclave before adding filtersterilized galactose. 4. Antibiotics (prepare 1000 stock solutions and maintain at 20  C; add to media below 55  C): 100 μg/mL erythromycin (dissolve in 100% ethanol), 30 μg/mL or 250 μg/mL kanamycin (for Escherichia coli or Vibrio parahaemolyticus, respectively. Dissolve in ultra-pure water), 100 μg/mL spectinomycin (dissolve in ultra-pure water). 5. Sterile phosphate-buffered saline (PBS). 6. Ethanol, 96–100% (keep in a flammable storage cabinet away from heat source).

2.2 Strains and Plasmids

1. A transposon donor: E. coli DH5α λ pir harboring the miniTn5 delivery vector, pEVS170 (kanamycin resistance), containing an RP4 origin of transfer for mobilization, a hyperactive Tn5 transposase, a kanamycin resistance cassette to maintain

14

Daniel Tchelet and Dor Salomon

the plasmid in the λ pir host, and transposase recognition sequences flanking an R6K origin and erythromycin resistance cassette (to select for transposon insertions in the recipient cell genome) [14]. 2. A conjugation helper: E. coli CC118 λ pir harboring pEVS104 (kanamycin resistance) [14]. 3. Bacterial attacker cells employing a functional antibacterial T6SS, and a nonfunctional mutant (e.g., in this protocol, V. parahaemolyticus BB22OP Δhcp1 with an active T6SS2, and V. parahaemolyticus BB22OP Δhcp1Δhcp2 with an inactive T6SS2, respectively [7]). 4. Fluorescent, sensitive prey cells (e.g., in this protocol, V. natriegens ATCC 14048 containing a stable, high copy plasmid from which GFP is constitutively expressed (pGFP; spectinomycin resistance) [15]). 2.3

Equipment

1. A temperature controlled incubator. 2. A temperature controlled shaker. 3. Sterile 96-well plates with lid. 4. Eight-channel pipettor. 5. Metal pin replicator (48- or 96-pins). 6. Fluorescence imager.

3

Methods

3.1 Generating a Transposon Mutant Library

This section describes the calibration of conjugation-based transposon mutagenesis in V. parahaemolyticus BB22OP Δhcp1, in which T6SS2 is the only functional contact-dependent antibacterial system; a second antibacterial system, T6SS1, had been inactivated by deletion of hcp1 encoding a core component of the system [7]. Once the conditions that result in generating plates with individual transposon mutant colonies have been identified, a mutant library can be constructed (see Fig. 1). It is recommended that all steps of this protocol be performed in a sterile environment (see Note 4). 1. Grow conjugation helper and transposon donor cells [14] at 37  C in 3 mL of LB supplemented with appropriate antibiotics overnight. 2. Concomitantly, grow V. parahaemolyticus BB22OP Δhcp1 cells [7] at 30  C in 3 mL of MLB overnight. 3. After washing each culture with fresh media devoid of antibiotics, mix 100 μL of each of the two E. coli strains with 50 μL of the Vibrio strain in a sterile tube and vortex briefly.

Elucidating Mechanisms of Interbacterial Competition

15

Fig. 1 Calibration of random transposon mutagenesis. A recipient antibacterial strain culture is mixed with cultures of a conjugation helper strain and a transposon donor strain. The mixture is spotted on LB plates and incubated overnight (ON). Bacteria are scraped off the plate and increasing volumes of the cell suspension are spread on selective plates to identify optimal conditions resulting in high numbers of single colonies. The diagram was created using BioRender.com

4. Spot 10 drops of 10 μL each on a prewarmed LB plate (see Note 5) and incubate overnight at 37  C with the plate facing upwards (see Note 6). 5. The next day, add 5 mL of sterile PBS to the LB plate (see Note 7) and use a 1 mL pipette tip (see Note 8) to gently scrape off the bacteria from the plate. 6. Transfer the cell suspension from the plate into a sterile 15 mL conical tube and vortex until no large cell clumps are visible (see Note 9). 7. Inoculate increasing volumes of the cell suspension (between 2 and 200 μL) onto selective MMM plates supplemented with

16

Daniel Tchelet and Dor Salomon

erythromycin (see Note 10) and incubate at 30  C for 1–2 days, or until colonies are visible (see Note 11). 8. Identify the highest cell suspension volume that still results in single colonies (see Note 12). 9. To construct a transposon mutant library, repeat steps 1–7 and use the conditions that have been identified as optimal in step 8 to prepare enough plates so that a desired number of mutant colonies is obtained (see Note 13). 3.2 Calibrating BaCoF

This section describes the calibration of BaCoF; it serves to identify the conditions (i.e., attacker-to-prey volume ratio and incubation time required for optimal signal detection) enabling a clear distinction between competitions resulting in prey intoxication or prey growth. First, a 96-well plate containing attackers with an active or an inactive antibacterial system (the latter is used as a positive control for nonintoxicating attacker) is prepared. Increasing volumes of sensitive fluorescent prey are then added to the wells, and the mixed cultures are stamped onto competition plates and monitored for prey fluorescence over time (see Fig. 2). 1. Streak attacker bacterial strains (i.e., a parental strain with a functional antibacterial system and a derivative in which the antibacterial system is inactive) onto a plate and grow under appropriate conditions until single colonies of ~1 mm in diameter are observed (see Note 14). 2. Fill a 96-well plate with 100 μL of MLB media per well (see Note 15). 3. Inoculate the wells in the top half of the plate (i.e., rows A–D for quadruplicates, or B–D for triplicates) with single colonies of the parental attacker strain (see Note 16), and the wells in the bottom half (i.e., rows E–H for quadruplicates, or E–G for triplicates) with single colonies of the derivative strain in which the antibacterial system is inactive (see Note 17). 4. Inoculate 5 mL of MLB supplemented with appropriate antibiotics (if needed) with the fluorescent sensitive prey strain (i.e., V. natriegens harboring pGFP, in this example) and grow overnight at 30  C with agitation (see Note 18). 5. Incubate the inoculated 96-well plate from step 3 overnight at 30  C (see Note 19). 6. On the following day, take competition plates (in the current example, MLB plates) out and incubate at room temperature for at least 30 min with the lid slightly open to allow the plates to dry (see Note 20). 7. Wash the prey culture and resuspend in 5 mL of fresh media without antibiotics. 8. Transfer the prey culture to a sterile reservoir.

Elucidating Mechanisms of Interbacterial Competition

17

Fig. 2 BaCoF calibration. Half of a 96-well plate is inoculated with single colonies of an antibacterial attacker strain, while the other half is inoculated with an inactive mutant. On the following day, increasing volumes of a fluorescent prey culture are added to the plate, and the mixtures are stamped onto a competition plate. Fluorescence if visualized to identify the appropriate prey volume and incubation time for subsequent screens. Overnight, ON. The diagram was created using BioRender.com

9. Using an eight-channel pipettor, add increasing volumes of the prey to each column of the 96-well plate from step 5 and mix by aspirating and ejecting the liquid 4–5 times (see Note 21). Replace tips after each step. 10. Sterilize a multipin replicator by immersing 2 mm of the metal pins in a 96–100% ethanol solution for 5 s, and then carefully remove and pass over a flame. Once the pins have caught fire, slowly rotate the replicator to ensure that all the pins are flaming. Continue until all the ethanol had evaporated and no flames are visible. Let the replicator cool down for 1 min (see Note 22).

18

Daniel Tchelet and Dor Salomon

11. Mark the top side of the prewarmed competition plates for orientation. 12. Dip the replicator in the 96-well plate from step 9 for 2 s and then gently stamp the competition plate, making sure that all pins are touching the plate and that you do not wound the agar (see Note 23). 13. Allow the stamped plate to dry until no liquid can be detected on the agar. 14. Incubate the plate at 30  C. 15. Monitor fluorescence (see Note 24) every 2–4 hours, until the signal in mixed cultures containing the inactive system strain is clear and no signal is detected in mixed cultures containing the parental attacker strain (see Note 25). 16. Determine the prey volume and duration of competition that produce an optimal differential signal allowing distinction between intoxicating competitions and nontoxic competitions. 3.3 Screening a Mutant Library

Once a mutant library has been generated (see Subheading 3.1) and the conditions for the BaCoF have been established (see Subheading 3.2), BaCoF can be used to screen for mutants that lost their antibacterial toxicity (see Fig. 3). Although here we describe utilizing BaCoF to identify positive regulators of an antibacterial system, the method can be easily adapted to identify negative regulators (see Note 26). 1. Fill 96-well plates (see Note 27) with 100 μL of MLB media per well. 2. Use a toothpick to inoculate all but two wells in each 96-well plate with individual mutant colonies from the prepared library (see Subheading 3.1, step 9; see Note 28). 3. Inoculate one of the two remaining wells in each plate with a parental attacker, and the other well with a derivative strain in which the antibacterial system is inactive; these will serve as negative and positive controls, respectively, and will allow you to assess the signal intensity in each plate (see Note 29). 4. Repeat step 4 in Subheading 3.2 (see Note 30). 5. Incubate the inoculated 96-well plates from step 3 overnight at 30  C. 6. On the following day, repeat steps 6–8 in Subheading 3.2. 7. Using an eight-channel pipettor, add the prey volume determined in Subheading 3.2 to each well in the 96-well plates from step 5 and mix by aspirating and ejecting the liquid 4–5 times. Replace tips after each step. 8. Repeat steps 10–14 in Subheading 3.2 (see Note 31).

Elucidating Mechanisms of Interbacterial Competition

19

Fig. 3 BaCoF screen. 96-well plates are inoculated with single healthy colonies of a random transposon mutant library. In each plate, negative and positive control wells (denoted by a red rectangle) are included. On the following day, a fluorescent prey is added to the wells at a volume determined during the BaCoF calibration step. The mixtures are stamped onto a competition plate, and fluorescence is visualized to identify hits (a hit in the presented example plate is denoted by a pink arrow). Overnight, ON. The diagram was created using BioRender.com

9. Monitor plates for fluorescent colonies (i.e., hits) at the timepoint determined in Subheading 3.2. 10. Pick fluorescent colonies (aside from the positive control) (see Note 32) and streak onto a selective agar plate (i.e., MMM supplemented with erythromycin) to isolate the mutant attacker cells from the prey cells (see Note 33). 11. To validate the hits identified in step 9, repeat steps 1–8 with the isolated mutant attackers from step 10. Mutant attackers that are hampered in their ability to kill the sensitive prey (i.e., that allow the prey to grow and its fluorescence to be detected)

20

Daniel Tchelet and Dor Salomon

are putative candidates containing a transposon insertion that disrupted the activation of the antibacterial system of interest (see Note 34).

4

Notes 1. Transposon insertions may result in polar effects; one should consider the possibility that the gene responsible for the observed phenotype is not necessarily the gene that has been directly disrupted by the transposon. 2. The prey can either be a nonkin bacterial strain that is sensitive to intoxication by the attacker’s system of interest, or it can be a kin strain in which one or more genes required for immunity against kin-intoxication have been mutated or deleted. 3. Other methods for generating mutant libraries (e.g., using mutagenic chemicals, such as EMS (ethyl methanesulfonate) or MMS (methyl methanesulfonate), can be used if a suitable transposon tool is unavailable. 4. To maintain a sterile environment, it is recommended that all steps will be performed inside a biosafety cabinet, unless otherwise stated (e.g., when an open fire is required). Alternatively, the procedure can be performed on a work bench next to an open flame. If working with bacteria designated as biosafety level 2 or above, please consult with your institution’s safety guidelines to determine whether a biosafety cabinet is obligatory. 5. Plates kept at 4  C should be incubated at room temperature for 30 min or at 30  C for 15 min prior to spotting. 6. Handle plate with care. Avoid tilting the plate and disturbing the spotted cultures when transferring it into a 37  C incubator for the overnight incubation. 7. For some halophilic bacteria, PBS may reduce cell viability. If this happens, use 5 mL of fresh LB instead. 8. Sterile inoculation loops can also be used to scrape cells off the LB plate. 9. If large cell clumps remain, use a pipettor with a 1 mL tip to pipet the clumps until they disappear. 10. Our preferred method for homogeneous spreading of a bacterial suspension on a plate is using sterilized glass beads. However, the suspension can also be spread on the plate using other methods, such as with a Drigalski spatula. For volumes 70%). When cells are highly confluent, prepare two 250 mL flasks with 15 mL L929 medium. Aspirate medium from the confluent flask and wash with 10 mL PBS. 4. Cell trypsinization: Add 1 mL trypsin–EDTA solution to the washed flask, shake and tilt flask until the entire cell-attached surface is coated and incubate for 1 min. Gently beat the bottom of the flask until cells are detached (may require additional incubation). This step will be repeated later with different volumes of trypsin–EDTA solution. 5. Add 9 mL L929 medium to the trypsinized cell culture (to a total of 10 mL) and pipet gently but thoroughly to ensure cells are detached and resuspended. Transfer 5 mL to each 250 mL flask (to a total volume of 20 mL), incubate overnight and monitor cell confluence. 6. When cells are highly confluent, prepare two 550 mL flasks for each confluent flask and add 30 mL L929 medium to each. Aspirate medium from confluent flask, wash with 20 mL PBS, trypsinize with 3 mL trypsin–EDTA solution (see step 4) and add 17 mL L929 medium. Pipet gently but thoroughly to ensure cells are detached and resuspended, and transfer 10 mL of trypsinized cell culture to each 550 mL flask (to a total volume of 40 mL). Incubate overnight and monitor cell confluence. 7. When cells are highly confluent, prepare 20 145 mm plates for each confluent flask and add 30 mL L929 medium to each plate. Aspirate medium from the confluent flask, wash with 30 mL PBS, trypsinize with 6 mL trypsin–EDTA solution (see step 4) and add 14 mL L929 medium. Pipet gently but thoroughly to ensure cells are detached and resuspended, then add an additional 180 mL L929 medium to the flask. Transfer 10 mL of trypsinized cell culture to each plate (to a total volume of 40 mL), incubate overnight and monitor cell confluence (may take 72 h to achieve). 8. When cells are highly confluent, filter the supernatant (L929conditioned medium) and store at 20  C for later use (see Note 3).

88

Etai Boichis et al.

3.2 Preparation of BMDMs

1. Sacrifice mice (see Note 4) and sterilize the bodies with 70% ethanol spray. Remove the leg bones by cutting as far down the ankle and as far up the hip as possible using sterilized scissors. Avoid splintering the bones, damaging the cartilage or contact with the main vein. 2. Clear excess muscle and tissue from the bones and use sterilized tweezers to transfer them to a conical tube containing 10 mL BMDM medium + pen-strep (one conical tube for every 2 mice). 3. For every conical tube containing leg bones prepare 3 NTC 60 mm plates – one with 1 mL BMDM medium + pen-strep (to clean the bones before marrow extraction) and two empty plates for the bone marrow. Additionally, load two 10 mL syringes with 10 mL BMDM medium + pen-strep for every conical tube and attach 26-gauge needles to them. 4. Transfer each bone to the NTC plate with the BMDM medium + pen-strep using tweezers, clean it until the marrow can be seen through the semitransparent bones. 5. Hold each cleaned leg above an empty NTC plate and using sterilized scissors, recover the femur by cutting below the hip and above the knee, and the tibia by cutting below the knee and above the ankle (Fig. 2). This will result in 2 bones with openings on both sides, allowing for simple marrow extraction. 6. Carefully flush out the marrow from each bone into the empty NTC plate using a loaded syringe. Flush until the bone is completely white and red clumps are no longer discharged. Each loaded syringe contains enough BMDM medium + pen-strep to extract marrow from multiple bones and fill a single plate.

Fig. 2 Recovery of bone marrow. Recover the femur and tibia (a), cut at their extremities (b), use a loaded syringe to flush the marrow (c)

Listeria monocytogenes Infection of Macrophage Cells

89

7. Resuspend the marrow by pipetting up and down, transfer the suspension from the plates to a 50 mL conical tube and pellet at 50  g for 1 min. Transfer the supernatant (BMDM suspension devoid of unwanted tissue) into a new 50 mL conical tube and pellet at 120  g for 10 min. 8. Carefully aspirate the supernatant and gently resuspend in 10 mL BMDM medium + pen-strep. Warm BMDM medium (without pen-strep) to 37  C and pellet the cell suspension once more at 200  g for 10 min, aspirate the supernatant and gently resuspend in 10 mL warmed BMDM medium. 9. Sample the cell suspension and count the cells. Dilute the suspension with BMDM medium to a concentration of 107 cells/mL. 10. Add 5  106 cells (0.5 mL of the diluted suspension) to 150 mm NTC plates filled with 30 mL BMDM medium. Gently shake the plate to ensure even cell dispersal and incubate for 72 h. Check plates once a day for possible contaminations. 11. After 72 h of incubation, supplement each plate with an additional 10 mL BMDM medium to nourish the cells and incubate for a further 96 h. 12. Observe the cells under a microscope. If the cells have formed a semiconfluent monolayer, transfer the chilled PBS bottles from refrigeration to buckets of ice water in preparation for the following steps. 13. Aspirate the medium from 10 plates. Wash the cells by gently adding 20 mL chilled PBS, taking care not to disturb the monolayer, gently shaking the plates and immediately aspirating. 14. Detach the cells from the plates by adding another 20 mL ice-cold PBS to each plate and incubating them at 4  C for 10 min. Ensure the plates are as level as possible during the incubation. 15. Pipet each plate 10 times to resuspend the cell culture. When pipetting down, tilt the plate and pour the culture down its side to detach any remaining attached cells. 16. Verify that the monolayer was almost entirely suspended using a microscope. If so, transfer the cell suspension from the plates to 50 mL conical tubes, pellet at 120  g for 10 min and carefully aspirate the supernatant. 17. Resuspend the cells in 10 mL BMDM, transfer the cell suspension to an unsuspended cell pellet and resuspend. Repeat until all cells from all 50 mL conical tubes are collected in a single tube.

90

Etai Boichis et al.

18. Repeat steps 13–17 until all cells from all plates are collected into a single tube. 19. Sample the concentrated cell suspension and count the cells. Pellet again at 120  g for 10 min, discard the supernatant and add BMDM freezing medium to a concentration of 107 cells/ mL. 20. Divide the cell suspension into 1 mL aliquots in 2 mL screw cap microtubes, freeze them for 1 day at 80  C and transfer them to liquid nitrogen for long term storage. 3.3 Infection of BMDMs by Listeria monocytogenes

1. For each L. monocytogenes strain to be tested, place 13 glass coverslips in a 60 mm NTC plate, add 5 mL BMDM medium, aspirate carefully and adjust coverslips using a pipette tip to avoid overlaps. This step lodges the coverslips in place (see Note 5). 2. Thaw BMDMs at 37  C for 1–2 min and transfer to 9 mL BMDM medium + pen-strep in a 50 mL tube (to a total volume of 10 mL). Pellet at 120  g– for 10 min, discard supernatant and gently resuspend the cells in 10 mL fresh BMDM medium + pen-strep. 3. Sample the cell suspension and count cells using a microscope. Using BMDM + pen-strep medium, dilute the suspension to a concentration of 4  105 cells/mL and transfer 5 mL (2  106 cells) to each 60 mm plate (containing the glass coverslips). Gently shake the plates to ensure even cell dispersal and incubate overnight. 4. Start a bacterial culture for the relevant L. monocytogenes strains in 3 mL of BHI liquid medium and incubate overnight at 30  C without shaking. 5. Prepare 12 BHI-agar plates and 12 tubes with 5 mL sterile DDW/ultrapure water for each L. monocytogenes strain to be tested. 6. The following day, prewarm BMDM medium (without pen-strep) and PBS to 37  C, predry the BHI-agar plates. 7. Transfer 0.5 mL of each overnight bacterial culture to a 1.5 mL tube and pellet at >14,000  g for 30 s. Discard the supernatant, wash in 0.5 mL PBS and gently resuspend. Repeat twice. 8. Remove cell culture plates from incubation and inspect the cell density and adhesion using a microscope. If BMDMs have attached in a semiconfluent monolayer, carefully adjust the coverslips using pipette tips, aspirate the medium, wash twice with 5 mL warm PBS and add 5 mL warm BMDM medium. Keep the BMDM medium at room temperature for the following steps.

Listeria monocytogenes Infection of Macrophage Cells

91

9. Infect BMDMs with 5 μL of bacterial suspension (one strain per plate), gently shake the plates to ensure even dispersal of bacteria within the cell culture and incubate (see Note 6). 10. Plate serial dilutions of the remaining bacterial suspension on BHI agar plates and incubate overnight at 37  C. Count the colonies to assess the multiplicity of infection (MOI; ~10 for WT L. monocytogenes) and confirm that the MOI is similar across all bacterial strains tested. 11. 30 min after initial infection, aspirate the medium, wash three times in PBS, add 5 mL fresh BMDM medium and return the medium to cold storage. This removes all bacteria that have yet to adhere to the BMDMs. 12. 1 h postinfection (h.p.i.), add 5 μL gentamicin sulfate solution to each cell culture plate. Gently shake the plates to ensure even dispersal of the gentamicin in the medium. This step kills off any bacteria yet to be internalized by the BMDMs. 3.4 Intracellular Growth Analysis of L. monocytogenes in BMDMs

1. At 2, 3, 4, and 6 h.p.i.: for each L. monocytogenes strain tested, use ethanol-sterilized tweezers to transfer 3 coverslips from the cell culture plate to three 15 mL tubes containing sterile water (Fig. 3). Vortex the tubes for 1 min to lyse the BMDMs, releasing the bacteria into the water. 2. At 2 and 3 h.p.i., plate 50 μL water directly from each tube on dry BHI-agar plates (100 dilution factor), disperse the bacteria using sterile glass beads and incubate overnight at 37  C. 3. At 4 h.p.i. dilute the bacteria tenfold by transferring 50 μL water from each tube into 450 μL BHI liquid medium, briefly vortex the diluted medium and plate 50 μL on BHI agar plates (1000 dilution factor). Disperse bacteria using sterile glass beads and incubate overnight at 37  C.

A

B

1.00E+06

Lm WT CFU/coverslip

L. monocytogenes

Lm Δhly

1.00E+05

1.00E+04

BHI agar 1.00E+03

BMDM

H2O

0

2

4

6

h.p.i.

Fig. 3 Analysis of L. monocytogenes intracellular growth. BMDMs are thawed, diluted, added to an NTC plate containing 13 glass coverslips and incubated overnight. The following day, after infection and gentamicin treatment, coverslips are transferred into 5 mL H2O and vortexed to release the bacteria from the cells. The bacterial suspension is either directly plated or diluted and then plated on BHI agar plates (a) which are then incubated overnight at 37  C. Finally, bacterial colonies are counted and their growth curve is plotted (b)

92

Etai Boichis et al.

4. At 6 h.p.i. dilute the bacteria tenfold as stated previously, and then dilute tenfold again. Briefly vortex the diluted bacteria, plate 50 μL on BHI agar plates (10,000 dilution factor), disperse bacteria using sterile glass beads and incubate overnight at 37  C. 5. The following day count colonies that formed on every plate. For each L. monocytogenes strain tested, use the dilution factor to calculate the average number of bacteria recovered from the BMDMs for every hour. 6. Plot the growth curve on a semilogarithmic graph (colonyforming units [CFU] per coverslip vs. hours postinfection).

4

Notes 1. We recommend dividing heat-inactivated FBS into 50 mL aliquots and storing them at 20  C to simplify the preparation of BMDM medium. 2. These volumes may be up- or downscaled according to your needs. 3. We recommend a two-person team carry out the final two steps. We also recommend dividing the L929-conditioned medium into 30 mL aliquots before freezing to simply the preparation of BMDM medium. Furthermore, if you wish to create a L929 cell stock, you may trypsinize cells from one of the plates, resuspend in L929 freezing medium (L929 growth medium supplemented with 10% DMSO and a further 10% inactivated FBS) and store in liquid nitrogen. 4. We order 8-week-old female C57BL/6 mice, and allow them to acclimate for up to 10 days in our mice facility (until they begin gaining weight) before being sacrificed. We typically extract 5  108 to 1  109 BMDM cells from 4 mice. 5. This protocol describes BMDM infection by L. monocytogenes for the purpose of performing an intracellular growth experiment. As such, it necessitates the sampling of BMDMs over time, and thus requires the use of coverslips placed on non– tissue culture-treated plates. Other experiments, such as the extraction of BMDM nucleic acid to analyze their transcriptomic response to infection, follow the same infection protocol, but instead utilize tissue culture-treated plates without coverslips. 6. We recommend running a timer from the moment of infection to avoid timing issues in the following steps of the experiment.

Listeria monocytogenes Infection of Macrophage Cells

93

References 1. Swaminathan B, Gerner-Smidt P (2007) The epidemiology of human listeriosis. Microbes Infect 9:1236–1243. https://doi.org/10. 1016/j.micinf.2007.05.011 2. Schultze T, Hilker R, Mannala GK et al (2015) A detailed view of the intracellular transcriptome of listeria monocytogenes in murine macrophages using RNA-seq. Front Microbiol 6: 1199. https://doi.org/10.3389/fmicb.2015. 01199 3. Dussurget O, Pizarro-Cerda J, Cossart P (2004) Molecular determinants of listeria monocytogenes virulence. Annu Rev Microbiol 58: 587–610. https://doi.org/10.1146/annurev. micro.57.030502.090934 4. Crimmins GT, Herskovits AA, Rehder K et al (2008) Listeria monocytogenes multidrug resistance transporters activate a cytosolic surveillance pathway of innate immunity. Proc Natl Acad Sci U S A 105:10191–10196. https:// doi.org/10.1073/pnas.0804170105

5. Rabinovich L, Sigal N, Borovok I et al (2012) Prophage excision activates listeria competence genes that promote phagosomal escape and virulence. Cell 150:792–802. https://doi.org/10. 1016/j.cell.2012.06.036 6. Sauer JD, Witte CE, Zemansky J et al (2010) Listeria monocytogenes triggers AIM2mediated pyroptosis upon infrequent bacteriolysis in the macrophage cytosol. Cell Host Microbe 7:412–419. https://doi.org/10. 1016/j.chom.2010.04.004 7. Shaughnessy LM (2007) The role of the activated macrophage in clearing listeria monocytogenes infection. Front Biosci 12:2683. https:// doi.org/10.2741/2364 8. Andreu N, Phelan J, De Sessions PF et al (2017) Primary macrophages and J774 cells respond differently to infection with mycobacterium tuberculosis. Sci Rep 7. https://doi.org/10. 1038/srep42225

Chapter 9 Preparation and Inflammasome Activation of Murine Bone Marrow–Derived and Resident Peritoneal Macrophages Izumi Sasaki and Tsuneyasu Kaisho Abstract Cholera toxin (CT), secreted by Vibrio cholerae, not only causes cholera but also functions as an immune adjuvant. Macrophages, which respond to a variety of immune adjuvants, are quite heterogenous and their development and function depend on the tissues where they are localized. We have characterized the effects of the B subunit of CT (CTB) on two types of murine macrophages, that is, bone marrow–derived macrophages (BMMs) and resident peritoneal macrophages (rPMs). CTB could induce production of interleukin-1β (IL-1β) from both macrophages in synergy with lipopolysaccharides. However, underlying molecular mechanisms for IL-1β induction were different. Here, we describe the protocols for preparation and stimulation of BMMs and rPMs. Key words Resident peritoneal macrophages, Bone marrow–derived macrophages, Cholera toxin, Lipopolysaccharides, Interleukin-1β

1

Introduction Cholera toxin (CT) is a virulence factor causing an acute dehydrating diarrheal disease, called cholera. CT is a bacterial enterotoxin derived from Vibrio cholerae and comprised of one A subunit and five B subunits (CTBs). CTB directly associates with the cell surface ganglioside GM1 and guides CT to the ER via Golgi apparatus through what we call retrograde transport [1, 2]. CTB is retained in the ER, while CTA is released to the cytosol and induces elevation of intracellular cyclic AMP levels, thereby causing diarrhea, a main manifestation of cholera. CT also functions as an immune adjuvant that can induce pro-inflammatory cytokine production and generate T cell or antibody responses [3–8]. Macrophages are myeloid phagocytic mononuclear cells involved in innate immunity and respond to a variety of pathogens or immune adjuvants. Macrophages are heterogenous and show different properties, depending on tissues where they are localized,

Ohad Gal-Mor (ed.), Bacterial Virulence: Methods and Protocols, Methods in Molecular Biology, vol. 2427, https://doi.org/10.1007/978-1-0716-1971-1_9, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022

95

Izumi Sasaki and Tsuneyasu Kaisho

in terms of gene expression profiles, cytokine production patterns, or dependence of development on transcription factors. For example, splenic red pulp macrophages, which are involved in clearance of senescent red blood cells, show extremely high expression of an ETS family transcription factor, SPIC, which is required for their development [9, 10]. Macrophages in a peritoneal cavity show their specific gene expression profile and restricted expression of a transcription factor, GATA6, and develop in a GATA6-dependent manner [11]. Macrophages can be generated in vitro also from bone marrow (BM) cells in the presence of a cytokine, macrophage colony stimulating factor (M-CSF). We have analyzed how resident peritoneal macrophages (rPMs) and BM-derived macrophages (BMMs) respond to a CT unit, CTB, which also functions as an immune adjuvant, although the activity is less potent than CT [12]. CTB alone fails to induce production of interleukin-1β (IL-1β) from both macrophages. However, CTB activates BMMs to produce IL-1β in synergy with an E. coli strain, O111:B4, derived lipopolysaccharides (LPS), which can bind to CTB, but not with an E. coli strain O55:B5derived LPS, which fails to bind to CTB (see Fig. 1). In BMMs IL-1β production depends on intracellular sensing of LPS through noncanonical caspases [12, 13]. In this case, CTB functions as a chaperone for LPS and can be substituted with transfection reagents that facilitate LPS to enter the cells. Meanwhile, CTB activates rPMs to produce IL-1β in synergy with both types of LPS (see Fig. 2), although LPS O55:B5 is not detected in the cytosol as in BMMs. A series of experiments showed that, in rPMs BMMs

5 IL-1β (ng/ml)

96

4 3 2 1

0 LPS O55:B5

+

–

+

–

LPS O111:B4

–

+

–

+

–

–

+

+

CTB

Fig. 1 CTB-induced IL-1β production from LPS-primed BMMs. BMMs were first cultured for 5 h in the presence of 500 ng/mL LPS O111:B4 or LPS O55:B5. Then, CTB was added at 20 μg/mL and the cells were cultured for further 19 h. IL-1β production was measured by ELISA. The results are presented as means  SD

IL-1β (ng/ml)

Preparation of Murine Macrophages

97

rPECs

7 6 5 4 3 2 1 0

LPS O55:B5

+

–

+

–

LPS O111:B4

–

+

–

+

CTB

–

–

+

+

Fig. 2 CTB-induced IL-1β production from LPS-primed rPECs. rPECs were cultured, stimulated and analyzed as described in the Fig. 1 legend. As described later in Fig. 6, rPMs are mainly involved in IL-1β production. The results are presented as means  SD

stimulated with CTB and LPS O55:B5, IL-1β production requires two signals, one from LPS, which stimulates a transmembrane sensor, TLR4, and the other from CTB itself, which exerts through intracellular sensors, that is, pyrin and NLRP3 inflammasomes [12]. Thus, rPMs show distinct features from BMMs in the way to respond to CTB. Notably, pyrin inflammasome functions in rPMs, but not in BMMs and analysis on rPMs enabled us to demonstrate that CTB functions as a novel pyrin inflammasome activator. Here we show how to prepare BMMs and rPMs and stimulate them with inflammasome activators.

2

Materials

2.1

Mice

2.2

Reagents

C57BL/6 mice. 1. Phosphate-buffered saline (PBS). 2. Magnetic-activated cell sorting (MACS) Buffer: PBS supplemented with 1% fetal calf serum (FCS), 5 mM ethylenediaminetetraacetic acid (EDTA), and 0.01% sodium azide (NaN3). 3. Recombinant mouse M-CSF. 4. Antibodies: anti-CD16/32, biotinylated anti-F4/80, PerCPCy5.5-conjugated streptavidin and V450-conjugated antiCD11b. 5. Streptavidin MicroBeads (Miltenyi Biotec).

98

Izumi Sasaki and Tsuneyasu Kaisho

6. Culture medium (CM): Roswell Park Memorial Institute (RPMI) 1640 medium supplemented with 10% FCS, 100 U/mL penicillin G, 100 μg/mL streptomycin, and 109 nM 2-mercaptoethanol. 7. Stimuli: LPS O111:B4 (L3012, sigma), LPS O55:B5 (L2637, sigma), CTB (103B, List Biological Laboratories), adenosine triphosphate (ATP). 8. Mouse IL-1β ELISA kit (SMLB00C, R&D systems). 2.3

Materials

1. Forceps and surgery scissors. 2. 3 mL disposable droppers. 3. 15 mL tubes. 4. 40 μL meshes. 5. 27G needles. 6. 20G needles. 7. LS columns (Miltenyi Biotec).

3

Methods

3.1 Preparation of BMMs

1. Sacrifice a C57BL/6 mouse, and spray it with 70% ethanol. 2. Cut off femora and tibiae by using forceps and surgery scissors. 3. Place the bones into PBS in a petri dish. Aspirate PBS and add 70% ethanol for 1 min to sterilize. 4. Aspirate 70% ethanol, add PBS and aspirate it to rinse ethanol. 5. Cut off both ends of the bones by using forceps and surgery scissors. 6. Flush the bones by injecting PBS with a 10 mL syringe attached with a 27G needle. 7. Pipet aggregated bone marrow cells several times to obtain single-cell suspension. 8. Remove cell clumps through a 40 μm mesh. 9. Centrifuge cells at 250  g for 5 min at 4  C. Aspirate supernatants and resuspend them in 1  106 cells per mL in CM. Usually 2–4  107 bone marrow cells can be obtained from one mouse. 10. Seed 2  105 cells per well in 96-well flat plates and culture them for 4 days in the presence of 20 ng/mL of M-CSF. Then, thus generated cells can be used as BMMs (see Fig. 3). Usually 3–6  106 BMMs can be obtained from one mouse.

Preparation of Murine Macrophages

99

Fig. 3 Preparation of BMMs and rPMs. BMMs can be generated by culturing bone marrow cells in the presence of M-CSF. rPECs contain not only rPMs but also non-rPMs. FACS profiles of those cells were shown. Numbers in dot plots indicate percentages of gated cells

3.2 Preparation of rPMs

1. Sacrifice a C57BL/6 mouse and spray it with 70% ethanol. 2. Cut the outer skin of the back by using forceps and surgery scissors (see Fig. 4a, and see Note 1). 3. Pull it off to expose not only the peritoneal inner skin but also the muscles of both forelegs and hind legs (see Fig. 4b,c). 4. Put the mouse on the retention board to face upward. 5. Inject 10 mL of ice-cold PBS into the peritoneal cavity by using a 10 mL syringe attached with a 20 G needle (see Fig. 5a, and see Note 2). 6. Collect the PBS as much as possible and transfer to a 15 mL tube kept on ice (see Fig. 5b, and see Note 3). 7. Cut the peritoneal inner skin by using forceps and surgery scissors (see Fig. 5c) and collect the remaining PBS in the peritoneal cavity by using a 3 mL disposable dropper while holding up the skin with forceps (see Fig. 5d, and see Note 4). Thus, collected cells can be used as resident peritoneal exudate cells (rPECs) (see Note 5). Usually 1–2  106 rPECs can be obtained from one mouse.

100

Izumi Sasaki and Tsuneyasu Kaisho

Fig. 4 Exposure of the peritoneal inner skin. The peritoneal inner skin is exposed by cutting (a) and tearing off the outer skin (b, c)

Preparation of Murine Macrophages

101

Fig. 5 Collection of the peritoneal lavage fluid. PBS was first injected into the peritoneal cavity (a) and then recovered by using a syringe with a needle and a dropper (b–d)

8. rPECs include not only rPMs but also other cells such as B cells or neutrophils. rPMs can be purified, for example, by MACS. 9. Centrifuge rPECs at 820  g for 5 min at 4  C. Aspirate supernatants and resuspend the cells in 1  107 cells per mL in CM. 10. Add anti-CD16/32 antibody (final concentration (final conc.) 5 μg/mL) and leave them for 5 min on ice to block the unspecific binding of antibodies to Fc receptors. 11. Add biotinylated anti-F4/80 antibody (final conc. 1 μg/mL) and leave them for 20 min on ice. 12. Add 10 mL of MACS Buffer and centrifuge them at 820  g for 5 min at 4  C. Aspirate supernatants and resuspend the cells in 1  107 cells per mL in MACS Buffer. 13. Add one-fifth volume of streptavidin microbeads and leave them for 20 min on ice. 14. Add 10 mL of MACS Buffer and centrifuge them at 820  g for 5 min at 4  C. Aspirate supernatants, resuspend the cells in 1 mL of MACS Buffer and magnetically sort them with LS column according to manufacturer’s instructions. The flowthrough cells can be used as F4/80 negative cells (hereafter,

102

Izumi Sasaki and Tsuneyasu Kaisho

“non-rPMs”). Cells conjugated with Micro-beads can be used as F4/80 positive cells, that is, rPMs (see Fig. 3). Usually 3–6  105 rPMs can be obtained from one mouse. 3.3 Evaluation of Purity of Macrophages

1. Centrifuge about 100,000 BMMs, rPECs, rPMs, or non-rPMs each in a 1.5 mL eppendorf tube and centrifuge those cells at 5800  g for 1 min at 4  C.Aspirate supernatants. 2. Add 20 μL of MACS buffer with anti-CD16/32 antibody (final conc. 5 μg/mL) and leave them for 5 min on ice. 3. Add 20 μL of MACS buffer with biotinylated anti-F4/80 antibody (final conc. 1 μg/mL) and leave them for 20 min on ice. 4. Add 1 mL of MACS Buffer and centrifuge cells at 5800  g for 1 min at 4  C. Aspirate supernatants. 5. Add 20 μL of MACS buffer with PerCP-Cy5.5-conjugated streptavidin (final conc. 2 μg/mL) and V450-conjugated anti-CD11b antibody (final conc. 2 μg/mL) and leave for 20 min on ice with protection from light. 6. Add 1 mL of MACS Buffer and centrifuge cells at 5800  g for 1 min at 4  C. Aspirate supernatants and resuspend the cells in 0.5 mL in MACS Buffer. 7. Analyze the cells by using a flow cytometer (see Fig.3 and see ref. [12]).

3.4 Stimulation with Inflammasome Activators

1. Centrifuge rPECs, rPMs, and non-rPMs at 820  g for 5 min at 4  C. Aspirate supernatants and resuspend them in 2  106 cells per mL in CM. 2. Seed 2  105 cells per well in 96-well flat bottom plates and culture them for 5 h in the presence of 500 ng/mL LPS O55: B5. 3. Add CTB (final conc. 20 μg/mL) or an NLRP3 inflammasome activator, ATP (final conc. 1 mM) and culture the cells for further 19 h. 4. Collect culture supernatants and subject them to ELISA for IL-1β (see Fig. 6). In these conditions, rPMs are major sources of IL-1β production from rPECs.

4

Notes 1. To avoid the risk to puncture the peritoneal inner skin, we recommend you to cut the outer skin of back. 2. Please be careful not to injure any organs during this step. 3. Please be careful not to aspirate any fat tissues or other organs during this step.

Preparation of Murine Macrophages rPECs

rPMs

103

non-rPMs

IL-1β (ng/ml)

8 6 4 2

0 LPS O55:B5 CTB

IL-1β (ng/ml)

12

+ –

+ +

rPECs

+ –

+ +

+ –

+ +

non-rPMs

rPMs

10 8 6 4 2

0 LPS O55:B5 ATP

+ –

+ +

+ –

+ +

+ –

+ +

Fig. 6 CTB or ATP-induced IL-1β production from LPS-primed rPECs, rPMs and non-rPMs. Cells were cultured, stimulated, and analyzed as described in the Fig. 1 legend. The results are presented as means  SD

4. Please be careful not to contaminate the cells with blood during this step. 5. We can also collect the cells in the peritoneal cavity on 3–5 days after intraperitoneal injection of 1 mL of 4% (w/v) brewer thioglycollate medium (B2551, sigma). Thus collected cells include a variety of macrophages, neutrophils or monocytes. Most of these cells are activated and show quite different characteristics from rPECs and rPMs.

Acknowledgments This work was supported by Grants-in-Aids for Scientific Research (B) (to T. Kaisho), for Scientific Research (C) (to I. Sasaki), for Scientific Research on Innovative Areas (to T. Kaisho), for Exploratory Research (to T. Kaisho), Takeda Science Foundation (to T. Kaisho, and I. Sasaki), and AMED (to T. Kaisho). This work was also supported in part by the Extramural Collaborative Research Grant of Cancer Research Institute, Kanazawa University, the Grant for Joint Research Project of the Institute of Medical Science, the University of Tokyo, and Wakayama Medical University Special Grant-in-Aid for Research Projects.

104

Izumi Sasaki and Tsuneyasu Kaisho

References 1. Lencer WI, Tsai B (2003) The intracellular voyage of cholera toxin: going retro. Trends Biochem Sci 28(12):639–645. https://doi. org/10.1016/j.tibs.2003.10.002 2. Chinnapen DJ, Chinnapen H, Saslowsky D, Lencer WI (2007) Rafting with cholera toxin: endocytosis and trafficking from plasma membrane to ER. FEMS Microbiol Lett 266 (2):129–137. https://doi.org/10.1111/j. 1574-6968.2006.00545.x 3. Elson CO, Ealding W (1984) Generalized systemic and mucosal immunity in mice after mucosal stimulation with cholera toxin. J Immunol 132(6):2736–2741 4. Xu-Amano J, Kiyono H, Jackson RJ, Staats HF, Fujihashi K, Burrows PD, Elson CO, Pillai S, McGhee JR (1993) Helper T cell subsets for immunoglobulin a responses: oral immunization with tetanus toxoid and cholera toxin as adjuvant selectively induces Th2 cells in mucosa associated tissues. J Exp Med 178 (4):1309–1320. https://doi.org/10.1084/ jem.178.4.1309 5. Marinaro M, Staats HF, Hiroi T, Jackson RJ, Coste M, Boyaka PN, Okahashi N, Yamamoto M, Kiyono H, Bluethmann H, Fujihashi K, McGhee JR (1995) Mucosal adjuvant effect of cholera toxin in mice results from induction of T helper 2 (Th2) cells and IL-4. J Immunol 155(10):4621–4629 6. Wakabayashi A, Nakagawa Y, Shimizu M, Moriya K, Nishiyama Y, Takahashi H (2008) Suppression of an already established tumor growing through activated mucosal CTLs induced by Oral Administration of Tumor Antigen with cholera toxin. J Immunol 180 (6):4000–4010. https://doi.org/10.4049/ jimmunol.180.6.4000 7. Datta SK, Sabet M, Nguyen KP, Valdez PA, Gonzalez-Navajas JM, Islam S, Mihajlov I, Fierer J, Insel PA, Webster NJ, Guiney DG, Raz E (2010) Mucosal adjuvant activity of cholera toxin requires Th17 cells and protects against inhalation anthrax. Proc Natl Acad Sci U S A 107(23):10638–10643. https://doi. org/10.1073/pnas.1002348107 8. Wakabayashi A, Shimizu M, Shinya E, Takahashi H (2018) HMGB1 released from intestinal epithelia damaged by cholera toxin adjuvant

contributes to activation of mucosal dendritic cells and induction of intestinal cytotoxic T lymphocytes and IgA. Cell Death Dis 9 (6):631. https://doi.org/10.1038/s41419018-0665-z 9. Kohyama M, Ise W, Edelson BT, Wilker PR, Hildner K, Mejia C, Frazier WA, Murphy TL, Murphy KM (2009) Role for Spi-C in the development of red pulp macrophages and splenic iron homeostasis. Nature 457 (7227):318–321. https://doi.org/10.1038/ nature07472 10. Kayama H, Kohyama M, Okuzaki D, Motooka D, Barman S, Okumura R, Muneta M, Hoshino K, Sasaki I, Ise W, Matsuno H, Nishimura J, Kurosaki T, Nakamura S, Arase H, Kaisho T, Takeda K (2018) Heme ameliorates dextran sodium sulfate-induced colitis through providing intestinal macrophages with noninflammatory profiles. Proc Natl Acad Sci U S A 115 (33):8418–8423. https://doi.org/10.1073/ pnas.1808426115 11. Okabe Y, Medzhitov R (2014) Tissue-specific signals control reversible program of localization and functional polarization of macrophages. Cell 157(4):832–844. https://doi. org/10.1016/j.cell.2014.04.016 12. Orimo T, Sasaki I, Hemmi H, Ozasa T, Fukuda-Ohta Y, Ohta T, Morinaka M, Kitauchi M, Yamaguchi T, Sato Y, Tanaka T, Hoshino K, Katayama KI, Fukuda S, Miyake K, Yamamoto M, Satoh T, Furukawa K, Kuroda E, Ishii KJ, Takeda K, Kaisho T (2019) Cholera toxin B induces interleukin1β production from resident peritoneal macrophages through the pyrin inflammasome as well as the NLRP3 inflammasome. Int Immunol 31 (10):657–668. https://doi.org/10.1093/ intimm/dxz004 13. Kayagaki N, Wong MT, Stowe IB, Ramani SR, Gonzalez LC, Akashi-Takamura S, Miyake K, Zhang J, Lee WP, Muszynski A, Forsberg LS, Carlson RW, Dixit VM (2013) Noncanonical inflammasome activation by intracellular LPS independent of TLR4. Science 341 (6151):1246–1249. https://doi.org/10. 1126/science.1240248

Chapter 10 Flow Cytometry–Based Single Cell Analyses of Bacterial Adaptation to Intracellular Environments Marc Schulte

and Michael Hensel

Abstract Since decades, flow cytometry (FC) is a powerful technique to perform single cell analyses with high accuracy and throughput. Moreover, FC is the method of choice to study bacterial cell heterogeneity and complements single-cell imaging techniques. The complex experimental approaches for FC sample preparation and the subsequent FC adjustment and gating strategy demand careful considerations to be successful when analyzing complex microbial populations, especially when liberated populations of intracellular bacterial pathogens, or bacterial pathogens inside intact host cells are analyzed. Here, we provide a set of experimental protocols for FC sample preparation of (1) in vitro cultured bacterial cells, (2) liberated intracellular bacteria from host cells, or (3) preparation of intact infected phagocytic or epithelial cells commonly used as host cells in infection biology. Since sample preparation, cytometer adjustment, and gating strategy are essential for experimental success, we aim to provide our expertise to support application of FC by other researchers. Key words Flow cytometry, Single cell analysis, Intracellular bacteria, Host cells, High-throughput analyses

1

Introduction

1.1 Flow Cytometry for Single Cell Infection Biology

Flow cytometry (FC) is a powerful method for single cell analyses of large populations of cells. FC enables characterization of various characteristics of eukaryotic or prokaryotic cells and their activities at high speed. The size and granularity of each cellular or subcellular particle can be recorded, and labeling of specific structures by fluorochromes of fluorescent proteins enables additional layers of interrogation. Fluorescence-based FC was developed by Wolfgang Go¨hde in collaboration with Wolfgang Dittrich in 1968 at the Westphalian Wilhelms University in Mu¨nster, Germany [1]. For the measurement, a cell suspension is aspirated and passed through a flow chamber, which can accommodate only one cell at a time. All measured quantitative properties of each cell are collected and evaluated with a software tool. Afterwards, the cells either are

Ohad Gal-Mor (ed.), Bacterial Virulence: Methods and Protocols, Methods in Molecular Biology, vol. 2427, https://doi.org/10.1007/978-1-0716-1971-1_10, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022

105

106

Marc Schulte and Michael Hensel

discarded in a waste container, or can be sorted according to their fluorescence properties by fluorescence-assisted cell sorting (FACS). Salient features of FC are the high throughput, as well as the wide range of cell quantities that can be analyzed. It is possible to measure several 10,000 cells per second, but also to resolve less than one cell per microliter of cell suspension, thus providing representative information about cellular populations with a very high resolution in a very short time. An enormously field of applications can be covered, including clinical routine diagnostics in infectiology and immunology, through medical and cell biology basic research, to applications in biotechnology [2, 3]. Ranging from analyses of cell physiology including measurements of pH changes, calcium fluxes, protein content in the cytoplasm, amount of reactive oxygen species, or changes in membrane potential, to analyses of cell proliferation and the detection of apoptosis or necrosis using DNA analyses, almost all conceivable forms of examinations can be realized [4–11]. In clinical diagnostics, FC makes it very easy to differentiate and quantify different cell types of blood. In scientific research, other factors are usually determined via fluorescence properties in addition to the determination of cell numbers. Antibody labeling can be used to detect and quantify various surface proteins (e.g., fimbriae on surface of Salmonella enterica) [12]. Using fluorescent dyes, living and dead cells can be distinguished and their proportion of the population can be determined [13, 14]. With the help of fluorescence-based reporter systems it is possible to analyze expression of specific genes [15], to determine the presence of cytosolic intracellular S. enterica [16], to measure the metabolic activity of a bacterial population [17], or to discriminate distinct replicative intracellular subpopulations [18, 19]. Hence, FC is the perfect tool to study bacterial cell heterogeneity, in particular using intracellular bacterial pathogens in combination with their host cells. The range of applications for FC appears infinite. Particularly with the use of ever newer and more sophisticated fluorescence-based reporter systems, a wide range of properties can be analyzed. Therefore, FC is a powerful and efficient tool to answer current scientific questions. Here, we describe various protocols as well as cytometry and gating settings to prepare and analyze bacterial cells that are either obtained from in vitro cultures, liberated from host cells after infection, or analyzed inside intact host cells. Our protocols and settings are adapted for the Attune NxT Acoustic Focusing Cytometer (ThermoFisher Scientific, Inc.), however, the protocols will be applicable for other flow cytometers. We provide protocols and examples of analyses for host cells commonly used in infection biology, for example, HeLa cells, RAW264.7 macrophages, but also for human primary phagocytes. Further details on analyses of S. enterica harboring fluorescent protein reporters by FC can be

Flow Cytometry of Intracellular Bacteria

107

found in recent publications on response to antimicrobial radicals of host cells [20], analyses of integrity of the Salmonella-containing vacuole (SCV) [16], effect of host cell glycosylation on SCV acidification [21], physiology of S. enterica intracellular populations and persisters [19, 22], adaptation of typhoidal serovars of S. enterica to life in mammalian host cells [23], and characterization of the nutritional environment of intracellular S. enterica [24, 25].

2

Materials

2.1 Bacterial Strains, Host Cells, Bacterial Infection

1. General lab equipment: pipettes, lab coat, gloves, 1.5 mL test tubes, tabletop centrifuge. 2. Attune NxT Acoustic Focusing Cytometer (ThermoFisher Scientific, Life Technologies). 3. 12- or 6-well plates, sterile cell-culture treated surfaces (TPP). 4. Bacterial strains. (a) Salmonella enterica serovar Typhimurium (STM) NCTC12023 wild type and isogenic mutant strains harboring plasmids for expression of fluorescent proteins. (b) Plasmids for constitutive or regulated expression of genes encoding fluorescent proteins (see Note 1). 5. Eukaryotic host cells. (a) HeLa (American Type Culture Collection, ATCC no. CCL-2). (b) RAW264.7 (American Type Culture Collection, ATCC no. TIB-71). (c) U937 (American Type Culture Collection, ATCC no. CRL-1593.2). (d) Human primary macrophages (prepared from monocytes isolated from pooled blood samples of healthy donors). 6. Cell culture medium. (a) For HeLa cells, use Dulbecco’s Modified Eagle’s medium (DMEM) + 10% fetal calf serum. (b) For RAW264.7, use DMEM + 6% fetal calf serum. (c) For U937, use RPMI (Biochrom AG, FG1385) + 10% fetal calf serum (ThermoFisher Scientific, Gibco™). (d) For primary cells, use RPMI-1640 + 10% fetal calf serum. 7. PBS (phosphate-buffered saline, LPS-free). 8. 3% para-formaldehyde in PBS (fixative). 9. Biotase (Biochrom AG, detachment of HeLa cells). 10. 0.5 mM EGTA in PBS (detachment of macrophages).

108

Marc Schulte and Michael Hensel

11. 100 mM NH4Cl in PBS (quench solution for fixation). 12. LB or PCN medium (bacterial growth medium). (a) For maintenance of plasmid, appropriate antibiotics are added to bacterial growth medium, such as Carbenicillin at 50 μg
mL1. 13. Gentamicin, 10 mg
mL1 stock solution. As flow cytometer, the Attune NxT Acoustic Focusing Cytometer (2017) from ThermoFisher Scientific was used. See Table 1 for specifications of filter sets used, and Table 2 for the specific instrument settings. We recommend for the flow cytometer used to determine the sensitivity in detection of bacterial cells as shown in Fig. 1, and the accuracy in detection of bacteria with distinct fluorescent proteins as shown in Fig. 2.

2.2 Instrument and Filter Sets

Table 1 Filters settings of the Attune NxT cytometer Laser (excitation)

Filter

Channel (readout)

For fluorescent protein

Blue, 488 nm (GFP)

488/10

BL1-H

sfGFP, GFPmut3

Blue, 488 nm (GFP)

530/30

BL2-H

–

Blue, 488 nm (GFP)

590/40

BL3-H

–

Yellow, 561 nm (RFP)

585/16

YL1-H

DsRed_T3

Yellow, 561 nm (RFP)

620/15

YL2-H

mCherry, mCherry2, tagRFP-T

Yellow, 561 nm (RFP)

695/40

YL3-H

–

Table 2 General settings for individual measurements Bacteria in vitro or liberated from host cells

Parameter

HeLa cells or human primary macrophages

RAW264.7 or U937 macrophages

SSC/FSC

340/420

100/140

80/340

Sensor gain BL detectors (GFP)

Individual

Individual

Individual

Sensor gain YL detectors (RFP)

Individual

Individual

Individual

FSC/SSC threshold

100/2500

25,000/0

25,000/0

100

100

10,000 infected cells (constitutive gate)

10,000 infected cells (constitutive gate)

Flow rate (μL
min

1

) 25

Minimal cell counts for 10,000 bacteria quantification (constitutive gate)

Flow Cytometry of Intracellular Bacteria

109

Fig. 1 Total cell number determination of bacteria in vitro. STM WT harboring plasmids with constitutive expression of either DsRed, sfGFP, tagRFP-T, mCherry, or mCherry2 was grown o/n in LB medium, diluted to an OD600 of 0.05 in fresh LB and incubated at 37  C. Every hour, samples were taken and subjected to FC to quantify the constitutive fluorescent events per mL (bacteria
mL1) [19, 22] 2.3

3

Software

1. Attune NxT software (3.1.1162.1, Thermo Fisher Scientific, Inc.) or higher (see Note 2).

Methods

3.1 Protocol for Preparing and Measuring Bacteria In Vitro

1. Inoculate liquid cultures of required strains in appropriate medium (LB or PCN medium, add antibiotics if required) with single bacteria colonies from plates (see Note 3) and incubate overnight at 37  C with aeration (see Note 4). If overnight cultures will be analyzed, proceed with step 3. 2. Inoculate subcultures if required an incubate at 37  C with aeration (see Note 4) until time point for measurement (see Note 5). 3. At time point for measurement, dilute culture in PBS to a final concentration of not more than app. 1–5
106 bacteria
mL1 (app. 1 μL of OD600 ¼ 5 in 1 mL PBS). 4. Centrifuge sample for 5 min at 20,000
g at RT and discard the supernatant.

110

Marc Schulte and Michael Hensel

Fig. 2 Detection accuracy of bacterial particles on an Attune NxT cytometer. STM WT strains constitutively expressing DsRed or sfGFP were grown in LB medium o/n. (a) Controls of PBS without STM, only DsRedpositive STM, or only sfGFP-positive STM are shown. Events per μL are indicated in each gate. Mixtures of DsRed- and sfGFP-expressing STM in various ratios as indicated were prepared in PBS. A constant high amount of DsRed-positive STM was mixed with equal, or 10-, 100-, 1,000-, or 10,000-fold lower amounts of sfGFP-positive STM (b), or mixtures were prepared vice versa with constant amounts of sfGFP-positive STM. (d) The mixtures were directly subjected to FC and relative amounts (events x μL1) of sfGFP- or DsRedpositive STM measured in the first sample was set to 100% (100/100). Mixtures with gradual ten-fold reduction of red- or green-fluorescent STM within a sample containing constant high amount of green- or red-fluorescent STM, respectively, were quantified. The measured value (events
μL1 in %) compared to the first sample containing high amounts of both, red- and green-fluorescent STM, is indicated below [19]

5. Add 500 μL 3% para-formaldehyde in PBS, resuspend pellet, and fix for 15 min at RT. 6. Centrifuge sample for 5 min at 20,000
g at RT and discard the supernatant. 7. Add 250–1000 μL 100 mM NH4Cl in PBS to quench all residual aldehydes, resuspend pellet. 8. Samples are ready for FC analyses as show in Fig. 3 (see Note 6).

Flow Cytometry of Intracellular Bacteria

111

Fig. 3 Gating for measuring bacterial particles. Bacteria-sized particles were selected by FSC/SSC and DsRedpositive cells (YL-1) were gated. The sfGFP fluorescence intensity (BL-1) of the DsRed-positive population was recorded and can show extra- and intracellular induction of selected genes (stress response, nutrient limitation, etc.) 3.2 Protocol for Preparing and Measuring Bacteria Liberated from Host Cells (HeLa, RAW264.7, U937, etc.)

1. Before infection, host cells were seeded in surface-treated 12or 6-well plates to reach confluency at day of infection (see Note 7). 2. Before infection, inoculate liquid cultures of required strain in LB medium (add antibiotics, if required) with single bacteria colonies from plates (see Note 3) and incubate overnight at 37  C with aeration (see Note 4). For infection of macrophages by STM. proceed with step 4. 3. For HeLa cell infection with STM, inoculate subcultures 1:31 in fresh LB medium (add antibiotics, if required) and incubate for 3.5 h at 37  C with aeration (see Note 4). 4. Adjust OD600 with PBS to 0.2 (app. 3
108 CFU
mL1). 5. Use suitable volume of diluted bacteria for infection of host cells. Directly add suitable volume of diluted bacteria to host cells in cell culture medium. 6. Optional: If infection is synchronized by centrifugation, centrifuge well plates for 5 min at 500
g at RT (see Note 8). 7. Incubate infected host cells for 25 min at 37  C at 5% CO2. 8. Wash cells thrice with warm PBS. Take care that cells do not detach from the bottom. This is time point 0 h. 9. Add cell culture medium containing 100 μg
mL1 gentamicin to kill all extracellular bacteria and incubate for 1 h at 37  C at 5% CO2. 10. Remove medium and add cell culture medium containing 10 μg
mL1 gentamicin and incubate for at 37  C at 5% CO2 until time point for measurement.

112

Marc Schulte and Michael Hensel

11. At time point for measurement wash cells twice with warm PBS and add 500–1000 μL 0.5% Triton-X-100 in PBS to lyse the host cells. Incubate for 10 min at RT with shaking (see Note 9). Transfer entire lysate from wells to 1.5 mL test tubes, rinse well bottom to detach remaining cells. 12. Centrifuge lysate for 5 min at 500
g at RT to pellet host cell debris, recover bacteria from the supernatant and transfer to a clean test tube. 13. Centrifuge sample for 5 min at 20,000
g at RT and discard the supernatant. If living bacteria will be measured, add 250 μL PBS and continue with FC analyses. 14. Add 500 μL 3% para-formaldehyde in PBS and fix for 15 min at RT. 15. Centrifuge sample for 5 min at 20,000
g at RT and discard the supernatant. 16. Add 250 μL 100 mM NH4Cl in PBS to quench all residual aldehydes. 17. Samples are ready for FC analyses (see Note 7). 3.3 Protocol for Preparing and Measuring Infected Host Cells (HeLa, RAW264.7, U937, etc.)

1. Before infection, host cells were seeded in surface-treated 12or 6-well plates to reach confluency at day of infection (see Note 6). 2. Before infection, inoculate liquid cultures of required strain in LB medium with antibiotics, if required, with single bacterial colonies from plates (see Note 3) and incubate overnight at 37  C with aeration (see Note 4). For infection of macrophage by STM, proceed with step 4. 3. For HeLa cell infection with STM, inoculate subcultures 1:31 in fresh LB medium (add antibiotics, if required) and incubate for 3.5 h at 37  C with aeration (see Note 4). 4. Adjust OD600 with PBS to 0.2 (app. 3
108 CFU
mL1). 5. Use suitable volume of diluted bacteria for infection of host cells. Directly add suitable volume of diluted bacteria to host cells in cell culture medium. 6. Optional: If infection is synchronized by centrifugation, centrifuge multiwell plates for 5 min at 500
g at RT (see Note 8). 7. Incubate infected host cells for 25 min at 37  C at 5% CO2. 8. Wash cells thrice with prewarmed PBS. Take care not to detach cells from the bottom. This is time point 0 h. 9. Add cell culture medium containing 100 μg
mL1 gentamicin to kill all extracellular bacteria and incubate for 1 h at 37  C at 5% CO2.

Flow Cytometry of Intracellular Bacteria

113

10. Remove medium and add cell culture medium containing 10 μg
mL1 gentamicin and incubate for at 37  C at 5% CO2 until time point for measurement. At time point for measurement, wash cells twice with warm PBS. To detach HeLa cells, add 1 mL biotase to detach HeLa cells. To detach macrophages, add 1 mL ice-cold 5 mM EDTA in PBS. 11. Incubate for 10 min at 37  C (HeLa cells) or 4  C (macrophages) with shaking (see Note 10). Transfer entire suspension from multiwell plates to 1.5 mL Eppendorf tubes. Rinse well bottom to detach remaining cells. 12. Centrifuge suspension for 5 min at 1000
g at RT to pellet host cells and discard the supernatant. If living host cells are measured, add 250 μL PBS and proceed with step 16. 13. Add 500 μL 3% para-formaldehyde in PBS and fix for 15 min at RT. 14. Centrifuge sample for 5 min at 1000
g at RT and discard the supernatant. 15. Add 250 μL 100 mM NH4Cl in PBS to quench all residual aldehydes. 16. Samples are ready for FC analyses as shown in Figs. 4, 5, 6, and 7 for HeLa cells, RAW274.7 macrophages, human primary macrophages, and U937 macrophages, respectively (see Note 7). We recommend to determined.

Fig. 4 Gating for FC analyses of infected HeLa cells. HeLa cell-sized particles were selected by FSC/SSC and DsRed-positive cells (YL-1) were gated. The sfGFP fluorescence intensity (BL-1) of the DsRed-positive population was recorded and shows in this case host cells with cytosolic presence of a subpopulation of intracellular STM

114

Marc Schulte and Michael Hensel

Fig. 5 Gating for FC analyses of infected RAW264.7 macrophages. RAW264.7 macrophage-sized particles were selected by FSC/SSC and tagRFP-T-positive cells (YL-2) were gated. The sfGFP fluorescence intensity (BL-1) of the tagRFP-T-positive population was recorded and shows in this case host cells with intracellular metabolic active STM

Fig. 6 Gating for FC analyses of infected human primary macrophages. Blood-derived human macrophages were selected by FSC/SSC and DsRed-positive cells (YL-1) were gated. The sfGFP fluorescence intensity (BL-1) of the DsRed-positive population was recorded

4

Notes 1. Fluorescent proteins should be selected to match excitation by available lasers and to allow distinct readout of fluorescence signals of bacterial and host cells, or multiple distinct parameters. 2. Other software packages may be used for subsequent data analyses, such as FlowJo (BD) or FCS Express (De Novo Software). Conversion of proprietary Attune NxT file format in standard FCS3.1 file format is required.

Flow Cytometry of Intracellular Bacteria

115

Fig. 7 Gating for FC analyses of infected human U937 macrophages. Human U937 macrophages were selected by FSC/SSC and DsRed-positive cells (YL-1) were gated. The sfGFP fluorescence intensity (BL-1) of the DsRed-positive population was recorded

3. Always prepare a positive and negative control for every experiment and experimental condition (fluorescent and nonfluorescent bacteria). 4. A roller drum was used for agitation at 60 rpm of bacterial cultures in glass test tubes. Other forms in incubation may require other incubation periods to obtain invasive cultures. 5. Add reagents (stressors, inductors, etc.) to cultures at selected time points of culture, if required. 6. The eukaryotic cell line used is independent for this protocol; however, FC settings have to be adjusted accordingly. 7. Fluorochrome-labeled or fluorescent protein expressing cells prepared for analyses by FC may also be analyzed by epifluorescence microscopy. Micrographs may indicate aberrant cell forms, cell aggregation and further artifacts that may influence FC analyses. Thus, it is recommended to prepare aliquots of samples for subsequent image analyses by microscopy. To obtain suitable cell density, concentration by centrifugation is required. 8. Synchronization by centrifugation is recommended for infection of macrophages. 9. Host cells are lysed and detached from well bottom, check by microscopy before proceeding to next step. 10. Host cells are detached from well bottom, check by microscopy for full detachment before continuing.

116

Marc Schulte and Michael Hensel

Acknowledgments This work was supported by the DFG by project P15 in SFB 944. References 1. Dittrich W, Go¨hde W (1969) Impulsfluorimetrie bei Einzelzellen in Suspensionen. Z Naturf 24b:360–361 2. Brown M, Wittwer C (2000) Flow cytometry: principles and clinical applications in hematology. Clin Chem 46(8):1221–1229. https:// doi.org/10.1093/clinchem/46.8.1221 3. Rieseberg M, Kasper C, Reardon KF, Scheper T (2001) Flow cytometry in biotechnology. Appl Microbiol Biotechnol 56(3–4):350–360. https://doi.org/10.1007/s002530100673 4. Chow S, Hedley D (2001) Flow cytometric measurement of intracellular pH. Curr Protoc Cytom. Chapter 9:Unit 9 3. https://doi.org/ 10.1002/0471142956.cy0903s14 5. Eruslanov E, Kusmartsev S (2010) Identification of ROS using oxidized DCFDA and flowcytometry. Methods Mol Biol 594:57–72. https://doi.org/10.1007/978-1-60761411-1_4 6. Hedley DW, Chow S (1994) Evaluation of methods for measuring cellular glutathione content using flow cytometry. Cytometry 15(4):349–358. https://doi.org/10.1002/ cyto.990150411 7. June CH, Abe R, Rabinovitch PS (1997) Measurement of intracellular calcium ions by flow cytometry. Curr Protoc Cytom. Chapter 9: Unit 9 8. https://doi.org/10.1002/ 0471142956.cy0908s02 8. Pozarowski P, Darzynkiewicz Z (2004) Analysis of cell cycle by flow cytometry. Methods Mol Biol 281:301–311. https://doi.org/10. 1385/1-59259-811-0:301 9. Riccardi C, Nicoletti I (2006) Analysis of apoptosis by propidium iodide staining and flow cytometry. Nat Protoc 1(3):1458–1461. https://doi.org/10.1038/nprot.2006.238 10. Shapiro HM (2000) Membrane potential estimation by flow cytometry. Methods 21(3): 271–279. https://doi.org/10.1006/meth. 2000.1007 11. Vermes I, Haanen C, Reutelingsperger C (2000) Flow cytometry of apoptotic cell death. J Immunol Methods 243(1–2): 167–190. https://doi.org/10.1016/S00221759(00)00233-7 12. Hansmeier N, Miskiewicz K, Elpers L, Liss V, Hensel M, Sterzenbach T (2017) Functional

expression of the entire adhesiome of Salmonella enterica serotype Typhimurium. Sci Rep 7(1):10326. https://doi.org/10.1038/ s41598-017-10598-2 13. Berney M, Hammes F, Bosshard F, Weilenmann HU, Egli T (2007) Assessment and interpretation of bacterial viability by using the LIVE/DEAD BacLight kit in combination with flow cytometry. Appl Environ Microbiol 73(10):3283–3290. https://doi.org/10. 1128/AEM.02750-06 14. Sasaki DT, Dumas SE, Engleman EG (1987) Discrimination of viable and non-viable cells using propidium iodide in two color immunofluorescence. Cytometry 8(4):413–420. https://doi.org/10.1002/cyto.990080411 15. Stapels DAC, Hill PWS, Westermann AJ, Fisher RA, Thurston TL, Saliba AE, Blommestein I, Vogel J, Helaine S (2018) Salmonella persisters undermine host immune defenses during antibiotic treatment. Science 362 (6419):1156–1160. https://doi.org/10. 1126/science.aat7148 16. Ro¨der J, Hensel M (2020) Presence of SopE and mode of infection result in increased Salmonella-containing vacuole damage and cytosolic release during host cell infection by Salmonella enterica. Cell Microbiol 22(5): e13155. https://doi.org/cmi.13155/cmi. 13155 17. Helaine S, Thompson JA, Watson KG, Liu M, Boyle C, Holden DW (2010) Dynamics of intracellular bacterial replication at the single cell level. Proc Natl Acad Sci U S A 107(8): 3746–3751. https://doi.org/10.1073/pnas. 1000041107 18. Helaine S, Cheverton AM, Watson KG, Faure LM, Matthews SA, Holden DW (2014) Internalization of Salmonella by macrophages induces formation of nonreplicating persisters. Science 343(6167):204–204. https://doi. org/10.1126/science.1244705 19. Schulte M, Olschewski K, Hensel M (2021) The protected physiological state of intracellular Salmonella enterica persisters reduces host cell-imposed stress. Commun Biol 4(1):520. https://doi.org/10.1038/s42003-02102049-6 20. Noster J, Chao TC, Sander N, Schulte M, Reuter T, Hansmeier N, Hensel M (2019)

Flow Cytometry of Intracellular Bacteria Proteomics of intracellular Salmonella enterica reveals roles of Salmonella pathogenicity island 2 in metabolism and antioxidant defense. PLoS Pathog 15(4):e1007741. https://doi.org/10. 1371/journal.ppat.1007741 21. Galeev A, Suwandi A, Bakker H, Oktiviyari A, Routier FH, Krone L, Hensel M, Grassl GA (2020) Proteoglycan-dependent endo-lysosomal fusion affects intracellular survival of Salmonella Typhimurium in epithelial cells. Front Immunol 11: 731. https://doi.org/10.3389/ fimmu.2020.00731 22. Schulte M, Olschewski K, Hensel M (2021) Fluorescent protein-based reporters reveal stress response of intracellular Salmonella enterica at level of single bacterial cells. Cell Microbiol 23(3):e13293. https://doi.org/10. 1111/cmi.13293

117

23. Reuter T, Scharte F, Franzkoch R, Liss V, Hensel M (2021). Single cell analyses reveal distinct adaptation of typhoidal and non-typhoidal Salmonella enterica serovars to intracellular lifestyle. PLoS Pathog 17: e1009319. https:// doi.org/10.1371/journal.ppat.1009319 24. Ro¨der J, Felgner P, Hensel M (2021) Single cell analyses reveal phosphate availability as critical factor for nutrition of Salmonella enterica within mammalian host cells. Cell Microbiol: e13374. https://doi.org/10.1111/cmi. 13374 25. Ro¨der J, Felgner P, Hensel M (2021) Comprehensive single cell analyses of the nutritional environment of intracellular Salmonella enterica. Front Cell Infect Microbiol 11:624650. https://doi.org/10.3389/fcimb.2021. 624650

Chapter 11 Quantification of Microbial Fluorescent Sensors During Live Intracellular Infections Erez Mills and Erik Petersen Abstract The interaction of pathogens with their eukaryotic hosts during intracellular growth is critical to many diseases. However, the relative scarcity of pathogen biomolecules versus the abundant host biomolecule concentration can make quantitative evaluation of pathogen intracellular responses difficult. Recent years have seen an explosion in utilization of fluorescent proteins to serve as transcriptional reporters and biosensors for quantification of pathogen responses. Here, we describe a method to establish a fluorescent assay quantifying pathogen behavior during intracellular infection and to quantify these results at a single cell level. The sensitivity of these fluorescent assays permits the live observation of changing pathogen responses, while the ability to measure at a single cell level uncovers subpopulations of pathogens whose existence may be missed during the population-level assays often required to accumulate sufficient pathogen biomolecules for analysis. Key words Fluorescent reporter, Intracellular pathogen, Single-cell quantification, Live cell microscopy, Cyclic-di-GMP, Salmonella

1

Introduction Intracellular pathogens—including bacteria such as Salmonella, Brucella, Listeria, and Legionella as well as eukaryotes such as Plasmodium and various fungi—survive and grow inside host cells. Intracellular residence protects these pathogens from humoral immune responses and might result in prolonged and even chronic infections. Furthermore, their intracellular life style also protects these organisms against a number of immunological and medical interventions such as antibody targeting or antimicrobial treatment [1, 2]. Understanding the conditions encountered by intracellular pathogens and their physiology during intracellular life is important for the development of novel anti-microbial drugs and strategies. Light emission is an extremely useful tool for the study of pathogen physiology. Fluorescence- and luminescence-based sensors allow the quantification of a large range of physical and

Ohad Gal-Mor (ed.), Bacterial Virulence: Methods and Protocols, Methods in Molecular Biology, vol. 2427, https://doi.org/10.1007/978-1-0716-1971-1_11, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022

119

120

Erez Mills and Erik Petersen

molecular properties in real-time in live cells. These include gene expression [3], NADPH levels [4], oxygen levels [5], type three secretion system effector transport [6], and second messenger regulation [7]. Further, any study of interaction between two different entities (pathogens and host cells in this instance) amplifies the variability of each. These microscopy-based sensors provide an opportunity to measure the interactions at a single cell level, permitting researchers to identify important interaction subsets that may be missed by other population-based techniques. We have developed an assay to measure a fluorescent biosensor within live intracellular pathogens. While our protocol was based on a redesigned Forster resonance energy transfer (FRET)-based biosensor that has been previously used in free living bacteria to measure cyclic-di-GMP levels in real time [7, 8], it should be adaptable to many fluorescent/luminescent sensors and host cell types if the equipment available allows for measurement. In our protocol, we infect bone marrow–derived macrophages with Salmonella expressing this fluorescent biosensor. These infected cells are then counterstained and imaged live, permitting analysis of realtime sensor activity within intracellular pathogens at a single cell level. We then discuss a method to quantitatively analyze these images using open-source software. Thus, we are able to quantify both the population and diversity of pathogen responses to the intracellular environment.

2

Materials

2.1 Bone Marrow– Derived macrophages (BMDMs)

1. RPMI 1640 media: Contains L-glutamine and phenol red, but without HEPES. Should be supplemented with 10% heatinactivated fetal bovine serum (hiFBS) prior to use. 2. L929 cultured media: Growth factor–secreting L929 cells are cultured in RPMI with 10% hiFBS at 37
C and 5% CO2. After 7 days, media supernatant is removed, filtered through a 0.45 μm filter, and stored at 80
C. 3. BMDM differentiation media: RPMI 1640 containing 10% hiFBS, 15% L929 cultured media, and 1X penicillin–streptomycin. Filter-sterilize through a 0.22 μm filter. 4. Bone marrow macrophages: Extract bone marrow through previously published protocols [9–11] and culture in 20 mL of BMDM differentiation media within a noncoated 150 mm petri dish in a 37
C/5% CO2 incubator. After 4 days, add additional 15 mL of BMDM differentiation media. BMDMs are best useable between 8 and 12 days after extraction. 5. Tissue culture–grade phosphate buffered saline (PBS).

Quantification of Intracellular Microbial Fluorescent

121

6. Lidocaine–EDTA solution: 4 mg/mL lidocaine (200 mg for 50 mL), 5 mM EDTA (113 mg for 50 mL), dissolved in tissue culture–grade PBS and 0.22 μm filter-sterilized. 7. Hemocytometer, trypan blue, and inverted light microscope for cell counting. 8. 37
C, 5% CO2 incubator and biosafety cabinet for cell manipulations. 2.2 Bacteria Encoding a Fluorescent Sensor

1. An intracellular bacterial strain encoding a fluorescent sensor whose intensity will be measured during intracellular survival (see Notes 1 and 2). These can include promoter-reporter constructs, FRET biosensors, or whichever fluorescent assay where measurement is desired. This protocol is not designed to test subcellular localization of fluorescent fusion proteins, but will measure the fluorescence level of fluorescent proteins or other reporter molecules as long as even puncta resulting from localized expression remain within the linear sensitivity range. 2. If multiple fluorescent sensors are used in the same strain (i.e., in FRET biosensors, dual transcriptional reporters, etc.), strains expressing each single fluorescent protein should also be made to determine the level of bleedthrough between fluorescent channels during microscopy. 3. Appropriate growth media (LB), transcriptional inducers, and antibiotics as necessary.

2.3 BMDM Infections and Microscopy

1. 12 mm diameter untreated glass coverslips: At least two for each sample to be tested, to account for any breakage that may occur. Autoclave (dry cycle) within a small, foil-covered glass beaker or other suitable vessels to sterilize. 2. 24-well tissue culture plates: Each well will contain a single glass coverslip. 3. Fine-tipped forceps, tweezers, or needles to maneuver coverslips. 4. FluoroBrite DMEM media: This is a cell culture media specially formulated to provide low background fluorescence during live cell imaging. If extended exposure to the media is anticipated, it should be supplemented with 10% hiFBS and L-glutamine. For short-term exposures (like the approximately 30 min exposure detailed here), these supplements can be left out to maintain low background fluorescence. 5. Gentamicin stock at 50 mg/mL in water, 0.22 μm filtersterilized. 6. 1 inch  3 inch glass slides. 7. SecureSeal Imaging Spacers (SS8X9), 8  9 mm diameter: These are thin, double-backed adhesive stickers that permit

122

Erez Mills and Erik Petersen

the coverslip to be suspended above a small pool of media for live infections. This part number comes as a large, 8 chamber sheet that can be trimmed into individual chambers using a pair of sharp scissors. 8. Wheat germ agglutinin (WGA) fluorescent conjugate or another live cell-compatible membrane dye: To localize cells during live image analysis, membrane dyes compatible with live imaging are used. One example is the lectin wheat germ agglutinin conjugated to a fluorescent dye (several Alexa Fluor dye variants are available) that is sufficiently distinguishable from the fluorescent sensors encoded by the bacterial strain used. This protocol uses WGA conjugated to Alexa Fluor 680, diluted to 1 mg/mL in PBS as per manufacturer’s instructions, aliquoted, and frozen at 20
C. 9. ProLong Live Antifade reagent: This is added to the imaging media to stabilize the fluorescent signal and prevent photobleaching. Other antifade reagents will likely provide similar results so long as they are designed for live cell imaging. ProLong Live Antifade reagent should be aliquoted and frozen at 20
C as per manufacturer’s instructions. 10. Microscope suitable for live-cell imaging: While any fluorescent microscope that can acquire images can be used, quantification consistency will be dependent on the quality of images obtained. Confocal spinning disc microscopes will work well. 2.4

Image Analysis

1. ImageJ image analysis software with the MicrobeJ plug-in: ImageJ is an open-source image analysis suite (https:// imagej.net/ImageJ), and MicrobeJ is an ImageJ plug-in specifically designed for bacterial analysis (https://www.microbej. com/). 2. Spreadsheet software like Excel, R, or Matlab for final data manipulation.

3

Methods

3.1 Preparation of Bone Marrow–Derived Macrophages

1. Place autoclaved 12 mm circular coverslips into individual wells of a 24-well polystyrene plate. Include at least two wells for each sample to be imaged to account for coverslip breakage. 2. Remove BMDM differentiation media from the BMDM dishes and gently wash twice with 10 mL PBS by pipetting over the top of any attached cells. 3. To lift macrophages from their petri dishes, remove the final PBS wash and add 2 mL of the lidocaine–EDTA solution. Incubate at 37
C, 5% CO2 for 5 min.

Quantification of Intracellular Microbial Fluorescent

123

4. Wash cells from the surface of the dish by tilting the plate at a 30-degree angle and pipetting 10 mL of PBS across the surface. Repeatedly pipet this solution across the surface, then remove to a 50 mL tube. Conduct this wash with two more rounds of 10 mL of PBS, finishing with approximately 32 mL of cell suspension. Centrifuge this cell suspension at 233  g for 5 min to pellet. 5. Decant PBS from the BMDM pellet and resuspend cells in RPMI with 10% hiFBS. Determine BMDM concentration by counting on a hemocytometer with trypan blue (see Note 3) and dilute in RPMI with 10% hiFBS to a concentration of 3  105 cells/mL (see Note 4). Add 1 mL of cells to each coverslip-containing well and incubate overnight at 37
C, 5% CO2. 3.2 Preparation of Fluorescent Sensor– Expressing Bacteria

1. Prepare 3 mL of LB in a 15 mL culture tube containing appropriate antibiotic and fluorescent sensor inducer if required. For pBAD18 expression, 100 μg/mL ampicillin and 0.02% arabinose is suitable (see Note 5). 2. Inoculate this induction culture from a glycerol stock or freshly streaked plate of the fluorescent sensor–expressing bacteria and grow overnight at 37
C with shaking at 250 rpm.

3.3 Infection of Bone Marrow–Derived Macrophages

1. Retrieve the overnight bacterial culture and determine the desired multiplicity of infection (MOI). If desired, the overnight bacterial culture can be washed with sterile water through repeated centrifugation and resuspension of the bacterial pellet to remove any culture component or endotoxin from the media. Alternatively, if multiple bacterial strains are used, overnight samples can be diluted to an equal OD (for instance 1.0) in fresh LB to standardize the amount of bacterial culture carryover. 2. Determine the OD at 600 nm of the prepared bacterial culture and, using appropriate CFU/OD600 values for the bacterial strain, determine the concentration (CFU/mL) of the bacterial culture. Calculate the amount of overnight culture required for the desired MOI dependent on BMDM seeding density. Infections should be conducted in RPMI with 10% hiFBS in a volume between 0.25 and 1 mL. Add the appropriate amount of overnight culture to RPMI for the desired infection culture. 3. After their overnight incubation, the prepared BMDMs will have adhered to the glass coverslips. Remove the RPMI media from the wells and replace with the appropriate infection culture. Centrifuge at 1000  g for 5 min to facilitate bacterial contact with BMDMs, then transfer to the 37
C, 5% CO2 incubator for 30 min to allow bacterial internalization.

124

Erez Mills and Erik Petersen

4. Prepare a stock of RPMI with 10% hiFBS containing 50 μg/ mL gentamicin. 1 mL of media will be used for each well. 5. After the 30 min incubation, remove the infection culture from BMDM wells. Wash twice with 0.75 mL of PBS. Add 1 mL of RPMI with gentamicin and incubate for at least 30 min to ensure killing of any noninternalized bacteria. After this 30 min exposure to gentamicin, cells can be imaged or the incubation can be continued until a desired time point is reached. 3.4 Microscopy of Bone Marrow–Derived Macrophages

1. A solution of FluoroBrite DMEM containing 50 μg/mL gentamicin at a rate of 1 mL per well will be required. Generate a sufficient volume to provide for all wells plus a few milliliters by diluting the gentamicin 50 mg/mL stock into FluoroBrite DMEM. 2. Prepare imaging media by removing 1 mL of FluoroBrite with gentamicin to a 1.5 mL tube and adding 10 μL of ProLong Live Antifade reagent. 3. Separate the remaining FluoroBrite media with gentamicin equally into two tubes. Prepare counterstain media by diluting the 1 mg/mL WGA-AlexaFluor680 stock at a rate of 1.5 μL/ mL into one of these tubes. Cover with foil or place within a drawer to limit exposure to the light. Save the remaining half of the FluoroBrite media containing gentamicin as a wash media. 4. To a glass slide, place a single chamber of the SecureSeal spacer by removing one side of the adhesive paper with fine tweezers and carefully laying the chamber onto the glass slide. Lightly press the chamber onto the slide to ensure adhesion (see Note 6). Using the fine tweezers, remove the other side of adhesive paper to expose the adhesive surface. 5. To the coverslip to be imaged, remove the RPMI media and add 0.5 mL of the counterstain media and incubate at 37
C/ 5% CO2 for 5 min. 6. Remove the counterstain media from the coverslip to be imaged and add 0.5 mL of FluoroBrite with gentamicin. 7. To the prepared glass slide with SecureSeal spacer, add 7 μL of the imaging media. 8. Remove the FluoroBrite media from the coverslip well, and using a pair of fine tweezers carefully tilt the coverslip up from the bottom of the well and lift it out of the plate (see Note 7). Lightly touch the side of the coverslip to a Kimwipe to wick off excess media. Keep track of which side of the coverslip was sitting up in the well as this side contains the adhered cells. 9. Invert the coverslip onto the prepared chamber so that the adhered cells are placed into the imaging media. Do this at an

Quantification of Intracellular Microbial Fluorescent

125

angle so that the majority of the air bubbles are excluded from the chamber. Using a Kimwipe, press very lightly on the coverslip to adhere it to the chamber while at the same time removing a majority of the media remaining on the coverslip surface. 10. Take the slide to the microscope for imaging. If using an oil objective, place a small drop of oil on the coverslip before inverting onto the microscope stage. Use the counterstain to localize and focus the cells on the coverslip. If acquiring a large number of images for quantification, move the objective to the upper left outer edge of the chamber. 11. Begin imaging the cells (see Note 8). Settings for the bacterial fluorescent sensors should have previously been worked out so that each fluorescent channel can be measured at a point where the fluorescent signal will be within the linear range of the camera and not saturating (see Subheading 3.6). 12. The adhered cells will have spread out upon the surface of the coverslip. Similar to a pyramid, the greatest volume of the cell will be found just above the coverslip surface. Use the counterstain to identify the imaging plane of the coverslip and move up within the Z orientation slightly so that the background fluorescence of the coverslip is clear from the imaging plane. Attempt to localize as many full cells within the microscope field of view as possible to maximize the potential for bacterial detection. 13. After the cells have been appropriately framed within the microscope using the counterstain, capture a fluorescent image beginning with the fluorescent signals from the bacterial sensors, then the cellular counterstain, and finally a brightfield/DIC image if able/desired. 14. To acquire further images, move the field of view along the coverslip to a new section of cells. To avoid potential bleaching between fields of view, leave at least one unimaged field between each image. Reorient the Z direction as necessary to maintain the imaging plane within the majority of the cellular volume. If the objective was originally placed in the upper left to maximize the number of potential images from each coverslip, move in a zig-zag pattern (right, down, left, down, right, down, etc.) until the entire coverslip is imaged. This will help to prevent any potential duplication of cells within the image files. 3.5 Analysis of Microscopy Images (Fig. 1)

1. Using the microscopy software, export the images as .tif files (some versions of ImageJ can handle different file types, but this protocol assumes .tif file formats). Ensure that each fluorescent channel is exported as a separate .tif file labeled with the channel number (c1, c2, etc.) and without any image correction applied.

126

Erez Mills and Erik Petersen

Fig. 1 Example of microscopy images and analysis. (a) An overlaid microscopy image from a Salmonella-infected bone marrow–derived macrophage consisting of panels B–E. (b) The WGA-Cy5 counterstain used to localize the macrophage for microscopy imaging. (c–e) Three separate fluorescent reporters imaged on individual channels for quantification. (f) The cell mask generated through manipulation of the image intensity scale to equalize intensity of the panel from (e) for bacterial identification. (g–h) MicrobeJ analysis using the cell mask from (g) and the settings from (h) to identify individual bacteria and quantify the fluorescent intensity of each bacterium in panels (c–e)

Quantification of Intracellular Microbial Fluorescent

127

2. Image analysis within MicrobeJ requires the use of a cell mask to determine the outline of each bacterium. To do this, a second set of .tif files must be exported with one channel having been adapted for cell mask use. If a constitutive fluorescent reporter is used, this is a good channel to work on for the cell mask. The point of the cell mask image is to generate an image that displays only bacteria with expression within the linear range, while excluding the variability inherent to fluorescent expression. This should give us an image in which all bacteria to be measured are visible, but their intensity is about the same across the population. 3. Using the microscope software, open the image file and decide upon a maximum and minimum value to count as a measurable bacterium. To further bring these bacteria into range, adjust the gamma value of the image to 0.01 (see Note 9). After this image manipulation for the cell mask, export this channel as a . tif file to a separate folder. Delete any other .tif files from this manipulated set apart from the cell mask file. Rename the previous channel files to increase the channel number by one (i.e., c1 –> c2). Then, rename the cell mask file as c1 and place all files within the same folder. 4. Open ImageJ and load the MicrobeJ plugin [12]. Open the cell mask file and adjust the bacterial identification settings in the MicrobeJ plugin until individual bacteria are separated and accurately detected (https://www.microbej.com/tutorials/). Begin by altering the expected bacterial length, width, and area settings until clumps of bacteria are distinguished from each other but individual bacteria are not segmented. Further adjustment of the remaining bacterial identification settings within MicrobeJ may be necessary to further refine these adjustments (see Note 10). Save these settings for use in all subsequent images. 5. Analyze the images using the MicrobeJ plugin and the settings designed for detection of the bacteria. This will detect each bacterium in each image file, as well as corresponding intensity values for each fluorescent channel. Fluorescent intensities for the counterstain can be excluded. The remaining fluorescent intensity values can be exported to a spreadsheet program for further calculation. 6. During final calculations, any correction for bleedthrough between channels (described in Subheading 3.6) can be applied. Detection of bacteria whose values are too high or too low to be within the linear range of measurements for the camera will also be important. Depending on the sensor design, these may require further analysis. As they are outside the linear range, fluorescent values should not be assumed to be

128

Erez Mills and Erik Petersen

accurate. However, if the sensor is designed to measure intensity, these may be considered to be either at the maximum or minimum value to avoid excluding a particular set of bacteria. 3.6 Microscopy Optimization for Multiple Reporters

1. If multiple fluorescent reporters are used, there may be a certain level of bleedthrough between fluorescent channels. This occurs when a second fluorescent reporter is excited and emission detected during imaging of a first fluorescent reporter. This is especially a problem when using a FRET biosensor where excitation of the second fluorescent reporter is to be expected. 2. To account for the level of bleedthrough, a representative single fluorescent reporter is required. While an identical replicate to the full experiment can be repeated with the single reporter strain, this is only a matter of determining the level of bleedthrough. Any method of obtaining fluorescent signals (smearing fluorescent bacteria onto a slide) will suffice. 3. Image the single fluorescent reporters with identical settings as those used for the full experiment. Any fluorescent signal recorded in the second fluorescent channel would represent bleedthrough. The percentage of bleedthrough from the first channel into the second channel can be determined using the analysis described here, and future fluorescent intensities can be adjusted to account for this bleedthrough.

4

Notes 1. Host cells provide some obstacles to microscopic measurement that are useful to consider in the development of fluorescent biosensors. For instance, the autofluorescence of host cell components can result in high background measurements that cause increased variability during quantification. Background subtraction can be done to minimize this effect, but due to the nature of the autofluorescence (typically localized to host membranes) specific subtraction may not be sufficient. To avoid this, fluorophores can be selected in the orange to red wavelength range that do not overlap as much with the blue to green wavelength autofluorescence seen in host cells. Alternatively, biosensors can be developed that express at levels sufficiently higher than the autofluorescent background so that the impact is reduced. To reduce the disruption caused by host cell background fluorescence during our intracellular Salmonella experiments, our intracellular biosensor utilized the chromophore teal fluorescent protein (mTFP) owing to its brighter emission than cyan fluorescent protein (CFP) [13] and

Quantification of Intracellular Microbial Fluorescent

129

Kusabira orange variant 2 (mKO2) that fell outside the primary autofluorescence range [14]. 2. Similarly, care must be taken to consider the intracellular environment when designing a fluorescent/luminescent biosensor. While the cytoplasm is likely a rich environment for pathogen growth, those pathogens that reside within the phagosome of macrophages or dendritic cells may be exposed to nutrient restriction, acidic pH, and other antimicrobial factors. The acidic pH specifically may alter fluorescent protein stability (and therefore emission) and deplete pathogen ATP levels to interfere with ATP-dependent luminescence output. In our case, as the cytoplasm of intracellular Salmonella may acidify during macrophage phagocytosis, we had to consider this as well. A second reason our biosensor utilized mKO2 was due to the low acidic stability of yellow fluorescent protein (YFP) [13]. We also employed a “dead” biosensor as a control. This biosensor was a point mutant which could not bind the molecule of interest—cyclic di-GMP. Utilizing this control allowed us to account for changes in fluorescence that were caused by expression and stability of the biosensor, as well as by the background of the host cell. Because we utilized a ratiometric biosensor which was dependent on both its fluorophores for measurement, the dead biosensor control was especially useful for the normalization of measurements and avoiding artifacts. 3. During BMDM counting, if large clumps of cells are detected vortex the cell suspension and recount to ensure an accurate count is determined. 4. The value of 3  105 cells per well works for BMDMs to ensure that cells are sufficiently spread out and not on top of one another. While treatment and maintenance of gentamicin in the culture medium after infection does a good job of preventing extracellular bacteria survival and detection, increased cellular density can lead to an increased inability to ensure that bacteria are truly intracellular. At densities of 3  105 per well, we were able to determine that all bacteria appeared to be intracellular. 5. Expression of the fluorescent biosensors will vary greatly upon the particular bacterial strain, sensor components, and reporter system used. This protocol is best designed to measure the fluorescent intensity of sensors that are equally distributed throughout the bacterial cell cytoplasm. If sensors or fluorescent proteins are overexpressed, clustering can occur and present as punctate fluorescent spots. In addition to overall fluorescent intensity, MicrobeJ is also designed to measure the standard deviation in intensity across a single bacterium, allowing for detection of these puncta. Because fluorescent

130

Erez Mills and Erik Petersen

intensities within these puncta are liable to be outside the linear range of detection, these bacteria may need to be excluded from analysis. Prior to imaging, care should be taken to optimize the expression conditions of the biosensor. 6. When preparing the SecureSeal chambers on the slides, do not press down too hard. These are designed to be a consistent depth to keep the focal plane as level as possible. Pressing too hard will deform the chambers, causing the coverslip to tilt on the final slide. 7. Removing the coverslips for imaging takes a bit of practice, and will occasionally lead to breakage. This is why it is suggested to make a duplicate coverslip for each sample, so that if they break the second can be used. If your tweezers are not fine enough to get underneath the coverslip, a 12 gauge, 1.5-inch needle helps to provide a sharp point for lifting the coverslip up. At that point, the tweezers can be used to grasp the coverslip for removal. 8. Imaging of the cells will be very dependent upon your particular system and fluorescent reporter used. It is important to take the time to optimize at the outset until you are satisfied that the conditions are as good as they will get. Once imaging settings have been settled upon, it is important to keep these consistent throughout the experiment. Deviation from these settings will alter the quantification of those images. 9. Cell mask production requires that the maximum and minimum ranges of intensities are both constrained, and that the gamma value is changed to adjust bacterial intensities to an approximately equal level. Reducing the maximum ceiling will ensure that all bacteria within the desired range of measurement are presented to the analysis software equally irrespective of fluorescent intensity. Make sure that your minimum cutoff is above the background level so that host cell components are not included in the cell mask. Adjusting the maximum and minimum ranges in the image will bring the bacteria into closer range, but still provide for a variety of bacterial intensities. The gamma value converts pixel intensity from a linear range (at gamma ¼ 1.0) to an exponential one that further condenses fluorescent values upon a single point. This will greatly reduce the differences in intensities between the different bacteria to aid analysis. These settings may need to be adjusted through trial and error for the specific settings and systems used, but once determined should be conserved across all analyzed images. 10. Similarly, optimization of the MicrobeJ analysis settings requires a bit of trial and error, although this can be altered to retest images without changing the data within the images.

Quantification of Intracellular Microbial Fluorescent

131

Once the settings are decided upon though, the same settings should be applied to all acquired images within the data set to ensure conformity.

Acknowledgments Research in the Mills lab is supported by grants from the Israel Science Foundation (grant number 1272/20), the Israeli Ministry of Science and Technology (grant number 88638), and the US-Israel Binational Agricultural Research and Development Fund (grant number IS-5242-20). Research in the Petersen lab is supported by the US-Israel Binational Agricultural Research and Development Fund (grant number IS-5242-20). EM is chair of the Vigevani Senior Lectureship in Animal Sciences. References 1. Tulkens PM (1991 Feb) Intracellular distribution and activity of antibiotics. Eur J Clin Microbiol Infect Dis 10(2):100–106 2. Kamaruzzaman NF, Kendall S, Good L (2017 Jul) Targeting the hard to reach: challenges and novel strategies in the treatment of intracellular bacterial infections. Br J Pharmacol 174(14): 2225–2236 3. Aviv G, Gal-Mor O (1734) Usage of a bioluminescence reporter system to image promoter activity during host infection. Methods Mol Biol 2018:33–38 4. Goldbeck O, Eck AW, Seibold GM (2018) Real time monitoring of NADPH concentrations in Corynebacterium glutamicum and Escherichia coli via the genetically encoded sensor mBFP. Front Microbiol 9:2564 5. Potzkei J, Kunze M, Drepper T, Gensch T, Jaeger K-E, Bu¨chs J (2012 Mar 22) Real-time determination of intracellular oxygen in bacteria using a genetically encoded FRET-based biosensor. BMC Biol 10(1):28 6. Mills E, Baruch K, Charpentier X, Kobi S, Rosenshine I (2008 Feb 14) Real-time analysis of effector translocation by the type III secretion system of enteropathogenic Escherichia coli. Cell Host Microbe 3(2):104–113 7. Christen M, Kulasekara HD, Christen B, Kulasekara BR, Hoffman LR, Miller SI (2010 Jun 4) Asymmetrical distribution of the second messenger c-di-GMP upon bacterial cell division. Science 328(5983):1295–1297

8. Petersen E, Mills E, Miller SI (2019 Mar 26) Cyclic-di-GMP regulation promotes survival of a slow-replicating subpopulation of intracellular salmonella typhimurium. PNAS 116(13): 6335–6340 9. Amend SR, Valkenburg KC, Pienta KJ (2016 Apr 14) Murine hind limb long bone dissection and bone marrow isolation. JoVE 110:e53936 10. Assouvie A, Daley-Bauer LP, Rousselet G (2018) Growing murine bone marrow-derived macrophages. Methods Mol Biol 1784:29–33 11. Chalot M. Isolation and Phenotyping of Bone Marrow Macrophages. In: Rousselet G, editor. Macrophages: Methods and Protocols [Internet]. New York, NY: Springer; 2018 [cited 2021 Jan 20]. pp. 87–92. (Methods in Molecular Biology). Available from: https://doi.org/10. 1007/978-1-4939-7837-3_8 12. Ducret A, Quardokus EM, Brun YV (2016 Jun 20) MicrobeJ, a tool for high throughput bacterial cell detection and quantitative analysis. Nat Microbiol 1(7):1–7 13. Chudakov DM, Matz MV, Lukyanov S, Lukyanov KA (2010 Jul 1) Fluorescent proteins and their applications in imaging living cells and tissues. Physiol Rev 90(3):1103–1163 14. Billinton N, Knight AW (2001 Apr 15) Seeing the wood through the trees: a review of techniques for distinguishing green fluorescent protein from endogenous autofluorescence. Anal Biochem 291(2):175–197

Chapter 12 Dissecting Human Blood Immune Cells Response to Intracellular Infection Using Single-Cell RNA Sequencing Shelly Hen-Avivi and Roi Avraham Abstract Complex interactions between diverse host immune cells can determine the outcome of pathogen infections. Advances in single-cell RNA sequencing (scRNA-seq) allow detection of the transcriptional patterns of different immune cells at steady state and after infection. To reveal the complex interactions of the human immune system in response to diverse intracellular pathogens, we developed a protocol for scRNA-seq of ex vivo infected human peripheral blood mononuclear cells (PBMCs). We demonstrate here infection with Salmonella enterica serovar Typhimurium, but this protocol can be used for any other pathogen of interest, and expand our knowledge of human host–pathogen biology. Key words Host–pathogen interaction, PBMCs, Single-cell RNA-seq, Salmonella Typhimurium

1

Introduction A tug-of-war has evolved between the host immune system, that elicits specific responses aimed at eliminating invading pathogens, and intracellular bacterial pathogens that manipulate the immune system to enable their own growth. It is usually considered that macrophages are the main cellular target for intracellular bacteria, and these cellular encounters have been the main focus for the studies of host–pathogen interactions [1–5]. However, the immune system is composed of a repertoire of immune cells that elicit an efficient immune response through a complex web of cell– cell interactions. The different immune cells signal, present antigens, engage in physical interactions and activate each other in an orchestrated manner that eventually determines the outcome of infection at the organism level. Thus, studying the immune responses to infection in the context of comprehensive repertoire of immune cell types is essential for our understanding of infection biology.

Ohad Gal-Mor (ed.), Bacterial Virulence: Methods and Protocols, Methods in Molecular Biology, vol. 2427, https://doi.org/10.1007/978-1-0716-1971-1_12, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022

133

134

Shelly Hen-Avivi and Roi Avraham

The growing application of single-cell RNA sequencing (scRNA-seq) technology in biological research has a tremendous contribution to our understanding of cell heterogeneity. Using scRNA-seq, cells can be clustered into cell types and subtypes according to similarity in their transcriptomes, which allows better definitions of cell identities and cell states. Applying scRNA-seq on immune cell samples can promote our understanding of how the immune system integrates signals and responses from different cell types in steady state and after infection [6]. This could not be achieved by bulk measurements, which average the expression of the whole sample, therefore the resolution of different cell types as well as subtypes within a samples is lost. Indeed, scRNA-seq already promoted the field of host–pathogen interaction by detecting subtypes that would not be discovered by standard bulk measurements [6, 7]. Following elaborate analysis for scRNA-seq data, the next major challenge is to gain functional knowledge for the role of the suggested cellular subtypes during infection. Understanding host–pathogen interaction in humans harbors additional layers of complexity. In addition to the heterogeneity at the cellular level mentioned above (both due to different cell types in the immune system and due heterogeneous subtypes within each cell type), humans differ in genetics and environmental effects, which can affect their immune responses and the infection outcome. In addition, the availability of samples from humans, especially healthy, is restricted. An accessible and easy to collect and preserve human immune cells are peripheral blood mononuclear cells (PBMCs). PBMCs are extracted from standard blood sample and include monocytes, B, T, dendritic and NK cells. Indeed, these immune circulating cells were already shown to be affected during infections [8, 9] . PBMCs can be collected from healthy donors, and be used for ex vivo infection with the pathogen of interest for scRNA-seq to study the host–pathogen interaction. This can be used to comprehensively describe the immune subtypes that participate in the response against pathogens, to study what differs between groups of individuals that are resistant to certain infections and those who are susceptible, and study how immune cells are activated upon infection with different pathogens. Importantly, PBMCs allow studying cell–cell interactions which are crucial for an efficient immune response. A specific cell type can be further enriched or purified for specific cell type–pathogen interaction. In this chapter, we provide a detailed protocol that we developed for dissecting the molecular details underlying the outcome of intracellular infection of human cells. This includes human PBMC extraction, monocyte enrichment, cell growth, infection with the intracellular pathogen Salmonella enterica serovar Typhimurium (Salmonella Typhimurium) and sample preparations for scRNAseq using 10 genomics® platform. This protocol can be easily adapted to other pathogen of interest.

Studying Human Infection Using scRNA-Seq of Blood Immune Cells

135

Time estimation for this procedure is as follows. Day

Description

Day 1

4.1, 4.2 PBMC extraction (+ monocyte enrichment if required)/PBMC defrost Bacteria growth 4.3

PBMC/monocyte infection Day 2 Preparation for single-cell Day 2 or sequencing 3 (see Note 1) Start single-cell RNAseq sequencing Day 3 or 4 Continue single(see cell RNAseq sequencing Note 1) Bacterial culture verification

1.1

2

Abbreviations

Method section

4.4 4.5 According to 10 Genomics® manufacturer’s protocols According to 10 Genomics® manufacturer’s protocols 4.6

RT

Room temperature

scRNA-seq

Single-cell RNA sequencing

PBMCs

Peripheral blood mononuclear cells

PBS +/+ PBS /

Phosphate buffered saline, with calcium and magnesium Phosphate buffered saline, without calcium and magnesium

FBS

Fetal bovine serum

RPMI+

RPMI medium+10% FBS+ 1 mM sodium pyruvate

min

Minutes

h

Hours

Materials

2.1 PBMC Isolation from Human Blood Sample

1. Whole blood sample or leukocyte enriched sample. 2. Phosphate buffered saline (PBS) +/+. 3. Lymphoprep™, in RT (Alere Technologies AS). 4. RPMI Medium 1640 with L-Glutamine. 5. Fetal bovine serum (FBS), heat inactivated at 56 C for 30 min. 6. Sodium pyruvate. 7. Freezing tubes (if PBMCs will be frozen). 8. Untreated 96-well round bottom plates. 9. Pipette-controller with slow mode option.

136

Shelly Hen-Avivi and Roi Avraham

10. Live/dead staining (i.e., trypan blue or AO/PI). 11. Cell counter/microscope for counting cells. 12. Centrifuge with acceleration, braking, and cooling options. In case of starting from whole blood sample, the following are also required: 1. Dextran 500 (Spectrum Chemical). 2. Sodium citrate. 3. Citric acid. 4. Bottle top vacuum filter, 0.22 μm pore. 2.2 Monocyte Enrichment

1. Sterile bottle. 2. Percoll. 3. Sterile DDW. 4. 1.6 M NaCl solution, sterile filtered (0.22 μm) 5. PBS +/+. 6. Untreated 6-well flat-bottom plates. 7. Live/dead staining. 8. Cell counter/microscope for counting cells. 9. Centrifuge with acceleration, braking, and cooling options.

2.3

Bacterial Growth

1. LB medium (Lennox). 2. Polyethylene dual-position snap-cap tubes. 3. Incubator with rotator, set to 37  C.

2.4 Bacterial Preparation, PBMC Infection, and Preparation for scRNA-Seq

1. Sterial 1.5 mL Eppendorf tubes. 2. PBS +/+. 3. PBS

/ .

4. Polystyrene transparent cuvettes for OD. 5. LB agar plates+ appropriate antibiotics (if antibiotic is relevant). 6. RPMI+. 7. RPMI+ with 50 μg/mL gentamycin. 8. 5 mM EDTA in PBS / for monocytes

/

for PBMCs, 10 mM EDTA in PBS

9. Cell scraper (for monocytes only). 10. 0.04% BSA (molecular biology grade) in PBS 11. Tip strainer (Flowmi Cell Strainers). 12. Spectrophotometer. 13. Live/dead staining. 14. Cell counter/microscope for counting cells.

/

Studying Human Infection Using scRNA-Seq of Blood Immune Cells

3

137

Methods Important: • All procedures below with PBMCs or monocytes should be performed in biological hood. Ensure that materials brought into the hood are disinfected with 70% ethanol. • Bacterial waste should be decontaminated and treated according to relevant safety instructions.

3.1 PBMC Isolation from Human Blood Sample

3.1.1 Starting from Human Whole Blood Sample

The following protocol is based on a density gradient for isolation of mononuclear cells from peripheral blood. Granulocytes and red blood cells sediment through the Lymphoprep™ layer during centrifugation due to higher density than PBMCs, and PBMCs can be isolated. Importantly, granulocyte do not survive freezing and thawing processes, while PBMCs can be preserved frozen for long time. 1. Prepare 6% Dextran 500 by adding 6 g Dextran 500 to 100 mL prewarmed PBS +/+ (see Note 2). Filter the solution in bottle top vacuum filter. This solution can be kept in 4  C. 2. Prepare Citrate Buffer: add 25 g sodium citrate and 8 g of citric acid into 500 mL PBS +/+. Filter the solution in bottle top vacuum filter. This solution can be kept in 4  C. 3. Prepare RPMI+: RPMI+ 10% FBS+ 1 mM sodium pyruvate. RPMI+ can be kept in 4  C. 4. Prepare 50 mL tubes according to the blood volume that was drawn, one tube per 30 mL blood (see Note 3—expected PBMC number from blood sample). 5. Freshly prepare a mix of Dextran and Citrate Buffer: 5 mL Dextran and 3.5 mL Citrate Buffer per 50 mL tube. Scale up according to the number of tubes. 6. Divide 8.5 mL of the mixed Dextran and Citrate Buffer for each 50 mL tube. 7. Sterilize the IV line connected to the blood bag with 70% ethanol, then cut line to open the blood bag. 8. Pour 30 mL blood into each 50 mL tube (Fig 1a, b). 9. Invert the tubes gently, prevent foaming. 10. Incubate the tubes in RT for 30 min in a hood. 11. After 30 min incubation, two phases should appear in the tubes: plasma and white blood cells (leukocyte fraction) in the upper phase and red blood cells in the lower phase (Fig. 1c).

138

Shelly Hen-Avivi and Roi Avraham

Immune cells from the blood as a window to the immune system Starting from a blood sample

A

Starting from a leukocyte enriched sample

Add Dextran

B

Incubation

C Leukocyte fraction Reb blood cells

Add Lymphoprep

D

E

Leukocyte fraction

For monocyte enrichment

Plasma PBMCs Lymphoprep

Lymphoprep

Granulocytes & red blood cells

F

G

PBMCs fraction

Monocytes enriched fraction

Percoll

Plate PBMCs

Plate monocytes

H

I

96-well plate

6-well plate flat untreated

round untreated

J Grow bacteria

K infect PBMCs/monocytes

L Validate bacteria MOI by CFU

with control bacteria no bacteria

M Prepare samples for scRNA-Seq

Fig. 1 Protocol workflow from blood to scRNA-seq of human immune cells

Studying Human Infection Using scRNA-Seq of Blood Immune Cells

139

12. Using a pipette, transfer each upper phase to a new 50 mL tube. Avoid disturbing the phases, do not transfer the lower phase. 13. Continue to Subheading 3.1.3. 3.1.2 Starting from Human Leukocyte Enriched Fraction

Some blood resources (i.e., hospitals) can provide human leukocyte enriched fractions. This shortens the PBMC extraction time, so if available this is preferred. For this section and the sections below, we will refer to leukocyte enriched fractions as “blood”. 1. Prepare RPMI+ (see Subheading 3.1.1, step 3). 2. Sterilize the IV line connected to the blood bag with 70% ethanol, then cut line and gently squeeze the bag, releasing the blood into 50 mL tube(s). The number of tubes depends on the blood volume in the blood bag. 3. Split the blood to 50 mL tubes with 6 mL each. 4. Add 20 mL PBS +/+ in RT to each tube. Avoid foaming. Mix gently by inverting the tubes. 5. Continue to Subheading 3.1.3.

3.1.3 Lymphoprep Extraction

1. Cool down PBS +/+ and RPMI+ in refrigerator or ice bucket. 2. Using 10 mL pipette, take 12 mL of Lymphoprep, place on the bottom of blood 50 mL tube (from Subheading 3.1.1 or 3.1.2) and slowly remove the pipette from pipettor and allow the Lymphoprep to slowly flow out. Keep the pipette inside the tube until all the tubes are ready with Lymphoprep (see Note 4). Slowly and carefully, remove the pipettes from the tubes, keeping the gradient in the tubes (see Fig. 1d). 3. Transfer the tubes gently to the centrifuge, keeping the gradient in the tubes. 4. Centrifuge at 630  g for 30 min in RT, important: acceleration 1, braking 1 (see Note 5, program 1). After centrifugation, the following layers should appear (from top to bottom): plasma, PBMCs (white interface, “buffy coat”), lymphoprep, and granulocytes + red blood cells (Fig. 1e). 5. Cool the centrifuge to 4  C (see Note 5, program 2). 6. Set the pipette controller to “slow” mode. 7. Using the pipette controller, draw ~10 mL of the upper liquid phase without disturbing the PBMC interphase in bottom of the yellow phase. Discard the liquid. 8. Use pipette to transfer PBMCs (Fig. 1e) into a new 50 mL tube. Combine PBMC fractions from 2 50 mL tubes into 1 50 mL tube (see Note 6).

140

Shelly Hen-Avivi and Roi Avraham

9. Add ice-cold PBS +/+ to the PBMCs up to full 50 mL tube. 10. Spin at 630  g for 15 min at 4  C, acceleration 9, braking 9 (see Note 5, program 2). 11. Remove supernatant, agitate the pellet (see Note 7), combine pellets from 2 tubes into one 50 mL tube. 12. Add ice-cold PBS +/+ to the transferred tube to wash it and maximize cells collection, then transfer the wash to the PBMC tube. If needed add ice-cold PBS +/+ so the PBMCs tube is full. 13. Spin at 630  g for 15 min at 4  C, acceleration 9, braking 9 (see Note 5, program 2). 14. All PBMC pellets can now be pooled together into a single 50 mL tube. 15. When all the cells are concentrated in a single tube, resuspend in ~5 mL of cold RPMI+. 16. Count the cells and estimate the viability using live/dead staining. 17. Carry out the next desired step, (a) To continue with PBMCs for experiment: dilute the cells to 5  106 cells/mL, divide 100 μL (5  105 cells) per well in 96-well untreated round bottom plate (see Note 8 for possible amounts of PBMCs per well). Place the plate in 37  C with 5% CO2 incubator overnight (Fig. 1h, see Notes 9 and 10). (b) For PBMC freezing (see Note 11—cell freezing/thawing). After PBMCs are frozen, they can be thawed when convenient and be used for this protocol, starting at Subheading 3.1.3, step 17a. (c) If monocytes enriched samples are desired, dilute the cells to 50  106 cells/mL and continue to the protocol in Subheading 3.2. 3.2 Monocyte Enrichment

Following PBMC isolation, monocytes can be enriched. The protocol described below is expected to yield ~75% purity and recovery of monocytes from PBMCs. If higher purification and recovery indexes are required, bead-based protocols can be used. Note that bead-based protocols might activate the monocytes and as a result can influence the infection. Therefore, monocyte enrichment as described below is often used. scRNA-seq was successfully implemented for PBMCs, and adaptations for monocytes appear in the protocol below. Monocyte enrichment and infection was tested; however, monocyte sequencing using this protocol and 10 Genomics® should be validated.

Studying Human Infection Using scRNA-Seq of Blood Immune Cells

141

1. Warm PBS +/+ and RPMI+ in 37  C. Cool additional bottle of PBS +/+ to 4  C. 2. Prepare 100 mL of Hyperosmotic Percoll: in a sterile bottle, mix 48.5 mL percoll, 41.5 mL sterile DDW and 10 mL of filtersterile 1.6 M NaCl solution. Scale accordingly to number of samples. 3. For each 3 mL of PBMCs at up to 50  105 cells/mL concentration (see Subheading 3.1.3 step 17c, live and dead cells) 10 mL of hyperosmotic Percoll are required. Scale the volumes up if required. Do not use a higher cell concentration; this will overload the gradient. 4. Prepare 15 mL tubes with 10 mL hyperosmotic percoll solution. 5. Slowly add 3 mL of PBMCs on top of 10 mL hyperosmotic percoll solution by turning (not pressing) the speed dial on pipette controller; this releases the vacuum and causes the samples to gently pour out (Fig. 1f). 6. Spin at 580  g for 15 min at RT, acceleration—1, braking—1 (see Note 5, program 3). 7. Take the interface which contains the monocytes (~6 mL), or up to 8 mL if the interface and lower percoll layer look clear of cells (Fig. 1g, see Note 12). 8. Combine the cells to one 50 mL tube, and add up to 50 mL with ice-cold PBS. 9. Spin at 350  g for 7 min at 4  C, acceleration—9, braking—9 (see Note 5, program 4). 10. Aspirate and discard the supernatant. 11. Resuspend with RPMI+ (see Subheading 3.1.1, see Note 13). 12. Count the cells and estimate viability using live/dead staining. 13. Dilute the cells to 2.5  106 cells/mL and add 2 mL for 5  106 cells/well for a 6-well flat untreated plate (Fig. 1i, see Notes 14 and 15). Incubate the monocytes in 37  C with 5% CO2 incubator for 1 h. 14. After 1 h discard the media, and gently wash wells with warm PBS +/+ to remove nonadherent cells, further enriching the monocyte population. 15. Add 2 mL of RPMI+ per well, incubate at 37  C 5% CO2 incubator overnight (see Note 16).

142

3.3

Shelly Hen-Avivi and Roi Avraham

Bacteria Growth

In the protocol below, the bacteria used for infection are in stationary phase and are grown under aerobic conditions in LB media (see Note 17). 1. Start growing the culture from a glycerol stock or from a single colony grown on LB agar plate supplemented with the appropriate antibiotic (see Note 18). 2. Prepare two dual-position snap-cap tubes with 3 mL LB+ antibiotic each. 3. Inoculate bacteria from glycerol stock/single colony into one of the tubes. The other tube is used as a control to detect if the media or any other step introduced contamination. 4. Place both tubes in a rotator inside 37  C incubator for 16 h. After 16 h, only the tube in which bacteria was inoculated into should become turbid, the control tube should stay clear (Fig. 1j).

3.4 PBMC/Monocyte Infection

1. Transfer 1 mL of the 16 h bacteria culture to new sterile 1.5 mL Eppendorf.

3.4.1 Bacterial Preparation

2. Centrifuge the 1 mL bacteria culture for 1 min, max speed (>10,000  g). 3. Discard the supernatant, resuspend the bacteria pellet with 1 mL of PBS +/+. 4. Measure the optical density of the culture at 600 nm (OD600). (a) Use PBS +/+ as blank for OD600 measurement. (b) Determine the culture OD600 according to the OD read and the dilution that was made (see Note 19). 5. Dilute the bacteria culture according to the desired multiplicity of infection (MOI) and the volume of bacteria that will be used. (a) As a rule of thumb, OD600 of 1 is estimated as 1  109 bacteria/mL, but this should be validated for the bacteria of interest. (b) We usually use MOI of 1 (one bacterium per one cell of PBMCs; to avoid flooding the sample with extracellular bacteria). A recommended volume of bacteria is 10 μL for PBMCs in 96-well plate or 100 μL for monocytes in 6-well plate. Make sure not to add large volume of bacteria as this will dilute the cells medium. For example, for cells in 96-well plate prepare bacteria according to the following. Cells—5  105 cells/well. MOI—1. Volume to use—10 μL. Dilute the bacterial culture in PBS +/+ to 5  107 bacteria/ mL.

Studying Human Infection Using scRNA-Seq of Blood Immune Cells 3.4.2 PBMC/Monocyte Infection

PBMC Infection

143

This protocol aims to explore the intracellular effect of Salmonella Typhimurium on transcriptional responses of human immune cells. Therefore, gentamicin treatment is done to kill extracellular bacteria. If using other baceria, make sure that it is sensitive to the antibiotic and to the used concentration. 1. Prepare RPMI+ with 50 μg/mL gentamicin by adding gentamycin to RPMI+ media to this final concentration. 2. Add 10 μL of PBS +/+ to control uninfected wells. Add 10 μL of diluted bacterial culture to infected wells (Fig. 1k). Keep the bacteria used for infection for verification of the bacterial dilution, see step 11). 3. Using pipette mix the cells+ PBS or bacteria by pipetting five times. 4. Centrifuge the cells at 500  g for 5 min to increase the contact with the bacteria. 5. Incubate the cells in 37  C with 5% CO2 incubator for 30 min for internalization (see Note 20). 6. Centrifuge the cells at 500  g for 5 min, discard the media without disturbing the cells by removing 90% of the media. 7. Resuspend the cells with 150 μL RPMI + with 50 μg/mL gentamicin. 8. Centrifuge the cells at 500  g for 5 min, discard the media without disturbing the cells by removing 90% of the media. 9. Resuspend the cells in 100 μL RPMI + with 50 μg/mL gentamicin. 10. Incubate the PBMCs for the desired time of infection in 37  C with 5% CO2 incubator (see Note 21). 11. While incubating the PBMCs, verify the used bacteria dilution. (a) From the diluted culture used for infection (in Subheading “PBMC Infection,” step 2), prepare a new concentration of 1000 bacteria/mL. Use serial dilutions for accuracy. Dilute the culture in PBS +/+. (b) Plate 100 μL from bacterial dilution of 1000 bacteria/mL on LB+ selective antibiotic plate (if antibiotic is relevant here, Fig. 1l, see Note 22). (c) Incubate the bacteria plate in 37  C incubator overnight (see Note 23).

Adaptations for Monocytes Infection

For infection of monocytes, the following adaptations should be done: (a) Media can be changed with no need for centrifugations. (b) Scale up the volume of media/PBS for 6-well plate.

144

Shelly Hen-Avivi and Roi Avraham

(c) Scale up the volume of bacteria used for infection (without affecting the MOI) for addition to 6-well plate to allow mixing of the bacteria in the media. (d) In steps of resuspension, only add media without mixing the cells as monocytes adhere to the plate. 3.5 Cell Preparation for scRNA-Seq

3.5.1 For PBMCs

PBMCs were successfully sequenced using 10x Genomics® applying the protocol below. Additionally, we present here adaptations that are expected to fit for 10x Genomics® sequencing of monocytes; however, this should be validated. 1. After incubation for the relevant time: centrifuge the cells at 500  g for 5 min, discard the media without disturbing the cells by removing 90% of the media. 2. Resuspend the cells in 150 μL PBS

/ .

3. Centrifuge the cells at 500  g for 5 min, discard the PBS without disturbing the cells by removing 90% of the PBS / . 4. Add 120 μL of 5 mM EDTA (in PBS times (see Note 24).

/ ), gently pipette five

5. Incubate the cells for 5 min in RT. 6. Gently pipette for additional five times. 7. Centrifuge the cells at 500  g for 5 min, discard the EDTA without disturbing the cells by removing 90% of the supernatant. 8. Resuspend the cells in 150 μL of 0.04% BSA in PBS / . From now on keep the cells on ice and work as quickly as possible to keep the cells viable and in good condition for 10 scRNA-seq. 9. Filter the cells using a tip strainer into a new Eppendorf tube. 10. Count the cells and estimate viability using live/dead staining (see Note 25). 11. Adjust cell concentration according to 10 Genomics® manufacturer protocols with 0.04% BSA in PBS / . 12. Use the cells immediately for 10x Genomics® Single Cell Protocol (Fig. 1m). 3.5.2 Suggested Adaptations for Monocytes Only

(a) Media can be changed with no need for centrifugations. (b) Scale up the volume of media/PBS for 6-well plate. (c) For detaching the cells from the plate, carry out the following. • Use 10 mM EDTA, incubate for 10 min on ice. • Scrape the cells with a scraper and collect to Eppendorf tubes.

Studying Human Infection Using scRNA-Seq of Blood Immune Cells

145

• Centrifuge the cells at 500  g for 5 min, discard the EDTA without disturbing the cells. • Resuspend the cells in 500 μL of 0.04% BSA in PBS 3.6 Bacterial Culture Verification

4

/ .

After overnight incubation, count the colonies of the plated bacteria from Subheading “PBMC Infection,” step 11. This should verify the used MOI for the experiment.

Notes 1. From “Preparation for single-cell sequencing” and onward: can be done at the day of infection or the day after, depending on the time postinfection that is required for scRNA-seq. 2. Dextran does not dissolve easily; vortexing and shaking the mixture are required to get everything dissolved. 3. Expected PBMCs yield from healthy adult donor is (0.8 to 3.2)  106 cells from 1 mL of blood. 4. Be careful when using 10 mL pipette with 12 mL volume, as it is close to the pipette physical limit. It is important here as the release of the Lymphoprep in 10 mL pipette creates less turbulence than in larger one. 5. Centrifuge programs: Program 1

630  g

30 min

RT

Acceleration—1

Braking—1

Program 2

630  g

15 min

4 C

Acceleration—9

Braking—9

Program 3

580  g

15 min

RT

Acceleration—1

Braking—1



Acceleration—9

Braking—9

Program 4

350  g

7 min

4 C

6. Do not take the cells that are stuck to tube walls. Avoid taking the Lymphoprep layer beneath the buffy coat. It is OK to take some yellow upper phase. 7. Agitating the pellet breaks it and does not harm the cells. 8. If plenty of PBMCs are available, it is convenient to work with 5  106 cells/mL and take 100 μL for 5  105 cells/well in 96-well untreated round bottom plate. However, if PBMCs amount is limited, the number can be reduced to 1  105 cells/ well. Less than this number of cells is not recommended as it is difficult to see the cells pellet in centrifugations steps. 9. PBMCs contain nonadherent cells as well as adherent cells. Therefore, centrifugation is required in order to change media or wash the cells, and round bottom untreated dishes are therefore used.

146

Shelly Hen-Avivi and Roi Avraham

10. Incubation of the PBMCs overnight will let the cells rest before the infection. This is important especially when defrosted cells are used, and reduces the stress response from the extraction or defrost procedures. 11. Cell freezing/thawing is done following a protocol recommended for 10 genomics: “Fresh Frozen Human Peripheral Blood Mononuclear Cells for Single Cell RNA Sequencing” (https://support.10xgenomics.com/single-cell-gene-expres sion/sample-prep/doc/demonstrated-protocol-fresh-fro zen-human-peripheral-blood-mononuclear-cells-for-singlecell-rna-sequencing). 12. Collecting small amount of the Percoll layer will not damage the monocyte enrichment. 13. Start from low RPMI+ volume and adjust according to the number of cells in the sample. 14. Monocytes are plated here on 6-well plate in order to enable scraping of the cells before scRNA-seq (see Subheading 3.5). Monocytes will adhere also to untreated plate, and detaching them will be easier than from treated plate. 15. Monocytes are sensitive, so freezing and defrosting of monocytes is not recommended. 16. If the enrichened monocytes will be kept for longer than 48 h or will be differentiated, use human male AB+ serum instead of FBS at this step, this helps to keep the monocytes viable. 17. In the described protocol, the bacteria are grown to stationary phase and under aerobic conditions. Stationary phase is considered as less pathogenic for Salmonella Typhimurium infection, as SPI-1 genes are lowly expressed under stationary conditions and therefore more host cells survive. Dual-position snap-cap tubes and rotator are used for aeration and nutrient distribution in the solution. Other growth stages or conditions might be considered according to the study goals, for example shaking instead of rotating, tightly closed tubes instead of Dual-position snap-cap tubes, temperature other than 37  C for growing the bacteria, and different media than LB. 18. Using antibiotic which the bacteria is resistant for will help to avoid contaminations; however, it is possible to work without antibiotics at all. 19. Usually 10–20 dilution will be sufficient for being in the spectrophotometer linear range. Dilute only for the measurement, do not dilute the whole bacteria culture. 20. The time of internalization can be modified according to the used bacteria for infection.

Studying Human Infection Using scRNA-Seq of Blood Immune Cells

147

21. Make sure that the PBMCs survive the desired time of incubation (including the resting time after extraction or defrost, see Subheading 3.1.3, step 17a), and there is no general or celltype specific cell death. Four to eight hours of incubation after infection with Salmonella Typhimurium were tested and sequenced successfully. 22. 100 μL should contain 100 bacteria. 23. This step is important for verification of the bacterial culture used for infection. This will reflect the real number of bacteria that was used and therefore the real MOI. This step is crucial when comparing infection with two different bacteria or more, in order to make sure that the same MOI was used. If the colonies number is different than expected, this should be taken into consideration. 24. This detaches cells that adhered to the plate. 25. For single-cell RNA-seq using 10 genomics ® both live and dead cells need to be considered; therefore, high viability is important. References 1. Arpaia N, Godec J, Lau L et al (2011) TLR signaling is required for salmonella typhimurium virulence. Cell 144:675–688. https://doi.org/ 10.1016/j.cell.2011.01.031 2. Hagar JA, Powell DA, Aachoui Y et al (2013) Cytoplasmic LPS activates caspase-11: implications in TLR4-independent endotoxic shock. Science 341:1250–1253. https://doi.org/10. 1126/science.1240988 3. Zanoni I, Ostuni R, Marek LR et al (2011) CD14 controls the LPS-induced endocytosis of toll-like receptor 4. Cell 147:868–880. https:// doi.org/10.1016/j.cell.2011.09.051 4. Woodward JJ, Iavarone AT, Portnoy DA (2010) C-di-AMP secreted by intracellular listeria monocytogenes activates a host type I interferon response. Science 328:1703–1705. https://doi. org/10.1126/science.1189801 5. Lam GY, Cemma M, Muise AM et al (2013) Host and bacterial factors that regulate LC3 recruitment to listeria monocytogenes during the early stages of macrophage infection.

Autophagy 9:985–995. https://doi.org/10. 4161/auto.24406 6. Bossel Ben-Moshe N, Hen-Avivi S, Levitin N et al (2019) Predicting bacterial infection outcomes using single cell RNA-sequencing analysis of human immune cells. Nat Commun 10:3266. https://doi.org/10.1038/s41467-01911257-y 7. Avraham R, Haseley N, Brown D et al (2015) Pathogen cell-to-cell variability drives heterogeneity in host immune responses. Cell 162:1309– 1321. https://doi.org/10.1016/j.cell.2015. 08.027 8. Shi C, Pamer EG (2011) Monocyte recruitment during infection and inflammation. Nat Rev Immunol 11:762–774. https://doi.org/10. 1038/nri3070 9. Nduati EW, Ng DHL, Ndungu FM et al (2010) Distinct kinetics of memory B-cell and plasmacell responses in peripheral blood following a blood-stage plasmodium chabaudi infection in mice. PLoS One 5:e15007. https://doi.org/ 10.1371/journal.pone.0015007

Chapter 13 Salmonella enterica Infection of Human and Mouse Colon Organoid-Derived Monolayers Erin C. Boyle, Eva J. Wunschel, and Guntram A. Grassl Abstract Intestinal epithelial organoids reflect the morphology and function of an in vivo epithelial barrier. The composition of epithelial cell types reflects the cellular composition of the original tissue (small or large intestine) and organoids can be grown from different species. Thus, intestinal organoids constitute an ideal model to investigate infections of different hosts with enteric pathogens. In this chapter, we will focus on Salmonella infection of human and mouse colonoids grown in a 2D monolayer on permeable filter supports. Key words Salmonella, Infection, Intestinal epithelial cells, Organoids, Colonoids, Cell culture, In vitro model, Host–pathogen interaction

1

Introduction The intestinal epithelium is the first barrier against infections with enteric pathogens such as Salmonella. In order to cause disease, Salmonella adheres to and invades intestinal epithelial cells (IECs) and disrupts cell–cell junctions. Thus, Salmonella employs both transcellular and paracellular mechanisms in order to overcome the barrier function of the intestinal epithelium. By studying the interaction of Salmonella with IECs, key insights into its pathogenesis can be gained. Tissue culture cell lines have been extensively used to investigate Salmonella infection of epithelial cells. However, cell lines contain only a single cell type and are typically cancerous or immortalized. Accordingly, they often produce different cellular responses to external stimuli than primary cells [1, 2]. Intestinal organoids are “mini-guts” derived from either adult stem cells or from induced pluripotent stem cells [3, 4]. Organoid technology now offers the unique opportunity to cultivate a complex primary epithelium in vitro. For this purpose, whole crypts or epithelial stem cells can

Ohad Gal-Mor (ed.), Bacterial Virulence: Methods and Protocols, Methods in Molecular Biology, vol. 2427, https://doi.org/10.1007/978-1-0716-1971-1_13, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022

149

150

Erin C. Boyle et al.

be isolated from different sections of the intestine. The resulting three-dimensional (3D) organoids are cultivated in a drop of Matrigel™ and have the crypt–villus architecture and cellular composition of the original tissue [5, 6] (Fig. 1). All major IEC types are present including stem cells, transit-amplifying cells, Paneth cells, mucus-producing goblet cells, enteroendocrine cells, and absorptive enterocytes. Even rare cell populations such as M cells or Tuft cells can be present or induced [7]. Thus, intestinal organoids cultivated from primary cells and containing the entire range of epithelial cell types reflect the in vivo situation much better than cell lines. Organoid culture is more flexible than ex vivo culture of primary tissue as they can be expanded, frozen, thawed, and grown in long-term culture [8]. Because they structurally and functionally recapitulate the normal physiology and pathophysiology of the intestinal epithelium, organoids represent important models of human disease. In some cases, organoids can be used as an alternative to animal experimentation. Increasingly, intestinal organoids are being used to investigate the complex interactions of enteropathogens with the host epithelium including the mucus produced by goblet cells. The range of genetically modified mouse strains facilitates the investigation of host factors important for infection. On the other hand, human-derived organoids have the advantage of better modeling infections of human patients. Moreover, human organoids are especially useful to study infection of host-restricted serovars like S. enterica serovar Typhi. The apical side of IECs in 3D organoids faces inward into the organoid lumen. Thus, to access the apical surface for infection experiments, 3D organoids can be disrupted, seeded on permeable filter inserts, and cultivated in two-dimensional (2D) monolayers [9]. Here, we describe the isolation and cultivation of colon organoids (colonoids) grown from adult stem cells from mouse and human tissues, their cultivation and differentiation in 2D monolayers, and their use to elucidate mechanisms of Salmonella infection (Fig. 2).

2

Materials

2.1 Collection of LWRN-Conditioned Medium

1. Solutions should be sterile and prepared using ultrapure deionized water. A 37
C, 5% CO2 incubator is needed to grow cells/organoids and a light microscope is required to visualize them. 2. L-WRN cells (ATCC® CRL-3276™) (see Note 1). 3. L-WRN culture medium: Dulbecco’s Modified Eagle Medium (DMEM) containing GlutaMAX™-I, 4.5 g/L D-glucose, 1 mM pyruvate, and 10% heat-inactivated fetal bovine serum

Salmonella Infection of Colon Monolayers

151

Fig. 1 Colonoids growing in Matrigel™. Human and mouse colonoids were passaged and photographs were taken 4 h after splitting (d0) or on day 3, 5, or 7 after splitting, as indicated. Original magnification: 100. Scale bar: 100 μm

Fig. 2 Differentiated human colonoid-derived 2D monolayer. 1  105 cells were seeded on a Transwell membrane filter insert and grown for 11 days in expansion medium. Medium was changed to differentiation medium and grown for 2 more days prior to infection with S. Typhimurium. Cells were fixed with PFA and stained with antibodies against villin, E-cadherin, Salmonella LPS, or with the lectin WGA. Original magnification: 630. Scale bar: 10 μm

(FBS). When antibiotics are called for, add 0.5 mg/mL G-418 and 0.5 mg/mL hygromycin B. 4. 0.05% trypsin–ethylenediaminetetraacetic acid (EDTA). 5. Sterile Dulbecco’s phosphate-buffered saline without calcium or magnesium (PBS/). 6. Cooling, low speed, tabletop centrifuge. 7. Flasks (T75, T175). 8. 15 and 50 mL conical polypropylene tubes. 9. Water bath set to 37
C. 2.2 Isolation of Colon Crypts from Mouse Tissue

1. 70% ethanol made in water. 2. Mouse colon (approx. 0.5–1 cm2) (see Note 2). 3. Sterile 10 cm petri dishes.

152

Erin C. Boyle et al.

4. Sterile, ice-cold PBS/. 5. Sterile, ice-cold crypt chelation buffer: 10 mM EDTA in PBS/. 6. Mouse organoid medium. l

DMEM/F12 supplemented with 2 mM GlutaMAX™-I

l

50% LWRN-conditioned supernatant

l

10 mM HEPES piperazineethanesulfonic acid]

l

1 B-27 supplement

l

50 ng/mL recombinant mouse epidermal growth factor (rm-EGF)

l

1 mM N-acetyl-L-cysteine

l

10 μM Y-27623

l

100 U/mL penicillin

l

100 μg/mL streptomycin.

[4-(2-hydroxyethyl)-1-

7. Growth factor-reduced, phenol red-free Matrigel™ (see Note 3). 8. Sterile tissue forceps and surgical scissors. 9. 10 mL sterile plastic syringe with an 18G needle. 10. 15 and 50 mL conical polypropylene tubes. 11. 24-well tissue culture plate. 12. Cooling, low-speed, tabletop centrifuge. 13. Ice bucket. 14. Orbital shaker. 2.3 Isolation of Colon Crypts from Human Tissue

1. Human colon tissue (approx. 0.5–1 cm2) (see Note 4). 2. Sterile 10 cm petri dishes. 3. Sterile, ice-cold PBS/. 4. Sterile, ice-cold crypt chelation buffer: 10 mM EDTA in PBS/. 5. Human organoid medium. l

DMEM/F12 supplemented with 2 mM GlutaMAX™-I

l

50% LWRN-conditioned supernatant

l

10 mM HEPES

l

1 B-27 supplement

l

50 ng/mL rm-EGF

l

1 mM N-acetyl-L-cysteine

l

10 μM Y-27623

l

100 U/mL penicillin

Salmonella Infection of Colon Monolayers l

100 μg/mL streptomycin

l

500 nM A83–01

l

10 μM SB202190

l

10 nM Gastrin I.

153

6. Growth factor-reduced, phenol red-free Matrigel™ (see Note 3). 7. Sterile tissue forceps and surgical scissors. 8. 10 mL sterile plastic syringe with an 18G needle. 9. 15 and 50 mL conical polypropylene tubes. 10. 24-well tissue culture plate. 11. Cooling, low speed, tabletop centrifuge. 12. Ice bucket. 13. Orbital shaker. 2.4 Passaging Colon Organoids

1. Sterile, ice-cold PBS/. 2. Growth factor-reduced, phenol red-free Matrigel™ (see Note 3). 3. Cooling, low speed, tabletop centrifuge. 4. Ice bucket. 5. 15 mL conical polypropylene tubes. 6. Mouse or human organoid medium (see Subheading 2.2 or 2.3).

2.5 Generating 2D Colon Epithelial Cell Monolayers

1. Growth factor-reduced, phenol red-free Matrigel™ (see Note 3). 2. 0.05% (w/v) trypsin–EDTA. 3. Ice-cold DMEM with 10% FBS. 4. Monolayer medium. l

DMEM/F-12

l

50% L-WRN supernatant

l

20% FBS

l

2 mM L-glutamine

l

100 U/mL penicillin

l

100 μg/mL streptomycin

l

10 μM Y-27632

l

50 ng/mL rm-EGF.

5. Differentiation medium: l

DMEM/F-12

l

5% L-WRN supernatant

154

Erin C. Boyle et al. l

20% FBS

l

2 mM L-glutamine

l

50 ng/mL rm-EGF

l

5 μM DAPT

6. Hemocytometer. 7. Sterile, ice-cold PBS/. 8. Transwell inserts: 6.5 mm diameter, 0.4 μm or 3.0 μm pores, polyester membrane. 9. Cooling, low speed, tabletop centrifuge. 10. Ice bucket. 11. 15 mL conical polypropylene tubes. 12. Water bath at 37
C. 13. Volt-ohm-meter (EVOM2) with chopstick electrode SFX2. 2.6 S. enterica Infection of 2D Colon Epithelial Cell Monolayers

1. Lysogeny broth (LB). 2. LB supplemented with the appropriate antibiotics for the bacterial strains used. 3. LB agar plates with the appropriate antibiotics for the bacterial strains used. 4. Sterile PBS with calcium and magnesium (PBS+/+). 5. Shaking incubator at 37
C. 6. Plate incubator at 37
C. 7. Sterile test tube with vented cap. 8. Infection medium: l

DMEM/F-12.

l

20% FBS

l

2 mM L-glutamine.

9. Volt-ohm-meter. 10. Spectrometer. 11. Refrigerated benchtop centrifuge. 2.7 Quantifying S. enterica Adherence and Invasion of 2D Colonoids Using the Gentamicin Protection Assay

1. Sterile PBS+/+. 2. Infection medium (see Subheading 2.6) containing 100 μg/uL gentamicin. 3. Water bath at 37
C. 4. Lysis buffer: PBS containing 1% Triton X-100 and 0.1% SDS.

Salmonella Infection of Colon Monolayers

155

5. LB agar plates with antibiotics appropriate for the S. enterica strain. 6. Plate incubator at 37
C.

3

Methods

3.1 Collection of L-WRN–Conditioned Medium

1. Cool the tabletop centrifuge to 4
C. Set the water bath to 37
C and prewarm the L-WRN culture medium. 2. Thaw vial of L-WRN cells in the 37
C water bath. Once thawed, immediately add cells to a 15 mL conical tube filled with 13 mL prewarmed L-WRN culture medium. 3. Spin cells down at 400  g for 10 min at 4
C. Discard supernatant. 4. Resuspend cells in 1 mL culture medium with antibiotics and transfer to a T75 flask with 14 mL culture medium with antibiotics. 5. Incubate cells until confluent. 6. From this point forward, use culture medium without antibiotics. 7. Discard supernatant and wash adherent cells twice gently with 12 mL PBS/. Discard washes. Cover cells with 1 mL prewarmed trypsin–EDTA and incubate at 37
C until cells are dislodged (approximately 3–5 min). Add 9 mL culture medium. 8. Spin down cells at 400  g for 10 min at 4
C. Discard supernatant. 9. Resuspend cells in 10 mL of fresh culture medium. 10. Add 2 mL of the cell suspension to five separate T175 flasks. 11. Add 23 mL of culture medium to each flask. 12. Incubate cells until confluent (3–4 days). Remove medium and gently rinse adherent cells with 10 mL culture medium. Discard this wash solution. 13. Add 25 mL fresh culture medium and incubate for 48 h. The supernatant is now considered “conditioned medium.” 14. Collect the conditioned medium in 50 mL conical tubes. Replace with 25 mL fresh medium and incubate the cells for another 48 h. 15. Centrifuge the conditioned medium at 500  g for 10 min at 4
C to pellet cellular debris. 16. Collect the supernatant in a T175 flask, standing upright. Store at 4
C until collection period is over.

156

Erin C. Boyle et al.

17. Collect conditioned medium a total of six times, pooling all supernatants in one T175 flask. 18. Aliquot (e.g., 30 mL) conditioned medium and store at 20
C (see Note 5). 3.2 Isolation of Colon Crypts from Mouse Tissue

1. Prepare all reagents before beginning the isolation procedure and keep them on ice. Cool centrifuge to 4
C. Preincubate a 24-well plate at 37
C. 2. Prepare fresh chelation buffer (10 mM EDTA in ice-cold PBS/) from a 0.5 M stock of EDTA (pH 8.0). 3. Euthanize a mouse. 4. Lay mouse on paper towels and wet abdomen with 70% ethanol to sterilize. 5. Open the abdominal cavity and locate the terminal colon. Grasp the rectum with forceps and cut distally with scissors. To dissect out the colon, gently pull out the intestines while still grasping the rectum and make another cut 0.5 cm from the cecum. Transfer the colon into a petri dish containing approximately 15 mL cold PBS/. Everything from here until step 17 should be done on ice with ice-cold solutions. 6. Carefully remove mesentery with scissors, being careful not to perforate the colon. 7. Flush the colon with ice-cold PBS/ using an 18G needle mounted on a 10 mL syringe. Place the needle into the lumen and flush until fecal matter is removed. Transfer the rinsed colon into a new petri dish containing cold PBS/ on ice. 8. Open the colon lengthwise with scissors. Cut into 1 cm pieces and with forceps, transfer into a 15 mL conical tube filled with 5 mL ice-cold PBS/. 9. Invert the tube three times, let the tissue pieces settle, and remove the supernatant. Add 5 mL of ice-cold PBS/. Repeat this washing procedure two more times. 10. After the last wash, add 5 mL ice-cold PBS/ to the tissue fragments and pour into sterile petri dish on ice. Cut colon into 10 cells)). The presence of infiltrating neutrophils is quantified by 0–2 (0: absent – 1: moderate – 2: severe). The amount of submucosal edema is quantified by

210

Katrin Ehrhardt and Guntram A. Grassl

Fig. 3 Histopathological changes of the cecum in acute Salmonella induced colitis. Mice were treated with a single dose of streptomycin (20 mg/mouse) and 24 h later infected with S. Typhimurium SL1344 (3  106 bacteria/mouse). Mice were euthanized at day 1 or day 4 postinfection. Note: uninfected mice have a large, fecesfilled cecum and defined fecal pellets in the colon. Upon infection, the cecum shrinks and appears white as it contains less fecal matter and more inflammatory cells and dead epithelial cells. Cecum tissue was formalinfixed and embedded in paraffin. 3 μm sections were stained with H&E. Note: lumen is filled with fecal matter in sections from control mice, while there are dead epithelial cells and immune cells in the cecal lumen of infected mice. At 20 magnification submucosal edema (e) and mucosal hyperplasia are clearly visible. At 100 magnification epithelial desquamation (d), crypt abscess formation (a) and ulceration (u) become apparent. Note that gross morphology and extent of histopathological changes depend on several factors including the Salmonella serovar used for infection, the dose of infection, the genetic background of mice and the resident microbiota. Scale bars at 20 original magnification: 500 μm. Scale bars at 100 original magnification: 100 μm. L lumen, M mucosa, MP muscularis propria, SM submucosa

0–2 (0: absent – 1: moderate (10–80% of mucosa) – 2: severe (>80% of mucosa)).

4

Notes 1. Because the microbiota can influence the colonization efficiency of Salmonella and Salmonella-induced inflammation, it is crucial to use littermates. In addition, mice need to be matched by age and gender. 2. For S. Typhimurium, an OD600 ¼ 1 approximately corresponds to a concentration of 1  109 bacteria/ml. If desired, subculture a 1:30 dilution of the ON culture of S. Typhimurium in fresh LB and grow for 3 h to mid-logarithmic phase for increased invasiveness.

Salmonella-Induced Murine Colitis Model

211

3. The microbiota composition can be analyzed (e.g., by 16S RNA sequencing) from a fresh fecal pelleted collected and flash-frozen or stored in 500 μl RNAlater at
20  C. 4. Be aware that fecal pellets can contain high concentrations of Salmonella and the equipment (e.g., box for weighing, tweezers) needs to be disinfected after contact with the feces. 5. Using a 2 ml safelock tube facilitates a homogeneous mechanical homogenization with the stainless-steel bead (see Subheading 3.5.2). 6. Use a tip with a large orifice for pipetting of viscous solutions like feces or organ homogenates. 7. Using antibiotics is important to ensure that only Salmonella is growing and quantified. 8. Do not damage the surface of the agar with the pipette tips during plating as this would make enumeration of colonies difficult. 9. LB agar plates can be pre-dried half-opened in a sterile bench for 20–30 min. The plated bacterial solution dries faster on pre-dried plates. 10. Other inflammation markers such as calprotectin and cytokines/chemokines can be quantified from the supernatant as well. 11. Per mouse one histological chamber for intestinal organs and one for systemic organs are used. It is important to collect pieces from the same tissue locations from each mouse for comparability. 12. Instruments are disinfected and cleaned between steps in 70% ethanol and sterile PBS. 13. (a) If desired, take an additional 3 mm long piece of tissues for RNA isolation (e.g., cecum, colon, ileum). Remove the content and store the tissue in RNAlater at
20  C until further processing. RNA isolation and quantitative reverse transcription-PCR (qRT-PCR) are not described in this paper. (b) If desired, the bacterial load can be quantified separately for the content (luminal Salmonella) and for adherent and intracellular bacteria in the tissue: squeeze the content of ileum, cecum, or colon into a tube (with PBS and stainless-steel bead), place the tissue into another tube (with 1 ml PBS), and cut the tissue into pieces. To remove nonadherent luminal bacteria from the tissue, wash tissue multiple times with cold PBS. Transfer tissue to a tube with 1 ml PBS and a stainlesssteel bead. Homogenize with the Qiagen TissueLyser II: the content is homogenized for 5 min and the tissue is homogenized two times for 8–10 min at 30 Hz and the samples are cooled in between for 5 min. Homogenates are plated for the

212

Katrin Ehrhardt and Guntram A. Grassl

quantification of the bacterial load as described above (Subheading 3.7, step 3). Optionally, the inflammation marker Lcn2 can be quantified in the homogenates of ileum, cecum and colon contents (see Subheading 3.5.3). 14. In addition to H&E staining, a number of further staining methods can be performed (e.g., immunostainings using specific antibodies to Salmonella and/or immune cell populations to analyze bacterial localization, immune cell infiltration). 15. Examine each category with different magnifications of the microscope (40–400) to get an overview and detailed information of pathological changes. 16. Pathology scoring should be done with samples blinded to the observer and performed by two independent pathologists. 17. Desquamation means epithelial cell shedding into the lumen. Ulceration is the loss of the epithelium often accompanied by migration of immune cell and/or erythrocytes from the underlying tissue into the lumen.

Acknowledgments GAG is supported by the Deutsche Forschungsgemeinschaft (DFG) priority program SPP1656/2, the German Federal Ministry of Education and Research (BMBF) Infect-ERA consortium grant 031L0093B and DFG collaborative research center SFB 900 TP08 (Project number 158989968). Ethics statement: Images in Fig. 3 were obtained in animal experiments that were performed in accordance with the German Animal Protection Law and were approved by the Animal Research Ethics Board of the Ministry of Environment, Kiel, Germany (approval # V312–7224.123-3). References 1. Gal-Mor O (2018) Persistent infection and long-term carriage of typhoidal and nontyphoidal Salmonellae. Clin Microbiol Rev 32(1):e00088–e00018 2. Grassl GA, Finlay BB (2008) Pathogenesis of enteric salmonella infections. Curr Opin Gastroenterol 24:22–26 3. Barthel M, Hapfelmeier S, Quintanilla-Martı´nez L et al (2003) Pretreatment of mice with streptomycin provides a salmonella enterica serovar typhimurium colitis model that allows analysis of both pathogen and host. Infect Immun 71:2839–2858 4. Bohnhoff M, Drake BL, Miller CP (1954) Effect of streptomycin on susceptibility of

intestinal tract to experimental salmonella infection. Proc Soc Exp Biol Med 86:132–137 5. Hurley D, McCusker MP, Fanning S et al (2014) Salmonella-host interactions - modulation of the host innate immune system. Front Immunol 5:1–11 6. Gogoi M, Shreenivas MM, Chakravortty D (2019) Hoodwinking the big-eater to prosper: the salmonella -macrophage paradigm. J Innate Immun 11:289–299 7. Kaiser P, Diard M, Stecher B, et al (2012) The streptomycin mouse model for Salmonella diarrhea: functional analysis of the microbiota, the pathogen’s virulence factors, and the host’s mucosal immune response. Immunol Rev. 245

Salmonella-Induced Murine Colitis Model (1):56-83. https://doi.org/10.1111/j.1600065X.2011.01070.x 8. Eckmann L, Kagnoff MF (2001) Cytokines in host defense against salmonella. Microbes Infect 3:1191–1200 9. Behnsen J, Perez-Lopez A, Nuccio SP et al (2015) Exploiting host immunity: the salmonella paradigm. Trends Immunol 36:112–120 10. Ehrhardt K, Steck N, Kappelhoff R et al (2019) Persistent salmonella enterica serovar typhimurium infection induces protease expression during intestinal fibrosis. Inflamm Bowel Dis 25:1629–1643 11. Grassl GA, Valdez Y, Bergstrom KSB et al (2008) Chronic enteric salmonella infection in mice leads to severe and persistent intestinal fibrosis. Gastroenterology 134:768–780 12. Stecher B, Paesold G, Barthel M et al (2006) Chronic salmonella enterica serovar typhimurium-induced colitis and cholangitis in streptomycin-pretreated Nramp1+/+ mice. Infect Immun 74:5047–5057 13. Vidal S, Tremblay ML, Govoni G et al (1995) The ity/lsh/bcg locus: natural resistance to infection with intracellular parasites is abrogated by disruption of the nrampl gene. J Exp Med 182:655–666 14. Cunrath O, Bumann D (2019) Host resistance factor SLC11A1 restricts Salmonella growth through magnesium deprivation. Science. 366 (6468):995–999. https://doi.org/10.1126/ science.aax7898 15. Valdez Y, Diehl GE, Vallance BA et al (2008) Nramp1 expression by dendritic cells modulates inflammatory responses during salmonella typhimurium infection. Cell Microbiol 10: 1646–1661 16. Valdez Y, Grassl GA, Guttman JA et al (2009) Nramp1 drives an accelerated inflammatory

213

response during salmonella -induced colitis in mice. Cell Microbiol 11:351–362 17. Hapfelmeier S, Hardt WD (2005) A mouse model for S. typhimurium-induced enterocolitis. Trends Microbiol 13(10):497–503 18. Monack DM, Bouley DM, Falkow S (2004) Salmonella typhimurium persists within macrophages in the mesenteric lymph nodes of chronically infected Nramp1+/+ mice and can be reactivated by IFNγ neutralization. J Exp Med 199:231–241 19. Stecher B, Hardt WD (2011) Mechanisms controlling pathogen colonization of the gut. Curr Opin Microbiol 14:82–91 20. Woo H, Okamoto S, Guiney D et al (2008) A model of salmonella colitis with features of diarrhea in SLC11A1 wild-type mice. PLoS One 3:e1603 21. Sekirov I, Tam NM, Jogova M et al (2008) Antibiotic-induced perturbations of the intestinal microbiota alter host susceptibility to enteric infection. Infect Immun 76:4726– 4736 22. Stecher B, Robbiani R, Walker AW et al (2007) Salmonella enterica serovar typhimurium exploits inflammation to compete with the intestinal microbiota. PLoS Biol 5:2177–2189 23. Ferreira RBR, Gill N, Willing BP et al (2011) The intestinal microbiota plays a role in salmonella-induced colitis independent of pathogen colonization. PLoS One 6:e20338 24. Wu S, Lu R, Zhang Y-g et al (2010) Chronic salmonella infected mouse model. J Vis Exp 39: 1947 25. Lo BC, Shin SB, Messing M et al (2019) Chronic salmonella infection induced intestinal fibrosis. J Vis Exp 2019:1–7

Chapter 18 Analysis of Salmonella Typhi Pathogenesis in a Humanized Mouse Model Taylor A. Stepien, Stephen J. Libby, Joyce E. Karlinsey, Michael A. Brehm, Dale L. Greiner, Leonard D. Shultz, Thea Brabb, and Ferric C. Fang Abstract Efforts to understand molecular mechanisms of pathogenesis of the human-restricted pathogen Salmonella enterica serovar Typhi, the causative agent of typhoid fever, have been hampered by the lack of a tractable small animal model. This obstacle has been surmounted by a humanized mouse model in which genetically modified mice are engrafted with purified CD34+ stem cells from human umbilical cord blood, designated CD34+ Hu-NSG (formerly hu-SRC-SCID) mice. We have shown that these mice develop a lethal systemic infection with S. Typhi that is dependent on the presence of engrafted human hematopoietic cells. Immunological and pathological features of human typhoid are recapitulated in this model, which has been successfully employed for the identification of bacterial genetic determinants of S. Typhi virulence. Here we describe the methods used to infect CD34+ Hu-NSG mice with S. Typhi in humanized mice and to construct and analyze a transposon-directed insertion site sequencing S. Typhi library, and provide general considerations for the use of humanized mice for the study of a human-restricted pathogen. Key words Humanized, Enteric fever, Typhoid, Pathogenesis, TraDIS

1

Introduction Salmonella enterica serovar Typhi, the primary causative agent of enteric fever, is responsible for approximately 15 million infections and 200,000 deaths each year [1]. Efforts to understand the molecular mechanisms of S. Typhi virulence have relied extensively on the murine model of infection with the related serovar S. Typhimurium, a versatile pathogen capable of causing systemic infections in a variety of hosts including humans, mice, swine, chickens, and cattle [2]. In contrast, Salmonella Typhi selectively causes disease in humans, despite close genomic relatedness to S. Typhimurium [3]. Detailed comparisons have identified specific genetic differences between S. Typhi and S. Typhimurium and other nontyphoidal Salmonella serotypes [3–5]. However, the lack of a small animal

Ohad Gal-Mor (ed.), Bacterial Virulence: Methods and Protocols, Methods in Molecular Biology, vol. 2427, https://doi.org/10.1007/978-1-0716-1971-1_18, © The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022

215

216

Taylor A. Stepien et al.

model for S. Typhi has prevented the functional determination of genetic loci essential for S. Typhi virulence. Our laboratory has developed a model using mice carrying human hematopoietic cells, which are capable of sustaining a progressive systemic infection with S. Typhi. This has allowed the performance of highthroughput screening of transposon libraries to identify genetic factors important for S. Typhi virulence. Humanized mice are constructed in immunodeficient genetic backgrounds, reducing the background presence of murine immune cells and allowing their replacement with engrafted human cells. A combination of the severe combined immunodeficiency (scid) mutation and nonobese diabetic (NOD) strain background results in the absence of murine T and B cells and reduced activity of NK cells [6–9]. Knockout of the IL-2 receptor common γ-chain impairs the murine cell response to IL-2, IL-4, IL-7, IL-9, and IL-15, leading to an absence of NK cells and superior human hematopoietic stem cell (HSC) engraftment [10, 11]. Although severely immunocompromised, NOD-scidIL2rɣnull (NSG) mice remain completely resistant to infection with S. Typhi in the absence of engrafted cells [12]. The NSG mouse is now widely used as a preferred background on which to engraft HSC and peripheral blood mononuclear cells (PBMC), as well as other normal or malignant human cell populations. Engraftment of immunodeficient mouse strains to generate CD34+Hu-NSG mice can be performed with human umbilical cord blood HSC, bone marrow, or mobilized HSC, and can also include transplantation of human fetal liver and thymus under the kidney capsule (BLT mice) [13]. Additional modifications to the NSG genetic background have been developed to improve engraftment and reduce graftversus-host disease (GvHD) (see Jackson Laboratory website) [14]. In 2010, two laboratories reported the use of Rag2
/-IL2rɣ
/
immunodeficient mice to study S. Typhi infection. Song, et al. used Rag2
/-IL2rɣ
/
mice engrafted with human fetal liver hematopoietic stem and progenitor cells. These investigators observed dissemination of S. Typhi to the spleen and liver, with bacterial replication at those sites, but no clinical signs of infection or mortality. Analysis of cell populations in organs showed a depletion of human cells following infection, and pro-inflammatory serum cytokine levels were elevated [15]. Firoz Mian, et al. used Rag2
/-IL2rɣ
/
mice engrafted with CD34+-enriched HSC and observed evidence of meningitis and the spread of S. Typhi to liver, spleen, blood and bone marrow, but no mortality [16]. To date, the only lethal small animal model of S. Typhi infection remains the CD34+ Hu-NSG model, which uses NSG mice engrafted with CD34+ HSC derived from umbilical cord blood (Fig. 1a) [12, 17]. The presence of human hematopoietic cells in engrafted mice appears to be the key factor required to support progressive infection in vivo. In vitro studies comparing human and

A Humanized Mouse Model for S. Typhi

217

Fig. 1 Construction of CD34+ Hu-NSG Humanized Mice and TraDIS to identify S. Typhi loci required for virulence. (a) NOD-scidIL2rɣnull mice are irradiated and injected with CD34+ human hematopoietic stem cells (HSC) derived from umbilical cord blood. Engraftment of mature human immune cells (CD45+) is confirmed in the peripheral blood 2 months after injection. (b) Humanized mice are infected with high-density S. Typhi transposon pools, and next-generation sequencing is used to compare input and output pools to identify counterselected mutants

murine macrophages have suggested that S. Typhi is better able to replicate and survive in human macrophages [18–21]. Taken together, the in vitro and in vivo observations suggest that human macrophages are required for productive infection with S. Typhi. The pathology observed in S. Typhi-infected CD34+ Hu-NSG mice resembles that of human typhoid, including hepatic Kupffer cell swelling and splenic granulomatous inflammation with multinucleated giant cells [12, 22, 23]. Human cytokines are elevated in serum of infected humanized mice [12]. Concentrations of human cytokines in this model may be readily measured using commercial assays. The CD34+ Hu-NSG mouse does have important limitations. The residual presence of murine immune cells creates a chimeric immune environment that can be detrimental to the host, and CD34+ Hu-NSG mice eventually succumb to graft-versus-host disease [24]. In addition, older mice may exhibit increasing levels of T cell activation, which may be associated with reduced susceptibility to S. Typhi. Oral inoculation of S. Typhi does not result in productive systemic infection, possibly due to impaired survival of

218

Taylor A. Stepien et al.

S. Typhi in the murine gut and the absence of mucosal lymphoid tissue. These mice do not appear to contain Peyer’s patches, which are the primary site of intestinal invasion following oral infection of Salmonella [17]. Gut mucosal lymphoid tissue (GALT) does not develop in CD34+ Hu-NSG mice due to the absence of the IL-2 receptor common γ-chain and whole-body irradiation required for engraftment, although newer models of NSG mice can be engrafted with human HSC in the absence of irradiation as preconditioning [25]. Subject-to-subject variation is observed due to variable engraftment levels and donor heterogeneity. Finally, the cost and labor required to produce CD34+ Hu-NSG mice limits experimental sample size. Despite these constraints, the CD34+ Hu-NSG model provides a unique opportunity to study the pathogenesis of S. Typhi infection.

2

Materials

2.1 Humanized MiceSources

When the CD34+ Hu-NSG murine model of Salmonella Typhi infection was initially reported, the only sources of these mice were the University of Massachusetts Medical School and the Jackson Laboratory [12]. Now, there are multiple companies that offer the CD34+ Hu- NOD-scidIL2rɣnull engrafted mice and NOD-scidIL2rɣnull-derivative human cell-engrafted mice. In addition, the Jackson Laboratory offers numerous NSG-mouse derivatives as engraftment backgrounds [14] (see Notes 1 and 2). Mice can now be ordered following engraftment with umbilical-cord CD34+ HSC or peripheral blood mononuclear cells from the same donor or from multiple donors. We have not investigated the role of HLA or blood groups on the growth of S. Typhi in CD34+ Hu-NSG mice, as all of our infections have been cohorts of engrafted mice from mixed donors.

2.2 Source of S. Typhi

The considerable cost of CD34+ Hu-NSG mice warrants careful consideration when choosing a strain of S. Typhi for virulence experiments. Many laboratories have a characterized strain of S. Typhi used for in vitro experimentation, such as invasion assays with epithelial cells or survival assays with phagocytic cells. For laboratories considering experimentation with humanized mice, there are several important considerations.

2.2.1 Characterized Clinical Isolates

It may be preferable to work with recent clinical S. Typhi isolates that are known to cause disease in humans. We selected the clinical isolate S. Typhi Ty2 for our studies. Laboratory-adapted strains of S. Typhi may have acquired mutations that could negatively impact infection in CD34+ Hu-NSG mice. S. Typhi Ty2 can be obtained from the American Type Culture Collection (ATCC), and the genomic sequence of this strain is available in public databases.

A Humanized Mouse Model for S. Typhi

219

2.2.2 Presence of Vi Antigen

An important virulence characteristic of S. Typhi is production of the Vi capsular polysaccharide. Nearly all clinical isolates are Viantigen-producing as determined by an agglutination assay using antiserum to Vi-capsule, but this trait can be lost by serial passage. A simple slide agglutination test can be performed to confirm Vi expression (see below). The role of Vi-capsule in the biology and pathogenesis of S. Typhi infection in humans is well documented [26, 27], and a vaccine consisting of purified Vi-antigen is immunogenic and protective.

2.2.3 Multidrug Resistance Status

The antibiotic resistance profile of the S. Typhi strain to be utilized is an important consideration, as drug resistance may pose two problems. First, antibiotic resistance may complicate further genetic manipulation using common selectable markers. Second, a multiple drug-resistant (MDR) strain such as CT18 [28] complicates biosafety containment and laboratory safety. Genetic manipulation should not include antibiotic resistance markers that would prevent successful treatment in the event of a laboratory infection. When considering genetic manipulation, consult with the local Institutional Biosafety Committee or the Environmental Health and Safety offices for guidance.

2.3 Growth of S. Typhi

All solutions and media should be prepared using analytical-grade reagents. 1. Luria-Bertani (LB) broth and agar are available from most scientific suppliers. For consistency, it is advisable to purchase LB broth and LB agar as premade powders. 2. Aromix 100 is a solution of aromatic amino acids that facilitates the growth of S. Typhi in LB broth and on plates. Dissolve 40 mg mL
1 L-phenylalanine, 40 mg mL
1 L-tryptophan, 10 mg mL
1 2,3-dihydroxybenzoic acid, and 10 mg mL
1 p-amino benzoic acid in water, filter-sterilize, and store at 4  C in a bottle wrapped in aluminum foil to protect from light; do not use if discoloration occurs. Add this mixture to LB broth and LB agar after autoclaving (see Note 3). 3. Dissolve antibiotic stocks in appropriate solvents and filtersterilize when needed. 4. Glass culture tubes should normally be used for the cultivation of bacteria. 5. Vi antiserum (BD Difco, Cat# 228271).

2.4 Infection of CD34+ HU-NSG and NSG Mice

1. Sterile syringes with 25-gauge Luer-lock needles. 2. Sterile phosphate buffered saline (PBS), tissue culture grade. All solutions and chemicals used in mice must be USP grade or

220

Taylor A. Stepien et al.

tissue culture grade. Exceptions require approval from the local IACUC or local animal use administrators. 2.5 Organ Harvest and Blood Collection

1. 95% ethanol in wash bottle. 2. Surgical forceps and scissors, usually multiple sets. Curved scissors are advantageous. 3. 12  75 mm sterile round-bottom tubes for dilutions of homogenized tissues (Falcon Cat# 352054). 4. Plastic round-bottom dilution tubes for homogenization of tissues. 5. Sterile PBS for homogenizing tissues and serial dilutions. 6. Homogenizer to homogenize tissues. 7. Wide-bore pipet tips. 8. Serum separation tubes (BD Microtainer Cat# 365967). 9. Goldenrod animal lancet 3 mm (Braintree Scientific Inc.).

2.6 Transposon Library Construction

1. 0.45 μM nitrocellulose membrane filters. 2. Q Trays, 240  240  20 mm (Molecular Devices). 3. Dimethyl sulfoxide (DMSO). 4. Qiagen Blood and Tissue Kit (Qiagen Cat#69504). 5. Covaris microTUBE AFA Fiber Crimp-Cap 6  16 mm (Covaris Cat#520052). 6. TE buffer. 7. Sterile PCR tubes. 8. NEBNext End Repair Module (NEB Cat#E6050). 9. MinElute PCR Cleanup Kit (Qiagen Cat#28004,28006). 10. EB buffer. 11. Solution of 9.5 mM dCTP and 0.5 mM ddCTP prepared as follows: Final

Stock

10 μL

20 μL

dCTP

9.5 mM

100 mM

0.95

1.9

2.85

ddCTP

0.5 mM

10 mM

0.5

1

1.5

8.55

17.1

H2O

30 μL

25.65

12. Terminal Deoxynucleotidyl Transferase, Recombinant (Promega Cat#M1871). 13. Performa DTR Cat#98780).

Gel

Filtration

Cartridges

(EdgeBio

14. Qubit dsDNA BR Assay Kit (Invitrogen Cat#Q32850).

A Humanized Mouse Model for S. Typhi

221

15. Qubit dsDNA HS Assay Kit (Invitrogen Cat#Q32851). 16. KAPA HiFi HotStart ReadyMix (Roche Cat#KK2620). 17. KAPA HiFi HotStart Library Amplification Kit (Roche Cat#KK2612). 18. SYBR Green I. 19. 96-well round-bottom microtiter plate (Costar Cat#3795) . 20. SPRIselect Reagent Cat#B23318).

(Beckman

Coulter

Life

Sciences

21. Agilent High Sensitivity DNA Kit (Agilent Cat#5067-4626). 22. 85% ethanol. 23. Library Quantification Cat#KK4824).

3

Kit—Illumina/Universal

(Roche

Methods

3.1 Biosafety and Animal Husbandry 3.1.1 Humanized Mice

3.1.2 Salmonella enterica

Mice containing human cells or tissues must be housed at ABSL2level or higher containment according to the NIH Guide. Prior to ordering and working with these mice, it is important to consult with the veterinary care staff. Some suppliers of humanized mice recommend maintaining the mice on medicated water containing trimethoprim-sulfamethoxazole or Baytril (enrofloxacin). However, we have not found this to be necessary, as our mice are housed in autoclaved bedding and caging with irradiated chow and handled only in a biosafety cabinet using strict technique to minimize introduction of Pneumocystis murina and other pathogens. Additionally, the presence of antibiotics may confound infection experiments. If medicated water is used, mice should be on antibiotic-free water at least 7 days prior to infection. During the washout period, mice need to be housed in clean cages and changed every other day; mice are coprophagic and will ingest their antibiotic-containing feces, resulting in self-inoculation. S. Typhi is considered a risk group 2 (RG2) pathogen in most countries, and all in vitro and in vivo work must be performed with BSL2 and ABSL2 containment. Consultation with local biosafety or Environmental Health and Safety officers is important prior to beginning work with these agents. All standard BSL2 containment practices and procedures must be followed. Any aerosol-generating activities should be performed in a certified Class II biosafety cabinet. For best practices, growth of liquid cultures should be performed in a separate incubator. There should be a protocol in place for cleaning an accidental spill of an RG2 agent. Additional guidance can be found at http://www.cdc.gov and https://www.cdc.gov/labs/BMBL.html.

222

Taylor A. Stepien et al.

3.1.3 Laboratory Animal Husbandry Staff

Laboratory staff should be offered vaccination against S. Typhi. There are presently two widely available vaccines: the oral live attenuated Ty21a vaccine and an injectable Vi-antigen preparation. Consult medical professionals and local Occupational Health specialists about receiving these vaccines.

3.2 Vi Agglutination Assay

Before working with S. Typhi, the presence of Vi must be confirmed by agglutination assay. Use a proper negative control such as S. Typhimurium, an E. coli K12 strain, or a Vi mutant strain of S. Typhi (vexA or tviA mutation). 1. Add 10 μL of overnight culture of S. Typhi to glass slide. 2. Add 10 μL of Vi antiserum and mix. 3. Allow to sit at room temperature for 10–15 min. A positive agglutination will appear as a firm and granular clumping of the culture.

3.3 Determination of S. Typhi Inoculum for CD34+ Hu-NSG Infection

As the costs of CD34+ Hu-NSG mice are significant, taking the time to accurately and reproducibly prepare the infection inoculum is crucial (see Note 4). We have not attempted to inoculate humanized mice with more than 2  105 CFU of wild-type S. Typhi Ty2 (see Note 5). Dosing of other strains and other mouse suppliers should be determined empirically. The purpose of the following procedure is to accurately determine the number of viable bacteria grown in culture. We routinely perform a practice preparation three times on three separate days. All cultures are initiated using freshly prepared LB broth with 1 aromix. All cultures are started from freezer stocks and grown for 18 h (overnight) at 37  C on a platform shaker. Day 0 1. Start cultures of S. Typhi strains by inoculating 5 mL LB in a glass culture tube directly from freezer stock and incubate at 37  C with shaking at 250 rpm for 18 h (overnight). Day 1 2. Measure OD600 on a spectrophotometer, and adjust cultures to OD600 ¼ 1.0 in sterile PBS as a means of normalizing all cultures. 3. Make appropriate serial dilutions in sterile PBS and plate on LB agar. Incubate overnight at 37  C. Days 2–3 4. Determine the colony forming units (CFU) of viable bacteria per mL of the culture adjusted to OD600 ¼ 1.0. Use this calculation to determine the volume of OD600 ¼ 1.0 that will be used for infection. Dilute bacteria in sterile PBS so that the

A Humanized Mouse Model for S. Typhi

223

injection volume per mouse is 0.5 mL. Although we typically use this volume, smaller volumes can be used. 5. Repeat steps 1–4 at least three times on three separate days. Although this might sound excessive, the cost of the mice warrants extra precautions to ensure reproducibility. 3.3.1 Determination of S. Typhi Inoculum for Competitive Infections

Competitive infections are used to compare the virulence of two strains, typically mutant and wild-type [29]. Strains to be compared must have distinctive antibiotic resistance profiles to allow individual enumeration. It is not recommended to exceed 2  105 CFU per mouse, or 1  105 CFU of each strain. 6. Complete steps 1–4 for each strain three times to determine the number of viable bacteria per mL at OD600 ¼ 1.0. 7. Mix two strains in a 1:1 ratio (by number of viable bacteria), and plate serial dilutions on LB agar plates. Incubate overnight at 37  C. 8. On the following day, pick 100 colonies and patch onto selective and nonselective LB agar plates to determine the actual ratio of the two strains. The Competitive Index (CI) is determined by dividing the output ratio (CFU mutant/CFU wild type) by the input ratio (CFU mutant/CFU wild type). 9. Adjust volumes if needed and repeat steps 7 and 8 three times on three separate days.

3.4 Infection of CD34+ Hu-NSG Mice or NSG Mice

1. Grow S. Typhi cultures exactly as done for the inoculum determination. 2. Dilute and plate the inoculum onto LB agar to determine the actual dose. Incubate plates overnight at 37  C and count the following day. 3. Infect the mice by intraperitoneal injection (see Notes 6 and 7). There is no reason to save the inoculum for additional viability determination, as S. Typhi is viable in PBS for many hours. 4. Mice should be monitored according to the stipulations on the IACUC protocol. We monitor mice twice daily and more frequently if they appear ill (see Note 8). Consult with veterinary and animal care staff for protocols regarding after-hours health checks. Mice that are developing systemic infection will show the following symptoms: reduced body temperature, hunched body position, reduced nesting behavior, slow and unsteady movement, and frequently, a loose yellow rectal discharge. Mice that exhibit these characteristics are becoming moribund and will need to be euthanized, as they will not recover (see Notes 9 and 10). Development of symptoms can occur within 24–48 h of inoculation. The NSG nonengrafted mice should not develop any of these symptoms, even

224

Taylor A. Stepien et al.

following administration of high doses of wild type S. Typhi, and should be included as controls. 3.5

Blood Collection

Humanized mice can be periodically bled to assay murine and human cytokine levels. The frequency and method of bleeding, and volume of blood removed, is dictated by the institution’s IACUC protocol. We use the submandibular puncture method to collect blood postinfection. 1. Use Goldenrod 3 mm lancet to pierce the mandibular vein. 2. Collect blood in BD Microtainer Serum Separator Tubes (SST), and allow to sit for approximately 5 min. 3. Centrifuge at 5000 rpm (2300  g) for 5 min at room temperature using a microcentrifuge. 4. Remove serum to a clean microfuge tube and freeze at
80 until ready to analyze.

3.6 Organ Homogenization for CFU Determination

Tissue homogenization and plating of serial dilutions of the homogenate are required to determine the bacterial burden following infection (see Note 11). There are multiple methods to homogenize tissues. Our laboratory uses reusable homogenizers that can be cleaned and sterilized with gas or hydrogen peroxide methods that are used in a hospital central supply facility, to avoid autoclaving. Metal homogenizers can be used, but a method to clean and decontaminate between samples will have to be developed. Our laboratory uses the following homogenizers and handheld power unit: Fisher Brand 150 (#15-340-167), Omni homogenizers (#15-340-104), and an adapter for the homogenizer Fisher Brand (#15-340-11). All homogenization must be carried out in a Class II Biosafety Cabinet due to the generation of infectious aerosols. 1. Label and preweigh all 12  75 mm sterile collection tubes; the homogenizer fits these tubes. Label LB agar plates. 2. Note the ear notch pattern identification for each mouse or other identifying marks on the mouse. This information will be needed to correlate data to engraftment level for the particular animal. 3. After euthanasia, surface decontaminate the mouse with 95% ethanol. Flood the surface to remove debris. 4. Aseptically remove tissues from the mouse, and add to labeled and preweighed tubes. Make sure to keep the dissection instruments in beakers of 95% ethanol. 5. Weigh each tube with the organ to determine the CFU per gram of tissue. 6. Add 1 mL sterile PBS to tissue and homogenize (see Note 12).

A Humanized Mouse Model for S. Typhi

225

7. Serially dilute homogenized tissue by tenfold dilutions. For the first one or two dilutions, use wide-bore pipette tips to facilitate pipetting. 8. Plate 100 μL of one dilution per LB agar plates in a range of dilutions to so that 30–300 colonies per plate can be counted accurately. Depending on the strain being used, antibiotics may be included in the agar plates. 9. Incubate plates overnight at 37  C. Tissue homogenates can be stored on ice at 4  C and rediluted and replated the following day, if colony counts are not possible (see Note 13). If there is contamination with other bacteria, replate the homogenates onto xylose lysine deoxycholate (XLD) agar, which is selective for Salmonella. 10. Count the number of colonies and calculate bacterial burden per organ. 3.7 Organ Preservation

A small section of each organ may be saved for histology by preservation in 4% neutral buffered formalin. Remove a section for histology prior to weighing the remainder of organ for CFU determination.

3.8 Genetic Manipulation of Salmonella enterica

Standard methods for the genetic manipulation of Gram-negative bacteria can be utilized for Salmonella Typhi. Lambda red-mediated site-specific recombination is a useful tool for disrupting chromosomal genes in this serotype [30]. Transformation is commonly performed by electroporation. Unfortunately, there are no generalized transducing phages for Salmonella Typhi, and each mutation must be made separately. We recommend the use of low- to medium-copy number plasmid vectors for expression and complementation studies. Useful plasmids include pSC101-based plasmids, including the pWSK series [31], pACYC184 series (p15A-based) [32], or the RK2-RP4-based plasmids (pRB3) [33]. Plasmids that are stable in the absence of selection should be used where possible for animal infections. ColE1-based replicons (e.g., pUC, pSK) are unstable in Salmonella and are not recommended.

3.9 Transposon Library Construction, Infection, and Analysis

Construction of a transposon mutant library in S. Typhi is possible using a Tn5-based transposon, and such a library has been screened in humanized mice using transposon-directed insertion site sequencing (TraDIS) to identify genes required for virulence (Fig. 1b) [34, 35] (see Note 14).

3.9.1 S. Typhi Transposon Library Construction

Transposon mutagenesis of S. Typhi is performed by conjugal mating of pLG100 containing transposable element T22 (ISlacZTn2/FRT with selectable kanamycin marker) [36]. All matings and recoveries should be performed in a Class II Biosafety Cabinet.

226

Taylor A. Stepien et al.

1. Grow donor strain pLG100/Rho3 in LB broth with carbenicillin and 2,6-diaminopimelic acid (DAP) to OD600 ~ 1.0. 2. Mix donor strain with recipient strain S. Typhi grown in LB broth with 1 aromix to OD600 ~ 1.0 at a ratio of 0.1:1. 3. Spot onto a sterile nitrocellulose membrane filter seeded on an LB agar plate, and incubate at 37  C for 1 h. 4. Perform eleven independent matings (steps 1–3). 5. Add filters to 1 mL LB broth with aromix and vortex, then pool together. 6. Plate pooled matings onto ten QTrays containing LB agar with aromix and kanamycin (no DAP); incubate at 37  C for ~18 h (overnight). 7. The following day, harvest each plate with 15 mL of LB broth, then pool the samples. 8. Add DMSO to 10%, and freeze in 1 mL aliquots at
80  C. 9. Thaw one library aliquot and plate serial dilutions on LB agar to determine the viable titer of the transposon library. 10. For library infection of humanized mice, use a freshly thawed library aliquot and calculated viability to prepare the inoculum. Infect humanized mice as described in Subheading 3.4. 3.9.2 Recovery and Archiving of “Input” and “Output” Samples

1. Add 0.5 mL of the thawed library aliquot used for the infection inoculum to a 125 mL Erlenmeyer flask containing 25 mL LB broth + 1 aromix + antibiotic selection. 2. Incubate at 37  C for 18 h with shaking at 200 rpm. 3. Add DMSO to 10% and store aliquots at
80  C (this constitutes the “Input” samples). 4. When mice have reached the appropriate infection time point, harvest organs as described in Subheading 3.6. After organ homogenization in sterile PBS, a portion of each organ can be plated for CFU determination. 5. Place the remainder of the homogenized organ in a 125 mL Erlenmeyer flask containing 25 mL LB broth + 1X aromix + antibiotic selection. 6. Incubate at 37  C for 18 h with shaking at 200 rpm. 7. Filter outgrowths through a 70 μM tissue strainer, add DMSO to 10%, and store aliquots at
80  C (this constitutes the “Output” samples).

3.9.3 Isolation of DNA for TraDIS

1. Prepare total DNA from both thawed “Input” and “Output” samples using the Qiagen Blood and Tissue Kit. 2. Finish DNA isolation with an additional ethanol precipitation at the end to concentrate DNA and remove impurities.

A Humanized Mouse Model for S. Typhi

227

3. Resuspend DNA in 100 μL TE and quantify. A minimum of 1.5 μg of high-quality DNA is required for the TraDIS library construction. 3.9.4 DNA Shearing

1. For each sample, add 1–1.5 μg total DNA to a Covaris tube, filling the tube to 130 μL total volume with additional TE buffer. 2. Shear to a fragment size of ~300 bp using a Covaris LE220 Ultrasonicator (Covaris, Woburn, MA) with rack PN500282, duty factor 30%, (W) 450 and 200 cycles 200 for 60 s.

3.9.5 End Repair

1. For each sample, prepare the following end-repair reaction. Keep all reagents on ice. Sheared DNA

130 μL

10 end-repair buffer

15.5 μL

End-repair enzyme mix

7.5 μL

Sterile water (adjust as needed)

2 μL

Total reaction volume

155 μL

2. Incubate at 20  C for 30 min in a thermocycler, dividing each reaction into two tubes of 77.5 μL each. 3. Purify DNA using MinElute PCR Cleanup Kit. Elute from each column with 2  10 μL EB buffer, for a total elution volume of 20 μL. 3.9.6 C-Tailing

4. Optional: quantify DNA by fluorometry. 1. For each sample, prepare the following C-Tailing Reaction. Keep all reagents on ice. End-repaired DNA

18.6 μL

Fresh solution of 9.5 mM dCTP and 0.5 mM ddCTP

2.8 μL

5 TdT reaction buffer

5.6 μL

Terminal transferase enzyme

1.0 μL

Total reaction volume

28 μL

As a negative control, include a sample with no TdT enzyme. 2. Incubate at 37  C for 60 min, then at 75  C for 20 min. 3. Purify the DNA using Performa DTR gel filtration cartridges. Centrifuge the cartridges for 2 min at 800  g, then store at
20  C. 4. Optional: assay 2 μL of each sample by Qubit dsDNA BR Assay Kit.

228

Taylor A. Stepien et al.

3.9.7 PCR1

1. For each sample, prepare the following PCR reaction. Keep all reagents on ice. EDGE-purified C-tailed DNA, ~150 ng

7.4 μL

2 KAPA HiFI HotStart ReadyMix

25 μL

10 μM primer olj376 (Ultramer)

3 μL

10 μM primer T22-87_Left

1 μL

100 SYBR green

0.25 μL

PCR-grade sterile water

13.35 μL

Total reaction volume

50 μL

As a negative control, include the end-repaired and C-tailed sample with no TdT enzyme (there should be no amplification).

3.9.8 PCR2

2. Run the PCR in a thermocycler under the following conditions: 95  C for 2 min, 24 (98  C for 30 s, 64  C for 30 s, 72  C for 1.5 min, read), 72  C for 2 min, then hold at 10  C. The inflection point should be approximately 24 cycles with 150 ng of sample. 1. For each sample, prepare the following PCR reaction. Keep all reagents on ice. PCR1 product

1.2 μL

2 KAPA HiFI HotStart ReadyMix

25 μL

10 μM primer T22_PAIR_AmpF_Left

3 μL

10 μM primer TdT_Index_XX

3 μL

100 SYBR green

0.25 μL

PCR-grade sterile water

17.55 μL

Total reaction volume

50 μL

See Table 1 for primer sequences for T22 insertion mutant pool specific for left end.

3.9.9 PCR for Sequencing

2. Run the PCR in a thermocycler under the following conditions: 95  C for 2 min, 25–30* (98  C for 30 s, 64  C for 30 s, 72  C for 1.5 min, read), 72  C for 2 min, then hold at 10  C. *Run PCR2 for 25–30 cycles to determine the inflection point of each sample. Repeat run of PCR2, stopping each reaction near the inflection point determined in the initial PCR2 run.

A Humanized Mouse Model for S. Typhi

229

Table 1 Primer Sequences Primer name

Sequence 5’- 3’

T22—87_Le (pLG100) T20-87_Le (pLG66a or pJK804) olj376

ATCCCCCTAGGGCGCGCCGAAGT GGATCCCTAGGGCGCGCCGAAGT GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGGGGGGGGGGGGGGGG

T22_PAIR_AmpF_LEFT

AATGATACGGCGACCACCGAGATCTACACTAGAGAATAGGAACTTCGGAATAGGAACTTCTTAGATGTGTATAAGAG

TdT_Index_01_ATCACG

CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_02_CGATGT

CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_03_TTAGGC

CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_04_TGACCA

CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_05_ACAGTG

CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_06_GCCAAT

CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_07_CAGATC

CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_08_ACTTGA

CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_09_GATCAG

CAAGCAGAAGACGGCATACGAGATCTGATCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_10_TAGCTT

CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_11_GGCTAC

CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_12_CTTGTA

CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_13_AGTCAA

CAAGCAGAAGACGGCATACGAGATTTGACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_14_AGTTCC

CAAGCAGAAGACGGCATACGAGATGGAACTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_15_ATGTCA

CAAGCAGAAGACGGCATACGAGATTGACATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_16_CCGTCC

CAAGCAGAAGACGGCATACGAGATGGACGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_18_GTCCGC

CAAGCAGAAGACGGCATACGAGATGCGGACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_19_GTGAAA

CAAGCAGAAGACGGCATACGAGATTTTCACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_20_GTGGCC

CAAGCAGAAGACGGCATACGAGATGGCCACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_21_GTTTCG

CAAGCAGAAGACGGCATACGAGATCGAAACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_22_CGTACG

CAAGCAGAAGACGGCATACGAGATCGTACGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_23_GAGTGG

CAAGCAGAAGACGGCATACGAGATCCACTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_25_ACTGAT

CAAGCAGAAGACGGCATACGAGATATCAGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

TdT_Index_27_ATTCCT

CAAGCAGAAGACGGCATACGAGATAGGAATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

T22_custom_1stRead_SEQ_Le

CCGAGATCTACACTAGAGAATAGGAACTTCGGAATAGGAACTTCTTAGATGTGTATAAGAG

P7c’

CAAGCAGAAGACGGCATACGAGAT

Note: When designing/choosing a set of index primers for multiplexing, red-channel and green-channel diversity requirements must be considered for the barcode bases (see Illumina documentation) All primers were ordered from IDT as ultramers, except T22_custom_1stRead_SEQ_Left, which was HPLC purified

3.9.10 SPRI Size Selection

1. Use SPRI beads for 0.8–0.61 size selection and a range of 230–660 base-pairs (this method selects first the right side of the bp range, then the left). 2. Set up the 96-well microtiter plate: Add samples and the appropriate amount of SPRI beads (95 μL sample volume * 0.61 ¼ 58 μL SPRI beads). Mix ten times and incubate for 1 min at room temperature. 3. Place on an Agencourt SPRIPlate 96R ring super magnet plate (Beckman Coulter) for 2 min. 4. Remove 145 μL supernatant to a new well while on the magnet, then remove from magnet.

230

Taylor A. Stepien et al.

5. Add appropriate amount of beads to the supernatant (145 μL sample volume * (0.8–0.61) ¼ 27.6 μL SPRI beads). Mix ten times and incubate 1 min at room temperature. 6. Place on the magnet for 2 min. 7. Discard the supernatant on the magnet, then add 180 μL fresh 85% ethanol and incubate for 30 s on the magnet at room temperature. 8. Discard ethanol and air-dry for 2 min on the magnet at room temperature. 9. Transfer supernatant to a new microfuge tube. Store at
20  C. 3.9.11

Quantification

Perform quantification using an Agilent Bioanalyzer 2100 (1 μL) (size ~250–600 bp, average size ~400 bp, ~15 nM). 1. Use the qPCR KAPA Library Quantification Kit for Illumina platforms. (a) Run both 1:5000 and 1:10,000 dilutions in triplicate with the Illumina primers included in the kit. (b) Run a 1:5000 dilution in triplicate with custom primers “T22_custom_1stRead_SEQ_Left” and “P7c’“ to determine the amount of transposon-specific products in the library. (c) Use the Data Analysis Template from KAPA Biosystems to determine library quantitation. 2. For multiplexing, use genomics facility’s specifications for concentration as determined by Agilent and proper dilution for Qubit dsDNA HS Assay. (a) Pool to a final concentration of 2 nM of each library. (b) Assay 3 μL of pooled library by Qubit dsDNA HS Assay Kit. (c) Optional: perform qPCR KAPA Library Quantification (use dilutions at 1:500 and 1:1000 for Illumina primers and 1:500 for Tn-specific primers).

3.9.12 Next-Generation Sequencing

1. Submit samples to genomics facility. (a) ~30 μL 2 nM pooled library. (b) ~20 μL 100 μM HPLC-purified custom primer. 2. Platform: HiSeq Rapid Run (65  C) (2 lanes if multiplexing 24 libraries).

A Humanized Mouse Model for S. Typhi

231

(a) 50 SR. (b) 15 pM final library concentration, with a 6% spike-in of a 12.5 pM hiX library: redenature by heating to 95  C for 5 min, then plunge into ice bath.

4

Notes 1. NSG mice, whether nonengrafted or engrafted, are similarly sensitive to S. Typhimurium as C57Bl/6 or BALB/c mice. 2. Refer to the Jackson Laboratory website for information on NSG mouse backgrounds and engraftment options: https:// www.jax.org/jax-mice-and-services/in-vivo-pharmacology/ humanized-mice. 3. It is possible to grow S. Typhi in other rich media. However, we have not characterized growth and virulence of S. Typhi in other media besides LB. 4. Practicing growth of the Salmonella inoculum culture is essential to ensure the exact dose, and three separate growth experiments are recommended. 5. The dose of S. Typhi may have to be determined empirically depending on the source of humanized mice and source of donor used. We do not recommend exceeding 2  105 total wild-type S. Typhi per CD34+ Hu-NSG mouse. 6. Humanized mice do not support oral infection with S. Typhi, as the poor survival of S. Typhi in the murine gut and the absence of normal GALT, including Peyer’s patches, does not allow Salmonella to invade the intestinal epithelium. Thus, intraperitoneal or intravenous infection is recommended. 7. Mice should be infected within 5 days of receipt. Engraftment eventually leads to GvHD, causing thick and tough skin, and a lack of grooming. This can be accompanied by anemia, evidenced by pale footpads. Prompt infection will help to avoid the confounding effects of GvHD. 8. It is advised to infect mice earlier in the day so that they can be monitored in the hours immediately following infection. Mice should be monitored at regular intervals for signs of infection, including weight loss, dehydration (skin tenting), hunched appearance, slow movement, and lack of nesting behavior. Mice sacrificed when moribund will achieve the best results in terms of organ analysis, while mice that succumb to infection prior to organ harvest will likely yield unreliable results. 9. Be prepared with endpoint materials for euthanasia of mice at different times. Mice may exhibit different sensitivity to S. Typhi due to variation in engraftment and donor background.

232

Taylor A. Stepien et al.

10. CD34+ Hu-NSG mice infected with 4  105 S. Typhi transposon library experienced acute infections, showing signs of infection within 24–36 h. Infected humanized mice had >4  105 CFU in livers and spleens at these timepoints, indicating growth of S. Typhi in vivo. Some mice never showed signs of infection, and subsequent analysis of organism burden showed 28

23

Observations

Switch off infrared lamp

pathogenic agent, allows animals or biological samples to be introduced or removed via leak-proof containers without breaking containment. (2) An accommodation room where feed is suspended above floor level in order to limit direct contamination through animal droppings. The drinking water is delivered by a pipette system with small drinking troughs. Contact with the droppings is limited as a grid allows the droppings to fall into a receiving tray containing a decontaminant solution of quaternary ammonium which results in quick sterilization. The wire mesh of the grid is 1 cm
1 cm for chicks up to 10 days of age, and 2 cm
2 cm for chicks over 10 days of age. A removable partition with a guillotine door separates the breeding space and facilitates handling. (3) An

Experimental Salmonella Infection Models in Chicks

255

Fig. 2 Presentation of one large isolator used in the “isolator” model. A type A3 confined isolator (a) of 2.26 m2 is used. It is equipped with five pairs of rubber gloves for handling and it consists of three parts: (1) a handling area where feed and materials are stored. (2) A room for chickens where the drinking water is delivered by a pipette system with small drinking troughs (b). (3) An excretion pit located under the breeding space, which must be regularly decontaminated with a germicide

excretion pit located under the breeding space must be regularly decontaminated with a germicide (TH5 2%) (see Note 4). All chicks have free access to drinking water and are fed ad libitum. A nycthemeral rhythm of 12 h of darkness and 12 h of light is applied. The isolator is equipped with five pairs of rubber gloves for handling. 2.4.5 Inoculation

1. I.V. Catheter Terumo® (22G
1). 2. Syringe Plastipak 1 mL Luer lock. 3. Needle Terumo® (25G
5/800 , 0.5
16 mm).

2.4.6 Euthanasia

1. Circlip pliers for chicks younger than 15 days. 2. Paper towel. 3. Aluminum foil. 4. Bunsen burner. 5. A poultry stunner (VE memory in our case) and a home-made guillotine.

2.4.7 Autopsy

1. 1.8 mL cryogenic vials. 2. Dry ice. 3. Preweighed plastic sample pots (1/droppings). 4. Dissection kit with scissors and surgical clips. 5. A beaker with 70 alcohol for each manipulator. 6. Preweighed blender bags with filter (1/droppings or ceca or internal organs). 7. Sterile Eppendorf microtubes.

256

Philippe Velge et al.

8. RNAlater (Qiagen) or equivalent product. 9. 70 alcohol. 10. Dry ice. 11. PBS containing 0.1% Tween 80. 12. 0.14 mol/mL EDTA (ethylenediaminetetraacetic acid). 2.5 Bacterial Numeration

1. 150 mm petri dishes containing selective medium Salmonella– Shigella (SS) agar supplemented with antibiotic, 500 μg/mL streptomycin sulfate salt (Sm500), 20 μg/mL Nalidixic acid (Nal20). 2. Bagmixer (e.g., MiniMix CC, Interscience). 3. Automatic plater (e.g., easySpiral Pro, Interscience) or dilution tubes with 1.8 mL saline water. 4. Automatic colony counter (e.g., Scan 4000, Interscience). 5. PBS.

3

Methods

3.1 Preparation of a Frozen Inoculum

1. Grow the Salmonella strain in 10 mL of Tryptic Soy Broth (TSB) supplemented with the appropriate antibiotic overnight at 37  C with agitation (190 rpm). 2. The next day, inoculate 400 mL of TSB supplemented with the appropriate antibiotic with 4 mL of the overnight preculture and incubate the Erlenmeyer for 24 h at 37  C under agitation (190 rpm). 3. Centrifuge the bacterial culture at 4800
g for 20 min at 20  C and resuspend the pellet in 20 mL of PBS containing 50% glycerol. 4. Distribute 1.2 mL of the obtained solution in 1.8 mL cryogenics vials and store them at 80  C. 5. A few days after freezing, unfreeze one vial and numerate the inoculum to determine the exact concentration of the inoculum by serial dilutions in PBS and spread on TSA plates. This vial is thrown away after use.

3.2 Animal Handling Before Inoculation

Animal experiments must be carried out in strict accordance with the local legislation, and the experiments must be approved by an ethics committee. The principles of reduction, replacement and refinement are implemented in all animal experiments. Everybody working on animals should be allowed to handle animals. 1. For the cage model: Just after hatch, all chicks are reared together in the cage for 6 days to favour acquisition and homogenisation of the gut microbiota. Then the 6-day-old chicks are

Experimental Salmonella Infection Models in Chicks

257

randomly distributed into the different cages according to the different conditions. 2. For the isolator model: from the day of hatch, chicks are reared together in the battery cages at a temperature of 35  C for 6 days to favour acquisition and homogenisation of gut microbiota. If chicks receive a treatment or bacteria the day of hatch, each group is reared in a separate room. The method of transferring chicks depends on the type of isolator. We used a box to transfer the chicks through the airlock or the double watertight door. 3.3 Checking for the Absence of Salmonella in Chicks

The EOPS status of the animals is checked regularly. However, before the experiment the Salmonella-free status of the birds is verified. For this purpose: 1. Place wipes in the transport boxes of the chicks. 2. After transport, place the dropping-stained wipes in 10 mL buffered peptone water for 24 h at 37  C. 3. Prepare a 1/10 dilution of this peptone water in Rappaport medium. Incubate for 24 h at 37  C. 4. Isolate bacteria on petri dishes containing Rambach medium (Salmonella colonies are fuchsia red in color).

3.4

Inoculation

1. On the day of inoculation (7-day-old chicks), unfreeze one inoculum aliquot and dilute it to adjust the bacterial concentration to 2.5
105 CFU/mL before inoculation. Prepare at least 50% more inoculum than the volume you need to inoculate the chicks. To standardize the different experiments in the same project, one frozen aliquot from the same initial inoculum preparation is used for each experiment. The aliquot is thrown away after use. 2. Numerate this preparation in order to validate its 2.5
105 CFU/mL final concentration. Numeration can be performed on an automatic plater (easySpiral Pro) or by serial dilutions of the inoculum in PBS. 3. Orally inoculate 0.2 mL of the 2.5
105 CFU/mL suspension with a 1 mL syringe mounted with a catheter at the end. To do this, one person holds the chick while another person stretches its neck slightly and opens the beak by pressing on the base of the beak, in order to enter the catheter into the esophagus without hurting the chick, and injects 0.2 mL of the suspension (Fig. 3) (see Note 5).

3.5 Sample Recovery from Live Animals

For chicks reared in cages or isolators several samples are recovered before and after infection. The type of samples and when they are retrieved may vary depending on the scientific question but

258

Philippe Velge et al.

Fig. 3 Chick handling to orally inoculated compounds or pathogens. Chicks are orally inoculated with 0.2 mL of the Salmonella suspension with a 1 mL syringe mounted with a catheter on its end. For this purpose, one person holds the chick while another person stretches its neck slightly and opens the beak by pressing on the base of the beak. Enter the catheter into the esophagus without hurting the chick, and inject the suspension slowly

generally, samples are taken at 4, 6, 11, 14, and 21, 28 days of age (see Note 6). 3.5.1 Fresh Fecal Samples

Colonization levels of the Salmonella strain and the gut microbiota composition can be studied on fecal samples. 1. Collect fecal samples by gently pressing the chick abdomen (see Note 7). Droppings are collected in a preweighed sampling pot. 2. A small amount of droppings is deposited quickly in a sterile Eppendorf microtube using a sterilized single use spatula and rapidly frozen in a dry ice/alcohol bath for further analysis of the microbiota. 3. The rest of the feces in the pot is conserved for bacterial numeration.

Experimental Salmonella Infection Models in Chicks

259

It is advisable to collect droppings as soon as the lighting is switched on, because the chicks feed and expel feces immediately after the lights come on. 3.5.2 Blood Samples

Blood is recovered in the occipital sinus to measure the number of circulating immune cells, levels of cytokines, and gene expression of immune cells. The chick is kept upright with its head bent forward. Blood is taken using a syringe equipped with a needle and a guard allowing the sample to be taken at the level of the occipital sinus, an arteriovenous node located at the back of the head, which allows a larger volume to be taken in a few seconds without risk of hematoma, compared to sample taken from the artery under the clavicle. The guard allows the needle to be inserted at a constant distance to preserve the chick and to be sure to enter the vein. For chicks under 6 weeks old, the needle should not exceed 3 mm from the guard. The guard corresponds to the cap of a 25G
5/800 (0.5
16 mm) needle with a length of 26 mm.

3.6 Post-mortem Sample Recovery

1. Chicks under 15 days old are killed using circlip pliers. The neck of the chick is placed between each arm of the plier and the cervical vertebrae are broken.

3.6.1 Euthanasia

2. Over 15 days of age, chicks are first stunned by electronarcosis before crushing the cervical vertebrae with a guillotine. 3. After death, chicks are rapidly soaked in a warm quaternary ammonium solution (Lukewarm, 1/2000 for few a minutes) in order to disinfect the outer surface of the animal.

3.6.2 Beginning of the Necropsy

1. Install the dissection station. Light the Bunsen burner, fill the beaker with 70% alcohol (up to the height of the scissor blades) and put the scissors and surgical clips in the beaker. Install a paper towel on a piece of aluminum foil close to the Bunsen burner (Fig. 4a). 2. Take a chick from the quaternary ammonium solution and drain off excess liquid. Then put it on its back on the paper towel. 3. During the autopsy, scissors and clips must be sterilized in the flame of the Bunsen burner and left to cool slightly before each use. 4. First, the chicken skin is removed by making an incision in the lower abdomen and by lifting the skin up to the neck (Fig. 4b). Then soak the scissors and surgical clips in 70% alcohol, put them in the flame and wait for them to cool. 5. Second, open the chick, incise the muscle just under the tip of the wishbone and cut along the wishbone (Fig. 4c). Again,

260

Philippe Velge et al.

Fig. 4 Dissection station and first steps of autopsy. (a) The dissection station consists of a large piece of aluminum foil on which is placed a paper towel, a Bunsen burner, a beaker containing 70% alcohol, surgical scissors, and clips. (b) To open the skin, first the chicken skin is removed by making an incision in the lower abdomen and by lifting the skin up to the neck. (c) Then, an incision of the muscle just under the tip of the wishbone is made and the muscle is cut along the wishbone

Fig. 5 Recovery of organs. Internal organs should be removed before intestinal organs. (a) Picture of the chick after opening. The liver is burgundy red in color and is located just above the intestine and the gizzard. (b) To see the spleen and the ceca lift the gizzard. The spleen is located under the proventriculus. It is small, round and garnet red in color. (c) The ceca are located at the junction of the small and the large intestine. The cecal tonsils, a lymphoid organ related to Peyer’s patches in mammals, are located at the base of the cecum very close to the intersection of the cecum with the small intestine

sterilize the scissors and surgical clips in 70% alcohol and Bunsen burner flame, and let them cool. 6. Cut the wishbone to facilitate organ removal and sterilize scissors and surgical clips once again. In addition, pulling the thighs backward breaks the connection at the spine, thus keeping the thighs apart and making it easier to take samples (Fig. 5).

Experimental Salmonella Infection Models in Chicks 3.6.3 Blood Sampling

261

It is possible to take a blood sample during autopsy. Blood recovered from the heart post-mortem should be used more for antibody research than for working on viable cells. 1. Soak Pasteur pipettes in a beaker containing 0.14 mol/L EDTA to prevent blood clotting in the pipette. 2. Introduce the pipette equipped with a pear-propipette into the heart, quickly after opening the animal. Let the blood rise in the pipette. 3. Put the blood into a sterile Eppendorf tube containing 100 μL of 0.14 mol/L EDTA.

3.6.4 Recovery of Internal Organs

If collected, internal organs should be removed before intestinal organs as the latter could contaminate the former. Systemic Salmonella colonization can be estimated in the spleen or liver after necropsy. The liver is burgundy red in color and is located just above the intestine (Fig. 5a). Only take a small piece of liver. It is sufficient and avoids bleeding. The spleen is also often used to study the systemic immune response using qRT-PCR. The spleen is located under the proventriculus (Fig. 5b). It is small, round and garnet red in color. To recover the spleen, lift the gizzard. Liver and spleen samples are each put in a preweighed and identified blender bag for bacterial enumeration or in a sterile Eppendorf microtube containing RNALater (Qiagen, or equivalent product). The spleen and liver samples can be cut in half to provide samples for the two types of analysis (bacterial numeration and immune response). Samples in RNALater should be conserved at 4  C overnight and then can be stored for several months at 80  C.

3.6.5 Cecal Tissue and Cecal Content Recovery

Several analyses can be performed on ceca including: Salmonella numeration, mucosal immune response analysis (cecal tissue or cecal tonsils), microbiota analysis (cecal content or cecal mucus) and intestinal metabolite analysis (cecal content). The cecum is located at the junction of the ileum and the colon (Fig. 5b, c). Be careful to collect all the cecum by cutting it at its intersection with the intestine. A cecum can be recovered after necropsy to quantify levels of Salmonella colonization. This cecum should be collected in a preweighed and identified blender bag. A second cecum can be used to collect cecal content (see Note 8). Cecal content is collected in a preweighed sampling pot and some of this sample should be deposited quickly in a sterile Eppendorf microtube with a sterilized single use spatula and rapidly frozen in a dry ice/alcohol bath for further analysis of the microbiota or metabolites. To collect cecal mucus samples, after recovery of cecal content, the cecal tissue is washed and gently stirred in PBS to remove

262

Philippe Velge et al.

attached cecal content. Two additional washes are conducted with PBS containing 0.1% Tween 80 to recover mucus. The resulting mixture is shaken vigorously and rapidly frozen in dry ice for further processing. From the second cecum, the cecal tonsil, a lymphoid organ related to Peyer’s patches in mammals, can be collected (Fig. 5c). The cecal tonsil is located at the base of the cecum very close to the intersection of the cecum with the ileum. The cecal tonsil is hardly detected the first days of age but grows rapidly with the age of the chicks. Put the cecal tonsil into a sterile Eppendorf tube containing RNALater (Qiagen, or equivalent product). Samples in RNALater should be conserved at 4  C overnight and then can be stored for several months at 80  C. 3.7 Bacterial Numeration

4

To measure the levels of Salmonella, the preweighed pot or bag containing the sample (droppings, ceca, spleen, or liver) are weighed in order to obtain the weight of each organ (or piece of organ). Add aseptically 2 mL of TSB for spleen or 10 mL for other organs and crush the organ using a Bagmixer (in our case, with the MiniMix CC set at speed 4 for 2 min). If necessary, dilutions are performed in PBS. Spreading is carried out on Salmonella–Shigella (SS) medium containing antibiotics in petri dishes using an easySpiral Pro device. The petri dishes are then placed at 37  C for 24 h. Counting is carried out with an automatic counter (Scan 4000 in our case) after adjusting the dilution parameters. The mean counts of Salmonella CFU in organs are calculated per gram at each time point. When no colonies are detected, the sample homogenates are enriched to reveal contamination below the detection threshold. Enrichments are performed by diluting each crushed organ in 30 mL TSB. After 24 h at 37  C, these cultures are plated on SS medium containing nalidixic acid and streptomycin and then incubated at 37  C for 24 h. Under these conditions, the detection threshold after enrichment is one bacterium per organ.

Notes 1. It is important to take into account that during infection of chickens by Salmonella, the ambient air is contaminated. It is therefore essential to wear protective clothing or even take a shower when leaving the room. 2. Antibiotic resistant strains should be used if bacterial numeration is performed on nonsterile organs such as the intestine. A few years ago, we used the LA5 strain but emergence of nalidixic acid-resistant strains in the microbiota of the PA12 chicks forced us to select a streptomycin resistant clone of LA5. The colonization ability/virulence of this clone has been validated.

Experimental Salmonella Infection Models in Chicks

263

3. The composition and the granulometry of the feed have an impact on Salmonella colonization of chicks. We recommend using feed with a well-defined composition and always the same feed. The composition of different batches of feed supplied by manufacturers can vary. 4. It is not possible to leave a large amount of germicide in the droppings container due to the high humidity level. To kill bacteria present in the fecal droppings under the grids, droppings are covered with the minimal quantity of germicide. This germicide evaporates very quickly, therefore the droppings should be soaked 2 days a week by watering all around the isolator using a hose connected to a “can” containing the germicide and care should be taken not to leave any germicide on the grids. 5. When inoculating, it is important to wait for the chick to swallow before putting it back on the floor because otherwise the chicks tend to reject part of the inoculum. 6. The time required for the passage of the inoculum into the ileum is variable. This is related to the retention time in the crop and gizzard, which is related to feed intake and can vary from between 0 to more than 12 h. 7. For analysis of microbiota composition, it is important to use fresh samples and not fecal samples taken from the floor several hours after dropping. Cloacal swabs often give intermittent presence of Salmonella contrary to analysis of fresh fecal samples [4]. 8. In the majority of experiments, similar levels of Salmonella colonization are observed in the two ceca. Moreover, a higher colonization level is observed in the ceca than in the fresh fecal samples. Similarly, a slightly higher colonization level is observed in the spleen than in the liver.

Acknowledgments These models of infection were developed with the support of the Institut National de la Recherche Agronomique and with the transnational Emida projects “Healthy gut” and “Difagh” as well as the Aniwha project “AWAP.” “This work also received funding from the European Union’s Horizon 2020 Research and Innovation programme under grant agreement No 773830: One Health European Joint Programme, MoMIR-PPC project.” We would like to thank the “Ministry of Agriculture CASDAR,” ITAVI and INRAE for funding the research project CASDAR E-Broilertrack n 18ART1832 which made it possible to take the photographs of experimental breeding methods. We would like to thank Ange´lique

264

Philippe Velge et al.

Travel and Pauline Creach of the ITAVI poultry sector and the CASDAR project managers for the photographs. We also thank the members of the Experimental Infectiology Platform (UE-1277 PFIE, INRAE Centre Val de Loire, Nouzilly, France, https://doi. org/10.15454/1.5535888072272498e12) and particularly Ste´phane Abrioux, Mickae¨l Riou, and Laurence Merat; Sylvain Breton, Alexis Ple´au, Arnaud Faurie, Olivier Dube`s, and Myle`ne Girault. References 1. European Food Safety A, European Centre for Disease P, Control (2019) The European Union one health 2018 Zoonoses report. EFSA J 17(12):e05926. https://doi.org/10. 2903/j.efsa.2019.5926 2. Velge P, Cloeckaert A, Barrow P (2005) Emergence of Salmonella epidemics: the problems related to Salmonella enterica serotype Enteritidis and multiple antibiotic resistance in other major serotypes. Vet Res 36(3):267–288. https://doi.org/10.1051/vetres:2005005 3. Duchet-Suchaux M, Lechopier P, Marly J, Bernardet P, Delaunay R, Pardon P (1995) Quantification of experimental Salmonella enteritidis carrier state in B13 leghorn chicks. Avian Dis 39:796. https://doi.org/10.2307/ 1592416 4. Duchet Suchaux M, Mompart F, Berthelot F, Beaumont C, Lechopier P, Pardon P (1997) Differences in frequency, level, and duration of cecal carriage between four outbred chicken lines infected orally with Salmonella enteritidis. Avian Dis 41:559–567. https://doi.org/10. 2307/1592145 5. Sadeyen JR, Trotereau J, Velge P, Marly J, Beaumont C, Barrow PA, et al. (2004) Salmonella carrier state in chicken: comparison of expression of immune response genes between susceptible and resistant animals. Microbes Infect 6(14):1278–1286. https://doi.org/10. 1016/j.micinf.2004.07.005 6. Menanteau P, Kempf F, Trotereau J, Virlogeux-Payant I, Gitton E, Dalifard J et al (2018) Role of systemic infection, cross contaminations and super-shedders in Salmonella carrier state in chicken. Environ Microbiol 20(9):3246–3260. https://doi.org/10.1111/ 1462-2920.14294 7. Gast RK, Mitchell BW, Holt PS (1998) Airborne transmission of Salmonella enteritidis infection between groups of chicks in controlled-environment isolation cabinets’.

Avian Dis 42:315–320. https://doi.org/10. 1093/ps/78.1.57 8. Kempf F, Menanteau P, Rychlik I, Kubasova T, Trotereau J, Virlogeux-Payant I et al (2020) Gut microbiota composition before infection determines the Salmonella super- and low-shedder phenotypes in chicken. Microb Biotechnol 13:1611–1630. https://doi.org/ 10.1111/1751-7915.13621 9. Calenge F, Kaiser P, Vignal A, Beaumont C (2010) Genetic control of resistance to salmonellosis and to Salmonella carrier-state in fowl: a review. Genet Sel Evol 42:11. https://doi. org/10.1186/1297-9686-42-11 10. Chausse AM, Grepinet O, Bottreau E, Le Vern Y, Menanteau P, Trotereau J et al (2011) Expression of toll-like receptor 4 and downstream effectors in selected cecal cell subpopulations of chicks resistant or susceptible to Salmonella carrier state. Infect Immun 79(8): 3445–3454. https://doi.org/10.1128/IAI. 00025-11 11. Gopinath S, Hotson A, Johns J, Nolan G, Monack D (2013) The systemic immune state of super-shedder mice is characterized by a unique neutrophil-dependent blunting of TH1 responses. PLoS Pathog 9(6):e1003408. https://doi.org/10.1371/journal.ppat. 1003408 12. Dibb-Fuller MP, Allen-Vercoe E, Thorns CJ, Woodward MJ (1999) Fimbriae- and flagellamediated association with and invasion of cultured epithelial cells by Salmonella enteritidis. Microbiology 145(Pt 5):1023–1031. https://doi.org/10.1099/13500872-1455-1023 13. Grepinet O, Rossignol A, Loux V, Chiapello H, Gendrault A, Gibrat JF et al (2012) Genome sequence of the invasive salmonella enterica subsp. enterica serotype Enteritidis strain LA5. J Bacteriol 194(9):2387–2388. https:// doi.org/10.1128/JB.00256-12

INDEX A

E

Adhesion assay.....................................168, 169, 171–174 Allelic exchange................................................................. 3 Animal model .............................186, 215, 216, 237, 238 Antibacterial toxin........................................................... 12 Attaching and effacing E. coli ....................................... 167

E. coli DH5α λ pir........................................................... 13 E. coli SM10 .................................................................. 7, 8 Effectidor...................................................................25–35 Effector ...........................................25–34, 37–39, 43–45, 47–49, 52, 53, 62, 68, 120 Electrochemiluminescence (ECL) ...........................40, 43 Enteric fever .................................................................. 215 Enterococcus faecalis ............................................. 177–183 Enterohemorrhagic E. coli (EHEC) .......................37–39, 41, 43, 45 Enteropathogenic E. coli (EPEC) ...........................37–39, 41, 43, 45

B Bacterial adhesin............................................................ 168 Bacterial adhesiomes ..................................................... 168 Bacterial competition ...................................................... 12 Bacterial Competition Fluorescence (BaCoF) .............................. 12, 13, 15, 17–19, 23 Bacterial pathogenicity...................................47, 177–182 Bacterial secretion system ............................................... 47 Bacteria-plant interaction ............................................. 168 Bioluminescence................................................... 235–247 Bone marrow-derived macrophage (BMDM)..............................83–92, 120–124, 129 Brain heart infusion (BHI) medium ............................ 179

C Carrier state ..................................................236, 249–263 C57BL/6 mice..........................................................92, 97 Chicken infection model ..................................... 215, 250 Cholera toxin (CT) ...................................................95, 96 Chromoprotein .........................................................13, 22 Colitis........................................................... 201, 202, 204 Colonoids ...................................150, 151, 154, 160, 161 Contact-dependent growth inhibition (CDI)............... 11 Coomassie G-250 staining ............................................. 48 Coomassie staining ..................................... 39, 42, 43, 52 Cyclic-di-GMP ..................................................... 120, 129

D DAPI staining.................................................................. 81 DMEM/F-12....................................................... 153, 154 DMN-Tre ........................................................... 74, 75, 81 Dulbecco’s modified Eagle’s medium (DMEM)...................................39, 41, 44, 45, 60, 61, 65, 67, 85, 106, 121, 124, 150, 152, 153, 158, 159, 161

F Fascia.............................................................186–188, 196 Fetal bovine serum (FBS) .......................... 60, 61, 65–67, 70, 75, 85, 86, 92, 120, 135, 137, 146, 150, 153, 154, 158, 159, 161 Flagella ..............................................................49, 52, 168 Flow cytometry (FC) ................................. 105, 106, 109, 110, 112–115 Fluorescence-assisted cell sorting (FACS) ............ 99, 106 Fluorescent reporters ............................... 57, 75, 76, 126, 127, 130, 236 Food contamination ......................................83, 167, 201 Forster Resonance Energy Transfer (FRET)............................................. 120, 121, 126

G Galleria mellonella (wax worm) .......................... 177–182 Gene deletion .............................................................. 3–10 Gibson assembly........................................................5–7, 9 Gram-positive cocci ............................................. 187, 188 Group A streptococcus (GAS) ........................... 185–189, 191–193, 195, 196, 198

H Hanks’s Buffered Salt Solution (HBSS).................................................... 61, 67, 68 7H9 broth .................................................................75, 76 HEK293T cells..........................................................64, 65

Ohad Gal-Mor (ed.), Bacterial Virulence: Methods and Protocols, Methods in Molecular Biology, vol. 2427, https://doi.org/10.1007/978-1-0716-1971-1, © The Editor(s) (if applicable) and The Author(s), under exclusive license to Springer Science+Business Media, LLC, part of Springer Nature 2022

265

BACTERIAL VIRULENCE: METHODS AND PROTOCOLS

266 Index

HeLa cells .................. 58–61, 66–69, 106, 108, 111–113 Hematoxylin and Eosin (H&E) staining....................190, 195–197, 209, 210, 212 High content screening (HCS)................................74–81 HighBiT (HiBiT) .....................58, 59, 61, 62, 67, 68, 70 High-throughput analysis.........................................58, 63 High-throughput screening .................................. 12, 216 Histopathology scoring ................................................ 209 Homologous recombination ....................................3, 4, 6 Humanized mouse model ................................... 215–232

I ImageJ....................................................53, 122, 125, 127 Immunoblotting ............................................................. 40 Inflammasome .........................................................95–103 Inflammation marker .................204, 206, 207, 211, 212 Interleukin-1β (IL-1β) ............................ 96–98, 102, 103 Intracellular bacteria ............................... 79–81, 133, 211 Intracellular screening..................................................... 74 Invertebrate infection model............................... 177–182 In vivo imaging .................................................... 238, 242

K Kaplan–Meier survival curves .............................. 179, 180 Koch’s postulates .......................................................... 186

L LargeBiT (LgBiT) .....................................................58–70 Lentivirus............................................................ 60, 64, 65 L929 fibroblasts .............................................................. 85 Lipopolysaccharides (LPS) .............................96–98, 101, 151, 162, 178 Listeria monocytogenes ........................... 3–10, 83–92, 177 Live cell imaging .................................................. 121, 122 L929 medium............................................................85, 87 Luciferase................................................................ 58, 236 Luciferase Assay.................................................. 59, 61, 62 L-WRN medium ........................................ 150, 151, 153, 155, 156, 161 Lysogeny broth (LB) ................................. 5, 7, 8, 13–15, 19, 23, 38, 39, 41, 48–52, 59, 108–112, 121, 123, 136, 142, 143, 146, 154, 155, 159, 160, 171, 204, 205, 207, 209, 211, 219, 222–226, 231

M Machine learning......................................... 26, 27, 29, 34 Macrophage colony stimulating factor (M-CSF) ................................................. 85, 96–99 Macrophages .............................................. 73, 74, 76, 77, 83–92, 95, 96, 101, 103, 106, 108, 111–115, 120, 122–124, 126, 129, 133, 178, 187, 202, 217 Marine LB (MLB).............................................. 13–15, 17 Marine minimal media (MMM)........................ 13, 15, 19

Matrigel ...................................... 150–153, 157–159, 161 MicrobeJ .....................................122, 126, 127, 129, 130 Murashige–Skoog (MS) agar.......................169–171, 175 Mutagenesis..................................................................... 21 Mutant library ............................... 12, 14, 16, 17, 19, 20, 74, 81, 225 Mycobacterium tuberculosis (Mtb) ..................... 73–78, 81

N Nano-Glo............................................................ 59, 61–70 NanoLuc (NLuc) ......................................................57–71 Necrosis ................................................................ 106, 187 Necrotizing fasciitis (NF) .................................... 185–198 Neutrophils..................................99, 103, 178, 187, 188, 195, 196, 202, 209 Next-generation sequencing (NGS) ................... 217, 230 N-minimal medium ........................................... 48, 50–52

O Organoid .................................... 149–153, 157–159, 161

P p-chloro-phenylalanine ................................................. 5, 6 Phenylalanine synthetase (PheS) ................................ 3–10 Phorbol 12-myristate13-acetate (PMA) ..................75, 76 Phosphate-buffered saline (PBS) .....................13, 15, 19, 39–41, 61, 63, 64, 67, 69, 75, 77, 82, 85–87, 89, 91, 97–99, 101, 106, 108–113, 120–124, 135–137, 139–145, 151, 154, 158, 160, 162, 169, 171–174, 178, 179, 181, 182, 189, 190, 192–195, 197, 203, 206–208, 211, 219, 220, 222–224, 226, 252, 256, 257, 261, 262 pPL16 ................................................................................ 4

R Rambach medium ................................................ 252, 257 Rappaport medium .............................................. 252, 257 RAW264.7 cells.................................................... 111–114 Reporter system ..................................................... 58, 129 RPMI-1640 medium ...................................................... 75

S Salmonella enterica .................................. 47–53, 59, 106, 134, 150, 154, 155, 159–162, 167–175, 201, 215, 221, 225, 244 Salmonella induced colitis ................................... 201–212 Salmonella pathogenicity island (SPI) ........................... 47 Salmonella Typhimurium ...............................51, 58, 143, 146, 147 Secretion ........................... 11, 12, 25, 37–45, 47–49, 53, 57–70, 120, 168, 191, 202 Secretion assay ....................................... 49, 51, 58, 61–63

BACTERIAL VIRULENCE: METHODS

AND

PROTOCOLS Index 267

Single cell analysis ................................................ 105–116 Single cell RNA-seq (scRNA-seq)...................... 134–136, 138, 140, 144–146 Sodium dodecyl-sulfate polyacrylamide gel electrophoresis (SDS-PAGE).......................40–43, 52, 53 Specific pathogen free (SPF) ............................... 191, 252

Trichloroacetic acid (TCA)................... 39, 41, 42, 48–51 Tryptic Soy Broth (TSB) medium ...................... 237, 252 Tuberculosis (TB) .....................................................73–82 Type 3 secretion system (T3SS) ....................... 25–27, 32, 37–39, 43, 47–53 Type 6 secretion system (T6SS) ...............................11–14 Typhoid ......................................201, 217, 235, 236, 241

T

U

THP-1 cells ...............................................................73–82 Tn5 transposon .........................................................13, 21 Transepithelial electrical resistance (TEER) ..................................................... 159, 161 Transfection ........................................................ 60, 65, 96 Translocation .............................................................45, 58 Translocator...............................................................39, 43 Transposon-directed insertion site sequencing (TraDIS) ...........................................217, 225–227 Transposon mutagenesis........................... 12, 14, 15, 225

U937 cells............................................................. 111–114

V Vibrio cholerae.................................................................. 95 Vibrio parahaemolyticus ............................................13, 14 VLE-RPMI ................................................................60, 66

X Xanthomonas campestris pv. campestris (Xcc) ..........26–28